CYTOPLASMIC DNA SYNTHESIS IN AMOEBA PROTEUS. 3. FURTHER STUDIES ON THE NATURE OF THE DNA--CONTAINING ELEMENTS.

PubMed

WOLSTENHOLME, D R; PLAUT, W

1964-09-01

The application of electron microscope autoradiography to Amoeba proteus cells labeled with tritiated thymidine has permitted the identification of morphologically distinct particles in the cytoplasm as the sites of incorporated DNA precursor. The particles correspond to those previously described from light microscope studies, with respect to both H(3)Tdr incorporation and distribution in centrifugally stratified amoebae. Ingested bacteria differ from the particles, in morphology as well as in the absence of associated label. Attempts to introduce a normal particle labeling pattern by incubating amoebae with labeled sediment derived from used amoeba medium failed. The resultant conclusion, that the particles are maintained in the amoeba by self-duplication, is supported by the presence of particles in configurations suggestive of division.

The acquisition of gender labels in infancy: implications for gender-typed play.

PubMed

Zosuls, Kristina M; Ruble, Diane N; Tamis-Lemonda, Catherine S; Shrout, Patrick E; Bornstein, Marc H; Greulich, Faith K

2009-05-01

Two aspects of children's early gender development-the spontaneous production of gender labels and gender-typed play-were examined longitudinally in a sample of 82 children. Survival analysis, a statistical technique well suited to questions involving developmental transitions, was used to investigate the timing of the onset of children's gender labeling as based on mothers' biweekly telephone interviews regarding their children's language from 9 through 21 months. Videotapes of children's play both alone and with mother during home visits at 17 and 21 months were independently analyzed for play with gender-stereotyped and gender-neutral toys. Finally, the relation between gender labeling and gender-typed play was examined. Children transitioned to using gender labels at approximately 19 months, on average. Although girls and boys showed similar patterns in the development of gender labeling, girls began labeling significantly earlier than boys. Modest sex differences in play were present at 17 months and increased at 21 months. Gender labeling predicted increases in gender-typed play, suggesting that knowledge of gender categories might influence gender typing before the age of 2. Copyright 2009 APA, all rights reserved

The acquisition of gender labels in infancy: Implications for sex-typed play

PubMed Central

Zosuls, Kristina M.; Ruble, Diane N.; Tamis-LeMonda, Catherine S.; Shrout, Patrick E.; Bornstein, Marc H.; Greulich, Faith K.

2009-01-01

Two aspects of children’s early gender development - the spontaneous production of gender labels and sex-typed play - were examined longitudinally in a sample of 82 children. Survival analysis, a statistical technique well suited to questions involving developmental transitions, was used to investigate the timing of the onset of children’s gender labeling as based on mothers’ biweekly reports on their children’s language from 9 through 21 months. Videotapes of children’s play both alone and with mother at 17 and 21 months were independently analyzed for play with gender stereotyped and neutral toys. Finally, the relation between gender labeling and sex-typed play was examined. Children transitioned to using gender labels at approximately 19 months on average. Although girls and boys showed similar patterns in the development of gender labeling, girls began labeling significantly earlier than boys. Modest sex differences in play were present at 17 months and increased at 21 months. Gender labeling predicted increases in sex-typed play, suggesting that knowledge of gender categories might influence sex-typing before the age of 2. PMID:19413425

Photosynthetic carbon metabolism in seagrasses C-labeling evidence for the c(3) pathway.

PubMed

Andrews, T J; Abel, K M

1979-04-01

The delta(13)C values of several seagrasses were considerably less negative than those of terrestrial C(3) plants and tended toward those of terrestrial C(4) plants. However, for Thalassia hemprichii (Ehrenb.) Aschers and Halophila spinulosa (R. Br.) Aschers, phosphoglycerate and other C(3) cycle intermediates predominated among the early labeled products of photosynthesis in (14)C-labeled seawater (more than 90% at the earliest times) and the labeling pattern at longer times was brought about by the operation of the C(3) pathway. Malate and aspartate together accounted for only a minor fraction of the total fixed label at all times and the kinetic data of this labeling were not at all consistent with these compounds being early intermediates in seagrass photosynthesis. Pulse-chase (14)C-labeling studies further substantiated these conclusions. Significant labeling of photorespiratory intermediates was observed in all experiments. The kinetics of total fixation of label during some steady-state and pulse-chase experiments suggested that there may be an intermediate pool of inorganic carbon of variable size closely associated with the leaves, either externally or internally. Such a pool may be one cause for the C(4)-like carbon isotope ratios of seagrasses.

Self-supervised ARTMAP.

PubMed

Amis, Gregory P; Carpenter, Gail A

2010-03-01

Computational models of learning typically train on labeled input patterns (supervised learning), unlabeled input patterns (unsupervised learning), or a combination of the two (semi-supervised learning). In each case input patterns have a fixed number of features throughout training and testing. Human and machine learning contexts present additional opportunities for expanding incomplete knowledge from formal training, via self-directed learning that incorporates features not previously experienced. This article defines a new self-supervised learning paradigm to address these richer learning contexts, introducing a neural network called self-supervised ARTMAP. Self-supervised learning integrates knowledge from a teacher (labeled patterns with some features), knowledge from the environment (unlabeled patterns with more features), and knowledge from internal model activation (self-labeled patterns). Self-supervised ARTMAP learns about novel features from unlabeled patterns without destroying partial knowledge previously acquired from labeled patterns. A category selection function bases system predictions on known features, and distributed network activation scales unlabeled learning to prediction confidence. Slow distributed learning on unlabeled patterns focuses on novel features and confident predictions, defining classification boundaries that were ambiguous in the labeled patterns. Self-supervised ARTMAP improves test accuracy on illustrative low-dimensional problems and on high-dimensional benchmarks. Model code and benchmark data are available from: http://techlab.eu.edu/SSART/. Copyright 2009 Elsevier Ltd. All rights reserved.

Defining multiple, distinct, and shared spatiotemporal patterns of DNA replication and endoreduplication from 3D image analysis of developing maize (Zea mays L.) root tip nuclei.

PubMed

Bass, Hank W; Hoffman, Gregg G; Lee, Tae-Jin; Wear, Emily E; Joseph, Stacey R; Allen, George C; Hanley-Bowdoin, Linda; Thompson, William F

2015-11-01

Spatiotemporal patterns of DNA replication have been described for yeast and many types of cultured animal cells, frequently after cell cycle arrest to aid in synchronization. However, patterns of DNA replication in nuclei from plants or naturally developing organs remain largely uncharacterized. Here we report findings from 3D quantitative analysis of DNA replication and endoreduplication in nuclei from pulse-labeled developing maize root tips. In both early and middle S phase nuclei, flow-sorted on the basis of DNA content, replicative labeling was widely distributed across euchromatic regions of the nucleoplasm. We did not observe the perinuclear or perinucleolar replicative labeling patterns characteristic of middle S phase in mammals. Instead, the early versus middle S phase patterns in maize could be distinguished cytologically by correlating two quantitative, continuous variables, replicative labeling and DAPI staining. Early S nuclei exhibited widely distributed euchromatic labeling preferentially localized to regions with weak DAPI signals. Middle S nuclei also exhibited widely distributed euchromatic labeling, but the label was preferentially localized to regions with strong DAPI signals. Highly condensed heterochromatin, including knobs, replicated during late S phase as previously reported. Similar spatiotemporal replication patterns were observed for both mitotic and endocycling maize nuclei. These results revealed that maize euchromatin exists as an intermingled mixture of two components distinguished by their condensation state and replication timing. These different patterns might reflect a previously described genome organization pattern, with "gene islands" mostly replicating during early S phase followed by most of the intergenic repetitive regions replicating during middle S phase.

Replacing maladaptive speech with verbal labeling responses: an analysis of generalized responding.

PubMed Central

Foxx, R M; Faw, G D; McMorrow, M J; Kyle, M S; Bittle, R G

1988-01-01

We taught three mentally handicapped students to answer questions with verbal labels and evaluated the generalized effects of this training on their maladaptive speech (e.g., echolalia) and correct responding to untrained questions. The students received cues-pause-point training on an initial question set followed by generalization assessments on a different set in another setting. Probes were conducted on novel questions in three other settings to determine the strength and spread of the generalization effect. A multiple baseline across subjects design revealed that maladaptive speech was replaced with correct labels (answers) to questions in the training and all generalization settings. These results replicate and extend previous research that suggested that cues-pause-point procedures may be useful in replacing maladaptive speech patterns by teaching students to use their verbal labeling repertoires. PMID:3225258

DNA SYNTHETIC RATES AND CHROMOSOME REPLICATION IN GENERATING MARROW CELLS,

DTIC Science & Technology

The normally dividing bone marrow cells of the domestic cat provede suitable material for the examination of DNA replication patterns in individual chromosomes. Autoradiographic studies of chromosomes labeled with tritiated thymidine indicate a direct relation of chromosome size to duration of DNA synthetic activity of the 10 hours of the S period studied. In this same period dividing cells achieved a maximum labeling of 80%. This suggests that a portion of the normally dividing cell population undergoes an arrest of considerable length in the G2 period. (Author)

To call a cloud 'cirrus': sound symbolism in names for categories or items.

PubMed

Ković, Vanja; Sučević, Jelena; Styles, Suzy J

2017-01-01

The aim of the present paper is to experimentally test whether sound symbolism has selective effects on labels with different ranges-of-reference within a simple noun-hierarchy. In two experiments, adult participants learned the make up of two categories of unfamiliar objects ('alien life forms'), and were passively exposed to either category-labels or item-labels, in a learning-by-guessing categorization task. Following category training, participants were tested on their visual discrimination of object pairs. For different groups of participants, the labels were either congruent or incongruent with the objects. In Experiment 1, when trained on items with individual labels, participants were worse (made more errors) at detecting visual object mismatches when trained labels were incongruent. In Experiment 2, when participants were trained on items in labelled categories, participants were faster at detecting a match if the trained labels were congruent, and faster at detecting a mismatch if the trained labels were incongruent. This pattern of results suggests that sound symbolism in category labels facilitates later similarity judgments when congruent, and discrimination when incongruent, whereas for item labels incongruence generates error in judgements of visual object differences. These findings reveal that sound symbolic congruence has a different outcome at different levels of labelling within a noun hierarchy. These effects emerged in the absence of the label itself, indicating subtle but pervasive effects on visual object processing.

Assimilate partitioning in avocado, Persea americana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finazzo, S.; Davenport, T.L.

1986-04-01

Assimilate partitioning is being studied in avocado, Persea americana cv. Millborrow in relation to fruit set. Single leaves on girdled branches of 10 year old trees were radiolabeled for 1 hr with 13..mu..Ci of /sup 14/CO/sub 2/. The source leaves were sampled during the experiment to measure translocation rates. At harvest the sink tissues were dissected and the incorporated radioactivity was measured. The translocation of /sup 14/C-labelled compounds to other leaves was minimal. Incorporation of label into fruitlets varied with the tissue and the stage of development. Sink (fruitlets) nearest to the labelled leaf and sharing the same phyllotaxy incorporatedmore » the most /sup 14/C. Source leaves for single non-abscising fruitlets retained 3X more /sup 14/C-labelled compounds than did source leaves for 2 or more fruitlets at 31 hrs. post-labelling. Export of label decreased appreciably when fruitlets abscised. If fruitlets abscised within 4 days of labeling then the translocation pattern was similar to the pattern for single fruitlets. If the fruitlet abscised later, the translocation pattern was intermediate between the single and double fruitlet pattern.« less

Graphic Warning Labels in Cigarette Advertisements: Recall and Viewing Patterns

PubMed Central

Strasser, Andrew A.; Tang, Kathy Z.; Romer, Daniel; Jepson, Chris; Cappella, Joseph N.

2012-01-01

Background The Family Smoking Prevention and Control Act gave the U.S. Food and Drug Administration (FDA) legal authority to mandate graphic warning labels on cigarette advertising and packaging. The FDA requires that these graphic warning labels be embedded into cigarette advertising and packaging by September 2012. Purpose The aim of this study was to examine differences in recall and viewing patterns of text-only versus graphic cigarette warning labels; and, the association between viewing patterns and recall. Methods Participants (current daily smokers; N=200) were randomized to view a cigarette advertisement with either text-only or graphic warning labels. Viewing patterns were measured using eye-tracking, and recall was later assessed. Sessions were conducted between November 2008 and November 2009. Data analysis was conducted between March 2011 and July 2011. Results There was a significant difference in percentage correct recall of the warning label between those in the text-only versus graphic warning label condition, 50% versus 83% (χ2 =23.74, p=0.0001). Time to first view of the graphic warning label text, and dwell time duration (i.e., time spent looking) on the graphic image were significantly associated with correct recall. Warning labels that drew attention more quickly and resulted in longer dwell times were associated with better recall. Conclusions Graphic warning labels improve smokers’ recall of warning and health risks; they do so by drawing and holding attention. PMID:22704744

Graphic warning labels in cigarette advertisements: recall and viewing patterns.

PubMed

Strasser, Andrew A; Tang, Kathy Z; Romer, Daniel; Jepson, Christopher; Cappella, Joseph N

2012-07-01

The Family Smoking Prevention and Control Act gave the U.S. Food and Drug Administration (FDA) legal authority to mandate graphic warning labels on cigarette advertising and packaging. The FDA requires that these graphic warning labels be embedded into cigarette advertising and packaging by September 2012. The aim of this study was to examine differences in recall and viewing patterns of text-only versus graphic cigarette warning labels and the association between viewing patterns and recall. Participants (current daily smokers; N=200) were randomized to view a cigarette advertisement with either text-only or graphic warning labels. Viewing patterns were measured using eye-tracking, and recall was later assessed. Sessions were conducted between November 2008 and November 2009. Data analysis was conducted between March 2011 and July 2011. There was a significant difference in percentage correct recall of the warning label between those in the text-only versus graphic warning label condition, 50% vs 83% (χ(2)=23.74, p=0.0001). Time to first viewing of the graphic warning label text and dwell time duration (i.e., time spent looking) on the graphic image were significantly associated with correct recall. Warning labels that drew attention more quickly and resulted in longer dwell times were associated with better recall. Graphic warning labels improve smokers' recall of warning and health risks; these labels do so by drawing and holding attention. Copyright © 2012 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

Maximum likelihood estimation of label imperfections and its use in the identification of mislabeled patterns

NASA Technical Reports Server (NTRS)

Chittineni, C. B.

1979-01-01

The problem of estimating label imperfections and the use of the estimation in identifying mislabeled patterns is presented. Expressions for the maximum likelihood estimates of classification errors and a priori probabilities are derived from the classification of a set of labeled patterns. Expressions also are given for the asymptotic variances of probability of correct classification and proportions. Simple models are developed for imperfections in the labels and for classification errors and are used in the formulation of a maximum likelihood estimation scheme. Schemes are presented for the identification of mislabeled patterns in terms of threshold on the discriminant functions for both two-class and multiclass cases. Expressions are derived for the probability that the imperfect label identification scheme will result in a wrong decision and are used in computing thresholds. The results of practical applications of these techniques in the processing of remotely sensed multispectral data are presented.

Young Children’s Competency to Take the Oath: Effects of Task, Maltreatment, and Age

PubMed Central

Carrick, Nathalie; Quas, Jodi A.

2012-01-01

This study examined maltreated and non-maltreated children’s (N = 183) emerging understanding of “truth” and “lie,” terms about which they are quizzed to qualify as competent to testify. Four- to six-year-old children were asked to accept or reject true and false (T/F) statements, label T/F statements as the “truth” or “a lie,” label T/F statements as “good” or “bad,” and label “truth” and “lie” as “good” or “bad.” The youngest children were at ceiling in accepting/rejecting T/F statements. The labeling tasks revealed improvement with age and children performed similarly across the tasks. Most children were better able to evaluate “truth” than “lie.” Maltreated children exhibited somewhat different response patterns, suggesting greater sensitivity to the immorality of lying. PMID:19263199

Lobular and cellular patterns of early hepatic glycogen deposition in the rat as observed by light and electron microscopic radioautography after injection of /sup 3/H-galactose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michaels, J.E.; Hung, J.T.; Garfield, S.A.

1984-05-01

Very low hepatic glycogen levels are achieved by overnight fasting of adrenalectomized (ADX) rats. Subsequent injection of dexamethasone (DEX), a synthetic glucocorticoid, stimulates marked increases in glycogen synthesis. Using this system and injecting /sup 3/H-galactose as a glycogen precursor 1 hr prior to sacrifice, the intralobular and intracellular patterns of labeled glycogen deposition were studied by light (LM) and electron (EM) microscopic radioautography. LM radioautography revealed that 1 hr after DEX treatment, labeling patterns for both periportal and centrilobular hepatocytes resembled those in rats with no DEX treatment: 18% of the hepatocytes were unlabeled, and 82% showed light labeling. Twomore » hours after treatment with DEX, 14% of the hepatocytes remained unlabeled, and 78% were lightly labeled; however, 8% of the cells, located randomly throughout the lobule, were intensely labeled. An increased number of heavily labeled cells (26%) appeared 3 hr after DEX treatment; and by 5 hr 91% of the hepatocytes were intensely labeled. Label over the periportal cells at this time was aggregated, whereas centrilobular cells displayed dispersed label. EM radioautographs showed that 2 to 3 hr after DEX injection initial labeling of hepatocytes, regardless of their intralobular location, occurred over foci of smooth endoplasmic reticulum (SER) and small electron-dense particles of presumptive glycogen, and in areas of SER and distinct glycogen particles. After 5 hrs of treatment with DEX, the intracellular distribution of label reflected the glycogen patterns characteristic of periportal or centrilobular regions.« less

Exploring enhanced menu labels' influence on fast food selections and exercise-related attitudes, perceptions, and intentions.

PubMed

Lee, Morgan S; Thompson, Joel Kevin

2016-10-01

Labeling restaurant menus with calorie counts is a popular public health intervention, but research shows these labels have small, inconsistent effects on behavior. Supplementing calorie counts with physical activity equivalents may produce stronger results, but few studies of these enhanced labels have been conducted, and the labels' potential to influence exercise-related outcomes remains unexplored. This online study evaluated the impact of no information, calories-only, and calories plus equivalent miles of walking labels on fast food item selection and exercise-related attitudes, perceptions, and intentions. Participants (N = 643) were randomly assigned to a labeling condition and completed a menu ordering task followed by measures of exercise-related outcomes. The labels had little effect on ordering behavior, with no significant differences in total calories ordered and counterintuitive increases in calories ordered in the two informational conditions in some item categories. The labels also had little impact on the exercise-related outcomes, though participants in the two informational conditions perceived exercise as less enjoyable than did participants in the no information condition, and trends following the same pattern were found for other exercise-related outcomes. The present findings concur with literature demonstrating small, inconsistent effects of current menu labeling strategies and suggest that alternatives such as traffic light systems should be explored. Copyright © 2016 Elsevier Ltd. All rights reserved.

Intestinal uptake of betaine in vitro and the distribution of methyl groups from betaine, choline, and methionine in the body of broiler chicks.

PubMed

Kettunen, H; Peuranen, S; Tiihonen, K; Saarinen, M

2001-02-01

The efficiency of betaine absorption into small intestinal slices of broiler chicks was studied in vitro with 14C-labeled betaine. The relative proportion of Na+-coupled betaine uptake, as well as the total uptake capacity was larger in the duodenum than in the jejunum. Dietary betaine increased the Na+-coupled uptake in the duodenum. In in vivo-experiments, methyl-14C-labeled betaine, methionine, or choline was fed to broiler chicks. Betaine appeared in the blood more rapidly, and reached a higher total concentration than choline or methionine. The data suggest that choline and methionine were associated with plasma lipoproteins whereas betaine remained free in the plasma. The label distribution in liver, kidney, and intestinal tissues was studied 24 h after label ingestion. Most of the label from betaine was found in the aquaeous phase in the muscle, while in the liver and jejunum the label from betaine was distributed more evenly between the aquaeous, lipid, and protein phases. Label from choline accumulated in the lipid fraction, particularly so in the liver, whereas label from methionine showed a more variable distribution pattern. The distribution results are interpreted in terms of specific roles of betaine, choline, and methionine in methyl group metabolism.

Easy as ABCABC: Abstract Language Facilitates Performance on a Concrete Patterning Task

ERIC Educational Resources Information Center

Fyfe, Emily R.; McNeil, Nicole M.; Rittle-Johnson, Bethany

2015-01-01

The labels used to describe patterns and relations can influence children's relational reasoning. In this study, 62 preschoolers (M[subscript age] = 4.4 years) solved and described eight pattern abstraction problems (i.e., recreated the relation in a model pattern using novel materials). Some children were exposed to concrete labels (e.g.,…

Adherence to Preexposure Prophylaxis: Current, Emerging, and Anticipated Bases of Evidence

PubMed Central

Amico, K. Rivet; Stirratt, Michael J.

2014-01-01

Despite considerable discussion and debate about adherence to preexposure prophylaxis (PrEP) for human immunodeficiency virus (HIV), scant data are available that characterize patterns of adherence to open-label PrEP. The current evidence base is instead dominated by research on adherence to placebo-controlled investigational drug by way of drug detection in active-arm participants of large randomized controlled trials (RCTs). Important differences between the context of blinded RCTs and open-label use suggest caution when generalizing from study product adherence to real-world PrEP use. Evidence specific to open-label PrEP adherence is presently sparse but will expand rapidly over the next few years as roll-out, demonstration projects, and more rigorous research collect and present findings. The current evidence bases established cannot yet predict uptake, adherence, or persistence with open-label effective PrEP. Emerging evidence suggests that some cohorts could execute better adherence in open-label use vs placebo-controlled research. Uptake of PrEP is presently slow in the United States; whether this changes as grassroots and community efforts increase awareness of PrEP as an effective HIV prevention option remains to be determined. As recommended by multiple guidelines for PrEP use, all current demonstration projects offer PrEP education and/or counseling. PrEP support approaches generally fall into community-based, technology, monitoring, and integrated sexual health promotion approaches. Developing and implementing research that moves beyond simple correlates of either study product use or open-label PrEP adherence toward more comprehensive models of sociobehavioral and socioecological adherence determinants would greatly accelerate progress. Intervention research is needed to identify effective models of support for open-label PrEP adherence. PMID:24926036

Measurement of Enzyme Isotope Effects.

PubMed

Kholodar, Svetlana A; Ghosh, Ananda K; Kohen, Amnon

2017-01-01

Enzyme isotope effects, or the kinetic effects of "heavy" enzymes, refer to the effect of isotopically labeled protein residues on the enzyme's activity or physical properties. These effects are increasingly employed in the examination of the possible contributions of protein dynamics to enzyme catalysis. One hypothesis assumed that isotopic substitution of all 12 C, 14 N, and nonexchangeable 1 H by 13 C, 15 N, and 2 H, would slow down protein picosecond to femtosecond dynamics without any effect on the system's electrostatics following the Born-Oppenheimer approximation. It was suggested that reduced reaction rates reported for several "heavy" enzymes accords with that hypothesis. However, numerous deviations from the predictions of that hypothesis were also reported. Current studies also attempt to test the role of individual residues by site-specific labeling or by labeling a pattern of residues on activity. It appears that in several systems the protein's fast dynamics are indeed reduced in "heavy" enzymes in a way that reduces the probability of barrier crossing of its chemical step. Other observations, however, indicated that slower protein dynamics are electrostatically altered in isotopically labeled enzymes. Interestingly, these effects appear to be system dependent, thus it might be premature to suggest a general role of "heavy" enzymes' effect on catalysis. © 2017 Elsevier Inc. All rights reserved.

Envelope: interactive software for modeling and fitting complex isotope distributions.

PubMed

Sykes, Michael T; Williamson, James R

2008-10-20

An important aspect of proteomic mass spectrometry involves quantifying and interpreting the isotope distributions arising from mixtures of macromolecules with different isotope labeling patterns. These patterns can be quite complex, in particular with in vivo metabolic labeling experiments producing fractional atomic labeling or fractional residue labeling of peptides or other macromolecules. In general, it can be difficult to distinguish the contributions of species with different labeling patterns to an experimental spectrum and difficult to calculate a theoretical isotope distribution to fit such data. There is a need for interactive and user-friendly software that can calculate and fit the entire isotope distribution of a complex mixture while comparing these calculations with experimental data and extracting the contributions from the differently labeled species. Envelope has been developed to be user-friendly while still being as flexible and powerful as possible. Envelope can simultaneously calculate the isotope distributions for any number of different labeling patterns for a given peptide or oligonucleotide, while automatically summing these into a single overall isotope distribution. Envelope can handle fractional or complete atom or residue-based labeling, and the contribution from each different user-defined labeling pattern is clearly illustrated in the interactive display and is individually adjustable. At present, Envelope supports labeling with 2H, 13C, and 15N, and supports adjustments for baseline correction, an instrument accuracy offset in the m/z domain, and peak width. Furthermore, Envelope can display experimental data superimposed on calculated isotope distributions, and calculate a least-squares goodness of fit between the two. All of this information is displayed on the screen in a single graphical user interface. Envelope supports high-quality output of experimental and calculated distributions in PNG or PDF format. Beyond simply comparing calculated distributions to experimental data, Envelope is useful for planning or designing metabolic labeling experiments, by visualizing hypothetical isotope distributions in order to evaluate the feasibility of a labeling strategy. Envelope is also useful as a teaching tool, with its real-time display capabilities providing a straightforward way to illustrate the key variable factors that contribute to an observed isotope distribution. Envelope is a powerful tool for the interactive calculation and visualization of complex isotope distributions for comparison to experimental data. It is available under the GNU General Public License from http://williamson.scripps.edu/envelope/.

Consumer purchasing patterns in response to calorie labeling legislation in New York City

PubMed Central

2011-01-01

Background Obesity is a major public health threat and policies aimed at curbing this epidemic are emerging. National calorie labeling legislation is forthcoming and requires rigorous evaluation to examine its impact on consumers. The purpose of this study was to examine whether point-of-purchase calorie labels in New York City (NYC) chain restaurants affected food purchasing patterns in a sample of lower income adults in NYC and Newark, NJ. Methods This study utilized a difference-in-difference design to survey 1,170 adult patrons of four popular chain restaurants in NYC and Newark, NJ (which did not introduce labeling) before and after calorie labeling was implemented in NYC. Receipt data were collected and analyzed to examine food and beverage purchases and frequency of fast food consumption. Descriptive statistics were generated, and linear and logistic regression, difference-in-difference analysis, and predicted probabilities were used to analyze the data. Results A difference-in-difference analysis revealed no significant favorable differences and some unfavorable differences in food purchasing patterns and frequency of fast food consumption between adult patrons of fast food restaurants in NYC and Newark, NJ. Adults in NYC who reported noticing and using the calorie labels consumed fast food less frequently compared to adults who did not notice the labels (4.9 vs. 6.6 meals per week, p <0.05). Conclusion While no favorable differences in purchasing as a result of labeling were noted, self-reported use of calorie labels was associated with some favorable behavioral patterns in a subset of adults in NYC. However, overall impact of the legislation may be limited. More research is needed to understand the most effective way to deliver calorie information to consumers. PMID:21619632

Consumer purchasing patterns in response to calorie labeling legislation in New York City.

PubMed

Vadiveloo, Maya K; Dixon, L Beth; Elbel, Brian

2011-05-27

Obesity is a major public health threat and policies aimed at curbing this epidemic are emerging. National calorie labeling legislation is forthcoming and requires rigorous evaluation to examine its impact on consumers. The purpose of this study was to examine whether point-of-purchase calorie labels in New York City (NYC) chain restaurants affected food purchasing patterns in a sample of lower income adults in NYC and Newark, NJ. This study utilized a difference-in-difference design to survey 1,170 adult patrons of four popular chain restaurants in NYC and Newark, NJ (which did not introduce labeling) before and after calorie labeling was implemented in NYC. Receipt data were collected and analyzed to examine food and beverage purchases and frequency of fast food consumption. Descriptive statistics were generated, and linear and logistic regression, difference-in-difference analysis, and predicted probabilities were used to analyze the data. A difference-in-difference analysis revealed no significant favorable differences and some unfavorable differences in food purchasing patterns and frequency of fast food consumption between adult patrons of fast food restaurants in NYC and Newark, NJ. Adults in NYC who reported noticing and using the calorie labels consumed fast food less frequently compared to adults who did not notice the labels (4.9 vs. 6.6 meals per week, p <0.05). While no favorable differences in purchasing as a result of labeling were noted, self-reported use of calorie labels was associated with some favorable behavioral patterns in a subset of adults in NYC. However, overall impact of the legislation may be limited. More research is needed to understand the most effective way to deliver calorie information to consumers.

Unraveling carbohydrate transport mechanisms in young beech trees (Fagus sylvatica f. purpurea) by 13CO2 efflux measurements from stem and soil

NASA Astrophysics Data System (ADS)

Thoms, Ronny; Muhr, Jan; Keitel, Claudia; Kayler, Zachary; Gavrichkova, Olga; Köhler, Michael; Gessler, Arthur; Gleixner, Gerd

2016-04-01

Transport mechanisms of soluble carbohydrates and diurnal CO2 efflux from tree stems and surrounding soil are well studied. However, the effect of transport carbohydrates on respiration and their interaction with storage processes is largely unknown. Therefore, we performed a set of 13CO2 pulse labeling experiments on young trees of European beech (Fagus sylvatica f. purpurea). We labeled the whole tree crowns in a closed transparent plastic chamber with 99% 13CO2 for 30 min. In one experiment, only a single branch was labeled and removed 36 hours after labeling. In all experiments, we continuously measured the 13CO2 efflux from stem, branch and soil and sampled leaf and stem material every 3 h for 2 days, followed by a daily sampling of leaves in the successive 5 days. The compound specific δ 13C value of extracted soluble carbohydrates from leaf and stem material was measured by high-performance liquid chromatography linked with an isotope ratio mass spectrometer (HPLC-IRMS). The 13CO2 signal from soil respiration occurred only few hours after labeling indicating a very high transport rate of carbohydrates from leaf to roots and to the rhizosphere. The label was continuously depleted within the next 5 days. In contrast, we observed a remarkable oscillating pattern of 13CO2 efflux from the stem with maximum 13CO2 enrichment at noon and minima at night time. This oscillation suggests that enriched carbohydrates are respired during the day, whereas in the night the enriched sugars are not respired. The observed oscillation in stem 13CO2 enrichment remained unchanged even when only single branches were labelled and cut right afterwards. Thus, storage and conversion of carbohydrates only occurred within the stem. The δ13C patterns of extracted soluble carbohydrates showed, that a transformation of transitory starch to carbohydrates and vice versa was no driver of the oscillating 13CO2 efflux from the stem. Carbohydrates might have been transported in the phloem to the location of biosynthesis further to a storage pool from which they are respired during the day. Keywords: 13CO2 efflux, oscillating pattern, carbohydrates, transitory starch

Anticonvulsant use after formulary status change for brand-name second-generation anticonvulsants.

PubMed

Patel, Hemal; Toe, Diana C; Burke, Shawn; Rasu, Rafia S

2010-08-01

Anticonvulsant medications are commonly used for off-label indications. However, managed care organizations can restrict utilization of medication to indicated uses only. To evaluate the pattern of off-label use of second-generation anticonvulsants after implementing a formulary change. We did a retrospective analysis of an administrative pharmacy claims database for a managed care plan with more than 1 million members continuously enrolled during 2004-2005. The study evaluated off-label use and explored pharmacy utilization patterns (by physician specialty, region, plan type, age, sex, copayment) across the study population following the formulary change. A total of 10,185 patients had at least 1 pharmacy claim (total of 137,638 claims) for a second-generation anticonvulsant during the study period. Most members were female (68%), and 4.9% were <18 years old. A total of 3986 of 4698 patients (84.8%) and 4600 of 5487 patients (83.8%) had anticonvulsants prescribed for off-label use in 2004 and 2005, respectively (P = .162). The off-label usage pattern varied for individual anticonvulsants in 2004 and 2005 (P <.050), which may have been because of the change to nonpreferred coverage. Primary care physicians accounted for 41.3% of the prescribing of second-generation anticonvulsants for off-label uses, followed by neurologists (9.4%), psychiatrists (2.8%), and other (46.5%). The coverage change resulted in cost savings for the plan of $0.16 per member per month. The off-label usage pattern varied for individual anticonvulsants in 2004 and 2005. Future considerations for controlling off-label use may include requiring prior authorization and provider education.

Labeling Residential Community Characteristics from Collective Activity Patterns Using Taxi Trip Data

NASA Astrophysics Data System (ADS)

Zhou, Y.; Fang, Z.

2017-09-01

There existing a significant social and spatial differentiation in the residential communities in urban city. People live in different places have different socioeconomic background, resulting in various geographically activity patterns. This paper aims to label the characteristics of residential communities in a city using collective activity patterns derived from taxi trip data. Specifically, we first present a method to allocate the O/D (Origin/Destination) points of taxi trips to the land use parcels where the activities taken place in. Then several indices are employed to describe the collective activity patterns, including both activity intensity, travel distance, travel time, and activity space of residents by taking account of the geographical distribution of all O/Ds of the taxi trip related to that residential community. Followed by that, an agglomerative hierarchical clustering algorithm is introduced to cluster the residential communities with similar activity patterns. In the case study of Wuhan, the residential communities are clearly divided into eight clusters, which could be labelled as ordinary communities, privileged communities, old isolated communities, suburban communities, and so on. In this paper, we provide a new perspective to label the land use under same type from people's mobility patterns with the support of big trajectory data.

Nonserotonergic projection neurons in the midbrain raphe nuclei contain the vesicular glutamate transporter VGLUT3.

PubMed

Jackson, Jesse; Bland, Brian H; Antle, Michael C

2009-01-01

The brainstem raphe nuclei are typically assigned a role in serotonergic brain function. However, numerous studies have reported that a large proportion of raphe projection cells are nonserotonergic. The identity of these projection cells is unknown. Recent studies have reported that the vesicular glutamate transporter VGLUT3 is found in both serotonergic and nonserotonergic neurons in both the median raphe (MR) and dorsal raphe (DR) nuclei. We injected the retrograde tracer cholera toxin subunit B into either the dorsal hippocampus or the medial septum (MS) and used triple labeled immunofluorescence to determine if nonserotonergic raphe cells projecting to these structures contained VGLUT3. Consistent with previous studies, only about half of retrogradely labeled MR neurons projecting to the hippocampus contained serotonin, whereas a majority of the retrogradely labeled nonserotonergic cells contained VGLUT3. Similar patterns were observed for MR cells projecting to the MS. About half of retrogradely labeled nonserotonergic neurons in the DR contained VGLUT3. Additionally, a large number of retrogradely labeled cells in the caudal linear and interpeduncular nuclei projecting to the MS were found to contain VGLUT3. These data suggest the enigmatic nonserotonergic projection from the MR to forebrain regions may be glutamatergic. In addition, these results demonstrate a dissociation between glutamatergic and serotonergic MR afferent inputs to the MS and hippocampus suggesting divergent and/or complementary roles of these pathways in modulating cellular activity within the septohippocampal network.

Stripe-patterned thermo-responsive cell culture dish for cell separation without cell labeling.

PubMed

Kumashiro, Yoshikazu; Ishihara, Jun; Umemoto, Terumasa; Itoga, Kazuyoshi; Kobayashi, Jun; Shimizu, Tatsuya; Yamato, Masayuki; Okano, Teruo

2015-02-11

A stripe-patterned thermo-responsive surface is prepared to enable cell separation without labeling. The thermo-responsive surface containing a 3 μm striped pattern exhibits various cell adhesion and detachment properties. A mixture of three cell types is separated on the patterned surface based on their distinct cell-adhesion properties, and the composition of the cells is analyzed by flow cytometry. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A nudge in a healthy direction. The effect of nutrition labels on food purchasing behaviors in university dining facilities.

PubMed

Cioffi, Catherine E; Levitsky, David A; Pacanowski, Carly R; Bertz, Fredrik

2015-09-01

Despite legislation that requires restaurants to post nutritional labels on their products or menu items, the scientific literature provides inconsistent support for the idea that adding labels to foods will change buying patterns. Lack of success of previous research may be that sample sizes have been too small and durations of studies too short. To assess the effect of nutrition labeling on pre-packaged food purchases in university dining facilities. Weekly sales data for a sample of pre-packaged food items were obtained and analyzed, spanning three semesters before and three semesters after nutritional labels were introduced on to the sample of foods. The labels summarized caloric content and nutrient composition information. Mean nutrient composition purchased were calculated for the sample of foods. Labeled food items were categorized as high-calorie, low-calorie, high-fat, or low-fat foods and analyzed for change as a function of the introduction of the labels. Data were obtained from all retail dining units located at Cornell University, Ithaca, NY where the pre-packaged food items were sold. Results indicated that the introduction of food labels resulted in a 7% reduction of the mean total kcals purchased per week (p < 0.001) from the labeled foods. Total fat purchased per week were also reduced by 7% (p < 0.001). Percent of sales from "low-calorie" and "low-fat" foods (p < 0.001) increased, while percent of sales from "high-calorie" and "high-fat" foods decreased (p < 0.001). The results suggest that nutrition labels on pre-packaged foods in a large university dining hall produces a small but significant reduction of labeled high calorie and high fat foods purchased and an increase in low calorie, low fat foods. Copyright © 2015 Elsevier Ltd. All rights reserved.

Infants' understanding of false labeling events: the referential roles of words and the speakers who use them.

PubMed

Koenig, Melissa A; Echols, Catharine H

2003-04-01

The four studies reported here examine whether 16-month-old infants' responses to true and false utterances interact with their knowledge of human agents. In Study 1, infants heard repeated instances either of true or false labeling of common objects; labels came from an active human speaker seated next to the infant. In Study 2, infants experienced the same stimuli and procedure; however, we replaced the human speaker of Study 1 with an audio speaker in the same location. In Study 3, labels came from a hidden audio speaker. In Study 4, a human speaker labeled the objects while facing away from them. In Study 1, infants looked significantly longer to the human agent when she falsely labeled than when she truthfully labeled the objects. Infants did not show a similar pattern of attention for the audio speaker of Study 2, the silent human of Study 3 or the facing-backward speaker of Study 4. In fact, infants who experienced truthful labeling looked significantly longer to the facing-backward labeler of Study 4 than to true labelers of the other three contexts. Additionally, infants were more likely to correct false labels when produced by the human labeler of Study 1 than in any of the other contexts. These findings suggest, first, that infants are developing a critical conception of other human speakers as truthful communicators, and second, that infants understand that human speakers may provide uniquely useful information when a word fails to match its referent. These findings are consistent with the view that infants can recognize differences in knowledge and that such differences can be based on differences in the availability of perceptual experience.

Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gust, I.D.; Feinstone, S.M.; Purcell, R.H.

1980-01-01

A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

The Orphan Drug Act: Restoring the Mission to Rare Diseases.

PubMed

Daniel, Michael G; Pawlik, Timothy M; Fader, Amanda N; Esnaola, Nestor F; Makary, Martin A

2016-04-01

The Orphan Drug Act has fostered drug development for patients with rare cancers and other diseases; however, current data suggest that companies are gaming the system to use the law for mainstream drugs. We identify a pattern of pharmaceutical companies submitting drugs to the Food and Drug Administration (FDA) as orphan drugs but once approved, the drugs are used broadly off-label with the lucrative orphan drug protections and exclusivity benefits. Since the law was passed, the proportion of new FDA-approved drugs that were submitted as orphan drugs has increased with a peak last year of 41% of all FDA-approved drugs approved as orphan drugs. On the basis of the current data, we suggest that patients with rare cancers and other diseases may suffer due to dilution of the incentives and benefits. We propose reform to increase submission scrutiny, decrease benefits based on off-label use, and increase price transparency.

Detection of CdSe quantum dot photoluminescence for security label on paper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Isnaeni,, E-mail: isnaeni@lipi.go.id; Sugiarto, Iyon Titok; Bilqis, Ratu

CdSe quantum dot has great potential in various applications especially for emitting devices. One example potential application of CdSe quantum dot is security label for anti-counterfeiting. In this work, we present a practical approach of security label on paper using one and two colors of colloidal CdSe quantum dot, which is used as stamping ink on various types of paper. Under ambient condition, quantum dot is almost invisible. The quantum dot security label can be revealed by detecting emission of quantum dot using photoluminescence and cnc machine. The recorded quantum dot emission intensity is then analyzed using home-made program tomore » reveal quantum dot pattern stamp having the word ’RAHASIA’. We found that security label using quantum dot works well on several types of paper. The quantum dot patterns can survive several days and further treatment is required to protect the quantum dot. Oxidation of quantum dot that occurred during this experiment reduced the emission intensity of quantum dot patterns.« less

Testing the optimal defence hypothesis for two indirect defences: extrafloral nectar and volatile organic compounds

PubMed Central

Radhika, Venkatesan; Kost, Christian; Bartram, Stefan; Heil, Martin

2008-01-01

Many plants respond to herbivory with an increased production of extrafloral nectar (EFN) and/or volatile organic compounds (VOCs) to attract predatory arthropods as an indirect defensive strategy. In this study, we tested whether these two indirect defences fit the optimal defence hypothesis (ODH), which predicts the within-plant allocation of anti-herbivore defences according to trade-offs between growth and defence. Using jasmonic acid-induced plants of Phaseolus lunatus and Ricinus communis, we tested whether the within-plant distribution pattern of these two indirect defences reflects the fitness value of the respective plant parts. Furthermore, we quantified photosynthetic rates and followed the within-plant transport of assimilates with 13C labelling experiments. EFN secretion and VOC emission were highest in younger leaves. Moreover, the photosynthetic rate increased with leaf age, and pulse-labelling experiments suggested transport of carbon to younger leaves. Our results demonstrate that the ODH can explain the within-plant allocation pattern of both indirect defences studied. PMID:18493790

Change detection and classification of land cover in multispectral satellite imagery using clustering of sparse approximations (CoSA) over learned feature dictionaries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moody, Daniela I.; Brumby, Steven P.; Rowland, Joel C.

Neuromimetic machine vision and pattern recognition algorithms are of great interest for landscape characterization and change detection in satellite imagery in support of global climate change science and modeling. We present results from an ongoing effort to extend machine vision methods to the environmental sciences, using adaptive sparse signal processing combined with machine learning. A Hebbian learning rule is used to build multispectral, multiresolution dictionaries from regional satellite normalized band difference index data. Land cover labels are automatically generated via our CoSA algorithm: Clustering of Sparse Approximations, using a clustering distance metric that combines spectral and spatial textural characteristics tomore » help separate geologic, vegetative, and hydrologie features. We demonstrate our method on example Worldview-2 satellite images of an Arctic region, and use CoSA labels to detect seasonal surface changes. In conclusion, our results suggest that neuroscience-based models are a promising approach to practical pattern recognition and change detection problems in remote sensing.« less

Change detection and classification of land cover in multispectral satellite imagery using clustering of sparse approximations (CoSA) over learned feature dictionaries

DOE PAGES

Moody, Daniela I.; Brumby, Steven P.; Rowland, Joel C.; ...

2014-10-01

Neuromimetic machine vision and pattern recognition algorithms are of great interest for landscape characterization and change detection in satellite imagery in support of global climate change science and modeling. We present results from an ongoing effort to extend machine vision methods to the environmental sciences, using adaptive sparse signal processing combined with machine learning. A Hebbian learning rule is used to build multispectral, multiresolution dictionaries from regional satellite normalized band difference index data. Land cover labels are automatically generated via our CoSA algorithm: Clustering of Sparse Approximations, using a clustering distance metric that combines spectral and spatial textural characteristics tomore » help separate geologic, vegetative, and hydrologie features. We demonstrate our method on example Worldview-2 satellite images of an Arctic region, and use CoSA labels to detect seasonal surface changes. In conclusion, our results suggest that neuroscience-based models are a promising approach to practical pattern recognition and change detection problems in remote sensing.« less

Appearance and distribution of surface proteins of the human erythrocyte membrane. An electron microscope and immunochemical labeling study

PubMed Central

Shotton, D.; Thompson, K.; Wofsy, L.; Branton, D.

1978-01-01

We have used freeze-etching, before and after immunoferritin labeling, to visualize spectrin molecules and other surface proteins of the human erythrocyte membrane. After intramembrane particle aggregation was induced, spectrin molecules, identified by labeling with ferritin-conjugated antispectrin, were clustered on the cytoplasmic surface of the membrane in patches directly underlying the particle clusters. This labeling pattern confirms the involvement of spectrin in such particle aggregates, as previously inferred from indirect evidence. Ferritin-conjugated antihapten molecules, directed against external and cytoplasmic surface proteins of the erythrocyte membrane which had been covalently labeled nonspecifically with the hapten p-diazoniumphenyl-beta-D-lactoside, were similarly found in direct association with such intramembrane particle aggregates. This indicates that when spectrin and the intramembrane particles are aggregated, all the major proteins of the erythrocyte membrane are constrained to coaggregate with them. Although giving no direct information concerning the freedom of translational movement of proteins in the unperturbed erythrocyte membrane, these experiments suggest that a close dynamic association may exist between the integral and peripheral protein components of the membrane, such that immobilization of one component can restrict the lateral mobility of others. PMID:10605454

Demonstration of prominent actin filaments in the root columella

NASA Technical Reports Server (NTRS)

Collings, D. A.; Zsuppan, G.; Allen, N. S.; Blancaflor, E. B.; Brown, C. S. (Principal Investigator)

2001-01-01

The distribution of actin filaments within the gravity-sensing columella cells of plant roots remains poorly understood, with studies over numerous years providing inconsistent descriptions of actin organization in these cells. This uncertainty in actin organization, and thus in actin's role in graviperception and gravisignaling, has led us to investigate actin arrangements in the columella cells of Zea mays L., Medicago truncatula Gaertn., Linum usitatissiilium L. and Nicotianla benthamiana Domin. Actin organization was examined using a combination of optimized immunofluorescence techniques, and an improved fluorochrome-conjugated phalloidin labeling method reliant on 3-maleimidobenzoyl-N-hydroxy-succinimide ester (MBS) cross-linking combined with glycerol permeabilization. Confocal microscopy of root sections labeled with anti-actin antibodies revealed patterns suggestive of actin throughout the columella region. These patterns included short and fragmented actin bundles, fluorescent rings around amyloplasts and intense fluorescence originating from the nucleus. Additionally, confocal microscopy of MBS-stabilized and Alexa Fluor-phalloidin-labeled root sections revealed a previously undetected state of actin organization in the columella. Discrete actin structures surrounded the amyloplasts and prominent actin cables radiated from the nuclear surface toward the cell periphery. Furthermore, the cortex of the columella cells contained fine actin bundles (or single filaments) that had a predominant transverse orientation. We also used confocal microscopy of plant roots expressing endoplasmic reticulum (ER)-targeted green fluorescent protein to demonstrate rapid ER movements within the columella cells, suggesting that the imaged actin network is functional. The successful identification of discrete actin structures in the root columella cells forms the perception and signaling.

Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

PubMed Central

Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

2018-01-01

Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

Simvastatin prescribing patterns before and after FDA dosing restrictions: a retrospective analysis of a large healthcare claims database.

PubMed

Tuchscherer, Rhianna M; Nair, Kavita; Ghushchyan, Vahram; Saseen, Joseph J

2015-02-01

Muscle-related events, or myopathies, are a commonly reported adverse event associated with statin use. In June 2011, the US FDA released a Drug Safety Communication that provided updated product labeling with dosing restrictions for simvastatin to minimize the risk of myopathies. Our objective was to describe prescribing patterns of simvastatin in combination with medications known to increase the risk of myopathies following updated product labeling dosing restrictions in June 2011. A retrospective observational analysis was carried out, in which administrative claims data were utilized to identify prescribing patterns of simvastatin in combination with calcium channel blockers (CCBs) and other pre-specified drug therapies. Prescribing patterns were analyzed on a monthly basis 24 months prior to and 9 months following product label changes. Incidence of muscle-related events was also analyzed. In June 2011, a total of 60% of patients with overlapping simvastatin-CCB claims and 94% of patients with overlapping simvastatin-non-CCB claims were prescribed an against-label combination. As of March 2012, a total of 41% and 93% of patients continued to be prescribed against-label simvastatin-CCB and simvastatin-non-CCB combinations, respectively. The most commonly prescribed dose of simvastatin was 20 mg (39%). Against-label combinations were most commonly prescribed at a simvastatin dose of 40 mg (56%). Amlodipine was the most commonly prescribed CCB in combination with simvastatin (70%) and the most common CCB prescribed against-label (67%). Despite improvements in prescribing practices, many patients are still exposed to potentially harmful simvastatin combinations. Aggressive changes in simvastatin prescribing systems and processes are needed to improve compliance with FDA labeling to improve medication and patient safety.

Characterization of Central Carbon Metabolism of Streptococcus pneumoniae by Isotopologue Profiling*

PubMed Central

Härtel, Tobias; Eylert, Eva; Schulz, Christian; Petruschka, Lothar; Gierok, Philipp; Grubmüller, Stephanie; Lalk, Michael; Eisenreich, Wolfgang; Hammerschmidt, Sven

2012-01-01

The metabolism of Streptococcus pneumoniae was studied by isotopologue profiling after bacterial cultivation in chemically defined medium supplemented with [U-13C6]- or [1,2-13C2]glucose. GC/MS analysis of protein-derived amino acids showed lack of 13C label in amino acids that were also essential for pneumococcal growth. Ala, Ser, Asp, and Thr displayed high 13C enrichments, whereas Phe, Tyr, and Gly were only slightly labeled. The analysis of the labeling patterns showed formation of triose phosphate and pyruvate via the Embden-Meyerhof-Parnas pathway. The labeling patterns of Asp and Thr suggested formation of oxaloacetate exclusively via the phosphoenolpyruvate carboxylase reaction. Apparently, α-ketoglutarate was generated from unlabeled glutamate via the aspartate transaminase reaction. A fraction of Phe and Tyr obtained label via the chorismate route from erythrose 4-phosphate, generated via the pentose phosphate pathway, and phosphoenolpyruvate. Strikingly, the data revealed no significant flux from phosphoglycerate to Ser and Gly but showed formation of Ser via the reverse reaction, namely by hydroxymethylation of Gly. The essential Gly was acquired from the medium, and the biosynthesis pathway was confirmed in experiments using [U-13C2]glycine as a tracer. The hydroxymethyl group in Ser originated from formate, which was generated by the pyruvate formate-lyase. Highly similar isotopologue profiles were observed in corresponding experiments with pneumococcal mutants deficient in PavA, CodY, and glucose-6-phosphate dehydrogenase pointing to the robustness of the core metabolic network used by these facultative pathogenic bacteria. In conclusion, this study demonstrates the dual utilization of carbohydrates and amino acids under in vitro conditions and identifies the unconventional de novo biosynthesis of serine by pneumococci. PMID:22167202

Children's organized physical activity patterns from childhood into adolescence.

PubMed

Findlay, Leanne C; Garner, Rochelle E; Kohen, Dafna E

2009-11-01

Few longitudinal studies of physical activity have included young children or used nationally representative datasets. The purpose of the current study was to explore patterns of organized physical activity for Canadian children aged 4 through 17 years. Data from 5 cycles of the National Longitudinal Survey of Children and Youth were analyzed separately for boys (n = 4463) and girls (n = 4354) using multiple trajectory modeling. Boys' and girls' organized physical activity was best represented by 3 trajectory groups. For boys, these groups were labeled: high stable, high decreasing, and low decreasing participation. For girls, these groups were labeled: high decreasing, moderate stable, and low decreasing participation. Risk factors (parental education, household income, urban/rural dwelling, and single/dual parent) were explored. For boys and girls, having a parent with postsecondary education and living in a higher income household were associated with a greater likelihood of weekly participation in organized physical activity. Living in an urban area was also significantly associated with a greater likelihood of weekly participation for girls. Results suggest that Canadian children's organized physical activity is best represented by multiple patterns of participation that tend to peak in middle childhood and decline into adolescence.

The heterotrimeric motor protein kinesin-II localizes to the midpiece and flagellum of sea urchin and sand dollar sperm.

PubMed

Henson, J H; Cole, D G; Roesener, C D; Capuano, S; Mendola, R J; Scholey, J M

1997-01-01

We have utilized immunoblotting and light microscopic immunofluorescent staining methods to examine the expression and localization of sea urchin kinesin-II, a heterotrimeric plus end-directed microtubule motor protein (previously referred to as KRP(85/95)), in sea urchin and sand dollar sperm. We demonstrate the presence of the 85 K and 115 K subunits of kinesin-II in sperm and localize these proteins to the sperm flagella and midpiece. The kinesin-II localization pattern is punctate and discontinuous, and in the flagella it is quite distinct from the continuous labeling present in sperm labeled with anti-flagellar dynein. The kinesin-II staining is largely insensitive to prefixation detergent extraction, suggesting that it is not associated with membranous elements in the sperm. In the midpiece the kinesin-II staining is similar to the pattern present in sperm labeled with an anti-centrosomal antibody. To our knowledge, this is the first localization of kinesin-like proteins in mature sperm and corroborates the recent identification and localization of kinesin-like proteins in the flagella and basal body of the unicellular green alga Chlamydomonas. We hypothesize that kinesin-II in the sperm may play functional roles in intraflagellar transport and/or the formation of flagella during spermatogenesis.

Axonal transport studied in a single vertebrate neuron: the giant electromotor neuron of the electric catfish, Malapterurus electricus.

PubMed

Zimmermann, H; Tashiro, T; Komiya, Y; Kurokawa, M

1989-02-01

Axonal transport was studied using a single vertebrate neuron, the giant electromotor neuron of the electric catfish, Malapterurus electricus. The electric organs of this strongly electric fish are innervated by two neurons whose axons form one electric nerve each. After injection of [35S]methionine into the spinal cord at the level of the two perikarya radioactively labelled material is exported by fast flow as a small wave with a velocity of 5.8 mm/h and a somal release time of 91 min (29 degrees C). Slow flow investigated between 15 and 39 days had a velocity of 1.36 mm/d at 29 degrees C. Analysis of radiolabelled proteins by polyacrylamide gel electrophoresis revealed different patterns of labelling between slow and fast flow. The relative molecular mass of the two major proteins labelled on slow flow correspond to actin and tubulin. Labelled proteins of higher relative molecular mass may correspond to neurofilament proteins. Our results suggest that this vertebrate single-neuron and single-axon system can be used successfully for axonal transport studies.

Selective affinity labeling of a 27-kDa integral membrane protein in rat liver and kidney with N-bromoacetyl derivatives of L-thyroxine and 3,5,3'-triiodo-L-thyronine.

PubMed

Köhrle, J; Rasmussen, U B; Rokos, H; Leonard, J L; Hesch, R D

1990-04-15

125I-Labeled N-bromoacetyl derivatives of L-thyroxine and L-triiodothyronine were used as alkylating affinity labels to identify rat liver and kidney microsomal membrane proteins which specifically bind thyroid hormones. Affinity label incorporation was analyzed by ethanol precipitation and individual affinity labeled proteins were identified by autoradiography after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing conditions. Six to eight membrane proteins ranging in size from 17 to 84 kDa were affinity labeled by both bromoacetyl-L-thyroxine (BrAcT4) and bromoacetyl-L-triiodothyronine (BrAcT3). Affinity labeling was time- and temperature-dependent, and both reduced dithiols and detergents increased affinity labeling, predominantly in a 27-kDa protein(s). Up to 80% of the affinity label was associated with a 27-kDa protein (p27) under optimal conditions. Affinity labeling of p27 by 0.4 nM BrAc[125I]L-T4 was blocked by 0.1 microM of the alkylating ligands BrAcT4, BrAcT3, or 100 microM iodoacetate, by 10 microM concentrations of the non-alkylating, reversible ligands N-acetyl-L-thyroxine, 3,3',5'-triiodothyronine, 3,5-diiodosalicylate, and EMD 21388, a T4-antagonistic flavonoid. Neither 10 microM L-T4, nor 10 microM N-acetyltriiodothyronine or 10 microM L-triiodothyronine blocked affinity labeling of p27 or other affinity labeled bands. Affinity labeling of a 17-kDa band was partially inhibited by excess of the alkylating ligands BrAcT4, BrAcT3, and iodoacetate, but labeling of other minor bands was not blocked by excess of the competitors. BrAc[125I]T4 yielded higher affinity label incorporation than BrAc[125I]T3, although similar banding patterns were observed, except that BrAcT3 affinity labeled more intensely a 58,000-Da band in liver and a 53,000-55,000-Da band in kidney. The pattern of other affinity labeled proteins with p27 as the predominant band was similar in liver and kidney. Peptide mapping of affinity labeled p27 and p55 bands by chemical cleavage and protease fragmentation revealed no common bands excluding that p27 is a degradation product of p55. These data indicate that N-bromoacetyl derivatives of T4 and T3 affinity label a limited but similar constellation of membrane proteins with BrAcT4 incorporation greater than that of BrAcT3. One membrane protein (p27) of low abundance (2-5 pmol/mg microsomal protein) with a reactive sulfhydryl group is selectively labeled under conditions identical to those used to measure thyroid hormone 5'-deiodination. Only p27 showed differential affinity labeling in the presence of noncovalently bound inhibitors or substrates on 5'-deiodinase suggesting that p27 is likely to be a component of type I 5'-deiodinase in rat liver and kidney.

Metabolic flux ratio analysis and cell staining suggest the existence of C4 photosynthesis in Phaeodactylum tricornutum.

PubMed

Huang, A; Liu, L; Zhao, P; Yang, C; Wang, G C

2016-03-01

Mechanisms for carbon fixation via photosynthesis in the diatom Phaeodactylum tricornutum Bohlin were studied recently but there remains a long-standing debate concerning the occurrence of C4 photosynthesis in this species. A thorough investigation of carbon metabolism and the evidence for C4 photosynthesis based on organelle partitioning was needed. In this study, we identified the flux ratios between C3 and C4 compounds in P. tricornutum using (13)C-labelling metabolic flux ratio analysis, and stained cells with various cell-permeant fluorescent probes to investigate the likely organelle partitioning required for single-cell C4 photosynthesis. Metabolic flux ratio analysis indicated the C3/C4 exchange ratios were high. Cell staining indicated organelle partitioning required for single-cell C4 photosynthesis might exist in P. tricornutum. The results of (13)C-labelling metabolic flux ratio analysis and cell staining suggest single-cell C4 photosynthesis exists in P. tricornutum. This study provides insights into photosynthesis patterns of P. tricornutum and the evidence for C4 photosynthesis based on (13)C-labelling metabolic flux ratio analysis and organelle partitioning. © 2015 The Society for Applied Microbiology.

Pattern Recognition Of Blood Vessel Networks In Ocular Fundus Images

NASA Astrophysics Data System (ADS)

Akita, K.; Kuga, H.

1982-11-01

We propose a computer method of recognizing blood vessel networks in color ocular fundus images which are used in the mass diagnosis of adult diseases such as hypertension and diabetes. A line detection algorithm is applied to extract the blood vessels, and the skeleton patterns of them are made to analyze and describe their structures. The recognition of line segments of arteries and/or veins in the vessel networks consists of three stages. First, a few segments which satisfy a certain constraint are picked up and discriminated as arteries or veins. This is the initial labeling. Then the remaining unknown ones are labeled by utilizing the physical level knowledge. We propose two schemes for this stage : a deterministic labeling and a probabilistic relaxation labeling. Finally the label of each line segment is checked so as to minimize the total number of labeling contradictions. Some experimental results are also presented.

Qualitative variation of photolabelled benzodiazepine receptors in different species.

PubMed

Hebebrand, J; Friedl, W; Lentes, K U; Propping, P

1986-01-01

In order to examine whether species differences of benzodiazepine receptor subunits exist, we compared the fluorographic pattern of photoaffinity labelled subunits after SDS-PAGE in five species: fish, frog, chicken, mouse and calf. Each species showed a distinct pattern of specifically labelled proteins. We conclude that species variation of benzodiazepine receptor does indeed exist.

A Peptide-Based Method for 13C Metabolic Flux Analysis in Microbial Communities

PubMed Central

Ghosh, Amit; Nilmeier, Jerome; Weaver, Daniel; Adams, Paul D.; Keasling, Jay D.; Mukhopadhyay, Aindrila; Petzold, Christopher J.; Martín, Héctor García

2014-01-01

The study of intracellular metabolic fluxes and inter-species metabolite exchange for microbial communities is of crucial importance to understand and predict their behaviour. The most authoritative method of measuring intracellular fluxes, 13C Metabolic Flux Analysis (13C MFA), uses the labeling pattern obtained from metabolites (typically amino acids) during 13C labeling experiments to derive intracellular fluxes. However, these metabolite labeling patterns cannot easily be obtained for each of the members of the community. Here we propose a new type of 13C MFA that infers fluxes based on peptide labeling, instead of amino acid labeling. The advantage of this method resides in the fact that the peptide sequence can be used to identify the microbial species it originates from and, simultaneously, the peptide labeling can be used to infer intracellular metabolic fluxes. Peptide identity and labeling patterns can be obtained in a high-throughput manner from modern proteomics techniques. We show that, using this method, it is theoretically possible to recover intracellular metabolic fluxes in the same way as through the standard amino acid based 13C MFA, and quantify the amount of information lost as a consequence of using peptides instead of amino acids. We show that by using a relatively small number of peptides we can counter this information loss. We computationally tested this method with a well-characterized simple microbial community consisting of two species. PMID:25188426

Localization of caveolin-1 and c-src in mature and differentiating photoreceptors: raft proteins co-distribute with rhodopsin during development

PubMed Central

Berta, Ágnes I.; Boesze-Battaglia, Kathleen; Magyar, Attila; Szél, Ágoston; Kiss, Anna L.

2014-01-01

Numerous biochemical and morphological studies have provided insight into the distribution pattern of caveolin-1 and the presence of membrane rafts in the vertebrate retina. To date however, studies have not addressed the localization profile of raft specific proteins during development. Therefore the purpose of our studies was to follow the localization pattern of caveolin-1, phosphocaveolin-1 and c-src in the developing retina and compare it to that observed in adults. Specific antibodies were used to visualize the distribution of caveolin-1, c-src, a kinase phosphorylating caveolin-1, and phospho-caveolin-1. The labeling pattern of this scaffolded complex was compared to those of rhodopsin and rhodopsin kinase. Samples were analyzed at various time points during postnatal development and compared to adult retinas. The immunocytochemical studies were complemented with immunoblots and immunoprecipitation studies. In the mature retina caveolin-1 and c-src localized mainly to the cell body and IS of photoreceptors, with only very weakly labeled OS. In contrast, phospho-caveolin-1 was only detectable in the OS of photoreceptors. During development we followed the expression and distribution profile of these proteins in a temporal sequence with special attention to the period when OS formation is most robust. Double labeling immunocytochemistry and immunoprecipitation showed rhodopsin to colocalize and co-immunoprecipitate with caveolin-1 and c-src. Individual punctate structures between the outer limiting membrane and the outer plexiform layer were seen at P10 to be labeled by both rhodopsin and caveolin-1 as well as by rhodopsin and c-src, respectively. These studies suggest that membrane raft specific proteins are co-distributed during development, thereby pointing to a role for such complexes in OS formation. In addition, the presence of small punctate structures containing caveolin-1, c-src and rhodopsin raise the possibility that these proteins may transport together to OS during development and that caveolin-1 exists predominantly in a phosphorylated form in the OS. PMID:21938483

Medial forebrain bundle lesions fail to structurally and functionally disconnect the ventral tegmental area from many ipsilateral forebrain nuclei: implications for the neural substrate of brain stimulation reward.

PubMed

Simmons, J M; Ackermann, R F; Gallistel, C R

1998-10-15

Lesions in the medial forebrain bundle rostral to a stimulating electrode have variable effects on the rewarding efficacy of self-stimulation. We attempted to account for this variability by measuring the anatomical and functional effects of electrolytic lesions at the level of the lateral hypothalamus (LH) and by correlating these effects to postlesion changes in threshold pulse frequency (pps) for self-stimulation in the ventral tegmental area (VTA). We implanted True Blue in the VTA and compared cell labeling patterns in forebrain regions of intact and lesioned animals. We also compared stimulation-induced regional [14C]deoxyglucose (DG) accumulation patterns in the forebrains of intact and lesioned animals. As expected, postlesion threshold shifts varied: threshold pps remained the same or decreased in eight animals, increased by small but significant amounts in three rats, and increased substantially in six subjects. Unexpectedly, LH lesions did not anatomically or functionally disconnect all forebrain nuclei from the VTA. Most septal and preoptic regions contained equivalent levels of True Blue label in intact and lesioned animals. In both intact and lesioned groups, VTA stimulation increased metabolic activity in the fundus of the striatum (FS), the nucleus of the diagonal band, and the medial preoptic area. On the other hand, True Blue labeling demonstrated anatomical disconnection of the accumbens, FS, substantia innominata/magnocellular preoptic nucleus (SI/MA), and bed nucleus of the stria terminalis. [14C]DG autoradiography indicated functional disconnection of the lateral preoptic area and SI/MA. Correlations between patterns of True Blue labeling or [14C]deoxyglucose accumulation and postlesion shifts in threshold pulse frequency were weak and generally negative. These direct measures of connectivity concord with the behavioral measures in suggesting a diffuse net-like connection between forebrain nuclei and the VTA.

Evaluation of ULV Applications Against Old World Sand Fly (Diptera: Psychodidae) Species in Equatorial Kenya

DTIC Science & Technology

2011-01-01

patterns of UV-labeled droplets captured on cotton ribbons adjacent to sand ßy cages in spray plots did not match patterns ofmortality.Wediscuss the...untreated areas. Surprisingly, ULV active ingredient deposition inferred from patterns of UV-labeled droplets captured on cotton ribbons adjacent to...the west plot on the second spray day; looking south. Cotton droplet capture ribbons have already been attached in position between the posts at each

Development of wide-angle 2D light scattering static cytometry

NASA Astrophysics Data System (ADS)

Xie, Linyan; Liu, Qiao; Shao, Changshun; Su, Xuantao

2016-10-01

We have recently developed a 2D light scattering static cytometer for cellular analysis in a label-free manner, which measures side scatter (SSC) light in the polar angular range from 79 to 101 degrees. Compared with conventional flow cytometry, our cytometric technique requires no fluorescent labeling of the cells, and static cytometry measurements can be performed without flow control. In this paper we present an improved label-free static cytometer that can obtain 2D light scattering patterns in a wider angular range. By illuminating the static microspheres on chip with a scanning optical fiber, wide-angle 2D light scattering patterns of single standard microspheres with a mean diameter of 3.87 μm are obtained. The 2D patterns of 3.87 μm microspheres contain both large-angle forward scatter (FSC) and SSC light in the polar angular range from 40 to 100 degrees, approximately. Experimental 2D patterns of 3.87 μm microspheres are in good agreement with Mie theory simulated ones. The wide-angle light scattering measurements may provide a better resolution for particle analysis as compared with the SSC measurements. Two dimensional light scattering patterns of HL-60 human acute leukemia cells are obtained by using our static cytometer. Compared with SSC 2D light scattering patterns, wide-angle 2D patterns contain richer information of the HL-60 cells. The obtaining of 2D light scattering patterns in a wide angular range could help to enhance the capabilities of our label-free static cytometry for cell analysis.

A central mesencephalic reticular formation projection to medial rectus motoneurons supplying singly and multiply innervated extraocular muscle fibers.

PubMed

Bohlen, Martin O; Warren, Susan; May, Paul J

2017-06-01

We recently demonstrated a bilateral projection to the supraoculomotor area from the central mesencephalic reticular formation (cMRF), a region implicated in horizontal gaze changes. C-group motoneurons, which supply multiply innervated fibers in the medial rectus muscle, are located within the primate supraoculomotor area, but their inputs and function are poorly understood. Here, we tested whether C-group motoneurons in Macaca fascicularis monkeys receive a direct cMRF input by injecting this portion of the reticular formation with anterograde tracers in combination with injection of retrograde tracer into the medial rectus muscle. The results indicate that the cMRF provides a dense, bilateral projection to the region of the medial rectus C-group motoneurons. Numerous close associations between labeled terminals and each multiply innervated fiber motoneuron were present. Within the oculomotor nucleus, a much sparser ipsilateral projection onto some of the A- and B- group medial rectus motoneurons that supply singly innervated fibers was observed. Ultrastructural analysis demonstrated a direct synaptic linkage between anterogradely labeled reticular terminals and retrogradely labeled medial rectus motoneurons in all three groups. These findings reinforce the notion that the cMRF is a critical hub for oculomotility by proving that it contains premotor neurons supplying horizontal extraocular muscle motoneurons. The differences between the cMRF input patterns for C-group versus A- and B-group motoneurons suggest the C-group motoneurons serve a different oculomotor role than the others. The similar patterns of cMRF input to C-group motoneurons and preganglionic Edinger-Westphal motoneurons suggest that medial rectus C-group motoneurons may play a role in accommodation-related vergence. © 2017 Wiley Periodicals, Inc.

Attachment sites of the coracoclavicular ligaments are characterized by fibrocartilage differentiation: a study on human cadaveric tissue.

PubMed

Ockert, B; Braunstein, V; Sprecher, C; Shinohara, Y; Kirchhoff, C; Milz, S

2012-02-01

We analyzed the immunohistochemical labeling patterns of the extracellular matrix of the coracoclavicular ligaments (CCL) in order to relate the molecular composition of the attachment sites to their mechanical environment. Ligaments were exposed from 12 fresh-frozen human cadaveric samples (four males, mean age: 48.6 ± 12.1 years). Cryosection of methanol-fixed and decalcified tissue was cut and sections were labeled with a panel of monoclonal antibodies directed against collagens, proteoglycans and proteins of vascular components. Attachment sites of both ligaments showed characteristic fibrocartilaginous labeling of collagen type II, aggrecan and link protein in all samples. Labeling for type II collagen was most conspicuous at the insertion of the coracoid process. Morphometry of adjacent samples revealed a fibrocartilage zone of 10-15% in relationship with the ligament proper, where labeling for type II collagen, aggrecan and link protein was negative. The presence of fibrocartilage at both entheses of the trapezoid and conoid ligament suggests that the CCL complex is subject to shear/compression forces. A variable fibrocartilage differentiation at the entheses of both ligaments may be related to the marked change in loading and insertion angle that the ligaments undergo during shoulder movement. © 2010 John Wiley & Sons A/S.

Magnetic Labeling of Activated Microglia in Experimental Gliomas1

PubMed Central

Fleige, Gerrit; Nolte, Christiane; Synowitz, Michael; Seeberger, Florian; Kettenmann, Helmut; Zimmer, Claus

2001-01-01

Abstract Microglia, as intrinsic immunoeffector cells of the central nervous system (CNS), play a very sensitive, crucial role in the response to almost any brain pathology where they are activated to a phagocytic state. Based on the characteristic features of activated microglia, we investigated whether these cells can be visualized with magnetic resonance imaging (MRI) using ultrasmall superparamagnetic iron oxides (USPIOs). The hypothesis of this study was that MR microglia visualization could not only reveal the extent of the tumor, but also allow for assessing the status of immunologic defense. Using USPIOs in cell culture experiments and in a rat glioma model, we showed that microglia can be labeled magnetically. Labeled microglia are detected by confocal microscopy within and around tumors in a typical border-like pattern. Quantitative in vitro studies revealed that microglia internalize amounts of USPIOs that are significantly higher than those incorporated by tumor cells and astrocytes. Labeled microglia can be detected and quantified with MRI in cell phantoms, and the extent of the tumor can be seen in glioma-bearing rats in vivo. We conclude that magnetic labeling of microglia provides a potential tool for MRI of gliomas, which reflects tumor morphology precisely. Furthermore, the results suggest that MRI may yield functional data on the immunologic reaction of the CNS. PMID:11774031

Starch Biosynthesis in Developing Wheat Grain 1

PubMed Central

Keeling, Peter L.; Wood, John R.; Tyson, R. Huw; Bridges, Ian G.

1988-01-01

We have used 13C-labeled sugars and nuclear magnetic resonance (NMR) spectrometry to study the metabolic pathway of starch biosynthesis in developing wheat grain (Triticum aestivum cv Mardler). Our aim was to examine the extent of redistribution of 13C between carbons atoms 1 and 6 of [1-13C] or [6-13C]glucose (or fructose) incorporated into starch, and hence provide evidence for or against the involvement of triose phosphates in the metabolic pathway. Starch synthesis in the endosperm tissue was studied in two experimental systems. First, the 13C sugars were supplied to isolated endosperm tissue incubated in vitro, and second the 13C sugars were supplied in vivo to the intact plant. The 13C starch produced by the endosperm tissue of the grain was isolated and enzymically degraded to glucose using amyloglucosidase, and the distribution of 13C in all glucosyl carbons was quantified by 13C-NMR spectrometry. In all of the experiments, irrespective of the incubation time or incubation conditions, there was a similar pattern of partial (between 15 and 20%) redistribution of label between carbons 1 and 6 of glucose recovered from starch. There was no detectable increase over background 13C incidence in carbons 2 to 5. Within each experiment, the same pattern of partial redistribution of label was found in the glucosyl and fructosyl moieties of sucrose extracted from the tissue. Since it is unlikely that sucrose is present in the amyloplast, we suggest that the observed redistribution of label occurred in the cytosolic compartment of the endosperm cells and that both sucrose and starch are synthesized from a common pool of intermediates, such as hexose phosphate. We suggest that redistribution of label occurs via a cytosolic pathway cycle involving conversion of hexose phosphate to triose phosphate, interconversion of triose phosphate by triose phosphate isomerase, and resynthesis of hexose phosphate in the cytosol. A further round of triose phosphate interconversion in the amyloplast could not be detected. These data seriously weaken the argument for the selective uptake of triose phosphates by the amyloplast as part of the pathway of starch biosynthesis from sucrose in plant storage tissues. Instead, we suggest that a hexose phosphate such as glucose 1-phosphate, glucose 6-phosphate, or fructose 6-phosphate is the most likely candidate for entry into the amyloplast. A pathway of starch biosynthesis is presented, which is consistent with our data and with the current information on the intracellular distribution of enzymes in plant storage tissues. PMID:16666140

Microtubule dynamics in nerve cells: analysis using microinjection of biotinylated tubulin into PC12 cells

PubMed Central

1988-01-01

To study microtubule (MT) dynamics in nerve cells, we microinjected biotin-labeled tubulin into the cell body of chemically fused and differentiated PC12 cells and performed the immunofluorescence or immunogold procedure using an anti-biotin antibody followed by secondary antibodies coupled to fluorescent dye or colloidal gold. Incorporation of labeled subunits into the cytoskeleton of neurites was observed within minutes after microinjection. Serial electron microscopic reconstruction revealed that existing MTs in PC12 neurites incorporated labeled subunits mainly at their distal ends and the elongation rate of labeled segments was estimated to be less than 0.3 micron/min. Overall organization of MTs in the nerve cells was different from that in undifferentiated cells such as fibroblasts. Namely, we have not identified any MT-organizing centers from which labeled MTs are emanating in the cell bodies of the injected cells. Stereo electron microscopy revealed that some fully labeled segments seemed to start in the close vicinity of electron dense material within the neurites. This suggests new nucleation off some structures in the neurites. We have also studied the overall pattern of the incorporation of labeled subunits which extended progressively from the proximal part of the neurites toward their tips. To characterize the mechanism of tubulin incorporation, we have measured mean density of gold labeling per unit length of labeled segments at different parts of the neurites. The results indicate access of free tubulin subunits into the neurites and local incorporation into the neurite cytoskeleton. Our results lead to the conclusion that MTs are not static polymers but dynamic structures that continue to elongate even within the differentiated nerve cell processes. PMID:3047145

Some approaches to optimal cluster labeling of aerospace imagery

NASA Technical Reports Server (NTRS)

Chittineni, C. B.

1980-01-01

Some approaches are presented to the problem of labeling clusters using information from a given set of labeled and unlabeled aerospace imagery patterns. The assignment of class labels to the clusters is formulated as the determination of the best assignment over all possible ones with respect to some criterion. Cluster labeling is also viewed as the probability of correct labeling with a maximization of likelihood function. Results of the application of these techniques in the processing of remotely sensed multispectral scanner imagery data are presented.

Multiple-labelling immunoEM using different sizes of colloidal gold: alternative approaches to test for differential distribution and colocalization in subcellular structures.

PubMed

Mayhew, Terry M; Lucocq, John M

2011-03-01

Various methods for quantifying cellular immunogold labelling on transmission electron microscope thin sections are currently available. All rely on sound random sampling principles and are applicable to single immunolabelling across compartments within a given cell type or between different experimental groups of cells. Although methods are also available to test for colocalization in double/triple immunogold labelling studies, so far, these have relied on making multiple measurements of gold particle densities in defined areas or of inter-particle nearest neighbour distances. Here, we present alternative two-step approaches to codistribution and colocalization assessment that merely require raw counts of gold particles in distinct cellular compartments. For assessing codistribution over aggregate compartments, initial statistical evaluation involves combining contingency table and chi-squared analyses to provide predicted gold particle distributions. The observed and predicted distributions allow testing of the appropriate null hypothesis, namely, that there is no difference in the distribution patterns of proteins labelled by different sizes of gold particle. In short, the null hypothesis is that of colocalization. The approach for assessing colabelling recognises that, on thin sections, a compartment is made up of a set of sectional images (profiles) of cognate structures. The approach involves identifying two groups of compartmental profiles that are unlabelled and labelled for one gold marker size. The proportions in each group that are also labelled for the second gold marker size are then compared. Statistical analysis now uses a 2 × 2 contingency table combined with the Fisher exact probability test. Having identified double labelling, the profiles can be analysed further in order to identify characteristic features that might account for the double labelling. In each case, the approach is illustrated using synthetic and/or experimental datasets and can be refined to correct observed labelling patterns to specific labelling patterns. These simple and efficient approaches should be of more immediate utility to those interested in codistribution and colocalization in multiple immunogold labelling investigations.

