CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis
2003-01-01
A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729
Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification
Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.
2016-01-01
Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
The emergence of consensus: a primer
NASA Astrophysics Data System (ADS)
Baronchelli, Andrea
2018-02-01
The origin of population-scale coordination has puzzled philosophers and scientists for centuries. Recently, game theory, evolutionary approaches and complex systems science have provided quantitative insights on the mechanisms of social consensus. However, the literature is vast and widely scattered across fields, making it hard for the single researcher to navigate it. This short review aims to provide a compact overview of the main dimensions over which the debate has unfolded and to discuss some representative examples. It focuses on those situations in which consensus emerges `spontaneously' in the absence of centralized institutions and covers topics that include the macroscopic consequences of the different microscopic rules of behavioural contagion, the role of social networks and the mechanisms that prevent the formation of a consensus or alter it after it has emerged. Special attention is devoted to the recent wave of experiments on the emergence of consensus in social systems.
The emergence of consensus: a primer
2018-01-01
The origin of population-scale coordination has puzzled philosophers and scientists for centuries. Recently, game theory, evolutionary approaches and complex systems science have provided quantitative insights on the mechanisms of social consensus. However, the literature is vast and widely scattered across fields, making it hard for the single researcher to navigate it. This short review aims to provide a compact overview of the main dimensions over which the debate has unfolded and to discuss some representative examples. It focuses on those situations in which consensus emerges ‘spontaneously’ in the absence of centralized institutions and covers topics that include the macroscopic consequences of the different microscopic rules of behavioural contagion, the role of social networks and the mechanisms that prevent the formation of a consensus or alter it after it has emerged. Special attention is devoted to the recent wave of experiments on the emergence of consensus in social systems. PMID:29515905
The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.
Monot, Clément; Kuciak, Monika; Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël
2013-05-01
L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.
The Specificity and Flexibility of L1 Reverse Transcription Priming at Imperfect T-Tracts
Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël
2013-01-01
L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5′-TTTT/A-3′ sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether—and to which degree—the liberated 3′-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3′ end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3′ overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3′ end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome. PMID:23675310
Trung, Le Quang; VAN Puyvelde, Karolien; Triest, Ludwig
2008-03-01
Consensus primers, based on exon sequences of the cyp73 gene family coding for cinnamate 4-hydroxylase (C4H) of the lignin biosynthesis pathway, were designed for the tetraploid willow species Salix alba and Salix fragilis. Diagnostic alleles at species level were observed among introns of three cyp73 genes and allowed unambiguous detection of the first generation and introgressed hybrids in populations. Progeny analysis of a female S. alba with a male introgressed hybrid confirmed the codominant inheritance of each intron. Sequences of the diagnostic alleles of both species were similar to those found in the hybrids. © 2007 The Authors.
29 CFR Appendix B to Subpart L of... - National Consensus Standards
Code of Federal Regulations, 2010 CFR
2010-07-01
... 29 Labor 5 2010-07-01 2010-07-01 false National Consensus Standards B Appendix B to Subpart L of... Appendix B to Subpart L of Part 1910—National Consensus Standards The following table contains a cross-reference listing of those current national consensus standards which contains information and guidelines...
1991-05-01
AL-TP-1 991-0011 LA )_ NEURAL NETWORKS : A PRIMER.R • M 1 - T< R Vince L Wiggins 0 RRC, Incorporated N 3833 Texas Avenue, Suite 256 G Bryan, TX 77802T...5.av bln)2FUOTDTEF.-EOTTP NDIN NUMBCOERSD Neural Networks : A Primer C - F41 689-88-D-0251 PE - 62205F PR - 7719 6. AUTHOR(S) TA - 20 Vin~ce L Wiggins...Maximum 200 words) Neural network technology has recently demonstrated capabilities in areas important to personnel research such as statistical analysis
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Electro-Deposited Primer Development and Low-Polluting Primer Evaluation
1989-08-01
in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oDt- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V
Rajaram, Vengaldas; Nepolean, Thirunavukkarasu; Senthilvel, Senapathy; Varshney, Rajeev K; Vadez, Vincent; Srivastava, Rakesh K; Shah, Trushar M; Supriya, Ambawat; Kumar, Sushil; Ramana Kumari, Basava; Bhanuprakash, Amindala; Narasu, Mangamoori Lakshmi; Riera-Lizarazu, Oscar; Hash, Charles Thomas
2013-03-09
Pearl millet [Pennisetum glaucum (L.) R. Br.] is a widely cultivated drought- and high-temperature tolerant C4 cereal grown under dryland, rainfed and irrigated conditions in drought-prone regions of the tropics and sub-tropics of Africa, South Asia and the Americas. It is considered an orphan crop with relatively few genomic and genetic resources. This study was undertaken to increase the EST-based microsatellite marker and genetic resources for this crop to facilitate marker-assisted breeding. Newly developed EST-SSR markers (99), along with previously mapped EST-SSR (17), genomic SSR (53) and STS (2) markers, were used to construct linkage maps of four F7 recombinant inbred populations (RIP) based on crosses ICMB 841-P3 × 863B-P2 (RIP A), H 77/833-2 × PRLT 2/89-33 (RIP B), 81B-P6 × ICMP 451-P8 (RIP C) and PT 732B-P2 × P1449-2-P1 (RIP D). Mapped loci numbers were greatest for RIP A (104), followed by RIP B (78), RIP C (64) and RIP D (59). Total map lengths (Haldane) were 615 cM, 690 cM, 428 cM and 276 cM, respectively. A total of 176 loci detected by 171 primer pairs were mapped among the four crosses. A consensus map of 174 loci (899 cM) detected by 169 primer pairs was constructed using MergeMap to integrate the individual linkage maps. Locus order in the consensus map was well conserved for nearly all linkage groups. Eighty-nine EST-SSR marker loci from this consensus map had significant BLAST hits (top hits with e-value ≤ 1E-10) on the genome sequences of rice, foxtail millet, sorghum, maize and Brachypodium with 35, 88, 58, 48 and 38 loci, respectively. The consensus map developed in the present study contains the largest set of mapped SSRs reported to date for pearl millet, and represents a major consolidation of existing pearl millet genetic mapping information. This study increased numbers of mapped pearl millet SSR markers by >50%, filling important gaps in previously published SSR-based linkage maps for this species and will greatly
Comparison of MY09/11 consensus PCR and type-specific PCRs in the detection of oncogenic HPV types.
Depuydt, C E; Boulet, G A V; Horvath, C A J; Benoy, I H; Vereecken, A J; Bogers, J J
2007-01-01
The causal relationship between persistent infection with high-risk HPV and cervical cancer has resulted in the development of HPV DNA detection systems. The widely used MY09/11 consensus PCR targets a 450bp conserved sequence in the HPV L1 gene, and can therefore amplify a broad spectrum of HPV types. However, limitations of these consensus primers are evident, particularly in regard to the variability in detection sensitivity among different HPV types. This study compared MY09/11 PCR with type-specific PCRs in the detection of oncogenic HPV types. The study population comprised 15, 774 patients. Consensus PCR failed to detect 522 (10.9%) HPV infections indicated by type-specific PCRs. A significant correlation between failure of consensus PCR and HPV type was found. HPV types 51, 68 and 45 were missed most frequently. The clinical relevance of the HPV infections missed by MY09/11 PCR was reflected in the fraction of cases with cytological abnormalities and in follow-up, showing 104 (25.4%) CIN2+ cases. The MY09/11 false negativity could be the result of poor sensitivity, mismatch of MY09/11 primers or disruption of L1 target by HPV integration or DNA degradation. Furthermore, MY09/11 PCR lacked specificity for oncogenic HPVs. Diagnostic accuracy of the PCR systems, in terms of sensitivity (MY09/11 PCR: 87.9%; type-specific PCRs: 98.3%) and specificity (MY09/11 PCR: 38.7%; type-specific PCRs: 76.14%), and predictive values for histologically confirmed CIN2+, suggest that type-specific PCRs could be used in a clinical setting as a reliable screening tool.
Comparison of the antibacterial activity of different self-etching primers and adhesives.
Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray
2008-11-01
The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other
Integrated consensus genetic and physical maps of flax (Linum usitatissimum L.).
Cloutier, Sylvie; Ragupathy, Raja; Miranda, Evelyn; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Ward, Kerry; Rowland, Gordon; Duguid, Scott; Banik, Mitali
2012-12-01
Three linkage maps of flax (Linum usitatissimum L.) were constructed from populations CDC Bethune/Macbeth, E1747/Viking and SP2047/UGG5-5 containing between 385 and 469 mapped markers each. The first consensus map of flax was constructed incorporating 770 markers based on 371 shared markers including 114 that were shared by all three populations and 257 shared between any two populations. The 15 linkage group map corresponds to the haploid number of chromosomes of this species. The marker order of the consensus map was largely collinear in all three individual maps but a few local inversions and marker rearrangements spanning short intervals were observed. Segregation distortion was present in all linkage groups which contained 1-52 markers displaying non-Mendelian segregation. The total length of the consensus genetic map is 1,551 cM with a mean marker density of 2.0 cM. A total of 670 markers were anchored to 204 of the 416 fingerprinted contigs of the physical map corresponding to ~274 Mb or 74 % of the estimated flax genome size of 370 Mb. This high resolution consensus map will be a resource for comparative genomics, genome organization, evolution studies and anchoring of the whole genome shotgun sequence.
Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C
2004-11-01
To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
Novel ITS1 Fungal Primers for Characterization of the Mycobiome
Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.
2017-01-01
ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect
ERIC Educational Resources Information Center
Tillema, Marion; van den Bergh, Huub; Rijlaarsdam, Gert; Sanders, Ted
2013-01-01
It is the consensus that, as a result of the extra constraints placed on working memory, texts written in a second language (L2) are usually of lower quality than texts written in the first language (L1) by the same writer. However, no method is currently available for quantifying the quality difference between L1 and L2 texts. In the present…
Poliovirus serotype-specific VP1 sequencing primers.
Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen
2011-06-01
The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.
1st International consensus guidelines for advanced breast cancer (ABC 1).
Cardoso, F; Costa, A; Norton, L; Cameron, D; Cufer, T; Fallowfield, L; Francis, P; Gligorov, J; Kyriakides, S; Lin, N; Pagani, O; Senkus, E; Thomssen, C; Aapro, M; Bergh, J; Di Leo, A; El Saghir, N; Ganz, P A; Gelmon, K; Goldhirsch, A; Harbeck, N; Houssami, N; Hudis, C; Kaufman, B; Leadbeater, M; Mayer, M; Rodger, A; Rugo, H; Sacchini, V; Sledge, G; van't Veer, L; Viale, G; Krop, I; Winer, E
2012-06-01
The 1st international Consensus Conference for Advanced Breast Cancer (ABC 1) took place on November 2011, in Lisbon. Consensus guidelines for the management of this disease were developed. This manuscript summarizes these international consensus guidelines. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr
2015-01-01
ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize
Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei
2005-01-01
To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
29 CFR (non - mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards
Code of Federal Regulations, 2010 CFR
2010-07-01
... 29 Labor 8 2010-07-01 2010-07-01 false mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards (Non Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND... Consensus Standards ANSI/SIA A92.2-1990Vehicle-Mounted Elevating and Rotating Aerial Devices ANSI/SIA A92.3...
Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich
2007-04-25
The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of
Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon
2012-06-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.
Herzig, Eytan; Voronin, Nickolay
2012-01-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Thomssen, Christoph; Marschner, Norbert; Untch, Michael; Decker, Thomas; Hegewisch-Becker, Susanna; Jackisch, Christian; Janni, Wolfgang; Hans-Joachim, Lück; von Minckwitz, Gunter; Scharl, Anton; Schneeweiss, Andreas; Tesch, Hans; Welt, Anja; Harbeck, Nadia
2012-02-01
A group of German breast cancer experts (medical oncologists and gynaecologists) reviewed and commented on the results of the first international 'Advanced Breast Cancer First Consensus Conference' (ABC1) for the diagnosis and treatment of advanced breast cancer. The ABC1 Conference is an initiative of the European School of Oncology (ESO) Metastatic Breast Cancer Task Force in cooperation with the EBCC (European Breast Cancer Conference), ESMO (European Society of Medical Oncology) and the American JNCI (Journal of the National Cancer Institute). The main focus of the ABC1 Conference was metastatic breast cancer (stage IV). The ABC1 consensus is based on the vote of 33 breast cancer experts from different countries and has been specified as a guideline for therapeutic practice by the German expert group. It is the objective of the ABC1 consensus as well as of the German comments to provide an internationally standardized and evidence-based foundation for qualified decision-making in the treatment of metastatic breast cancer.
ERIC Educational Resources Information Center
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)
Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming
2013-01-01
Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.
Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S
2010-06-01
The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations.
A High Density Consensus Map of Rye (Secale cereale L.) Based on DArT Markers
Myśków, Beata; Stojałowski, Stefan; Heller-Uszyńska, Katarzyna; Góralska, Magdalena; Brągoszewski, Piotr; Uszyński, Grzegorz; Kilian, Andrzej; Rakoczy-Trojanowska, Monika
2011-01-01
Background Rye (Secale cereale L.) is an economically important crop, exhibiting unique features such as outstanding resistance to biotic and abiotic stresses and high nutrient use efficiency. This species presents a challenge to geneticists and breeders due to its large genome containing a high proportion of repetitive sequences, self incompatibility, severe inbreeding depression and tissue culture recalcitrance. The genomic resources currently available for rye are underdeveloped in comparison with other crops of similar economic importance. The aim of this study was to create a highly saturated, multilocus linkage map of rye via consensus mapping, based on Diversity Arrays Technology (DArT) markers. Methodology/Principal Findings Recombinant inbred lines (RILs) from 5 populations (564 in total) were genotyped using DArT markers and subjected to linkage analysis using Join Map 4.0 and Multipoint Consensus 2.2 software. A consensus map was constructed using a total of 9703 segregating markers. The average chromosome map length ranged from 199.9 cM (2R) to 251.4 cM (4R) and the average map density was 1.1 cM. The integrated map comprised 4048 loci with the number of markers per chromosome ranging from 454 for 7R to 805 for 4R. In comparison with previously published studies on rye, this represents an eight-fold increase in the number of loci placed on a consensus map and a more than two-fold increase in the number of genetically mapped DArT markers. Conclusions/Significance Through the careful choice of marker type, mapping populations and the use of software packages implementing powerful algorithms for map order optimization, we produced a valuable resource for rye and triticale genomics and breeding, which provides an excellent starting point for more in-depth studies on rye genome organization. PMID:22163026
Yoon, Hyejin; Leitner, Thomas
2014-12-17
Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less
Molecular identification of the ompL1 gene within Leptospira interrogans standard serovars.
Dezhbord, Mehrangiz; Esmaelizad, Majid; Khaki, Pejvak; Fotohi, Fariba; Zarehparvar Moghaddam, Athena
2014-06-11
Leptospirosis, caused by infection with pathogenic Leptospira species, is one of the most prevalent zoonotic diseases in the world. Current leptospiral vaccines are mainly multivalent dead whole-cell mixtures made of several local dominant serovars. Therefore, design and construction of an efficient recombinant vaccine for leptospirosis control is very important. OmpL1 is an immunogenic porin protein that could be of special significance in vaccination and serodiagnosis for leptospirosis. Three strains belonging to pathogenic L. interrogans were analyzed. The specific primers for proliferation of the ompL1 gene were designed. The amplified gene was cloned. In order to investigate the ompL1 nucleotide sequence and homological analysis of this gene, ompL1 genes cloned from standard vaccinal Leptospira serovars prevalent in Iran were sequenced and cloned. PCR amplification of the ompL1 gene using the designed primers resulted in a 963 bp ompL1 gene product. The PCR based on the ompL1 gene detected all pathogenic reference serovars of Leptospira spp. tested. Based on alignment and phylogenetic analysis, although the ompL1 nucleotide sequence was slightly different within three vaccinal serovars (100%-85% identity), amino acid alignment of the OmpL1 proteins revealed that there would be inconsiderable difference among them. The ompL1 gene of the three isolates was well conserved, differing only by a total of 6 bp and the proteins by 2 amino acids. The cloned gene could be further used for expression and recombinant OmpL1 as an efficient and conserved antigen, and may be a useful vaccine candidate against leptospirosis in our region.
Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.
Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca
2017-11-23
DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
29 CFR (non - mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards
Code of Federal Regulations, 2011 CFR
2011-07-01
... 29 Labor 8 2011-07-01 2011-07-01 false mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards (Non Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Scaffolds Pt. 1926, Subpt. L, App. C ...
29 CFR (non - mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards
Code of Federal Regulations, 2012 CFR
2012-07-01
... 29 Labor 8 2012-07-01 2012-07-01 false mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards (Non Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Scaffolds Pt. 1926, Subpt. L, App. C ...
29 CFR (non - mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards
Code of Federal Regulations, 2013 CFR
2013-07-01
... 29 Labor 8 2013-07-01 2013-07-01 false mandatory) Appendix C to Subpart L of Part 1926-List of National Consensus Standards (Non Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Scaffolds Pt. 1926, Subpt. L, App. C ...
New primers for the detection Leishmania species by multiplex polymerase chain reaction.
Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi
2018-02-01
Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
2012-08-01
Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a
Role of the Zn1 and Zn2 sites in metallo-β-lactamase L1
Hu, Zhenxin; Periyannan, Gopalraj; Bennett, Brian; Crowder, Michael W.
2009-01-01
In an effort to probe the role of the Zn(II) sites in metallo-β-lactamase L1, mononuclear metal ion containing and heterobimetallic analogs of the enzyme were generated and characterized using kinetic and spectroscopic studies. Mononuclear Zn(II)-containing L1, which binds Zn(II) in the consensus Zn1 site, was shown to be slightly active; however, this enzyme did not stabilize a nitrocefin-derived reaction intermediate that had been previously detected. Mononuclear Co(II)- and Fe(III)-containing L1 were essentially inactive, and NMR and EPR studies suggest that these metal ions bind to the consensus Zn2 site in L1. Heterobimetallic analogs (ZnCo and ZnFe) analogs of L1 were generated, and stopped-flow kinetic studies revealed that these enzymes rapidly hydrolyze nitrocefin and that there are large amounts of the reaction intermediate formed during the reaction. The heterobimetallic analogs were reacted with nitrocefin, and the reactions were rapidly freeze quenched. EPR studies on these samples demonstrate that Co(II) is five-coordinate in the resting state, proceeds through a four-coordinate species during the reaction, and is five-coordinate in the enzyme-product complex. These studies demonstrate that the metal ion in the Zn1 site is essential for catalysis in L1 and that the metal ion in the Zn2 site is crucial for stabilization of the nitrocefin-derived reaction intermediate. PMID:18831550
Role of the Zn1 and Zn2 sites in metallo-beta-lactamase L1.
Hu, Zhenxin; Periyannan, Gopalraj; Bennett, Brian; Crowder, Michael W
2008-10-29
In an effort to probe the role of the Zn(II) sites in metallo-beta-lactamase L1, mononuclear metal ion containing and heterobimetallic analogues of the enzyme were generated and characterized using kinetic and spectroscopic studies. Mononuclear Zn(II)-containing L1, which binds Zn(II) in the consensus Zn1 site, was shown to be slightly active; however, this enzyme did not stabilize a nitrocefin-derived reaction intermediate that had been previously detected. Mononuclear Co(II)- and Fe(III)-containing L1 were essentially inactive, and NMR and EPR studies suggest that these metal ions bind to the consensus Zn2 site in L1. Heterobimetallic analogues (ZnCo and ZnFe) analogues of L1 were generated, and stopped-flow kinetic studies revealed that these enzymes rapidly hydrolyze nitrocefin and that there are large amounts of the reaction intermediate formed during the reaction. The heterobimetallic analogues were reacted with nitrocefin, and the reactions were rapidly freeze quenched. EPR studies on these samples demonstrate that Co(II) is 5-coordinate in the resting state, proceeds through a 4-coordinate species during the reaction, and is 5-coordinate in the enzyme-product complex. These studies demonstrate that the metal ion in the Zn1 site is essential for catalysis in L1 and that the metal ion in the Zn2 site is crucial for stabilization of the nitrocefin-derived reaction intermediate.
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L
2006-08-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Reviving the Dead: History and Reactivation of an Extinct L1
Yang, Lei; Brunsfeld, John; Scott, LuAnn; Wichman, Holly
2014-01-01
Although L1 sequences are present in the genomes of all placental mammals and marsupials examined to date, their activity was lost in the megabat family, Pteropodidae, ∼24 million years ago. To examine the characteristics of L1s prior to their extinction, we analyzed the evolutionary history of L1s in the genome of a megabat, Pteropus vampyrus, and found a pattern of periodic L1 expansion and quiescence. In contrast to the well-characterized L1s in human and mouse, megabat genomes have accommodated two or more simultaneously active L1 families throughout their evolutionary history, and major peaks of L1 deposition into the genome always involved multiple families. We compared the consensus sequences of the two major megabat L1 families at the time of their extinction to consensus L1s of a variety of mammalian species. Megabat L1s are comparable to the other mammalian L1s in terms of adenosine content and conserved amino acids in the open reading frames (ORFs). However, the intergenic region (IGR) of the reconstructed element from the more active family is dramatically longer than the IGR of well-characterized human and mouse L1s. We synthesized the reconstructed element from this L1 family and tested the ability of its components to support retrotransposition in a tissue culture assay. Both ORFs are capable of supporting retrotransposition, while the IGR is inhibitory to retrotransposition, especially when combined with either of the reconstructed ORFs. We dissected the inhibitory effect of the IGR by testing truncated and shuffled versions and found that length is a key factor, but not the only one affecting inhibition of retrotransposition. Although the IGR is inhibitory to retrotransposition, this inhibition does not account for the extinction of L1s in megabats. Overall, the evolution of the L1 sequence or the quiescence of L1 is unlikely the reason of L1 extinction. PMID:24968166
Reviving the dead: history and reactivation of an extinct l1.
Yang, Lei; Brunsfeld, John; Scott, LuAnn; Wichman, Holly
2014-06-01
Although L1 sequences are present in the genomes of all placental mammals and marsupials examined to date, their activity was lost in the megabat family, Pteropodidae, ∼24 million years ago. To examine the characteristics of L1s prior to their extinction, we analyzed the evolutionary history of L1s in the genome of a megabat, Pteropus vampyrus, and found a pattern of periodic L1 expansion and quiescence. In contrast to the well-characterized L1s in human and mouse, megabat genomes have accommodated two or more simultaneously active L1 families throughout their evolutionary history, and major peaks of L1 deposition into the genome always involved multiple families. We compared the consensus sequences of the two major megabat L1 families at the time of their extinction to consensus L1s of a variety of mammalian species. Megabat L1s are comparable to the other mammalian L1s in terms of adenosine content and conserved amino acids in the open reading frames (ORFs). However, the intergenic region (IGR) of the reconstructed element from the more active family is dramatically longer than the IGR of well-characterized human and mouse L1s. We synthesized the reconstructed element from this L1 family and tested the ability of its components to support retrotransposition in a tissue culture assay. Both ORFs are capable of supporting retrotransposition, while the IGR is inhibitory to retrotransposition, especially when combined with either of the reconstructed ORFs. We dissected the inhibitory effect of the IGR by testing truncated and shuffled versions and found that length is a key factor, but not the only one affecting inhibition of retrotransposition. Although the IGR is inhibitory to retrotransposition, this inhibition does not account for the extinction of L1s in megabats. Overall, the evolution of the L1 sequence or the quiescence of L1 is unlikely the reason of L1 extinction.
Output testing of small-arms primers
NASA Technical Reports Server (NTRS)
Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.
1991-01-01
The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.
2006-01-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283
Vaira, A M; Accotto, G P; Costantini, A; Milne, R G
2003-06-01
A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
30 CFR 56.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully
Muchero, Wellington; Diop, Ndeye N; Bhat, Prasanna R; Fenton, Raymond D; Wanamaker, Steve; Pottorff, Marti; Hearne, Sarah; Cisse, Ndiaga; Fatokun, Christian; Ehlers, Jeffrey D; Roberts, Philip A; Close, Timothy J
2009-10-27
Consensus genetic linkage maps provide a genomic framework for quantitative trait loci identification, map-based cloning, assessment of genetic diversity, association mapping, and applied breeding in marker-assisted selection schemes. Among "orphan crops" with limited genomic resources such as cowpea [Vigna unguiculata (L.) Walp.] (2n = 2x = 22), the use of transcript-derived SNPs in genetic maps provides opportunities for automated genotyping and estimation of genome structure based on synteny analysis. Here, we report the development and validation of a high-throughput EST-derived SNP assay for cowpea, its application in consensus map building, and determination of synteny to reference genomes. SNP mining from 183,118 ESTs sequenced from 17 cDNA libraries yielded approximately 10,000 high-confidence SNPs from which an Illumina 1,536-SNP GoldenGate genotyping array was developed and applied to 741 recombinant inbred lines from six mapping populations. Approximately 90% of the SNPs were technically successful, providing 1,375 dependable markers. Of these, 928 were incorporated into a consensus genetic map spanning 680 cM with 11 linkage groups and an average marker distance of 0.73 cM. Comparison of this cowpea genetic map to reference legumes, soybean (Glycine max) and Medicago truncatula, revealed extensive macrosynteny encompassing 85 and 82%, respectively, of the cowpea map. Regions of soybean genome duplication were evident relative to the simpler diploid cowpea. Comparison with Arabidopsis revealed extensive genomic rearrangement with some conserved microsynteny. These results support evolutionary closeness between cowpea and soybean and identify regions for synteny-based functional genomics studies in legumes.
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Characterization of a Mobile clpL Gene from Lactobacillus rhamnosus
Suokko, Aki; Savijoki, Kirsi; Malinen, Erja; Palva, Airi; Varmanen, Pekka
2005-01-01
Two genes encoding ClpL ATPase proteins were identified in a probiotic Lactobacillus rhamnosus strain, E-97800. Sequence analyses revealed that the genes, designated clpL1 and clpL2, share 80% identity. The clpL2 gene showed the highest degree of identity (98.5%) to a clpL gene from Lactobacillus plantarum WCFSI, while it was not detected in three other L. rhamnosus strains studied. According to Northern analyses, the expression of clpL1 and the clpL2 were induced during heat shock by >20- and 3-fold, respectively. The functional promoter regions were determined by primer extension analyses, and the clpL1 promoter was found to be overlapped by an inverted repeat structure identical to the conserved CIRCE element, indicating that clpL1 belongs to the HrcA regulon in L. rhamnosus. No consensus binding sites for HrcA or CtsR could be identified in the clpL2 promoter region. Interestingly, the clpL2 gene was found to be surrounded by truncated transposase genes and flanked by inverted repeat structures nearly identical to the terminal repeats of the ISLpl1 from L. plantarum HN38. Furthermore, clpL2 was shown to be mobilized during prolonged cultivation at elevated temperature. The presence of a gene almost identical to clpL2 in L. plantarum and its absence in other L. rhamnosus strains suggest that the L. rhamnosus E-97800 has acquired the clpL2 gene via horizontal transfer. No change in the stress tolerance of the ClpL2-deficient derivative of E-97800 compared to the parental strain was observed. PMID:15812039
Preservation affinity in consensus modules among stages of HIV-1 progression.
Mosaddek Hossain, Sk Md; Ray, Sumanta; Mukhopadhyay, Anirban
2017-03-20
Analysis of gene expression data provides valuable insights into disease mechanism. Investigating relationship among co-expression modules of different stages is a meaningful tool to understand the way in which a disease progresses. Identifying topological preservation of modular structure also contributes to that understanding. HIV-1 disease provides a well-documented progression pattern through three stages of infection: acute, chronic and non-progressor. In this article, we have developed a novel framework to describe the relationship among the consensus (or shared) co-expression modules for each pair of HIV-1 infection stages. The consensus modules are identified to assess the preservation of network properties. We have investigated the preservation patterns of co-expression networks during HIV-1 disease progression through an eigengene-based approach. We discovered that the expression patterns of consensus modules have a strong preservation during the transitions of three infection stages. In particular, it is noticed that between acute and non-progressor stages the preservation is slightly more than the other pair of stages. Moreover, we have constructed eigengene networks for the identified consensus modules and observed the preservation structure among them. Some consensus modules are marked as preserved in two pairs of stages and are analyzed further to form a higher order meta-network consisting of a group of preserved modules. Additionally, we observed that module membership (MM) values of genes within a module are consistent with the preservation characteristics. The MM values of genes within a pair of preserved modules show strong correlation patterns across two infection stages. We have performed an extensive analysis to discover preservation pattern of co-expression network constructed from microarray gene expression data of three different HIV-1 progression stages. The preservation pattern is investigated through identification of consensus modules
Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei
2005-01-01
To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.
Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu
2015-08-01
Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun
2016-01-01
Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378
Hexavalent Chromium IV-Free Primer Development
NASA Technical Reports Server (NTRS)
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Hughes, Paul; Deng, Wenjie; Olson, Scott C; Coombs, Robert W; Chung, Michael H; Frenkel, Lisa M
2016-03-01
Accurate analysis of minor populations of drug-resistant HIV requires analysis of a sufficient number of viral templates. We assessed the effect of experimental conditions on the analysis of HIV pol 454 pyrosequences generated from plasma using (1) the "Insertion-deletion (indel) and Carry Forward Correction" (ICC) pipeline, which clusters sequence reads using a nonsubstitution approach and can correct for indels and carry forward errors, and (2) the "Primer Identification (ID)" method, which facilitates construction of a consensus sequence to correct for sequencing errors and allelic skewing. The Primer ID and ICC methods produced similar estimates of viral diversity, but differed in the number of sequence variants generated. Sequence preparation for ICC was comparably simple, but was limited by an inability to assess the number of templates analyzed and allelic skewing. The more costly Primer ID method corrected for allelic skewing and provided the number of viral templates analyzed, which revealed that amplifiable HIV templates varied across specimens and did not correlate with clinical viral load. This latter observation highlights the value of the Primer ID method, which by determining the number of templates amplified, enables more accurate assessment of minority species in the virus population, which may be relevant to prescribing effective antiretroviral therapy.
Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel
2011-01-01
Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
Consensus QSAR model for identifying novel H5N1 inhibitors.
Sharma, Nitin; Yap, Chun Wei
2012-08-01
Due to the importance of neuraminidase in the pathogenesis of influenza virus infection, it has been regarded as the most important drug target for the treatment of influenza. Resistance to currently available drugs and new findings related to structure of the protein requires novel neuraminidase 1 (N1) inhibitors. In this study, a consensus QSAR model with defined applicability domain (AD) was developed using published N1 inhibitors. The consensus model was validated using an external validation set. The model achieved high sensitivity, specificity, and overall accuracy along with low false positive rate (FPR) and false discovery rate (FDR). The performance of model on the external validation set and training set were comparable, thus it was unlikely to be overfitted. The low FPR and low FDR will increase its accuracy in screening large chemical libraries. Screening of ZINC library resulted in 64,772 compounds as probable N1 inhibitors, while 173,674 compounds were defined to be outside the AD of the consensus model. The advantage of the current model is that it was developed using a large and diverse dataset and has a defined AD which prevents its use on compounds that it is not capable of predicting. The consensus model developed in this study is made available via the free software, PaDEL-DDPredictor.
Matthew Parks; Aaron Liston; Rich Cronn
2011-01-01
Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.
2012-01-01
Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Polyacid macromolecule primers
Sugama, Toshifumi
1989-01-01
Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J
2006-01-01
Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most
30 CFR 57.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Pooler, M R; Ritchie, D F; Hartung, J S
1996-01-01
Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
1998-01-01
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
2005-04-19
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, D.M.; Rosen, R.S.