Prioritising lexical patterns to increase axiomatisation in biomedical ontologies. The role of localisation and modularity.

PubMed

Quesada-Martínez, M; Fernández-Breis, J T; Stevens, R; Mikroyannidi, E

2015-01-01

This article is part of the Focus Theme of METHODS of Information in Medicine on "Managing Interoperability and Complexity in Health Systems". In previous work, we have defined methods for the extraction of lexical patterns from labels as an initial step towards semi-automatic ontology enrichment methods. Our previous findings revealed that many biomedical ontologies could benefit from enrichment methods using lexical patterns as a starting point.Here, we aim to identify which lexical patterns are appropriate for ontology enrichment, driving its analysis by metrics to prioritised the patterns. We propose metrics for suggesting which lexical regularities should be the starting point to enrich complex ontologies. Our method determines the relevance of a lexical pattern by measuring its locality in the ontology, that is, the distance between the classes associated with the pattern, and the distribution of the pattern in a certain module of the ontology. The methods have been applied to four significant biomedical ontologies including the Gene Ontology and SNOMED CT. The metrics provide information about the engineering of the ontologies and the relevance of the patterns. Our method enables the suggestion of links between classes that are not made explicit in the ontology. We propose a prioritisation of the lexical patterns found in the analysed ontologies. The locality and distribution of lexical patterns offer insights into the further engineering of the ontology. Developers can use this information to improve the axiomatisation of their ontologies.

Automatic ground control point recognition with parallel associative memory

NASA Technical Reports Server (NTRS)

Al-Tahir, Raid; Toth, Charles K.; Schenck, Anton F.

1990-01-01

The basic principle of the associative memory is to match the unknown input pattern against a stored training set, and responding with the 'closest match' and the corresponding label. Generally, an associative memory system requires two preparatory steps: selecting attributes of the pattern class, and training the system by associating patterns with labels. Experimental results gained from using Parallel Associative Memory are presented. The primary concern is an automatic search for ground control points in aerial photographs. Synthetic patterns are tested followed by real data. The results are encouraging as a relatively high level of correct matches is reached.

Labeling of lectin receptors during the cell cycle.

PubMed

Garrido, J

1976-12-01

Labeling of lectin receptors during the cell cycle. (Localizabión de receptores para lectinas durante el ciclo celular). Arch. Biol. Med. Exper. 10: 100-104, 1976. The topographic distribution of specific cell surface receptors for concanavalin A and wheat germ agglutinin was studied by ultrastructural labeling in the course of the cell cycle. C12TSV5 cells were synchronized by double thymidine block or mechanical selection (shakeoff). They were labeled by means of lectin-peroxidase techniques while in G1 S, G2 and M phases of the cycle. The results obtained were similar for both lectins employed. Interphase cells (G1 S, G2) present a stlihtly discontinous labeling pattern that is similar to the one observed on unsynchronized cells of the same line. Cells in mitosis, on the contrary, present a highly discontinous distribution of reaction product. This pattern disappears after the cells enters G1 and is not present on mitotic cells fixed in aldehyde prior to labeling.

Segments and segmental properties in cross-language perception: Korean perception of English obstruents in various prosodic locations

NASA Astrophysics Data System (ADS)

de Jong, Kenneth; Silbert, Noah; Park, Hanyong

2004-05-01

Experimental models of cross-language perception and second-language acquisition (such as PAM and SLM) typically treat language differences in terms of whether the two languages share phonological segmental categories. Linguistic models, by contrast, generally examine properties which cross classify segments, such as features, rules, or prosodic constraints. Such models predict that perceptual patterns found for one segment will generalize to other segments of the same class. This paper presents perceptual identifications of Korean listeners to a set of voiced and voiceless English stops and fricatives in various prosodic locations to determine the extent to which such generality occurs. Results show some class-general effects; for example, voicing identification patterns generalize from stops, which occur in Korean, to nonsibilant fricatives, which are new to Korean listeners. However, when identification is poor, there are clear differences between segments within the same class. For example, in identifying stops and fricatives, both point of articulation and prosodic position bias perceptions; coronals are more often labeled fricatives, and syllable initial obstruents are more often labeled stops. These results suggest that class-general perceptual patterns are not a simple consequence of the structure of the perceptual system, but need to be acquired by factoring out within-class differences.

Dual-labeling method for electron microscopy to characterize synaptic connectivity using genetically encoded fluorescent reporters in Drosophila

PubMed Central

Tanaka, Nobuaki K.; Dye, Louis; Stopfer, Mark

2010-01-01

Light and electron microscopy (LM and EM) both offer important advantages for characterizing neuronal circuitry in intact brains: LM can reveal the general patterns neurons trace between brain areas, and EM can confirm synaptic connections between identified neurons within a small area. In a few species, genetic labeling with fluorescent proteins has been used with LM to visualize many kinds of neurons and to analyze their morphologies and projection patterns. However, combining these large-scale patterns with the fine detail available in EM analysis has been a technical challenge. To analyze the synaptic connectivity of neurons expressing fluorescent markers with EM, we developed a dual-labeling method for use with pre-embedded brains. In Drosophila expressing genetic labels and also injected with markers we visualized synaptic connections among two populations of neurons in the AL, one of which has been shown to mediate a specific function, odor evoked neural oscillation. PMID:21074556

Effects of tonal language background on tests of temporal sequencing in children.

PubMed

Mukari, Siti Zamratol-Mai S; Yu, Xuan; Ishak, Wan Syafira; Mazlan, Rafidah

2015-01-01

The aims of the present study were to determine the effects of language background on the performance of the pitch pattern sequence test (PPST) and duration pattern sequence test (DPST). As temporal order sequencing may be affected by age and working memory, these factors were also studied. Performance of tonal and non-tonal language speakers on PPST and DPST were compared. Twenty-eight native Mandarin (tonal language) speakers and twenty-nine native Malay (non-tonal language) speakers between seven to nine years old participated in this study. The results revealed that relative to native Malay speakers, native Mandarin speakers demonstrated better scores on the PPST in both humming and verbal labeling responses. However, a similar language effect was not apparent in the DPST. An age effect was only significant in the PPST (verbal labeling). Finally, no significant effect of working memory was found on the PPST and the DPST. These findings suggest that the PPST is affected by tonal language background, and highlight the importance of developing different normative values for tonal and non-tonal language speakers.

Fracture labelling of boar spermatozoa for the fucose-binding-protein (FBP).

PubMed

Friess, A E; Toepfer-Petersen, E; Schill, W B

1987-01-01

Labelling of fractured boar spermatozoa with the FUC-HRP gold method for a fucose-binding-protein (FBP) gave evidence the FBP is localized in the acrosomal matrix. All fracture faces through the acrosome from the rostral end towards the equatorial segment show similar labelling pattern. This labelling is completely blocked by preincubation of the fractured tissue with focoidan.

Hepatocellular differentiation status is characterized by distinct subnuclear localization and form of the chanzyme TRPM7.

PubMed

Ogunrinde, Adenike; Pereira, Robyn D; Beaton, Natalie; Lam, D Hung; Whetstone, Christiane; Hill, Ceredwyn E

The channel-kinase TRPM7 is important for the survival, proliferation, and differentiation, of many cell types. Both plasma membrane channel activity and kinase function are implicated in these roles. Channel activity is greater in less differentiated hepatoma cells compared with non-dividing, terminally differentiated adult hepatocytes, suggesting differences in protein expression and/or localization. We used electrophysiological and immunofluorescence approaches to establish whether hepatocellular differentiation is associated with altered TRPM7 expression. Mean outward current decreased by 44% in WIF-B hepatoma cells incubated with the established hepatic differentiating factors oncostatin M/dexamethasone for 1-8 days. Pre-incubation with pyridone 6, a pan-JAK inhibitor, blocked the current reduction. An antibody targeted to the C-terminus of TRPM7 labelled the cytoplasm in WIF-B cells and intact rat liver. Significant label also localized to the nuclear envelope (NE), with relatively more detected in adult hepatocytes compared with WIF-B cells. Hepatoma cells also exhibited nucleoplasmic labelling with intense signal in the nucleolus. The endogenous labelling pattern closely resembles that of HEK293T cells heterologously expressing a TRPM7 kinase construct containing a putative nucleolar localization sequence. These results suggest that TRPM7 form and distribution between the plasma membrane and nucleus, rather than expression, is altered in parallel with differentiation status in rat hepatic cells. Copyright © 2017 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

About the composition of self-relevance: Conjunctions not features are bound to the self.

PubMed

Schäfer, Sarah; Frings, Christian; Wentura, Dirk

2016-06-01

Sui and colleagues (Journal of Experimental Psychology: Human Perception and Performance, 38, 1105-1117, 2012) introduced a matching paradigm to investigate prioritized processing of instructed self-relevance. They arbitrarily assigned simple geometric shapes to the participant and two other persons. Subsequently, the task was to judge whether label-shape pairings matched or not. The authors found a remarkable self-prioritization effect, that is, for matching self-related trials verification was very fast and accurate in comparison to the non-matching conditions. We analyzed whether single features or feature conjunctions are tagged to the self. In particular, we assigned colored shapes to the labels and included partial-matching trials (i.e., trials in which only one feature matched the label, whereas the other feature did not match the label). If single features are tagged to the self, partial matches would result in interference, whereas they should elicit the same data pattern as non-matching trials if only feature conjunctions are tagged to the self. Our data suggest the latter; only feature conjunctions are tagged to the self and are processed in a prioritized manner. This result emphasizes the functionality of self-relevance as a selection mechanism.

Differential co-localization with choline acetyltransferase in nervus terminalis suggests functional differences for GnRH isoforms in bonnethead sharks (Sphyrna tiburo)

PubMed Central

Moeller, John F.; Meredith, Michael

2010-01-01

The nervus terminalis (NT) is a vertebrate cranial nerve whose function in adults is unknown. In bonnethead sharks the nerve is anatomically independent of the olfactory system, with two major cell populations within one or more ganglia along its exposed length. Most cells are immunoreactive for either gonadotropin-releasing hormone (GnRH) or RFamide-like peptides. To define further the cell populations and connectivity, we used double-label immuno-cytochemistry with antisera to different isoforms of GnRH and to choline acetyltransferase (ChAT). The labeling patterns of two GnRH antisera revealed different populations of GnRH immunoreactive (ir) cell-profiles in the NT ganglion. One antiserum labeled a large group of cells and fibers, which likely contain mammalian GnRH (GnRH-I) as described in previous studies, and which were ChAT immunoreactive. The other antiserum labeled large club-like structures, which were anuclear, and a sparse number of fibers, but with no clear labeling of cell bodies in the ganglion. These club structures were choline acetyltrasferase (ChAT) negative, and preabsorption control tests suggest they may contain chicken-GnRH-II (GnRH-II) or dogfish GnRH. The second major NT ganglion cell-type was immunoreactive for RF-amides, which regulate GnRH release in other vertebrates, and may provide an intraganglionic influence on GnRH release. The immunocytochemical and anatomical differences between the two GnRH immunoreactive profile types indicate possible functional differences for these isoforms in the NT. The club-like structures may be sites of GnRH release into the general circulation since these structures were observed near blood vessels and resembled structures seen in the median eminence of rats. PMID:20950589

Differential co-localization with choline acetyltransferase in nervus terminalis suggests functional differences for GnRH isoforms in bonnethead sharks (Sphyrna tiburo).

PubMed

Moeller, John F; Meredith, Michael

2010-12-17

The nervus terminalis (NT) is a vertebrate cranial nerve whose function in adults is unknown. In bonnethead sharks, the nerve is anatomically independent of the olfactory system, with two major cell populations within one or more ganglia along its exposed length. Most cells are immunoreactive for either gonadotropin-releasing hormone (GnRH) or RF-amide-like peptides. To define further the cell populations and connectivity, we used double-label immunocytochemistry with antisera to different isoforms of GnRH and to choline acetyltransferase (ChAT). The labeling patterns of two GnRH antisera revealed different populations of GnRH-immunoreactive (ir) cell profiles in the NT ganglion. One antiserum labeled a large group of cells and fibers, which likely contain mammalian GnRH (GnRH-I) as described in previous studies and which were ChAT immunoreactive. The other antiserum labeled large club-like structures, which were anuclear, and a sparse number of fibers, but with no clear labeling of cell bodies in the ganglion. These club structures were choline acetyltrasferase (ChAT)-negative, and preabsorption control tests suggest they may contain chicken-GnRH-II (GnRH-II) or dogfish GnRH. The second major NT ganglion cell-type was immunoreactive for RF-amides, which regulate GnRH release in other vertebrates, and may provide an intraganglionic influence on GnRH release. The immunocytochemical and anatomical differences between the two GnRH-immunoreactive profile types indicate possible functional differences for these isoforms in the NT. The club-like structures may be sites of GnRH release into the general circulation since these structures were observed near blood vessels and resembled structures seen in the median eminence of rats. Copyright © 2010 Elsevier B.V. All rights reserved.

Computational phenotype discovery using unsupervised feature learning over noisy, sparse, and irregular clinical data.

PubMed

Lasko, Thomas A; Denny, Joshua C; Levy, Mia A

2013-01-01

Inferring precise phenotypic patterns from population-scale clinical data is a core computational task in the development of precision, personalized medicine. The traditional approach uses supervised learning, in which an expert designates which patterns to look for (by specifying the learning task and the class labels), and where to look for them (by specifying the input variables). While appropriate for individual tasks, this approach scales poorly and misses the patterns that we don't think to look for. Unsupervised feature learning overcomes these limitations by identifying patterns (or features) that collectively form a compact and expressive representation of the source data, with no need for expert input or labeled examples. Its rising popularity is driven by new deep learning methods, which have produced high-profile successes on difficult standardized problems of object recognition in images. Here we introduce its use for phenotype discovery in clinical data. This use is challenging because the largest source of clinical data - Electronic Medical Records - typically contains noisy, sparse, and irregularly timed observations, rendering them poor substrates for deep learning methods. Our approach couples dirty clinical data to deep learning architecture via longitudinal probability densities inferred using Gaussian process regression. From episodic, longitudinal sequences of serum uric acid measurements in 4368 individuals we produced continuous phenotypic features that suggest multiple population subtypes, and that accurately distinguished (0.97 AUC) the uric-acid signatures of gout vs. acute leukemia despite not being optimized for the task. The unsupervised features were as accurate as gold-standard features engineered by an expert with complete knowledge of the domain, the classification task, and the class labels. Our findings demonstrate the potential for achieving computational phenotype discovery at population scale. We expect such data-driven phenotypes to expose unknown disease variants and subtypes and to provide rich targets for genetic association studies.

Computational Phenotype Discovery Using Unsupervised Feature Learning over Noisy, Sparse, and Irregular Clinical Data

PubMed Central

Lasko, Thomas A.; Denny, Joshua C.; Levy, Mia A.

2013-01-01

Inferring precise phenotypic patterns from population-scale clinical data is a core computational task in the development of precision, personalized medicine. The traditional approach uses supervised learning, in which an expert designates which patterns to look for (by specifying the learning task and the class labels), and where to look for them (by specifying the input variables). While appropriate for individual tasks, this approach scales poorly and misses the patterns that we don’t think to look for. Unsupervised feature learning overcomes these limitations by identifying patterns (or features) that collectively form a compact and expressive representation of the source data, with no need for expert input or labeled examples. Its rising popularity is driven by new deep learning methods, which have produced high-profile successes on difficult standardized problems of object recognition in images. Here we introduce its use for phenotype discovery in clinical data. This use is challenging because the largest source of clinical data – Electronic Medical Records – typically contains noisy, sparse, and irregularly timed observations, rendering them poor substrates for deep learning methods. Our approach couples dirty clinical data to deep learning architecture via longitudinal probability densities inferred using Gaussian process regression. From episodic, longitudinal sequences of serum uric acid measurements in 4368 individuals we produced continuous phenotypic features that suggest multiple population subtypes, and that accurately distinguished (0.97 AUC) the uric-acid signatures of gout vs. acute leukemia despite not being optimized for the task. The unsupervised features were as accurate as gold-standard features engineered by an expert with complete knowledge of the domain, the classification task, and the class labels. Our findings demonstrate the potential for achieving computational phenotype discovery at population scale. We expect such data-driven phenotypes to expose unknown disease variants and subtypes and to provide rich targets for genetic association studies. PMID:23826094

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Deep learning architectures for multi-label classification of intelligent health risk prediction.

PubMed

Maxwell, Andrew; Li, Runzhi; Yang, Bei; Weng, Heng; Ou, Aihua; Hong, Huixiao; Zhou, Zhaoxian; Gong, Ping; Zhang, Chaoyang

2017-12-28

Multi-label classification of data remains to be a challenging problem. Because of the complexity of the data, it is sometimes difficult to infer information about classes that are not mutually exclusive. For medical data, patients could have symptoms of multiple different diseases at the same time and it is important to develop tools that help to identify problems early. Intelligent health risk prediction models built with deep learning architectures offer a powerful tool for physicians to identify patterns in patient data that indicate risks associated with certain types of chronic diseases. Physical examination records of 110,300 anonymous patients were used to predict diabetes, hypertension, fatty liver, a combination of these three chronic diseases, and the absence of disease (8 classes in total). The dataset was split into training (90%) and testing (10%) sub-datasets. Ten-fold cross validation was used to evaluate prediction accuracy with metrics such as precision, recall, and F-score. Deep Learning (DL) architectures were compared with standard and state-of-the-art multi-label classification methods. Preliminary results suggest that Deep Neural Networks (DNN), a DL architecture, when applied to multi-label classification of chronic diseases, produced accuracy that was comparable to that of common methods such as Support Vector Machines. We have implemented DNNs to handle both problem transformation and algorithm adaption type multi-label methods and compare both to see which is preferable. Deep Learning architectures have the potential of inferring more information about the patterns of physical examination data than common classification methods. The advanced techniques of Deep Learning can be used to identify the significance of different features from physical examination data as well as to learn the contributions of each feature that impact a patient's risk for chronic diseases. However, accurate prediction of chronic disease risks remains a challenging problem that warrants further studies.

French-speaking children’s freely produced labels for facial expressions

PubMed Central

Maassarani, Reem; Gosselin, Pierre; Montembeault, Patricia; Gagnon, Mathieu

2014-01-01

In this study, we investigated the labeling of facial expressions in French-speaking children. The participants were 137 French-speaking children, between the ages of 5 and 11 years, recruited from three elementary schools in Ottawa, Ontario, Canada. The facial expressions included expressions of happiness, sadness, fear, surprise, anger, and disgust. Participants were shown one facial expression at a time, and asked to say what the stimulus person was feeling. Participants’ responses were coded by two raters who made judgments concerning the specific emotion category in which the responses belonged. 5- and 6-year-olds were quite accurate in labeling facial expressions of happiness, anger, and sadness but far less accurate for facial expressions of fear, surprise, and disgust. An improvement in accuracy as a function of age was found for fear and surprise only. Labeling facial expressions of disgust proved to be very difficult for the children, even for the 11-year-olds. In order to examine the fit between the model proposed by Widen and Russell (2003) and our data, we looked at the number of participants who had the predicted response patterns. Overall, 88.52% of the participants did. Most of the participants used between 3 and 5 labels, with correspondence percentages varying between 80.00% and 100.00%. Our results suggest that the model proposed by Widen and Russell (2003) is not limited to English-speaking children, but also accounts for the sequence of emotion labeling in French-Canadian children. PMID:24926281

21-Methylpyrenyl-cholesterol stably and specifically associates with lipoprotein peripheral hemi-membrane: A new labelling tool

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaibelet, Gérald; CEA, SB2SM and UMR8221 CNRS, IBiTec-Saclay, Gif-sur-Yvette; Tercé, François

Highlights: •21-Methylpyrenyl-cholesterol specifically and stably associates to lipoproteins. •It is not esterified by LCAT, and thus reliably labels their peripheral hemi-membrane. •HDL vs. LDL are well distinguishable by various fluorescent labelling characteristics. •LDL peripheral hemi-membrane harbors cholesterol-rich ordered lipid (micro)domains. •Cultured cells can be stained by such labelled lipoproteins-mediated delivery. -- Abstract: Lipoproteins are important biological components. However, they have few convenient fluorescent labelling probes currently reported, and their physiological reliability can be questioned. We compared the association of two fluorescent cholesterol derivatives, 22-nitrobenzoxadiazole-cholesterol (NBD-Chol) and 21-methylpyrenyl-cholesterol (Pyr-met-Chol), to serum lipoproteins and to purified HDL and LDL. Both lipoproteins couldmore » be stably labelled by Pyr-met-Chol, but virtually not by NBD-Chol. At variance with NBD-Chol, LCAT did not esterify Pyr-met-Chol. The labelling characteristics of lipoproteins by Pyr-met-Chol were well distinguishable between HDL and LDL, regarding dializability, associated probe amount and labelling kinetics. We took benefit of the pyrene labelling to approach the structural organization of LDL peripheral hemi-membrane, since Pyr-met-Chol-labelled LDL, but not HDL, presented a fluorescence emission of pyrene excimers, indicating that the probe was present in an ordered lipid micro-environment. Since the peripheral membrane of LDL contains more sphingomyelin (SM) than HDL, this excimer formation was consistent with the existence of cholesterol- and SM-enriched lipid microdomains in LDL, as already suggested in model membranes of similar composition and reminiscent to the well-described “lipid rafts” in bilayer membranes. Finally, we showed that Pyr-met-Chol could stain cultured PC-3 cells via lipoprotein-mediated delivery, with a staining pattern well different to that observed with NBD-Chol non-specifically delivered to the cells.« less

Consumer Understanding and Use of Food and Nutrition Labeling in Turkey

ERIC Educational Resources Information Center

Besler, Halit Tanju; Buyuktuncer, Zehra; Uyar, Muhemmed Fatih

2012-01-01

Objectives: To determine patterns of food and nutrition labels use by Turkish consumers, and examine constraints on the use of this information. Design: Cross-sectional survey. Setting: Twenty-six regions of Turkey. Participants: Consumers (n = 1,536), aged 12-56 years. Variables measured: Level of interest in food and nutrition labels, the…

Modular-extramodular organization in developing multisensory shell regions of the mouse inferior colliculus.

PubMed

Dillingham, Christopher H; Gay, Sean M; Behrooz, Roxana; Gabriele, Mark L

2017-12-01

The complex neuroanatomical connections of the inferior colliculus (IC) and its major subdivisions offer a juxtaposition of segregated processing streams with distinct organizational features. While the tonotopically layered central nucleus is well-documented, less is known about functional compartments in the neighboring lateral cortex (LCIC). In addition to a laminar framework, LCIC afferent-efferent patterns suggest a multimodal mosaic, consisting of a patchy modular network with surrounding extramodular domains. This study utilizes several neurochemical markers that reveal an emerging LCIC modular-extramodular microarchitecture. In newborn and post-hearing C57BL/6J and CBA/CaJ mice, histochemical and immunocytochemical stains were performed for acetylcholinesterase (AChE), nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d), glutamic acid decarboxylase (GAD), cytochrome oxidase (CO), and calretinin (CR). Discontinuous layer 2 modules are positive for AChE, NADPH-d, GAD, and CO throughout the rostrocaudal LCIC. While not readily apparent at birth, discrete cell clusters emerge over the first postnatal week, yielding an identifiable modular network prior to hearing onset. Modular boundaries continue to become increasingly distinct with age, as surrounding extramodular fields remain largely negative for each marker. Alignment of modular markers in serial sections suggests each highlight the same periodic patchy network throughout the nascent LCIC. In contrast, CR patterns appear complementary, preferentially staining extramodular LCIC zones. Double-labeling experiments confirm that NADPH-d, the most consistent developmental modular marker, and CR label separate, nonoverlapping LCIC compartments. Determining how this emerging modularity may align with similar LCIC patch-matrix-like Eph/ephrin guidance patterns, and how each interface with, and potentially influence developing multimodal LCIC projection configurations is discussed. © 2017 Wiley Periodicals, Inc.

Evaluating structural pattern recognition for handwritten math via primitive label graphs

NASA Astrophysics Data System (ADS)

Zanibbi, Richard; Mouchère, Harold; Viard-Gaudin, Christian

2013-01-01

Currently, structural pattern recognizer evaluations compare graphs of detected structure to target structures (i.e. ground truth) using recognition rates, recall and precision for object segmentation, classification and relationships. In document recognition, these target objects (e.g. symbols) are frequently comprised of multiple primitives (e.g. connected components, or strokes for online handwritten data), but current metrics do not characterize errors at the primitive level, from which object-level structure is obtained. Primitive label graphs are directed graphs defined over primitives and primitive pairs. We define new metrics obtained by Hamming distances over label graphs, which allow classification, segmentation and parsing errors to be characterized separately, or using a single measure. Recall and precision for detected objects may also be computed directly from label graphs. We illustrate the new metrics by comparing a new primitive-level evaluation to the symbol-level evaluation performed for the CROHME 2012 handwritten math recognition competition. A Python-based set of utilities for evaluating, visualizing and translating label graphs is publicly available.

Canine melanoma diagnosis: RACK1 as a potential biological marker.

PubMed

Campagne, C; Julé, S; Alleaume, C; Bernex, F; Ezagal, J; Château-Joubert, S; Estrada, M; Aubin-Houzelstein, G; Panthier, J-J; Egidy, G

2013-11-01

Melanoma diagnosis in dogs can be challenging due to the variety of histological appearances of canine melanocytic neoplasms. Markers of malignancy are needed. Receptor for activated C-kinase 1 (RACK1) was found to characterize melanomas in other mammals. We investigated the value of RACK1 detection in the classification of 19 cutaneous and 5 mucosal melanocytic neoplasms in dogs. These tumors were categorized as melanocytomas or benign and melanomas or malignant after evaluation of their morphology, mitotic index, and Ki-67 growth fraction. Using immunofluorescence, we confirmed microphthalmia-associated transcription factor (MITF) as a marker of normal and transformed melanocytic cells in dog tissues. All control (n = 10) and tumoral (n = 24) samples stained positively for MITF (34/34, 100%). Whereas RACK1 was not detected in healthy skin melanocytes, melanocytic lesions were all positive for RACK1 signal (24/24, 100%). RACK1 cytoplasmic staining appeared with 2 distinct distribution patterns: strong, diffuse, and homogeneous or granular and heterogeneous. All melanoma samples (13/13, 100%) stained homogeneously for RACK1. All melanocytomas (11/11, 100%) stained heterogeneously for RACK1. Immunohistochemistry was less consistent than immunofluorescence for all labelings in melanocytic lesions, which were often very pigmented. Thus, the fluorescent RACK1-MITF labeling pattern helped to distinguish melanomas from melanocytomas. Furthermore, RACK1 labeling correlated with 2 of 11 morphological features linked to malignancy: cell and nuclear size. These results suggest that RACK1 may be used as a marker in dog melanomas.

A microfluidic laser scattering sensor for label-free detection of waterborne pathogens

NASA Astrophysics Data System (ADS)

Wei, Huang; Yang, Limei; Li, Feng

2016-10-01

A microfluidic-based multi-angle laser scattering (MALS) sensor capable of acquiring scattering pattern of single particle is demonstrated. The size and relative refractive index (RI) of polystyrene (PS) microspheres were deduced with accuracies of 60 nm and 0.001 by analyzing the scattering patterns. We measured scattering patterns of waterborne parasites i.e., cryptosporidium parvum (c.parvum) and giardia lamblia (g.lamblia), and some other representative species in 1 L water within 1 hour, and the waterborne parasites were identified with accuracy better than 96% by classification of distinctive scattering patterns with a support-vector-machine (SVM) algorithm. The system provides a promising tool for label-free and rapid detection of waterborne parasites.

Neuroimaging classification of progression patterns in glioblastoma: a systematic review.

PubMed

Piper, Rory J; Senthil, Keerthi K; Yan, Jiun-Lin; Price, Stephen J

2018-03-30

Our primary objective was to report the current neuroimaging classification systems of spatial patterns of progression in glioblastoma. In addition, we aimed to report the terminology used to describe 'progression' and to assess the compliance with the Response Assessment in Neuro-Oncology (RANO) Criteria. We conducted a systematic review to identify all neuroimaging studies of glioblastoma that have employed a categorical classification system of spatial progression patterns. Our review was registered with Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) registry. From the included 157 results, we identified 129 studies that used labels of spatial progression patterns that were not based on radiation volumes (Group 1) and 50 studies that used labels that were based on radiation volumes (Group 2). In Group 1, we found 113 individual labels and the most frequent were: local/localised (58%), distant/distal (51%), diffuse (20%), multifocal (15%) and subependymal/subventricular zone (15%). We identified 13 different labels used to refer to 'progression', of which the most frequent were 'recurrence' (99%) and 'progression' (92%). We identified that 37% (n = 33/90) of the studies published following the release of the RANO classification were adherent compliant with the RANO criteria. Our review reports significant heterogeneity in the published systems used to classify glioblastoma spatial progression patterns. Standardization of terminology and classification systems used in studying progression would increase the efficiency of our research in our attempts to more successfully treat glioblastoma.

Complex genomic rearrangement in CCS-LacZ transgenic mice.

PubMed

Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

2007-02-01

The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

Food-intake patterns assessed by using front-of-pack labeling program criteria associated with better diet quality and lower cardiometabolic risk

USDA-ARS?s Scientific Manuscript database

Front-of-pack labeling systems may provide additional guidance to that already available to facilitate the identification of foods that improve diet quality. We examined the association between choosing foods that meet criteria of an established front-of-pack labeling system with food-group and nutr...

Labeling and Other Effects of Actinomycin D on Human Chromosomes*

PubMed Central

Miles, Charles P.

1970-01-01

3H-actinomycin D, a guanine-binding agent, labels fixed human chromosomes nonrandomly. Actinomycin D added in G2 inhibits secondary constrictions and breaks chromosomes. There is some tendency for label to be concentrated at the ends of chromosomes and near the centromere. Labeling with 3H-thymidine in the late stage of DNA synthesis shows a different pattern and in general lacks the telomeric concentrations. The sites of actinomycin D-induced breaks do not show good correspondence with the sites of actinomycin D label. Images PMID:5267140

Immunofluorescence reveals unusual patterns of labelling for connexin43 localized to calbindin-D28K-positive interstitial cells in the pineal gland.

PubMed

Tsao, D D; Wang, S G; Lynn, B D; Nagy, J I

2017-06-01

Gap junctions between cells in the pineal gland have been described ultrastructurally, but their connexin constituents have not been fully characterized. We used immunofluorescence in combination with markers of pineal cells to document the cellular localization of connexin43 (Cx43). Immunofluorescence labelling of Cx43 with several different antibodies was widely distributed throughout the pineal, whereas another connexin examined, connexin26, was not found in pineal but only in surrounding leptomeninges. Labelling apparently associated with plasma membranes was visualized either as fine Cx43-puncta (1-2 μm) or as unusually large pools of Cx43 ranging up to 4-7 μm in diameter or length. These puncta and pools were highly concentrated in perivascular spaces, where they were associated with numerous cells devoid of labelling for markers of pinealocytes (e.g. tryptophan hydroxylase and serotonin), and where they were minimally associated with blood vessels and lacked association with resident macrophages. Astrocytes labelled for glial fibrillary acidic protein were largely restricted to the anterior pole of the pineal gland, where they displayed only fine and sparse Cx43-puncta along their processes. Labelling for Cx43 was localized largely though not exclusively to the somata and long processes of a subpopulation of perivascular interstitial cells that were immunopositive for calbindin-D28K. These cells were often located among dense bundles or termination areas of sympathetic fibres labelled for tyrosine hydroxylase or serotonin. The results indicate that interstitial cells form abundant gap junctions composed of Cx43, and suggest that gap junction-mediated intracellular communication by these cells supports the activities of pinealocytes. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Tritium ( 3 H) Retention In Mice: Administered As HTO, DTO or as 3 H-Labeled Amino-Acids.

PubMed

Priest, Nicholas D; Blimkie, Melinda S J; Wyatt, Heather; Bugden, Michelle; Bannister, Laura A; Gueguen, Yann; Jourdain, Jean-Rene; Klokov, Dmitry

2017-05-01

The objective of this study was to compare the biokinetics of injected H-labeled light (HTO) and heavy (DTO) water in CBA/CaJ mice and to compare the organ distribution and/or body content of H administered by chronic ingestion for 1 mo to C57Bl/6J mice, as either H-labeled water or H-labeled amino acids (glycine, alanine and proline). HTO and DTO were administered to CBA/CaJ mice by single intraperitoneal injection and body retention was determined for up to 384 h post-injection. Tritium-labeled water or H-labeled amino acids were given to C57Bl/6J mice ad libitum for 30 d in drinking water. Body content and organ distribution of H during the period of administration and subsequent to administration was determined by liquid scintillation counting. No differences were found between the biokinetics of HTO and DTO, indicating that data generated using HTO can be used to help assess the consequences of H releases from heavy water reactors. The results for H-water showed that the concentration of radionuclide in the mice reached a peak after about 10 d and dropped rapidly after the cessation of H administration. The maximum concentration reached was only 50% of that in the water consumed, indicating that mice receive a significant fraction of their water from respiration. Contrary to the findings of others, the pattern of H retention following the administration of a cocktail of the labeled amino acids was very little different from that found for the water. This is consistent with the suggestion that most of the ingested amino acids were rapidly metabolized, releasing water and carbon dioxide.

Metabolism of arginine by aging and 7 day old pumpkin seedlings.

PubMed

Splittstoesser, W E

1969-03-01

The metabolism of arginine by etiolated pumpkin (Cucurbita moschata) seedlings was studied over various time and age intervals by injecting arginine-U-(14)C into the cotyledons. At most, 25% of the (14)C was transported from the cotyledon to the axis tissue and the amount of this transport decreased with increasing age of the seedlings. The cotyledons of 25 day old plants contained 60% of the administered (14)C as unmetabolized arginine. Little (14)C was in sugars and it appeared that arginine was the primary translocation product. Time course studies showed that arginine was extensively metabolized and the labeling patterns suggest that different pathways were in operation in the axis and cotyledons. The amount of arginine incorporated into cotyledonary protein show that synthesis and turnover were occurring at rapid rate. Only 25% of the label incorporated into protein by 1.5 hr remained after 96 hr. The label in protein was stable in the axis tissue. By 96 hr 50% of the administered label occurred as (14)CO(2) and it appeared that arginine was metabolized, through glutamate, by the citrio acid cycle in the cotyledons. The experiments showed that an extensive conversion of arginine carbon into other amino acids did not occur.

Change detection in Arctic satellite imagery using clustering of sparse approximations (CoSA) over learned feature dictionaries

NASA Astrophysics Data System (ADS)

Moody, Daniela I.; Wilson, Cathy J.; Rowland, Joel C.; Altmann, Garrett L.

2015-06-01

Advanced pattern recognition and computer vision algorithms are of great interest for landscape characterization, change detection, and change monitoring in satellite imagery, in support of global climate change science and modeling. We present results from an ongoing effort to extend neuroscience-inspired models for feature extraction to the environmental sciences, and we demonstrate our work using Worldview-2 multispectral satellite imagery. We use a Hebbian learning rule to derive multispectral, multiresolution dictionaries directly from regional satellite normalized band difference index data. These feature dictionaries are used to build sparse scene representations, from which we automatically generate land cover labels via our CoSA algorithm: Clustering of Sparse Approximations. These data adaptive feature dictionaries use joint spectral and spatial textural characteristics to help separate geologic, vegetative, and hydrologic features. Land cover labels are estimated in example Worldview-2 satellite images of Barrow, Alaska, taken at two different times, and are used to detect and discuss seasonal surface changes. Our results suggest that an approach that learns from both spectral and spatial features is promising for practical pattern recognition problems in high resolution satellite imagery.

Embryonic development of connections in turtle pallium.

PubMed

Cordery, P; Molnár, Z

1999-10-11

We are interested in similarities and conserved mechanisms in early development of the reptilian and mammalian thalamocortical connections. We set out to analyse connectivity in embryonic turtle brains (Pseudemys scripta elegans, between stages 17 and 25), by using carbocyanine dye tracing. From the earliest stages studied, labelling from dorsal and ventral thalamus revealed backlabelled cells among developing thalamic fibres within the lateral forebrain bundle and striatum, which had similar morphology to backlabelled internal capsule cells in embryonic rat (Molnár and Cordery, 1999). However, thalamic crystal placements did not label cells in the dorsal ventricular ridge (DVR) at any stage examined. Crystal placements into both dorsal and lateral cortex labelled cells in the DVR and, reciprocally, DVR crystal placements labelled cells in the dorsal and lateral cortices. Retrograde labelling revealed that thalamic fibres arrive in the DVR and dorsal cortex by stage 19. The DVR received projections from the nucleus rotundus and the dorsal cortex exclusively from the perirotundal complex (including lateral geniculate nucleus). Thalamic fibres show this remarkable degree of specificity from the earliest stage we could examine with selective retrograde labelling (stage 19). Our study demonstrates that axons of similar cells are among the first to reach dorsal and ventral thalamus in mammals and reptiles. Our connectional analysis in turtle suggests that some cells of the mammalian primitive internal capsule are homologous to a cell group within the reptilian lateral forebrain bundle and striatum and that diverse vertebrate brains might use a highly conserved pattern of early thalamocortical development. Copyright 1999 Wiley-Liss, Inc.

Regional alterations in long bone /sup 85/Sr clearance produced by internal fixation devices. Part II. Histomorphometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, D.J.; Daum, W.J.; Calhoun, J.H.

1988-01-01

The effects of each of the surgical stages involved in compression plating on the development of cortical thinning and porosity were assessed in the intact midshaft, stress-shielded femoral segments of adult mongrel dogs 6 months postoperatively. The data were evaluated in terms of a postsurgical tetracycline-based measure of remodeling and terminal /sup 85/Sr clearance (SrC) values for the plated segments of bone. Drilling had no effect on any parameter. Screw application was associated with minimal cortical thinning (p less than 0.05), while plate fixation clearly promoted thinning (p less than 0.01) and porosity (p less than 0.05). The percentage ofmore » labeled osteons, a measure of remodeling activity, increased only after plate fixation (p less than 0.05), and the labeling patterns suggested that most osteons had formed during the first 4 postsurgical months. That none of these changes were correlated with the 6-month SrC values suggests that the development of plate-induced osteopenia involves disparate histomorphometric time constants, rather than lack of any association.« less

Monosynaptic convergence of chorda tympani and glossopharyngeal afferents onto ascending relay neurons in the nucleus of the solitary tract: A high-resolution confocal and correlative electron microscopy approach

PubMed Central

Corson, James A.; Erisir, Alev

2014-01-01

While physiological studies suggested convergence of chorda tympani and glossopharyngeal afferent axons onto single neurons of the rostral nucleus of the solitary tract (rNTS), anatomical evidence has been elusive. The current study uses high-magnification confocal microscopy to identify putative synaptic contacts from afferent fibers of the two nerves onto individual projection neurons. Imaged tissue is re-visualized with electron microscopy, confirming that overlapping fluorescent signals in confocal z-stacks accurately identify appositions between labeled terminal and dendrite pairs. Monte Carlo modeling reveals that the probability of overlapping fluorophores is stochastically unrelated to the density of afferent label suggesting that convergent innervation in the rNTS is selective rather than opportunistic. Putative synaptic contacts from each nerve are often compartmentalized onto dendrite segments of convergently innervated neurons. These results have important implications for orosensory processing in the rNTS, and the techniques presented here have applications in investigations of neural microcircuitry with an emphasis on innervation patterning. PMID:23640852

Lexical leverage: Category knowledge boosts real-time novel word recognition in two-year- olds

PubMed Central

Borovsky, Arielle; Ellis, Erica M.; Evans, Julia L.; Elman, Jeffrey L.

2016-01-01

Recent research suggests that infants tend to add words to their vocabulary that are semantically related to other known words, though it is not clear why this pattern emerges. In this paper, we explore whether infants to leverage their existing vocabulary and semantic knowledge when interpreting novel label-object mappings in real-time. We initially identified categorical domains for which individual 24-month-old infants have relatively higher and lower levels of knowledge, irrespective of overall vocabulary size. Next, we taught infants novel words in these higher and lower knowledge domains and then asked if their subsequent real-time recognition of these items varied as a function of their category knowledge. While our participants successfully acquired the novel label -object mappings in our task, there were important differences in the way infants recognized these words in real time. Namely, infants showed more robust recognition of high (vs. low) domain knowledge words. These findings suggest that dense semantic structure facilitates early word learning and real-time novel word recognition. PMID:26452444

Coupling of solute transport and cell expansion in pea stems

NASA Technical Reports Server (NTRS)

Schmalstig, J. G.; Cosgrove, D. J.

1990-01-01

As cells expand and are displaced through the elongation zone of the epicotyl of etiolated pea (Pisum sativum L. var Alaska) seedlings, there is little net dilution of the cell sap, implying a coordination between cell expansion and solute uptake from the phloem. Using [14C] sucrose as a phloem tracer (applied to the hypogeous cotyledons), the pattern of label accumulation along the stem closely matched the growth rate pattern: high accumulation in the growing zone, little accumulation in nongrowing regions. Several results suggest that a major portion of phloem contents enters elongating cells through the symplast. We propose that the coordination between phloem transport and cell expansion is accomplished via regulatory pathways affecting both plasmodesmata conductivity and cell expansion.

Probabilistic cluster labeling of imagery data

NASA Technical Reports Server (NTRS)

Chittineni, C. B. (Principal Investigator)

1980-01-01

The problem of obtaining the probabilities of class labels for the clusters using spectral and spatial information from a given set of labeled patterns and their neighbors is considered. A relationship is developed between class and clusters conditional densities in terms of probabilities of class labels for the clusters. Expressions are presented for updating the a posteriori probabilities of the classes of a pixel using information from its local neighborhood. Fixed-point iteration schemes are developed for obtaining the optimal probabilities of class labels for the clusters. These schemes utilize spatial information and also the probabilities of label imperfections. Experimental results from the processing of remotely sensed multispectral scanner imagery data are presented.

In vivo detection of 13C isotopomer turnover in the human brain by sequential infusion of 13C labeled substrates

NASA Astrophysics Data System (ADS)

Li, Shizhe; Zhang, Yan; Ferraris Araneta, Maria; Xiang, Yun; Johnson, Christopher; Innis, Robert B.; Shen, Jun

2012-05-01

This study demonstrates the feasibility of simultaneously detecting human brain metabolites labeled by two substrates infused in a sequential order. In vivo 13C spectra of carboxylic/amide carbons were acquired only during the infusion of the second substrate. This approach allowed dynamic detection of 13C labeling from two substrates with considerably different labeling patterns. [2-13C]glucose and [U-13C6]glucose were used to generate singlet and doublet signals of the same carboxylic/amide carbon atom, respectively. Because of the large one-bond 13C-13C homonuclear J coupling between a carboxylic/amide carbon and an aliphatic carbon (˜50 Hz), the singlet and doublet signals of the same carboxylic/amide carbon were well distinguished. The results demonstrated that different 13C isotopomer patterns could be simultaneously and distinctly measured in vivo in a clinical setting at 3 T.

Relation between clinical mature and immature lymphocyte cells in human peripheral blood and their spatial label free scattering patterns

NASA Astrophysics Data System (ADS)

Zhang, Lu; Zhao, Xin; Zhang, Zhenxi; Zhao, Hong; Chen, Wei; Yuan, Li

2016-07-01

A single living cell's light scattering pattern (LSP) in the horizontal plane, which has been denoted as the cell's "2D fingerprint," may provide a powerful label-free detection tool in clinical applications. We have recently studied the LSP in spatial scattering planes, denoted as the cell's "3D fingerprint," for mature and immature lymphocyte cells in human peripheral blood. The effects of membrane size, morphology, and the existence of the nucleus on the spatial LSP are discussed. In order to distinguish clinical label-free mature and immature lymphocytes, the special features of the spatial LSP are studied by statistical method in both the spatial and frequency domains. Spatial LSP provides rich information on the cell's morphology and contents, which can distinguish mature from immature lymphocyte cells and hence ultimately it may be a useful label-free technique for clinical leukemia diagnosis.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

A Central Mesencephalic Reticular Formation Projection to the Supraoculomotor Area in Macaque Monkeys

PubMed Central

Bohlen, Martin O.; Warren, Susan; May, Paul J.

2015-01-01

The central mesencephalic reticular formation is physiologically implicated in oculomotor function and anatomically interwoven with many parts of the oculomotor system’s premotor circuitry. This study in Macaca fascicularis monkeys investigates the pattern of central mesencephalic reticular formation projections to the area in and around the extraocular motor nuclei, with special emphasis on the supraoculomotor area. It also examines the location of the cells responsible for this projection. Injections of biotinylated dextran amine were stereotaxically placed within the central mesencephalic reticular formation to anterogradely label axons and terminals. These revealed bilateral terminal fields in the supraoculomotor area. In addition, dense terminations were found in both the preganglionic Edinger-Westphal nuclei. The dense terminations just dorsal to the oculomotor nucleus overlap with the location of the C-group medial rectus motoneurons projecting to multiply innervated muscle fibers suggesting they may be targeted. Minor terminal fields were observed bilaterally within the borders of the oculomotor and abducens nuclei. Injections including the supraoculomotor area and oculomotor nucleus retrogradely labeled a tight band of neurons crossing the central third of the central mesencephalic reticular formation at all rostrocaudal levels, indicating a subregion of the nucleus provides this projection. Thus, these experiments reveal that a subregion of the central mesencephalic reticular formation may directly project to motoneurons in the oculomotor and abducens nuclei, as well as to preganglionic neurons controlling the tone of intraocular muscles. This pattern of projections suggests an as yet undetermined role in regulating the near triad. PMID:25859632

A central mesencephalic reticular formation projection to the supraoculomotor area in macaque monkeys.

PubMed

Bohlen, Martin O; Warren, Susan; May, Paul J

2016-05-01

The central mesencephalic reticular formation is physiologically implicated in oculomotor function and anatomically interwoven with many parts of the oculomotor system's premotor circuitry. This study in Macaca fascicularis monkeys investigates the pattern of central mesencephalic reticular formation projections to the area in and around the extraocular motor nuclei, with special emphasis on the supraoculomotor area. It also examines the location of the cells responsible for this projection. Injections of biotinylated dextran amine were stereotaxically placed within the central mesencephalic reticular formation to anterogradely label axons and terminals. These revealed bilateral terminal fields in the supraoculomotor area. In addition, dense terminations were found in both the preganglionic Edinger-Westphal nuclei. The dense terminations just dorsal to the oculomotor nucleus overlap with the location of the C-group medial rectus motoneurons projecting to multiply innervated muscle fibers suggesting they may be targeted. Minor terminal fields were observed bilaterally within the borders of the oculomotor and abducens nuclei. Injections including the supraoculomotor area and oculomotor nucleus retrogradely labeled a tight band of neurons crossing the central third of the central mesencephalic reticular formation at all rostrocaudal levels, indicating a subregion of the nucleus provides this projection. Thus, these experiments reveal that a subregion of the central mesencephalic reticular formation may directly project to motoneurons in the oculomotor and abducens nuclei, as well as to preganglionic neurons controlling the tone of intraocular muscles. This pattern of projections suggests an as yet undetermined role in regulating the near triad.

Permeabilization of the plasma membrane of L1210 mouse leukemia cells using lithotripter shock waves.

PubMed

Gambihler, S; Delius, M; Ellwart, J W

1994-09-01

Permeabilization of L1210 cells by lithotripter shock waves in vitro was monitored by evaluating the accumulation of fluorescein-labeled dextrans with a relative molecular mass ranging from 3,900-2,000,000. Incubation with labeled dextran alone caused a dose- and time-dependent increase in cellular fluorescence as determined by flow cytometry, with a vesicular distribution pattern in the cells consistent with endocytotic uptake. Shock wave exposure prior to incubation with labeled dextran revealed similar fluorescence intensities compared to incubation with labeled dextran alone. When cells were exposed to shock waves in the presence of labeled dextran, mean cellular fluorescence was further increased, indicating additional internalization of the probe. Confocal laser scanning microscopy confirmed intracellular fluorescence of labeled dextran with a diffuse distribution pattern. Fluorescence-activated cell sorting with subsequent determination of proliferation revealed that permeabilized cells were viable and able to proliferate. Permeabilization of the membrane of L1210 cells by shock waves in vitro allowed loading of dextrans with a relative molecular mass up to 2,000,000. Permeabilization of tumor cells by shock waves provides a useful tool for introducing molecules into cells which might be of interest for drug targeting in tumor therapy in vivo.

ClimateNet: A Machine Learning dataset for Climate Science Research

NASA Astrophysics Data System (ADS)

Prabhat, M.; Biard, J.; Ganguly, S.; Ames, S.; Kashinath, K.; Kim, S. K.; Kahou, S.; Maharaj, T.; Beckham, C.; O'Brien, T. A.; Wehner, M. F.; Williams, D. N.; Kunkel, K.; Collins, W. D.

2017-12-01

Deep Learning techniques have revolutionized commercial applications in Computer vision, speech recognition and control systems. The key for all of these developments was the creation of a curated, labeled dataset ImageNet, for enabling multiple research groups around the world to develop methods, benchmark performance and compete with each other. The success of Deep Learning can be largely attributed to the broad availability of this dataset. Our empirical investigations have revealed that Deep Learning is similarly poised to benefit the task of pattern detection in climate science. Unfortunately, labeled datasets, a key pre-requisite for training, are hard to find. Individual research groups are typically interested in specialized weather patterns, making it hard to unify, and share datasets across groups and institutions. In this work, we are proposing ClimateNet: a labeled dataset that provides labeled instances of extreme weather patterns, as well as associated raw fields in model and observational output. We develop a schema in NetCDF to enumerate weather pattern classes/types, store bounding boxes, and pixel-masks. We are also working on a TensorFlow implementation to natively import such NetCDF datasets, and are providing a reference convolutional architecture for binary classification tasks. Our hope is that researchers in Climate Science, as well as ML/DL, will be able to use (and extend) ClimateNet to make rapid progress in the application of Deep Learning for Climate Science research.

Characterization of the Trunk Neural Crest in the bamboo shark, Chiloscyllium punctatum

PubMed Central

Juarez, Marilyn; Reyes, Michelle; Coleman, Tiffany; Rotenstein, Lisa; Sao, Sothy; Martinez, Darwin; Jones, Matthew; Mackelprang, Rachel; de Bellard, Maria Elena

2013-01-01

The neural crest is a population of mesenchymal cells that after migrating from the neural tube give rise to a structures and cell-types: jaw, part of the peripheral ganglia and melanocytes. Although much is known about neural crest development in jawed vertebrates, a clear picture of trunk neural crest development for elasmobranchs is yet to be developed. Here we present a detailed study of trunk neural crest development in the bamboo shark, Chiloscyllium punctatum. Vital labeling with DiI and in situ hybridization using cloned Sox8 and Sox9 probes demonstrated that trunk neural crest cells follow a pattern similar to the migratory paths already described in zebrafish and amphibians. We found shark trunk neural crest along the rostral side of the somites, the ventromedial pathway, branchial arches, gut, sensory ganglia and nerves. Interestingly, Chiloscyllium punctatum Sox8 and Sox9 sequences aligned with vertebrate SoxE genes, but appeared to be more ancient than the corresponding vertebrate paralogs. The expression of these two SoxE genes in trunk neural crest cells, especially Sox9, matched the Sox10 migratory patterns observed in teleosts. Interestingly, we observed DiI cells and Sox9 labeling along the lateral line, suggesting that in C. punctatum, glial cells in the lateral line are likely of neural crest origin. Though this has been observed in other vertebrates, we are the first to show that the pattern is present in cartilaginous fishes. These findings demonstrate that trunk neural crest cell development in Chiloscyllium punctatum follows the same highly conserved migratory pattern observed in jawed vertebrates PMID:23640803

Impatience versus achievement strivings in the Type A pattern: Differential effects on students' health and academic achievement

NASA Technical Reports Server (NTRS)

Spence, Janet T.; Helmreich, Robert L.; Pred, Robert S.

1987-01-01

Psychometric analyses of college students' responses to the Jenkins Activity Survey, a self-report measure of the Type A behavior pattern, revealed the presence of two relatively independent factors. Based on these analyses, two scales, labeled Achievement Strivings (AS) and Impatience and Irritability (II), were developed. In two samples of male and female college students, scores on AS but not on II were found to be significantly correlated with grade point average. Responses to a health survey, on the other hand, indicated that frequency of physical complaints was significantly correlated with II but not with AS. These results suggest that there are two relatively independent factors in the Type A pattern that have differential effects on performance and health. Future research on the personality factors related to coronary heart disease and other disorders might more profitably focus on the syndrome reflected in the II scale than on the Type A pattern.

Rhizosphere C flux from tree roots to soil: spatial and temporal differences between sugar maple and yellow birch saplings

NASA Astrophysics Data System (ADS)

Phillips, R. P.; Fahey, T. J.

2003-12-01

Rhizosphere carbon flux (RCF) has rarely been measured for intact root-soil systems. We measured RCF for eight year-old saplings of sugar maple (Acer saccharum) and yellow birch (Betula allegheniensis) collected from Hubbard Brook Experimental Forest and transplanted into 35 cm diameter pots with native soil horizons intact. We hypothesized birch roots which support ectomycorrhizal fungi would release more C to the rhizosphere than sugar maple roots which support vesicular-arbuscular mycorrhizal fungi. Saplings (n=5) were pulse-labeled with 13CO2 at ambient CO2 concentrations for 4-6 hours, and the label was chased through rhizosphere and bulk soil pools in organic and mineral horizons for 7 days. We observed immediate appearance of the label in rhizosphere soil, and there was a striking difference in the temporal pattern of 13C concentration between species. In maple, peak concentration of the label appeared at day 1 and declined over time whereas in birch the label increased in concentration over the 7 day chase period. As a result, total RCF was 2-3 times greater from birch roots. We estimate at least 5% and 10% of NPP may be released from this flux pathway in sugar maple and yellow birch saplings respectively. These results suggest that rhizosphere C flux likely represents a substantial proportion of NPP in northern hardwood forests, and may be influenced by trees species and mycorrhizal association.

Long term imaging of living brain cancer cells

NASA Astrophysics Data System (ADS)

Farias, Patricia M. A.; Galembeck, André; Milani, Raquel; Andrade, Arnaldo C. D. S.; Stingl, Andreas

2018-02-01

QDs synthesized in aqueous medium and functionalized with polyethylene glycol were used as fluorescent probes. They label and monitor living healthy and cancer brain glial cells in culture. Physical-chemical characterization was performed. Toxicological studies were performed by in vivo short and long-term inhalation in animal models. Healthy and cancer glial living cells were incubated in culture media with highly controlled QDs. Specific features of glial cancer cells were enhanced by QD labelling. Cytoplasmic labelling pattern was clearly distinct for healthy and cancer cells. Labelled cells kept their normal activity for same period as non-labelled control samples.

Brainstem projections of neurons located in various subdivisions of the dorsolateral hypothalamic area-an anterograde tract-tracing study.

PubMed

Papp, Rege S; Palkovits, Miklós

2014-01-01

The projections from the dorsolateral hypothalamic area (DLH) to the lower brainstem have been investigated by using biotinylated dextran amine (BDA), an anterograde tracer in rats. The DLH can be divided into 3 areas (dorsomedial hypothalamus, perifornical area, lateral hypothalamic area), and further subdivided into 8 subdivisions. After unilateral stereotaxic injections of BDA into individual DLH subdivisions, the correct sites of injections were controlled histologically, and the distribution patterns of BDA-positive fibers were mapped on serial sections between the hypothalamus and spinal cord in 22 rats. BDA-labeled fibers were observable over 100 different brainstem areas, nuclei, or subdivisions. Injections into the 8 DLH subdivisions established distinct topographical patterns. In general, the density of labeled fibers was low in the lower brainstem. High density of fibers was seen only 4 of the 116 areas: in the lateral and ventrolateral parts of the periaqueductal gray, the Barrington's, and the pedunculopontine tegmental nuclei. All of the biogenic amine cell groups in the lower brainstem (9 noradrenaline, 3 adrenaline, and 9 serotonin cell groups) received labeled fibers, some of them from all, or at least 7 DLH subdivisions, mainly from perifornical and ventral lateral hypothalamic neurons. Some of the tegmental nuclei and nuclei of the reticular formation were widely innervated, although the density of the BDA-labeled fibers was generally low. No definitive descending BDA-positive pathway, but long-run solitaire BDA-labeled fibers were seen in the lower brainstem. These descending fibers joined some of the large tracts or fasciculi in the brainstem. The distribution pattern of BDA-positive fibers of DLH origin throughout the lower brainstem was comparable to patterns of previously published orexin- or melanin-concentrating hormone-immunoreactive fibers with somewhat differences.

Brainstem projections of neurons located in various subdivisions of the dorsolateral hypothalamic area—an anterograde tract-tracing study

PubMed Central

Papp, Rege S.; Palkovits, Miklós

2014-01-01

The projections from the dorsolateral hypothalamic area (DLH) to the lower brainstem have been investigated by using biotinylated dextran amine (BDA), an anterograde tracer in rats. The DLH can be divided into 3 areas (dorsomedial hypothalamus, perifornical area, lateral hypothalamic area), and further subdivided into 8 subdivisions. After unilateral stereotaxic injections of BDA into individual DLH subdivisions, the correct sites of injections were controlled histologically, and the distribution patterns of BDA-positive fibers were mapped on serial sections between the hypothalamus and spinal cord in 22 rats. BDA-labeled fibers were observable over 100 different brainstem areas, nuclei, or subdivisions. Injections into the 8 DLH subdivisions established distinct topographical patterns. In general, the density of labeled fibers was low in the lower brainstem. High density of fibers was seen only 4 of the 116 areas: in the lateral and ventrolateral parts of the periaqueductal gray, the Barrington's, and the pedunculopontine tegmental nuclei. All of the biogenic amine cell groups in the lower brainstem (9 noradrenaline, 3 adrenaline, and 9 serotonin cell groups) received labeled fibers, some of them from all, or at least 7 DLH subdivisions, mainly from perifornical and ventral lateral hypothalamic neurons. Some of the tegmental nuclei and nuclei of the reticular formation were widely innervated, although the density of the BDA-labeled fibers was generally low. No definitive descending BDA-positive pathway, but long-run solitaire BDA-labeled fibers were seen in the lower brainstem. These descending fibers joined some of the large tracts or fasciculi in the brainstem. The distribution pattern of BDA-positive fibers of DLH origin throughout the lower brainstem was comparable to patterns of previously published orexin- or melanin-concentrating hormone-immunoreactive fibers with somewhat differences. PMID:24904303

Postembryonic neurogenesis in the procerebrum of the terrestrial snail, Helix lucorum L

NASA Technical Reports Server (NTRS)

Zakharov, I. S.; Hayes, N. L.; Ierusalimsky, V. N.; Nowakowski, R. S.; Balaban, P. M.

1998-01-01

Neuronogenesis during posthatching development of the procerebrum of the terrestrial snail Helix lucorum was analyzed using bromodeoxyuridine immunohistochemistry to label proliferating cells. Comparison of the distribution of labeled cells in a series of animals which differed in age at the time of incubation with bromodeoxyuridine, in survival time after incubation, and in age at sacrifice reveals a clear pattern and developmental sequence in neuron origin. First, the proliferating cells are located only at the apical portion of the procerebrum. Second, cells which are produced at any particular age remain, for the most part, confined to a single layer in the procerebrum. Third, as development proceeds, each layer of previously produced neurons is displaced toward the basal part of the procerebrum by the production of additional neurons. Our results suggest that the vast majority of the neurons (probably about 70-80%) of the snail procerebrum are produced during the first 1-2 months of posthatching development.

Control of Task Sequences: What is the Role of Language?

PubMed Central

Mayr, Ulrich; Kleffner, Killian; Kikumoto, Atsushi; Redford, Melissa A.

2015-01-01

It is almost a truism that language aids serial-order control through self-cuing of upcoming sequential elements. We measured speech onset latencies as subjects performed hierarchically organized task sequences while "thinking aloud" each task label. Surprisingly, speech onset latencies and response times (RTs) were highly synchronized, a pattern that is not consistent with the hypothesis that speaking aids proactive retrieval of upcoming sequential elements during serial-order control. We also found that when instructed to do so, participants were able to speak task labels prior to presentation of response-relevant stimuli and that this substantially reduced RT signatures of retrieval—however at the cost of more sequencing errors. Thus, while proactive retrieval is possible in principle, in natural situations it seems to be prevented through a strong, "gestalt-like" tendency to synchronize speech and action. We suggest that this tendency may support context updating rather than proactive control. PMID:24274386

Examining the Impact of Online Labeling on Tutoring Behavior and Its Effect on the English Learning and Motivation of Low-Achieving University Students

ERIC Educational Resources Information Center

Wu, Ejean; Yang, Shu Ching

2016-01-01

This study examines the differential impact of tutor labeling vs. non-labeling approaches on the performance; motivation beliefs; and cognitive, social, and teaching presence of low-achieving students. Two interactive tutoring strategy patterns are investigated based on the taxonomical e-moderating model of Salmon. In addition, the tutees' online…

Nanoscale observation of local bound charges of patterned protein arrays by scanning force microscopy

NASA Astrophysics Data System (ADS)

Oh, Y. J.; Jo, W.; Kim, S.; Park, S.; Kim, Y. S.

2008-09-01

A protein patterned surface using micro-contact printing methods has been investigated by scanning force microscopy. Electrostatic force microscopy (EFM) was utilized for imaging the topography and detecting the electrical properties such as the local bound charge distribution of the patterned proteins. It was found that the patterned IgG proteins are arranged down to 1 µm, and the 90° rotation of patterned anti-IgG proteins was successfully undertaken. Through the estimation of the effective areas, it was possible to determine the local bound charges of patterned proteins which have opposite electrostatic force behaviors. Moreover, we studied the binding probability between IgG and anti-IgG in a 1 µm2 MIMIC system by topographic and electrostatic signals for applicable label-free detections. We showed that the patterned proteins can be used for immunoassay of proteins on the functional substrate, and that they can also be used for bioelectronics device application, indicating distinct advantages with regard to accuracy and a label-free detection.

Patterns of health-related behaviours among adolescents: a cross-sectional study based on the National Survey of School Health Brazil 2012

PubMed Central

Azeredo, Catarina Machado; Levy, Renata Bertazzi; Peres, Maria Fernanda Tourinho; Menezes, Paulo Rossi; Araya, Ricardo

2016-01-01

Objectives The aim of this study was to analyse the clustering of multiple health-related behaviours among adolescents and describe which socio-demographic characteristics are associated with these patterns. Design Cross-sectional study. Setting Brazilian schools assessed by the National Survey of School Health (PeNSE, 2012). Participants 104 109 Brazilian ninth-grade students from public and private schools (response rate=82.7%). Methods Exploratory and confirmatory factor analyses were performed to identify behaviour clustering and linear regression models were used to identify socio-demographic characteristics associated with each one of these behaviour patterns. Results We identified a good fit model with three behaviour patterns. The first was labelled ‘problem-behaviour’ and included aggressive behaviour, alcohol consumption, smoking, drug use and unsafe sex; the second was labelled ‘health-compromising diet and sedentary behaviours’ and included unhealthy food indicators and sedentary behaviour; and the third was labelled ‘health-promoting diet and physical activity’ and included healthy food indicators and physical activity. No differences in behaviour patterns were found between genders. The problem-behaviour pattern was associated with male gender, older age, more developed region (socially and economically) and public schools (compared with private). The ‘health-compromising diet and sedentary behaviours’ pattern was associated with female gender, older age, mothers with higher education level and more developed region. The ‘health-promoting diet and physical activity’ pattern was associated with male gender and mothers with higher education level. Conclusions Three health-related behaviour patterns were found among Brazilian adolescents. Interventions to decrease those negative patterns should take into account how these behaviours cluster together and the individuals most at risk. PMID:28186927

Subjective Responses to Emotional Stimuli During Labeling, Reappraisal, and Distraction

PubMed Central

Lieberman, Matthew D.; Inagaki, Tristen K.; Tabibnia, Golnaz; Crockett, Molly J.

2011-01-01

Although multiple neuroimaging studies suggest that affect labeling (i.e., putting feelings into words) can dampen affect-related responses in the amygdala, the consequences of affect labeling have not been examined in other channels of emotional responding. We conducted four studies examining the effect of affect labeling on self-reported emotional experience. In study one, self-reported distress was lower during affect labeling, compared to passive watching, of negative emotional pictures. Studies two and three added reappraisal and distraction conditions, respectively. Affect labeling showed similar effects on self-reported distress as both of these intentional emotion regulation strategies. In each of the first three studies, however, participant predictions about the effects of affect labeling suggest that unlike reappraisal and distraction, people do not believe affect labeling to be an effective emotion regulation strategy. Even after having the experience of affect labels leading to lower distress, participants still predicted that affect labeling would increase distress in the future. Thus, affect labeling is best described as an incidental emotion regulation process. Finally, study four employed positive emotional pictures and here, affect labeling was associated with diminished self-reported pleasure, relative to passive watching. This suggests that affect labeling tends to dampen affective responses in general, rather than specifically alleviating negative affect. PMID:21534661

Photoluminescence of patterned CdSe quantum dot for anti-counterfeiting label on paper

NASA Astrophysics Data System (ADS)

Isnaeni, Yulianto, Nursidik; Suliyanti, Maria Margaretha

2016-03-01

We successfully developed a method utilizing colloidal CdSe nanocrystalline quantum dot for anti-counterfeiting label on a piece of glossy paper. We deposited numbers and lines patterns of toluene soluble CdSe quantum dot using rubber stamper on a glossy paper. The width of line pattern was about 1-2 mm with 1-2 mm separation between lines. It required less than one minute for deposited CdSe quantum dot on glossy paper to dry and become invisible by naked eyes. However, patterned quantum dot become visible using long-pass filter glasses upon excitation of UV lamp or blue laser. We characterized photoluminescence of line patterns of quantum dot, and we found that emission boundaries of line patterns were clearly observed. The error of line size and shape were mainly due to defect of the original stamper. The emission peak wavelength of CdSe quantum dot was 629 nm. The emission spectrum of deposited quantum dot has full width at half maximum (FWHM) of 30-40 nm. The spectra similarity between deposited quantum dot and the original quantum dot in solution proved that our stamping method can be simply applied on glossy paper without changing basic optical property of the quantum dot. Further development of this technique is potential for anti-counterfeiting label on very important documents or objects.

Photoluminescence of patterned CdSe quantum dot for anti-counterfeiting label on paper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Isnaeni,, E-mail: isnaeni@lipi.go.id; Yulianto, Nursidik; Suliyanti, Maria Margaretha

We successfully developed a method utilizing colloidal CdSe nanocrystalline quantum dot for anti-counterfeiting label on a piece of glossy paper. We deposited numbers and lines patterns of toluene soluble CdSe quantum dot using rubber stamper on a glossy paper. The width of line pattern was about 1-2 mm with 1-2 mm separation between lines. It required less than one minute for deposited CdSe quantum dot on glossy paper to dry and become invisible by naked eyes. However, patterned quantum dot become visible using long-pass filter glasses upon excitation of UV lamp or blue laser. We characterized photoluminescence of line patterns of quantummore » dot, and we found that emission boundaries of line patterns were clearly observed. The error of line size and shape were mainly due to defect of the original stamper. The emission peak wavelength of CdSe quantum dot was 629 nm. The emission spectrum of deposited quantum dot has full width at half maximum (FWHM) of 30-40 nm. The spectra similarity between deposited quantum dot and the original quantum dot in solution proved that our stamping method can be simply applied on glossy paper without changing basic optical property of the quantum dot. Further development of this technique is potential for anti-counterfeiting label on very important documents or objects.« less

Color pattern specific proteins in black scales in developing wings ofPrecis coenia Hübner (Nymphalidae, Lepidoptera).

PubMed

Koch, P Bernhardt; Nijhout, H Frederik

1990-05-01

A set of stage specific proteins of approximally 86 to 90 kDal are synthesized by isolated wings ofPrecis coenia on day 5 of the pupal stage. They are named "B proteins". They are synthesized in presumptive black wing areas in higher amounts than in presumptive white wing areas and are the major proteins synthesized on day 5. Wings from 5 days old pupae, which were incubated with 35 S-methionine for 2 or 4 hours, incorporate radiolabel into presumptive black pattern elements. This is probably due to the localized synthesis of the above mentioned proteins. Injection of 35 S-methionine into whole pupae on day 5 resulted in the labelling of the mature black and grey scales but not white scales. This radiolabel incorporation pattern corresponds exactly to the incorporation of the melanin precursor 14 C-tyrosine into the scales. The results indicate that the "B proteins" are specifically related to the formation of black and grey portions of thePrecis wing pattern. Injection of 35 S-methionine into whole pupae on day 6 resulted in the labelling of the mature red scales probably due to labelling of "R proteins", which may be involved in the formation of red pattern elements.

Analysis of the therapeutic gain in the treatment of human osteosarcoma microcolonies in vitro with 211At-labelled monoclonal antibody.

PubMed

Larsen, R H; Bruland, O S; Hoff, P; Alstad, J; Rofstad, E K

1994-06-01

Microcolonies were obtained by culturing cells of two human osteosarcoma lines (OHS and KPDX) and one human melanoma line (WIX-c) for either 24 or 72 h. The microcolonies were treated with either alpha-particle radiation emitted by the 211At-labelled monoclonal antibody (MAb) TP-3 or external beam X-rays. Survival of microcolonies was assayed by colony formation. Therapeutic gain factor (TGF) values were calculated for two survival levels, 50% and 20% microcolony regeneration (i.e. at least one cell in 50% or 20% of the colonies survived the treatments). The TGF values were affected by the specific activity of the 211At-MAb conjugate, the antigen expression of the cells and the size and growth pattern of the microcolonies. Treatment with 211At-TP-3 gave TGF values that varied from 1.3 +/- 0.4 to 4.5 +/- 0.7 (mean +/- s.e.). The antigen-rich OHS cell line had on average 1.6 times higher TGF than the antigen-poor KPDX cell line. The TGF increased significantly with colony size for the densely packed colonies of the KPDX cell line but not for the OHS cell line, which had colonies with cells growing in a more scattered pattern. Control experiments with the two non-specific 211At forms, free 211At and 211At-labelled bovine serum albumin, gave TGF values from 0.6 +/- 0.1 to 1.0 +/- 0.3. This study suggests that in vivo evaluation of 211At-MAbs using relevant tumour models is desirable.

Analysis of the therapeutic gain in the treatment of human osteosarcoma microcolonies in vitro with 211At-labelled monoclonal antibody.

PubMed Central

Larsen, R. H.; Bruland, O. S.; Hoff, P.; Alstad, J.; Rofstad, E. K.

1994-01-01

Microcolonies were obtained by culturing cells of two human osteosarcoma lines (OHS and KPDX) and one human melanoma line (WIX-c) for either 24 or 72 h. The microcolonies were treated with either alpha-particle radiation emitted by the 211At-labelled monoclonal antibody (MAb) TP-3 or external beam X-rays. Survival of microcolonies was assayed by colony formation. Therapeutic gain factor (TGF) values were calculated for two survival levels, 50% and 20% microcolony regeneration (i.e. at least one cell in 50% or 20% of the colonies survived the treatments). The TGF values were affected by the specific activity of the 211At-MAb conjugate, the antigen expression of the cells and the size and growth pattern of the microcolonies. Treatment with 211At-TP-3 gave TGF values that varied from 1.3 +/- 0.4 to 4.5 +/- 0.7 (mean +/- s.e.). The antigen-rich OHS cell line had on average 1.6 times higher TGF than the antigen-poor KPDX cell line. The TGF increased significantly with colony size for the densely packed colonies of the KPDX cell line but not for the OHS cell line, which had colonies with cells growing in a more scattered pattern. Control experiments with the two non-specific 211At forms, free 211At and 211At-labelled bovine serum albumin, gave TGF values from 0.6 +/- 0.1 to 1.0 +/- 0.3. This study suggests that in vivo evaluation of 211At-MAbs using relevant tumour models is desirable. PMID:8198960

Site-directed spin labeling reveals a conformational switch in the phosphorylation domain of smooth muscle myosin.

PubMed

Nelson, Wendy D; Blakely, Sarah E; Nesmelov, Yuri E; Thomas, David D

2005-03-15

We have used site-directed spin labeling and EPR spectroscopy to detect structural changes within the regulatory light chain (RLC) of smooth muscle myosin upon phosphorylation. Smooth muscle contraction is activated by phosphorylation of S19 on RLC, but the structural basis of this process is unknown. There is no crystal structure containing a phosphorylated RLC, and there is no crystal structure for the N-terminal region of any RLC. Therefore, we have prepared single-Cys mutations throughout RLC, exchanged each mutant onto smooth muscle heavy meromyosin, verified normal regulatory function, and used EPR to determine dynamics and solvent accessibility at each site. A survey of spin-label sites throughout the RLC revealed that only the N-terminal region (first 24 aa) shows a significant change in dynamics upon phosphorylation, with most of the first 17 residues showing an increase in rotational amplitude. Therefore, we focused on this N-terminal region. Additional structural information was obtained from the pattern of oxygen accessibility along the sequence. In the absence of phosphorylation, little or no periodicity was observed, suggesting a lack of secondary structural order in this region. However, phosphorylation induced a strong helical pattern (3.6-residue periodicity) in the first 17 residues, while increasing accessibility throughout the first 24 residues. We have identified a domain within RLC, the N-terminal phosphorylation domain, in which phosphorylation increases helical order, internal dynamics, and accessibility. These results support a model in which this disorder-to-order transition within the phosphorylation domain results in decreased head-head interactions, activating myosin in smooth muscle.

How does early adulthood arrest alter substance use behavior? Are there differential effects by race/ethnicity and gender?

PubMed Central

Hassett-Walker, Connie; Walsemann, Katrina; Bell, Bethany; Fisk, Calley; Shadden, Mark; Zhou, Weidan

2017-01-01

Purpose Much criminal justice research has ignored racial/ethnic and gender differences in substance use subsequent to criminal justice involvement. This paper investigated how early adulthood arrest (i.e., 18 to 21 years of age) influences individuals’ subsequent transitions from non-substance use to substance use, and substance use to non-substance use through age 30. We also consider if these relationships differ by race/ethnicity and gender. Processes proscribed by labeling theory subsequent to getting arrested are considered. Methods We analyzed 15 waves of data from the National Longitudinal Survey of Youth 1997. Multinomial logistic regressions were performed using Stata software version 14. Results We found racial/ethnic differences in the effect of arrest on subsequent substance use, particularly marijuana. Being arrested was associated with shifting non-binge drinkers and non-marijuana users into binge drinking and marijuana use; as well as shifting binge drinkers and marijuana users into non-use. This pattern was most evident among White and Black men. For Black men, the association between arrest and both becoming a binge drinker and becoming a non-binge drinker was experienced most strongly during their early twenties. Women’s patterns in substance use transitions following an arrest were less clear than for the men. Conclusion Some results, particularly transitioning into marijuana use, offer qualified support for processes proscribed through labeling theory. Findings that arrest shifts individuals into non-marijuana use suggest that factors not accounted for by labeling theory – arrest serving as a teachable moment for those using substances - may be at play. PMID:29123972

Rods and cones contain antigenically distinctive S-antigens.

PubMed

Nork, T M; Mangini, N J; Millecchia, L L

1993-09-01

S-antigen (48 kDa protein or arrestin) is known to be present in rod photoreceptors. Its localization in cones is less clear with several conflicting reports among various species examined. This study employed three different anti-S-antigen antibodies (a48K, a polyclonal antiserum and two monoclonal antibodies, MAb A9-C6 and MAb 5c6.47) and examined their localization in rods and cones of human and cat retinas. To identify the respective cone types, an enzyme histochemical technique for carbonic anhydrase (CA) was employed to distinguish blue cones (CA-negative) from red or green cones (CA-positive). S-antigen localization was then examined by immunocytochemical staining of adjacent sections. In human retinas, a similar labeling pattern was seen with both a48K and MAb A9-C6, i.e., the rods and blue-sensitive cones were strongly positive, whereas the red- or green-sensitive cones showed little immunoreactivity. All human photoreceptors showed reactivity to MAb 5c6.47. In the cat retina, only CA-positive cones could be found. As in the human retina, both rods and cones of the cat were positive for MAb 5c6.47. A difference from the labeling pattern in human retina was noted for the other S-antigen antibodies; a48K labeled rods and all of the cones, whereas MAb A9-C6 reacted strongly with the rods but showed no cone staining. These results suggest that both rods and cones contain S-antigen but that they are antigenically distinctive.