1998-06-30
A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur
2015-01-01
The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers
Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank
2015-01-01
Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976
Bohra, Abhishek; Saxena, Rachit K; Gnanesh, B N; Saxena, Kulbhushan; Byregowda, M; Rathore, Abhishek; Kavikishor, P B; Cook, Douglas R; Varshney, Rajeev K
2012-10-01
Pigeonpea (Cajanus cajan L.) is an important food legume crop of rainfed agriculture. Owing to exposure of the crop to a number of biotic and abiotic stresses, the crop productivity has remained stagnant for almost last five decades at ca. 750 kg/ha. The availability of a cytoplasmic male sterility (CMS) system has facilitated the development and release of hybrids which are expected to enhance the productivity of pigeonpea. Recent advances in genomics and molecular breeding such as marker-assisted selection (MAS) offer the possibility to accelerate hybrid breeding. Molecular markers and genetic maps are pre-requisites for deploying MAS in breeding. However, in the case of pigeonpea, only one inter- and two intra-specific genetic maps are available so far. Here, four new intra-specific genetic maps comprising 59-140 simple sequence repeat (SSR) loci with map lengths ranging from 586.9 to 881.6 cM have been constructed. Using these four genetic maps together with two recently published intra-specific genetic maps, a consensus map was constructed, comprising of 339 SSR loci spanning a distance of 1,059 cM. Furthermore, quantitative trait loci (QTL) analysis for fertility restoration (Rf) conducted in three mapping populations identified four major QTLs explaining phenotypic variances up to 24 %. To the best of our knowledge, this is the first report on construction of a consensus genetic map in pigeonpea and on the identification of QTLs for fertility restoration. The developed consensus genetic map should serve as a reference for developing new genetic maps as well as correlating with the physical map in pigeonpea to be developed in near future. The availability of more informative markers in the bins harbouring QTLs for sterility mosaic disease (SMD) and Rf will facilitate the selection of the most suitable markers for genetic analysis and molecular breeding applications in pigeonpea.
Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains
USDA-ARS?s Scientific Manuscript database
Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...
Defense Primer: A Guide for New Members
2017-03-03
1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by
A Primer on Sampling for Statewide Assessment.
ERIC Educational Resources Information Center
Jaeger, Richard M.
This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…
Söderlund-Strand, Anna; Carlson, Joyce; Dillner, Joakim
2009-03-01
Human papillomavirus (HPV) infection is a necessary cause of cervical cancer and cervical dysplasia. Accurate and sensitive genotyping of multiple oncogenic HPVs is essential for a multitude of both clinical and research uses. We developed a modified general primer (MGP) PCR system with five forward and five reverse consensus primers. The MGP system was compared to the classical HPV general primer system GP5+/6+ using a proficiency panel with HPV plasmid dilutions as well as cervical samples from 592 women with low-grade cytological abnormalities. The reference method (GP5+/6+) had the desirable high sensitivity (five copies/PCR) for five oncogenic HPV types (HPV type 16 [HPV-16], HPV-18, HPV-56, HPV-59, and HPV-66). The MGP system was able to detect all 14 oncogenic HPV types at five copies/PCR. In the clinical samples, the MGP system detected a significantly higher proportion of women with more than two concomitant HPV infections than did the GP5+/6+ system (102/592 women compared to 42/592 women). MGP detected a significantly greater number of infections with HPV-16, -18, -31, -33, -35, -39, -42, -43, -45, -51, -52, -56, -58, and -70 than did GP5+/6+. In summary, the MGP system primers allow a more sensitive amplification of most of the HPV types that are established as oncogenic and had an improved ability to detect multiple concomitant HPV infections.
Multiplexing Short Primers for Viral Family PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Hiddessen, A L; Hara, C A
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less
Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.
Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo
2016-07-01
To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.
Lin, J H; Levin, H L
1997-01-15
All retroviruses and LTR-containing retrotransposons are thought to require specific tRNA molecules to serve as primers of reverse transcription. An exception is the LTR-containing retrotransposon Tf1, isolated from Schizosaccharomyces pombe. Instead of requiring a tRNA, the reverse transcriptase of Tf1 uses the first 11 bases of the Tf1 transcript as the primer for reverse transcription. The primer is generated by a cleavage that occurs between bases 11 and 12 of the Tf1 mRNA. Sequence analysis of the 5' untranslated region of the Tf1 mRNA resulted in the identification of a region with the potential to form an RNA structure of 89 bases that included the primer binding site and the first 11 bases of the Tf1 mRNA. Systematic mutagenesis of this region revealed 34 single-point mutants in the structure that resulted in reduced transposition activity. The defects in transposition correlated with reduced level of Tf1 reverse transcripts as determined by DNA blot analysis. Evidence that the RNA structure did form in vivo included the result that strains with second site mutations that restored complementarity resulted in increased levels of reverse transcripts and Tf1 transposition. The majority of the mutants defective for reverse transcription were unable to cleave the Tf1 mRNA between bases 11 and 12. These data indicate that formation of an extensive RNA structure was required for the cleavage reaction that generated the primer for Tf1 reverse transcription.
Multiplex primer prediction software for divergent targets
Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.
2009-01-01
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213
Case, Brett A; Hackel, Benjamin J
2016-08-01
Protein ligand charge can impact physiological delivery with charge reduction often benefiting performance. Yet neutralizing mutations can be detrimental to protein function. Herein, three approaches are evaluated to introduce charged-to-neutral mutations of three cations and three anions within an affibody engineered to bind epidermal growth factor receptor. These approaches-combinatorial library sorting or consensus design, based on natural homologs or library-sorted mutants-are used to identify mutations with favorable affinity, stability, and recombinant yield. Consensus design, based on 942 affibody homologs, yielded a mutant of modest function (Kd = 11 ±4 nM, Tm = 62°C, and yield = 4.0 ± 0.8 mg/L as compared to 5.3 ± 1.7 nM, 71°C, and 3.5 ± 0.3 mg/L for the parental affibody). Extension of consensus design to 10 additional mutants exhibited varied performance including a substantially improved mutant (Kd = 6.9 ± 1.4 nM, Tm = 71°C, and 12.7 ± 0.9 mg/L yield). Sorting a homolog-based combinatorial library of 7 × 10(5) mutants generated a distribution of mutants with lower stability and yield, but did identify one strongly binding variant (Kd = 1.2 ± 0.3 nM, Tm = 69°C, and 6.0 ± 0.4 mg/L yield). Synthetic consensus design, based on the amino acid distribution in functional library mutants, yielded higher affinities (P = 0.05) with comparable stabilities and yields. The best of four analyzed clones had Kd = 1.7 ± 0.5 nM, Tm = 68°C, and 7.0 ± 0.5 mg/L yield. While all three approaches were effective in creating targeted affibodies with six charged-to-neutral mutations, synthetic consensus design proved to be the most robust. Synthetic consensus design provides a valuable tool for ligand engineering, particularly in the context of charge manipulation. Biotechnol. Bioeng. 2016;113: 1628-1638. © 2016 Wiley Periodicals, Inc. © 2016 Wiley
Sex Stereotyping in Mexican Reading Primers.
ERIC Educational Resources Information Center
Heathcote, Olivia
A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.
Consensus on consensus: a synthesis of consensus estimates on human-caused global warming
NASA Astrophysics Data System (ADS)
Cook, John; Oreskes, Naomi; Doran, Peter T.; Anderegg, William R. L.; Verheggen, Bart; Maibach, Ed W.; Carlton, J. Stuart; Lewandowsky, Stephan; Skuce, Andrew G.; Green, Sarah A.; Nuccitelli, Dana; Jacobs, Peter; Richardson, Mark; Winkler, Bärbel; Painting, Rob; Rice, Ken
2016-04-01
The consensus that humans are causing recent global warming is shared by 90%-100% of publishing climate scientists according to six independent studies by co-authors of this paper. Those results are consistent with the 97% consensus reported by Cook et al (Environ. Res. Lett. 8 024024) based on 11 944 abstracts of research papers, of which 4014 took a position on the cause of recent global warming. A survey of authors of those papers (N = 2412 papers) also supported a 97% consensus. Tol (2016 Environ. Res. Lett. 11 048001) comes to a different conclusion using results from surveys of non-experts such as economic geologists and a self-selected group of those who reject the consensus. We demonstrate that this outcome is not unexpected because the level of consensus correlates with expertise in climate science. At one point, Tol also reduces the apparent consensus by assuming that abstracts that do not explicitly state the cause of global warming (‘no position’) represent non-endorsement, an approach that if applied elsewhere would reject consensus on well-established theories such as plate tectonics. We examine the available studies and conclude that the finding of 97% consensus in published climate research is robust and consistent with other surveys of climate scientists and peer-reviewed studies.
A Dozen Primers on Important Information Standards
ERIC Educational Resources Information Center
Dempsey, Kathy, Comp.
2007-01-01
This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…
Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation
NASA Technical Reports Server (NTRS)
Hockridge, R. R.; Thibault, H. G.
1972-01-01
The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.
Waggoner, Jane; Carline, Jan D; Durning, Steven J
2016-05-01
The authors of this article reviewed the methodology of three common consensus methods: nominal group process, consensus development panels, and the Delphi technique. The authors set out to determine how a majority of researchers are conducting these studies, how they are analyzing results, and subsequently the manner in which they are reporting their findings. The authors conclude with a set of guidelines and suggestions designed to aid researchers who choose to use the consensus methodology in their work.Overall, researchers need to describe their inclusion criteria. In addition to this, on the basis of the current literature the authors found that a panel size of 5 to 11 members was most beneficial across all consensus methods described. Lastly, the authors agreed that the statistical analyses done in consensus method studies should be as rigorous as possible and that the predetermined definition of consensus must be included in the ultimate manuscript. More specific recommendations are given for each of the three consensus methods described in the article.
A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.
Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin
2005-06-01
Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
A Primer for the Act-1 Language.
1982-04-01
Case Study. 7th Symposiumn on Operating Systems Principles, December, 1979. [Kerns 80] Kerns, B.S, Towards a Better Definition of Transactions ...1. ,X, aJ ablc as MITH Al ITI \\lFllumber 625. 1,)’lr;H fi. H. i 1,1110h)jO Abc rit I ots Of Iigs At Once W\\N OI tn Getting Con fuseCd: ! ;I’l 1,21 IIl
Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.
Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan
2015-09-01
The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.
Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R
2016-09-01
Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
HST archive primer, version 4.1
NASA Technical Reports Server (NTRS)
Fruchter, A. (Editor); Baum, S. (Editor)
1994-01-01
This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.
Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T
2016-09-01
Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.
Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A
2009-01-01
We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351
Koelzer, Viktor H; Gisler, Aline; Hanhart, Jonathan C; Griss, Johannes; Wagner, Stephan N; Willi, Niels; Cathomas, Gieri; Sachs, Melanie; Kempf, Werner; Thommen, Daniela S; Mertz, Kirsten D
2018-04-16
Immune checkpoint inhibitors have become a successful treatment in metastatic melanoma. The high response rates in a subset of patients suggest that a sensitive companion diagnostic test is required. The predictive value of programmed death ligand 1 (PD-L1) staining in melanoma has been questioned due to inconsistent correlation with clinical outcome. Whether this is due to predictive irrelevance of PD-L1 expression or inaccurate assessment techniques remains unclear. The aim of this study was to develop a standardized digital protocol for the assessment of PD-L1 staining in melanoma and to compare the output data and reproducibility to conventional assessment by expert pathologists. In two cohorts with a total of 69 cutaneous melanomas, a highly significant correlation was found between pathologist-based consensus reading and automated PD-L1 analysis (R=0.97, p<0.0001). Digital scoring captured the full diagnostic spectrum of PD-L1 expression at single cell resolution. An average of 150.472 melanoma cells (median 38.668 cells; range 733-1.078.965) were scored per lesion. Machine learning was used to control for heterogeneity introduced by PD-L1 positive inflammatory cells in the tumour microenvironment. The PD-L1 image analysis protocol showed excellent reproducibility (R=1.0, p<0.0001) when carried out on independent workstations and reduced variability in PD-L1 scoring of human observers. When melanomas were grouped by PD-L1 expression status, we found a clear correlation of PD-L1 positivity with CD8 positive T-cell infiltration, but not with tumour stage, metastasis or driver mutation status. Digital evaluation of PD-L1 reduces scoring variability and may facilitate patient stratification in clinical practice. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.
Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena
2009-08-01
Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.
2013-01-01
Background Faba bean (Vicia faba L.) is among the earliest domesticated crops from the Near East. Today this legume is a key protein feed and food worldwide and continues to serve an important role in culinary traditions throughout Middle East, Mediterranean region, China and Ethiopia. Adapted to a wide range of soil types, the main faba bean breeding objectives are to improve yield, resistance to biotic and abiotic stresses, seed quality and other agronomic traits. Genomic approaches aimed at enhancing faba bean breeding programs require high-quality genetic linkage maps to facilitate quantitative trait locus analysis and gene tagging for use in a marker-assisted selection. The objective of this study was to construct a reference consensus map in faba bean by joining the information from the most relevant maps reported so far in this crop. Results A combination of two approaches, increasing the number of anchor loci in diverse mapping populations and joining the corresponding genetic maps, was used to develop a reference consensus map in faba bean. The map was constructed from three main recombinant inbreed populations derived from four parental lines, incorporates 729 markers and is based on 69 common loci. It spans 4,602 cM with a range from 323 to 1041 loci in six main linkage groups or chromosomes, and an average marker density of one locus every 6 cM. Locus order is generally well maintained between the consensus map and the individual maps. Conclusion We have constructed a reliable and fairly dense consensus genetic linkage map that will serve as a basis for genomic approaches in faba bean research and breeding. The core map contains a larger number of markers than any previous individual map, covers existing gaps and achieves a wider coverage of the large faba bean genome as a whole. This tool can be used as a reference resource for studies in different genetic backgrounds, and provides a framework for transferring genetic information when using different
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.
Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon
2017-03-01
To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bowman, Stephen M
2008-09-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
Mitchell M. Sewell; Bradley K. Sherman; David B. Neale
1998-01-01
A consensus map for loblolly pine (Pinus taeda L.) was constructed from the integration of linkage data from two unrelated three-generation out bred pedigrees. The progeny segregation data from restriction fragment length polymorphism, random amplified polymorphic DNA, and isozyme genetic markers from each pedigree were recoded to reflect the two independent...
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-08-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-01-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
Nanotechnology: A Policy Primer
2010-03-12
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Nanotechnology: A Policy Primer
2010-01-04
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Primer Part 1-The building blocks of epilepsy genetics.
Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C
2016-06-01
This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
Kornegay, J R; Shepard, A P; Hankins, C; Franco, E; Lapointe, N; Richardson, H; Coutleé, F
2001-10-01
We assessed the value of a new digoxigenin (DIG)-labeled generic probe mix in a PCR-enzyme-linked immunosorbent assay format to screen for the presence of human papillomavirus (HPV) DNA amplified from clinical specimens. After screening with this new generic assay is performed, HPV DNA-positive samples can be directly genotyped using a reverse blotting method with product from the same PCR amplification. DNA from 287 genital specimens was amplified via PCR using biotin-labeled consensus primers directed to the L1 gene. HPV amplicons were captured on a streptavidin-coated microwell plate (MWP) and detected with a DIG-labeled HPV generic probe mix consisting of nested L1 fragments from types 11, 16, 18, and 51. Coamplification and detection of human DNA with biotinylated beta-globin primers served as a control for both sample adequacy and PCR amplification. All specimens were genotyped using a reverse line blot assay (13). Results for the generic assay using MWPs and a DIG-labeled HPV generic probe mix (DIG-MWP generic probe assay) were compared with results from a previous analysis using dot blots with a radiolabeled nested generic probe mix and type-specific probes for genotyping. The DIG-MWP generic probe assay resulted in high intralaboratory concordance in genotyping results (88% versus 73% agreement using traditional methods). There were 207 HPV-positive results using the DIG-MWP method and 196 positives using the radiolabeled generic probe technique, suggesting slightly improved sensitivity. Only one sample failed to test positive with the DIG-MWP generic probe assay in spite of a positive genotyping result. Concordance between the two laboratories was nearly 87%. Approximately 6% of samples that were positive or borderline when tested with the DIG-MWP generic probe assay were not detected with the HPV type-specific panel, perhaps representing very rare or novel HPV types. This new method is easier to perform than traditional generic probe techniques and uses
Carvalho, S I C; Ragassi, C F; Oliveira, I B; Amaral, Z P S; Reifschneider, F J B; Faleiro, F G; Buso, G S C
2015-07-17
In order to support further genetic, diversity, and phylogeny studies of Capsicum species, the transferability of a Capsicum annuum L. simple sequence repeat (SSR) microsatellite set was analyzed for C. frutescens L. ("malagueta" and "tabasco" peppers) and C. chinense Jacq. (smell peppers, among other types). A total of 185 SSR primers were evaluated in 12 accessions from 115 C. frutescens L. and 480 C. chinense Jacq, representing different types within each species. Transferability to C. frutescens L. and C. chinense Jacq. occurred for 116 primers (62.7%). Nineteen (16.37%) were polymorphic in C. frutescens L. and 36 (31.03%) in C. chinense Jacq., 17 of which were coincident and could be used to analyze samples obtained for the 2 species. Among these primers, CA49 showed a different amplitude range of alleles between the 2 species (130-132 base pairs for C. frutescens L. and 120-128 base pairs for C. chinense Jacq.), and could differentiate the species. A total of 55 alleles were identified among the 19 polymorphic SSR loci among accessions of C. frutescens L., with the number of alleles per locus ranging from 2 to 5, a mean of 2.89, and the polymorphic information content ranging from 0.30 to 0.65. The number of alleles identified in C. chinense Jacq. was 119, ranging from 2 to 5 alleles per locus, an average of 3.30, and polymorphic information content from 0.19 to 0.68. The C. annuum L. SSR primers were most often transfer-able and polymorphic for C. frutescens L. and C. chinense Jacq., and we present a set of SSR for each species.
Consensus formation times in anisotropic societies
NASA Astrophysics Data System (ADS)
Neirotti, Juan
2017-06-01
We developed a statistical mechanics model to study the emergence of a consensus in societies of adapting, interacting agents constrained by a social rule B . In the mean-field approximation, we find that if the agents' interaction H0 is weak, all agents adapt to the social rule B , with which they form a consensus; however, if the interaction is sufficiently strong, a consensus is built against the established status quo. We observed that, after a transient time αt, agents asymptotically approach complete consensus by following a path whereby they neglect their neighbors' opinions on socially neutral issues (i.e., issues for which the society as a whole has no opinion). αt is found to be finite for most values of the interagent interaction H0 and temperature T , with the exception of the values H0=1 , T →∞ , and the region determined by the inequalities β <2 and 2 β H0<1 +β -√{1 +2 β -β2 } , for which consensus, with respect to B , is never reached.
Jones, Christopher P.; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin
2013-01-01
The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNALys3. Host cell tRNALys is selectively packaged into HIV-1 through a specific interaction between the major tRNALys-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNALys3 is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNALys and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNALys3 in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNALys to increase the efficiency of tRNALys3 annealing to viral RNA. PMID:23264568
Hizi, Amnon
2008-01-01
The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5′ end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3′ end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs. PMID:18753200
Hizi, Amnon
2008-11-01
The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5' end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3' end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs.
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S
2016-10-01
The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies
Nanotechnology: A Policy Primer
2010-06-02
States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Nanotechnology: A Policy Primer
2008-05-20
of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a
Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M
2004-10-01
The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.
Dogan, Fırat; Dorttas, Selvi Deniz; Bilge Dagalp, Seval; Ataseven, Veysel Soydal; Alkan, Feray
2018-06-01
Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative
Formaldehyde as hypothetical primer of biohomochirality
NASA Astrophysics Data System (ADS)
Goldanskii, Vitalii I.
1996-07-01
One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).
Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.
Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya
2012-01-01
This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.
Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki
2014-01-01
The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Adult Schistosoma mansoni express cathepsin L proteinase activity.
Smith, A M; Dalton, J P; Clough, K A; Kilbane, C L; Harrop, S A; Hole, N; Brindley, P J
1994-09-01
This report presents the deduced amino acid sequence of a novel cathepsin L proteinase from Schistosoma mansoni, and describes cathepsin L-like activity in extracts of adult schistosomes. Using consensus primers specific for cysteine proteinases, gene fragments were amplified from adult S. mansoni cDNA by PCR and cloned. One of these fragments showed marked identity to Sm31, the cathepsin B cysteine proteinase of adult S. mansoni, whereas another differed from Sm31 and was employed as a probe to isolate two cDNAs from an adult S. mansoni gene library. Together these cDNAs encoded a novel preprocathepsin L of 319 amino acids; this zymogen is predicted to be processed in vivo into a mature, active cathepsin L proteinase of 215 amino acids. Closest homologies were with cathepsins L from rat, mouse, and chicken (46-47% identity). Southern hybridization analysis suggested that only one or a few copies of the gene was present per genome, demonstrated that its locus was distinct from that of Sm31, and that a homologous sequence was present in Schistosoma japonicum. Because these results indicated that schistosomes expressed a cathepsin L proteinase, extracts of adult S. mansoni were examined for acidic, cysteine proteinase activity. Based on rates of cleavage of peptidyl substrates employed to discriminate between classes of cysteine proteinases, namely cathepsin L (Z-phe-arg-AMC), cathepsin B (Z-arg-arg-AMC) and cathepsin H (Bz-arg-AMC), the extracts were found to contain vigorous cathepsin L-like activity.(ABSTRACT TRUNCATED AT 250 WORDS)
Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin
2013-02-01
The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
L1CAM: amending the "low-risk" category in endometrial carcinoma.
Kommoss, Felix; Kommoss, Friedrich; Grevenkamp, Friederike; Bunz, Anne-Kathrin; Taran, Florin-Andrei; Fend, Falko; Brucker, Sara Y; Wallwiener, Diethelm; Schönfisch, Birgitt; Greif, Karen; Lax, Sigurd; Staebler, Annette; Kommoss, Stefan
2017-02-01
Low- and intermediate-risk endometrial carcinomas have an excellent prognosis. Nonetheless, a small subgroup of such patients will experience unexpected relapse. Recently L1CAM was suggested to be a strong prognosticator in endometrial carcinoma. The focus of our study was on low- and intermediate-risk disease, where no or only limited adjuvant treatment is recommended according to current guidelines. Endometrial carcinomas of low, intermediate and high-intermediate risk according to published 2016 consensus guidelines were identified. The study was limited to cases with previous central pathology review focusing on histotype, depth of myometrial invasion, presence of lymphovascular space invasion (LVSI) and MELF pattern of invasion. Standard L1CAM immunohistochemistry was performed. Disease-specific uni- and multivariate survival analyses were calculated. A total of 344 cases were available for immunohistochemistry (low-risk: n = 250; intermediate-risk: n = 67; high-intermediate-risk: n = 27). L1CAM positivity rates were: 29/344 (8.4 %; all cases), 18/250 (7.2 %; low-risk), 6/67 (9.0 %; intermediate-risk) and 5/27 (18.5 %; high-intermediate-risk). Expression of L1CAM was independent of LVSI and MELF. L1CAM was a significant independent prognosticator for disease-specific survival with a hazard ratio of 5.98 [CI 1.50-22.14, p = 0.012]. Adverse prognostic significance of L1CAM positivity was maintained after low-risk subgroup analysis (5-year disease-specific survival rates 71.8 vs. 100 %, p < 0.0001). All four tumour-related deaths in the subgroup of low-risk disease occurred in patients with L1CAM-positive tumours. The current definition of "low-risk" in endometrial carcinoma should be amended. "Low-risk carcinomas" should be limited to L1CAM-negative tumours. L1CAM status will play a key role in future algorithms to tailor adjuvant treatment and patient follow-up strategies.
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.
Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming
2016-01-01
Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies
Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.
2014-01-01
Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
Rivera, Rebecca; Robles-Sikisaka, Refugio; Hoffman, Elizabeth M; Stacy, Brian A; Jensen, Eric D; Nollens, Hendrik H; Wellehan, James F X
2012-03-23
A seven-year old California sea lion (Zalophus californianus) presented with focally extensive, bilaterally symmetric, proliferative axillary skin lesions and preputial lesions. A second California sea lion in the same population presented with similar proliferative lesions on the underside of the tail. Histopathology revealed epidermal hyperplasia with severe hyperkeratosis, with proliferating keratinocytes forming broad, branching pegs that extended into the dermis. Pan-papillomaviral consensus PCR was used to obtain initial E1 sequence template and the complete genome was determined using a combination of rolling circle amplification and specific-primer PCR. Analysis revealed a novel papillomavirus, Zalophus californianus papillomavirus 1 (ZcPV1), with seven open reading frames encoding five early proteins (E6, E7, E1, E2 and E4) and two late proteins (L1 and L2). Phylogenetic analysis revealed that (ZcPV1) is most closely related to Equine papillomavirus 1 (EcPV1) in the genus Zetapapillomavirus, and Canine papillomaviruses 3 and 4 (CPV3, CPV4) in the genus Chipapillomavirus. The lesions regressed without intervention over a period of several months. Copyright © 2011 Elsevier B.V. All rights reserved.
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
2012-01-01
Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469
In vitro cytotoxicity of orthodontic primers.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa
2009-01-01
The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Chi, Xiang-Qun; Wang, Long; Guo, Ruoyu; Zhao, Dexi; Li, Jia; Zhang, Yongyu; Jiao, Nianzhi
2018-06-19
The protein coding genes (rbcL/cbbL/cbbM) for RuBisCO large subunit, the most abundant protein on earth that drives biological CO2 fixation, were considered as useful marker genes in characterizing CO2-assimilating plankton. However, their community specificity has hindered comprehensive screening of genetic diversity. In this study, six different rbcL/cbbL/cbbM primers were employed to screen clone libraries to identify CO2-assimilating plankton in Jiaozhou Bay. The following community compositions were observed: the community components in Form I A/B rbcL/cbbL clone library mainly comprised Chlorophyta and Proteobacteria, Form ID2 and ID3 libraries consisted of Bacillariophyta, Form II cbbM library consisted of Proteobacteria and Alveolata, and both Form I green and red libraries included Proteobacteria, respectively. At the genus taxonomic level, no overlaps among these clone libraries were observed, except for ID2 and ID3. Overall, the phytoplankton in Jiaozhou Bay mainly consists of Bacillariophyta, Chlorophyta, Cryptophyta, Haptophyceae, and Alveolata. The CO2-assimilating prokaryotes mainly consist of Proteobacteria. Considering the high sequence specificities of these marker genes, we propose that the joint use of multiple primers may be utilized in unveiling the diversity of CO2-assimilating organisms. In addition, designing novel RuBisCO gene primers that generate longer amplicons and have broader phylogenetic coverage may be necessary in the future.
Charter School Primer. Peter Lang Primer. Volume 34
ERIC Educational Resources Information Center
Tryjankowski, Anne Marie
2012-01-01
The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Primer on spontaneous heating and pyrophoricity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less
Improving consensus contact prediction via server correlation reduction.
Gao, Xin; Bu, Dongbo; Xu, Jinbo; Li, Ming
2009-05-06
Protein inter-residue contacts play a crucial role in the determination and prediction of protein structures. Previous studies on contact prediction indicate that although template-based consensus methods outperform sequence-based methods on targets with typical templates, such consensus methods perform poorly on new fold targets. However, we find out that even for new fold targets, the models generated by threading programs can contain many true contacts. The challenge is how to identify them. In this paper, we develop an integer linear programming model for consensus contact prediction. In contrast to the simple majority voting method assuming that all the individual servers are equally important and independent, the newly developed method evaluates their correlation by using maximum likelihood estimation and extracts independent latent servers from them by using principal component analysis. An integer linear programming method is then applied to assign a weight to each latent server to maximize the difference between true contacts and false ones. The proposed method is tested on the CASP7 data set. If the top L/5 predicted contacts are evaluated where L is the protein size, the average accuracy is 73%, which is much higher than that of any previously reported study. Moreover, if only the 15 new fold CASP7 targets are considered, our method achieves an average accuracy of 37%, which is much better than that of the majority voting method, SVM-LOMETS, SVM-SEQ, and SAM-T06. These methods demonstrate an average accuracy of 13.0%, 10.8%, 25.8% and 21.2%, respectively. Reducing server correlation and optimally combining independent latent servers show a significant improvement over the traditional consensus methods. This approach can hopefully provide a powerful tool for protein structure refinement and prediction use.
Ooi, Choon Jin; Makharia, Govind K; Hilmi, Ida; Gibson, Peter R; Fock, Kwong Ming; Ahuja, Vineet; Ling, Khoon Lin; Lim, Wee Chian; Thia, Kelvin T; Wei, Shu-chen; Leung, Wai Keung; Koh, Poh Koon; Gearry, Richard B; Goh, Khean Lee; Ouyang, Qin; Sollano, Jose; Manatsathit, Sathaporn; de Silva, H Janaka; Rerknimitr, Rungsun; Pisespongsa, Pises; Abu Hassan, Muhamad Radzi; Sung, Joseph; Hibi, Toshifumi; Boey, Christopher C M; Moran, Neil; Leong, Rupert W L
2016-01-01
Inflammatory bowel disease (IBD) was previously thought to be rare in Asia, but emerging data indicate rising incidence and prevalence of IBD in the region. The Asia Pacific Working Group on Inflammatory Bowel Disease was established in Cebu, Philippines, at the Asia Pacific Digestive Week conference in 2006 under the auspices of the Asian Pacific Association of Gastroenterology with the goal of developing best management practices, coordinating research, and raising awareness of IBD in the region. The consensus group previously published recommendations for the diagnosis and management of ulcerative colitis with specific relevance to the Asia-Pacific region. The present consensus statements were developed following a similar process to address the epidemiology, diagnosis, and management of Crohn's disease. The goals of these statements are to pool the pertinent literature specifically highlighting relevant data and conditions in the Asia-Pacific region relating to the economy, health systems, background infectious diseases, differential diagnoses, and treatment availability. It does not intend to be all comprehensive and future revisions are likely to be required in this ever-changing field. © 2015 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.
Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria
2017-07-01
Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.
Fisher, Jacob C.
2017-01-01
Virtually all social diffusion work relies on a common formal basis, which predicts that consensus will develop among a connected population as the result of diffusion. In spite of the popularity of social diffusion models that predict consensus, few empirical studies examine consensus, or a clustering of attitudes, directly. Those that do either focus on the coordinating role of strict hierarchies, or on the results of online experiments, and do not consider how consensus occurs among groups in situ. This study uses longitudinal data on adolescent social networks to show how meso-level social structures, such as informal peer groups, moderate the process of consensus formation. Using a novel method for controlling for selection into a group, I find that centralized peer groups, meaning groups with clear leaders, have very low levels of consensus, while cohesive peer groups, meaning groups where more ties hold the members of the group together, have very high levels of consensus. This finding is robust to two different measures of cohesion and consensus. This suggests that consensus occurs either through central leaders’ enforcement or through diffusion of attitudes, but that central leaders have limited ability to enforce when people can leave the group easily. PMID:29335675
Li, Ying; Yu, Chuanfeng; Han, Huixia; Zhao, Caisheng; Zhang, Xiaoru
2016-07-15
A novel and sensitive surface-enhanced Raman scattering (SERS) method is proposed for the assay of DNA methyltransferase (MTase) activity and evaluation of inhibitors by developing a target triggering primer generation-based multiple signal amplification strategy. By using of a duplex substrate for Dam MTase, two hairpin templates and a Raman probe, multiple signal amplification mode is achieved. Once recognized by Dam MTase, the duplex substrate can be cleaved by Dpn I endonuclease and two primers are released for triggering the multiple signal amplification reaction. Consequently, a wide dynamic range and remarkably high sensitivity are obtained under isothermal conditions. The detection limit is 2.57×10(-4)UmL(-1). This assay exhibits an excellent selectivity and is successfully applied in the screening of inhibitors for Dam MTase. In addition, this novel sensing system is potentially universal as the recognition element can be conveniently designed for other target analytes by changing the substrate of DNA MTase. Copyright © 2016 Elsevier B.V. All rights reserved.
DOT National Transportation Integrated Search
1972-01-01
This primer was directed to the district and resident engineers of the Virginia Department of Highways, who are responsible for conducting highway public hearings, and to the environmental specialists of the Department's Environmental Quality Divisio...
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Methylated DNMT1 and E2F1 are targeted for proteolysis by L3MBTL3 and CRL4DCAF5 ubiquitin ligase.
Leng, Feng; Yu, Jiekai; Zhang, Chunxiao; Alejo, Salvador; Hoang, Nam; Sun, Hong; Lu, Fei; Zhang, Hui
2018-04-24
Many non-histone proteins are lysine methylated and a novel function of this modification is to trigger the proteolysis of methylated proteins. Here, we report that the methylated lysine 142 of DNMT1, a major DNA methyltransferase that preserves epigenetic inheritance of DNA methylation patterns during DNA replication, is demethylated by LSD1. A novel methyl-binding protein, L3MBTL3, binds the K142-methylated DNMT1 and recruits a novel CRL4 DCAF5 ubiquitin ligase to degrade DNMT1. Both LSD1 and PHF20L1 act primarily in S phase to prevent DNMT1 degradation by L3MBTL3-CRL4 DCAF5 . Mouse L3MBTL3/MBT-1 deletion causes accumulation of DNMT1 protein, increased genomic DNA methylation, and late embryonic lethality. DNMT1 contains a consensus methylation motif shared by many non-histone proteins including E2F1, a key transcription factor for S phase. We show that the methylation-dependent E2F1 degradation is also controlled by L3MBTL3-CRL4 DCAF5 . Our studies elucidate for the first time a novel mechanism by which the stability of many methylated non-histone proteins are regulated.
Rust transformation/rust compatible primers
NASA Technical Reports Server (NTRS)
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Beam shaping for laser initiated optical primers
NASA Astrophysics Data System (ADS)
Lizotte, Todd E.
2008-08-01
Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.
Munday, John S; French, Adrienne F
2015-06-01
Oral squamous cell carcinomas (OSCCs) are common feline cancers. Why OSCCs are so common in cats is unknown; however, 25% of human OSCCs are caused by papillomaviruses (PVs). Two feline oral PVs (FcaPV-1 and 4) are recognized. As PVs are highly host and location specific, if PVs do cause feline OSCCs, FcaPV-1 and 4 are the most likely etiological agents. PCR primers specific for FcaPV-1 amplified DNA from 1 of 36 feline OSCCs and 1 of 16 inflammatory oral lesions. No DNA was amplified by primers specific for FcaPV-4. PV DNA was not amplified from any additional sample using consensus primers. No PV cytopathology was visible in the OSCC that contained FcaPV-1 DNA, but viral cytopathology was present in a focus of epithelial hyperplasia in the non-neoplastic sample. This study does not support a PV etiology of feline OSCCs, but shows that FcaPV-1 can asymptomatically infect the mouth of cats. Copyright © 2015 Elsevier Ltd. All rights reserved.
Farkas, H; Martinez-Saguer, I; Bork, K; Bowen, T; Craig, T; Frank, M; Germenis, A E; Grumach, A S; Luczay, A; Varga, L; Zanichelli, A
2017-02-01
The consensus documents published to date on hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) have focused on adult patients. Many of the previous recommendations have not been adapted to pediatric patients. We intended to produce consensus recommendations for the diagnosis and management of pediatric patients with C1-INH-HAE. During an expert panel meeting that took place during the 9th C1 Inhibitor Deficiency Workshop in Budapest, 2015 (www.haenet.hu), pediatric data were presented and discussed and a consensus was developed by voting. The symptoms of C1-INH-HAE often present in childhood. Differential diagnosis can be difficult as abdominal pain is common in pediatric C1-INH-HAE, but also commonly occurs in the general pediatric population. The early onset of symptoms may predict a more severe subsequent course of the disease. Before the age of 1 year, C1-INH levels may be lower than in adults; therefore, it is advisable to confirm the diagnosis after the age of one year. All neonates/infants with an affected C1-INH-HAE family member should be screened for C1-INH deficiency. Pediatric patients should always carry a C1-INH-HAE information card and medicine for emergency use. The regulatory approval status of the drugs for prophylaxis and for acute treatment is different in each country. Plasma-derived C1-INH, recombinant C1-INH, and ecallantide are the only agents licensed for the acute treatment of pediatric patients. Clinical trials are underway with additional drugs. It is recommended to follow up patients in an HAE comprehensive care center. The pediatric-focused international consensus for the diagnosis and management of C1-INH-HAE patients was created. © 2016 The Authors. Allergy Published by John Wiley & Sons Ltd.
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome
Sarika; Arora, Vasu; Iquebal, M. A.; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on ‘three-tier architecture’ that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers’ search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/ PMID:23396298
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Development of a Consensus Taxonomy of Sedentary Behaviors (SIT): Report of Delphi Round 1
Chastin, Sebastien Francois Martin; Schwarz, Ulf; Skelton, Dawn Ann
2013-01-01
Background Over the last decade, sedentary behaviors have emerged as a distinctive behavioral paradigm with deleterious effects on health independent of physical activity. The next phase of research is to establish dose response between sedentary behaviors and health outcomes and improve understanding of context and determinants of these behaviors. Establishing a common taxonomy of these behaviors is a necessary step in this process. Aim The Sedentary behavior International Taxonomy project was developed to establish a classification of sedentary behaviors by use of a formal consensus process. Methods The study follows a Delphi process in three Rounds. A preparatory stage informed the development of terms of reference documents. In Round 1, experts were asked to make statements about the taxonomy; 1) its purpose and use ; 2) the domains, categories or facets that should be consider and include; 3) the structure/architecture to arrange and link these domains and facets. In Round 2 experts will be presented with a draft taxonomy emerging from Round 1 and invited to comment and propose alterations. The taxonomy will then be finalised at the outset of this stage. Results Results of Round 1 are reported here. There is a general consensus that a taxonomy will help advances in research by facilitating systematic and standardised: 1) investigation and analysis; 2) reporting and communication; 3) data pooling, comparison and meta-analysis; 4) development of measurement tools; 4) data descriptions, leading to higher quality in data querying and facilitate discoveries. There is also a consensus that such a taxonomy should be flexible to accommodate diverse purposes of use, and future advances in the field and yet provide a cross-disciplinary common language. A consensual taxonomy structure emerged with nine primary facets (Purpose, Environment, Posture, Social, Measurement, Associated behavior, Status, Time, Type) and the draft structure presented here for Round 2. PMID
Development of a consensus taxonomy of sedentary behaviors (SIT): report of Delphi Round 1.
Chastin, Sebastien Francois Martin; Schwarz, Ulf; Skelton, Dawn A; Skelton, Dawn Ann
2013-01-01
Over the last decade, sedentary behaviors have emerged as a distinctive behavioral paradigm with deleterious effects on health independent of physical activity. The next phase of research is to establish dose response between sedentary behaviors and health outcomes and improve understanding of context and determinants of these behaviors. Establishing a common taxonomy of these behaviors is a necessary step in this process. The Sedentary behavior International Taxonomy project was developed to establish a classification of sedentary behaviors by use of a formal consensus process. The study follows a Delphi process in three Rounds. A preparatory stage informed the development of terms of reference documents. In Round 1, experts were asked to make statements about the taxonomy; 1) its purpose and use ; 2) the domains, categories or facets that should be consider and include; 3) the structure/architecture to arrange and link these domains and facets. In Round 2 experts will be presented with a draft taxonomy emerging from Round 1 and invited to comment and propose alterations. The taxonomy will then be finalised at the outset of this stage. Results of Round 1 are reported here. There is a general consensus that a taxonomy will help advances in research by facilitating systematic and standardised: 1) investigation and analysis; 2) reporting and communication; 3) data pooling, comparison and meta-analysis; 4) development of measurement tools; 4) data descriptions, leading to higher quality in data querying and facilitate discoveries. There is also a consensus that such a taxonomy should be flexible to accommodate diverse purposes of use, and future advances in the field and yet provide a cross-disciplinary common language. A consensual taxonomy structure emerged with nine primary facets (Purpose, Environment, Posture, Social, Measurement, Associated behavior, Status, Time, Type) and the draft structure presented here for Round 2.
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
Relationships among L1 Print Exposure and Early L1 Literacy Skills, L2 Aptitude, and L2 Proficiency
ERIC Educational Resources Information Center
Sparks, Richard L.; Patton, Jon; Ganschow, Leonore; Humbach, Nancy
2012-01-01
Authors examined the relationship between individual differences in L1 print exposure and differences in early L1 skills and later L2 aptitude, L2 proficiency, and L2 classroom achievement. Participants were administered measures of L1 word decoding, spelling, phonemic awareness, reading comprehension, receptive vocabulary, and listening…
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Protective Coats For Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Macdowell, Louis G, III
1993-01-01
Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.
Constructive conflict and staff consensus in substance abuse treatment.
Melnick, Gerald; Wexler, Harry K; Chaple, Michael; Cleland, Charles M
2009-03-01
Previous studies demonstrated the relationship between consensus among both staff and clients with client engagement in treatment and between client consensus and 1-year treatment outcomes. The present article explores the correlates of staff consensus, defined as the level of agreement among staff as to the importance of treatment activities in their program, using a national sample of 80 residential substance abuse treatment programs. Constructive conflict resolution had the largest effect on consensus. Low client-to-staff ratios, staff education, and staff experience in substance abuse treatment were also significantly related to consensus. Frequency of training, an expected correlate of consensus, was negatively associated with consensus, whereas frequency of supervision was not a significant correlate. The implications of the findings for future research and program improvement are discussed.
Randhawa, Rohit; Duseja, Ajay; Changotra, Harish
2017-02-01
Various case-control studies have shown association of single nucleotide polymorphism rs12303764(G/T) in ULK1 with crohn's disease. The techniques used in these studies were time consuming, complicated and require sophisticated/expensive instruments. Therefore, in order to overcome these problems, we have developed a new, rapid and cost effective Tetra-primer ARMS-PCR assay to genotype single nucleotide polymorphism rs12303764(G/T) of ULK1 gene. We manually designed allele specific primers. DNA fragment amplified using outer primers was sequenced to obtain samples with known genotypes (GG, GT and TT) for further use in the development of T-ARMS-PCR assay. Amplification conditions were optimized for parameters; annealing temperature, Taq DNA polymerase and primers. The developed T-ARMS-PCR assay was applied to genotype one hundred samples from healthy individuals. Genotyping results of 10 DNA samples from healthy individuals for rs12303764(G/T) by T-ARMS-PCR assay and sequencing were concordant. The newly developed assay was further applied to genotype samples from 100 healthy individuals of North Indian origin. Genotype frequencies were 9, 34 and 57 % for GG, GT and TT, respectively. Allele frequencies were 0.26 and 0.74 for G and T, respectively. The allele frequencies were in Hardy-Weinberg's equilibrium (p = 0.2443). T-ARMS-PCR assay developed in our laboratory for genotyping rs12303764 (G/T) of ULK1 gene is time saving and cost-effective as compared to the available methods. Furthermore, this is the first study reporting allelic and genotype frequencies of ULK1 rs12303764 (G/T) variants in North Indian population.
Vygotsky on Education Primer. Peter Lang Primer. Volume 30
ERIC Educational Resources Information Center
Lake, Robert
2012-01-01
The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…
Site Selective Binding of Zn(ll) ot Metallo-b-Lactamase L1 from Stenotrophomonas Maltophilia
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costello,A.; Periyannan, G.; Yang, K.
2006-01-01
Extended X-ray absorption fine structure studies of the metallo-{beta}-lactamase L1 from Stenotrophomonas maltophilia containing 1 and 2 equiv of Zn(II) and containing 2 equiv of Zn(II) plus hydrolyzed nitrocefin are presented. The data indicate that the first, catalytically dominant metal ion is bound by L1 at the consensus Zn1 site. The data further suggest that binding of the first metal helps preorganize the ligands for binding of the second metal ion. The di-Zn enzyme displays a well-defined metal-metal interaction at 3.42 Angstroms. Reaction with the {beta}-lactam antibiotic nitrocefin results in a product-bound species, in which the ring-opened lactam rotates inmore » the active site to present the S1 sulfur atom of nitrocefin to one of the metal ions for coordination. The product bridges the two metal ions, with a concomitant lengthening of the Zn-Zn interaction to 3.62 Angstroms.« less
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice
Single-primer fluorescent sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.
Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Value for money assessment for public-private partnerships : a primer.
DOT National Transportation Integrated Search
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.
Initialization of Formation Flying Using Primer Vector Theory
NASA Technical Reports Server (NTRS)
Mailhe, Laurie; Schiff, Conrad; Folta, David
2002-01-01
In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.
Primer-Free Aptamer Selection Using A Random DNA Library
Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary
2010-01-01
Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences
IV Spanish Consensus Conference on Helicobacter pylori infection treatment.
Gisbert, Javier P; Molina-Infante, Javier; Amador, Javier; Bermejo, Fernando; Bujanda, Luis; Calvet, Xavier; Castro-Fernández, Manuel; Cuadrado-Lavín, Antonio; Elizalde, J Ignasi; Gene, Emili; Gomollón, Fernando; Lanas, Ángel; Martín de Argila, Carlos; Mearin, Fermín; Montoro, Miguel; Pérez-Aisa, Ángeles; Pérez-Trallero, Emilio; McNicholl, Adrián G
2016-12-01
Helicobacter pylori approximately infect 50% of Spanish population and causes chronic gastritis, peptic ulcer and gastric cancer. Until now, three consensus meetings on H.pylori infection had been performed in Spain (the last in 2012). The changes in the treatment schemes, and the increasing available evidence, have justified organizing the IVSpanish Consensus Conference (March 2016), focused on the treatment of this infection. Nineteen experts participated, who performed a systematic review of the scientific evidence and developed a series of recommendation that were subjected to an anonymous Delphi process of iterative voting. Scientific evidence and the strength of the recommendation were classified using GRADE guidelines. As starting point, this consensus increased the minimum acceptable efficacy of recommended treatments that should reach, or preferably surpass, the 90% cure rate when prescribed empirically. Therefore, only quadruple therapies (with or without bismuth), and generally lasting 14 days, are recommended both for first and second line treatments. Non-bismuth quadruple concomitant regimen, including a proton pump inhibitor, clarithromycin, amoxicillin and metronidazole, is recommended as first line. In the present consensus, other first line alternatives and rescue treatments are also reviewed and recommended. Copyright © 2016 Elsevier España, S.L.U., AEEH y AEG. All rights reserved.
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
Composite-composite repair bond strength: effect of different adhesion primers.
Tezvergil, A; Lassila, L V J; Vallittu, P K
2003-11-01
Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.
Comparing and Contrasting Consensus versus Empirical Domains
Jason, Leonard A.; Kot, Bobby; Sunnquist, Madison; Brown, Abigail; Reed, Jordan; Furst, Jacob; Newton, Julia L.; Strand, Elin Bolle; Vernon, Suzanne D.
2015-01-01
Background Since the publication of the CFS case definition [1], there have been a number of other criteria proposed including the Canadian Consensus Criteria [2] and the Myalgic Encephalomyelitis: International Consensus Criteria. [3] Purpose The current study compared these domains that were developed through consensus methods to one obtained through more empirical approaches using factor analysis. Methods Using data mining, we compared and contrasted fundamental features of consensus-based criteria versus empirical latent factors. In general, these approaches found the domain of Fatigue/Post-exertional malaise as best differentiating patients from controls. Results Findings indicated that the Fukuda et al. criteria had the worst sensitivity and specificity. Conclusions These outcomes might help both theorists and researchers better determine which fundamental domains to be used for the case definition. PMID:26977374
Valliere-Douglass, John F; Kodama, Paul; Mujacic, Mirna; Brady, Lowell J; Wang, Wes; Wallace, Alison; Yan, Boxu; Reddy, Pranhitha; Treuheit, Michael J; Balland, Alain
2009-11-20
We report that N-linked oligosaccharide structures can be present on an asparagine residue not adhering to the consensus site motif NX(S/T), where X is not proline, described in the literature. We have observed oligosaccharides on a non-consensus asparaginyl residue in the C(H)1 constant domain of IgG1 and IgG2 antibodies. The initial findings were obtained from characterization of charge variant populations evident in a recombinant human antibody of the IgG2 subclass. HPLC-MS results indicated that cation-exchange chromatography acidic variant populations were enriched in antibody with a second glycosylation site, in addition to the well documented canonical glycosylation site located in the C(H)2 domain. Subsequent tryptic and chymotryptic peptide map data indicated that the second glycosylation site was associated with the amino acid sequence TVSWN(162)SGAL in the C(H)1 domain of the antibody. This highly atypical modification is present at levels of 0.5-2.0% on most of the recombinant antibodies that have been tested and has also been observed in IgG1 antibodies derived from human donors. Site-directed mutagenesis of the C(H)1 domain sequence in a recombinant-human IgG1 antibody resulted in an increase in non-consensus glycosylation to 3.15%, a greater than 4-fold increase over the level observed in the wild type, by changing the -1 and +1 amino acids relative to the asparagine residue at position 162. We believe that further understanding of the phenomenon of non-consensus glycosylation can be used to gain fundamental insights into the fidelity of the cellular glycosylation machinery.
Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L
1998-01-01
Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs. PMID:9707446
Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L
1998-08-17
Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.
Shop primer as part of the corrosion protective coating for submerged steel structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bjordal, M.; Steinsmo, U.
In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less
Economics : pricing, demand, and economic efficiency : a primer.
DOT National Transportation Integrated Search
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
ITS primers for the identification of marketable Boletus.
Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola
2006-02-10
Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.
Muddukrishna, Bhavana; Jackson, Christopher A; Yu, Michael C
2017-06-01
Protein arginine methylation occurs on spliceosomal components and spliceosome-associated proteins, but how this modification contributes to their function in pre-mRNA splicing remains sparse. Here we provide evidence that protein arginine methylation of the yeast SR-/hnRNP-like protein Npl3 plays a role in facilitating efficient splicing of the SUS1 intron that harbors a non-consensus 5' splice site and branch site. In yeast cells lacking the major protein arginine methyltransferase HMT1, we observed a change in the co-transcriptional recruitment of the U1 snRNP subunit Snp1 and Npl3 to pre-mRNAs harboring both consensus (ECM33 and ASC1) and non-consensus (SUS1) 5' splice site and branch site. Using an Npl3 mutant that phenocopies wild-type Npl3 when expressed in Δhmt1 cells, we showed that the arginine methylation of Npl3 is responsible for this. Examination of pre-mRNA splicing efficiency in these mutants reveals the requirement of Npl3 methylation for the efficient splicing of SUS1 intron 1, but not of ECM33 or ASC1. Changing the 5' splice site and branch site in SUS1 intron 1 to the consensus form restored splicing efficiency in an Hmt1-independent manner. Results from biochemical studies show that methylation of Npl3 promotes its optimal association with the U1 snRNP through its association with the U1 snRNP subunit Mud1. Based on these data, we propose a model in which Hmt1, via arginine methylation of Npl3, facilitates U1 snRNP engagement with the pre-mRNA to promote usage of non-consensus splice sites by the splicing machinery. Published by Elsevier B.V.
Crystallographic observation of nonenzymatic RNA primer extension.
Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W
2018-05-31
The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.
75 FR 70074 - Consensus Standards, Light-Sport Aircraft
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-16
... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Consensus Standards, Light-Sport... accepted consensus standards relating to the provisions of the Sport Pilot and Light-Sport Aircraft rule issued July 16, 2004, and effective September 1, 2004. ASTM International Committee F37 on Light Sport...
Consensus generation and variant detection by Celera Assembler.
Denisov, Gennady; Walenz, Brian; Halpern, Aaron L; Miller, Jason; Axelrod, Nelson; Levy, Samuel; Sutton, Granger
2008-04-15
We present an algorithm to identify allelic variation given a Whole Genome Shotgun (WGS) assembly of haploid sequences, and to produce a set of haploid consensus sequences rather than a single consensus sequence. Existing WGS assemblers take a column-by-column approach to consensus generation, and produce a single consensus sequence which can be inconsistent with the underlying haploid alleles, and inconsistent with any of the aligned sequence reads. Our new algorithm uses a dynamic windowing approach. It detects alleles by simultaneously processing the portions of aligned reads spanning a region of sequence variation, assigns reads to their respective alleles, phases adjacent variant alleles and generates a consensus sequence corresponding to each confirmed allele. This algorithm was used to produce the first diploid genome sequence of an individual human. It can also be applied to assemblies of multiple diploid individuals and hybrid assemblies of multiple haploid organisms. Being applied to the individual human genome assembly, the new algorithm detects exactly two confirmed alleles and reports two consensus sequences in 98.98% of the total number 2,033311 detected regions of sequence variation. In 33,269 out of 460,373 detected regions of size >1 bp, it fixes the constructed errors of a mosaic haploid representation of a diploid locus as produced by the original Celera Assembler consensus algorithm. Using an optimized procedure calibrated against 1 506 344 known SNPs, it detects 438 814 new heterozygous SNPs with false positive rate 12%. The open source code is available at: http://wgs-assembler.cvs.sourceforge.net/wgs-assembler/
ERIC Educational Resources Information Center
National Institutes of Health (DHHS), Bethesda, MD.
This report is the product of a National Institutes of Health Consensus Development Conference on Noise and Hearing Loss which addressed the characteristics of noise-induced hearing loss, acoustic parameters of hazardous noise exposure, individual and age-specific susceptibility, and prevention strategies. The report examines the incidence of…
NASA Astrophysics Data System (ADS)
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-03-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-01-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911
Efficient decentralized consensus protocols
NASA Technical Reports Server (NTRS)
Lakshman, T. V.; Agrawala, A. K.
1986-01-01
Decentralized consensus protocols are characterized by successive rounds of message interchanges. Protocols which achieve a consensus in one round of message interchange require O(N-squared) messages, where N is the number of participants. In this paper, a communication scheme, based on finite projective planes, which requires only O(N sq rt N) messages for each round is presented. Using this communication scheme, decentralized consensus protocols which achieve a consensus within two rounds of message interchange are developed. The protocols are symmetric, and the communication scheme does not impose any hierarchical structure. The scheme is illustrated using blocking and nonblocking commit protocols, decentralized extrema finding, and computation of the sum function.
Kondrysová, Eva; Krak, Karol; Mandák, Bohumil
2017-01-01
Premise of the study: Microsatellite primers were developed to characterize the genetic diversity and structure of the annual herb Atriplex tatarica (Amaranthaceae) and to facilitate ecological and evolutionary studies of A. tatarica and its relatives. Methods and Results: Sixteen novel microsatellite primers were developed for A. tatarica based on high-throughput sequencing of enriched libraries. All markers were polymorphic, with the number of alleles per locus ranging from three to 25 and observed and expected heterozygosity ranging from 0.08 to 0.74 and 0.10 to 0.87, respectively. In addition, some of these loci were successfully amplified and showed polymorphisms in four Atriplex and seven Chenopodium species. Conclusions: The microsatellite markers published here will be useful in assessing genetic diversity, structure, and gene flow within and across populations of A. tatarica, as well as in other species of Atriplex and the related genus Chenopodium. PMID:29188148
Li, Fan; Ma, Liying; Feng, Yi; Hu, Jing; Ni, Na; Ruan, Yuhua; Shao, Yiming
2017-06-01
HIV-1 transmission in intravenous drug users (IDUs) has been characterized by high genetic multiplicity and suggests a greater challenge for HIV-1 infection blocking. We investigated a total of 749 sequences of full-length gp160 gene obtained by single genome sequencing (SGS) from 22 HIV-1 early infected IDUs in Xinjiang province, northwest China, and generated a transmitted and founder virus (T/F virus) consensus sequence (IDU.CON). The T/F virus was classified as subtype CRF07_BC and predicted to be CCR5-tropic virus. The variable region (V1, V2, and V4 loop) of IDU.CON showed length variation compared with the heterosexual T/F virus consensus sequence (HSX.CON) and homosexual T/F virus consensus sequence (MSM.CON). A total of 26 N-linked glycosylation sites were discovered in the IDU.CON sequence, which is less than that of MSM.CON and HSX.CON. Characterization of T/F virus from IDUs highlights the genetic make-up and complexity of virus near the moment of transmission or in early infection preceding systemic dissemination and is important toward the development of an effective HIV-1 preventive methods, including vaccines.
NASA Astrophysics Data System (ADS)
Legates, David R.; Soon, Willie; Briggs, William M.; Monckton of Brenchley, Christopher
2015-04-01
Agnotology is the study of how ignorance arises via circulation of misinformation calculated to mislead. Legates et al. (Sci Educ 22:2007-2017, 2013) had questioned the applicability of agnotology to politically-charged debates. In their reply, Bedford and Cook (Sci Educ 22:2019-2030, 2013), seeking to apply agnotology to climate science, asserted that fossil-fuel interests had promoted doubt about a climate consensus. Their definition of climate `misinformation' was contingent upon the post-modernist assumptions that scientific truth is discernible by measuring a consensus among experts, and that a near unanimous consensus exists. However, inspection of a claim by Cook et al. (Environ Res Lett 8:024024, 2013) of 97.1 % consensus, heavily relied upon by Bedford and Cook, shows just 0.3 % endorsement of the standard definition of consensus: that most warming since 1950 is anthropogenic. Agnotology, then, is a two-edged sword since either side in a debate may claim that general ignorance arises from misinformation allegedly circulated by the other. Significant questions about anthropogenic influences on climate remain. Therefore, Legates et al. appropriately asserted that partisan presentations of controversies stifle debate and have no place in education.
Quick spacecraft charging primer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larsen, Brian Arthur
2014-03-12
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
NASA Astrophysics Data System (ADS)
Wright, K. E.; Domagal-Goldman, S. D.
2011-12-01
We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.
Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore
2018-01-01
To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.
Development of a PD-L1 Complementary Diagnostic Immunohistochemistry Assay (SP142) for Atezolizumab.
Vennapusa, Bharathi; Baker, Brian; Kowanetz, Marcin; Boone, Jennifer; Menzl, Ina; Bruey, Jean-Marie; Fine, Gregg; Mariathasan, Sanjeev; McCaffery, Ian; Mocci, Simonetta; Rost, Sandra; Smith, Dustin; Dennis, Eslie; Tang, Szu-Yu; Damadzadeh, Bita; Walker, Espen; Hegde, Priti S; Williams, J Andrew; Koeppen, Hartmut; Boyd, Zachary
2018-01-16
Cancer immunotherapies, such as atezolizumab, are proving to be a valuable therapeutic strategy across indications, including non-small cell lung cancer (NSCLC) and urothelial cancer (UC). Here, we describe a diagnostic assay that measures programmed-death ligand 1 (PD-L1) expression, via immunohistochemistry, to identify patients who will derive the most benefit from treatment with atezolizumab, a humanized monoclonal anti-PD-L1 antibody. We describe the performance of the VENTANA PD-L1 (SP142) Assay in terms of specificity, sensitivity, and the ability to stain both tumor cells (TC) and tumor-infiltrating immune cells (IC), in NSCLC and UC tissues. The reader precision, repeatability and intermediate precision, interlaboratory reproducibility, and the effectiveness of pathologist training on the assessment of PD-L1 staining on both TC and IC were evaluated. We detail the analytical validation of the VENTANA PD-L1 (SP142) Assay for PD-L1 expression in NSCLC and UC tissues and show that the assay reliably evaluated staining on both TC and IC across multiple expression levels/clinical cut-offs. The reader precision showed high overall agreement when compared with consensus scores. In addition, pathologists met the predefined training criteria (≥85.0% overall percent agreement) for the assessment of PD-L1 expression in NSCLC and UC tissues with an average overall percent agreement ≥95.0%. The assay evaluates PD-L1 staining on both cell types and is robust and precise. In addition, it can help to identify those patients who may benefit the most from treatment with atezolizumab, although treatment benefit has been demonstrated in an all-comer NSCLC and UC patient population.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets
Monoclonal Antibody L1Mab-13 Detected Human PD-L1 in Lung Cancers.
Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Yanaka, Miyuki; Chang, Yao-Wen; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari
2018-04-01
Programmed cell death ligand-1 (PD-L1) is a type I transmembrane glycoprotein expressed on antigen-presenting cells. It is also expressed in several tumor cells such as melanoma and lung cancer cells. A strong correlation has been reported between human PD-L1 (hPD-L1) expression in tumor cells and negative prognosis in cancer patients. Here, a novel anti-hPD-L1 monoclonal antibody (mAb) L 1 Mab-13 (IgG 1 , kappa) was produced using a cell-based immunization and screening (CBIS) method. We investigated hPD-L1 expression in lung cancer using flow cytometry, Western blot, and immunohistochemical analyses. L 1 Mab-13 specifically reacted hPD-L1 of hPD-L1-overexpressed Chinese hamster ovary (CHO)-K1 cells and endogenous hPD-L1 of KMST-6 (human fibroblast) in flow cytometry and Western blot. Furthermore, L 1 Mab-13 reacted with lung cancer cell lines (EBC-1, Lu65, and Lu99) in flow cytometry and stained lung cancer tissues in a membrane-staining pattern in immunohistochemical analysis. These results indicate that a novel anti-hPD-L1 mAb, L 1 Mab-13, is very useful for detecting hPD-L1 of lung cancers in flow cytometry, Western blot, and immunohistochemical analyses.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lawton, Colleen A.F.; Michalski, Jeff; El-Naqa, Issam
2009-06-01
Purpose: Radiation therapy to the pelvic lymph nodes in high-risk prostate cancer is required on several Radiation Therapy Oncology Group (RTOG) clinical trials. Based on a prior lymph node contouring project, we have shown significant disagreement in the definition of pelvic lymph node volumes among genitourinary radiation oncology specialists involved in developing and executing current RTOG trials. Materials and Methods: A consensus meeting was held on October 3, 2007, to reach agreement on pelvic lymph node volumes. Data were presented to address the lymph node drainage of the prostate. Extensive discussion ensued to develop clinical target volume (CTV) pelvic lymphmore » node consensus. Results: Consensus was obtained resulting in computed tomography image-based pelvic lymph node CTVs. Based on this consensus, the pelvic lymph node volumes to be irradiated include: distal common iliac, presacral lymph nodes (S{sub 1}-S{sub 3}), external iliac lymph nodes, internal iliac lymph nodes, and obturator lymph nodes. Lymph node CTVs include the vessels (artery and vein) and a 7-mm radial margin being careful to 'carve out' bowel, bladder, bone, and muscle. Volumes begin at the L5/S1 interspace and end at the superior aspect of the pubic bone. Consensus on dose-volume histogram constraints for OARs was also attained. Conclusions: Consensus on pelvic lymph node CTVs for radiation therapy to address high-risk prostate cancer was attained and is available as web-based computed tomography images as well as a descriptive format through the RTOG. This will allow for uniformity in evaluating the benefit and risk of such treatment.« less
ERIC Educational Resources Information Center
Whetstone, B. D.; Yates, Benny
This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…
GhL1L1 affects cell fate specification by regulating GhPIN1-mediated auxin distribution.
Xu, Jiao; Yang, Xiyan; Li, Baoqi; Chen, Lin; Min, Ling; Zhang, Xianlong
2018-05-13
Auxin is as an efficient initiator and regulator of cell fate during somatic embryogenesis (SE), but the molecular mechanisms and regulating networks of this process are not well understood. In this report, we analysed SE process induced by Leafy cotyledon1-like 1 (GhL1L1), a NF-YB subfamily gene specifically expressed in embryonic tissues in cotton. We also identified the target gene of GhL1L1, and its role in auxin distribution and cell fate specification during embryonic development was analysed. Overexpression of GhL1L1 accelerated embryonic cell formation, associated with an increased concentration of IAA in embryogenic calluses (ECs) and in the shoot apical meristem (SAM), corresponding to altered expression of the auxin transport gene GhPIN1. By contrast, GhL1L1-deficient explants showed retarded embryonic cell formation, and the concentration of IAA was decreased in GhL1L1-deficient ECs. Disruption of auxin distribution accelerated the specification of embryonic cell fate together with regulation of GhPIN1. Furthermore, we showed that PHOSPHATASE 2AA2 (GhPP2AA2) was activated by GhL1L1 through targeting the G-box of its promoter, hence regulating the activity of GhPIN1 protein. Our results indicate that GhL1L1 functions as a key regulator in auxin distribution to regulate cell fate specification in cotton and contribute to the understanding of the complex process of SE in plant species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Pandey, Sonika; Patel, Manish Kumar; Jha, Bhavanath
2016-01-01
Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII) specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13), overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid), and lower electrolytic leakage, lipid peroxidation (MDA content) and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas. PMID:27411057
Pandey, Sonika; Patel, Manish Kumar; Mishra, Avinash; Jha, Bhavanath
2016-01-01
Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII) specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13), overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid), and lower electrolytic leakage, lipid peroxidation (MDA content) and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.
The use of ovarian reserve markers in IVF clinical practice: a national consensus.
La Marca, Antonio; Ferraretti, Anna Pia; Palermo, Roberto; Ubaldi, Filippo M
2016-01-01
Ovarian reserve markers have been documented to perform very well in the clinical practice. While this is widely recognized, still now there is no consensus on how to use new biomarkers in the clinical practice. This study was conducted among Italian IVF centres using the Delphi technique, a validated consensus-building process. Briefly three consecutive questionnaires were developed for clinicians in charge of IVF centres. In the first rounds, participants were asked to rate the importance of a list of statements regarding the categorization of ovarian response and the diagnostic role of biomarkers. In round 3, participants were asked to rate their agreement and consensus on the list of statements derived from the first two rounds. There were 120 respondents. Consensus was achieved for many points: (a) poor ovarian response is predicted on the basis of the following: AMH < 1 ng/ml or AFC < 7, FSH ≥ 10 IU/l, age ≥ 40 yrs; (b) hyper-response is predicted on the basis of the following: AMH > 3 ng/ml or AFC > 14; (c) day 3 FSH measurement should always be associated to estradiol; (d) AMH can be measured on a random basis; (e) the measurement of the AFC with the 2D technology may be considered adequate and (f) the AFC should be measured in the early follicular phase and consists in the total number of 2-9 mm follicles in both the ovaries. The present study suggests that extensive consensus on the importance and use of new ovarian reserve markers to improve IVF safety and performance is already present among clinicians.