Linking autotrophic activity in environmental samples with specific bacterial taxa by detection of 13C-labelled fatty acids.

PubMed

Knief, Claudia; Altendorf, Karlheinz; Lipski, André

2003-11-01

A method for the detection of physiologically active autotrophic bacteria in complex microbial communities was developed based on labelling with the stable isotope 13C. Labelling of autotrophic nitrifying, sulphur-oxidizing and iron-oxidizing populations was performed in situ by incubation with NaH[13C]O3. Incorporated label into fatty acid methyl esters (FAMEs) was detected and quantified using gas chromatography-mass spectrometry in single ion monitoring mode. Before the analyses of different environmental samples, the protocol was evaluated in pure culture experiments. In different environmental samples a selective labelling of fatty acids demonstrated which microbial taxa were responsible for the respective chemolithoautotrophic activity. The most strongly labelled fatty acids of a sample from a sulphide treating biofilter from an animal rendering plant were cis-7-hexadecenoic acid (16:1 cis7) and 11-methyl hexadecanoic acid (16:0 11methyl), which are as-yet not known for any sulphide-oxidizing autotroph. The fatty acid labelling pattern of an experimental biotrickling filter sample supplied with dimethyl disulphide clearly indicated the presence and activity of sulphide-oxidizing bacteria of the genus Thiobacillus. For a third environmental sample from an acid mining lake sediment, the assignment of autotrophic activity to bacteria of the genus Leptospirillum but not to Acidithiobacillus could be made by this method, as the fatty acid patterns of these bacteria show clear differences.

Brain-wide maps of Fos expression during fear learning and recall.

PubMed

Cho, Jin-Hyung; Rendall, Sam D; Gray, Jesse M

2017-04-01

Fos induction during learning labels neuronal ensembles in the hippocampus that encode a specific physical environment, revealing a memory trace. In the cortex and other regions, the extent to which Fos induction during learning reveals specific sensory representations is unknown. Here we generate high-quality brain-wide maps of Fos mRNA expression during auditory fear conditioning and recall in the setting of the home cage. These maps reveal a brain-wide pattern of Fos induction that is remarkably similar among fear conditioning, shock-only, tone-only, and fear recall conditions, casting doubt on the idea that Fos reveals auditory-specific sensory representations. Indeed, novel auditory tones lead to as much gene induction in visual as in auditory cortex, while familiar (nonconditioned) tones do not appreciably induce Fos anywhere in the brain. Fos expression levels do not correlate with physical activity, suggesting that they are not determined by behavioral activity-driven alterations in sensory experience. In the thalamus, Fos is induced more prominently in limbic than in sensory relay nuclei, suggesting that Fos may be most sensitive to emotional state. Thus, our data suggest that Fos expression during simple associative learning labels ensembles activated generally by arousal rather than specifically by a particular sensory cue. © 2017 Cho et al.; Published by Cold Spring Harbor Laboratory Press.

Brain-wide maps of Fos expression during fear learning and recall

PubMed Central

Cho, Jin-Hyung; Rendall, Sam D.; Gray, Jesse M.

2017-01-01

Fos induction during learning labels neuronal ensembles in the hippocampus that encode a specific physical environment, revealing a memory trace. In the cortex and other regions, the extent to which Fos induction during learning reveals specific sensory representations is unknown. Here we generate high-quality brain-wide maps of Fos mRNA expression during auditory fear conditioning and recall in the setting of the home cage. These maps reveal a brain-wide pattern of Fos induction that is remarkably similar among fear conditioning, shock-only, tone-only, and fear recall conditions, casting doubt on the idea that Fos reveals auditory-specific sensory representations. Indeed, novel auditory tones lead to as much gene induction in visual as in auditory cortex, while familiar (nonconditioned) tones do not appreciably induce Fos anywhere in the brain. Fos expression levels do not correlate with physical activity, suggesting that they are not determined by behavioral activity-driven alterations in sensory experience. In the thalamus, Fos is induced more prominently in limbic than in sensory relay nuclei, suggesting that Fos may be most sensitive to emotional state. Thus, our data suggest that Fos expression during simple associative learning labels ensembles activated generally by arousal rather than specifically by a particular sensory cue. PMID:28331016

Subtypes of ataques de nervios: the influence of coexisting psychiatric diagnosis.

PubMed

Salmán, E; Liebowitz, M R; Guarnaccia, P J; Jusino, C M; Garfinkel, R; Street, L; Cárdenas, D L; Silvestre, J; Fyer, A J; Carrasco, J L; Davies, S O; Klein, D F

1998-06-01

The current study assesses the relationship between presenting symptomatology of the self-labeled Hispanic popular diagnosis of ataques de nervios and the specific co-morbid psychiatric diagnoses. Hispanic subjects seeking treatment at an anxiety disorders clinic (n = 156) were assessed with a specially designed self-report instrument for both traditional ataque de nervios and panic symptoms, and with structured or semistructured psychiatric interviews for Axis-I disorders. This report focuses on 102 subjects with ataque de nervios who also met criteria for panic disorder, other anxiety disorders, or an affective disorder. Distinct ataque symptom patterns correlated with co-existing panic disorder, affective disorders, or other anxiety disorders. Individuals with both ataque and panic disorder reported the most asphyxia, fear of dying, and increased fear during their ataques. People with ataques who also met criteria for affective disorder reported the most anger, screaming, becoming aggressive, and breaking things during ataques. Ataque positive subjects with other anxiety disorders were less salient for both panic-like and emotional-anger symptoms. The findings suggest that (a) ataque de nervios is a popular label referring to several distinct patterns of loss of emotional control, (b) the type of loss of emotional control is influenced by the associated psychiatric disorder, and (c) ataque symptom patterns may be a useful clinical marker for detecting psychiatric disorders. Further study is needed to examine the relationship between ataque de nervios and psychiatric disorders, as well as the relationship to cultural, demographic, environmental, and personality factors.

Ontogenetic expression of the vanilloid receptors TRPV1 and TRPV2 in the rat retina.

PubMed

Leonelli, Mauro; Martins, Daniel O; Kihara, Alexandre H; Britto, Luiz R G

2009-11-01

The present study aimed to analyze the gene and protein expression and the pattern of distribution of the vanilloid receptors TRPV1 and TRPV2 in the developing rat retina. During the early phases of development, TRPV1 was found mainly in the neuroblastic layer of the retina and in the pigmented epithelium. In the adult, TRPV1 was found in microglial cells, blood vessels, astrocytes and in neuronal structures, namely synaptic boutons of both retinal plexiform layers, as well as in cell bodies of the inner nuclear layer and the ganglion cell layer. The pattern of distribution of TRPV1 was mainly punctate, and there was higher TRPV1 labeling in the peripheral retina than in central regions. TRPV2 expression was quite distinct. Its expression was virtually undetectable by immunoblotting before P1, and that receptor was found by immunohistochemistry only by postnatal day 15 (P15). RNA and protein analysis showed that the adult levels are only reached by P60, which includes small processes in the retinal plexiform layers, and labeled cellular bodies in the inner nuclear layer and the ganglion cell layer. There was no overlapping between the signal observed for both receptors. In conclusion, our results showed that the patterns of distribution of TRPV1 and TRPV2 are different during the development of the rat retina, suggesting that they have specific roles in both visual processing and in providing specific cues to neural development.

Differential Protein Composition and Gene Expression in Leaf Mesophyll Cells and Bundle Sheath Cells of the C(4) Plant Digitaria sanguinalis (L.) Scop.

PubMed

Potter, J W; Black, C C

1982-08-01

The distribution and molecular weights of cellular proteins in soluble and membrane-associated locations were analyzed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Coomassie blue staining of leaf (Digitaria sanguinalis L. Scop.) extracts and isolated cell extracts. Leaf polypeptides also were pulse-labeled, followed by isolation of the labeled leaf cell types and analysis of the newly synthesized polypeptides in each cell type by electrophoresis and fluorography.Comparison of the electrophoretic patterns of crabgrass whole leaf polypeptides with isolated cell-type polypeptides indicated a difference in protein distribution patterns for the two cell types. The mesophyll cells exhibited a greater allocation of total cellular protein into membrane-associated proteins relative to soluble proteins. In contrast, the bundle sheath cells exhibited a higher percentage of total cellular protein in soluble proteins. Phosphoenolpyruvate carboxylase was the major soluble protein in the mesophyll cell and ribulose bisphosphate carboxylase was the major soluble protein in the bundle sheath cell. The majority of in vivo(35)S-pulse-labeled proteins synthesized by the two crabgrass cell types corresponded in molecular weight to the proteins present in the cell types which were detected by conventional staining techniques. The bundle sheath cell and mesophyll cell fluorograph profiles each had 15 major (35)S-labeled proteins. The major incorporation of (35)S by bundle sheath cells was into products which co-electrophoresed with the large and small subunits of ribulose bisphosphate carboxylase. In contrast, a major (35)S-labeled product in mesophyll cell extracts co-electrophoresed with the subunit of phosphoenolpyruvate carboxylase. Both cell types exhibited equivalent in vivo labeling of a polypeptide with one- and two-dimensional electrophoretic behavior similar to the major apoprotein of the light-harvesting chlorophyll a/b protein. Results from the use of protein synthesis inhibitors during pulse-labeling experiments indicated intercellular differences in both organelle and cytoplasmic protein synthesis. A majority of the (35)S incorporation by crabgrass mesophyll cell 70S ribosomes was associated with a pair of membrane-associated polypeptides of molecular weight 32,000 and 34,500; a comparison of fluorograph and stained gel profiles suggests these products resemble the precursor and mature forms of the maize chloroplast 32,000 dalton protein reported by Grebanier et al. (1978 J. Cell Biol. 28:734-746). In contrast, crabgrass bundle sheath cell organelle translation was directed predominantly into a product which co-electrophoresed with the large subunit of ribulose bisphosphate carboxylase.

Ectopic transgene expression in the retina of four transgenic mouse lines

PubMed Central

Gábriel, Robert; Erdélyi, Ferenc; Szabó, Gábor; Lawrence, J. Josh

2017-01-01

Retinal expression of transgenes was examined in four mouse lines. Two constructs were driven by the choline acetyltransferase (ChAT) promoter: green fluorescent protein conjugated to tau protein (tau-GFP) or cytosolic yellow fluorescent protein (YFP) generated through CRE recombinase-induced expression of Rosa26 (ChAT-CRE/ Rosa26YFP). Two other constructs targeted inhibitory interneurons: GABAergic horizontal and amacrine cells identified by glutamic acid decarboxylase (GAD65-GFP) or parvalbumin (PV) cells (PV-CRE/Rosa26YFP). Animals were transcardially perfused and retinal sections prepared. Antibodies against PV, calretinin (CALR), calbindin (CALB), and tyrosine hydroxylase (TH) were used to counterstain transgene-expressing cells. In PVxRosa and ChAT-tauGFP constructs, staining appeared in vertically oriented row of processes resembling Müller cells. In the ChATxRosa construct, populations of amacrine cells and neurons in the ganglion cell layer were labeled. Some cones also exhibited GFP fluorescence. CALR, PV and TH were found in none of these cells. Occasionally, we found GFP/ CALR and GFP/PV double-stained cells in the ganglion cell layer (GCL). In the GAD65-GFP construct, all layers of the neuroretina were labeled, except photoreceptors. Not all horizontal cells expressed GFP. We did not find GFP/TH double-labeled cells and GFP was rarely present in CALR-and CALB-containing cells. Many PV-positive neurons were also labeled for GFP, including small diameter amacrines. In the GCL, single labeling for GFP and PV was ascertained, as well as several CALR/PV double-stained neurons. In the GCL, cells triple labeled with GFP/CALR/ CALB were sparse. In conclusion, only one of the four transgenic constructs exhibited an expression pattern consistent with endogenous retinal protein expression, while the others strongly suggested ectopic gene expression. PMID:26563404

The cystine-glutamate exchanger (xCT, Slc7a11) is expressed in significant concentrations in a subpopulation of astrocytes in the mouse brain.

PubMed

Ottestad-Hansen, Sigrid; Hu, Qiu Xiang; Follin-Arbelet, Virgine Veronique; Bentea, Eduard; Sato, Hideyo; Massie, Ann; Zhou, Yun; Danbolt, Niels Christian

2018-05-01

The cystine-glutamate exchanger (xCT) promotes glutathione synthesis by catalyzing cystine uptake and glutamate release. The released glutamate may modulate normal neural signaling and contribute to excitotoxicity in pathological situations. Uncertainty, however, remains as neither the expression levels nor the distribution of xCT have been unambiguously determined. In fact, xCT has been reported in astrocytes, neurons, oligodendrocytes and microglia, but most of the information derives from cell cultures. Here, we show by immunohistochemistry and by Western blotting that xCT is widely expressed in the central nervous system of both sexes. The labeling specificity was validated using tissue from xCT knockout mice as controls. Astrocytes were selectively labeled, but showed greatly varying labeling intensities. This astroglial heterogeneity resulted in an astrocyte domain-like labeling pattern. Strong xCT labeling was also found in the leptomeninges, along some blood vessels, in selected circumventricular organs and in a subpopulation of tanycytes residing the lateral walls of the ventral third ventricle. Neurons, oligodendrocytes and resting microglia, as well as reactive microglia induced by glutamine synthetase deficiency, were unlabeled. The concentration of xCT protein in hippocampus was compared with that of the EAAT3 glutamate transporter by immunoblotting using a chimeric xCT-EAAT3 protein to normalize xCT and EAAT3 labeling intensities. The immunoblots suggested an xCT/EAAT3 ratio close to one (0.75 ± 0.07; average ± SEM; n = 4) in adult C57BL6 mice. xCT is present in select blood/brain/CSF interface areas and in an astrocyte subpopulation, in sufficient quantities to support the notion that system xc- provides physiologically relevant transport activity. © 2018 Wiley Periodicals, Inc.

Terminal Distribution of the Corticospinal Projection from the Hand/Arm Region of the Primary Motor Cortex to the Cervical Enlargement in Rhesus Monkey

PubMed Central

Morecraft, Robert J.; Ge, Jizhi; Stilwell-Morecraft, Kimberly S.; McNeal, David W.; Pizzimenti, Marc A.; Darling, Warren G.

2013-01-01

To further our understanding of the corticospinal projection (CSP) from the hand/arm representation of the primary motor cortex (M1), high-resolution anterograde tracing methodology and stereology were used to investigate the terminal distribution of this connection at spinal levels C5 to T1. The highest number of labeled terminal boutons occurred contralaterally (98%) with few ipsilaterally (2%). Contralaterally, labeled boutons were located within laminae I – X, with the densest distribution found in lamina VII and, to a lesser extent, laminae IX and VI. Fewer terminals were found in other contralateral laminae. Within lamina VII, terminal boutons were most prominent in the dorsomedial, dorsolateral and ventrolateral subsectors. Within lamina IX, the heaviest terminal labeling was distributed dorsally. Ipsilaterally, boutons were found in laminae V – X. The most pronounced distribution occurred in the dorsomedial and ventromedial sectors of lamina VII and fewer labeled boutons were located in other ipsilateral laminae. Segmentally, contralateral lamina VII labeling was highest at levels C5-C7. In contrast, lamina IX labeling was highest at C7-T1 and more widely dispersed amongst the quadrants at C8-T1. Our findings suggest dominant contralateral influence of the M1 hand/arm CSP, a contralateral innervation pattern in lamina VII supporting Kuypers (1982) conceptual framework of a “lateral motor system”, and a projection to lamina IX indicating significant influence on motoneurons innervating flexors acting on the shoulder and elbow rostrally (C5-C7), along with flexors, extensors, abductors and adductors acting on the digits, hand and wrist caudally (C8-T1). PMID:23840034

Development and evaluation of an automatic labeling technique for spring small grains

NASA Technical Reports Server (NTRS)

Crist, E. P.; Malila, W. A. (Principal Investigator)

1981-01-01

A labeling technique is described which seeks to associate a sampling entity with a particular crop or crop group based on similarity of growing season and temporal-spectral patterns of development. Human analyst provide contextual information, after which labeling decisions are made automatically. Results of a test of the technique on a large, multi-year data set are reported. Grain labeling accuracies are similar to those achieved by human analysis techniques, while non-grain accuracies are lower. Recommendations for improvments and implications of the test results are discussed.

Conditional random fields for pattern recognition applied to structured data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burr, Tom; Skurikhin, Alexei

In order to predict labels from an output domain, Y, pattern recognition is used to gather measurements from an input domain, X. Image analysis is one setting where one might want to infer whether a pixel patch contains an object that is “manmade” (such as a building) or “natural” (such as a tree). Suppose the label for a pixel patch is “manmade”; if the label for a nearby pixel patch is then more likely to be “manmade” there is structure in the output domain that can be exploited to improve pattern recognition performance. Modeling P(X) is difficult because features betweenmore » parts of the model are often correlated. Thus, conditional random fields (CRFs) model structured data using the conditional distribution P(Y|X = x), without specifying a model for P(X), and are well suited for applications with dependent features. Our paper has two parts. First, we overview CRFs and their application to pattern recognition in structured problems. Our primary examples are image analysis applications in which there is dependence among samples (pixel patches) in the output domain. Second, we identify research topics and present numerical examples.« less

Conditional random fields for pattern recognition applied to structured data

DOE PAGES

Burr, Tom; Skurikhin, Alexei

2015-07-14

In order to predict labels from an output domain, Y, pattern recognition is used to gather measurements from an input domain, X. Image analysis is one setting where one might want to infer whether a pixel patch contains an object that is “manmade” (such as a building) or “natural” (such as a tree). Suppose the label for a pixel patch is “manmade”; if the label for a nearby pixel patch is then more likely to be “manmade” there is structure in the output domain that can be exploited to improve pattern recognition performance. Modeling P(X) is difficult because features betweenmore » parts of the model are often correlated. Thus, conditional random fields (CRFs) model structured data using the conditional distribution P(Y|X = x), without specifying a model for P(X), and are well suited for applications with dependent features. Our paper has two parts. First, we overview CRFs and their application to pattern recognition in structured problems. Our primary examples are image analysis applications in which there is dependence among samples (pixel patches) in the output domain. Second, we identify research topics and present numerical examples.« less

Competitive FRET-aptamer-based detection of methylphosphonic acid, a common nerve agent metabolite.

PubMed

Bruno, John G; Carrillo, Maria P; Phillips, Taylor; Vail, Neal K; Hanson, Douglas

2008-09-01

Competitive fluorescence resonance energy transfer (FRET)-aptamer-based assay formats are described for one-step detection of methylphosphonic acid (MPA; a metabolite of several organophosphorus (OP) nerve agents). AminoMPA was attached to tosyl-magnetic beads and used for DNA aptamer selection from which one dominant aptamer sequence emerged. Two different FRET approaches were attempted. In one approach, the complementary DNA sequence was used as a template for labeling the aptamer with Alexa Fluor 546 (AF 546)-14-dUTP by asymmetric PCR. Following 3-dimensional (3-D), molecular modeling of the aptamer-MPA complex, a series of three fluoresceinated aptamers labeled at positions 50, 51, and 52 in the putative optimal binding pocket were synthesized. In both FRET formats, aminoMPA was linked to Black Hole Quencher (BHQ-1 or BHQ-2)-succinimides and allowed to bind the fluorescein or AF 546-labeled MPA aptamer. Following gel filtration to purify the labeled MPA aptamer-BHQ-aminoMPA FRET complexes, the complexes were competed against various concentrations of unlabeled MPA, MPA derivatives, and unrelated compounds in titration and cross-reactivity studies. Both approaches yielded low microgram per milliliter detection limits for MPA with generally low levels of cross-reactivity for unrelated compounds. However, the data suggest a pattern of traits that may effect the direction (lights on or off) and intensity of the FRET.

Ultrastructure of Deoxyribonucleic Acid-Membrane Associations in Escherichia coli

PubMed Central

Altenburg, B. C.; Suit, Joan C.; Brinkley, B. R.

1970-01-01

Areas of contact between deoxyribonucleic acid (DNA) and intracytoplasmic membrane are frequently seen in the “extra” membrane-forming strain Escherichia coli 0111a1. By examination of serial sections, it has been estimated that these DNA-membrane associations occur in at least 60% of the extra membrane-containing cells. Most of the DNA masses contained only one contact area. Several cells in which the DNA had been stretched revealed individual fibers connecting to the membrane, suggesting a firm attachment of DNA to membrane. The areas of membrane associated with DNA fibers were usually between 100 and 500 nm in diameter, although some smaller areas were seen. Electron microscopic autoradiography of cells in which the replication forks were labeled showed grains over 24% of the profiles containing a contact area, whereas there were grains over only 16% of the profiles without a contact area. Data from autoradiographs of cells in which the label was “chased” away from the replication fork showed the reverse labeling pattern. These data indicate that the areas of contact between DNA and intracytoplasmic membranes seen in electron micrographs contain the DNA replication forks. Images PMID:4919755

Amygdala reactivity in healthy adults is correlated with prefrontal cortical thickness.

PubMed

Foland-Ross, Lara C; Altshuler, Lori L; Bookheimer, Susan Y; Lieberman, Matthew D; Townsend, Jennifer; Penfold, Conor; Moody, Teena; Ahlf, Kyle; Shen, Jim K; Madsen, Sarah K; Rasser, Paul E; Toga, Arthur W; Thompson, Paul M

2010-12-08

Recent evidence suggests that putting feelings into words activates the prefrontal cortex (PFC) and suppresses the response of the amygdala, potentially helping to alleviate emotional distress. To further elucidate the relationship between brain structure and function in these regions, structural and functional magnetic resonance imaging (MRI) data were collected from a sample of 20 healthy human subjects. Structural MRI data were processed using cortical pattern-matching algorithms to produce spatially normalized maps of cortical thickness. During functional scanning, subjects cognitively assessed an emotional target face by choosing one of two linguistic labels (label emotion condition) or matched geometric forms (control condition). Manually prescribed regions of interest for the left amygdala were used to extract percentage signal change in this region occurring during the contrast of label emotion versus match forms. A correlation analysis between left amygdala activation and cortical thickness was then performed along each point of the cortical surface, resulting in a color-coded r value at each cortical point. Correlation analyses revealed that gray matter thickness in left ventromedial PFC was inversely correlated with task-related activation in the amygdala. These data add support to a general role of the ventromedial PFC in regulating activity of the amygdala.

The science on front-of-package food labels.

PubMed

Hawley, Kristy L; Roberto, Christina A; Bragg, Marie A; Liu, Peggy J; Schwartz, Marlene B; Brownell, Kelly D

2013-03-01

The U.S. Food and Drug Administration and Institute of Medicine are currently investigating front-of-package (FOP) food labelling systems to provide science-based guidance to the food industry. The present paper reviews the literature on FOP labelling and supermarket shelf-labelling systems published or under review by February 2011 to inform current investigations and identify areas of future research. A structured search was undertaken of research studies on consumer use, understanding of, preference for, perception of and behaviours relating to FOP/shelf labelling published between January 2004 and February 2011. Twenty-eight studies from a structured search met inclusion criteria. Reviewed studies examined consumer preferences, understanding and use of different labelling systems as well as label impact on purchasing patterns and industry product reformulation. The findings indicate that the Multiple Traffic Light system has most consistently helped consumers identify healthier products; however, additional research on different labelling systems' abilities to influence consumer behaviour is needed.

Crystalline and amorphous cellulose in the secondary walls of Arabidopsis.

PubMed

Ruel, Katia; Nishiyama, Yoshiharu; Joseleau, Jean-Paul

2012-09-01

In the cell walls of higher plants, cellulose chains are present in crystalline microfibril, with an amorphous part at the surface, or present as amorphous material. To assess the distribution and relative occurrence of the two forms of cellulose in the inflorescence stem of Arabidopsis, we used two carbohydrate-binding modules, CBM3a and CBM28, specific for crystalline and amorphous cellulose, respectively, with immunogold detection in TEM. The binding of the two CBMs displayed specific patterns suggesting that the synthesis of cellulose leads to variable nanodomains of cellulose structures according to cell type. In developing cell walls, only CBM3a bound significantly to the incipient primary walls, indicating that at the onset of its deposition cellulose is in a crystalline structure. As the secondary wall develops, the labeling with both CBMs becomes more intense. The variation of the labeling pattern by CBM3a between transverse and longitudinal sections appeared related to microfibril orientation and differed between fibers and vessels. Although the two CBMs do not allow the description of the complete status of cellulose microstructures, they revealed the dynamics of the deposition of crystalline and amorphous forms of cellulose during wall formation and between cell types adapting cellulose microstructures to the cell function. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

A broad spectrum of actin paralogs in Paramecium tetraurelia cells display differential localization and function.

PubMed

Sehring, Ivonne M; Reiner, Christoph; Mansfeld, Jörg; Plattner, Helmut; Kissmehl, Roland

2007-01-01

To localize the different actin paralogs found in Paramecium and to disclose functional implications, we used overexpression of GFP-fusion proteins and antibody labeling, as well as gene silencing. Several isoforms are associated with food vacuoles of different stages. GFP-actin either forms a tail at the lee side of the organelle, or it is vesicle bound in a homogenous or in a speckled arrangement, thus reflecting an actin-based mosaic of the phagosome surface appropriate for association and/or dissociation of other vesicles upon travel through the cell. Several paralogs occur in cilia. A set of actins is found in the cell cortex where actin outlines the regular surface pattern. Labeling of defined structures of the oral cavity is due to other types of actin, whereas yet more types are distributed in a pattern suggesting association with the numerous Golgi fields. A substantial fraction of actins is associated with cytoskeletal elements that are known to be composed of other proteins. Silencing of the respective actin genes or gene subfamilies entails inhibitory effects on organelles compatible with localization studies. Knock down of the actin found in the cleavage furrow abolishes cell division, whereas silencing of other actin genes alters vitality, cell shape and swimming behavior.

Ultrastructural and cytochemical evidence for single impulse initiation zones in vestibular macular nerve fibers of rat

NASA Technical Reports Server (NTRS)

Ross, Muriel D.; Chee, Oliver; Black, Samuel; Cutler, Lynn

1991-01-01

Cupric ion-ferricyanide labeling methods and related ferrocyanide-stained tissues were used to locate the characterize, at the ultrastructural level, presumptive impulse initiation zones in the three types of vestibular macular nerve fibers. Large-diameter, M-type vestibular nerve fibers terminate in a calyx at the heminode, and labeling is coextensive with the base of the calyx. Intermediate, M/U-type nerve fibers have short, unmyelinated preterminal segments that sometimes bifurcate intamacularly, and small-diameter, U-type nerve fibers have long, unmyelinated preterminal axons and up to three branches. Preterminals of these nerve fibers display ultrastructural heterogeneity that is correlated with labeling patterns for sodium channels and/or associated polyanionic sites. They have a nodelike ultrastructure and label heavily from near the heminode to the base of the macula. Their intramacular branches, less organized ultrastructurally, label only slightly. Results indicate that vestibular nerve fibers have one impulse initiation zone, located near the heminode, that varies in length according to nerve fiber type. Structural heterogeneity may favor impulse conduction in the central direction, and length of the impulse initiation zone could influence nerve discharge patterns.

Long-term direct visualization of passively transferred fluorophore-conjugated antibodies.

PubMed

Schneider, Jeffrey R; Carias, Ann M; Bastian, Arangaserry R; Cianci, Gianguido C; Kiser, Patrick F; Veazey, Ronald S; Hope, Thomas J

2017-11-01

The use of therapeutic antibodies, delivered by intravenous (IV) instillation, is a rapidly expanding area of biomedical treatment for a variety of conditions. However, little is known about how the antibodies are anatomically distributed following infusion and the underlying mechanism mediating therapeutic antibody distribution to specific anatomical sites remains to be elucidated. Current efforts utilize low resolution and sensitivity methods such as ELISA and indirect labeling imaging techniques, which often leads to high background and difficulty in assessing biodistribution. Here, using the in vivo non-human primate model, we demonstrate that it is possible to utilize the fluorophores Cy5 and Cy3 directly conjugated to antibodies for direct visualization and quantification of passively transferred antibodies in plasma, tissue, and in mucosal secretions. Antibodies were formulated with 1-2 fluorophores per antibody to minimally influence antibody function. Fluorophore conjugated Gamunex-C (pooled human IgG) were tested for binding to protein A, via surface plasmon resonance, and showed similar levels of binding when compared to unlabeled Gamunex-C. In order to assess the effect fluorophore labeling has on turnover and localization, rhesus macaques were IV infused with either labeled or unlabeled Gamunex-C. Plasma, vaginal Weck-Cel fluid, cervicovaginal mucus, and vaginal/rectal tissue biopsies were collected up to 8weeks. Similar turnover and biodistribution was observed between labeled and unlabeled antibodies, showing that the labeling process did not have an obvious deleterious effect on localization or turnover. Cy5 and Cy3 labeled antibodies were readily detected in the same pattern regardless of fluorophore. Tissue distribution was measured in macaque vaginal and rectal biopsies. The labeled antibody in macaque biopsies was found to have similar biodistribution pattern to endogenous antibodies in macaque and human tissues. In the vaginal and rectal mucosa, endogenous and infused antibodies were found primarily within the lamina propria. In the mucosal squamous epithelium of the vaginal vault, significant antibody was also observed in a striated pattern in the superficial, nonviable, stratum corneum. Endogenous antibody distribution in both human and macaque squamous tissues exhibited a similar pattern as seen with the labeled and unlabeled antibodies. This proof-of-principle study reveals that the labeled antibody is stable and physiologically similar relative to endogenous antibody setting the stage for future work to better understand the mechanisms of how antibodies reach unique anatomical sites. Direct visualization of fluorophore-conjugated antibodies following passive infusion can be utilized to assess the kinetics of biodistribution of infused antibodies and may be a useful approach to monitor and predict efficacy of therapeutic antibodies. Copyright © 2017 Elsevier B.V. All rights reserved.

Jacalin and peanut agglutinin (PNA) bindings in the taste bud cells of the rat: new reliable markers for type IV cells of the rat taste buds.

PubMed

Taniguchi, Ryo; Shi, Lei; Fujii, Masae; Ueda, Katsura; Honma, Shiho; Wakisaka, Satoshi

2005-12-01

Lectin histochemistry of Jacalin (Artocarpus integrifolia) and peanut agglutinin (PNA), specific lectins for galactosyl (beta-1, 3) N-acetylgalactosamine (galactosyl (beta-1, 3) GalNAc), was applied to the gustatory epithelium of the adult rat. In the ordinary lingual epithelium, Jacalin and PNA labeled the cell membrane from the basal to granular cell layer. They also bound membranes of rounded-cells at the basal portion of taste buds, but the number of PNA labeled cells was smaller than that of Jacalin labeled cells. There was no apparent difference in the binding patterns of Jacalin and PNA among the taste buds of the lingual papillae and those of the palatal epithelium. Occasionally, a few spindle-shaped cells were labeled with Jacalin, but not with PNA. Double labeling of Jacalin and alpha-gustducin, a specific marker for type II cells, revealed that Jacalin-labeled spindle-shaped taste cells were immunonegative for alpha-gustducin. Spindle-shaped cells expressing protein gene product 9.5 (PGP 9.5) immunoreactivity lacked Jacalin labeling. During the development of taste buds in circumvallate papillae, the binding pattern of Jacalin became almost identical from postnatal day 5. The present results indicate that rounded cells at the basal portion of the taste buds cells (type IV cells) bind to Jacalin and PNA, and these lectins are specific markers for type IV cells of the rat taste cells.

A Semisupervised Support Vector Machines Algorithm for BCI Systems

PubMed Central

Qin, Jianzhao; Li, Yuanqing; Sun, Wei

2007-01-01

As an emerging technology, brain-computer interfaces (BCIs) bring us new communication interfaces which translate brain activities into control signals for devices like computers, robots, and so forth. In this study, we propose a semisupervised support vector machine (SVM) algorithm for brain-computer interface (BCI) systems, aiming at reducing the time-consuming training process. In this algorithm, we apply a semisupervised SVM for translating the features extracted from the electrical recordings of brain into control signals. This SVM classifier is built from a small labeled data set and a large unlabeled data set. Meanwhile, to reduce the time for training semisupervised SVM, we propose a batch-mode incremental learning method, which can also be easily applied to the online BCI systems. Additionally, it is suggested in many studies that common spatial pattern (CSP) is very effective in discriminating two different brain states. However, CSP needs a sufficient labeled data set. In order to overcome the drawback of CSP, we suggest a two-stage feature extraction method for the semisupervised learning algorithm. We apply our algorithm to two BCI experimental data sets. The offline data analysis results demonstrate the effectiveness of our algorithm. PMID:18368141

Synthesis and Characterization of a deuterium labeled Stercobilin: A Potential Biomarker for Autism.

PubMed

Coffey, J M; Vadas, A; Puleo, Y; Lewis, K; Pirone, G; Rudolph, H L; Helms, E; Wood, T D; Flynn-Charlebois, A

2018-05-14

Stercobilin is an end-stage metabolite of hemoglobin, a component of red blood cells. It has been found that there is a significantly lower concentration of stercobilin in the urine of people diagnosed with Autism Spectrum Disorders (ASD), suggesting potential utility as a biomarker. In vitro, we have synthesized stercobilin from its precursor bilirubin through a reduction reaction proceeded by an oxidation reaction. In addition, we have isotopically labeled the stercobilin product with deuterium using this protocol. Nuclear Magnetic Resonance (NMR) investigations show the products of the unlabeled stercobilin (Rxn 1) and the deuterated stercobilin (Rxn 2) both had a loss of signals in the 5.0-7.0 ppm range indicating proper conversion to stercobilin. Changes in the multiplicity of the sp3 region of the proton NMR suggest proper deuterium incorporation. Mass Spectrometry (MS) studies of Rxn 1 show a difference in fragmentation patterns than that of Rxn 2 proposing potential locations for deuterium incorporation. This isotopologue of stercobilin is stable (> 6 months), and further analysis permits investigation for its use as a biomarker and potential quantitative diagnostic probe for ASD. This article is protected by copyright. All rights reserved.

Child Nutrition Labeling for Meat and Poultry Products.

ERIC Educational Resources Information Center

Wade, Cheryl; And Others

Prepared for food manufacturers, this publication contains instructions for calculating the contribution that a meat or poultry product makes toward the meal pattern requirements of child nutrition programs. It also contains instructions on how to apply for and obtain the approval for a label containing a child nutrition statement. These…

Factors Affecting Treatment Acceptability for Psychostimulant Medication versus Psychoeducational Intervention.

ERIC Educational Resources Information Center

Stinnett, Terry A.; Crawford, Stephanie A.; Gillespie, Marci D.; Cruce, Michael K.; Langford, Courtney A.

2001-01-01

Examines future teachers' judgments of acceptability for two common treatments for children with the Attention Deficit Hyperactivity Disorder (ADHD) label. In this study, the ADHD label evoked greater expectations of attentional difficulties even when the pattern of functioning was similar to nonlabeled children. On the other hand, children with…

Consumer perceptions of front-of-package labelling systems and healthiness of foods.

PubMed

Savoie, Nathalie; Barlow Gale, Karine; Harvey, Karen L; Binnie, Mary Ann; Pasut, Laura

2013-09-19

The purpose of this study was to assess the impact of four different front-of-package (FOP) labelling systems on consumer perception and purchasing intent of food, and whether these systems help consumers select a balanced pattern of eating. The four FOP labelling systems studied included two nutrient-specific systems ‒ the Traffic Light (TL) and the Guideline Daily Amount (GDA) ‒ and two summary indicator systems ‒ NuVal(®) and My-5(®). Phase 1 was a small study with 36 participants to determine consumer understanding of the four FOP labelling systems and to inform the development of the questions for Phase 2, which consisted of a survey of 2,200 adults obtained through an online panel. Although the TL and GDA were rated similar to the Nutrition Facts table in terms of attributes, these FOP systems were considered more visually appealing. Consumers indicated that the numeric summary indicator systems did not provide sufficient information. Approximately half of the respondents indicated that the FOP systems would help them make healthier choices. However, due to the limitations of each, consumers often misinterpreted a food's healthiness compared to their baseline perceptions. Similarly, consumers' intent to purchase based on the FOP system did not show a consistent pattern. Although well received by consumers, FOP labelling systems can lead to confusion depending on perceived understanding of the system used. The nutrient-specific systems tend to be preferred by most consumers; however, the overall impact on selecting healthier eating patterns has yet to be demonstrated.

Metabolic Patterns in Spirodela polyrhiza Revealed by 15N Stable Isotope Labeling of Amino Acids in Photoautotrophic, Heterotrophic, and Mixotrophic Growth Conditions

PubMed Central

Evans, Erin M.; Freund, Dana M.; Sondervan, Veronica M.; Cohen, Jerry D.; Hegeman, Adrian D.

2018-01-01

In this study we describe a [15N] stable isotopic labeling study of amino acids in Spirodela polyrhiza (common duckweed) grown under three different light and carbon input conditions which represent unique potential metabolic modes. Plants were grown with a light cycle, either with supplemental sucrose (mixotrophic) or without supplemental sucrose (photoautotrophic) and in the dark with supplemental sucrose (heterotrophic). Labeling patterns, pool sizes (both metabolically active and inactive), and kinetics/turnover rates were estimated for 17 of the proteinogenic amino acids. Estimation of these parameters followed several overall trends. First, most amino acids showed plateaus in labeling patterns of <100% [15N]-labeling, indicating the possibility of a large proportion of amino acids residing in metabolically inactive metabolite pools. Second, total pool sizes appear largest in the dark (heterotrophic) condition, whereas active pool sizes appeared to be largest in the light with sucrose (mixotrophic) growth condition. In contrast turnover measurements based on pool size were highest overall in the light with sucrose experiment, with the exception of leucine/isoleucine, lysine, and arginine, which all showed higher turnover in the dark. K-means clustering analysis also revealed more rapid turnover in the light treatments with many amino acids clustering in lower-turnover groups. Emerging insights from other research were also supported, such as the prevalence of alternate pathways for serine metabolism in non-photosynthetic cells. These data provide extensive novel information on amino acid pool size and kinetics in S. polyrhiza and can serve as groundwork for future metabolic studies. PMID:29904627

Metabolic Patterns in Spirodela polyrhiza Revealed by 15N Stable Isotope Labeling of Amino Acids in Photoautotrophic, Heterotrophic, and Mixotrophic Growth Conditions.