Bonding of Resin Cement to Zirconia with High Pressure Primer Coating
Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua
2014-01-01
Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678
Kayesh, E; Zhang, Y Y; Liu, G S; Bilkish, N; Sun, X; Leng, X P; Fang, J G
2013-09-23
The objectives of this investigation were to develop and validate the expressed sequence tag (EST)-simple sequence repeat (SSR) markers from large EST sequences, and to study the segregation and distribution of SSRs within two grapevine parental lines. In total, 94 F₁ lines crossed between "Early Rose" and "Red Globe" were studied. Approximately 2100 EST-SSR sequences of Vitis vinifera L. were searched for SSRs and analyzed for the design of polymerase chain reaction (PCR) primers amplifying the SSR-rich regions. Trinucleotide repeats were found to be the most abundant, followed by other nucleotide repeats. A total of 182 SSR primer pairs were first developed for the study on the parental polymorphism. Among the 182 SSR primers, 142 primer pairs (78%) could amplify the anticipated PCR products, among which only 52 primer pairs (36.62%) showed polymorphism between the two parents. These polymorphic bands were further surveyed among the 94 F₁ lines, and the results showed that a total of 162 bands were amplified, and 98 of them were polymorphic in both parents (60.86% polymorphism), with an average of 1.88 polymorphic DNA bands for each primer pair. After testing with the chi-square test, 33 of the clearly amplified polymorphic bands followed a 3:1 ratio, and 37 followed a 1:1 ratio. The rest showed distorted segregation ratios.
A Transportation Modeling Primer
DOT National Transportation Integrated Search
2006-06-01
This primer is intended to explain the urban transportation modeling process works, the assumptions made and the steps used to forecast travel demand for urban transportation planning. This is done in order to help to understand the process and its i...
A physicists guide to The Los Alamos Primer
NASA Astrophysics Data System (ADS)
Reed, B. Cameron
2016-11-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.
The pivotal role of perceived scientific consensus in acceptance of science
NASA Astrophysics Data System (ADS)
Lewandowsky, Stephan; Gignac, Gilles E.; Vaughan, Samuel
2013-04-01
Although most experts agree that CO2 emissions are causing anthropogenic global warming (AGW), public concern has been declining. One reason for this decline is the `manufacture of doubt' by political and vested interests, which often challenge the existence of the scientific consensus. The role of perceived consensus in shaping public opinion is therefore of considerable interest: in particular, it is unknown whether consensus determines people's beliefs causally. It is also unclear whether perception of consensus can override people's `worldviews', which are known to foster rejection of AGW. Study 1 shows that acceptance of several scientific propositions--from HIV/AIDS to AGW--is captured by a common factor that is correlated with another factor that captures perceived scientific consensus. Study 2 reveals a causal role of perceived consensus by showing that acceptance of AGW increases when consensus is highlighted. Consensus information also neutralizes the effect of worldview.
Cheng, Lei; Zhang, Ke; Weir, Michael D.; Liu, Huaibing; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives Recent studies developed antibacterial bonding agents and composites containing a quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg). The objectives of this study were to investigate: (1) the effect of antibacterial primers containing QADM and NAg on the inhibition of Streptococcus mutans (S. mutans) impregnated into dentin blocks for the first time, and (2) the effect of QADM or NAg alone or in combination, and the effect of NAg mass fraction, on S. mutans viability in dentin. Methods Scotchbond Multi-Purpose (SBMP) bonding agent was used. QADM and NAg were incorporated into SBMP primer. Six primers were tested: SBMP primer control, control + 10% QADM (mass %), control + 0.05% NAg, control + 10% QADM + 0.05% NAg, control + 0.1% NAg, and control + 10% QADM + 0.1% NAg. S. mutans were impregnated into dentin blocks, then a primer was applied. The viable colony-forming units (CFU) were then measured by harvesting the bacteria in dentin using a sonication method. Results Control + 10% QADM + 0.1% NAg had bacteria inhibition zone 8-fold that of control (p < 0.05). The sonication method successfully harvested bacteria from dentin blocks. Control + 10% QADM + 0.1% NAg inhibited S. mutans in dentin blocks, reducing the viable CFU in dentin by three orders of magnitude, compared to control dentin without primer. Using QADM+NAg was more effective than QADM alone. Higher NAg content increased the potency. Dentin shear bond strength was similar for all groups (p > 0.1). Significance Antibacterial primer with QADM and NAg were shown to inhibit the S. mutans impregnated into dentin blocks for the first time. Bonding agent containing QADM and NAg is promising to eradicate bacteria in tooth cavity and inhibit caries. The QADM and NAg may have applicability to other adhesives, cements, sealants and composites. PMID:23422420
2011-01-01
Background A number of molecular marker linkage maps have been developed for melon (Cucumis melo L.) over the last two decades. However, these maps were constructed using different marker sets, thus, making comparative analysis among maps difficult. In order to solve this problem, a consensus genetic map in melon was constructed using primarily highly transferable anchor markers that have broad potential use for mapping, synteny, and comparative quantitative trait loci (QTL) analysis, increasing breeding effectiveness and efficiency via marker-assisted selection (MAS). Results Under the framework of the International Cucurbit Genomics Initiative (ICuGI, http://www.icugi.org), an integrated genetic map has been constructed by merging data from eight independent mapping experiments using a genetically diverse array of parental lines. The consensus map spans 1150 cM across the 12 melon linkage groups and is composed of 1592 markers (640 SSRs, 330 SNPs, 252 AFLPs, 239 RFLPs, 89 RAPDs, 15 IMAs, 16 indels and 11 morphological traits) with a mean marker density of 0.72 cM/marker. One hundred and ninety-six of these markers (157 SSRs, 32 SNPs, 6 indels and 1 RAPD) were newly developed, mapped or provided by industry representatives as released markers, including 27 SNPs and 5 indels from genes involved in the organic acid metabolism and transport, and 58 EST-SSRs. Additionally, 85 of 822 SSR markers contributed by Syngenta Seeds were included in the integrated map. In addition, 370 QTL controlling 62 traits from 18 previously reported mapping experiments using genetically diverse parental genotypes were also integrated into the consensus map. Some QTL associated with economically important traits detected in separate studies mapped to similar genomic positions. For example, independently identified QTL controlling fruit shape were mapped on similar genomic positions, suggesting that such QTL are possibly responsible for the phenotypic variability observed for this trait in
Diaz, Aurora; Fergany, Mohamed; Formisano, Gelsomina; Ziarsolo, Peio; Blanca, José; Fei, Zhanjun; Staub, Jack E; Zalapa, Juan E; Cuevas, Hugo E; Dace, Gayle; Oliver, Marc; Boissot, Nathalie; Dogimont, Catherine; Pitrat, Michel; Hofstede, René; van Koert, Paul; Harel-Beja, Rotem; Tzuri, Galil; Portnoy, Vitaly; Cohen, Shahar; Schaffer, Arthur; Katzir, Nurit; Xu, Yong; Zhang, Haiying; Fukino, Nobuko; Matsumoto, Satoru; Garcia-Mas, Jordi; Monforte, Antonio J
2011-07-28
A number of molecular marker linkage maps have been developed for melon (Cucumis melo L.) over the last two decades. However, these maps were constructed using different marker sets, thus, making comparative analysis among maps difficult. In order to solve this problem, a consensus genetic map in melon was constructed using primarily highly transferable anchor markers that have broad potential use for mapping, synteny, and comparative quantitative trait loci (QTL) analysis, increasing breeding effectiveness and efficiency via marker-assisted selection (MAS). Under the framework of the International Cucurbit Genomics Initiative (ICuGI, http://www.icugi.org), an integrated genetic map has been constructed by merging data from eight independent mapping experiments using a genetically diverse array of parental lines. The consensus map spans 1150 cM across the 12 melon linkage groups and is composed of 1592 markers (640 SSRs, 330 SNPs, 252 AFLPs, 239 RFLPs, 89 RAPDs, 15 IMAs, 16 indels and 11 morphological traits) with a mean marker density of 0.72 cM/marker. One hundred and ninety-six of these markers (157 SSRs, 32 SNPs, 6 indels and 1 RAPD) were newly developed, mapped or provided by industry representatives as released markers, including 27 SNPs and 5 indels from genes involved in the organic acid metabolism and transport, and 58 EST-SSRs. Additionally, 85 of 822 SSR markers contributed by Syngenta Seeds were included in the integrated map. In addition, 370 QTL controlling 62 traits from 18 previously reported mapping experiments using genetically diverse parental genotypes were also integrated into the consensus map. Some QTL associated with economically important traits detected in separate studies mapped to similar genomic positions. For example, independently identified QTL controlling fruit shape were mapped on similar genomic positions, suggesting that such QTL are possibly responsible for the phenotypic variability observed for this trait in a broad array of
Reading Assessment: A Primer for Teachers and Tutors.
ERIC Educational Resources Information Center
Caldwell, JoAnne Schudt
This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…
Molecular mechanism of PD-1/PD-L1 blockade via anti-PD-L1 antibodies atezolizumab and durvalumab.
Lee, Hyun Tae; Lee, Ju Yeon; Lim, Heejin; Lee, Sang Hyung; Moon, Yu Jeong; Pyo, Hyo Jeong; Ryu, Seong Eon; Shin, Woori; Heo, Yong-Seok
2017-07-17
In 2016 and 2017, monoclonal antibodies targeting PD-L1, including atezolizumab, durvalumab, and avelumab, were approved by the FDA for the treatment of multiple advanced cancers. And many other anti-PD-L1 antibodies are under clinical trials. Recently, the crystal structures of PD-L1 in complex with BMS-936559 and avelumab have been determined, revealing details of the antigen-antibody interactions. However, it is still unknown how atezolizumab and durvalumab specifically recognize PD-L1, although this is important for investigating novel binding sites on PD-L1 targeted by other therapeutic antibodies for the design and improvement of anti-PD-L1 agents. Here, we report the crystal structures of PD-L1 in complex with atezolizumab and durvalumab to elucidate the precise epitopes involved and the structural basis for PD-1/PD-L1 blockade by these antibodies. A comprehensive comparison of PD-L1 interactions with anti-PD-L1 antibodies provides a better understanding of the mechanism of PD-L1 blockade as well as new insights into the rational design of improved anti-PD-L1 therapeutics.
PD5: a general purpose library for primer design software.
Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda
2013-01-01
Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Ulloa, Mauricio; Hulse-Kemp, Amanda M; De Santiago, Luis M; Stelly, David M; Burke, John J
2017-01-01
High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, eg, upland cotton ( Gossypium hirsutum L., "2n = 52"). Three independently developed intraspecific upland mapping populations were analyzed to generate 3 high-density genetic linkage single-nucleotide polymorphism (SNP) maps and a consensus map using the CottonSNP63K array. The populations consisted of a previously reported F 2 , a recombinant inbred line (RIL), and reciprocal RIL population, from "Phytogen 72" and "Stoneville 474" cultivars. The cluster file provided 7417 genotyped SNP markers, resulting in 26 linkage groups corresponding to the 26 chromosomes (c) of the allotetraploid upland cotton (AD) 1 arisen from the merging of 2 genomes ("A" Old World and "D" New World). Patterns of chromosome-specific recombination were largely consistent across mapping populations. The high-density genetic consensus map included 7244 SNP markers that spanned 3538 cM and comprised 3824 SNP bins, of which 1783 and 2041 were in the A t and D t subgenomes with 1825 and 1713 cM map lengths, respectively. Subgenome average distances were nearly identical, indicating that subgenomic differences in bin number arose due to the high numbers of SNPs on the D t subgenome. Examination of expected recombination frequency or crossovers (COs) on the chromosomes within each population of the 2 subgenomes revealed that COs were also not affected by the SNPs or SNP bin number in these subgenomes. Comparative alignment analyses identified historical ancestral A t -subgenomic translocations of c02 and c03, as well as of c04 and c05. The consensus map SNP sequences aligned with high congruency to the NBI assembly of Gossypium hirsutum . However, the genomic comparisons revealed evidence of additional
Status of NC Primer Demonstration & Transition
2014-11-20
Camo Paint Scheme H-53 • Six a/c selected for demonstration of Hentzen 17176KEP FRCE • Full non-chromate coating stack-up demo – Hentzen...CCC • BUNO #: #163076 #163080 #164859 11 NC Primer Demos: Camo Paint Scheme F/A-18A-D • 13 a/c selected for demonstration of PPG-Deft 02-GN... Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K
Wen, Weie; He, Zhonghu; Gao, Fengmei; Liu, Jindong; Jin, Hui; Zhai, Shengnan; Qu, Yanying; Xia, Xianchun
2017-01-01
A high-density consensus map is a powerful tool for gene mapping, cloning and molecular marker-assisted selection in wheat breeding. The objective of this study was to construct a high-density, single nucleotide polymorphism (SNP)-based consensus map of common wheat (Triticum aestivum L.) by integrating genetic maps from four recombinant inbred line populations. The populations were each genotyped using the wheat 90K Infinium iSelect SNP assay. A total of 29,692 SNP markers were mapped on 21 linkage groups corresponding to 21 hexaploid wheat chromosomes, covering 2,906.86 cM, with an overall marker density of 10.21 markers/cM. Compared with the previous maps based on the wheat 90K SNP chip detected 22,736 (76.6%) of the SNPs with consistent chromosomal locations, whereas 1,974 (6.7%) showed different chromosomal locations, and 4,982 (16.8%) were newly mapped. Alignment of the present consensus map and the wheat expressed sequence tags (ESTs) Chromosome Bin Map enabled assignment of 1,221 SNP markers to specific chromosome bins and 819 ESTs were integrated into the consensus map. The marker orders of the consensus map were validated based on physical positions on the wheat genome with Spearman rank correlation coefficients ranging from 0.69 (4D) to 0.97 (1A, 4B, 5B, and 6A), and were also confirmed by comparison with genetic position on the previously 40K SNP consensus map with Spearman rank correlation coefficients ranging from 0.84 (6D) to 0.99 (6A). Chromosomal rearrangements reported previously were confirmed in the present consensus map and new putative rearrangements were identified. In addition, an integrated consensus map was developed through the combination of five published maps with ours, containing 52,607 molecular markers. The consensus map described here provided a high-density SNP marker map and a reliable order of SNPs, representing a step forward in mapping and validation of chromosomal locations of SNPs on the wheat 90K array. Moreover, it can be
[PD-L1 expression and PD-1/PD-L1 inhibitors in breast cancer].
Monneur, Audrey; Gonçalves, Anthony; Bertucci, François
2018-03-01
The development of immune checkpoints inhibitors represents one of the major recent advances in oncology. Monoclonal antibodies directed against the programmed cell death protein 1 (PD-1) or its ligand (PD-L1) provides durable disease control, particularly in melanoma, lung, kidney, bladder and head and neck cancers. The purpose of this review is to synthesize current data on the expression of PD-L1 in breast cancer and on the preliminary clinical results of PD-1/PD-L1 inhibitors in breast cancer patients. In breast cancer, PD-L1 expression is heterogeneous and is generally associated with the presence of tumor-infiltrating lymphocytes as well as the presence of poor-prognosis factors, such as young age, high grade, ER-negativity, PR-negativity, and HER-2 overexpression, high proliferative index, and aggressive molecular subtypes (triple negative, basal-like, HER-2-overexpressing). Its prognostic value remains controversial when assessed with immunohistochemistry, whereas it seems favorable in triple-negative cancers when assessed at the mRNA level. Early clinical trials with PD-1/PD-L1 inhibitors in breast cancer have shown efficacy in terms of tumor response and/or disease control in refractory metastatic breast cancers, notably in the triple-negative subtype. Many trials are currently underway, both in the metastatic and neo-adjuvant setting. A crucial issue is identification of biomarkers predictive of response to PD-1/PD-L1 inhibitors. Copyright © 2018 Société Française du Cancer. Published by Elsevier Masson SAS. All rights reserved.
Sparse Recovery via l1 and L1 Optimization
2014-11-01
problem, with t being the descent direc- tion, obtaining ut = uxx + f − 1 µ p(u) (6) as an evolution equation. We can hope that these L1 regularized (or...implementation. He considered a wide class of second–order elliptic equations and, with Friedman [14], an extension to parabolic equa- tions. In [15, 16...obtaining an elliptic PDE, or by gradi- ent descent to obtain a parabolic PDE. Addition- ally, some PDEs can be rewritten using the L1 subgradient such as the
Rutvisuttinunt, Wiriya; Meyer, Peter R.; Scott, Walter A.
2008-01-01
Background Human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT) forms stable ternary complexes in which RT is bound tightly at fixed positions on the primer-template (P/T). We have probed downstream interactions between RT and the template strand in the complex containing the incoming dNTP (+1 dNTP•RT•P/T complex) and in the complex containing the pyrophosphate analog, foscarnet (foscarnet•RT•P/T complex). Methods and Results UV-induced cross-linking between RT and the DNA template strand was most efficient when a bromodeoxyuridine residue was placed in the +2 position (the first template position downstream from the incoming dNTP). Furthermore, formation of the +1 dNTP•RT•P/T complex on a biotin-containing template inhibited binding of streptavidin when biotin was in the +2 position on the template but not when the biotin was in the +3 position. Streptavidin pre-bound to a biotin residue in the template caused RT to stall two to three nucleotides upstream from the biotin residue. The downstream border of the complex formed by the stalled RT was mapped by digestion with exonuclease RecJF. UV-induced cross-linking of the complex formed by the pyrophosphate analog, foscarnet, with RT and P/T occurred preferentially with bromodeoxyuridine in the +1 position on the template in keeping with the location of RT one base upstream in the foscarnet•RT•P/T complex (i.e., in the pre-translocation position). Conclusions For +1 dNTP•RT•P/T and foscarnet•RT•P/T stable complexes, tight interactions were observed between RT and the first unpaired template nucleotide following the bound dNTP or the primer terminus, respectively. PMID:18974785
Uncoupling primer and releaser responses to pheromone in honey bees
NASA Astrophysics Data System (ADS)
Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.
2007-05-01
Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.
Aluminum Rich Epoxy Primer for Ground and Air Vehicles
2017-03-01
UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements
Primer on consumer marketing research : procedures, methods, and tools
DOT National Transportation Integrated Search
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Morgan, Benjamin S. T.; Egerton-Warburton, Louise M.
2017-01-01
Premise of the study: Arbuscular mycorrhizal fungi (AMF) are globally important root symbioses that enhance plant growth and nutrition and influence ecosystem structure and function. To better characterize levels of AMF diversity relevant to ecosystem function, deeper sequencing depth in environmental samples is needed. In this study, Illumina barcoded primers and a bioinformatics pipeline were developed and applied to study AMF diversity and community structure in environmental samples. Methods: Libraries of small subunit ribosomal RNA fragment amplicons were amplified from environmental DNA using a single-step PCR reaction with barcoded NS31/AML2 primers. Amplicons were sequenced on an Illumina MiSeq sequencer using version 2, 2 × 250-bp paired-end chemistry, and analyzed using QIIME and RDP Classifier. Results: Sequencing captured 196 to 6416 operational taxonomic units (OTUs; depending on clustering parameters) representing nine AMF genera. Regardless of clustering parameters, ∼20 OTUs dominated AMF communities (78–87% reads) with the remaining reads distributed among other OTUs. Analyses also showed significant biogeographic differences in AMF communities and that community composition could be linked to specific edaphic factors. Discussion: Barcoded NS31/AML2 primers and Illumina MiSeq sequencing provide a powerful approach to address AMF diversity and variations in fungal assemblages across host plants, ecosystems, and responses to environmental drivers including global change. PMID:28924511
swga: a primer design toolkit for selective whole genome amplification.
Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin
2017-07-15
Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
NASA Astrophysics Data System (ADS)
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
Hydrology of Central Florida Lakes - A Primer
Schiffer, Donna M.
1998-01-01
INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central
Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola
2017-10-01
ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
NPC1L1 and Cholesterol Transport
Betters, Jenna L.; Yu, Liqing
2010-01-01
The polytopic transmembrane protein, Niemann-Pick C1-Like 1 (NPC1L1), is enriched in the apical membrane of small intestine absorptive enterocytes where it mediates extracellular sterol transport across the brush border membrane. It is essential for intestinal sterol absorption and is the molecular target of ezetimibe, a potent cholesterol absorption inhibitor that lowers blood cholesterol in humans. NPC1L1 is also highly expressed in human liver. The hepatic function of NPC1L1 may be to limit excessive biliary cholesterol loss. NPC1L1-dependent sterol uptake seems to be a clathrin-mediated endocytic process and is regulated by cellular cholesterol content. Recently, NPC1L1 inhibition has been shown to have beneficial effects on components of the metabolic syndrome, such as obesity, insulin resistance, fatty liver, in addition to atherosclerosis. PMID:20307540
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Brulé, Fabienne; Marquet, Roland; Rong, Liwei; Wainberg, Mark A; Roques, Bernard P; Le Grice, Stuart F J; Ehresmann, Bernard; Ehresmann, Chantal
2002-01-01
The conversion of the single-stranded RNA genome into double-stranded DNA by virus-coded reverse transcriptase (RT) is an essential step of the retrovirus life cycle. In human immunodeficiency virus type 1 (HIV-1), RT uses the cellular tRNA(Lys)3 to initiate the (-) strand DNA synthesis. Placement of the primer tRNA(Lys)3 involves binding of its 3'-terminal 18 nt to a complementary region of genomic RNA termed PBS. However, the PBS sequence is not the unique determinant of primer usage and additional contacts are important. This placement is believed to be achieved in vivo by the nucleocapsid domain of Gag or by the mature protein NCp. Up to now, structural information essentially arose from heat-annealed primer-template complexes (Isel et al., J Mol Biol, 1995, 247:236-250; Isel et al., EMBO J, 1999, 18:1038-1048). Here, we investigated the formation of the primer-template complex mediated by NCp and compared structural and functional properties of heat- and NCp-annealed complexes. We showed that both heat- and NCp-mediated procedures allow comparable high yields of annealing. Then, we investigated structural features of both kinds of complexes by enzymatic probing, and we compared their relative efficiency in (-) strong stop DNA synthesis. We did not find any significant differences between these complexes, suggesting that information derived from the heat-annealed complex can be transposed to the NCp-mediated complex and most likely to complexes formed in vivo. PMID:11873759
Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun
2015-12-03
Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Assessing the Nation's Literacy: A State Policy Primer.
ERIC Educational Resources Information Center
National Governors' Association, Washington, DC.
This primer is designed to provide a step-by-step guide for state policymakers and state agency officials interested in assessing the literacy skills of the people of their state. Chapter 1 describes the importance of assessing the literacy skills in each state. Literacy is discussed as an economic necessity, a requirement for a healthy democracy,…
Integrating Meaning and Structure in L1-L2 and L2-L1 Translations
ERIC Educational Resources Information Center
Lim, Jung Hyun; Christianson, Kiel
2013-01-01
This article examined the integration of semantic and morphosyntactic information by Korean learners of English as a second language (L2). In Experiment 1, L2 learners listened to English active or passive sentences that were either plausible or implausible and translated them into Korean. A significant number of Korean translations maintained the…
L1 and L2 Distance Effects in Learning L3 Dutch
ERIC Educational Resources Information Center
Schepens, Job J.; der Slik, Frans; Hout, Roeland
2016-01-01
Many people speak more than two languages. How do languages acquired earlier affect the learnability of additional languages? We show that linguistic distances between speakers' first (L1) and second (L2) languages and their third (L3) language play a role. Larger distances from the L1 to the L3 and from the L2 to the L3 correlate with lower…
Processing of English Focal Stress by L1-English and L1-Mandarin/L2-English Speakers
ERIC Educational Resources Information Center
Guigelaar, Ellen R.
2017-01-01
Late second language (L2) learners often struggle with L2 prosody, both in perception and production. This may result from first language (L1) interference or some property of how a second language functions in a late learner independent of what their L1 might be. Here we investigate prosody's role in determining information structure through…
Polisher (conflicting versions 2.0.8 on IM Form, 1.0 on abstract)
DOE Office of Scientific and Technical Information (OSTI.GOV)
2008-09-18
Polisher is a software package designed to facilitate the error correction of an assembled genome using Illumia read data. The software addresses substandard regions by automatically correcting consensus errors and/or suggesting primer walking reactions to improve the quality of the bases. This is done by performing the following:...........
Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii
Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon
2005-01-01
Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482
Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.
2013-11-20
Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less
Kuol, Nyanbol; Stojanovska, Lily; Nurgali, Kulmira; Apostolopoulos, Vasso
2018-02-01
Expression of PD-1 on T/B cells regulates peripheral tolerance and autoimmunity. Binding of PD-1 to its ligand, PD-L1, leads to protection against self-reactivity. In contrary, tumor cells have evolved immune escape mechanisms whereby overexpression of PD-L1 induces anergy and/or apoptosis of PD-1 positive T cells by interfering with T cell receptor signal transduction. PD-L1 and PD-1 blockade using antibodies are in human clinical trials as an alternative cancer treatment modality. Areas covered: We describe the role of PD-1/PD-L1 in disease in the context of autoimmunity, neurological disorders, stroke and cancer. For immunotherapy/vaccines to be successful, the expression of PD-L1/PD-1 on immune cells should be considered, and the combination of checkpoint inhibitors and vaccines may pave the way for successful outcomes to disease.
ERIC Educational Resources Information Center
Poster, John B.
Dynamics in the education policy arena suggest that, despite two generations of researchers extolling democratic leadership styles and consensus building over autocratic techniques, wide participation in policymaking and the broadest possible consensus are not always productive: American society has not yet agreed on what schools should…
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
de Groot, G. Arjen; During, Heinjo J.; Maas, Jan W.; Schneider, Harald; Vogel, Johannes C.; Erkens, Roy H. J.
2011-01-01
Although consensus has now been reached on a general two-locus DNA barcode for land plants, the selected combination of markers (rbcL + matK) is not applicable for ferns at the moment. Yet especially for ferns, DNA barcoding is potentially of great value since fern gametophytes—while playing an essential role in fern colonization and reproduction—generally lack the morphological complexity for morphology-based identification and have therefore been underappreciated in ecological studies. We evaluated the potential of a combination of rbcL with a noncoding plastid marker, trnL-F, to obtain DNA-identifications for fern species. A regional approach was adopted, by creating a reference database of trusted rbcL and trnL-F sequences for the wild-occurring homosporous ferns of NW-Europe. A combination of parsimony analyses and distance-based analyses was performed to evaluate the discriminatory power of the two-region barcode. DNA was successfully extracted from 86 tiny fern gametophytes and was used as a test case for the performance of DNA-based identification. Primer universality proved high for both markers. Based on the combined rbcL + trnL-F dataset, all genera as well as all species with non-equal chloroplast genomes formed their own well supported monophyletic clade, indicating a high discriminatory power. Interspecific distances were larger than intraspecific distances for all tested taxa. Identification tests on gametophytes showed a comparable result. All test samples could be identified to genus level, species identification was well possible unless they belonged to a pair of Dryopteris species with completely identical chloroplast genomes. Our results suggest a high potential of the combined use of rbcL and trnL-F as a two-locus cpDNA barcode for identification of fern species. A regional approach may be preferred for ecological tests. We here offer such a ready-to-use barcoding approach for ferns, which opens the way for answering a whole range of
Tank, David C.
2016-01-01
Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929
Selected Transportation Topics : Energy Primer
DOT National Transportation Integrated Search
1975-01-01
Energy involved in transportation has become a critical consideration in recent years. This primer contains ten representative articles of those resulting from government reports, conference papers, etc., on what the current energy situation is, and ...
Sechi, Leonardo A.; Zanetti, Stefania; Dupré, Ilaria; Delogu, Giovanni; Fadda, Giovanni
1998-01-01
The presence of enterobacterial repetitive intergenic consensus (ERIC) sequences was demonstrated for the first time in the genome of Mycobacterium tuberculosis; these sequences have been found in transcribed regions of the chromosomes of gram-negative bacteria. In this study genetic diversity among clinical isolates of M. tuberculosis was determined by PCR with ERIC primers (ERIC-PCR). The study isolates comprised 71 clinical isolates collected from Sardinia, Italy. ERIC-PCR was able to identify 59 distinct profiles. The results obtained were compared with IS6110 and PCR-GTG fingerprinting. We found that the level of differentiation obtained by ERIC-PCR is greater than that obtained by IS6110 fingerprinting and comparable to that obtained by PCR-GTG. This method of fingerprinting is rapid and sensitive and can be applied to the study of the epidemiology of M. tuberculosis infections, especially when IS6110 fingerprinting is not of any help. PMID:9431935
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology
Dixon, George P.; Martin, Joe A.; Thompson, Don
1998-01-01
A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.
Baggenstoss, Bruce A; Washburn, Jennifer L
2017-01-01
Abstract Class I hyaluronan synthases (HAS) assemble [GlcNAc(β1,4)GlcUA(β1,3)]n-UDP at the reducing end and also make chitin. Streptococcus equisimilis HAS (SeHAS) also synthesizes chitin-UDP oligosaccharides, (GlcNAc-β1,4)n-GlcNAc(α1→)UDP (Weigel et al. 2015). Here we determined if HAS uses chitin-UDPs as primers to initiate HA synthesis, leaving the non-HA primer at the nonreducing (NR) end. HA made by SeHAS membranes was purified, digested with streptomyces lyase, and hydrophobic oligomers were enriched by solid phase extraction and analyzed by MALDI-TOF MS. Jack bean hexosaminidase (JBH) and MS/MS were used to analyze 19 m/z species of possible GnHn ions with clustered GlcNAc (G) residues attached to disaccharide units (H): (GlcNAcβ1,4)2–5[GlcUA(β1,3)GlcNAc]2–6. JBH digestion sequentially removed GlcNAc from the NR-end of GnHn oligomers, producing successively smaller GnH2–3 series members. Since lyase releases dehydro-oligos (dHn; M−18), only the unique NR-end oligo lacks dehydro-GlcUA. Hn oligomers were undetectable in lyase digests, whereas JBH treatment created new H2–6m/z peaks (i.e. HA tetra- through dodeca-oligomers). MS/MS of larger GnHn species produced chitin (2–5 GlcNAcs), HA oligomers and multiple smaller series members with fewer GlcNAcs. All NR-ends (97%) started with GlcNAc, as a chitin trimer (three GlcNAcs), indicating that GlcNAc(β1,4)2GlcNAc(α1→)-UDP may be optimal for initiation of HA synthesis. Also, HA made by live S. pyogenes cells had G4Hn chitin-oligo NR-ends. We conclude that chitin-UDP functions in vitro and in live cells as a primer to initiate synthesis of all HA chains and these primers remain at the NR-ends of HA chains as residual chitin caps [(GlcNAc-β1,4)3–4]. PMID:28138013
Weigel, Paul H; Baggenstoss, Bruce A; Washburn, Jennifer L
2017-06-01
Class I hyaluronan synthases (HAS) assemble [GlcNAc(β1,4)GlcUA(β1,3)]n-UDP at the reducing end and also make chitin. Streptococcus equisimilis HAS (SeHAS) also synthesizes chitin-UDP oligosaccharides, (GlcNAc-β1,4)n-GlcNAc(α1→)UDP (Weigel et al. 2015). Here we determined if HAS uses chitin-UDPs as primers to initiate HA synthesis, leaving the non-HA primer at the nonreducing (NR) end. HA made by SeHAS membranes was purified, digested with streptomyces lyase, and hydrophobic oligomers were enriched by solid phase extraction and analyzed by MALDI-TOF MS. Jack bean hexosaminidase (JBH) and MS/MS were used to analyze 19 m/z species of possible GnHn ions with clustered GlcNAc (G) residues attached to disaccharide units (H): (GlcNAcβ1,4)2-5[GlcUA(β1,3)GlcNAc]2-6. JBH digestion sequentially removed GlcNAc from the NR-end of GnHn oligomers, producing successively smaller GnH2-3 series members. Since lyase releases dehydro-oligos (dHn; M-18), only the unique NR-end oligo lacks dehydro-GlcUA. Hn oligomers were undetectable in lyase digests, whereas JBH treatment created new H2-6m/z peaks (i.e. HA tetra- through dodeca-oligomers). MS/MS of larger GnHn species produced chitin (2-5 GlcNAcs), HA oligomers and multiple smaller series members with fewer GlcNAcs. All NR-ends (97%) started with GlcNAc, as a chitin trimer (three GlcNAcs), indicating that GlcNAc(β1,4)2GlcNAc(α1→)-UDP may be optimal for initiation of HA synthesis. Also, HA made by live S. pyogenes cells had G4Hn chitin-oligo NR-ends. We conclude that chitin-UDP functions in vitro and in live cells as a primer to initiate synthesis of all HA chains and these primers remain at the NR-ends of HA chains as residual chitin caps [(GlcNAc-β1,4)3-4]. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
White primer permits a corrosion-resistant coating of minimum weight
NASA Technical Reports Server (NTRS)
Albrecht, R. H.; Jensen, D. P.; Schnake, P.
1966-01-01
White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Nanotechnology: A Policy Primer
2013-06-24
National Science Foundation (NSF), Department of Energy (DOE), National Aeronautics and Space Administration ( NASA ), Department of Commerce (DOC...and Extension Service, Department of Agriculture ( USDA ); (continued...) Nanotechnology: A Policy Primer Congressional Research Service 6 NSET...State; Department of Transportation; Department of the Treasury; EPA; Food and Drug Administration; Forest Service, USDA ; Intelligence Technology
TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rearden, Bradley T; Mueller, Don; Bowman, Stephen M
2009-01-01
This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity andmore » uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.« less
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Identification of consensus biomarkers for predicting non-genotoxic hepatocarcinogens
Huang, Shan-Han; Tung, Chun-Wei
2017-01-01
The assessment of non-genotoxic hepatocarcinogens (NGHCs) is currently relying on two-year rodent bioassays. Toxicogenomics biomarkers provide a potential alternative method for the prioritization of NGHCs that could be useful for risk assessment. However, previous studies using inconsistently classified chemicals as the training set and a single microarray dataset concluded no consensus biomarkers. In this study, 4 consensus biomarkers of A2m, Ca3, Cxcl1, and Cyp8b1 were identified from four large-scale microarray datasets of the one-day single maximum tolerated dose and a large set of chemicals without inconsistent classifications. Machine learning techniques were subsequently applied to develop prediction models for NGHCs. The final bagging decision tree models were constructed with an average AUC performance of 0.803 for an independent test. A set of 16 chemicals with controversial classifications were reclassified according to the consensus biomarkers. The developed prediction models and identified consensus biomarkers are expected to be potential alternative methods for prioritization of NGHCs for further experimental validation. PMID:28117354
Congestion pricing : a primer : overview
DOT National Transportation Integrated Search
2008-10-01
This Overview primer was produced to explain the concept of congestion pricing and its benefits, to present examples of congestion-pricing approaches implemented in the United States and abroad, and to briefly discuss federal-aid policy and programs ...
A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR
Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven
2016-01-01
Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and
Sprung, Charles L; Truog, Robert D; Curtis, J Randall; Joynt, Gavin M; Baras, Mario; Michalsen, Andrej; Briegel, Josef; Kesecioglu, Jozef; Efferen, Linda; De Robertis, Edoardo; Bulpa, Pierre; Metnitz, Philipp; Patil, Namrata; Hawryluck, Laura; Manthous, Constantine; Moreno, Rui; Leonard, Sara; Hill, Nicholas S; Wennberg, Elisabet; McDermid, Robert C; Mikstacki, Adam; Mularski, Richard A; Hartog, Christiane S; Avidan, Alexander
2014-10-15
Great differences in end-of-life practices in treating the critically ill around the world warrant agreement regarding the major ethical principles. This analysis determines the extent of worldwide consensus for end-of-life practices, delineates where there is and is not consensus, and analyzes reasons for lack of consensus. Critical care societies worldwide were invited to participate. Country coordinators were identified and draft statements were developed for major end-of-life issues and translated into six languages. Multidisciplinary responses using a web-based survey assessed agreement or disagreement with definitions and statements linked to anonymous demographic information. Consensus was prospectively defined as >80% agreement. Definitions and statements not obtaining consensus were revised based on comments of respondents, and then translated and redistributed. Of the initial 1,283 responses from 32 countries, consensus was found for 66 (81%) of the 81 definitions and statements; 26 (32%) had >90% agreement. With 83 additional responses to the original questionnaire (1,366 total) and 604 responses to the revised statements, consensus could be obtained for another 11 of the 15 statements. Consensus was obtained for informed consent, withholding and withdrawing life-sustaining treatment, legal requirements, intensive care unit therapies, cardiopulmonary resuscitation, shared decision making, medical and nursing consensus, brain death, and palliative care. Consensus was obtained for 77 of 81 (95%) statements. Worldwide consensus could be developed for the majority of definitions and statements about end-of-life practices. Statements achieving consensus provide standards of practice for end-of-life care; statements without consensus identify important areas for future research.
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P
1984-01-01
Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344
Consensus on current management of endometriosis.
Johnson, Neil P; Hummelshoj, Lone
2013-06-01
Is there a global consensus on the management of endometriosis that considers the views of women with endometriosis? It was possible to produce an international consensus statement on the current management of endometriosis through engagement of representatives of national and international, medical and non-medical societies with an interest in endometriosis. Management of endometriosis anywhere in the world has been based partially on evidence-based practices and partially on unsubstantiated therapies and approaches. Several guidelines have been developed by a number of national and international bodies, yet areas of controversy and uncertainty remain, not least due to a paucity of firm evidence. A consensus meeting, in conjunction with a pre- and post-meeting process, was undertaken. A consensus meeting was held on 8 September 2011, in conjunction with the 11th World Congress on Endometriosis in Montpellier, France. A rigorous pre- and post-meeting process, involving 56 representatives of 34 national and international, medical and non-medical organizations from a range of disciplines, led to this consensus statement. A total of 69 consensus statements were developed. Seven statements had unanimous consensus; however, none of the statements were made without expression of a caveat about the strength of the statement or the statement itself. Only two statements failed to achieve majority consensus. The statements covered global considerations, the role of endometriosis organizations, support groups, centres or networks of expertise, the impact of endometriosis throughout a woman's life course, and a full range of treatment options for pain, infertility and other symptoms related to endometriosis. This consensus process differed from that of formal guideline development. A different group of international experts from those participating in this process would likely have yielded subtly different consensus statements. This is the first time that a large, global
Public Participation Guide: Consensus Workshops
A consensus conference is a type of public meeting that allows stakeholders to be involved in assessing an issue or proposal and working together to find common ground and deliver consensus-based input.
Multi-Optimisation Consensus Clustering
NASA Astrophysics Data System (ADS)
Li, Jian; Swift, Stephen; Liu, Xiaohui
Ensemble Clustering has been developed to provide an alternative way of obtaining more stable and accurate clustering results. It aims to avoid the biases of individual clustering algorithms. However, it is still a challenge to develop an efficient and robust method for Ensemble Clustering. Based on an existing ensemble clustering method, Consensus Clustering (CC), this paper introduces an advanced Consensus Clustering algorithm called Multi-Optimisation Consensus Clustering (MOCC), which utilises an optimised Agreement Separation criterion and a Multi-Optimisation framework to improve the performance of CC. Fifteen different data sets are used for evaluating the performance of MOCC. The results reveal that MOCC can generate more accurate clustering results than the original CC algorithm.
NASA Astrophysics Data System (ADS)
Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.
2017-08-01
The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.
Unit-length line-1 transcripts in human teratocarcinoma cells.
Skowronski, J; Fanning, T G; Singer, M F
1988-01-01
We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389
Do L2 Writing Courses Affect the Improvement of L1 Writing Skills via Skills Transfer from L2 to L1?
ERIC Educational Resources Information Center
Gonca, Altmisdort
2016-01-01
This study investigates the relationship of second language (L2) writing skills proficiency with the first language (L1) writing skills, in light of the language transfer. The study aims to analyze the positive effects of L2 writing proficiency on L1 writing proficiency. Forty native Turkish-speaking university students participated in the study.…
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
Kidney, B A; Haines, D M; Ellis, J A; Burnham, M L; Teifke, J P; Czerwinski, G; Jackson, M L
2001-06-01
To determine whether vaccine site-associated sarcomas (VSS) from cats contain papillomavirus antigen or DNA. 50 formalin-fixed paraffin-embedded tissue blocks of VSS from cats. Sections from each tissue block were evaluated for papillomavirus antigen by use of an avidin-biotin-complex immunohistochemical staining method, using rabbit anti-bovine papillomavirus type-1 antibody. The DNA was extracted from sections of each tissue block, and polymerase chain reaction assays were performed, using primers designed to amplify regions of the E5 gene of bovine papillomavirus and consensus primers designed to amplify a region of the L1 gene of animal papillomaviruses. Sections from 20 of the tissue blocks were evaluated by use of nonradioactive in situ hybridization for bovine papillomavirus DNA. Papillomavirus antigen and DNA were not detected in any of the VSS. Results suggest that papillomaviruses likely do not have any direct involvement in the pathogenesis of VSS in cats.
Calais, Jeremie; Czernin, Johannes; Cao, Minsong; Kishan, Amar U; Hegde, John V; Shaverdian, Narek; Sandler, Kiri; Chu, Fang-I; King, Chris R; Steinberg, Michael L; Rauscher, Isabel; Schmidt-Hegemann, Nina-Sophie; Poeppel, Thorsten; Hetkamp, Philipp; Ceci, Francesco; Herrmann, Ken; Fendler, Wolfgang P; Eiber, Matthias; Nickols, Nicholas G
2018-02-01
Target volume delineations for prostate cancer (PCa) salvage radiotherapy (SRT) after radical prostatectomy are usually drawn in the absence of visibly recurrent disease. 68 Ga-labeled prostate-specific membrane antigen (PSMA-11) PET/CT detects recurrent PCa with sensitivity superior to standard-of-care imaging at serum prostate-specific antigen (PSA) values low enough to affect target volume delineations for routine SRT. Our objective was to map the recurrence pattern of PCa early biochemical recurrence (BCR) after radical prostatectomy with 68 Ga-PSMA-11 PET/CT in patients with serum PSA levels of less than 1 ng/mL, determine how often consensus clinical target volumes (CTVs) based on the Radiation Therapy Oncology Group (RTOG) guidelines cover 68 Ga-PSMA-11 PET/CT-defined disease, and assess the potential impact of 68 Ga-PSMA-11 PET/CT on SRT. Methods: This was a post hoc analysis of an intention-to-treat population of 270 patients who underwent 68 Ga-PSMA-11 PET/CT at 4 institutions for BCR after prostatectomy without prior radiotherapy at a PSA level of less than 1 ng/mL. RTOG consensus CTVs that included both the prostate bed and the pelvic lymph nodes were contoured on the CT dataset of the PET/CT image by a radiation oncologist masked to the PET component. 68 Ga-PSMA-11 PET/CT images were analyzed by a nuclear medicine physician. 68 Ga-PSMA-11-positive lesions not covered by planning volumes based on the consensus CTVs were considered to have a potential major impact on treatment planning. Results: The median PSA level at the time of 68 Ga-PSMA-11 PET/CT was 0.48 ng/mL (range, 0.03-1 ng/mL). One hundred thirty-two of 270 patients (49%) had a positive 68 Ga-PSMA-11 PET/CT result. Fifty-two of 270 (19%) had at least one PSMA-11-positive lesion not covered by the consensus CTVs. Thirty-three of 270 (12%) had extrapelvic PSMA-11-positive lesions, and 19 of 270 (7%) had PSMA-11-positive lesions within the pelvis but not covered by the consensus CTVs. The 2 most
Primer and platform effects on 16S rRNA tag sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien; Singh, Kanwar; Fern, Alison
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Primer and platform effects on 16S rRNA tag sequencing
Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...
2015-08-04
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
,
1992-01-01
substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.
Quantitative Assessment of the Heterogeneity of PD-L1 Expression in Non-Small-Cell Lung Cancer.
McLaughlin, Joseph; Han, Gang; Schalper, Kurt A; Carvajal-Hausdorf, Daniel; Pelekanou, Vasiliki; Rehman, Jamaal; Velcheti, Vamsidhar; Herbst, Roy; LoRusso, Patricia; Rimm, David L
2016-01-01
Early-phase trials with monoclonal antibodies targeting PD-1 (programmed cell death protein 1) and PD-L1 (programmed cell death 1 ligand 1) have demonstrated durable clinical responses in patients with non-small-cell lung cancer (NSCLC). However, current assays for the prognostic and/or predictive role of tumor PD-L1 expression are not standardized with respect to either quantity or distribution of expression. To demonstrate PD-L1 protein distribution in NSCLC tumors using both conventional immunohistochemistry (IHC) and quantitative immunofluorescence (QIF) and compare results obtained using 2 different PD-L1 antibodies. PD-L1 was measured using E1L3N and SP142, 2 rabbit monoclonal antibodies, in 49 NSCLC whole-tissue sections and a corresponding tissue microarray with the same 49 cases. Non-small-cell lung cancer biopsy specimens from 2011 to 2012 were collected retrospectively from the Yale Thoracic Oncology Program Tissue Bank. Human melanoma Mel 624 cells stably transfected with PD-L1 as well as Mel 624 parental cells, and human term placenta whole tissue sections were used as controls and for antibody validation. PD-L1 protein expression in tumor and stroma was assessed using chromogenic IHC and the AQUA (Automated Quantitative Analysis) method of QIF. Tumor-infiltrating lymphocytes (TILs) were scored in hematoxylin-eosin slides using current consensus guidelines. The association between PD-L1 protein expression, TILs, and clinicopathological features were determined. PD-L1 expression discordance or heterogeneity using the diaminobenzidine chromogen and QIF was the main outcome measure selected prior to performing the study. Using chromogenic IHC, both antibodies showed fair to poor concordance. The PD-L1 antibodies showed poor concordance (Cohen κ range, 0.124-0.340) using conventional chromogenic IHC and showed intra-assay heterogeneity (E1L3N coefficient of variation [CV], 6.75%-75.24%; SP142 CV, 12.17%-109.61%) and significant interassay discordance
Chemical and mechanical aspects of HMR primer in relationship to wood bonding
Alfred W. Christiansen
2005-01-01
The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
Mioduchowska, Monika; Czyż, Michał Jan; Gołdyn, Bartłomiej; Kur, Jarosław; Sell, Jerzy
2018-01-01
The cytochrome c oxidase subunit I (cox1) gene is the main mitochondrial molecular marker playing a pivotal role in phylogenetic research and is a crucial barcode sequence. Folmer's "universal" primers designed to amplify this gene in metazoan invertebrates allowed quick and easy barcode and phylogenetic analysis. On the other hand, the increase in the number of studies on barcoding leads to more frequent publishing of incorrect sequences, due to amplification of non-target taxa, and insufficient analysis of the obtained sequences. Consequently, some sequences deposited in genetic databases are incorrectly described as obtained from invertebrates, while being in fact bacterial sequences. In our study, in which we used Folmer's primers to amplify COI sequences of the crustacean fairy shrimp Branchipus schaefferi (Fischer 1834), we also obtained COI sequences of microbial contaminants from Aeromonas sp. However, when we searched the GenBank database for sequences closely matching these contaminations we found entries described as representatives of Gastrotricha and Mollusca. When these entries were compared with other sequences bearing the same names in the database, the genetic distance between the incorrect and correct sequences amplified from the same species was c.a. 65%. Although the responsibility for the correct molecular identification of species rests on researchers, the errors found in already published sequences data have not been re-evaluated so far. On the basis of the standard sampling technique we have estimated with 95% probability that the chances of finding incorrectly described metazoan sequences in the GenBank depend on the systematic group, and variety from less than 1% (Mollusca and Arthropoda) up to 6.9% (Gastrotricha). Consequently, the increasing popularity of DNA barcoding and metabarcoding analysis may lead to overestimation of species diversity. Finally, the study also discusses the sources of the problems with amplification of non
Definition of a COPD self-management intervention: International Expert Group consensus.
Effing, Tanja W; Vercoulen, Jan H; Bourbeau, Jean; Trappenburg, Jaap; Lenferink, Anke; Cafarella, Paul; Coultas, David; Meek, Paula; van der Valk, Paul; Bischoff, Erik W M A; Bucknall, Christine; Dewan, Naresh A; Early, Frances; Fan, Vincent; Frith, Peter; Janssen, Daisy J A; Mitchell, Katy; Morgan, Mike; Nici, Linda; Patel, Irem; Walters, Haydn; Rice, Kathryn L; Singh, Sally; Zuwallack, Richard; Benzo, Roberto; Goldstein, Roger; Partridge, Martyn R; van der Palen, Job
2016-07-01
There is an urgent need for consensus on what defines a chronic obstructive pulmonary disease (COPD) self-management intervention. We aimed to obtain consensus regarding the conceptual definition of a COPD self-management intervention by engaging an international panel of COPD self-management experts using Delphi technique features and an additional group meeting.In each consensus round the experts were asked to provide feedback on the proposed definition and to score their level of agreement (1=totally disagree; 5=totally agree). The information provided was used to modify the definition for the next consensus round. Thematic analysis was used for free text responses and descriptive statistics were used for agreement scores.In total, 28 experts participated. The consensus round response rate varied randomly over the five rounds (ranging from 48% (n=13) to 85% (n=23)), and mean definition agreement scores increased from 3.8 (round 1) to 4.8 (round 5) with an increasing percentage of experts allocating the highest score of 5 (round 1: 14% (n=3); round 5: 83% (n=19)).In this study we reached consensus regarding a conceptual definition of what should be a COPD self-management intervention, clarifying the requisites for such an intervention. Operationalisation of this conceptual definition in the near future will be an essential next step. The content of this work is not subject to copyright. Design and branding are copyright ©ERS 2016.
Carter, Laura L; Leach, Michael W; Azoitei, Mihai L; Cui, Junqing; Pelker, Jeffrey W; Jussif, Jason; Benoit, Steve; Ireland, Gretchen; Luxenberg, Deborah; Askew, G Roger; Milarski, Kim L; Groves, Christopher; Brown, Tom; Carito, Brenda A; Percival, Karen; Carreno, Beatriz M; Collins, Mary; Marusic, Suzana
2007-01-01
Interactions between PD-1 and its two differentially expressed ligands, PD-L1 and PD-L2, attenuate T cell activation and effector function. To determine the role of these molecules in autoimmune disease of the CNS, PD-1-/-, PD-L1-/- and PD-L2-/- mice were generated and immunized to induce experimental autoimmune encephalomyelitis (EAE). PD-1-/- and PD-L1-/- mice developed more severe EAE than wild type and PD-L2-/- mice. Consistent with this, PD-1-/- and PD-L1-/- cells produced elevated levels of the pro-inflammatory cytokines IFN-gamma, TNF, IL-6 and IL-17. These results demonstrate that interactions between PD-1/PD-L1, but not PD-1/PDL-2, are crucial in attenuating T cell responses in EAE.
Democracy-based consensus in medicine.
Greco, Massimiliano; Zangrillo, Alberto; Mucchetti, Marta; Nobile, Leda; Landoni, Paolo; Bellomo, Rinaldo; Landoni, Giovanni
2015-04-01
High-quality evidence and derived guidelines, as typically published in major academic journals, are a major process that shapes physician decision-making worldwide. However, for many aspects of medical practice, there is a lack of High-quality evidence or an overload of somewhat contradictory low-quality information, which makes decision-making a difficult, uncertain, and unpredictable process. When the issues in question are important and evidence limited or controversial, the medical community seeks to establish common ground for "best practice" through consensus conferences and consensus statements or guidelines. Such consensus statements are seen as a useful tool to establish expert agreement, define the boundaries of acceptable practice, provide priorities for the research agenda, and obtain opinions from different countries and healthcare systems. This standard approach, however, can be criticized for being elitist, noninclusive, and poorly representative of the community of clinicians who will have to make decisions about the implementation of such recommendations. Accordingly, the authors propose a new model based on a combination of a local core meeting (detailed review and expert input) followed by a worldwide web-based network assessment (democracy-based consensus). The authors already have applied this approach to develop consensus on all nonsurgical interventions that increase or reduce perioperative mortality in critically ill patients and in those with acute kidney injury. The methodology was based on 5 sequential local and web-based steps. Both a panel of experts and a large number of professionals from all over the world were involved, giving birth to a new type of "democracy-based consensus." This new type of "democracy-based consensus" has the potential to increase grass-root clinician involvement, expand the reach to less-developed countries, provide a more global perspective on proposed interventions, and perhaps more importantly, increase
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L
2005-01-01
We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain
Kyoto global consensus report on Helicobacter pylori gastritis
Sugano, Kentaro; Tack, Jan; Kuipers, Ernst J; Graham, David Y; El-Omar, Emad M; Miura, Soichiro; Haruma, Ken; Asaka, Masahiro; Uemura, Naomi; Malfertheiner, Peter
2015-01-01
Objective To present results of the Kyoto Global Consensus Meeting, which was convened to develop global consensus on (1) classification of chronic gastritis and duodenitis, (2) clinical distinction of dyspepsia caused by Helicobacter pylori from functional dyspepsia, (3) appropriate diagnostic assessment of gastritis and (4) when, whom and how to treat H. pylori gastritis. Design Twenty-three clinical questions addressing the above-mentioned four domains were drafted for which expert panels were asked to formulate relevant statements. A Delphi method using an anonymous electronic system was adopted to develop the consensus, the level of which was predefined as ≥80%. Final modifications of clinical questions and consensus were achieved at the face-to-face meeting in Kyoto. Results All 24 statements for 22 clinical questions after extensive modifications and omission of one clinical question were achieved with a consensus level of >80%. To better organise classification of gastritis and duodenitis based on aetiology, a new classification of gastritis and duodenitis is recommended for the 11th international classification. A new category of H. pylori-associated dyspepsia together with a diagnostic algorithm was proposed. The adoption of grading systems for gastric cancer risk stratification, and modern image-enhancing endoscopy for the diagnosis of gastritis, were recommended. Treatment to eradicate H. pylori infection before preneoplastic changes develop, if feasible, was recommended to minimise the risk of more serious complications of the infection. Conclusions A global consensus for gastritis was developed for the first time, which will be the basis for an international classification system and for further research on the subject. PMID:26187502
Do L1 Reading Achievement and L1 Print Exposure Contribute to the Prediction of L2 Proficiency?
ERIC Educational Resources Information Center
Sparks, Richard L.; Patton, Jon; Ganschow, Leonore; Humbach, Nancy
2012-01-01
The study examined whether individual differences in high school first language (L1) reading achievement and print exposure would account for unique variance in second language (L2) written (word decoding, spelling, writing, reading comprehension) and oral (listening/speaking) proficiency after adjusting for the effects of early L1 literacy and…
García Merino, A; Ramón Ara Callizo, J; Fernández Fernández, O; Landete Pascual, L; Moral Torres, E; Rodríguez-Antigüedad Zarrantz, A
2017-03-01
With the advent of new disease-modifying drugs, the treatment of multiple sclerosis is becoming increasingly complex. Using consensus statements is therefore advisable. The present consensus statement, which was drawn up by the Spanish Society of Neurology's study group for demyelinating diseases, updates previous consensus statements on the disease. The present study lists the medications currently approved for multiple sclerosis and their official indications, and analyses such treatment-related aspects as activity, early treatment, maintenance, follow-up, treatment failure, changes in medication, and special therapeutic situations. This consensus statement includes treatment recommendations for a wide range of demyelinating diseases, from isolated demyelinating syndromes to the different forms of multiple sclerosis, as well as recommendations for initial therapy and changes in drug medication, and additional comments on induction and combined therapy and practical aspects of the use of these drugs. Copyright © 2016 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.
Development of a Nonchromate Structural Adhesive Bond Primer
2014-11-01
with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE NOV 2014 2. REPORT TYPE 3. DATES...Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non-inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate
Hatamleh, Muhanad M; Watts, David C
2011-02-01
To evaluate the effect of three commonly used bond primers on the bending strength of glass fibers and their bond strength to maxillofacial silicone elastomer after 360 hours of accelerated daylight aging. Eighty specimens were fabricated by embedding resin-impregnated fiber bundles (1.5-mm diameter, 20-mm long) into maxillofacial silicone elastomer M511 (Cosmesil). Twenty fiber bundles served as control and did not receive surface treatment with primers, whereas the remaining 60 fibers were treated with three primers (n = 20): G611 (Principality Medical), A-304 (Factor II), and A-330-Gold (Factor II). Forty specimens were dry stored at room temperature (23 ± 1°C) for 24 hours, and the remaining specimens were aged using an environmental chamber under accelerated exposure to artificial daylight for 360 hours. The aging cycle included continuous exposure to quartz-filtered visible daylight (irradiance 760 W/m(2) ) under an alternating weathering cycle (wet for 18 minutes, dry for 102 minutes). Pull-out tests were performed to evaluate bond strength between fiber bundles and silicone using a universal testing machine at 1 mm/min crosshead speed. A 3-point bending test was performed to evaluate the bending strength of the fiber bundles. One-way Analysis of Variance (ANOVA), Bonferroni post hoc test, and an independent t-test were carried out to detect statistical significances (p < 0.05). Mean (SD) values of maximum pull-out forces (N) before aging for groups: no primer, G611, A-304, A-330-G were: 13.63 (7.45), 20.44 (2.99), 22.06 (6.69), and 57.91 (10.15), respectively. All primers increased bond strength in comparison to control specimens (p < 0.05). Primer A-330-G showed the greatest increase among all primers (p < 0.05); however, bonding degraded after aging (p < 0.05), and pull-out forces were 13.58 (2.61), 6.17 (2.89), 6.95 (2.61), and 11.72 (3.03). Maximum bending strengths of fiber bundles at baseline increased after treatment with primers and light aging in
L1 to Teach L2: Complexities and Contradictions
ERIC Educational Resources Information Center
Copland, Fiona; Neokleous, Georgios
2011-01-01
This article uncovers the complexities and contradictions inherent in making decisions about L1 use in the English language classroom. Through an analysis of data from classrooms in a Cypriot context and from interviews with Cypriot teachers, a number of functions for L1 use are identified, as are the teachers' rationales for using L1 for…
Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R
2004-12-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Use of tannin anticorrosive reaction primer to improve traditional coating systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matamala, G.; Droguett, G.; Smeltzer, W.
1994-04-01
Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less
Direct role for the RNA polymerase domain of T7 primase in primer delivery
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.
2010-01-01
Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755
Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.
2003-01-01
A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936
Nakamura, Satoki; Kahyo, Tomoaki; Tao, Hong; Shibata, Kiyoshi; Kurabe, Nobuya; Yamada, Hidetaka; Shinmura, Kazuya; Ohnishi, Kazunori; Sugimura, Haruhiko
2015-01-01
Herein, we report the characterization of Limb expression 1-like, (LIX1L), a putative RNA-binding protein (RBP) containing a double-stranded RNA binding motif, which is highly expressed in various cancer tissues. Analysis of MALDI-TOF/TOF mass spectrometry and RNA immunoprecipitation-sequencing of interacting proteins and the microRNAs (miRNAs) bound to LIX1L revealed that LIX1L interacts with proteins (RIOK1, nucleolin and PABPC4) and miRNAs (has-miRNA-520a-5p, −300, −216b, −326, −190a, −548b-3p, −7–5p and −1296) in HEK-293 cells. Moreover, the reduction of phosphorylated Tyr136 (pTyr136) in LIX1L through the homeodomain peptide, PY136, inhibited LIX1L-induced cell proliferation in vitro, and PY136 inhibited MKN45 cell proliferation in vivo. We also determined the miRNA-targeted genes and showed that was apoptosis induced through the reduction of pTyr136. Moreover, ROS1, HCK, ABL1, ABL2, JAK3, LCK and TYR03 were identified as candidate kinases responsible for the phosphorylation of Tyr136 of LIX1L. These data provide novel insights into the biological significance of LIX1L, suggesting that this protein might be an RBP, with implications for therapeutic approaches for targeting LIX1L in LIX1L-expressing cancer cells. PMID:26310847
Gavert, Nancy; Ben-Shmuel, Amir; Raveh, Shani; Ben-Ze'ev, Avri
2008-11-01
L1-cell adhesion molecule (L1-CAM) is a cell adhesion receptor of the immunoglobulin superfamily, known for its roles in nerve cell function. While originally believed to be present only in brain cells, in recent years L1-CAM has been detected in other tissues, and in a variety of cancer cells, including some common types of human cancer. We review the prevalence of L1-CAM in human cancer, the possible mechanisms involved in L1-CAM-mediated tumorigenesis, and cancer therapies based upon L1-CAM antibody treatment. In colon cancer cells, the L1-CAM gene was identified as a target of the Wnt/beta-catenin-TCF signaling pathway, and L1-CAM was exclusively detected at the invasive front of colon and ovarian cancer tissue. The expression of L1-CAM in normal and cancer cells enhanced tumorigenesis and conferred metastasis in colon cancer cells. Antibodies against the L1-CAM ectodomain severely inhibited the proliferation of a variety of cancer cells in culture and reduced tumor burden when injected into mice harboring cancer cells expressing L1-CAM. These results, in addition to the presence of L1-CAM on the cell surface and its restricted distribution in normal tissues, make it an ideal target for tumor therapy.
Objective consensus from decision trees.
Putora, Paul Martin; Panje, Cedric M; Papachristofilou, Alexandros; Dal Pra, Alan; Hundsberger, Thomas; Plasswilm, Ludwig
2014-12-05
Consensus-based approaches provide an alternative to evidence-based decision making, especially in situations where high-level evidence is limited. Our aim was to demonstrate a novel source of information, objective consensus based on recommendations in decision tree format from multiple sources. Based on nine sample recommendations in decision tree format a representative analysis was performed. The most common (mode) recommendations for each eventuality (each permutation of parameters) were determined. The same procedure was applied to real clinical recommendations for primary radiotherapy for prostate cancer. Data was collected from 16 radiation oncology centres, converted into decision tree format and analyzed in order to determine the objective consensus. Based on information from multiple sources in decision tree format, treatment recommendations can be assessed for every parameter combination. An objective consensus can be determined by means of mode recommendations without compromise or confrontation among the parties. In the clinical example involving prostate cancer therapy, three parameters were used with two cut-off values each (Gleason score, PSA, T-stage) resulting in a total of 27 possible combinations per decision tree. Despite significant variations among the recommendations, a mode recommendation could be found for specific combinations of parameters. Recommendations represented as decision trees can serve as a basis for objective consensus among multiple parties.
MELCOR computer code manuals: Primer and user`s guides, Version 1.8.3 September 1994. Volume 1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Summers, R.M.; Cole, R.K. Jr.; Smith, R.C.
1995-03-01
MELCOR is a fully integrated, engineering-level computer code that models the progression of severe accidents in light water reactor nuclear power plants. MELCOR is being developed at Sandia National Laboratories for the US Nuclear Regulatory Commission as a second-generation plant risk assessment tool and the successor to the Source Term Code Package. A broad spectrum of severe accident phenomena in both boiling and pressurized water reactors is treated in MELCOR in a unified framework. These include: thermal-hydraulic response in the reactor coolant system, reactor cavity, containment, and confinement buildings; core heatup, degradation, and relocation; core-concrete attack; hydrogen production, transport, andmore » combustion; fission product release and transport; and the impact of engineered safety features on thermal-hydraulic and radionuclide behavior. Current uses of MELCOR include estimation of severe accident source terms and their sensitivities and uncertainties in a variety of applications. This publication of the MELCOR computer code manuals corresponds to MELCOR 1.8.3, released to users in August, 1994. Volume 1 contains a primer that describes MELCOR`s phenomenological scope, organization (by package), and documentation. The remainder of Volume 1 contains the MELCOR Users` Guides, which provide the input instructions and guidelines for each package. Volume 2 contains the MELCOR Reference Manuals, which describe the phenomenological models that have been implemented in each package.« less
2011-10-06
composites were prepared with varying metal to oxidizer (M/O) ratios ranging from 0.782 to 3.165 (see Table 7). The performance was measured by the...and the Army was expecting to begin their processing efforts in the near future. The Army purchased primer metal parts and was prepared to perform...43 Table 19 – Samples Prepared Using Different Mix Times and Amplitudes
Validation of consensus panel diagnosis in dementia.