PubMed

Evans, Erin M; Freund, Dana M; Sondervan, Veronica M; Cohen, Jerry D; Hegeman, Adrian D

2018-01-01

In this study we describe a [ 15 N] stable isotopic labeling study of amino acids in Spirodela polyrhiza (common duckweed) grown under three different light and carbon input conditions which represent unique potential metabolic modes. Plants were grown with a light cycle, either with supplemental sucrose (mixotrophic) or without supplemental sucrose (photoautotrophic) and in the dark with supplemental sucrose (heterotrophic). Labeling patterns, pool sizes (both metabolically active and inactive), and kinetics/turnover rates were estimated for 17 of the proteinogenic amino acids. Estimation of these parameters followed several overall trends. First, most amino acids showed plateaus in labeling patterns of <100% [ 15 N]-labeling, indicating the possibility of a large proportion of amino acids residing in metabolically inactive metabolite pools. Second, total pool sizes appear largest in the dark (heterotrophic) condition, whereas active pool sizes appeared to be largest in the light with sucrose (mixotrophic) growth condition. In contrast turnover measurements based on pool size were highest overall in the light with sucrose experiment, with the exception of leucine/isoleucine, lysine, and arginine, which all showed higher turnover in the dark. K-means clustering analysis also revealed more rapid turnover in the light treatments with many amino acids clustering in lower-turnover groups. Emerging insights from other research were also supported, such as the prevalence of alternate pathways for serine metabolism in non-photosynthetic cells. These data provide extensive novel information on amino acid pool size and kinetics in S. polyrhiza and can serve as groundwork for future metabolic studies.

Metabolic patterns in Spirodela polyrhiza revealed by 15N stable isotope labeling of amino acids in photoautotrophic, heterotrophic, and mixotrophic growth conditions

NASA Astrophysics Data System (ADS)

Evans, Erin M.; Freund, Dana M.; Sondervan, Veronica M.; Cohen, Jerry D.; Hegeman, Adrian D.

2018-05-01

In this study we describe a [15N] stable isotopic labeling study of amino acids in Spirodela polyrhiza (common duckweed) grown under three different light and carbon input conditions which represent unique potential metabolic modes. Plants were grown with a light cycle, either with supplemental sucrose (mixotrophic) or without supplemental sucrose (photoautotrophic) and in the dark with supplemental sucrose (heterotrophic). Labeling patterns, pool sizes (both metabolically active and inactive), and kinetics/turnover rates were estimated for fifteen of the proteinogenic amino acids. Estimation of these parameters followed several overall trends. First, most amino acids showed plateaus in labeling patterns of less than 100% [15N]-labeling, indicating the possibility of a large proportion of amino acids residing in metabolically inactive metabolite pools. Second, total pool sizes appear largest in the dark (heterotrophic) condition, whereas active pool sizes appeared to be largest in the light with sucrose (mixotrophic) growth condition. In contrast turnover measurements based on pool size were highest overall in the light with sucrose experiment, with the exception of leucine/isoleucine, lysine, and arginine, which all showed higher turnover in the dark. K-means clustering analysis also revealed more rapid turnover in the light treatments with many amino acids clustering in lower-turnover groups. Emerging insights from other research were also supported, such as the prevalence of alternate pathways for serine metabolism in non-photosynthetic cells. These data provide extensive novel information on amino acid pool size and kinetics in S. polyrhiza and can serve as groundwork for future metabolic studies.

Perception of front-of-pack labels according to social characteristics, nutritional knowledge and food purchasing habits.

PubMed

Méjean, Caroline; Macouillard, Pauline; Péneau, Sandrine; Hercberg, Serge; Castetbon, Katia

2013-03-01

To identify patterns of perception of front-of-pack (FOP) nutrition labels and to determine social factors, nutritional knowledge and attention to packaging features related to such patterns. Cross-sectional. Perception was measured using indicators of understanding and acceptability of three simple FOP labels (the 'Green Tick', the logo of the French Nutrition and Health Programme (PNNS logo) and 'simple traffic lights' (STL)) and two detailed formats ('multiple traffic lights' (MTL) and the 'colour range' logo (CR)). Associations of perception patterns with individual characteristics were examined using χ2 tests. Data from the French NutriNet-Santé cohort study. A total of 38,763 adults. Four perception patterns emerged. Poorly educated individuals were most often found in groups favouring simple formats. The 'favourable to CR' group had a high rate of men and older persons. Poor nutritional knowledge was more frequent in the 'favourable to STL' group, while individuals with substantial knowledge were proportionally more numerous in the 'favourable to MTL' group. The 'favourable to STL' group more frequently self-reported noting price and marketing characteristics during purchasing, while the 'favourable to MTL' and 'favourable to CR' groups declared more interest in nutritional information. The 'favourable to Green Tick and PNNS logo' group self-reported paying closer attention to claims and quality guarantee labels. The 'favourable to MTL' cluster was most frequently represented in our survey. However, simple FOP formats may be most appropriate for increasing awareness of healthy eating among targeted groups with poor nutritional knowledge and little interest in the nutritional quality of packaged foods.

Evaluation of stereo-array isotope labeling (SAIL) patterns for automated structural analysis of proteins with CYANA.

PubMed

Ikeya, Teppei; Terauchi, Tsutomu; Güntert, Peter; Kainosho, Masatsune

2006-07-01

Recently we have developed the stereo-array isotope labeling (SAIL) technique to overcome the conventional molecular size limitation in NMR protein structure determination by employing complete stereo- and regiospecific patterns of stable isotopes. SAIL sharpens signals and simplifies spectra without the loss of requisite structural information, thus making large classes of proteins newly accessible to detailed solution structure determination. The automated structure calculation program CYANA can efficiently analyze SAIL-NOESY spectra and calculate structures without manual analysis. Nevertheless, the original SAIL method might not be capable of determining the structures of proteins larger than 50 kDa or membrane proteins, for which the spectra are characterized by many broadened and overlapped peaks. Here we have carried out simulations of new SAIL patterns optimized for minimal relaxation and overlap, to evaluate the combined use of SAIL and CYANA for solving the structures of larger proteins and membrane proteins. The modified approach reduces the number of peaks to nearly half of that observed with uniform labeling, while still yielding well-defined structures and is expected to enable NMR structure determinations of these challenging systems.

Expression of Prox1 defines regions of the avian otocyst that give rise to sensory or neural cells

NASA Technical Reports Server (NTRS)

Stone, Jennifer S.; Shang, Jia-Lin; Tomarev, Stanislav

2003-01-01

The simple primordium of the inner ear (otocyst) differentiates into many cell types, including sensory neurons and hair cells. We examined expression of the divergent homeobox transcription factor, cProx1, during otocyst development in chickens. Nuclear cProx1 protein is not evident in the otic placode but emerges in the otic cup by stage 12. At stage 16, cProx1-positive nuclei are scattered continuously throughout the neuroepithelium, from anteroventral to posteromedial. These labeled cells are neural precursors; they express betaIII-tubulin and migrate to the cochleovestibular ganglion between stages 13 and 21. By stage 18, two areas develop a dense pattern of cProx1 expression in which every nucleus is labeled. These areas emerge at the anterior and posterior extremes of the band of scattered cProx1 expression and express the sensory markers cSerrate1 and Cath1 by stage 23. Four discrete patches of dense cProx1 expression appear by stage 23 that correspond to the future superior crista, lateral crista, saccular macula, and posterior crista, as confirmed by immunolabeling for hair cell antigen (HCA) by stage 29. The remaining sensory epithelia display a dense pattern of cProx1 expression and label for HCA by stage 29. In the basilar papilla, nuclear cProx1 expression is down-regulated in most hair cells by stage 37 and in many supporting cells by stage 40. Our findings show that regions of the otocyst that give rise to neurons or hair cells are distinguished by their relative density of cProx1-positive nuclei, and suggest a role for cProx1 in the genesis of these cell types.

Patterns of auxin and abscisic acid movement in the tips of gravistimulated primary roots of maize

NASA Technical Reports Server (NTRS)

Young, L. M.; Evans, M. L.

1996-01-01

Because both abscisic acid (ABA) and auxin (IAA) have been suggested as possible chemical mediators of differential growth during root gravitropism, we compared with redistribution of label from applied 3H-IAA and 3H-ABA during maize root gravitropism and examined the relative basipetal movement of 3H-IAA and 3H-ABA applied to the caps of vertical roots. Lateral movement of 3H-ABA across the tips of vertical roots was non-polar and about 2-fold greater than lateral movement of 3H-IAA (also non-polar). The greater movement of ABA was not due to enhanced uptake since the uptake of 3H-IAA was greater than that of 3H-ABA. Basipetal movement of label from 3H-IAA or 3H-ABA applied to the root cap was determined by measuring radioactivity in successive 1 mm sections behind the tip 90 minutes after application. ABA remained largely in the first mm (point of application) whereas IAA was concentrated in the region 2-4 mm from the tip with substantial levels found 7-8 mm from the tip. Pretreatment with inhibitors of polar auxin transport decreased both gravicurvature and the basipetal movement of IAA. When roots were placed horizontally, the movement of 3H-IAA from top to bottom across the cap was enhanced relative to movement from bottom to top whereas the pattern of movement of label from 3H-ABA was unaffected. These results are consistent with the hypothesis that IAA plays a role in root gravitropism but contrary to the idea that gravi-induced asymmetric distribution of ABA contributes to the response.

Patterns of health-related behaviours among adolescents: a cross-sectional study based on the National Survey of School Health Brazil 2012.

PubMed

Azeredo, Catarina Machado; Levy, Renata Bertazzi; Peres, Maria Fernanda Tourinho; Menezes, Paulo Rossi; Araya, Ricardo

2016-11-10

The aim of this study was to analyse the clustering of multiple health-related behaviours among adolescents and describe which socio-demographic characteristics are associated with these patterns. Cross-sectional study. Brazilian schools assessed by the National Survey of School Health (PeNSE, 2012). 104 109 Brazilian ninth-grade students from public and private schools (response rate=82.7%). Exploratory and confirmatory factor analyses were performed to identify behaviour clustering and linear regression models were used to identify socio-demographic characteristics associated with each one of these behaviour patterns. We identified a good fit model with three behaviour patterns. The first was labelled 'problem-behaviour' and included aggressive behaviour, alcohol consumption, smoking, drug use and unsafe sex; the second was labelled 'health-compromising diet and sedentary behaviours' and included unhealthy food indicators and sedentary behaviour; and the third was labelled 'health-promoting diet and physical activity' and included healthy food indicators and physical activity. No differences in behaviour patterns were found between genders. The problem-behaviour pattern was associated with male gender, older age, more developed region (socially and economically) and public schools (compared with private). The 'health-compromising diet and sedentary behaviours' pattern was associated with female gender, older age, mothers with higher education level and more developed region. The 'health-promoting diet and physical activity' pattern was associated with male gender and mothers with higher education level. Three health-related behaviour patterns were found among Brazilian adolescents. Interventions to decrease those negative patterns should take into account how these behaviours cluster together and the individuals most at risk. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Regional expression patterns of taste receptors and gustducin in the mouse tongue.

PubMed

Kim, Mi-Ryung; Kusakabe, Yuko; Miura, Hirohito; Shindo, Yoichiro; Ninomiya, Yuzo; Hino, Akihiro

2003-12-12

In order to understand differences in taste sensitivities of taste bud cells between the anterior and posterior part of tongue, it is important to analyze the regional expression patterns of genes related to taste signal transduction on the tongue. Here we examined the expression pattern of a taste receptor family, the T1r family, and gustducin in circumvallate and fungiform papillae of the mouse tongue using double-labeled in situ hybridization. Each member of the T1r family was expressed in both circumvallate and fungiform papillae with some differences in their expression patterns. The most striking difference between fungiform and circumvallate papillae was observed in their co-expression patterns of T1r2, T1r3, and gustducin. T1r2-positive cells in fungiform papillae co-expressed T1r3 and gustducin, whereas T1r2 and T1r3 double-positive cells in circumvallate papillae merely expressed gustducin. These results suggested that in fungiform papillae, gustducin might play a role in the sweet taste signal transduction cascade mediated by a sweet receptor based on the T1r2 and T1r3 combination, in fungiform papillae.

Value, Cost, and Sharing: Open Issues in Constrained Clustering

NASA Technical Reports Server (NTRS)

Wagstaff, Kiri L.

2006-01-01

Clustering is an important tool for data mining, since it can identify major patterns or trends without any supervision (labeled data). Over the past five years, semi-supervised (constrained) clustering methods have become very popular. These methods began with incorporating pairwise constraints and have developed into more general methods that can learn appropriate distance metrics. However, several important open questions have arisen about which constraints are most useful, how they can be actively acquired, and when and how they should be propagated to neighboring points. This position paper describes these open questions and suggests future directions for constrained clustering research.

Morphological properties of vestibulospinal neurons in primates

NASA Technical Reports Server (NTRS)

Boyle, Richard; Johanson, Curt

2003-01-01

The lateral and medial vestibulospinal tracts constitute the major descending pathways controlling extensor musculature of the body. We examined the axon morphology and synaptic input patterns and targets in the cervical spinal segments from these tract cells using intracellular recording and biocytin labeling in the squirrel monkey. Lumbosacral projecting cells represent a private, and mostly rapid, communication pathway between the dorsal Deiters' nucleus and the motor circuits controlling the lower limbs and tail. The cervical projecting cells provide both redundant and variable synaptic input to spinal cell groups, suggesting both general and specific control of the head and neck reflexes.

Assessing Attentional Prioritization of Front-of-Pack Nutrition Labels using Change Detection

PubMed Central

Becker, Mark W.; Sundar, Raghav Prashant; Bello, Nora; Alzahabi, Reem; Weatherspoon, Lorraine; Bix, Laura

2015-01-01

We used a change detection method to evaluate attentional prioritization of nutrition information that appears in the traditional “Nutrition Facts Panel” and in front-of-pack nutrition labels. Results provide compelling evidence that front-of-pack labels attract attention more readily than the Nutrition Facts Panel, even when participants are not specifically tasked with searching for nutrition information. Further, color-coding the relative nutritional value of key nutrients within the front-of-pack label resulted in increased attentional prioritization of nutrition information, but coding using facial icons did not significantly increase attention to the label. Finally, the general pattern of attentional prioritization across front-of-pack designs was consistent across a diverse sample of participants. Our results indicate that color-coded, front-of-pack nutrition labels increase attention to the nutrition information of packaged food, a finding that has implications for current policy discussions regarding labeling change. PMID:26851468

PatternLab for proteomics 4.0: A one-stop shop for analyzing shotgun proteomic data

PubMed Central

Carvalho, Paulo C; Lima, Diogo B; Leprevost, Felipe V; Santos, Marlon D M; Fischer, Juliana S G; Aquino, Priscila F; Moresco, James J; Yates, John R; Barbosa, Valmir C

2017-01-01

PatternLab for proteomics is an integrated computational environment that unifies several previously published modules for analyzing shotgun proteomic data. PatternLab contains modules for formatting sequence databases, performing peptide spectrum matching, statistically filtering and organizing shotgun proteomic data, extracting quantitative information from label-free and chemically labeled data, performing statistics for differential proteomics, displaying results in a variety of graphical formats, performing similarity-driven studies with de novo sequencing data, analyzing time-course experiments, and helping with the understanding of the biological significance of data in the light of the Gene Ontology. Here we describe PatternLab for proteomics 4.0, which closely knits together all of these modules in a self-contained environment, covering the principal aspects of proteomic data analysis as a freely available and easily installable software package. All updates to PatternLab, as well as all new features added to it, have been tested over the years on millions of mass spectra. PMID:26658470

Distant Supervision with Transductive Learning for Adverse Drug Reaction Identification from Electronic Medical Records

PubMed Central

Ikeda, Mitsuru

2017-01-01

Information extraction and knowledge discovery regarding adverse drug reaction (ADR) from large-scale clinical texts are very useful and needy processes. Two major difficulties of this task are the lack of domain experts for labeling examples and intractable processing of unstructured clinical texts. Even though most previous works have been conducted on these issues by applying semisupervised learning for the former and a word-based approach for the latter, they face with complexity in an acquisition of initial labeled data and ignorance of structured sequence of natural language. In this study, we propose automatic data labeling by distant supervision where knowledge bases are exploited to assign an entity-level relation label for each drug-event pair in texts, and then, we use patterns for characterizing ADR relation. The multiple-instance learning with expectation-maximization method is employed to estimate model parameters. The method applies transductive learning to iteratively reassign a probability of unknown drug-event pair at the training time. By investigating experiments with 50,998 discharge summaries, we evaluate our method by varying large number of parameters, that is, pattern types, pattern-weighting models, and initial and iterative weightings of relations for unlabeled data. Based on evaluations, our proposed method outperforms the word-based feature for NB-EM (iEM), MILR, and TSVM with F1 score of 11.3%, 9.3%, and 6.5% improvement, respectively. PMID:29090077

Obesity prevention and personal responsibility: the case of front-of-pack food labelling in Australia.

PubMed

Magnusson, Roger S

2010-11-02

In Australia, the food industry and public health groups are locked in serious struggle for regulatory influence over the terms of front-of-pack food labelling. Clear, unambiguous labelling of the nutritional content of pre-packaged foods and of standardized food items sold in chain restaurants is consistent with the prevailing philosophy of 'personal responsibility'. An interpretive, front-of-pack labelling scheme has the capacity to encourage healthier patterns of eating, and to be a catalyst for improvements in the nutritional quality of food products through re-formulation. On the other hand, the strength of opposition of the Australian Food and Grocery Council to 'Traffic Light Labelling', and its efforts to promote a non-interpretive, voluntary scheme, invite the interpretation that the food industry is resistant to any reforms that could destabilise current (unhealthy) purchasing patterns and the revenues they represent. This article argues that although policies that aim to educate consumers about the nutritional content of food are welcome, they are only one part of a broader basket of policies that are needed to make progress on obesity prevention and public health nutrition. However, to the extent that food labelling has the capacity to inform and empower consumers to make healthier choices--and to be a catalyst for improving the nutritional quality of commercial recipes--it has an important role to play. Furthermore, given the dietary impact of meals eaten in fast food and franchise restaurants, interpretive labelling requirements should not be restricted to pre-packaged foods. Food industry resistance to an interpretive food labelling scheme is an important test for government, and a case study of how self-interest prompts industry to promote weaker, voluntary schemes that pre-empt and undermine progressive public health regulation.

Obesity prevention and personal responsibility: the case of front-of-pack food labelling in Australia

PubMed Central

2010-01-01

Background In Australia, the food industry and public health groups are locked in serious struggle for regulatory influence over the terms of front-of-pack food labelling. Clear, unambiguous labelling of the nutritional content of pre-packaged foods and of standardized food items sold in chain restaurants is consistent with the prevailing philosophy of 'personal responsibility'. An interpretive, front-of-pack labelling scheme has the capacity to encourage healthier patterns of eating, and to be a catalyst for improvements in the nutritional quality of food products through re-formulation. On the other hand, the strength of opposition of the Australian Food and Grocery Council to 'Traffic Light Labelling', and its efforts to promote a non-interpretive, voluntary scheme, invite the interpretation that the food industry is resistant to any reforms that could destabilise current (unhealthy) purchasing patterns and the revenues they represent. Discussion This article argues that although policies that aim to educate consumers about the nutritional content of food are welcome, they are only one part of a broader basket of policies that are needed to make progress on obesity prevention and public health nutrition. However, to the extent that food labelling has the capacity to inform and empower consumers to make healthier choices - and to be a catalyst for improving the nutritional quality of commercial recipes - it has an important role to play. Furthermore, given the dietary impact of meals eaten in fast food and franchise restaurants, interpretive labelling requirements should not be restricted to pre-packaged foods. Summary Food industry resistance to an interpretive food labelling scheme is an important test for government, and a case study of how self-interest prompts industry to promote weaker, voluntary schemes that pre-empt and undermine progressive public health regulation. PMID:21044302

Cortical and subcortical connections of V1 and V2 in early postnatal macaque monkeys.

PubMed

Baldwin, Mary K L; Kaskan, Peter M; Zhang, Bin; Chino, Yuzo M; Kaas, Jon H

2012-02-15

Connections of primary (V1) and secondary (V2) visual areas were revealed in macaque monkeys ranging in age from 2 to 16 weeks by injecting small amounts of cholera toxin subunit B (CTB). Cortex was flattened and cut parallel to the surface to reveal injection sites, patterns of labeled cells, and patterns of cytochrome oxidase (CO) staining. Projections from the lateral geniculate nucleus and pulvinar to V1 were present at 4 weeks of age, as were pulvinar projections to thin and thick CO stripes in V2. Injections into V1 in 4- and 8-week-old monkeys labeled neurons in V2, V3, middle temporal area (MT), and dorsolateral area (DL)/V4. Within V1 and V2, labeled neurons were densely distributed around the injection sites, but formed patches at distances away from injection sites. Injections into V2 labeled neurons in V1, V3, DL/V4, and MT of monkeys 2-, 4-, and 8-weeks of age. Injections in thin stripes of V2 preferentially labeled neurons in other V2 thin stripes and neurons in the CO blob regions of V1. A likely thick stripe injection in V2 at 4 weeks of age labeled neurons around blobs. Most labeled neurons in V1 were in superficial cortical layers after V2 injections, and in deep layers of other areas. Although these features of adult V1 and V2 connectivity were in place as early as 2 postnatal weeks, labeled cells in V1 and V2 became more restricted to preferred CO compartments after 2 weeks of age. Copyright © 2011 Wiley-Liss, Inc.

Tubulin-related cerebellar dysplasia: definition of a distinct pattern of cerebellar malformation.

PubMed

Romaniello, Romina; Arrigoni, Filippo; Panzeri, Elena; Poretti, Andrea; Micalizzi, Alessia; Citterio, Andrea; Bedeschi, Maria Francesca; Berardinelli, Angela; Cusmai, Raffaella; D'Arrigo, Stefano; Ferraris, Alessandro; Hackenberg, Annette; Kuechler, Alma; Mancardi, Margherita; Nuovo, Sara; Oehl-Jaschkowitz, Barbara; Rossi, Andrea; Signorini, Sabrina; Tüttelmann, Frank; Wahl, Dagmar; Hehr, Ute; Boltshauser, Eugen; Bassi, Maria Teresa; Valente, Enza Maria; Borgatti, Renato

2017-12-01

To determine the neuroimaging pattern of cerebellar dysplasia (CD) and other posterior fossa morphological anomalies associated with mutations in tubulin genes and to perform clinical and genetic correlations. Twenty-eight patients harbouring 23 heterozygous pathogenic variants (ten novel) in tubulin genes TUBA1A (n = 10), TUBB2B (n = 8) or TUBB3 (n = 5) were studied by a brain MRI scan performed either on a 1.5 T (n = 10) or 3 T (n = 18) MR scanner with focus on the posterior fossa. Cerebellar anomalies were detected in 24/28 patients (86%). CD was recognised in 19/28 (68%) including cortical cerebellar dysplasia (CCD) in 18/28, either involving only the cerebellar hemispheres (12/28) or associated with vermis dysplasia (6/28). CCD was located only in the right hemisphere in 13/18 (72%), including four TUBB2B-, four TUBB3- and five TUBA1A-mutated patients, while in the other five TUBA1A cases it was located only in the left hemisphere or in both hemispheres. The postero-superior region of the cerebellar hemispheres was most frequently affected. The cerebellar involvement in tubulinopathies shows specific features that may be labelled as 'tubulin-related CD'. This pattern is unique and differs from other genetic causes of cerebellar dysplasia. • Cortical cerebellar dysplasia without cysts is suggestive of tubulin-related disorder. • Cerebellar dysplasia in tubulinopathies shows specific features labelled as 'tubulin-related CD'. • Focal and unilateral involvement of cerebellar hemispheres has important implications for counselling.

Reinstatement of Individual Past Events Revealed by the Similarity of Distributed Activation Patterns during Encoding and Retrieval

PubMed Central

Wing, Erik A.; Ritchey, Maureen; Cabeza, Roberto

2015-01-01

Neurobiological memory models assume memory traces are stored in neocortex, with pointers in the hippocampus, and are then reactivated during retrieval, yielding the experience of remembering. Whereas most prior neuroimaging studies on reactivation have focused on the reactivation of sets or categories of items, the current study sought to identify cortical patterns pertaining to memory for individual scenes. During encoding, participants viewed pictures of scenes paired with matching labels (e.g., “barn,” “tunnel”), and, during retrieval, they recalled the scenes in response to the labels and rated the quality of their visual memories. Using representational similarity analyses, we interrogated the similarity between activation patterns during encoding and retrieval both at the item level (individual scenes) and the set level (all scenes). The study yielded four main findings. First, in occipitotemporal cortex, memory success increased with encoding-retrieval similarity (ERS) at the item level but not at the set level, indicating the reactivation of individual scenes. Second, in ventrolateral pFC, memory increased with ERS for both item and set levels, indicating the recapitulation of memory processes that benefit encoding and retrieval of all scenes. Third, in retrosplenial/posterior cingulate cortex, ERS was sensitive to individual scene information irrespective of memory success, suggesting automatic activation of scene contexts. Finally, consistent with neurobiological models, hippocampal activity during encoding predicted the subsequent reactivation of individual items. These findings show the promise of studying memory with greater specificity by isolating individual mnemonic representations and determining their relationship to factors like the detail with which past events are remembered. PMID:25313659

Molecular Interactions of the Min Protein System Reproduce Spatiotemporal Patterning in Growing and Dividing Escherichia coli Cells.

PubMed

Walsh, James C; Angstmann, Christopher N; Duggin, Iain G; Curmi, Paul M G

2015-01-01

Oscillations of the Min protein system are involved in the correct midcell placement of the divisome during Escherichia coli cell division. Based on molecular interactions of the Min system, we formulated a mathematical model that reproduces Min patterning during cell growth and division. Specifically, the increase in the residence time of MinD attached to the membrane as its own concentration increases, is accounted for by dimerisation of membrane-bound MinD and its interaction with MinE. Simulation of this system generates unparalleled correlation between the waveshape of experimental and theoretical MinD distributions, suggesting that the dominant interactions of the physical system have been successfully incorporated into the model. For cells where MinD is fully-labelled with GFP, the model reproduces the stationary localization of MinD-GFP for short cells, followed by oscillations from pole to pole in larger cells, and the transition to the symmetric distribution during cell filamentation. Cells containing a secondary, GFP-labelled MinD display a contrasting pattern. The model is able to account for these differences, including temporary midcell localization just prior to division, by increasing the rate constant controlling MinD ATPase and heterotetramer dissociation. For both experimental conditions, the model can explain how cell division results in an equal distribution of MinD and MinE in the two daughter cells, and accounts for the temperature dependence of the period of Min oscillations. Thus, we show that while other interactions may be present, they are not needed to reproduce the main characteristics of the Min system in vivo.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Woo Taek; Franceschi, V.R.; Okita, T.W.

The subcellular localization of ADPglucose pyrophosphorylase, a key regulatory enzyme in starch biosynthesis, was determined in developing potato tuber cells by immunocytochemical localization techniques at the light microscopy level. Specific labeling of ADPglucose pyrophosphorylase by either immunofluorescence or immunogold followed by silver enhancement was detected only in the amyloplasts and indicates that this enzyme is located exclusively in the amyloplasts in developing potato tuber cells. Labeling occurred on the starch grains and, in some instances, specific labeling patterns were evident which may be related to sites active in starch deposition.

Hierarchical Multi-atlas Label Fusion with Multi-scale Feature Representation and Label-specific Patch Partition

PubMed Central

Wu, Guorong; Kim, Minjeong; Sanroma, Gerard; Wang, Qian; Munsell, Brent C.; Shen, Dinggang

2014-01-01

Multi-atlas patch-based label fusion methods have been successfully used to improve segmentation accuracy in many important medical image analysis applications. In general, to achieve label fusion a single target image is first registered to several atlas images, after registration a label is assigned to each target point in the target image by determining the similarity between the underlying target image patch (centered at the target point) and the aligned image patch in each atlas image. To achieve the highest level of accuracy during the label fusion process it’s critical the chosen patch similarity measurement accurately captures the tissue/shape appearance of the anatomical structure. One major limitation of existing state-of-the-art label fusion methods is that they often apply a fixed size image patch throughout the entire label fusion procedure. Doing so may severely affect the fidelity of the patch similarity measurement, which in turn may not adequately capture complex tissue appearance patterns expressed by the anatomical structure. To address this limitation, we advance state-of-the-art by adding three new label fusion contributions: First, each image patch now characterized by a multi-scale feature representation that encodes both local and semi-local image information. Doing so will increase the accuracy of the patch-based similarity measurement. Second, to limit the possibility of the patch-based similarity measurement being wrongly guided by the presence of multiple anatomical structures in the same image patch, each atlas image patch is further partitioned into a set of label-specific partial image patches according to the existing labels. Since image information has now been semantically divided into different patterns, these new label-specific atlas patches make the label fusion process more specific and flexible. Lastly, in order to correct target points that are mislabeled during label fusion, a hierarchically approach is used to improve the label fusion results. In particular, a coarse-to-fine iterative label fusion approach is used that gradually reduces the patch size. To evaluate the accuracy of our label fusion approach, the proposed method was used to segment the hippocampus in the ADNI dataset and 7.0 tesla MR images, sub-cortical regions in LONI LBPA40 dataset, mid-brain regions in SATA dataset from MICCAI 2013 segmentation challenge, and a set of key internal gray matter structures in IXI dataset. In all experiments, the segmentation results of the proposed hierarchical label fusion method with multi-scale feature representations and label-specific atlas patches are more accurate than several well-known state-of-the-art label fusion methods. PMID:25463474

Breadth of tuning in taste afferent neurons varies with stimulus strength

PubMed Central

Wu, An; Dvoryanchikov, Gennady; Pereira, Elizabeth; Chaudhari, Nirupa; Roper, Stephen D.

2015-01-01

Gustatory stimuli are detected by taste buds and transmitted to the hindbrain via sensory afferent neurons. Whether each taste quality (sweet, bitter and so on) is encoded by separate neurons (‘labelled lines') remains controversial. We used mice expressing GCaMP3 in geniculate ganglion sensory neurons to investigate taste-evoked activity. Using confocal calcium imaging, we recorded responses to oral stimulation with prototypic taste stimuli. Up to 69% of neurons respond to multiple tastants. Moreover, neurons tuned to a single taste quality at low concentration become more broadly tuned when stimuli are presented at higher concentration. Responses to sucrose and monosodium glutamate are most related. Although mice prefer dilute NaCl solutions and avoid concentrated NaCl, we found no evidence for two separate populations of sensory neurons that encode this distinction. Altogether, our data suggest that taste is encoded by activity in patterns of peripheral sensory neurons and challenge the notion of strict labelled line coding. PMID:26373451

Individual differences and emotional inferences during reading comprehension.

PubMed

Gillioz, Christelle; Gygax, Pascal; Tapiero, Isabelle

2012-12-01

This study investigated readers' representations of the main protagonist's emotional status in short narratives, as well as several mental factors that may affect these representations. General and visuospatial working memory, empathy, and simulation were investigated as potential individual differences in generating emotional inferences. Participants were confronted with narratives conveying information about the protagonist's emotional state. We manipulated each narrative's target sentence according to its content (emotional label vs. description of the behaviour associated to the emotion) and its congruence to the story (matching vs. mismatching). The results showed that globally the difference between reading times of congruent and incongruent target sentences was bigger in the behavioural than in the emotional condition. This pattern was accentuated for high visuospatial working memory participants when they were asked to simulate the stories. These results support the idea that mental models may be of a perceptual nature and may more likely include behavioural elements than emotion labels per se, as suggested earlier by Gygax et al. (2007). 2012 APA, all rights reserved

The biosynthesis of polysaccharides. Incorporation of d-[1-14C]glucose and d-[6-14C]glucose into plum-leaf polysaccharides

PubMed Central

Andrews, P.; Hough, L.; Picken, J. M.

1965-01-01

1. The utilization of specifically labelled d-glucose in the biosynthesis of plum-leaf polysaccharides has been studied. After these precursors had been metabolized in plum leaves, the polysaccharides were isolated from the leaves, and their monosaccharide constituents isolated and purified. 2. Both the specific activities and the distribution of 14C along the carbon chains of the monosaccharides were determined. Significant 14C activity was found in units of d-galactose, d-glucose, d-xylose and l-arabinose, but their specific activities varied widely. The labelling patterns suggest that in the leaves the other monosaccharides all arise directly from d-glucose without any skeletal change in the carbon chain, other than the loss of a terminal carbon atom in the synthesis of pentoses. 3. The results indicated that within the leaf there are various precursor pools for polysaccharide synthesis and that these pools are not in equilibrium with one another. PMID:14342252

Seasonal patterns of carbon allocation to respiratory pools in 60-yr-old deciduous (Fagus sylvatica) and evergreen (Picea abies) trees assessed via whole-tree stable carbon isotope labeling.

PubMed

Kuptz, Daniel; Fleischmann, Frank; Matyssek, Rainer; Grams, Thorsten E E

2011-07-01

• The CO(2) efflux of adult trees is supplied by recent photosynthates and carbon (C) stores. The extent to which these C pools contribute to growth and maintenance respiration (R(G) and R(M), respectively) remains obscure. • Recent photosynthates of adult beech (Fagus sylvatica) and spruce (Picea abies) trees were labeled by exposing whole-tree canopies to (13) C-depleted CO(2). Label was applied three times during the year (in spring, early summer and late summer) and changes in the stable C isotope composition (δ(13) C) of trunk and coarse-root CO(2) efflux were quantified. • Seasonal patterns in C translocation rate (CTR) and fractional contribution of label to CO(2) efflux (F(Label-Max)) were found. CTR was fastest during early summer. In beech, F(Label-Max) was lowest in spring and peaked in trunks during late summer (0.6 ± 0.1, mean ± SE), whereas no trend was observed in coarse roots. No seasonal dynamics in F(Label-Max) were found in spruce. • During spring, the R(G) of beech trunks was largely supplied by C stores. Recent photosynthates supplied growth in early summer and refilled C stores in late summer. In spruce, CO(2) efflux was constantly supplied by a mixture of stored (c. 75%) and recent (c. 25%) C. The hypothesis that R(G) is exclusively supplied by recent photosynthates was rejected for both species. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

Head-to-Head Visual Comparison between Brain Perfusion SPECT and Arterial Spin-Labeling MRI with Different Postlabeling Delays in Alzheimer Disease.

PubMed

Kaneta, T; Katsuse, O; Hirano, T; Ogawa, M; Yoshida, K; Odawara, T; Hirayasu, Y; Inoue, T

2017-08-01

Arterial spin-labeling MR imaging has been recently developed as a noninvasive technique with magnetically labeled arterial blood water as an endogenous contrast medium for the evaluation of CBF. Our aim was to compare arterial spin-labeling MR imaging and SPECT in the visual assessment of CBF in patients with Alzheimer disease. In 33 patients with Alzheimer disease or mild cognitive impairment due to Alzheimer disease, CBF images were obtained by using both arterial spin-labeling-MR imaging with a postlabeling delay of 1.5 seconds and 2.5 seconds (PLD 1.5 and PLD 2.5 , respectively) and brain perfusion SPECT. Twenty-two brain regions were visually assessed, and the diagnostic confidence of Alzheimer disease was recorded. Among all arterial spin-labeling images, 84.9% of PLD 1.5 and 9% of PLD 2.5 images showed the typical pattern of advanced Alzheimer disease (ie, decreased CBF in the bilateral parietal, temporal, and frontal lobes). PLD 1.5 , PLD 2.5 , and SPECT imaging resulted in obviously different visual assessments. PLD 1.5 showed a broad decrease in CBF, which could have been due to an early perfusion. In contrast, PLD 2.5 did not appear to be influenced by an early perfusion but showed fewer pathologic findings than SPECT. The distinctions observed by us should be carefully considered in the visual assessments of Alzheimer disease. Further studies are required to define the patterns of change in arterial spin-labeling-MR imaging associated with Alzheimer disease. © 2017 by American Journal of Neuroradiology.

Characterization of Bifunctional Spin Labels for Investigating the Structural and Dynamic Properties of Membrane Proteins Using EPR Spectroscopy.

PubMed

Sahu, Indra D; Craig, Andrew F; Dunagum, Megan M; McCarrick, Robert M; Lorigan, Gary A

2017-10-05

Site-directed spin labeling (SDSL) coupled with electron paramagnetic resonance (EPR) spectroscopy is a very powerful technique to study structural and dynamic properties of membrane proteins. The most widely used spin label is methanthiosulfonate (MTSL). However, the flexibility of this spin label introduces greater uncertainties in EPR measurements obtained for determining structures, side-chain dynamics, and backbone motion of membrane protein systems. Recently, a newer bifunctional spin label (BSL), 3,4-bis(methanethiosulfonylmethyl)-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-1-yloxy, has been introduced to overcome the dynamic limitations associated with the MTSL spin label and has been invaluable in determining protein backbone dynamics and inter-residue distances due to its restricted internal motion and fewer size restrictions. While BSL has been successful in providing more accurate information about the structure and dynamics of several proteins, a detailed characterization of the spin label is still lacking. In this study, we characterized BSLs by performing CW-EPR spectral line shape analysis as a function of temperature on spin-labeled sites inside and outside of the membrane for the integral membrane protein KCNE1 in POPC/POPG lipid bilayers and POPC/POPG lipodisq nanoparticles. The experimental data revealed a powder pattern spectral line shape for all of the KCNE1-BSL samples at 296 K, suggesting the motion of BSLs approaches the rigid limit regime for these series of samples. BSLs were further utilized to report for the first time the distance measurement between two BSLs attached on an integral membrane protein KCNE1 in POPC/POPG lipid bilayers at room temperature using dipolar line broadening CW-EPR spectroscopy. The CW dipolar line broadening EPR data revealed a 15 ± 2 Å distance between doubly attached BSLs on KCNE1 (53/57-63/67) which is consistent with molecular dynamics modeling and the solution NMR structure of KCNE1 which yielded a distance of 17 Å. This study demonstrates the utility of investigating the structural and dynamic properties of membrane proteins in physiologically relevant membrane mimetics using BSLs.

Redistribution of insoluble interphotoreceptor matrix components during photoreceptor differentiation in the mouse retina.