Gabel, Matthew J; Foster, Norman L; Heidebrink, Judith L; Higdon, Roger; Aizenstein, Howard J; Arnold, Steven E; Barbas, Nancy R; Boeve, Bradley F; Burke, James R; Clark, Christopher M; Dekosky, Steven T; Farlow, Martin R; Jagust, William J; Kawas, Claudia H; Koeppe, Robert A; Leverenz, James B; Lipton, Anne M; Peskind, Elaine R; Turner, R Scott; Womack, Kyle B; Zamrini, Edward Y
2010-12-01
The clinical diagnosis of dementing diseases largely depends on the subjective interpretation of patient symptoms. Consensus panels are frequently used in research to determine diagnoses when definitive pathologic findings are unavailable. Nevertheless, research on group decision making indicates that many factors can adversely affect panel performance. To determine conditions that improve consensus panel diagnosis. Comparison of neuropathologic diagnoses with individual and consensus panel diagnoses based on clinical scenarios only, fludeoxyglucose F 18 positron emission tomography images only, and scenarios plus images. Expert and trainee individual and consensus panel deliberations using a modified Delphi method in a pilot research study of the diagnostic utility of fludeoxyglucose F 18 positron emission tomography. Forty-five patients with pathologically confirmed Alzheimer disease or frontotemporal dementia. Statistical measures of diagnostic accuracy, agreement, and confidence for individual raters and panelists before and after consensus deliberations. The consensus protocol using trainees and experts surpassed the accuracy of individual expert diagnoses when clinical information elicited diverse judgments. In these situations, consensus was 3.5 times more likely to produce positive rather than negative changes in the accuracy and diagnostic certainty of individual panelists. A rule that forced group consensus was at least as accurate as majority and unanimity rules. Using a modified Delphi protocol to arrive at a consensus diagnosis is a reasonable substitute for pathologic information. This protocol improves diagnostic accuracy and certainty when panelist judgments differ and is easily adapted to other research and clinical settings while avoiding the potential pitfalls of group decision making.
Tang, Fei; Zheng, Pan
2018-01-01
Antibody blockade of the PD-1/PD-L1 pathway has elicited durable antitumor responses in the therapy of a broad spectrum of cancers. PD-L1 is constitutively expressed in certain tumors and host immune cells, and its expression can be induced or maintained by many factors. The expression of PD-L1 on tumor tissues has been reported to be positively correlated with the efficacy of anti-PD-1/PD-L1 therapy in patients. However, multiple clinical trials indicate that patients with PD-L1-negative tumors also respond to this blockade therapy, which suggests the potential contribution of PD-L1 from host immune cells. Recently, six articles independently evaluated and verified the contributions of PD-L1 from tumor versus non-tumor cells in various mouse tumor models. These studies confirmed that PD-L1 on either tumor cells or host immune cells contributes to tumor escape, and the relative contributions of PD-L1 on these cells seem to be context-dependent. While both tumor- and host-derived PD-L1 can play critical roles in immune suppression, differences in tumor immunogenicity appear to underlie their relative importance. Notably, these reports highlight the essential roles of PD-L1 from host myeloid cells in negatively regulating T cell activation and limiting T cell trafficking. Therefore, comprehensive evaluating the global PD-L1 expression, rather than monitoring PD-L1 expression on tumor cells alone, should be a more accurate way for predicting responses in PD-1/PD-L1 blockade therapy in cancer patients.
A primer on safety performance measures for the transportation planning process
DOT National Transportation Integrated Search
2009-09-01
This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
Nguyen, S M; Thamm, D H; Vail, D M; London, C A
2015-09-01
In veterinary medical oncology, there is currently no standardized protocol for assessing response to therapy in solid tumours. The lack of such a formalized guideline makes it challenging to critically compare outcome measures across various treatment protocols. The Veterinary Cooperative Oncology Group (VCOG) membership consensus document presented here is based on the recommendations of a subcommittee of American College of Veterinary Internal Medicine (ACVIM) board-certified veterinary oncologists. This consensus paper has used the human response evaluation criteria in solid tumours (RECIST v1.1) as a framework to establish standard procedures for response assessment in canine solid tumours that is meant to be easy to use, repeatable and applicable across a variety of clinical trial structures in veterinary oncology. It is hoped that this new canine RECIST (cRECIST v1.0) will be adopted within the veterinary oncology community and thereby facilitate the comparison of current and future treatment protocols used for companion animals with cancer. © 2013 Blackwell Publishing Ltd.
Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart
2014-11-01
In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.
Magro, Fernando; Ramos, Jaime; Correia, Luís; Lago, Paula; Peixe, Paula; Gonçalves, Ana Rita; Rodrigues, Ãngela; Vieira, Catarina; Ferreira, Daniela; Pereira Silva, João; Túlio, Maria Ana; Salgueiro, Paulo; Fernandes, Samuel
2016-02-01
Anaemia can be considered the most common extra-intestinal manifestation in inflammatory bowel disease. Nevertheless, anaemia is often under-diagnosed and under-treated both in adults and children with inflammatory bowel disease. Herein, we report the consensus statements on the management of anaemia in inflammatory bowel disease developed by the Portuguese Working Group on Inflammatory Bowel Disease (known as Grupo de Estudo da Doença Inflamatória Intestinal - GEDII) to aid clinicians in daily management of inflammatory bowel disease patients. A comprehensive literature review was conducted in order to prepare consensus statements on the following topics: (1) prevalence and diagnosis of anaemia in inflammatory bowel disease, (2) iron supplementation for the prevention of anaemia in inflammatory bowel disease and (3) treatment of anaemia in inflammatory bowel disease. The final statements for each topic were discussed at a consensus meeting and rated according to the Oxford Centre for Evidence-Based Medicine 2011 Levels of Evidence. It was concluded that anaemia has a high incidence and prevalence in inflammatory bowel disease, particularly in those with active disease and hospitalised. Patients with anaemia had decreased quality of life and frequently complained of fatigue. Absolute indications for intravenous therapy should be considered: (1) moderate to severe anaemia (haemoglobin < 10.5 g/dL) or clearly symptomatic anaemia; (2) previous intolerance to oral iron supplements; (3) inappropriate response to oral iron; (4) active severe intestinal disease; (5) need for a quick therapeutic response (e.g. surgery in the short term); (6) concomitant therapy with erythropoiesis-stimulating agent; and (7) patient's preference.
Tynkkynen, S; Satokari, R; Saarela, M; Mattila-Sandholm, T; Saxelin, M
1999-09-01
A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively.
Attitude Importance and the False Consensus Effect.
ERIC Educational Resources Information Center
Fabrigar, Leandre R.; Krosnick, Jon A.
1995-01-01
Explores the possibility that importance may regulate the magnitude of the false consensus effect. Analysis revealed a strong false consensus effect but no reliable relation between its magnitude and attitude importance. Results contradict assumptions that the false consensus effect arises from attitudes that directly or indirectly influence…
[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].
Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun
2009-10-01
To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.
Methodological Quality of Consensus Guidelines in Implant Dentistry.
Faggion, Clovis Mariano; Apaza, Karol; Ariza-Fritas, Tania; Málaga, Lilian; Giannakopoulos, Nikolaos Nikitas; Alarcón, Marco Antonio
2017-01-01
Consensus guidelines are useful to improve clinical decision making. Therefore, the methodological evaluation of these guidelines is of paramount importance. Low quality information may guide to inadequate or harmful clinical decisions. To evaluate the methodological quality of consensus guidelines published in implant dentistry using a validated methodological instrument. The six implant dentistry journals with impact factors were scrutinised for consensus guidelines related to implant dentistry. Two assessors independently selected consensus guidelines, and four assessors independently evaluated their methodological quality using the Appraisal of Guidelines for Research & Evaluation (AGREE) II instrument. Disagreements in the selection and evaluation of guidelines were resolved by consensus. First, the consensus guidelines were analysed alone. Then, systematic reviews conducted to support the guidelines were included in the analysis. Non-parametric statistics for dependent variables (Wilcoxon signed rank test) was used to compare both groups. Of 258 initially retrieved articles, 27 consensus guidelines were selected. Median scores in four domains (applicability, rigour of development, stakeholder involvement, and editorial independence), expressed as percentages of maximum possible domain scores, were below 50% (median, 26%, 30.70%, 41.70%, and 41.70%, respectively). The consensus guidelines and consensus guidelines + systematic reviews data sets could be compared for 19 guidelines, and the results showed significant improvements in all domain scores (p < 0.05). Methodological improvement of consensus guidelines published in major implant dentistry journals is needed. The findings of the present study may help researchers to better develop consensus guidelines in implant dentistry, which will improve the quality and trust of information needed to make proper clinical decisions.
Asian Consensus Report on Functional Dyspepsia
Miwa, Hiroto; Ghoshal, Uday C; Gonlachanvit, Sutep; Gwee, Kok-Ann; Ang, Tiing-Leong; Chang, Full-Young; Fock, Kwong Ming; Hongo, Michio; Hou, Xiaohua; Kachintorn, Udom; Ke, Meiyun; Lai, Kwok-Hung; Lee, Kwang Jae; Lu, Ching-Liang; Mahadeva, Sanjiv; Miura, Soichiro; Park, Hyojin; Rhee, Poong-Lyul; Sugano, Kentaro; Vilaichone, Ratha-korn; Wong, Benjamin CY
2012-01-01
Background/Aims Environmental factors such as food, lifestyle and prevalence of Helicobacter pylori infection are widely different in Asian countries compared to the West, and physiological functions and genetic factors of Asians may also be different from those of Westerners. Establishing an Asian consensus for functional dyspepsia is crucial in order to attract attention to such data from Asian countries, to articulate the experience and views of Asian experts, and to provide a relevant guide on management of functional dyspepsia for primary care physicians working in Asia. Methods Consensus team members were selected from Asian experts and consensus development was carried out using a modified Delphi method. Consensus teams collected published papers on functional dyspepsia especially from Asia and developed candidate consensus statements based on the generated clinical questions. At the first face-to-face meeting, each statement was reviewed and e-mail voting was done twice. At the second face-to-face meeting, final voting on each statement was done using keypad voting system. A grade of evidence and a strength of recommendation were applied to each statement according to the method of the GRADE Working Group. Results Twenty-nine consensus statements were finalized, including 7 for definition and diagnosis, 5 for epidemiology, 9 for pathophysiology and 8 for management. Algorithms for diagnosis and management of functional dyspepsia were added. Conclusions This consensus developed by Asian experts shows distinctive features of functional dyspepsia in Asia and will provide a guide to the diagnosis and management of functional dyspepsia for Asian primary care physicians. PMID:22523724
Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.
Tirumalai, R S; Modak, M J
1991-07-02
We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Kebir, Sied; Khurshid, Zain; Gaertner, Florian C.; Essler, Markus; Hattingen, Elke; Fimmers, Rolf; Scheffler, Björn; Herrlinger, Ulrich; Bundschuh, Ralph A.; Glas, Martin
2017-01-01
Rationale Timely detection of pseudoprogression (PSP) is crucial for the management of patients with high-grade glioma (HGG) but remains difficult. Textural features of O-(2-[18F]fluoroethyl)-L-tyrosine positron emission tomography (FET-PET) mirror tumor uptake heterogeneity; some of them may be associated with tumor progression. Methods Fourteen patients with HGG and suspected of PSP underwent FET-PET imaging. A set of 19 conventional and textural FET-PET features were evaluated and subjected to unsupervised consensus clustering. The final diagnosis of true progression vs. PSP was based on follow-up MRI using RANO criteria. Results Three robust clusters have been identified based on 10 predominantly textural FET-PET features. None of the patients with PSP fell into cluster 2, which was associated with high values for textural FET-PET markers of uptake heterogeneity. Three out of 4 patients with PSP were assigned to cluster 3 that was largely associated with low values of textural FET-PET features. By comparison, tumor-to-normal brain ratio (TNRmax) at the optimal cutoff 2.1 was less predictive of PSP (negative predictive value 57% for detecting true progression, p=0.07 vs. 75% with cluster 3, p=0.04). Principal Conclusions Clustering based on textural O-(2-[18F]fluoroethyl)-L-tyrosine PET features may provide valuable information in assessing the elusive phenomenon of pseudoprogression. PMID:28030820
Kebir, Sied; Khurshid, Zain; Gaertner, Florian C; Essler, Markus; Hattingen, Elke; Fimmers, Rolf; Scheffler, Björn; Herrlinger, Ulrich; Bundschuh, Ralph A; Glas, Martin
2017-01-31
Timely detection of pseudoprogression (PSP) is crucial for the management of patients with high-grade glioma (HGG) but remains difficult. Textural features of O-(2-[18F]fluoroethyl)-L-tyrosine positron emission tomography (FET-PET) mirror tumor uptake heterogeneity; some of them may be associated with tumor progression. Fourteen patients with HGG and suspected of PSP underwent FET-PET imaging. A set of 19 conventional and textural FET-PET features were evaluated and subjected to unsupervised consensus clustering. The final diagnosis of true progression vs. PSP was based on follow-up MRI using RANO criteria. Three robust clusters have been identified based on 10 predominantly textural FET-PET features. None of the patients with PSP fell into cluster 2, which was associated with high values for textural FET-PET markers of uptake heterogeneity. Three out of 4 patients with PSP were assigned to cluster 3 that was largely associated with low values of textural FET-PET features. By comparison, tumor-to-normal brain ratio (TNRmax) at the optimal cutoff 2.1 was less predictive of PSP (negative predictive value 57% for detecting true progression, p=0.07 vs. 75% with cluster 3, p=0.04). Clustering based on textural O-(2-[18F]fluoroethyl)-L-tyrosine PET features may provide valuable information in assessing the elusive phenomenon of pseudoprogression.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Liu, Junqi; Zhang, Chuanfeng; Hu, Jiegang; Tian, Qing; Wang, Xin; Gu, Hao; Zhang, Song; Zhao, Di; Fan, Ruitai
2018-02-23
Urothelial carcinoma ranks the ninth among malignant cancers. We conducted this study to identify which patients could benefit more from the treatment of programmed death-1 (PD-1)/programmed death-ligand1 (PD-L1) inhibitors. We performed literature searches, combined data from qualified literature and performed comparative analyses on the effectiveness of anti-PD-1/PD-L1 antibodies in patients with different PD-L1 expression levels. We divided patients into three groups according to the percentages of PD-L1-positive cells, namely the low- PD-L1 (PD-L1 < 1%), the medium-PD-L1 (PD-L1 ≥ 1 and < 5%) and the high-PD-L1 (PD-L1 ≥ 5%) groups. We found that the high-PD-L1 group responded significantly better than other groups (P = 0.0003, ORs = 0.45, 95%CI: 0.29-071; P = 0.0009, ORs = 0.43, 95%CI: 0.25-0.73, for low-PD-L1 and medium-PD-L1 groups, respectively), while the latter two groups responded similarly (P = 0.90, ORs = 1.06, 95%CI: 0.62-1.83) to both PD-1 and PD-L1 inhibitors. Furthermore, we found that the medium-PD-L1 and high-PD-L1 groups responded similarly to PD-1/ PD-L1 inhibitors (P = 0.65, ORs = 1.11, 95%CI: 0.69-1.77), while the low-PD-L1 group responded better to PD-1 inhibitors than PD-L1 inhibitors (P = 0.046, ORs = 1.92, 95%CI: 0.98-3.89). Our results suggest that PD-L1 positive patients should be defined as those with ≥ 5% or greaterPD-L1-positive cells. PD-1 antibodies performed better only in the low-group patients, likely because they could block the interactions of PD-1 with both PD-L1 and PD-L2.
CAMILLERI, M.; DROSSMAN, D. A.; BECKER, G.; WEBSTER, L. R.; DAVIES, A. N.; MAWE, G. M.
2015-01-01
Background Opioids are effective for acute and chronic pain conditions, but their use is associated with often difficult-to-manage constipation and other gastrointestinal (GI) effects due to effects on peripheral μ-opioid receptors in the gut. The mechanism of opioid-induced constipation (OIC) differs from that of functional constipation (FC), and OIC may not respond as well to most first-line treatments for FC. The impact of OIC on quality of life (QoL) induces some patients to decrease or stop their opioid therapy to relieve or avoid constipation. Purpose At a roundtable meeting on OIC, a working group developed a consensus definition for OIC diagnosis across disciplines and reviewed current OIC treatments and the potential of treatments in development. By consensus, OIC is defined as follows: ‘A change when initiating opioid therapy from baseline bowel habits that is characterized by any of the following: reduced bowel movement frequency, development or worsening of straining to pass bowel movements, a sense of incomplete rectal evacuation, or harder stool consistency’. The working group noted the prior validation of a patient response outcome and end point for clinical trials and recommended future efforts to create treatment guidelines and QoL measures specific for OIC. Details from the working group’s discussion and consensus recommendations for patient care and research are presented in this article. PMID:25164154
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
ERIC Educational Resources Information Center
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1.
Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D
2010-10-01
Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.
Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.
2004-01-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689
Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan
2017-01-01
The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration. PMID:28747833
Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi
2010-08-01
We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.
Fine mapping of the genic male-sterile ms 1 gene in Capsicum annuum L.
Jeong, Kyumi; Choi, Doil; Lee, Jundae
2018-01-01
The genomic region cosegregating with the genic male-sterile ms 1 gene of Capsicum annuum L. was delimited to a region of 869.9 kb on chromosome 5 through fine mapping analysis. A strong candidate gene, CA05g06780, a homolog of the Arabidopsis MALE STERILITY 1 gene that controls pollen development, was identified in this region. Genic male sterility caused by the ms 1 gene has been used for the economically efficient production of massive hybrid seeds in paprika (Capsicum annuum L.), a colored bell-type sweet pepper. Previously, a CAPS marker, PmsM1-CAPS, located about 2-3 cM from the ms 1 locus, was reported. In this study, we constructed a fine map near the ms 1 locus using high-resolution melting (HRM) markers in an F 2 population consisting of 1118 individual plants, which segregated into 867 male-fertile and 251 male-sterile plants. A total of 12 HRM markers linked to the ms 1 locus were developed from 53 primer sets targeting intraspecific SNPs derived by comparing genome-wide sequences obtained by next-generation resequencing analysis. Using this approach, we narrowed down the region cosegregating with the ms 1 gene to 869.9 kb of sequence. Gene prediction analysis revealed 11 open reading frames in this region. A strong candidate gene, CA05g06780, was identified; this gene is a homolog of the Arabidopsis MALE STERILITY 1 (MS1) gene, which encodes a PHD-type transcription factor that regulates pollen and tapetum development. Sequence comparison analysis suggested that the CA05g06780 gene is the strongest candidate for the ms 1 gene of paprika. To summarize, we developed a cosegregated marker, 32187928-HRM, for marker-assisted selection and identified a strong candidate for the ms 1 gene.
A consensus definition and core competencies for being an advocate for pharmacy.
Bzowyckyj, Andrew S; Janke, Kristin K
2013-03-12
To develop a consensus definition for "advocacy for the profession of pharmacy" and core competencies for doctor of pharmacy (PharmD) graduates to be effective advocates for the profession. A 3-round modified Delphi process was conducted using a panel of 9 experts. Participants revised a definition for "advocacy for the profession" and ultimately rated their agreement using a 5-point Likert scale. Competency statements were developed and subsequently rated for importance for being an advocate and importance to address in PharmD curricula. A consensus-derived definition was developed. Two competency statements achieved consensus for both measures of importance. Four competency statements achieved consensus for only 1 measure and another 4 did not reach consensus for either measure. A consensus-derived definition was developed describing advocacy for the profession of pharmacy and began laying the groundwork for the knowledge and skills necessary to be an effective advocate for the profession of pharmacy.
Consensus Building: A Key to School Transformation
ERIC Educational Resources Information Center
Baron, Daniel
2008-01-01
Consensus-based decision making can turn faculty meetings into meaningful and productive work sessions in which faculty members know that their input is respected and valued and important decisions are made. Reaching consensus has different meanings in different contexts. Decisions are made "by consensus" when the decision affects the entire…
Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki
2014-01-01
For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201
NASA Astrophysics Data System (ADS)
Conte, Yves Le; Bécard, Jean-Marc; Costagliola, Guy; de Vaublanc, Gérard; Maâtaoui, Mohamed El; Crauser, Didier; Plettner, Erika; Slessor, Keith N.
2006-05-01
A brood pheromone identified in honeybee larvae has primer and releaser pheromone effects on adult bees. Using gas chromatography-mass spectrometry (GC-MS) to evaluate fatty acid esters—the pheromonal compounds—in different parts of the larvae, we have localized the source of the esters as the larval salivary glands. A histochemical study describes the glands and confirms the presence of lipids in the glands. Epithelial cells of the gland likely secrete the fatty acids into the lumen of the gland. These results demonstrate the salivary glands to be a reservoir of esters, components of brood pheromone, in honeybee larvae.
L1 French Learning of L2 Spanish Past Tenses: L1 Transfer versus Aspect and Interface Issues
ERIC Educational Resources Information Center
Amenós-Pons, José; Ahern, Aoife; Gujarro-Fuentes, Pedro
2017-01-01
This paper examines the process of acquiring L2s that are closely related to the L1 through data on how adult French speakers learning L2 Spanish in a formal setting develop knowledge and use of past tenses in this L2. We consider the role of transfer and simplification in acquiring mental representations of the L2 grammar, specifically in the…
Brooks, B R
2000-03-01
The 2nd Consensus Conference (Versailles) on the early diagnosis of amyotrophic lateral sclerosis (ALS) developed themes identified at the 1st Consensus Conference (Chicago) on defining optimal management in ALS. These themes included describing the problems and limitations in current diagnostic practices, identifying consequences of early diagnosis on patient management, establishing recommendations to help healthcare personnel achieve the early diagnosis and proposing solutions to facilitate early diagnosis of ALS. Lessons from the ISIS Survey and the 1st Consensus Conference focused on the variability of the first-contact physician, supply factors for specialists and variability of application of medical techniques. The recently introduced concept of 'ALS health states or stages' was reviewed in terms of ongoing and potential prospective studies. The relative contribution of neuroimaging or clinical neurophysiological investigations to accelerating the diagnosis of ALS in clinical practice was debated. The role of a common ALS knowledge-base among patients, initial healthcare providers, diagnosing neurologists and confirming neurologists was critically appraised with regard to simplified 'ALS diagnostic algorithm', 'ten aphorisms in the diagnosis of ALS' and 'ALS axioms of referral'. Refining this ALS knowledge-base is required to identify a minimum dataset required for the evaluation and diagnosis of ALS.
Freshwater Wetlands: A Citizen's Primer.
ERIC Educational Resources Information Center
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Revisiting and re-engineering the classical zinc finger peptide: consensus peptide-1 (CP-1).
Besold, Angelique N; Widger, Leland R; Namuswe, Frances; Michalek, Jamie L; Michel, Sarah L J; Goldberg, David P
2016-04-01
Zinc plays key structural and catalytic roles in biology. Structural zinc sites are often referred to as zinc finger (ZF) sites, and the classical ZF contains a Cys2His2 motif that is involved in coordinating Zn(II). An optimized Cys2His2 ZF, named consensus peptide 1 (CP-1), was identified more than 20 years ago using a limited set of sequenced proteins. We have reexamined the CP-1 sequence, using our current, much larger database of sequenced proteins that have been identified from high-throughput sequencing methods, and found the sequence to be largely unchanged. The CCHH ligand set of CP-1 was then altered to a CAHH motif to impart hydrolytic activity. This ligand set mimics the His2Cys ligand set of peptide deformylase (PDF), a hydrolytically active M(II)-centered (M = Zn or Fe) protein. The resultant peptide [CP-1(CAHH)] was evaluated for its ability to coordinate Zn(II) and Co(II) ions, adopt secondary structure, and promote hydrolysis. CP-1(CAHH) was found to coordinate Co(II) and Zn(II) and a pentacoordinate geometry for Co(II)-CP-1(CAHH) was implicated from UV-vis data. This suggests a His2Cys(H2O)2 environment at the metal center. The Zn(II)-bound CP-1(CAHH) was shown to adopt partial secondary structure by 1-D (1)H NMR spectroscopy. Both Zn(II)-CP-1(CAHH) and Co(II)-CP-1(CAHH) show good hydrolytic activity toward the test substrate 4-nitrophenyl acetate, exhibiting faster rates than most active synthetic Zn(II) complexes.
Methodological Quality of Consensus Guidelines in Implant Dentistry
Faggion, Clovis Mariano; Apaza, Karol; Ariza-Fritas, Tania; Málaga, Lilian; Giannakopoulos, Nikolaos Nikitas; Alarcón, Marco Antonio
2017-01-01
Background Consensus guidelines are useful to improve clinical decision making. Therefore, the methodological evaluation of these guidelines is of paramount importance. Low quality information may guide to inadequate or harmful clinical decisions. Objective To evaluate the methodological quality of consensus guidelines published in implant dentistry using a validated methodological instrument. Methods The six implant dentistry journals with impact factors were scrutinised for consensus guidelines related to implant dentistry. Two assessors independently selected consensus guidelines, and four assessors independently evaluated their methodological quality using the Appraisal of Guidelines for Research & Evaluation (AGREE) II instrument. Disagreements in the selection and evaluation of guidelines were resolved by consensus. First, the consensus guidelines were analysed alone. Then, systematic reviews conducted to support the guidelines were included in the analysis. Non-parametric statistics for dependent variables (Wilcoxon signed rank test) was used to compare both groups. Results Of 258 initially retrieved articles, 27 consensus guidelines were selected. Median scores in four domains (applicability, rigour of development, stakeholder involvement, and editorial independence), expressed as percentages of maximum possible domain scores, were below 50% (median, 26%, 30.70%, 41.70%, and 41.70%, respectively). The consensus guidelines and consensus guidelines + systematic reviews data sets could be compared for 19 guidelines, and the results showed significant improvements in all domain scores (p < 0.05). Conclusions Methodological improvement of consensus guidelines published in major implant dentistry journals is needed. The findings of the present study may help researchers to better develop consensus guidelines in implant dentistry, which will improve the quality and trust of information needed to make proper clinical decisions. PMID:28107405
Structure and genomic organization of the human B1 receptor gene for kinins (BDKRB1).
Bachvarov, D R; Hess, J F; Menke, J G; Larrivée, J F; Marceau, F
1996-05-01
Two subtypes of mammalian bradykinin receptors, B1 and B2 (BDKRB1 and BDKRB2), have been defined based on their pharmacological properties. The B1 type kinin receptors have weak affinity for intact BK or Lys-BK but strong affinity for kinin metabolites without the C-terminal arginine (e.g., des-Arg9-BK and Lys-des-Arg9-BK, also called des-Arg10-kallidin), which are generated by kininase I. The B1 receptor expression is up-regulated following tissue injury and inflammation (hyperemia, exudation, hyperalgesia, etc.). In the present study, we have cloned and sequenced the gene encoding human B1 receptor from a human genomic library. The human B1 receptor gene contains three exons separated by two introns. The first and the second exon are noncoding, while the coding region and the 3'-flanking region are located entirely on the third exon. The exon-intron arrangement of the human B1 receptor gene shows significant similarity with the genes encoding the B2 receptor subtype in human, mouse, and rat. Sequence analysis of the 5'-flanking region revealed the presence of a consensus TATA box and of numerous candidate transcription factor binding sequences. Primer extension experiments have shown the existence of multiple transcription initiation sites situated downstream and upstream from the consensus TATA box. Genomic Southern blot analysis indicated that the human B1 receptor is encoded by a single-copy gene.
Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.
2013-01-01
Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions
NASA Technical Reports Server (NTRS)
Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.
1997-01-01
To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.
High-affinity PD-1 molecules deliver improved interaction with PD-L1 and PD-L2.
Li, Yanyan; Liang, Zhaoduan; Tian, Ye; Cai, Wenxuan; Weng, Zhiming; Chen, Lin; Zhang, Huanling; Bao, Yifeng; Zheng, Hongjun; Zeng, Sihai; Bei, Chunhua; Li, Yi
2018-06-11
The inhibitory checkpoint molecule programmed death (PD)-1 plays a vital role in maintaining immune homeostasis upon binding to its ligands, PD-L1 and PD-L2. Several recent studies have demonstrated that soluble PD-1 (sPD-1) can block the interaction between membrane PD-1 and PD-L1 to enhance the anti-tumor capability of T cells. However, the affinity of natural sPD-1 binding to PD-L1 is too low to permit therapeutic applications. Here a PD-1 variant with ~3,000-fold and ~70-fold affinity increase to bind PD-L1 and PD-L2, respectively, was generated through directed molecular evolution and phage display technology. Structural analysis showed that mutations at amino acid positions 124 and 132 of PD-1 played major roles in enhancing the affinity of PD-1 binding to its ligands. The high-affinity PD-1 mutant could compete with the binding of antibodies specific to PD-L1 or PD-L2 on cancer cells or dendritic cells (DCs), and it could enhance the proliferation and IFN-γ release of activated lymphocytes. These features potentially qualify the high-affinity PD-1 variant as a unique candidate for the development of a new class of PD-1 immune checkpoint blockade therapeutics. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
2014-08-01
consensus algorithm called randomized gossip is more suitable [7, 8]. In asynchronous randomized gossip algorithms, pairs of neighboring nodes exchange...messages and perform updates in an asynchronous and unattended manner, and they also 1 The class of broadcast gossip algorithms [9, 10, 11, 12] are...dynamics [2] and asynchronous pairwise randomized gossip [7, 8], broadcast gossip algorithms do not require that nodes know the identities of their
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Primer on transportation and climate change
DOT National Transportation Integrated Search
2008-04-01
This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...
Climate Ready Estuaries Rolling Easements Primer
Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
2015-12-09
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
Sensory reception of the primer pheromone ethyl oleate
NASA Astrophysics Data System (ADS)
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality
Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea
2017-01-01
Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368
L1 Korean and L1 Mandarin L2 English Learners' Acquisition of the Count/Mass Distinction in English
ERIC Educational Resources Information Center
Choi, Sea Hee; Ionin, Tania; Zhu, Yeqiu
2018-01-01
This study investigates the second language (L2) acquisition of the English count/mass distinction by speakers of Korean and Mandarin Chinese, with a focus on the semantics of atomicity. It is hypothesized that L1-Korean and L1-Mandarin L2-English learners are influenced by atomicity in the use of the count/mass morphosyntax in English. This…
Kyoto global consensus report on Helicobacter pylori gastritis.
Sugano, Kentaro; Tack, Jan; Kuipers, Ernst J; Graham, David Y; El-Omar, Emad M; Miura, Soichiro; Haruma, Ken; Asaka, Masahiro; Uemura, Naomi; Malfertheiner, Peter
2015-09-01
To present results of the Kyoto Global Consensus Meeting, which was convened to develop global consensus on (1) classification of chronic gastritis and duodenitis, (2) clinical distinction of dyspepsia caused by Helicobacter pylori from functional dyspepsia, (3) appropriate diagnostic assessment of gastritis and (4) when, whom and how to treat H. pylori gastritis. Twenty-three clinical questions addressing the above-mentioned four domains were drafted for which expert panels were asked to formulate relevant statements. A Delphi method using an anonymous electronic system was adopted to develop the consensus, the level of which was predefined as ≥80%. Final modifications of clinical questions and consensus were achieved at the face-to-face meeting in Kyoto. All 24 statements for 22 clinical questions after extensive modifications and omission of one clinical question were achieved with a consensus level of >80%. To better organise classification of gastritis and duodenitis based on aetiology, a new classification of gastritis and duodenitis is recommended for the 11th international classification. A new category of H. pylori-associated dyspepsia together with a diagnostic algorithm was proposed. The adoption of grading systems for gastric cancer risk stratification, and modern image-enhancing endoscopy for the diagnosis of gastritis, were recommended. Treatment to eradicate H. pylori infection before preneoplastic changes develop, if feasible, was recommended to minimise the risk of more serious complications of the infection. A global consensus for gastritis was developed for the first time, which will be the basis for an international classification system and for further research on the subject. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Zhang, L Q; Niu, Y D; Huridu, H; Hao, J F; Qi, Z; Hasi, A
2014-07-24
In order to obtain a salt-tolerant perennial alfalfa (Medicago sativa L.), we transferred the halophyte Salicornia europaea L. Na(+)/H(+) antiporter gene, SeNHX1, to alfalfa by using the Agrobacterium-mediated transformation method. The transformants were confirmed by both PCR and RT-PCR analyses. Of 197 plants that were obtained after transformation, 36 were positive by PCR analysis using 2 primer pairs for the CaMV35S-SeNHX1 and SeNHX1-Nos fragments; 6 plants survived in a greenhouse. RT-PCR analysis revealed that SeNHX1 was expressed in 5 plants. The resultant transgenic alfalfa had better salt tolerance. After stress treatment for 21 days with 0.6% NaCl, the chlorophyll and MDA contents in transgenic plants were lower, but proline content and SOD, POD, and CAT activities were higher than those in wild-type plants. These results suggest that the salt tolerance of transgenic alfalfa was improved by the overexpression of the SeNHX1 gene.