PubMed

Mieziewska, K; Szél, A; Van Veen, T; Aguirre, G D; Philp, N

1994-07-01

The development of the nervous system is largely influenced by the extracellular matrix (ECM). In the neural retina, the photoreceptors are surrounded by a unique ECM, the interphotoreceptor matrix (IPM). The IPM plays a central and possibly crucial role in the development, maintenance and specific function of the photoreceptors. Therefore, the characterization of IPM components is necessary to understand the mechanisms regulating photoreceptor differentiation. The IPM in the mouse retina was examined during photoreceptor morphogenesis with the monoclonal antibody (MAb) F22, which recognizes a 250 kDa component of the interphotoreceptor matrix. The binding pattern of MAb F22 revealed a striking redistribution in the expression of the 250 kDa F22 antigen in late stage of postnatal photoreceptor differentiation in the mouse retina. The F22 staining was detectable in the IPM around the inner segments on the third postnatal day (P3). The MAb F22 initially labeled the region around inner segments, but as the outer segments elongated, the F22 distribution became concentrated to the matrix around the rod and cone outer segments until P16-17. At P17, the F22 label around rods began to disappear, while the label around cones became more defined. The shift in label distribution was largely completed by P20. Residual rod-associated label disappeared within a few days. In the adult animal, the F22 antibody labeled the cone-associated matrix only, and this labeling pattern remained stationary. The change in the distribution of MAb F22 demonstrated by immunolabeling was not accompanied by changes in the size of the molecule; F22 antigen isolated from the IPM of P13-15, and from adult IPM migrated with the same molecular weight on SDS gels. The distribution of MAb F22 was compared to that of chondroitin sulfate proteoglycans which are abundant in the IPM. The labeling patterns of MAbs CS-56, C6-S and C4-S were distinct from that of MAb F22. A general decrease of the label intensity was seen with two chondroitin sulfate MAbs (CS-56 and C4-S) between 16 days and 4 months, but a total loss of rod-associated label was not observed. All three chondroitin sulfate MAbs labeled the retina at embryonic day (E) 11.5-13.5, a time of outgrowth of ganglion cell axons, but the F22 antigen was not detected in the retina at this stage of development. The results demonstrate that the F22 and the chondroitin sulfate antibodies are recognizing different molecules that have distinct roles in retinal morphogenesis.(ABSTRACT TRUNCATED AT 400 WORDS)

Segregation of feedforward and feedback projections in mouse visual cortex

PubMed Central

Berezovskii, Vladimir K.; Nassi, Jonathan J.; Born, Richard T.

2011-01-01

Hierarchical organization is a common feature of mammalian neocortex. Neurons that send their axons from lower to higher areas of the hierarchy are referred to as “feedforward” (FF) neurons, whereas those projecting in the opposite direction are called “feedback” (FB) neurons. Anatomical, functional and theoretical studies suggest that these different classes of projections play fundamentally different roles in perception. In primates, laminar differences in projection patterns often distinguish the two projection streams. In rodents, however, these differences are less clear, despite an established hierarchy of visual areas. Thus the rodent provides a strong test of the hypothesis that FF and FB neurons form distinct populations. We tested this hypothesis by injecting retrograde tracers into two different hierarchical levels of mouse visual cortex (areas 17 and AL) and then determining the relative proportions of double-labeled FB and FF neurons in an area intermediate to them (LM). Despite finding singly labeled neurons densely intermingled with no laminar segregation, we found few double-labeled neurons (~5% of each singly labeled population). We also examined the development of FF and FB connections. FF connections were present at the earliest time-point we examined (postnatal day two, P2), while FB connections were not detectable until P11. Our findings indicate that, even in cortices without laminar segregation of FF and FB neurons, the two projection systems are largely distinct at the neuronal level and also differ with respect to the timing of their outgrowth. PMID:21618232

In situ assessment of the velocity of carbon transfer by tracing 13 C in trunk CO2 efflux after pulse labelling: variations among tree species and seasons.

PubMed

Dannoura, Masako; Maillard, Pascale; Fresneau, Chantal; Plain, Caroline; Berveiller, Daniel; Gerant, Dominique; Chipeaux, Christophe; Bosc, Alexandre; Ngao, Jérôme; Damesin, Claire; Loustau, Denis; Epron, Daniel

2011-04-01

Phloem is the main pathway for transferring photosynthates belowground. In situ(13) C pulse labelling of trees 8-10 m tall was conducted in the field on 10 beech (Fagus sylvatica) trees, six sessile oak (Quercus petraea) trees and 10 maritime pine (Pinus pinaster) trees throughout the growing season. Respired (13) CO2 from trunks was tracked at different heights using tunable diode laser absorption spectrometry to determine time lags and the velocity of carbon transfer (V). The isotope composition of phloem extracts was measured on several occasions after labelling and used to estimate the rate constant of phloem sap outflux (kP ). Pulse labelling together with high-frequency measurement of the isotope composition of trunk CO2 efflux is a promising tool for studying phloem transport in the field. Seasonal variability in V was predicted in pine and oak by bivariate linear regressions with air temperature and soil water content. V differed among the three species consistently with known differences in phloem anatomy between broadleaf and coniferous trees. V increased with tree diameter in oak and beech, reflecting a nonlinear increase in volumetric flow with increasing bark cross-sectional area, which suggests changes in allocation pattern with tree diameter in broadleaf species. Discrepancies between V and kP indicate vertical changes in functional phloem properties. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

Evaluative communications between affectively ill and well mothers and their children.

PubMed

Inoff-Germain, G; Nottelmann, E D; Radke-Yarrow, M

1992-04-01

Earlier research suggests that the natural verbal discourse of mothers with their children can be important in clarifying, verifying, and evaluating the behavior in which a child is engaged, in attributing qualities to the child, and in influencing the child's self-perceptions. We investigated the potential influences of parental affective illness (bipolar affective disorder and unipolar depression in contrast to no history of psychiatric illness) on such "labeling" behavior in a sample of 61 mothers and their older (school-age) and younger (preschool-age) children. It was hypothesized that the dispositions characterizing affective illness (specifically, negativity and disengagement) would be reflected in the labeling statements of mothers with a diagnosis as they interacted with their children. Based on videotaped interactions during a visit to a home-like laboratory apartment, labeling statements were identified in terms of speaker and person being labeled ("addressee") and coded (positive, negative, mixed, or neutral) for judgmental and affective quality of the statement and reaction of the addressee. Data were analyzed (a) by family unit and (b) my mother to child statements. The general pattern of findings indicated, in relative terms, an excess of negativity on the part of family members in the bipolar group and a dearth of negative affect for mothers in the unipolar group. Negativity in the bipolar group appeared to be especially likely when the setting involved mothers and two male children. Additionally, findings are discussed in terms of sex differences in vulnerability to depression.

Development of tectal connectivity across metamorphosis in the bullfrog (Rana catesbeiana).

PubMed

Horowitz, Seth S; Simmons, Andrea Megela

2010-01-01

In the bullfrog (Rana catesbeiana), the process of metamorphosis culminates in the appearance of new visual and visuomotor behaviors reflective of the emergence of binocular vision and visually-guided prey capture behaviors as the animal transitions to life on land. Using several different neuroanatomical tracers, we examined the substrates that may underlie these behavioral changes by tracing the afferent and efferent connectivity of the midbrain optic tectum across metamorphic development. Intratectal, tectotoral, tectotegmental, tectobulbar, and tecto-thalamic tracts exhibit similar trajectories of neurobiotin fiber label across the developmental span from early larval tadpoles to adults. Developmental variability was apparent primarily in intensity and distribution of cell and puncta label in target nuclei. Combined injections of cholera toxin subunit β and Phaseolus vulgaris leucoagglutinin consistently label cell bodies, puncta, or fiber segments bilaterally in midbrain targets including the pretectal gray, laminar nucleus of the torus semicircularis, and the nucleus of the medial longitudinal fasciculus. Developmentally stable label was observed bilaterally in medullary targets including the medial vestibular nucleus, lateral vestibular nucleus, and reticular gray, and in forebrain targets including the posterior and ventromedial nuclei of the thalamus. The nucleus isthmi, cerebellum, lateral line nuclei, medial septum, ventral striatum, and medial pallium show more developmentally variable patterns of connectivity. Our results suggest that even during larval development, the optic tectum contains substrates for integration of visual with auditory, vestibular, and somatosensory cues, as well as for guidance of motivated behaviors. Copyright © 2011 S. Karger AG, Basel.

Mining and Modeling Real-world Networks: Patterns, Anomalies, and Tools

DTIC Science & Technology

2012-08-01

3 x 10 4 0 1 2 3 4 5 6 7 x 10 4 Youtube groups Yo ut ub e us er s porn general interest animemusic A1 A2 A3 A4 A3 Figure 10.1: PICS on YOUTUBE finds...groups in major feature clusters; notice that these clusters can be human-labeled as ‘ porn ’, ‘music’, ‘anime’, and ‘special interest’. With respect to...groups 140 labeled as ‘A2’. The node clusters in the blue square labeled as ‘4’ mostly belong to YouTube groups associated with ‘ porn and music’ labeled

Learning builds on learning: Infants' use of native language sound patterns to learn words

PubMed Central

Graf Estes, Katharine

2014-01-01

The present research investigated how infants apply prior knowledge of environmental regularities to support new learning. The experiments tested whether infants could exploit experience with native language (English) phonotactic patterns to facilitate associating sounds with meanings during word learning. Fourteen-month-olds heard fluent speech that contained cues for detecting target words; they were embedded in sequences that occur across word boundaries. A separate group heard the target words embedded without word boundary cues. Infants then participated in an object label-learning task. With the opportunity to use native language patterns to segment the target words, infants subsequently learned the labels. Without this experience, infants failed. Novice word learners can take advantage of early learning about sounds scaffold lexical development. PMID:24980741

Studies on the defect underlying the lysosomal storage of sialic acid in Salla disease. Lysosomal accumulation of sialic acid formed from N-acetyl-mannosamine or derived from low density lipoprotein in cultured mutant fibroblasts.

PubMed Central

Renlund, M; Kovanen, P T; Raivio, K O; Aula, P; Gahmberg, C G; Ehnholm, C

1986-01-01

Salla disease is a lysosomal storage disorder characterized by mental retardation and disturbed sialic acid metabolism. To study endogenous synthesis and breakdown of sialic acid, fibroblasts were incubated for 5 d in the presence and then in the absence of N-[3H]acetylmannosamine. Labeling of free sialic acid was 5-10 times higher in mutant than in normal cells. Radioactivity decreased in 4 d by 75% in normal but only by 30% in mutant fibroblasts. The labeling pattern was not normalized upon coculture of mutant and normal cells. To study the metabolism of extracellular sialic acid, low-density lipoprotein (LDL) was labeled in the sialic acid moiety (periodate-NaB3H4) or in the protein moiety (125I). Binding, internalization, lysosomal degradation, and exit of products of protein catabolism were similar in normal and mutant fibroblasts. Upon incubation with LDL labeled in the sialic acid moiety, mutant cells accumulated 2-3 times more free sialic acid radioactivity than normal fibroblasts, mostly in the lysosomal fraction. After a 24-h chase incubation, radioactivity in free sialic acid decreased by 70-80% in normal but only by 10-30% in mutant cells. In mutant fibroblasts, 40% of the radioactivity remained in lysosomes, whereas no labeled free sialic acid was detected in lysosomes from normal fibroblasts. We conclude that in Salla disease, fibroblast endogenous synthesis of sialic acid and lysosomal cleavage of exogenous glycoconjugates is normal, but free sialic acid cannot leave the lysosome. These findings suggest that the basic defect in Salla disease is deficient transport of free sialic acid through the lysosomal membrane. PMID:3944269

Involvement of over-expressed BMP4 in pentylenetetrazol kindling-induced cell proliferation in the dentate gyrus of adult rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin Jinbo; Ma Yuxin; Yin Qing

2007-03-30

The dentate gyrus (DG) of the hippocampus is one of a few regions in the adult mammalian brain characterized by ongoing neurogenesis. Proliferation of neural precursors in the granule cell layer of the DG has been identified in pentylenetetrazol (PTZ) kindling epilepsy model, however, little is known about the molecular mechanism. We previously reported that the expression pattern of bone morphogenetic proteins-4 (BMP4) mRNA in the hippocampus was developmentally regulated and mainly localized in the DG of the adult. To explore the role of BMP4 in epileptic activity, we detected BMP4 expression in the DG during PTZ kindling process andmore » explore its correlation with cell proliferation combined with bromodeoxyuridine (BrdU) labeling technique. We found that dynamic changes in BMP4 level and BrdU labeled cells dependent on the kindling stage of PTZ induced seizure-prone state. The number of BMP4 mRNA-positive cells and BrdU labeled cells reached the top level 1 day after PTZ kindled, then declined to base level 2 months later. Furthermore, there was a significant correlation between increased BMP4 mRNA expression and increased number of BrdU labeled cells. After effectively blocked expression of BMP4 with antisense oligodeoxynucleotides(ASODN), the BrdU labeled cells in the dentate gyrus subgranular zone(DG-SGZ) and hilus were significantly decreased 16d after First PTZ injection and 1, 3, 7, 14d after kindled respectively. These findings suggest that increased proliferation in the DG of the hippocampus resulted from kindling epilepsy elicited by PTZ maybe be modulated by BMP4 over-expression.« less

Influence of cognitive style on information processing and selection of yogurt labels: Insights from an eye-tracking study.

PubMed

Mawad, Franco; Trías, Marcela; Giménez, Ana; Maiche, Alejandro; Ares, Gastón

2015-08-01

Cognitive styles are characteristic and stable ways in which people acquire, organize and use information for solving problems and making decisions. Field dependence/independence is one of the most studied cognitive styles. Field independent subjects are characterized by having less difficulty in separating information from its contextual surroundings and being less likely to be influenced by external cues than field dependent individuals. The present work aimed at studying the influence of field dependence/independence cognitive style on consumers' visual processing and choice of yogurt labels. One hundred and thirty three consumers completed a choice conjoint task. They were asked to select their preferred yogurt label from each of 16 pairs of labels. While they completed the task their eye movements were recorded using an eye-tracker. Then, consumers were asked to complete the Group Embedded Figure Test to determine their cognitive style. Consumers were divided into two groups with different cognitive styles: 58% of the sample was characterized as field dependent and 42% as field independent. When making their choices, field dependent consumers tended to engage in less thoughtful information processing than field independent consumers and they made fewer fixations on traditional nutritional information. Besides, cognitive style significantly affected the relative importance of fat and sugar content on consumer choices and modulated the influence of the traffic light system. Field dependent consumers gave less importance to the nutritional composition of the yogurts than field independent consumers for selecting their preferred label. Results from this work suggest that studying the psychological underpinnings of consumers' decision making process when selecting food products has a great potential to contribute to a better understanding of how eating patterns and consumer preferences are shaped. Copyright © 2015 Elsevier Ltd. All rights reserved.

Biosynthesis of the unique trans-delta 3-hexadecenoic acid component of chloroplast phosphatidylglycerol: evidence concerning its site and mechanism of formation.

PubMed

Ohnishi, M; Thompson, G A

1991-08-01

As in most higher plants, chloroplast membranes of the green alga Dunaliella salina contain phosphatidylglycerol (PG) that is rich in trans-delta 3-hexadecenoic acid (16:1t), a fatty acid found nowhere else in the cell. After labeling D. salina with exogenous [3H]myristic acid [( 3H]14:0), the cis-unsaturated fatty acids of monogalactosyldiacylglycerol and sulfoquinovosyldiacylglycerol as well as PG had higher specific radioactivities in chloroplast envelopes than in thylakoids. In contrast, 16:1t was very slow to become radioactive, and its specific radioactivity was several times higher in isolated thylakoids than in envelopes after brief (3-20 min) labeling with [3H]14:0. Analysis of individual PG molecular species revealed that the fatty acid paired with 16:1t was also labeled slowly. Thus linoleate (18:2) released from a 16:1t-containing PG had a 350-fold (at 3 min) to 20-fold (at 60 min) lower specific radioactivity than did 18:2 from a palmitate (16:0)-containing PG. The findings suggest that the substrates for trans-desaturation are 16:0-containing PG molecular species which are readily labeled from [3H]14:0 in the envelope but are diluted by the large pool of thylakoid PG before penetrating to the desaturation site. By examining the labeling patterns of individual PG molecular species classes, it was concluded that D. salina 16:1t is formed from 16:0 linked to 18:2/16:0 PG and 18:3/16:0 PG by a trans-desaturase located within the inner recesses of the thylakoid compartment.

Peculiarities of RFLP of highly repetitive DNA in crow genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chelomina, G.N.; Kryukov, A.P.; Ivanov, S.V.

1995-02-01

We present a study of the structural organization of highly repetitive DNA in genomes of hooded crow Corvus cornix L., carrion crow C. corone L., and jungle crow C. macrorhynchos Wagl. RFLP and blot-hybridization with {sup 32}P-labeled Msp I fragment from hooded crow nDNA suggest the interspecific structural conservatism of the most repetitive DNA. The family of repeats we studied had tandem organization and the same (210 bp) period of reiteration for a set of restriction enzymes. However, in parallel to the general similarity of restriction patterns, there are species-specific peculiarities. The repetitive family revealed (Alu I, BsuR I, andmore » Msp I fragments) has quantitative RFLP of nDNA and interspecific differences in the extent of the multimer {open_quotes}ladder{close_quotes} pattern of Msp I fragments. The latter is more pronounced in nDNA of carrion crow than in that of phylogenetically distant jungle crow and closely related hooded crow. This suggests a recent amplification event for highly organized homological repeats in crow genomes. 10 refs., 2 figs.« less

The distribution and metabolism of urea in the eastern Canadian Arctic

NASA Astrophysics Data System (ADS)

Harrison, W. G.; Head, E. J. H.; Conover, R. J.; Longhurst, A. R.; Sameoto, D. D.

1985-01-01

Urea concentrations, uptake, and excretion were measured at various locations in northern Baffin Bay and surrounding waters during the summer of 1980. Concentrations were variable (<0.03 to > 2.00 mg-at. N m -3) but followed patterns of decreasing concentration with depth in the euphotic zone and with distance from land. Urea accounted for > 50% of the total dissolved nitrogen in the upper mixed layer at most stations. Urea uptake rates showed generally the same distributional patterns as did concentrations and on the average accounted for 32% of the total nitrogen (NO 3- + NH 4+ + urea) productivity in the eupholic zone. Ammonium, and frequently NO 3-, were utilized in preference to urea. Dual isotope ( 14C and 15N-urea) labelling experiments suggested that most urea-C was respired as CO 2 while 50 to 80% of the urea-N was incorporated by the phytoplankton. Excretion measurements suggested that the four dominant macrozooplankton species ( Calanus hyperboreus, C. finmarchicus, C. glacialis, and Metridia sp.) supplied only -3% of the urea-N but -40% of the NH 4+-N requirements of the primary producers.

Nutrition knowledge, food label use, and food intake patterns among Latinas with and without type 2 diabetes.

PubMed

Fitzgerald, Nurgül; Damio, Grace; Segura-Pérez, Sofia; Pérez-Escamilla, Rafael

2008-06-01

To examine the associations of nutrition knowledge, food label use, and food intake patterns among Latinas with and without diagnosed diabetes. This was a case-control study. A convenience sample of 201 (100 cases with diagnosed type 2 diabetes, 101 controls without diagnosed diabetes) nonpregnant, nonbreastfeeding Latinas without severe health conditions, aged 35 to 60 years were interviewed by bicultural interviewers. Diverse community-based recruitment methods were used. Independent samples t test, Mann-Whitney U, and chi(2) tests, and multivariate logistic regression were performed. Food labels self-efficacy and stage of change, and average nutrition knowledge scores were similar between cases and controls (P>0.05). Within the diabetes group, nutrition knowledge was greater among those who had seen a registered dietitian or a diabetes educator (P=0.020). Cases reported consuming artificially sweetened desserts and beverages more frequently than controls (P<0.001). Pooled sample cross-sectional analyses showed that nutrition knowledge was positively related to food label use, which in turn was related to a more healthful food intake pattern (P<0.05). After adjusting for likely confounders, socioeconomic status (SES) was positively related to nutrition knowledge (P=0.001) and intakes of fruits, vegetables, and meats (P

High-resolution 2-deoxyglucose mapping of functional cortical columns in mouse barrel cortex.

PubMed

McCasland, J S; Woolsey, T A

1988-12-22

Cortical columns associated with barrels in layer IV of the somatosensory cortex were characterized by high-resolution 2-deoxy-D-glucose (2DG) autoradiography in freely behaving mice. The method demonstrates a more exact match between columnar labeling and cytoarchitectonic barrel boundaries than previously reported. The pattern of cortical activation seen with stimulation of a single whisker (third whisker in the middle row of large hairs--C3) was compared with the patterns from two control conditions--normal animals with all whiskers present ("positive control")--and with all large whiskers clipped ("negative control"). Two types of measurements were made from 2DG autoradiograms of tangential cortical sections: 1) labeled cells were identified by eye and tabulated with a computer, and 2) grain densities were obtained automatically with a computer-controlled microscope and image processor. We studied the fine-grained patterns of 2DG labeling in a nine-barrel grid with the C3 barrel in the center. From the analysis we draw five major conclusions. 1. Approximately 30-40% of the total number of neurons in the C3 barrel column are activated when only the C3 whisker is stimulated. This is about twice the number of neurons labeled in the C3 column when all whiskers are stimulated and about ten times the number of neurons labeled when all large whiskers are clipped. 2. There is evidence for a vertical functional organization within a barrel-related whisker column which has smaller dimensions in the tangential direction than a barrel. There are densely labeled patches within a barrel which are unique to an individual cortex. The same patchy pattern is found in the appropriate regions of sections above and below the barrels through the full thickness of the cortex. This functional arrangement could be considered to be a "minicolumn" or more likely a group of "minicolumns" (Mountcastle: In G.M. Edelman and U.B. Mountcastle (eds): The Material Brain: Cortical Organization and the Group-Selective Theory of Higher Brain Function. Cambridge: MIT Press, '78). 3. Within the stereotyped geometry of the barrel field, there is considerable individual variation in the radial labeling distribution in corresponding (homotypical) columns of different cerebral hemispheres. This result is consistent with the hypothesis that dynamic processes operate to determine the connection strengths between neural elements in somatosensory cortex. It provides a basis for testing various "connectionist" and "group selection" theories of neural organization and development.(ABSTRACT TRUNCATED AT 400 WORDS)

Differential phosphorylation patterns of P-glycoprotein reconstituted into a proteoliposome system: insight into additional unconventional phosphorylation sites.

PubMed

Lelong-Rebel, Isabelle H; Cardarelli, Carol O

2005-01-01

Membrane vesicles from the multidrug-resistant KB-V1 and KB-C1 cell lines overexpressing P-glycoprotein (Pgp), responsible for pleiotropic chemotherapeutic agents resistance, were solubilized with octyl-glucoside (OG-EX) and further fractionated on DEAE-sepharose column with increased concentrations of NaCl. The fraction containing Pgp (F3) was reconstituted into proteoliposomes (F3-PLP). Comparisons of the phosphorylation levels of Pgp achieved throughout the purification and reconstitution steps were addressed in this study. The [delta32 P] ATP-driven phosphorylation of Pgp was strongly increased in OG-EX, decreased in F3 and not detected in F3-PLP, when compared to Pgp phosphorylation in native plasma membrane vesicles. [delta32 P]ATP-phosphorylation of Pgp in F3-PLP could be restored by exogenously added PKC or by the catalytic sub-unit of PKA. The vanadate-induced hyperphosphorylation effect on Pgp by [delta32 P]ATP observed with plasma membrane vesicles was maintained in OG-EX, but was lost in F3 and did not enable labelling in F3-PLP. Enhancement of [delta32 P]-labelling of native Pgp via [delta32 P]ATP combined with GTP was maintained and also triggered phosphorylation of purified/reconstituted Pgp in F3-PLP as well. Altogether, our data suggest differential phosphorylation patterns of the transporter linked to environmental molecular composition (lipids, presence of detergent) and structure (unfolded versus embedded). In addition, restoration by GTP of Pgp phosphorylation by [delta32 P]ATP in the frame of F3-PLP suggests intra-molecular modulations and hints that other phosphorylation sites and processes, different from the classic ones involving PKC and/or PKA, may participate in the transporter's mechanism.

A method for simultaneously delineating multiple targets in 3D-FISH using limited channels, lasers, and fluorochromes.

PubMed

Zhao, F Y; Yang, X; Chen, D Y; Ma, W Y; Zheng, J G; Zhang, X M

2014-01-01

Many studies have suggested a link between the spatial organization of genomes and fundamental biological processes such as genome reprogramming, gene expression, and differentiation. Multicolor fluorescence in situ hybridization on three-dimensionally preserved nuclei (3D-FISH), in combination with confocal microscopy, has become an effective technique for analyzing 3D genome structure and spatial patterns of defined nucleus targets including entire chromosome territories and single gene loci. This technique usually requires the simultaneous visualization of numerous targets labeled with different colored fluorochromes. Thus, the number of channels and lasers must be sufficient for the commonly used labeling scheme of 3D-FISH, "one probe-one target". However, these channels and lasers are usually restricted by a given microscope system. This paper presents a method for simultaneously delineating multiple targets in 3D-FISH using limited channels, lasers, and fluorochromes. In contrast to other labeling schemes, this method is convenient and simple for multicolor 3D-FISH studies, which may result in widespread adoption of the technique. Lastly, as an application of the method, the nucleus locations of chromosome territory 18/21 and centromere 18/21/13 in normal human lymphocytes were analyzed, which might present evidence of a radial higher order chromatin arrangement.

Internalization and sorting of a fluorescent analogue of glucosylceramide to the Golgi apparatus of human skin fibroblasts: utilization of endocytic and nonendocytic transport mechanisms

PubMed Central

1994-01-01

We examined the uptake and intracellular transport of the fluorescent glucosylceramide analogue N-[5-(5,7-dimethyl BODIPYTM)-1-pentanoyl]- glucosyl sphingosine (C5-DMB-GlcCer) in human skin fibroblasts, and we compared its behavior to that of the corresponding fluorescent analogues of sphingomyelin, galactosylceramide, and lactosylceramide. All four fluorescent analogues were readily transferred from defatted BSA to the plasma membrane during incubation at 4 degrees C. When cells treated with C5-DMB-GlcCer were washed, warmed to 37 degrees C, and subsequently incubated with defatted BSA to remove fluorescent lipid at the cell surface, strong fluorescence was observed at the Golgi apparatus, as well as weaker labeling at the nuclear envelope and other intracellular membranes. Similar results were obtained with C5-DMB- galactosylceramide, except that labeling of the Golgi apparatus was weaker than with C5-DMB-GlcCer. Internalization of C5-DMB-GlcCer was not inhibited by various treatments, including ATP depletion or warming to 19 degrees C, and biochemical analysis demonstrated that the lipid was not metabolized during its internalization. However, accumulation of C5-DMB-GlcCer at the Golgi apparatus was reduced when cells were treated with a nonfluorescent analogue of glucosylceramide, suggesting that accumulation of C5-DMB-GlcCer at the Golgi apparatus was a saturable process. In contrast, cells treated with C5-DMB-analogues of sphingomyelin or lactosylceramide internalized the fluorescent lipid into a punctate pattern of fluorescence during warming at 37 degrees C, and this process was temperature and energy dependent. These results with C5-DMB-sphingomyelin and C5-DMB-lactosylceramide were analogous to those obtained with another fluorescent analogue of sphingomyelin in which labeling of endocytic vesicles and plasma membrane lipid recycling were documented (Koval, M., and R. E. Pagano. 1990. J. Cell Biol. 111:429-442). Incubation of perforated cells with C5-DMB- sphingomyelin resulted in prominent labeling of the nuclear envelope and other intracellular membranes, similar to the pattern observed with C5-DMB-GlcCer in intact cells. These observations are consistent with the transbilayer movement of fluorescent analogues of glucosylceramide and galactosylceramide at the plasma membrane and early endosomes of human skin fibroblasts, and suggest that both endocytic and nonendocytic pathways are used in the internalization of these lipids from the plasma membrane. PMID:8188745

Chemoautotrophic carbon fixation rates and active bacterial communities in intertidal marine sediments.

PubMed

Boschker, Henricus T S; Vasquez-Cardenas, Diana; Bolhuis, Henk; Moerdijk-Poortvliet, Tanja W C; Moodley, Leon

2014-01-01

Chemoautotrophy has been little studied in typical coastal marine sediments, but may be an important component of carbon recycling as intense anaerobic mineralization processes in these sediments lead to accumulation of high amounts of reduced compounds, such as sulfides and ammonium. We studied chemoautotrophy by measuring dark-fixation of 13C-bicarbonate into phospholipid derived fatty acid (PLFA) biomarkers at two coastal sediment sites with contrasting sulfur chemistry in the Eastern Scheldt estuary, The Netherlands. At one site where free sulfide accumulated in the pore water right to the top of the sediment, PLFA labeling was restricted to compounds typically found in sulfur and ammonium oxidizing bacteria. At the other site, with no detectable free sulfide in the pore water, a very different PLFA labeling pattern was found with high amounts of label in branched i- and a-PLFA besides the typical compounds for sulfur and ammonium oxidizing bacteria. This suggests that other types of chemoautotrophic bacteria were also active, most likely Deltaproteobacteria related to sulfate reducers. Maximum rates of chemoautotrophy were detected in first 1 to 2 centimeters of both sediments and chemosynthetic biomass production was high ranging from 3 to 36 mmol C m(-2) d(-1). Average dark carbon fixation to sediment oxygen uptake ratios were 0.22±0.07 mol C (mol O2)(-1), which is in the range of the maximum growth yields reported for sulfur oxidizing bacteria indicating highly efficient growth. Chemoautotrophic biomass production was similar to carbon mineralization rates in the top of the free sulfide site, suggesting that chemoautotrophic bacteria could play a crucial role in the microbial food web and labeling in eukaryotic poly-unsaturated PLFA was indeed detectable. Our study shows that dark carbon fixation by chemoautotrophic bacteria is a major process in the carbon cycle of coastal sediments, and should therefore receive more attention in future studies on sediment biogeochemistry and microbial ecology.

Emotional and deliberative reactions to a public crisis: Mad Cow disease in France.

PubMed

Sinaceur, Marwan; Heath, Chip; Cole, Steve

2005-03-01

Although most theories of choice are cognitive, recent research has emphasized the role of emotions. We used a novel context--the Mad Cow crisis in France--to investigate how emotions alter choice even when consequences are held constant. A field study showed that individuals reduced beef consumption in months after many newspaper articles featured the emotional label "Mad Cow," but beef consumption was unaffected after articles featured scientific labels for the same disease. The reverse pattern held for the disease-related actions of a government bureaucracy. A lab study showed that the Mad Cow label induces people to make choices based solely on emotional reactions, whereas scientific labels induce people to consider their own probability judgments. Although the Mad Cow label produces less rational behavior than scientific labels, it is two to four times more common in the environment.

Photosynthate distribution patterns in cherrybark oak seedling sprouts

Treesearch

Brian Roy Lockhart; John D. Hodges; Emile S. Gardiner; Andrew W. Ezell

2003-01-01

Summary We used 14C tracers to determine photosynthate distribution in cherrybark oak (Quercus pagoda Raf.) seedling sprouts following release from competing mid-story vegetation. Fall acquisition of labeled photosynthates by seedlings followed expected source--sink patterns, with root and basal stem tissues...

Neurofilament protein defines regional patterns of cortical organization in the macaque monkey visual system: a quantitative immunohistochemical analysis

NASA Technical Reports Server (NTRS)

Hof, P. R.; Morrison, J. H.; Bloom, F. E. (Principal Investigator)

1995-01-01

Visual function in monkeys is subserved at the cortical level by a large number of areas defined by their specific physiological properties and connectivity patterns. For most of these cortical fields, a precise index of their degree of anatomical specialization has not yet been defined, although many regional patterns have been described using Nissl or myelin stains. In the present study, an attempt has been made to elucidate the regional characteristics, and to varying degrees boundaries, of several visual cortical areas in the macaque monkey using an antibody to neurofilament protein (SMI32). This antibody labels a subset of pyramidal neurons with highly specific regional and laminar distribution patterns in the cerebral cortex. Based on the staining patterns and regional quantitative analysis, as many as 28 cortical fields were reliably identified. Each field had a homogeneous distribution of labeled neurons, except area V1, where increases in layer IVB cell and in Meynert cell counts paralleled the increase in the degree of eccentricity in the visual field representation. Within the occipitotemporal pathway, areas V3 and V4 and fields in the inferior temporal cortex were characterized by a distinct population of neurofilament-rich neurons in layers II-IIIa, whereas areas located in the parietal cortex and part of the occipitoparietal pathway had a consistent population of large labeled neurons in layer Va. The mediotemporal areas MT and MST displayed a distinct population of densely labeled neurons in layer VI. Quantitative analysis of the laminar distribution of the labeled neurons demonstrated that the visual cortical areas could be grouped in four hierarchical levels based on the ratio of neuron counts between infragranular and supragranular layers, with the first (areas V1, V2, V3, and V3A) and third (temporal and parietal regions) levels characterized by low ratios and the second (areas MT, MST, and V4) and fourth (frontal regions) levels characterized by high to very high ratios. Such density trends may correspond to differential representation of corticocortically (and corticosubcortically) projecting neurons at several functional steps in the integration of the visual stimuli. In this context, it is possible that neurofilament protein is crucial for the unique capacity of certain subsets of neurons to perform the highly precise mapping functions of the monkey visual system.

Characterization of glucose-related metabolic pathways in differentiated rat oligodendrocyte lineage cells.

PubMed

Amaral, Ana I; Hadera, Mussie G; Tavares, Joana M; Kotter, Mark R N; Sonnewald, Ursula

2016-01-01

Although oligodendrocytes constitute a significant proportion of cells in the central nervous system (CNS), little is known about their intermediary metabolism. We have, therefore, characterized metabolic functions of primary oligodendrocyte precursor cell cultures at late stages of differentiation using isotope-labelled metabolites. We report that differentiated oligodendrocyte lineage cells avidly metabolize glucose in the cytosol and pyruvate derived from glucose in the mitochondria. The labelling patterns of metabolites obtained after incubation with [1,2-(13)C]glucose demonstrated that the pentose phosphate pathway (PPP) is highly active in oligodendrocytes (approximately 10% of glucose is metabolized via the PPP as indicated by labelling patterns in phosphoenolpyruvate). Mass spectrometry and magnetic resonance spectroscopy analyses of metabolites after incubation of cells with [1-(13)C]lactate or [1,2-(13)C]glucose, respectively, demonstrated that anaplerotic pyruvate carboxylation, which was thought to be exclusive to astrocytes, is also active in oligodendrocytes. Using [1,2-(13)C]acetate, we show that oligodendrocytes convert acetate into acetyl CoA which is metabolized in the tricarboxylic acid cycle. Analysis of labelling patterns of alanine after incubation of cells with [1,2-(13)C]acetate and [1,2-(13)C]glucose showed catabolic oxidation of malate or oxaloacetate. In conclusion, we report that oligodendrocyte lineage cells at late differentiation stages are metabolically highly active cells that are likely to contribute considerably to the metabolic activity of the CNS. © 2015 The Authors. Glia Published by Wiley Periodicals, Inc.

Identification of hormone-interacting amino acid residues within the steroid-binding domain of the glucocorticoid receptor in relation to other steroid hormone receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carlstedt-Duke, J.; Stroemstedt, P.E.; Persson, B.

1988-05-15

Purified rat liver glucocorticoid receptor was covalently charged with (/sup 3/H)glucocorticoid by photoaffinity labeling (UV irradiation of (/sup 3/H)triamcinolone acetonide-glucocorticoid receptor) or affinity labeling (incubation with (/sup 3/H)dexamethasone mesylate). After labeling, separate samples of the denatured receptor were cleaved with trypsin (directly or after prior succinylation), chymotrypsin, and cyanogen bromide. Labeled residues in the peptides obtained were identified by radiosequence analysis. The peaks of radioactivity corresponded to Met-622 and Cys-754 after photoaffinity labeling with (/sup 3/H)triamcinolone acetonide and Cys-656 after affinity labeling with (/sup 3/H)dexamethasone mesylate. The labeled residues are all positioned within hydrophobic segments of the steroid-binding domain. Themore » patterns of hydropathy and secondary structure for the glucocorticoid receptor are highly similar to those for the progestin receptor and similar but less so to those for the estrogen receptor and to those for c-erb A.« less

Fact vs fiction--how paratextual information shapes our reading processes.

PubMed

Altmann, Ulrike; Bohrn, Isabel C; Lubrich, Oliver; Menninghaus, Winfried; Jacobs, Arthur M

2014-01-01

Our life is full of stories: some of them depict real-life events and were reported, e.g. in the daily news or in autobiographies, whereas other stories, as often presented to us in movies and novels, are fictional. However, we have only little insights in the neurocognitive processes underlying the reading of factual as compared to fictional contents. We investigated the neurocognitive effects of reading short narratives, labeled to be either factual or fictional. Reading in a factual mode engaged an activation pattern suggesting an action-based reconstruction of the events depicted in a story. This process seems to be past-oriented and leads to shorter reaction times at the behavioral level. In contrast, the brain activation patterns corresponding to reading fiction seem to reflect a constructive simulation of what might have happened. This is in line with studies on imagination of possible past or future events.

Fact vs fiction—how paratextual information shapes our reading processes

PubMed Central

Altmann, Ulrike; Bohrn, Isabel C.; Lubrich, Oliver; Menninghaus, Winfried; Jacobs, Arthur M.

2014-01-01

Our life is full of stories: some of them depict real-life events and were reported, e.g. in the daily news or in autobiographies, whereas other stories, as often presented to us in movies and novels, are fictional. However, we have only little insights in the neurocognitive processes underlying the reading of factual as compared to fictional contents. We investigated the neurocognitive effects of reading short narratives, labeled to be either factual or fictional. Reading in a factual mode engaged an activation pattern suggesting an action-based reconstruction of the events depicted in a story. This process seems to be past-oriented and leads to shorter reaction times at the behavioral level. In contrast, the brain activation patterns corresponding to reading fiction seem to reflect a constructive simulation of what might have happened. This is in line with studies on imagination of possible past or future events. PMID:22956671

Emotions are understood from biological motion across remote cultures.