Salazar, Edith L; Mercado, E; Calzada, L
2005-01-01
The prevalence of human papillomavirus HPV-16DNA sequences in 57 penile carcinoma biopsies was examined using the polymerase chain reaction (PCR) with type specific internal probes, employing HPV consensus primers from the L1 region. The cases comprised 39 typical squamous cell carcinoma and 18 specimens with different subtype. PCR products were analyzed and HPV-16DNA was detected in a high percentage of specimens. Thirty-eight biopsies were HPV-16DNA positive. This determination was correlated with cellular differentiation and growth pattern. Our data corroborates that squamous cell carcinoma was invariably associated with HPV-16DNA.
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.
1995-01-01
The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.
Boelens, Petra G; Taylor, Claire; Henning, Geoffrey; Marang-van de Mheen, Perla J; Espin, Eloy; Wiggers, Theo; Gore-Booth, Jola; Moss, Barbara; Valentini, Vincenzo; van de Velde, Cornelis J H
2014-01-01
High-quality cancer care should be accessible for patients and healthcare professionals. Involvement of patients as partners in guideline formation and consensus processes is still rarely found. EURECCA, short for European Registration of Cancer Care, is the platform to improve outcomes of cancer care by reducing variation in the diagnostic and treatment process. EURECCA acknowledges the important role of patients in implementation of consensus information in clinical practice. The aim of this article is to describe the process of involving patients in the consensus process and in developing the patient summary of the consensus for colon and rectal cancer care. The Delphi method for achieving consensus was used. Three online voting rounds and one tele-voting round were offered to an expert panel of oncology professionals and patient representatives. At four different stages, patients and/or patient representatives were involved in the process: (1) during the consensus process, (2) lecturing about the role of the patient, (3) development of the patient summary, and (4) testing the patient summary. Representatives were invited to the voting and commenting rounds of this process and given an equal vote. Although patients were not consulted during the planning stages of this process, patient involvement increased following the panel's discussion of the implementation of the consensus among the patient population. After the consensus meeting, the patient summary was written by patient representatives, oncologists and nurses. A selection of proactive patients reviewed the draft patient summary; responses were positive and several patient-reported outcomes were added. Questionnaires to evaluate the use and implementation of the patient summary in daily practice are currently being developed and tested. Patient consultation will be needed in future planning for selection of topics. The present study may function as a model for future consensus processes to involve patients
Electrocoat Process for Non-Chromate Primers in DoD Manufacturing
2011-02-01
requirements are uniquely suited for aerospace aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated, environmentally friendly, electrodeposited primer. ● The primers will be
Fitness voter model: Damped oscillations and anomalous consensus.
Woolcock, Anthony; Connaughton, Colm; Merali, Yasmin; Vazquez, Federico
2017-09-01
We study the dynamics of opinion formation in a heterogeneous voter model on a complete graph, in which each agent is endowed with an integer fitness parameter k≥0, in addition to its + or - opinion state. The evolution of the distribution of k-values and the opinion dynamics are coupled together, so as to allow the system to dynamically develop heterogeneity and memory in a simple way. When two agents with different opinions interact, their k-values are compared, and with probability p the agent with the lower value adopts the opinion of the one with the higher value, while with probability 1-p the opposite happens. The agent that keeps its opinion (winning agent) increments its k-value by one. We study the dynamics of the system in the entire 0≤p≤1 range and compare with the case p=1/2, in which opinions are decoupled from the k-values and the dynamics is equivalent to that of the standard voter model. When 0≤p<1/2, agents with higher k-values are less persuasive, and the system approaches exponentially fast to the consensus state of the initial majority opinion. The mean consensus time τ appears to grow logarithmically with the number of agents N, and it is greatly decreased relative to the linear behavior τ∼N found in the standard voter model. When 1/2
1, agents with higher k-values are more persuasive, and the system initially relaxes to a state with an even coexistence of opinions, but eventually reaches consensus by finite-size fluctuations. The approach to the coexistence state is monotonic for 1/2
1 there are damped oscillations around the coexistence value. The final approach to coexistence is approximately a power law t^{-b(p)} in both regimes, where the exponent b increases with p. Also, τ increases respect to the standard voter model, although it still scales linearly with N. The p=1 case is special, with a relaxation to coexistence that scales as t^{-2.73} and a consensus time that scales as
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Silva, M A A; Souza, M M; Silva, G S; Melo, C A F; Corrêa, R X; Araújo, I S; Conceição, L D H C S
2014-08-07
The genus Passiflora L. is the most representative of Passifloraceae, with over 500 known species, among which 150-200 originated from Brazil. In addition to the great commercial importance of this genus for the fruit market, many of the species have exotic flowers with a huge diversity of colors and can thereby be exploited as ornamental plants. This study was aimed at investigating the transferability of microsatellite primers in wild Passiflora species (P. cacao, P. cincinnata, P. glandulosa, P. gibertii, and P. mucronata) and characterizing 29 P. alata accessions using microsatellite primers that were previously developed in a library enriched with microsatellites from P. edulis f. flavicarpa for P. alata. The interspecies cross-amplification rate varied, and P. cacao exhibited the highest rate of amplification, suggesting a greater degree of proximity to P. edulis. The study of intraspecific accessions in P. alata found genetic similarity, with values ranging from 0.47 to 1.00 and an average similarity of 0.74. Hence, this study revealed the intraspecific genetic variability of P. alata in the Universidade Estadual de Santa Cruz's Active Germplasm Bank and will lead to the adoption of mating strategies between accessions; thus making their use more suitable for breeding purposes.
Altevogt, Peter; Doberstein, Kai; Fogel, Mina
2016-04-01
L1 cell adhesion molecule (L1CAM) is one of the first neural adhesion molecules described with important functions in the development of the nervous system. Subsequent work discovered that L1CAM is expressed in many human cancers and is often associated with bad prognosis. This is most likely due to the motility and invasion promoting function of L1CAM. Here, we describe the path L1CAM has taken from a neural adhesion molecule to a recognized tumor antigen. We summarize the literature on L1CAM expression in cancers and pre-cancerous lesions. We focus on the genetic elements required for its re-expression and highlight preclinical studies for targeted therapy. The data suggest that L1CAM is a valuable diagnostic/prognostic marker and an attractive target for the therapy of several human cancers. © 2015 UICC.
Effect of N-acetyl cysteine on orthodontic primers cytotoxicity.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Schweikl, Helmut; Rengo, Sandro; Ambrosio, Luigi; Martina, Roberto; Valletta, Rosa
2011-02-01
The aims of this study were to evaluate the cytotoxicity of four orthodontic primers, including two hydrophilic and two hydrophobic materials, and to investigate the role of the reactive oxygen species (ROS) in induced cell damage. Moreover, the effects of the anti-oxidant N-acetyl cysteine (NAC) on primers toxicity was analyzed. Human gingival fibroblasts (HGF) were exposed to different concentrations of primers (0-0.25 mg/ml) in the presence or absence of NAC, and the cytotoxicity was assessed by the MTT assay, while cell death was quantified by flow cytometry after propidium iodide staining. The increase in the induced ROS levels was detected by flow cytometry measuring the fluorescence of the oxidation-sensitive dye 2',7'-dichlorofluorescein diacetate (DCFH-DA). All materials decreased cell viability in a dose-related manner after a 24 h exposure period. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease in cell viability (TC₅₀) in HGF was ranked as follows (median values): Eagle Fluorsure (0.078 mg/ml)>Transbond XT (0.081 mg/ml)>Transbond MIP (0.128 mg/ml)>Ortho solo (0.130 mg/ml). Moreover, in HGF cells, all materials induced a dose-dependent increase in ROS levels compared to untreated cells. Incubation of HGF with NAC significantly reduced ROS production and decreased the cell damage and cytotoxicity caused by all materials tested (p<0.001). Our results suggested that hydrophilic primers were less cytotoxic than hydrophobic materials. Moreover, we demonstrated a major role of ROS in the induction of cell death since the antioxidant N-acetyl cysteine was able to prevent cell damage induced by all materials tested. Copyright © 2010 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.
Remineralization Property of an Orthodontic Primer Containing a Bioactive Glass with Silver and Zinc
Lee, Seung-Min; Kim, In-Ryoung; Park, Bong-Soo; Ko, Ching-Chang; Son, Woo-Sung; Kim, Yong-Il
2017-01-01
White spot lesions (WSLs) are irreversible damages in orthodontic treatment due to excessive etching or demineralization by microorganisms. In this study, we conducted a mechanical and cell viability test to examine the antibacterial properties of 0.2% and 1% bioactive glass (BAG) and silver-doped and zinc-doped BAGs in a primer and evaluated their clinical applicability to prevent WSLs. The microhardness statistically significantly increased in the adhesive-containing BAG, while the other samples showed no statistically significant difference compared with the control group. The shear bond strength of all samples increased compared with that of the control group. The cell viability of the control and sample groups was similar within 24 h, but decreased slightly over 48 h. All samples showed antibacterial properties. Regarding remineralization property, the group containing 0.2% of the samples showed remineralization properties compared with the control group, but was not statistically significant; further, the group containing 1% of the samples showed a significant difference compared with the control group. Among them, the orthodontic bonding primer containing 1% silver-doped BAG showed the highest remineralization property. The new orthodontic bonding primer used in this study showed an antimicrobial effect, chemical remineralization effect, and WSL prevention as well as clinically applicable properties, both physically and biologically. PMID:29088092
Automated consensus contour building for prostate MRI.
Khalvati, Farzad
2014-01-01
Inter-observer variability is the lack of agreement among clinicians in contouring a given organ or tumour in a medical image. The variability in medical image contouring is a source of uncertainty in radiation treatment planning. Consensus contour of a given case, which was proposed to reduce the variability, is generated by combining the manually generated contours of several clinicians. However, having access to several clinicians (e.g., radiation oncologists) to generate a consensus contour for one patient is costly. This paper presents an algorithm that automatically generates a consensus contour for a given case using the atlases of different clinicians. The algorithm was applied to prostate MR images of 15 patients manually contoured by 5 clinicians. The automatic consensus contours were compared to manual consensus contours where a median Dice similarity coefficient (DSC) of 88% was achieved.
French national consensus clinical guidelines for the management of ulcerative colitis.
Peyrin-Biroulet, Laurent; Bouhnik, Yoram; Roblin, Xavier; Bonnaud, Guillaume; Hagège, Hervé; Hébuterne, Xavier
2016-07-01
Ulcerative colitis (UC) is a chronic inflammatory bowel disease of multifactorial etiology that primarily affects the colonic mucosa. The disease progresses over time, and clinical management guidelines should reflect its dynamic nature. There is limited evidence supporting UC management in specific clinical situations, thus precluding an evidence-based approach. To use a formal consensus method - the nominal group technique (NGT) - to develop a clinical practice expert opinion to outline simple algorithms and practices, optimize UC management, and assist clinicians in making treatment decisions. The consensus was developed by an expert panel of 37 gastroenterologists from various professional organizations with experience in UC management using the qualitative and iterative NGT, incorporating deliberations based on the European Crohn's and Colitis Organisation recommendations, recent reviews of scientific literature, and pertinent discussion topics developed by a steering committee. Examples of clinical cases for which there are limited evidence-based data from clinical trials were used. Two working groups proposed and voted on treatment algorithms that were then discussed and voted for by the nominal group as a whole, in order to reach a consensus. A clinical practice guideline covering management of the following clinical situations was developed: (i) moderate and severe UC; (ii) acute severe UC; (iii) pouchitis; (iv) refractory proctitis, in the form of treatment algorithms. Given the limited available evidence-based data, a formal consensus methodology was used to develop simple treatment guidelines for UC management in different clinical situations that is now accessible via an online application. Copyright © 2016 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.
New consensus multivariate models based on PLS and ANN studies of sigma-1 receptor antagonists.
Oliveira, Aline A; Lipinski, Célio F; Pereira, Estevão B; Honorio, Kathia M; Oliveira, Patrícia R; Weber, Karen C; Romero, Roseli A F; de Sousa, Alexsandro G; da Silva, Albérico B F
2017-10-02
The treatment of neuropathic pain is very complex and there are few drugs approved for this purpose. Among the studied compounds in the literature, sigma-1 receptor antagonists have shown to be promising. In order to develop QSAR studies applied to the compounds of 1-arylpyrazole derivatives, multivariate analyses have been performed in this work using partial least square (PLS) and artificial neural network (ANN) methods. A PLS model has been obtained and validated with 45 compounds in the training set and 13 compounds in the test set (r 2 training = 0.761, q 2 = 0.656, r 2 test = 0.746, MSE test = 0.132 and MAE test = 0.258). Additionally, multi-layer perceptron ANNs (MLP-ANNs) were employed in order to propose non-linear models trained by gradient descent with momentum backpropagation function. Based on MSE test values, the best MLP-ANN models were combined in a MLP-ANN consensus model (MLP-ANN-CM; r 2 test = 0.824, MSE test = 0.088 and MAE test = 0.197). In the end, a general consensus model (GCM) has been obtained using PLS and MLP-ANN-CM models (r 2 test = 0.811, MSE test = 0.100 and MAE test = 0.218). Besides, the selected descriptors (GGI6, Mor23m, SRW06, H7m, MLOGP, and μ) revealed important features that should be considered when one is planning new compounds of the 1-arylpyrazole class. The multivariate models proposed in this work are definitely a powerful tool for the rational drug design of new compounds for neuropathic pain treatment. Graphical abstract Main scaffold of the 1-arylpyrazole derivatives and the selected descriptors.
L2 Effects on L1 Event Conceptualization
ERIC Educational Resources Information Center
Bylund, Emanuel; Jarvis, Scott
2011-01-01
The finding that speakers of aspect languages encode event endpoints to a lesser extent than do speakers of non-aspect languages has led to the hypothesis that there is a relationship between grammatical aspect and event conceptualization (e.g., von Stutterheim and Nuse, 2003). The present study concerns L1 event conceptualization in 40 L1…
Böer, Erik; Bode, Rüdiger; Mock, Hans-Peter; Piontek, Michael; Kunze, Gotthard
2009-06-01
The tannase-encoding Arxula adeninivorans gene ATAN1 was isolated from genomic DNA by PCR, using as primers oligonucleotide sequences derived from peptides obtained after tryptic digestion of the purified tannase protein. The gene harbours an ORF of 1764 bp, encoding a 587-amino acid protein, preceded by an N-terminal secretion sequence comprising 28 residues. The deduced amino acid sequence was similar to those of tannases from Aspergillus oryzae (50% identity), A. niger (48%) and putative tannases from A. fumigatus (52%) and A. nidulans (50%). The sequence contains the consensus pentapeptide motif (-Gly-X-Ser-X-Gly-) which forms part of the catalytic centre of serine hydrolases. Expression of ATAN1 is regulated by the carbon source. Supplementation with tannic acid or gallic acid leads to induction of ATAN1, and accumulation of the native tannase enzyme in the medium. The enzymes recovered from both wild-type and recombinant strains were essentially indistinguishable. A molecular mass of approximately 320 kDa was determined, indicating that the native, glycosylated tannase consists of four identical subunits. The enzyme has a temperature optimum at 35-40 degrees C and a pH optimum at approximately 6.0. The enzyme is able to remove gallic acid from both condensed and hydrolysable tannins. The wild-type strain LS3 secreted amounts of tannase equivalent to 100 U/l under inducing conditions, while the transformant strain, which overexpresses the ATAN1 gene from the strong, constitutively active A. adeninivorans TEF1 promoter, produced levels of up to 400 U/l when grown in glucose medium in shake flasks. Copyright (c) 2009 John Wiley & Sons, Ltd.
Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar
2010-06-04
The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.
Primer vector theory and applications
NASA Technical Reports Server (NTRS)
Jezewski, D. J.
1975-01-01
A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.
Kayesh, E; Bilkish, N; Liu, G S; Chen, W; Leng, X P; Fang, J G
2014-03-31
Among different classes of molecular markers, expressed sequence tags (ESTs) are a new resource for developing simple sequence repeat (SSR) functional markers for genotyping and genetic mapping in F1 hybrid populations of Vitis vinifera L. Recently, because of the availability of an enormous amount of data for ESTs in the public domain, the emphasis has shifted from genomic SSRs to EST-SSRs, which belong to transcribed regions of the genome and may have a role in gene expression or function. The objective of this study was to assess the polymorphisms among 94 F1 hybrids from "Early Rose" and "Red Globe" using 25 EST-derived and 25 non-EST SSR markers. A total collection of 362,375 grape ESTs that were retrieved from the National Center for Biotechnology Information (NCBI) and 2522 EST-SSR sequences were identified. From them, 205 primer pairs were randomly selected, including 176 pairs that were EST-derived and 29 non-EST SSR primer pairs, for polymerase chain reaction amplification. A total of 131 alleles were amplified using 50 pairs of primers; 78 alleles were amplified using EST-derived SSR primers and 53 were from non-EST SSR primers. At most, 6 and 5 alleles were amplified by EST-derived and non-EST SSR primers, respectively. The EST-derived SSR markers showed a maximum polymorphic information content (PIC) value of 1 and a minimum of 0.33 while non-EST SSR markers had maximum and minimum PIC values of 1 and 0.25, respectively. The average PIC value was 0.56 for EST-derived SSR markers and 0.45 for non-EST SSR markers.
Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Wiesner, G.; Laken, S.
The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less
Laquel, P.; Litvak, S.; Castroviejo, M.
1994-01-01
DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Ishihara, Kenji; Kaneko, Motoko; Kitamura, Hajime; Takahashi, Aki; Hong, Jang Ja; Seyama, Toshio; Iida, Koji; Wada, Hiroshi; Hirasawa, Noriyasu; Ohuchi, Kazuo
2008-01-01
Acetylation and deacetylation of proteins occur in cells in response to various stimuli, and are reversibly catalyzed by histone acetyltransferase and histone deacetylase (HDAC), respectively. EoL-1 cells have an FIP1L1-PDGFRA fusion gene that causes transformation of eosinophilic precursor cells into leukemia cells. The HDAC inhibitors apicidin and n-butyrate suppress the proliferation of EoL-1 cells and induce differentiation into eosinophils by a decrease in the protein level of FIP1L1-PDGFRalpha without affecting the mRNA level for FIP1L1-PDGFRA. In this study, we analyzed the mechanism by which the protein level of FIP1L1-PDGFRalpha is decreased by apicidin and n-butyrate. EoL-1 cells were incubated in the presence of the HDAC inhibitors apicidin, trichostatin A or n-butyrate. The protein levels of FIP1L1-PDGFRalpha and phosphorylated eIF-2alpha were determined by Western blotting. Actinomycin D and cycloheximide were used to block RNA synthesis and protein synthesis, respectively, in the chasing experiment of the amount of FIP1L1-PDGFRalpha protein. When apicidin- and n-butyrate-treated EoL-1 cells were incubated in the presence of actinomycin D, the decrease in the protein level of FIP1L1-PDGFRalpha was significantly enhanced when compared with controls. In contrast, the protein levels were not changed by cycloheximide among these groups. Apicidin and n-butyrate induced the continuous phosphorylation of eIF-2alpha for up to 8 days. The decrease in the level of FIP1L1-PDGFRalpha protein by continuous inhibition of HDAC may be due to the decrease in the translation rate of FIP1L1-PDGFRA. Copyright 2008 S. Karger AG, Basel.
Christophersen, Edward; Butt, Zeeshan
2012-12-01
Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.
Bisciotti, G N; Volpi, P; Zini, R; Auci, A; Aprato, A; Belli, A; Bellistri, G; Benelli, P; Bona, S; Bonaiuti, D; Carimati, G; Canata, G L; Cassaghi, G; Cerulli, S; Delle Rose, G; Di Benedetto, P; Di Marzo, F; Di Pietto, F; Felicioni, L; Ferrario, L; Foglia, A; Galli, M; Gervasi, E; Gia, L; Giammattei, C; Guglielmi, A; Marioni, A; Moretti, B; Niccolai, R; Orgiani, N; Pantalone, A; Parra, F; Quaglia, A; Respizzi, F; Ricciotti, L; Pereira Ruiz, M T; Russo, A; Sebastiani, E; Tancredi, G; Tosi, F; Vuckovic, Z
2016-01-01
The nomenclature and the lack of consensus of clinical evaluation and imaging assessment in groin pain generate significant confusion in this field. The Groin Pain Syndrome Italian Consensus Conference has been organised in order to prepare a consensus document regarding taxonomy, clinical evaluation and imaging assessment for groin pain. A 1-day Consensus Conference was organised on 5 February 2016, in Milan (Italy). 41 Italian experts with different backgrounds participated in the discussion. A consensus document previously drafted was discussed, eventually modified, and finally approved by all members of the Consensus Conference. Unanimous consensus was reached concerning: (1) taxonomy (2) clinical evaluation and (3) imaging assessment. The synthesis of these 3 points is included in this paper. The Groin Pain Syndrome Italian Consensus Conference reached a consensus on three main points concerning the groin pain syndrome assessment, in an attempt to clarify this challenging medical problem. PMID:28890800
Besselink, Marc G; van Rijssen, L Bengt; Bassi, Claudio; Dervenis, Christos; Montorsi, Marco; Adham, Mustapha; Asbun, Horacio J; Bockhorn, Maximillian; Strobel, Oliver; Büchler, Markus W; Busch, Olivier R; Charnley, Richard M; Conlon, Kevin C; Fernández-Cruz, Laureano; Fingerhut, Abe; Friess, Helmut; Izbicki, Jakob R; Lillemoe, Keith D; Neoptolemos, John P; Sarr, Michael G; Shrikhande, Shailesh V; Sitarz, Robert; Vollmer, Charles M; Yeo, Charles J; Hartwig, Werner; Wolfgang, Christopher L; Gouma, Dirk J
2017-02-01
Recent literature suggests that chyle leak may complicate up to 10% of pancreatic resections. Treatment depends on its severity, which may include chylous ascites. No international consensus definition or grading system of chyle leak currently is available. The International Study Group on Pancreatic Surgery, an international panel of pancreatic surgeons working in well-known, high-volume centers, reviewed the literature and worked together to establish a consensus on the definition and classification of chyle leak after pancreatic operation. Chyle leak was defined as output of milky-colored fluid from a drain, drain site, or wound on or after postoperative day 3, with a triglyceride content ≥110 mg/dL (≥1.2 mmol/L). Three different grades of severity were defined according to the management needed: grade A, no specific intervention other than oral dietary restrictions; grade B, prolongation of hospital stay, nasoenteral nutrition with dietary restriction, total parenteral nutrition, octreotide, maintenance of surgical drains, or placement of new percutaneous drains; and grade C, need for other more invasive in-hospital treatment, intensive care unit admission, or mortality. This classification and grading system for chyle leak after pancreatic resection allows for comparison of outcomes between series. As with the other the International Study Group on Pancreatic Surgery consensus statements, this classification should facilitate communication and evaluation of different approaches to the prevention and treatment of this complication. Copyright © 2016 Elsevier Inc. All rights reserved.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
[GEITDAH consensus on attention deficit hyperactivity disorder].
Montañés-Rada, F; Gastaminza-Pérez, X; Catalá, M A; Ruiz-Sanz, F; Ruiz-Lázaro, P M; Herreros-Rodríguez, O; García-Giral, M; Ortiz-Guerra, J; Alda-Díez, J A; Mojarro-Práxedes, D; Cantó-Díez, T; Mardomingo-Sanz, M J; Sasot-Llevadot, J; Pàmias, M; Rey-Sánchez, F
2010-11-16
In this article, the GEITDAH -the Spanish abbreviation of the Special Interest Group on Attention Deficit Hyper-activity Disorder (ADHD)- presents a consensus reached by experts in the management of ADHD from all over Spain. The consensus concerns fundamental aspects that should be the starting point for future local or regional consensus guides. Another aim of this consensus is also to reduce the amount of variability that occurs in the health care offered to patients with ADHD in our country, as well as to act as a stimulus in educational matters. That fact that it is not very long will make it more popular among greater numbers of people and this will allow these goals to be reached more effectively. The conclusions in the consensus guide have been constructed around an introduction dealing with basic aspects and recommendations for diagnosis, treatment (both pharmacological and psychotherapeutic), patient flow and organisational aspects.
Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija
1999-01-01
A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively. PMID:10473394
Rare observation of daytime whistlers at very low latitude (L = 1.08)
NASA Astrophysics Data System (ADS)
Gokani, Sneha A.; Singh, Rajesh; Tulasi Ram, S.; Venkatesham, K.; Veenadhari, B.; Kumar, Sandeep; Selvakumaran, R.
2018-04-01
The source region and propagation mechanism of low latitude whistlers (Geomag. lat. <30°) have puzzled scientific community for last many decades. In view of recent reports, there is consensus on the source region of low latitude whistlers in the vicinity of the conjugate point. But the plausible conditions of ionospheric medium through which they travel are still uncertain. In addition to that, the whistlers in daytime are never observed at geomagnetic latitudes less than 20°. Here, for the first time, we present a rare observations of whistlers during sunlit hours from a very low-latitude station Allahabad (Geomag. Lat: 16.79°N, L = 1.08) in India on 04 February 2011. More than 90 whistlers are recorded during 1200-1300 UT during which the whole propagation path from lightning source region to whistler observation site is under sunlit. The favorable factors that facilitated the whistlers prior to the sunset are investigated in terms of source lightning characteristics, geomagnetic and background ionospheric medium conditions. The whistler activity period was found to be geomagnetically quiet. However, a significant suppression in ionospheric total electron content (TEC) compared to its quiet day average is found. This shows that background ionospheric conditions may play a key role in low latitude whistler propagation. This study reveals that whistlers can occur under sunlit hours at latitudes as low as L = 1.08 when the source lightning and ionospheric medium characteristics are optimally favorable.
Pizarro, Carolina; García-Díaz, Diego F; Codner, Ethel; Salas-Pérez, Francisca; Carrasco, Elena; Pérez-Bravo, Francisco
2014-11-01
Type 1 diabetes (T1D) has a complex etiology in which genetic and environmental factors are involved, whose interactions have not yet been completely clarified. In this context, the role in PD-1 pathway and its ligands 1 and 2 (PD-L1 and PD-L2) have been proposed as candidates in several autoimmune diseases. The aim of this work was to determine the allele and haplotype frequency of six gene polymorphisms of PD-ligands (PD-L1 and PD-L2) in Chilean T1D patients and their effect on serum levels of PD-L1 and autoantibody profile (GAD65 and IA2). This study cohort comprised 205 T1D patients and 205 normal children. We performed genotypic analysis of PD-L1 and PD-L2 genes by TaqMan method. Determination of anti-GAD65 and anti-IA-2 autoantibodies was performed by ELISA. The PD-L1 serum levels were measured. The allelic distribution of PD-L1 variants (rs2297137 and rs4143815) showed differences between T1D patients and controls (p = 0.035 and p = 0.022, respectively). No differences were detected among the PD-L2 polymorphisms, and only the rs16923189 showed genetic variation. T1D patients showed decreased serum levels of PD-L1 compared to controls: 1.42 [0.23-7.45] ng/mL versus 3.35 [0.49-5.89] ng/mL (p < 0.025). In addition, the CGG haplotype in PD-L1 associated with T1D (constructed from rs822342, rs2297137 and rs4143815 polymorphisms) showed an OR = 1.44 [1.08 to 1.93]. Finally, no association of these genetic variants was observed with serum concentrations of PD ligands or auto-antibody profile, although a correlation between PD-L1 ligand serum concentration and the age at disease onset was detected. Two polymorphism of PD-L1 are presented in different allelic variants between T1D and healthy subjects, also PDL-1 serum levels are significantly lowered in diabetics patients. Moreover, the age of onset of the disease determine differences between serum ligand levels in diabetics, being lower in younger. These results points to a possible establishment of
Threshold to Transfer Writing Skills from L1 to L2
ERIC Educational Resources Information Center
Ito, Fumihiko
2009-01-01
Background: It has been hypothesized that L2 (second language) readers are not able to draw on their L1 (first language) reading skills for the successful development of L2 reading skills until they develop a certain proficiency in L2 because a lack of proficiency blocks transfer of L1 reading skills to the reading of L2 texts. This minimum degree…
Evaluation of Water-Borne Lead and Chromium Free Anti-Corrosive Primers.
1982-07-30
000 a ’M0 0 nv 0 001 o % H-- H H- r- -. 4 Ch N 0 HI’t %ol c OD N I Co0 0 Ni01 en00l 00 0 . 4P A 0 r-4 B- S IV4 LolRI t a 00o 00 0 D0 NJ H-0 -r r4 V... Company Contact Sample No. ICI Americas W.P. Long S -6 Specialty Chemicals Div. Development Manager P.O. Box 751 Product Development Dept. New Murphy Rd...6iD-A128 833 EVALUATION OF iWTER-BORNE LEAD RND CHROMIUM FREE i/i ANTI-CORROSIVE PRIMERS(U) DL LABS NEWl YORK S B LEVINSON ET AL. 30 JUL 82 DL-68iB
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won
2018-02-01
The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.
2018-01-01
Objectives The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Materials and Methods Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al2O3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test (p = 0.05). Results Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 (p < 0.05). Conclusions Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used. PMID:29487838
Effect of metal primers on bond strength of resin cements to base metals.
Fonseca, Renata Garcia; de Almeida, Juliana Gomes dos Santos Paes; Haneda, Isabella Gagliardi; Adabo, Gelson Luis
2009-04-01
A strong and durable bond between a metal framework and a resin-based luting agent is desired. Metal primers have been shown to be very effective on noble alloys. However, there is insufficient information about their effect on base metals. The purpose of this study was to evaluate the effect of metal primers on the shear bond strength of resin cements to base metals. A total of 160 cast commercially pure titanium (CP Ti) and NiCr alloy (VeraBond II) disks were embedded in a polyvinyl chloride ring, and their surfaces were smoothed with silicon carbide papers (320, 400, and 600 grit) and airborne-particle abraded with 50-mum aluminum oxide. Specimens of each metal were divided into 4 groups (n=20), which received one of the following luting techniques: (1) Panavia F, (2) Alloy Primer plus Panavia F, (3) Bistite II DC, or (4) Metaltite plus Bistite II DC. Forty minutes after preparation, all specimens were stored in distilled water at 37 degrees C for 24 hours and then thermal cycled (1000 cycles, 5-55 degrees C). After thermal cycling, the specimens were stored in 37 degrees C distilled water for an additional 24 hours or 6 months before being tested in shear mode. Data (MPa) were analyzed using 3-way ANOVA and the post hoc Tukey test (alpha=.05). Each specimen was examined under an optical microscope (x30), and the failure mode was classified as adhesive, cohesive, or a combination of these. The only significant difference between the Panavia F and Alloy Primer plus Panavia F groups occurred in the NiCr alloy at 24 hours, at which point Panavia F demonstrated superior bond strength compared to Alloy Primer plus Panavia F (P<.001). The Bistite II DC and Metaltite plus Bistite II DC groups were not significantly different. The Bistite II DC and Metaltite plus Bistite II DC groups demonstrated significantly lower bond strength to CP Ti (P<.001) than the Panavia F and Alloy Primer plus Panavia F groups, and significantly lower bond strength to NiCr alloy (P<.001) than
Three cases with L1 syndrome and two novel mutations in the L1CAM gene.
Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco
2015-11-01
Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.
Social and strategic imitation: the way to consensus.
Vilone, Daniele; Ramasco, José J; Sánchez, Angel; Miguel, Maxi San
2012-01-01
Humans do not always make rational choices, a fact that experimental economics is putting on solid grounds. The social context plays an important role in determining our actions, and often we imitate friends or acquaintances without any strategic consideration. We explore here the interplay between strategic and social imitative behavior in a coordination problem on a social network. We observe that for interactions on 1D and 2D lattices any amount of social imitation prevents the freezing of the network in domains with different conventions, thus leading to global consensus. For interactions on complex networks, the interplay of social and strategic imitation also drives the system towards global consensus while neither dynamics alone does. We find an optimum value for the combination of imitative behaviors to reach consensus in a minimum time, and two different dynamical regimes to approach it: exponential when social imitation predominates, power-law when strategic considerations prevail.
Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme
2011-01-01
Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605
Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T
1988-05-01
Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.
The Relationship between L1 Fluency and L2 Fluency Development
ERIC Educational Resources Information Center
Derwing, Tracey M.; Munro, Murray J.; Thomson, Ronald I.; Rossiter, Marian J.
2009-01-01
A fundamental question in the study of second language (L2) fluency is the extent to which temporal characteristics of speakers' first language (L1) productions predict the same characteristics in the L2. A close relationship between a speaker's L1 and L2 temporal characteristics would suggest that fluency is governed by an underlying trait. This…
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Tremblay-LeMay, Rosemarie; Rastgoo, Nasrin; Chang, Hong
2018-03-27
Even with recent advances in therapy regimen, multiple myeloma patients commonly develop drug resistance and relapse. The relevance of targeting the PD-1/PD-L1 axis has been demonstrated in pre-clinical models. Monotherapy with PD-1 inhibitors produced disappointing results, but combinations with other drugs used in the treatment of multiple myeloma seemed promising, and clinical trials are ongoing. However, there have recently been concerns about the safety of PD-1 and PD-L1 inhibitors combined with immunomodulators in the treatment of multiple myeloma, and several trials have been suspended. There is therefore a need for alternative combinations of drugs or different approaches to target this pathway. Protein expression of PD-L1 on cancer cells, including in multiple myeloma, has been associated with intrinsic aggressive features independent of immune evasion mechanisms, thereby providing a rationale for the adoption of new strategies directly targeting PD-L1 protein expression. Drugs modulating the transcriptional and post-transcriptional regulation of PD-L1 could represent new therapeutic strategies for the treatment of multiple myeloma, help potentiate the action of other drugs or be combined to PD-1/PD-L1 inhibitors in order to avoid the potentially problematic combination with immunomodulators. This review will focus on the pathophysiology of PD-L1 expression in multiple myeloma and drugs that have been shown to modulate this expression.
A Self-Categorization Explanation for Opinion Consensus Perceptions
ERIC Educational Resources Information Center
Zhang, Jinguang; Reid, Scott A.
2013-01-01
The public expression of opinions (and related communicative activities) hinges upon the perception of opinion consensus. Current explanations for opinion consensus perceptions typically focus on egocentric and other biases, rather than functional cognitions. Using self-categorization theory we showed that opinion consensus perceptions flow from…
Sies, Helmut; Hollman, Peter C.H.; Grune, Tilman; Stahl, Wilhelm; Biesalski, Hans K.; Williamson, Gary
2012-01-01
Criteria for assessing the purported protection by flavanol-rich foods against vascular dysfunction and oxidative damage to biomolecules was the subject of the 27th Hohenheim Consensus Conference held on July 11, 2011. State-of-the-art evidence was put into perspective, focusing on several questions that were followed by a consensus answer. Among the topics addressed were the major sources of flavanols in the human diet, the bioavailability of flavanols, biomarkers for “health benefit,” and the biological function of flavanols. Consensus was reached on these topics. No conclusion was reached on the design of randomized, controlled trials for substantiation of health claims for flavanol-rich foods as to the necessity of a study arm with an isolated pharmacologically active compound, e.g., (−)-epicatechin. PMID:22516731
L1 literacy affects L2 pronunciation intake and text vocalization
NASA Astrophysics Data System (ADS)
Walton, Martin
2005-04-01
For both deaf and hearing learners, L1 acquisition calls on auditive, gestural and visual modes in progressive processes over longer stages imposed in strictly anatomical and social order from the earliest pre-lexical phase [Jusczyk (1993), Kuhl & Meltzoff (1996)] to ultimate literacy. By contrast, L2 learning will call on accelerating procedures but with restricted input, arbitrated by L1 literacy as can be traced in the English of French-speaking learners, whether observed in spontaneous speech or in text vocalization modes. An inventory of their predictable omissions, intrusions and substitutions at suprasegmental and syllabic levels, many of which they can actually hear while unable to vocalize in real-time, suggests that a photogenic segmentation of continuous speech into alphabetical units has eclipsed the indispensable earlier phonogenic module, filtering L2 intake and output. This competing mode analysis hypothesizes a critical effect on L2 pronunciation of L1 graphemic procedures acquired usually before puberty, informing data for any Critical Period Hypothesis or amounts of L1 activation influencing L2 accent [Flege (1997, 1998)] or any psychoacoustic French deafness with regard to English stress-timing [Dupoux (1997)]. A metaphonic model [Howell & Dean (1991)] adapted for French learners may remedially distance L1 from L2 vocalization procedures.
Primer Vector Optimization: Survey of Theory, new Analysis and Applications
NASA Astrophysics Data System (ADS)
Guzman
This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and
Detection of high PD-L1 expression in oral cancers by a novel monoclonal antibody L1Mab-4.
Yamada, Shinji; Itai, Shunsuke; Kaneko, Mika K; Kato, Yukinari
2018-03-01
Programmed cell death-ligand 1 (PD-L1), which is a ligand of programmed cell death-1 (PD-1), is a type I transmembrane glycoprotein that is expressed on antigen-presenting cells and several tumor cells, including melanoma and lung cancer cells. There is a strong correlation between human PD-L1 (hPD-L1) expression on tumor cells and negative prognosis in cancer patients. In this study, we produced a novel anti-hPD-L1 monoclonal antibody (mAb), L 1 Mab-4 (IgG 2b , kappa), using cell-based immunization and screening (CBIS) method and investigated hPD-L1 expression in oral cancers. L 1 Mab-4 reacted with oral cancer cell lines (Ca9-22, HO-1-u-1, SAS, HSC-2, HSC-3, and HSC-4) in flow cytometry and stained oral cancers in a membrane-staining pattern. L 1 Mab-4 stained 106/150 (70.7%) of oral squamous cell carcinomas, indicating the very high sensitivity of L 1 Mab-4. These results indicate that L 1 Mab-4 could be useful for investigating the function of hPD-L1 in oral cancers.
Mahmood, Shahid; Freitag, Thomas E; Prosser, James I
2006-06-01
PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
Hayat Topcu; Nergiz Coban; Keith Woeste; Mehmet Sutyemez; Salih Kafkas
2015-01-01
We attempted to develop new polymorphic SSR primer pairs in walnut using sequences derived from Juglans nigra L. genomic enriched library with GA repeat. The designed 94 SSR primer pairs were subjected to gradient PCR in 12 walnut cultivars to determine their optimum annealing temperatures and to determine whether they produce bands. Then, the...
Skela-Savič, Brigita; Macrae, Rhoda; Lillo-Crespo, Manuel; Rooney, Kevin D
2017-06-01
There is a limited body of research in the field of healthcare improvement science (HIS). Quality improvement and 'change making' should become an intrinsic part of everyone's job, every day in all parts of the healthcare system. The lack of theoretical grounding may partly explain the minimal transfer of health research into health policy. This article seeks to present the development of the definition for healthcare improvement science. A consensus method approach was adopted with a two-stage Delphi process, expert panel and consensus group techniques. A total of 18 participants were involved in the expert panel and consensus group, and 153 answers were analysed as a part of the Delphi survey. Participants were researchers, educators and healthcare professionals from Scotland, Slovenia, Spain, Italy, England, Poland, and Romania. A high level of consensus was achieved for the broad definition in the 2nd Delphi iteration (86%). The final definition was agreed on by the consensus group: 'Healthcare improvement science is the generation of knowledge to cultivate change and deliver person-centred care that is safe, effective, efficient, equitable and timely. It improves patient outcomes, health system performance and population health.' The process of developing a consensus definition revealed different understandings of healthcare improvement science between the participants. Having a shared consensus definition of healthcare improvement science is an important step forward, bringing about a common understanding in order to advance the professional education and practice of healthcare improvement science.
NASA Astrophysics Data System (ADS)
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Great Lakes rivermouths: a primer for managers
Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul
2013-01-01
Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described
L1 Explicit Instruction Can Improve L2 Online and Offline Performance
ERIC Educational Resources Information Center
McManus, Kevin; Marsden, Emma
2017-01-01
This study investigated the effectiveness of providing L1 explicit information (EI) with practice for making more accurate and faster interpretations of L2 French "Imparfait" (IMP). Two treatments were investigated: (a) "L2-only," providing EI about the L2 with L2 interpretation practice, and (b) "L2+L1," providing…
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weber, James R.; Schell, Charlotte J.; Marino, T
2004-02-10
This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.
Ultra-fast consensus of discrete-time multi-agent systems with multi-step predictive output feedback
NASA Astrophysics Data System (ADS)
Zhang, Wenle; Liu, Jianchang
2016-04-01
This article addresses the ultra-fast consensus problem of high-order discrete-time multi-agent systems based on a unified consensus framework. A novel multi-step predictive output mechanism is proposed under a directed communication topology containing a spanning tree. By predicting the outputs of a network several steps ahead and adding this information into the consensus protocol, it is shown that the asymptotic convergence factor is improved by a power of q + 1 compared to the routine consensus. The difficult problem of selecting the optimal control gain is solved well by introducing a variable called convergence step. In addition, the ultra-fast formation achievement is studied on the basis of this new consensus protocol. Finally, the ultra-fast consensus with respect to a reference model and robust consensus is discussed. Some simulations are performed to illustrate the effectiveness of the theoretical results.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
Recombination Creates Novel L1 (Line-1) Elements in Rattus Norvegicus
Hayward, B. E.; Zavanelli, M.; Furano, A. V.
1997-01-01
Mammalian L1 (long interspersed repeated DNA, LINE-1) retrotransposons consist of a 5' untranslated region (UTR) with regulatory properties, two protein encoding regions (ORF I, ORF II, which encodes a reverse transcriptase) and a 3' UTR. L1 elements have been evolving in mammals for >100 million years and this process continues to generate novel L1 subfamilies in modern species. Here we characterized the youngest known subfamily in Rattus norvegicus, L1(mlvi2), and unexpectedly found that this element has a dual ancestry. While its 3' UTR shares the same lineage as its nearest chronologically antecedent subfamilies, L1(3) and L1(4), its ORF I sequence does not. The L1(mlvi2) ORF I was derived from an ancestral ORF I sequence that was the evolutionary precursor of the L1(3) and L1(4) ORF I. We suggest that an ancestral ORF I sequence was recruited into the modern L1(mlvi2) subfamily by recombination that possibly could have resulted from template strand switching by the reverse transcriptase during L1 replication. This mechanism could also account for some of the structural features of rodent L1 5' UTR and ORF I sequences including one of the more dramatic features of L1 evolution in mammals, namely the repeated acquisition of novel 5' UTRs. PMID:9178013
COPD control: Can a consensus be found?
Guimarães, M; Bugalho, A; Oliveira, A S; Moita, J; Marques, A
2016-01-01
There are currently no reliable instruments for assessing the onset and progression of chronic obstructive pulmonary disease (COPD) or predicting its prognosis. Currently, a comprehensive assessment of COPD including several objective and subjective parameters is recommended. However, the lack of biomarkers precludes a correct assessment of COPD severity, which consequently hampers adequate therapeutic approaches and COPD control. In the absence of a definition of "well-controlled disease", a consensus regarding COPD control will be difficult to reach. However, COPD patient assessment should be multidimensional, and anchored in five points: control of symptoms, decline of pulmonary function, levels of physical activity, exacerbations, and Quality of Life. Several non-pharmacological and pharmacological measures are currently available to achieve disease control. Smoking cessation, vaccination, exercise training programs and pulmonary rehabilitation are recognized as important non-pharmacological measures but bronchodilators are the pivotal therapy in the control of COPD. This paper discusses several objective and subjective parameters that may bridge the gap between disease assessment and disease control. The authors conclude that, at present, it is not possible to reach a consensus regarding COPD control, essentially due to the lack of objective instruments to measure it. Some recommendations are set forth, but true COPD control awaits further objective assessments. Copyright © 2016. Published by Elsevier España, S.L.U.
A consensus statement on how to conduct inclusive health research.
Frankena, T K; Naaldenberg, J; Cardol, M; Garcia Iriarte, E; Buchner, T; Brooker, K; Embregts, P; Joosa, E; Crowther, F; Fudge Schormans, A; Schippers, A; Walmsley, J; O'Brien, P; Linehan, C; Northway, R; van Schrojenstein Lantman-de Valk, H; Leusink, G
2018-04-11
The active involvement of people with intellectual disabilities in research, or inclusive research, is relatively common. However, inclusive health research is less common, even though it is expected to lead to appropriate healthcare and increased quality of life. Inclusive health research can build upon lessons learned from inclusive research. A total of 17 experts on inclusive (health) research without intellectual disabilities and 40 experts with intellectual disabilities collaborated in this consensus statement. The consensus statement was developed in three consecutive rounds: (1) an initial feedback round; (2) a roundtable discussion at the 2016 International Association for the Scientific Study of Intellectual and Developmental Disabilities World Congress; and (3) a final feedback round. This consensus statement provides researchers with guidelines, agreed upon by experts in the field, regarding attributes, potential outcomes, reporting and publishing, and future research directions, for designing and conducting inclusive health research. Consensus was reached on how to design and conduct inclusive health research. However, this statement should be continuously adapted to incorporate recent knowledge. The focus of this consensus statement is largely on inclusive health research, but the principles can also be applied to other areas. © 2018 MENCAP and International Association of the Scientific Study of Intellectual and Developmental Disabilities and John Wiley & Sons Ltd.
A method for predicting service life of zinc rich primers on carbon steel
NASA Technical Reports Server (NTRS)
Hoppesch, C. W.
1986-01-01
The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Atmospheric Science Data Center
2018-05-07
... Level: L1 Platform: DEEP SPACE CLIMATE OBSERVATORY Instrument: CCD IMAGER Spatial ... L1B LAGRANGE Legacy: Retired data product , click here for a newer version. For more information or ...
Atmospheric Science Data Center
2018-05-05
... Level: L1 Platform: DEEP SPACE CLIMATE OBSERVATORY Instrument: CCD IMAGER Spatial ... L1B LAGRANGE Legacy: Retired data product , click here for a newer version. For more information or ...
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Stress-Induced Acoustic Variation in L2 and L1 Spanish Vowels.
Romanelli, Sofía; Menegotto, Andrea; Smyth, Ron
2018-05-28
We assessed the effect of lexical stress on the duration and quality of Spanish word-final vowels /a, e, o/ produced by American English late intermediate learners of L2 Spanish, as compared to those of native L1 Argentine Spanish speakers. Participants read 54 real words ending in /a, e, o/, with either final or penultimate lexical stress, embedded in a text and a word list. We measured vowel duration and both F1 and F2 frequencies at 3 temporal points. stressed vowels were longer than unstressed vowels, in Spanish L1 and L2. L1 and L2 Spanish stressed /a/ and /e/ had higher F1 values than their unstressed counterparts. Only the L2 speakers showed evidence of rising offglides for /e/ and /o/. The L2 and L1 Spanish vowel space was compressed in the absence of stress. Lexical stress affected the vowel quality of L1 and L2 Spanish vowels. We provide an up-to-date account of the formant trajectories of Argentine River Plate Spanish word-final /a, e, o/ and offer experimental support to the claim that stress affects the quality of Spanish vowels in word-final contexts. © 2018 S. Karger AG, Basel.
Mazón, P; Galve, E; Gómez, J; Gorostidi, M; Górriz, J L; Mediavilla, J D
The opinion of experts (different specialties) on the triple fixed-dose antihypertensive therapy in clinical practice may differ. Online questionnaire with controversial aspects of the triple therapy answered by panel of experts in hypertension (HT) using two-round modified Delphi method. The questionnaire was completed by 158 experts: Internal Medicine (49), Nephrology (26), Cardiology (83). Consensus was reached (agreement) on 27/45 items (60%); 7 items showed differences statistically significant. Consensus was reached regarding: Predictive factors in the need for combination therapy and its efficacy vs. increasing the dose of a pretreatment, and advantage of triple therapy (prescription/adherence/cost/pressure control) vs. free combination. This consensus provides an overview of the clinical use of triple therapy in moderate-severe and resistant/difficult to control HT. Copyright © 2016 SEH-LELHA. Publicado por Elsevier España, S.L.U. All rights reserved.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-01-01
Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974
A Primer on Simulation and Gaming.
ERIC Educational Resources Information Center
Barton, Richard F.
In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…
Maertens, H; Aggarwal, R; Macdonald, S; Vermassen, F; Van Herzeele, I
2016-01-01
The aim of this study was to establish a consensus on Fundamental Endovascular Skills (FES) for educational purposes and development of training curricula for endovascular procedures. The term "Fundamental Endovascular Skills" is widely used; however, the current literature does not explicitly describe what skills are included in this concept. Endovascular interventions are performed by several specialties that may have opposing perspectives on these skills. A two round Delphi questionnaire approach was used. Experts from interventional cardiology, interventional radiology, and vascular surgery from the United States and Europe were invited to participate. An electronic questionnaire was generated by endovascular therapists with an appropriate educational background but who would not participate in subsequent rounds. The questionnaire consisted of 50 statements describing knowledge, technical, and behavioral skills during endovascular procedures. Experts received the questionnaires by email. They were asked to rate the importance of each skill on a Likert scale from 1 to 5. A statement was considered fundamental when more than 90% of the experts rated it 4 or 5 out of 5. Twenty-three of 53 experts invited agreed to participate: six interventional radiologists (2 USA, 4 Europe), 10 vascular surgeons (4 USA, 6 Europe), and seven interventional cardiologists (4 USA, 3 Europe). There was a 100% response rate in the first round and 87% in the second round. Results showed excellent consensus among responders (Cronbach's alpha = .95 first round; .93 second round). Ninety percent of all proposed skills were considered fundamental. The most critical skills were determined. A transatlantic multispecialty consensus was achieved about the content of "FES" among interventional radiologists, interventional cardiologists, and vascular surgeons from Europe and the United States. These results can serve as directive principles for developing endovascular training curricula
Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm
2012-01-01
We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
Influence of PD-L1 cross-linking on cell death in PD-L1-expressing cell lines and bovine lymphocytes
Ikebuchi, Ryoyo; Konnai, Satoru; Okagawa, Tomohiro; Yokoyama, Kazumasa; Nakajima, Chie; Suzuki, Yasuhiko; Murata, Shiro; Ohashi, Kazuhiko
2014-01-01
Programmed death-ligand 1 (PD-L1) blockade is accepted as a novel strategy for the reactivation of exhausted T cells that express programmed death-1 (PD-1). However, the mechanism of PD-L1-mediated inhibitory signalling after PD-L1 cross-linking by anti-PD-L1 monoclonal antibody (mAb) or PD-1–immunogloblin fusion protein (PD-1-Ig) is still unknown, although it may induce cell death of PD-L1+ cells required for regular immune reactions. In this study, PD-1-Ig or anti-PD-L1 mAb treatment was tested in cell lines that expressed PD-L1 and bovine lymphocytes to investigate whether the treatment induces immune reactivation or PD-L1-mediated cell death. PD-L1 cross-linking by PD-1-Ig or anti-PD-L1 mAb primarily increased the number of dead cells in PD-L1high cells, but not in PD-L1low cells; these cells were prepared from Cos-7 cells in which bovine PD-L1 expression was induced by transfection. The PD-L1-mediated cell death also occurred in Cos-7 and HeLa cells transfected with vectors only encoding the extracellular region of PD-L1. In bovine lymphocytes, the anti-PD-L1 mAb treatment up-regulated interferon-γ (IFN-γ) production, whereas PD-1-Ig treatment decreased this cytokine production and cell proliferation. The IFN-γ production in B-cell-depleted peripheral blood mononuclear cells was not reduced by PD-1-Ig treatment and the percentages of dead cells in PD-L1+ B cells were increased by PD-1-Ig treatment, indicating that PD-1-Ig-induced immunosuppression in bovine lymphocytes could be caused by PD-L1-mediated B-cell death. This study provides novel information for the understanding of signalling through PD-L1. PMID:24405267
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Technologies that complement congestion pricing : a primer.
DOT National Transportation Integrated Search
2008-10-01
The purpose of this volume is to consider the technology options that are available to complement congestion-pricing approaches. This primer explores how technology broadens the success for congestion pricing by supporting the traveler's decision to ...
Optimal consensus algorithm integrated with obstacle avoidance
NASA Astrophysics Data System (ADS)
Wang, Jianan; Xin, Ming
2013-01-01
This article proposes a new consensus algorithm for the networked single-integrator systems in an obstacle-laden environment. A novel optimal control approach is utilised to achieve not only multi-agent consensus but also obstacle avoidance capability with minimised control efforts. Three cost functional components are defined to fulfil the respective tasks. In particular, an innovative nonquadratic obstacle avoidance cost function is constructed from an inverse optimal control perspective. The other two components are designed to ensure consensus and constrain the control effort. The asymptotic stability and optimality are proven. In addition, the distributed and analytical optimal control law only requires local information based on the communication topology to guarantee the proposed behaviours, rather than all agents' information. The consensus and obstacle avoidance are validated through simulations.
Restrepo-Ortiz, Claudia X; Casamayor, Emilio O
2013-12-01
Quantitative environmental distribution of two widely distributed uncultured freshwater Euryarchaeota with unknown functional role was explored by newly designed quantitative PCR primers targeting the 16S rRNA gene of clades Miscellaneous Euryarchaeota Group (MEG, containing the groups pMC2A384 and VALII/Eury4) and Deep-Sea Euryarchaeotal Groups (DSEG, targeting the cluster named VALIII containing the DHVE-3/DSEG, BC07-2A-27/DSEG-3 and DSEG-2 groups), respectively. The summer surface plankton of 28 lakes was analysed, and one additional dimictic deep alpine lake, Lake Redon, was temporally and vertically surveyed covering seasonal limnological variability. A trophic range between 0.2 and 5.2 μg l(-1) Chl a, and pH span from 3.8 to 9.5 was explored at altitudes between 632 and 2590 m above sea level. The primers showed to be highly selective with c. 85% coverage and 100% specificity. Only pH significantly explained the changes observed in gene abundances and environment. In Lake Redon, DSEG bloomed in deep stratified waters both in summer and early spring, and MEG at intermediate depths during the ice-cover period. Overall, MEG and DSEG showed a differential ecological distribution although correlational analyses indicated lack of coupling of both Euryarchaeota with phytoplankton (chlorophyll a). However, an intriguing positive and significant relationship was found between DSEG and putative ammonia oxidizing thaumarchaeota. © 2013 John Wiley & Sons Ltd and Society for Applied Microbiology.
Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068
L1 English/L2 Spanish: Orthography-Phonology Activation without Contrasts
ERIC Educational Resources Information Center
Shea, Christine
2017-01-01
We consider how orthography activates sounds that are in a noncontrastive relationship in the second language (L2) and for which only one variant exists in the first language (L1). Participants were L1 English / L2 Spanish and native Spanish listeners. Intervocalically, Spanish graphemes "b d g" correspond phonetically to stops and…
Macrae, Rhoda; Lillo-Crespo, Manuel; Rooney, Kevin D
2017-01-01
Abstract Introduction There is a limited body of research in the field of healthcare improvement science (HIS). Quality improvement and ‘change making’ should become an intrinsic part of everyone’s job, every day in all parts of the healthcare system. The lack of theoretical grounding may partly explain the minimal transfer of health research into health policy. Methods This article seeks to present the development of the definition for healthcare improvement science. A consensus method approach was adopted with a two-stage Delphi process, expert panel and consensus group techniques. A total of 18 participants were involved in the expert panel and consensus group, and 153 answers were analysed as a part of the Delphi survey. Participants were researchers, educators and healthcare professionals from Scotland, Slovenia, Spain, Italy, England, Poland, and Romania. Results A high level of consensus was achieved for the broad definition in the 2nd Delphi iteration (86%). The final definition was agreed on by the consensus group: ‘Healthcare improvement science is the generation of knowledge to cultivate change and deliver person-centred care that is safe, effective, efficient, equitable and timely. It improves patient outcomes, health system performance and population health.’ Conclusions The process of developing a consensus definition revealed different understandings of healthcare improvement science between the participants. Having a shared consensus definition of healthcare improvement science is an important step forward, bringing about a common understanding in order to advance the professional education and practice of healthcare improvement science. PMID:28289467
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Oddo, Mauro; Poole, Daniele; Helbok, Raimund; Meyfroidt, Geert; Stocchetti, Nino; Bouzat, Pierre; Cecconi, Maurizio; Geeraerts, Thomas; Martin-Loeches, Ignacio; Quintard, Hervé; Taccone, Fabio Silvio; Geocadin, Romergryko G; Hemphill, Claude; Ichai, Carole; Menon, David; Payen, Jean-François; Perner, Anders; Smith, Martin; Suarez, José; Videtta, Walter; Zanier, Elisa R; Citerio, Giuseppe
2018-04-01
To report the ESICM consensus and clinical practice recommendations on fluid therapy in neurointensive care patients. A consensus committee comprising 22 international experts met in October 2016 during ESICM LIVES2016. Teleconferences and electronic-based discussions between the members of the committee subsequently served to discuss and develop the consensus process. Population, intervention, comparison, and outcomes (PICO) questions were reviewed and updated as needed, and evidence profiles generated. The consensus focused on three main topics: (1) general fluid resuscitation and maintenance in neurointensive care patients, (2) hyperosmolar fluids for intracranial pressure control, (3) fluid management in delayed cerebral ischemia after subarachnoid haemorrhage. After an extensive literature search, the principles of the Grading of Recommendations Assessment, Development and Evaluation (GRADE) system were applied to assess the quality of evidence (from high to very low), to formulate treatment recommendations as strong or weak, and to issue best practice statements when applicable. A modified Delphi process based on the integration of evidence provided by the literature and expert opinions-using a sequential approach to avoid biases and misinterpretations-was used to generate the final consensus statement. The final consensus comprises a total of 32 statements, including 13 strong recommendations and 17 weak recommendations. No recommendations were provided for two statements. We present a consensus statement and clinical practice recommendations on fluid therapy for neurointensive care patients.
L1 Use in L2 Vocabulary Learning: Facilitator or Barrier
ERIC Educational Resources Information Center
Liu, Jing
2008-01-01
Based on empirical research and qualitative analysis, this paper aims to explore the effects of L1 use on L2 vocabulary teaching. The results show that, during L2 vocabulary teaching process, the proper application of L1 can effectively facilitate the memorization of new words, and the bilingual method (both English explanation and Chinese…
NASA Astrophysics Data System (ADS)
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Delphi based consensus study into planning for chemical incidents.
Crawford, I W F; Mackway-Jones, K; Russell, D R; Carley, S D
2004-01-01
To achieve consensus in all phases of chemical incident planning and response. A three round Delphi study was conducted using a panel of 39 experts from specialties involved in the management of chemical incidents. Areas that did not reach consensus in the Delphi study were presented as synopsis statements for discussion in four syndicate groups at a conference hosted by the Department of Health Emergency Planning Co-ordination Unit. A total of 183 of 322 statements had reached consensus upon completion of the Delphi study. This represented 56.8% of the total number of statements. Of these, 148 reached consensus at >94% and 35 reached consensus at >89%. The results of the process are presented as a series of synopsis consensus statements that cover all phases of chemical incident planning and response. The use of a Delphi study and subsequent syndicate group discussions achieved consensus in aspects of all phases of chemical incident planning and response that can be translated into practical guidance for use at regional prehospital and hospital level. Additionally, areas of non-consensus have been identified where further work is required.
Delphi based consensus study into planning for chemical incidents
Crawford, I; Mackway-Jones, K; Russell, D; Carley, S
2004-01-01
Objective: To achieve consensus in all phases of chemical incident planning and response. Design: A three round Delphi study was conducted using a panel of 39 experts from specialties involved in the management of chemical incidents. Areas that did not reach consensus in the Delphi study were presented as synopsis statements for discussion in four syndicate groups at a conference hosted by the Department of Health Emergency Planning Co-ordination Unit. Results: A total of 183 of 322 statements had reached consensus upon completion of the Delphi study. This represented 56.8% of the total number of statements. Of these, 148 reached consensus at >94% and 35 reached consensus at >89%. The results of the process are presented as a series of synopsis consensus statements that cover all phases of chemical incident planning and response. Conclusions: The use of a Delphi study and subsequent syndicate group discussions achieved consensus in aspects of all phases of chemical incident planning and response that can be translated into practical guidance for use at regional prehospital and hospital level. Additionally, areas of non-consensus have been identified where further work is required. PMID:14734369
Wherrett, Diane K.; Chiang, Jane L.; Delamater, Alan M.; DiMeglio, Linda A.; Gitelman, Stephen E.; Gottlieb, Peter A.; Herold, Kevan C.; Lovell, Daniel J.; Orchard, Trevor J.; Ryan, Christopher M.; Schatz, Desmond A.; Wendler, David S.
2015-01-01
Emerging data suggest that type 1 diabetes is a more aggressive disease in children than in adults, with important differences in pathophysiology and clinical course. Therefore, the efficacy of disease-modifying therapies may be different in the two populations. Understanding the developmental and regulatory pathways for type 1 diabetes–modifying therapies in children will enable industry, academia, funders, advocacy groups, and regulators to translate new science to clinical care. This consensus report characterizes the fundamental differences in type 1 diabetes between children and adults and proposes a thoughtful approach to better understand the development and regulatory pathways for type 1 diabetes therapies. PMID:26404927
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Use of Convexity in Ostomy Care: Results of an International Consensus Meeting.
Hoeflok, Jo; Salvadalena, Ginger; Pridham, Sue; Droste, Werner; McNichol, Laurie; Gray, Mikel
Ostomy skin barriers that incorporate a convexity feature have been available in the marketplace for decades, but limited resources are available to guide clinicians in selection and use of convex products. Given the widespread use of convexity, and the need to provide practical guidelines for appropriate use of pouching systems with convex features, an international consensus panel was convened to provide consensus-based guidance for this aspect of ostomy practice. Panelists were provided with a summary of relevant literature in advance of the meeting; these articles were used to generate and reach consensus on 26 statements during a 1-day meeting. Consensus was achieved when 80% of panelists agreed on a statement using an anonymous electronic response system. The 26 statements provide guidance for convex product characteristics, patient assessment, convexity use, and outcomes.
Colinet, Anne-Sophie; Thines, Louise; Deschamps, Antoine; Flémal, Gaëlle; Demaegd, Didier; Morsomme, Pierre
2017-07-01
The UPF0016 family is a recently identified group of poorly characterized membrane proteins whose function is conserved through evolution and that are defined by the presence of 1 or 2 copies of the E-φ-G-D-[KR]-[TS] consensus motif in their transmembrane domain. We showed that 2 members of this family, the human TMEM165 and the budding yeast Gdt1p, are functionally related and are likely to form a new group of Ca 2+ transporters. Mutations in TMEM165 have been demonstrated to cause a new type of rare human genetic diseases denominated as Congenital Disorders of Glycosylation. Using site-directed mutagenesis, we generated 17 mutations in the yeast Golgi-localized Ca 2+ transporter Gdt1p. Single alanine substitutions were targeted to the highly conserved consensus motifs, 4 acidic residues localized in the central cytosolic loop, and the arginine at position 71. The mutants were screened in a yeast strain devoid of both the endogenous Gdt1p exchanger and Pmr1p, the Ca 2+ -ATPase of the Golgi apparatus. We show here that acidic and polar uncharged residues of the consensus motifs play a crucial role in calcium tolerance and calcium transport activity and are therefore likely to be architectural components of the cation binding site of Gdt1p. Importantly, we confirm the essential role of the E53 residue whose mutation in humans triggers congenital disorders of glycosylation. © 2017 John Wiley & Sons Ltd.
Microsatellite primers for vulnerable seagrass Halophila beccarii (Hydrocharitaceae).
Jiang, Kai; Shi, Yi-Su; Zhang, Jian; Xu, Na-Na
2011-06-01
Polymorphic microsatellite primers were developed in the vulnerable seagrass Halophila beccarii to investigate genetic variation and provide necessary markers for studying its population genetic structure. Six polymorphic and six monomorphic microsatellite loci were developed in H. beccarii. Most loci were successfully amplified across 40 H. beccarii individuals collected from three populations from coastal regions of southern China. Two to four alleles per locus were observed at the six polymorphic loci. The highest expected heterozygosity was 0.5737. The results demonstrate low levels of polymorphism in H. beccarii from coastal regions of southern China. They also illustrate that these primers may be useful for studying the mating system and population genetics of H. beccarii on a global scale.