PubMed

Parkinson, Carolyn; Walker, Trent T; Memmi, Sarah; Wheatley, Thalia

2017-04-01

Patterns of bodily movement can be used to signal a wide variety of information, including emotional states. Are these signals reliant on culturally learned cues or are they intelligible across individuals lacking exposure to a common culture? To find out, we traveled to a remote Kreung village in Ratanakiri, Cambodia. First, we recorded Kreung portrayals of 5 emotions through bodily movement. These videos were later shown to American participants, who matched the videos with appropriate emotional labels with above chance accuracy (Study 1). The Kreung also viewed Western point-light displays of emotions. After each display, they were asked to either freely describe what was being expressed (Study 2) or choose from 5 predetermined response options (Study 3). Across these studies, Kreung participants recognized Western point-light displays of anger, fear, happiness, sadness, and pride with above chance accuracy. Kreung raters were not above chance in deciphering an American point-light display depicting love, suggesting that recognizing love may rely, at least in part, on culturally specific cues or modalities other than bodily movement. In addition, multidimensional scaling of the patterns of nonverbal behavior associated with each emotion in each culture suggested that similar patterns of nonverbal behavior are used to convey the same emotions across cultures. The considerable cross-cultural intelligibility observed across these studies suggests that the communication of emotion through movement is largely shaped by aspects of physiology and the environment shared by all humans, irrespective of differences in cultural context. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Immunohistochemical evidence suggests intrinsic regulatory activity of human eccrine sweat glands

PubMed Central

ZANCANARO, CARLO; MERIGO, FLAVIA; CRESCIMANNO, CATERINA; ORLANDINI, SIMONETTA; OSCULATI, ANTONIO

1999-01-01

Immunohistochemistry of normal eccrine sweat glands was performed on paraffin sections of human skin. Immunoreactivity (ir) for neuron specific enolase, S100 protein (S100), regulatory peptides, nitric oxide synthase type I (NOS-I) and choline-acetyltransferase (ChAT) was found in small nerve bundles close to sweat glands. In the glands, secretory cells were labelled with anticytokeratin antibody. Using antibodies to S100, calcitonin gene-related peptide (CGRP) and substance P (SP) a specific distribution pattern was found in secretory cells. Granulated (dark) and parietal (clear) cells were immunopositive for CGRP, and S100 and SP, respectively. Immunoreactivity was diffuse in the cytoplasm for CGRP and S100, and peripheral for SP. Myoepithelial cells were not labelled. Electron microscopy revealed electron dense granules, probably containing peptide, in granulated cells. Using antibodies to NOS-I and ChAT, ir was exclusively found in myoepithelial cells. Immunoreactivity for the atrial natriuretic peptide was absent in sweat glands. These results provide evidence for the presence of both regulatory peptides involved in vasodilation and key enzymes for the synthesis of nitric oxide and acetylcholine in the secretory coil of human sweat glands. It is suggested that human sweat glands are capable of some intrinsic regulation in addition to that carried out by their nerve supply. PMID:10386780

Toward a sustainability label for food products: an analysis of experts' and consumers' acceptance.

PubMed

Engels, Stéphanie V; Hansmann, Ralf; Scholz, Roland W

2010-01-01

The recent proliferation of standards and labels for organic, fair-trade, locally produced, and healthy food products risks creating confusion among consumers. This study presents a standardized approach to developing a comprehensive sustainability label that incorporates ecological, economic, and social values. The methodology is based on an extension of modular life-cycle assessment to non-environmental sustainability criteria. Interviews with a wide range of experts (n=65) and a consumer survey (n=233) were conducted to analyze the feasibility and potential effectiveness of the approach. Responses indicated that a comprehensive sustainability label could considerably influence consumption patterns and facilitate cross-product comparisons. Copyright © Taylor & Francis Group, LLC

Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

DOE PAGES

Zhang, Yan; Inouye, Hideyo; Crowley, Michael; ...

2016-10-14

Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yan; Inouye, Hideyo; Crowley, Michael

Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. This algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

Diffraction pattern simulation of cellulose fibrils using distributed and quantized pair distances

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yan; Inouye, Hideyo; Crowley, Michael

Intensity simulation of X-ray scattering from large twisted cellulose molecular fibrils is important in understanding the impact of chemical or physical treatments on structural properties such as twisting or coiling. This paper describes a highly efficient method for the simulation of X-ray diffraction patterns from complex fibrils using atom-type-specific pair-distance quantization. Pair distances are sorted into arrays which are labelled by atom type. Histograms of pair distances in each array are computed and binned and the resulting population distributions are used to represent the whole pair-distance data set. These quantized pair-distance arrays are used with a modified and vectorized Debyemore » formula to simulate diffraction patterns. This approach utilizes fewer pair distances in each iteration, and atomic scattering factors are moved outside the iteration since the arrays are labelled by atom type. As a result, this algorithm significantly reduces the computation time while maintaining the accuracy of diffraction pattern simulation, making possible the simulation of diffraction patterns from large twisted fibrils in a relatively short period of time, as is required for model testing and refinement.« less

Peridinialean dinoflagellate plate patterns, labels and homologies

USGS Publications Warehouse

Edwards, L.E.

1990-01-01

Tabulation patterns for peridinialean dinoflagellate thecae and cysts have been traditionally expressed using a plate labelling system described by C.A. Kofoid in the early 1900's. This system can obscure dinoflagellate plate homologies and has not always been strictly applied. The plate-labelling system presented here introduces new series labels but incorporates key features and ideas from the more recently proposed systems of G.L. Eaton and F.J.R. Taylor, as modified by W.R. Evitt. Plate-series recognition begins with the cingulum (C-series) and proceeds from the cingulum toward the apex for the three series of the epitheca/epicyst and proceeds from the cingulum toward the antapex for the two series of the hypotheca/hypocyst. The epithecal/epicystal model consists of eight plates that touch the anterior margin of the cingulum (E-series: plates E1-E7, ES), seven plates toward the apex that touch the E-series plates (M-series: R, M1-M6), and up to seven plates near the apex that do not touch E-series plates (D-series: Dp-Dv). The hypothecal/hypocystal model consists of eight plates that touch the posterior margin of the cingulum (H-series: H1-H6,HR,HS) and three plates toward the antapex (T1-T3). Epithecal/epicystal tabulation patterns come in both 8- and 7- models, corresponding to eight and seven plates, respectively, in the E-series. Hypothecal/hypocystal tabulation patterns also come in both 8- and 7-models, corresponding to eight and seven plates, respectively, in the H-series. By convention, the 7-model epitheca/epicyst has no plates E1 and M1; the 7-model hypotheca/hypocyst has no plate H6. Within an 8-model or 7-model, the system emphasizes plates that are presumed to be homologous by giving them identical labels. I introduce the adjectives "monothigmate", "dithigmate," and "trithigmate" to designate plates touching one, two, and three plates, respectively, of the adjacent series. The term "thigmation" applies to the analysis of plate contacts between plate series as a guide to interpretation. Application of the proposed plate labelling system involves: (1) locating the cingulum and identifying the plate series, (2) identifying the landmark plates within each series, (3) assigning appropriate plate numbers to plates in the E- and H-series, (4) assigning appropriate plate numbers to the remaining plates using thigmation and interactions of diagonally opposite pairs of plates (quartets) as guides to interpretation. A "typical" gonyaulacoid tabulation pattern combines a 7-model epitheca/epicyst and an 8-model hypotheca/hypocyst. A "typical" peridinioid tabulation pattern combines an 8-model epitheca/epicyst and a 7-model hypotheca/hypocyst. The group that is presently termed partiform gonyaulacoid (which includes the modern genus Cladopyxis Stein and the fossil Microdinium Cookson and Eisenack) has an 8-model epitheca/epicyst and an 8-model hypotheca/hypocyst. ?? 1990.

Pattern Recognition of the Multiple Sclerosis Syndrome

PubMed Central

Stewart, Renee; Healey, Kathleen M.

2017-01-01

During recent decades, the autoimmune disease neuromyelitis optica spectrum disorder (NMOSD), once broadly classified under the umbrella of multiple sclerosis (MS), has been extended to include autoimmune inflammatory conditions of the central nervous system (CNS), which are now diagnosable with serum serological tests. These antibody-mediated inflammatory diseases of the CNS share a clinical presentation to MS. A number of practical learning points emerge in this review, which is geared toward the pattern recognition of optic neuritis, transverse myelitis, brainstem/cerebellar and hemispheric tumefactive demyelinating lesion (TDL)-associated MS, aquaporin-4-antibody and myelin oligodendrocyte glycoprotein (MOG)-antibody NMOSD, overlap syndrome, and some yet-to-be-defined/classified demyelinating disease, all unspecifically labeled under MS syndrome. The goal of this review is to increase clinicians’ awareness of the clinical nuances of the autoimmune conditions for MS and NMSOD, and to highlight highly suggestive patterns of clinical, paraclinical or imaging presentations in order to improve differentiation. With overlay in clinical manifestations between MS and NMOSD, magnetic resonance imaging (MRI) of the brain, orbits and spinal cord, serology, and most importantly, high index of suspicion based on pattern recognition, will help lead to the final diagnosis. PMID:29064441

Label-free detection and identification of waterborne parasites using a microfluidic multi-angle laser scattering system

NASA Astrophysics Data System (ADS)

Huang, Wei; Yang, Limei; Lei, Lei; Li, Feng

2017-10-01

A microfluidic-based multi-angle laser scattering (MALS) system capable of acquiring scattering patterns of a single particle is designed and demonstrated. The system includes a sheathless nozzle microfluidic glass chip, and an on-chip MALS unit being in alignment with the nozzle exit in the chip. The size and relative refractive indices (RI) of polystyrene (PS) microspheres were deduced with accuracies of 60 nm and 0.002 by comparing the experimental scattering patterns with theoretical ones. We measured scattering patterns of waterborne parasites i.e., Cryptosporidium parvum (C.parvum) and Giardia lamblia (G. lamblia), and some other representative species suspended in deionized water at a maximum flow rate of 12 μL/min, and a maximum of 3000 waterborne parasites can be identified within one minute with a mean accuracy higher than 96% by classification of distinctive scattering patterns using a support-vector-machine (SVM) algorithm. The system provides a promising tool for label-free detection of waterborne parasites and other biological contaminants.

EFFECT OF RAPID SHALLOW BREATHING ON THE DISTRIBUTION OF 18-O-LABELED OZONE REACTION PRODUCT IN THE RESPIRATORY TRACT OF THE RAT

EPA Science Inventory

We examined the effect of breathing pattern on ozone reaction product content within the respiratory tract. Thirty-four anesthetized, maleWistar rats were exposed to oxygen-18 (18O)-labeled ozone at 1.0 ppm for 2 h using a dual-chamber, negative-pressure ventilation system. Fre...

Psychosocial Functioning of Bullied Youth Who Adopt versus Deny the Bully-Victim Label

ERIC Educational Resources Information Center

Sharkey, Jill D.; Ruderman, Matthew A.; Mayworm, Ashley M.; Green, Jennifer Greif; Furlong, Michael J.; Rivera, Nelly; Purisch, Lindsey

2015-01-01

This study addressed a need for research on the association between adopting or denying the label of bully victim and students' psychosocial functioning. Participants were 1,063 students in Grades 5, 7, and 9 in a school district in the northeastern United States. Students were grouped based on their pattern of responses to (a) the California…

On-target labeling of intracellular metabolites combined with chemical mapping of individual hyphae revealing cytoplasmic relocation of isotopologues.

PubMed

Hu, Jie-Bi; Chen, Yu-Chie; Urban, Pawel L

2012-06-05

A microscale analytical platform integrating microbial cell culture, isotopic labeling, along with visual and mass spectrometric imaging with single-cell resolution has been developed and applied in the monitoring of cellular metabolism in fungal mycelium. The method implements open chips with a two-dimensional surface pattern composed of hydrophobic and hydrophilic zones. Two hydrophilic islands are used as medium reservoirs, while the hydrophobic area constitutes the support for the growing aerial hyphae, which do not have direct contact with the medium. The first island, containing (12)C(6)-glucose medium, was initially inoculated with the mycelium (Neurospora crassa), and following the initial incubation period, the hyphae progressed toward the second medium island, containing an isotopically labeled substrate ((13)C(6)-glucose). The (13)C atoms were gradually incorporated into cellular metabolites, which was revealed by MALDI-MS. The fate of the chitin-biosynthesis precursor, uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), was monitored by recording mass spectra with characteristic isotopic patterns, which indicated the presence of various (12)C/(13)C isotopologues. The method enabled mapping the (13)C-labeled UDP-GlcNAc in fungal mycelium and recording its redistribution in hyphae, directly on the chip.

Fluorophore labeling of a cell-penetrating peptide induces differential effects on its cellular distribution and affects cell viability.

PubMed

Birch, Ditlev; Christensen, Malene Vinther; Staerk, Dan; Franzyk, Henrik; Nielsen, Hanne Mørck

2017-12-01

Cell-penetrating peptides constitute efficient delivery vectors, and studies of their uptake and mechanism of translocation typically involve fluorophore-labeled conjugates. In the present study, the influence of a number of specific fluorophores on the physico-chemical properties and uptake-related characteristics of penetratin were studied. An array of seven fluorophores belonging to distinct structural classes was examined, and the impact of fluorophore labeling on intracellular distribution and cytotoxicity was correlated to the physico-chemical properties of the conjugates. Exposure of several mammalian cell types to fluorophore-penetratin conjugates revealed a strong structure-dependent reduction in viability (1.5- to 20-fold lower IC 50 values as compared to those of non-labeled penetratin). Also, the degree of less severe effects on membrane integrity, as well as intracellular distribution patterns differed among the conjugates. Overall, neutral hydrophobic fluorophores or negatively charged fluorophores conferred less cytotoxicity as compared to the effect exerted by positively charged, hydrophobic fluorophores. The latter conjugates, however, exhibited less membrane association and more clearly defined intracellular distribution patterns. Thus, selection of the appropriate flurophore is critical. Copyright © 2017 Elsevier B.V. All rights reserved.

A Bio-Inspired, Motion-Based Analysis of Crowd Behavior Attributes Relevance to Motion Transparency, Velocity Gradients, and Motion Patterns

PubMed Central

Raudies, Florian; Neumann, Heiko

2012-01-01

The analysis of motion crowds is concerned with the detection of potential hazards for individuals of the crowd. Existing methods analyze the statistics of pixel motion to classify non-dangerous or dangerous behavior, to detect outlier motions, or to estimate the mean throughput of people for an image region. We suggest a biologically inspired model for the analysis of motion crowds that extracts motion features indicative for potential dangers in crowd behavior. Our model consists of stages for motion detection, integration, and pattern detection that model functions of the primate primary visual cortex area (V1), the middle temporal area (MT), and the medial superior temporal area (MST), respectively. This model allows for the processing of motion transparency, the appearance of multiple motions in the same visual region, in addition to processing opaque motion. We suggest that motion transparency helps to identify “danger zones” in motion crowds. For instance, motion transparency occurs in small exit passages during evacuation. However, motion transparency occurs also for non-dangerous crowd behavior when people move in opposite directions organized into separate lanes. Our analysis suggests: The combination of motion transparency and a slow motion speed can be used for labeling of candidate regions that contain dangerous behavior. In addition, locally detected decelerations or negative speed gradients of motions are a precursor of danger in crowd behavior as are globally detected motion patterns that show a contraction toward a single point. In sum, motion transparency, image speeds, motion patterns, and speed gradients extracted from visual motion in videos are important features to describe the behavioral state of a motion crowd. PMID:23300930

Patterns of cell death in the embryonic antenna of the grasshopper Schistocerca gregaria.

PubMed

Boyan, George; Graf, Philip; Ehrhardt, Erica

2018-03-01

We have investigated the pattern of apoptosis in the antennal epithelium during embryonic development of the grasshopper Schistocerca gregaria. The molecular labels lachesin and annulin reveal that the antennal epithelium becomes subdivided into segment-like meristal annuli within which sensory cell clusters later differentiate. To determine whether apoptosis is involved in the development of such sensory cell clusters, we examined the expression pattern of the cell death labels acridine orange and TUNEL in the epithelium. We found stereotypic, age-dependent, wave-like patterns of cell death in the antenna. Early in embryogenesis, apoptosis is restricted to the most basal meristal annuli but subsequently spreads to encompass almost the entire antenna. Cell death then declines in more basal annuli and is only found in the tip region later in embryogenesis. Apoptosis is restricted throughout to the midregion of a given annulus and away from its border with neighboring annuli, arguing against a causal role in annular formation. Double-labeling for cell death and sensory cell differentiation reveals apoptosis occurring within bands of differentiating sensory cell clusters, matching the meristal organization of the apical antenna. Examination of the individual epithelial lineages which generate sensory cells reveals that apoptosis begins peripherally within a lineage and with age expands to encompass the differentiated sensory cell at the base. We conclude that complete lineages can undergo apoptosis and that the youngest cells in these lineages appear to die first, with the sensory neuron dying last. Lineage-based death in combination with cell death patterns in different regions of the antenna may contribute to odor-mediated behaviors in the grasshopper.

Semantic Similarity of Labels and Inductive Generalization: Taking a Second Look

ERIC Educational Resources Information Center

Fisher, Anna V.; Matlen, Bryan J.; Godwin, Karrie E.

2011-01-01

Prior research suggests that preschoolers can generalize object properties based on category information conveyed by semantically-similar labels. However, previous research did not control for co-occurrence probability of labels in natural speech. The current studies re-assessed children's generalization with semantically-similar labels.…

Cigarette pack warning labels in Russia: how graphic should they be?

PubMed

Wade, Benjamin; Merrill, Ray M; Lindsay, Gordon B

2011-06-01

Tobacco warning labels on cigarette packs have been shown to reduce cigarette consumption. The current study measures the Russian population's acceptance and preference of graphic (picture + text) tobacco warning labels. Nationally representative data were collected from 1778 participants in the Russian Federation in October 2009. A cross-sectional survey was conducted through person-to-person household interviews with respondents aged ≥ 14 years. Survey questions included standard demographic queries and three study-specific questions. Participants rated the strength of 13 cigarette warning labels according to their effectiveness to deter from smoking. Smoking status and the population's acceptance of similar warning labels was also measured. A dose-response pattern is apparent between the degree of graphic content of cigarette warning labels and the public's perception regarding the warning label's ability to discourage smoking. Approximately 87% of all respondents thought Russian authorities should require tobacco manufacturers to place graphic warning labels on cigarette packs, while 80% of current smokers wanted their government to enact such enforcement. The Russian population would strongly support government policy that would require graphic warning labels to be placed on cigarette packs in their country. In order to best deter from smoking, future cigarette warning labels in Russia should be as graphic as possible.

Regional differences in lectin binding patterns of vestibular hair cells

NASA Technical Reports Server (NTRS)

Baird, Richard A.; Schuff, N. R.; Bancroft, J.

1994-01-01

Surface glycoconjugates of hair cells and supporting cells in the vestibular endorgans of the bullfrog were identified using biotinylated lectins with different carbohydrate specificities. Lectin binding in hair cells was consistent with the presence of glucose and mannose (CON A), galactose (RCA-I), N-acetylgalactosamine (VVA), but not fucose (UEA-I) residues. Hair cells in the bullfrog sacculus, unlike those in the utriculus and semicircular canals, did not stain for N-acetylglucosamine (WGA) or N-acetylgalactosamine (VVA). By contrast, WGA and, to a lesser extent, VVA, differentially stained utricular and semicircular canal hair cells, labeling hair cells located in peripheral, but not central, regions. In mammals, WGA uniformly labeled Type 1 hair cells while labeling, as in the bullfrog, Type 2 hair cells only in peripheral regions. These regional variations were retained after enzymatic digestion. We conclude that vestibular hair cells differ in their surface glycoconjugates and that differences in lectin binding patterns can be used to identify hair cell types and to infer the epithelial origin of isolated vestibular hair cells.

Artificial Neural Networks for Processing Graphs with Application to Image Understanding: A Survey

NASA Astrophysics Data System (ADS)

Bianchini, Monica; Scarselli, Franco

In graphical pattern recognition, each data is represented as an arrangement of elements, that encodes both the properties of each element and the relations among them. Hence, patterns are modelled as labelled graphs where, in general, labels can be attached to both nodes and edges. Artificial neural networks able to process graphs are a powerful tool for addressing a great variety of real-world problems, where the information is naturally organized in entities and relationships among entities and, in fact, they have been widely used in computer vision, f.i. in logo recognition, in similarity retrieval, and for object detection. In this chapter, we propose a survey of neural network models able to process structured information, with a particular focus on those architectures tailored to address image understanding applications. Starting from the original recursive model (RNNs), we subsequently present different ways to represent images - by trees, forests of trees, multiresolution trees, directed acyclic graphs with labelled edges, general graphs - and, correspondingly, neural network architectures appropriate to process such structures.

Identification of Biomarkers Associated with the Healing of Chronic Wounds

DTIC Science & Technology

2015-11-01

The analysis of the wound fluid began with a broad survey tool Kinex™ Antibody Microarray (KAM) a single dye , non-competitive sample binding...signaling proteins. Lysate protein from each sample was covalently labeled with a fluorescent dye combination. Free dye molecules were then...patterned structures is controlled by varying their pattern geometry. The biodegradation of micro-patterned structures is modeled geometrically based on

Food and Beverage Selection Patterns among Menu Label Users and Nonusers: Results from a Cross-Sectional Study.

PubMed

Gruner, Jessie; Ohri-Vachaspati, Punam

2017-06-01

By May 5, 2017, restaurants with 20 or more locations nationwide will be required to post calorie information on menus and menu boards. Previous research shows that those who use menu labels purchase fewer calories, but how users are saving calories is unknown. To assess food and beverage selection patterns among menu label users and nonusers. Secondary, cross-sectional analysis using data from a study examining sociodemographic disparities in menu label usage at a national fast-food restaurant chain. Participants were recruited outside restaurant locations, using street-intercept survey methodology. Consenting customers submitted receipts and completed a brief oral survey. Receipt data were used to categorize food and beverage purchases. Side, beverage, and entrée purchases. Sides and beverages were classified as healthier and less-healthy options consistent with the 2015 Dietary Guidelines for Americans. Healthier options contained items promoted in the guidelines, such as whole fruits, vegetables, low-fat dairy, and 100% fruit juice; less-healthy options contained solid fat or added sugar. Entrées were categorized as lower-, medium-, and higher-calorie options, based on quartile cutoffs. Multinomial logistic regression models were used to estimate prevalence ratios (PRs) for purchases among menu label users and nonusers, controlling for sociodemographic characteristics and total price paid. Healthier sides were selected by 7.5% of users vs 2.5% of nonusers; healthier beverages were selected by 34.0% of users vs 11.6% of nonusers; and lowest-calorie entrées were selected by 28.3% of users vs 30.1% of nonusers. Compared with nonusers (n=276), users (n=53) had a higher probability of purchasing healthier sides (PR=5.44; P=0.034), and healthier beverages (PR=3.37; P=0.005). No significant differences were seen in the purchasing patterns of entrées. Targeting educational campaigns to side and beverage purchasing behaviors may increase the effectiveness of menu labeling. Copyright © 2017 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

Immunogold detection of glycoprotein antigens in sea urchin embryos.

PubMed

Benson, N C; Benson, S C; Wilt, F

1989-01-01

Four developmental stages of sea urchin embryos were labeled with colloidal gold in an attempt to elucidate the intracellular trafficking patterns within the cells that produce the glycoprotein matrix of the embryonic spicule. The primary mesenchyme cells (PMCs) form a syncytium and secrete an organic matrix on which calcium carbonate is laid down to form an endoskeletal spicule. The organic matrix has been isolated and characterized as glycoprotein consisting of four major bands. Polyclonal antibodies to these glycoproteins were used to label embryos from the mesenchyme blastula, early gastrula, late gastrula, and plutei stages of development. The label is concentrated in the Golgi complex and associated vesicles, in secretory vesicles, and in the organic matrix. The density of the labeling increases as development proceeds.

The Relationship between Distributed Leadership and Teachers' Academic Optimism

ERIC Educational Resources Information Center

Mascall, Blair; Leithwood, Kenneth; Straus, Tiiu; Sacks, Robin

2008-01-01

Purpose: The goal of this study was to examine the relationship between four patterns of distributed leadership and a modified version of a variable Hoy et al. have labeled "teachers' academic optimism." The distributed leadership patterns reflect the extent to which the performance of leadership functions is consciously aligned across…

Histochemistry of nerve fibres double labelled with anti-TRPV2 antibodies and sensory nerve marker AM1-43 in the dental pulp of rat molars.

PubMed

Nishikawa, Sumio

2008-09-01

AM1-43 can label sensory nerve fibres and sensory neurons. Permeation of non-selective cation channels of the nerve cell membrane is suggested to be the mechanism responsible for labelling. To identify these channels, two candidates, TRPV1 and TRPV2 were examined by immunocytochemistry in the dental pulp and trigeminal ganglion of rats injected with AM1-43. A part of AM1-43-labelled nerve fibres was also positive for anti-TRPV2 antibody but negative for anti-TRPV1 antibody in the dental pulp. In the trigeminal ganglion, a part of the neuron showed both bright AM1-43 labelling and anti-TRPV2 immunolabelling, but neurons double labelled with AM1-43 and TRPV1 were rare. These results suggest that TRPV2 channels, but not TRPV1 channels, contribute to the fluorescent labelling of AM1-43 in the dental pulp.

Association of perception of front-of-pack labels with dietary, lifestyle and health characteristics.

PubMed

Méjean, Caroline; Macouillard, Pauline; Péneau, Sandrine; Lassale, Camille; Hercberg, Serge; Castetbon, Katia

2014-01-01

To identify patterns of perception of front-of-pack (FOP) nutrition labels and determine dietary, lifestyle and health profiles related to such patterns. Cross-sectional. 28,952 French adults participating in the web-based Nutrinet-Santé cohort. Perception was measured using indicators of understanding and acceptability for three simple FOP labels ("green tick", the logo of the French Nutrition and Health Program and "simple traffic lights" (STL)), and two detailed FOP formats ("multiple traffic lights" (MTL) and "color range" logo (CR)), placed on ready-to-eat soup packages. Dietary intake data were collected using three web-based 24 h records. Associations of perception patterns with individual characteristics, including diet, lifestyle and health status, were examined using analysis of covariance and logistic regression, adjusted for socio-demographic and economic factors. No clear trend emerged concerning differences in dietary intake between perception groups. Low physical activity and obesity were more frequent in the 'favorable to STL' group (respectively, 20.7% and 10.7%). The 'favorable to MTL' group included the highest percentage of individuals who declared type 2 diabetes (2.2%). Persons with hypertension were proportionally more numerous in the 'favorable to MTL' and the 'favorable to CR logo' groups (respectively, 9.5% and 9.3%). After adjustment for socio-demographic and economic factors, no FOP label stood out as being more suitable than another for reaching populations with poor diet. However, both STL and MTL may be most appropriate for increasing awareness of healthy eating among groups at higher risk of nutrition-related chronic diseases.

Distribution of ELOVL4 in the Developing and Adult Mouse Brain

PubMed Central

Sherry, David M.; Hopiavuori, Blake R.; Stiles, Megan A.; Rahman, Negar S.; Ozan, Kathryn G.; Deak, Ferenc; Agbaga, Martin-Paul; Anderson, Robert E.

2017-01-01

ELOngation of Very Long chain fatty acids (ELOVL)-4 is essential for the synthesis of very long chain-fatty acids (fatty acids with chain lengths ≥ 28 carbons). The functions of ELOVL4 and its very long-chain fatty acid products are poorly understood at present. However, mutations in ELOVL4 cause neurodevelopmental or neurodegenerative diseases that vary according to the mutation and inheritance pattern. Heterozygous inheritance of different ELOVL4 mutations causes Stargardt-like Macular Dystrophy or Spinocerebellar Ataxia type 34. Homozygous inheritance of ELOVL4 mutations causes more severe disease characterized by seizures, intellectual disability, ichthyosis, and premature death. To better understand ELOVL4 and very long chain fatty acid function in the brain, we examined ELOVL4 expression in the mouse brain between embryonic day 18 and postnatal day 60 by immunolabeling using ELOVL4 and other marker antibodies. ELOVL4 was widely expressed in a region- and cell type-specific manner, and was restricted to cell bodies, consistent with its known localization to endoplasmic reticulum. ELOVL4 labeling was most prominent in gray matter, although labeling also was present in some cells located in white matter. ELOVL4 was widely expressed in the developing brain by embryonic day 18 and was especially pronounced in regions underlying the lateral ventricles and other neurogenic regions. The basal ganglia in particular showed intense ELOVL4 labeling at this stage. In the postnatal brain, cerebral cortex, hippocampus, cerebellum, thalamus, hypothalamus, midbrain, pons, and medulla all showed prominent ELOVL4 labeling, although ELOVL4 distribution was not uniform across all cells or subnuclei within these regions. In contrast, the basal ganglia showed little ELOVL4 labeling in the postnatal brain. Double labeling studies showed that ELOVL4 was primarily expressed by neurons, although presumptive oligodendrocytes located in white matter tracts also showed labeling. Little or no ELOVL4 labeling was present in astrocytes or radial glial cells. These findings suggest that ELOVL4 and its very long chain fatty acid products are important in many parts of the brain and that they are particularly associated with neuronal function. Specific roles for ELOVL4 and its products in oligodendrocytes and myelin and in cellular proliferation, especially during development, are possible. PMID:28507511

Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation

NASA Technical Reports Server (NTRS)

Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

1997-01-01

Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

In Vivo Integrity and Biological Fate of Chelator-Free Zirconium-89-Labeled Mesoporous Silica Nanoparticles

PubMed Central

2015-01-01

Traditional chelator-based radio-labeled nanoparticles and positron emission tomography (PET) imaging are playing vital roles in the field of nano-oncology. However, their long-term in vivo integrity and potential mismatch of the biodistribution patterns between nanoparticles and radio-isotopes are two major concerns for this approach. Here, we present a chelator-free zirconium-89 (89Zr, t1/2 = 78.4 h) labeling of mesoporous silica nanoparticle (MSN) with significantly enhanced in vivo long-term (>20 days) stability. Successful radio-labeling and in vivo stability are demonstrated to be highly dependent on both the concentration and location of deprotonated silanol groups (−Si–O–) from two types of silica nanoparticles investigated. This work reports 89Zr-labeled MSN with a detailed labeling mechanism investigation and long-term stability study. With its attractive radio-stability and the simplicity of chelator-free radio-labeling, 89Zr-MSN offers a novel, simple, and accurate way for studying the in vivo long-term fate and PET image-guided drug delivery of MSN in the near future. PMID:26213260

In Vivo Integrity and Biological Fate of Chelator-Free Zirconium-89-Labeled Mesoporous Silica Nanoparticles.

PubMed

Chen, Feng; Goel, Shreya; Valdovinos, Hector F; Luo, Haiming; Hernandez, Reinier; Barnhart, Todd E; Cai, Weibo

2015-08-25

Traditional chelator-based radio-labeled nanoparticles and positron emission tomography (PET) imaging are playing vital roles in the field of nano-oncology. However, their long-term in vivo integrity and potential mismatch of the biodistribution patterns between nanoparticles and radio-isotopes are two major concerns for this approach. Here, we present a chelator-free zirconium-89 ((89)Zr, t1/2 = 78.4 h) labeling of mesoporous silica nanoparticle (MSN) with significantly enhanced in vivo long-term (>20 days) stability. Successful radio-labeling and in vivo stability are demonstrated to be highly dependent on both the concentration and location of deprotonated silanol groups (-Si-O(-)) from two types of silica nanoparticles investigated. This work reports (89)Zr-labeled MSN with a detailed labeling mechanism investigation and long-term stability study. With its attractive radio-stability and the simplicity of chelator-free radio-labeling, (89)Zr-MSN offers a novel, simple, and accurate way for studying the in vivo long-term fate and PET image-guided drug delivery of MSN in the near future.

Memory for product sounds: the effect of sound and label type.

PubMed

Ozcan, Elif; van Egmond, René

2007-11-01

The (mnemonic) interactions between auditory, visual, and the semantic systems have been investigated using structurally complex auditory stimuli (i.e., product sounds). Six types of product sounds (air, alarm, cyclic, impact, liquid, mechanical) that vary in spectral-temporal structure were presented in four label type conditions: self-generated text, text, image, and pictogram. A memory paradigm that incorporated free recall, recognition, and matching tasks was employed. The results for the sound type suggest that the amount of spectral-temporal structure in a sound can be indicative for memory performance. Findings related to label type suggest that 'self' creates a strong bias for the retrieval and the recognition of sounds that were self-labeled; the density and the complexity of the visual information (i.e., pictograms) hinders the memory performance ('visual' overshadowing effect); and image labeling has an additive effect on the recall and matching tasks (dual coding). Thus, the findings suggest that the memory performances for product sounds are task-dependent.

Disclaimer labels on fashion magazine advertisements: effects on social comparison and body dissatisfaction.

PubMed

Tiggemann, Marika; Slater, Amy; Bury, Belinda; Hawkins, Kimberley; Firth, Bonny

2013-01-01

Recent proposals across a number of Western countries have suggested that idealised media images should carry some sort of disclaimer informing readers when these images have been digitally enhanced. The present studies aimed to experimentally investigate the impact on women's body dissatisfaction of the addition of such warning labels to fashion magazine advertisements. Participants were 120 and 114 female undergraduate students in Experiment 1 and Experiment 2 respectively. In both experiments, participants viewed fashion magazine advertisements with either no warning label, a generic warning label, or a specific more detailed warning label. In neither experiment was there a significant effect of type of label. However, state appearance comparison was found to predict change in body dissatisfaction irrespective of condition. Unexpectedly, trait appearance comparison moderated the effect of label on body dissatisfaction, such that for women high on trait appearance comparison, exposure to specific warning labels actually resulted in increased body dissatisfaction. In sum, the present results showed no benefit of warning labels in ameliorating the known negative effect of viewing thin-ideal media images, and even suggested that one form of warning (specific) might be harmful for some individuals. Accordingly, it was concluded that more extensive research is required to guide the most effective use of disclaimer labels. Copyright © 2012 Elsevier Ltd. All rights reserved.

Correlative Light- and Electron Microscopy Using Quantum Dot Nanoparticles.

PubMed

Killingsworth, Murray C; Bobryshev, Yuri V

2016-08-07

A method is described whereby quantum dot (QD) nanoparticles can be used for correlative immunocytochemical studies of human pathology tissue using widefield fluorescence light microscopy and transmission electron microscopy (TEM). To demonstrate the protocol we have immunolabeled ultrathin epoxy sections of human somatostatinoma tumor using a primary antibody to somatostatin, followed by a biotinylated secondary antibody and visualization with streptavidin conjugated 585 nm cadmium-selenium (CdSe) quantum dots (QDs). The sections are mounted on a TEM specimen grid then placed on a glass slide for observation by widefield fluorescence light microscopy. Light microscopy reveals 585 nm QD labeling as bright orange fluorescence forming a granular pattern within the tumor cell cytoplasm. At low to mid-range magnification by light microscopy the labeling pattern can be easily recognized and the level of non-specific or background labeling assessed. This is a critical step for subsequent interpretation of the immunolabeling pattern by TEM and evaluation of the morphological context. The same section is then blotted dry and viewed by TEM. QD probes are seen to be attached to amorphous material contained in individual secretory granules. Images are acquired from the same region of interest (ROI) seen by light microscopy for correlative analysis. Corresponding images from each modality may then be blended to overlay fluorescence data on TEM ultrastructure of the corresponding region.

Ulex Europaeus Agglutinin-1 Is a Reliable Taste Bud Marker for In Situ Hybridization Analyses.

PubMed

Yoshimoto, Joto; Okada, Shinji; Kishi, Mikiya; Misaka, Takumi

2016-03-01

Taste signals are received by taste buds. To better understand the taste reception system, expression patterns of taste-related molecules are determined by in situ hybridization (ISH) analyses at the histological level. Nevertheless, even though ISH is essential for determining mRNA expression, few taste bud markers can be applied together with ISH. Ulex europaeus agglutinin-1 (UEA-1) appears to be a reliable murine taste bud marker based on immunohistochemistry (IHC) analyses. However, there is no evidence as to whether UEA-1 can be used for ISH. Thus, the present study evaluated UEA-1 using various histochemical methods, especially ISH. When lectin staining was performed after ISH procedures, UEA-1 clearly labeled taste cellular membranes and distinctly indicated boundaries between taste buds and the surrounding epithelial cells. Additionally, UEA-1 was determined as a taste bud marker not only when used in single-colored ISH but also when employed with double-labeled ISH or during simultaneous detection using IHC and ISH methods. These results suggest that UEA-1 is a useful marker when conducting analyses based on ISH methods. To clarify UEA-1 staining details, multi-fluorescent IHC (together with UEA-1 staining) was examined, resulting in more than 99% of cells being labeled by UEA-1 and overlapping with KCNQ1-expressing cells. © 2016 The Histochemical Society.

Ulex Europaeus Agglutinin-1 Is a Reliable Taste Bud Marker for In Situ Hybridization Analyses

PubMed Central

Yoshimoto, Joto; Okada, Shinji; Kishi, Mikiya; Misaka, Takumi

2015-01-01

Taste signals are received by taste buds. To better understand the taste reception system, expression patterns of taste-related molecules are determined by in situ hybridization (ISH) analyses at the histological level. Nevertheless, even though ISH is essential for determining mRNA expression, few taste bud markers can be applied together with ISH. Ulex europaeus agglutinin-1 (UEA-1) appears to be a reliable murine taste bud marker based on immunohistochemistry (IHC) analyses. However, there is no evidence as to whether UEA-1 can be used for ISH. Thus, the present study evaluated UEA-1 using various histochemical methods, especially ISH. When lectin staining was performed after ISH procedures, UEA-1 clearly labeled taste cellular membranes and distinctly indicated boundaries between taste buds and the surrounding epithelial cells. Additionally, UEA-1 was determined as a taste bud marker not only when used in single-colored ISH but also when employed with double-labeled ISH or during simultaneous detection using IHC and ISH methods. These results suggest that UEA-1 is a useful marker when conducting analyses based on ISH methods. To clarify UEA-1 staining details, multi-fluorescent IHC (together with UEA-1 staining) was examined, resulting in more than 99% of cells being labeled by UEA-1 and overlapping with KCNQ1-expressing cells. PMID:26718243

Towards a physiological basis for intensive culture of American sycamore, Platanus occidentalis L

DOE Office of Scientific and Technical Information (OSTI.GOV)

McVay, M.E.

1984-01-01

The light environment of forest canopies is complex leading to differentiation in morphological development and alteration of physiological processes that are important for the proper combination of genotype and site factors to maximize final yield. To select leaves and plants of a uniform age plastochron and leaf plastochron indices were developed for American sycamore Platanus occidentalis L. The application of these indices was useful in selecting a population of plants of uniform age and, morphological development, and useful in selecting leaves of uniform age within the zone of leaf development. Labeling studies in which leaves of specific ages were fedmore » /sup 14/CO/sub 2/ indicated that leaves of this species undergo transitions in degree and direction of export. Acropetal export of photosynthates conforms to a phyllotactic sequence, suggesting a relationship between arrangement of vascular bundles and phyllotaxy. Examination of the /sup 14/CO/sub 2/ labeling patterns in source leaves (LPI 2.0) showed rapid incorporation of label into amino acid, sugar, and organic acid chemical pools that can be used to in situ synthesis of proteins, lipids, and other structural components. However as the irradiance regime under which the plants were grown decreased, leaves partitioned more fixed /sup 14/CO/sub 2/ into starch than into the water soluble fraction from which metabolic and structural components as well as a transport species could be synthesized.« less

Augmentation in the treatment of restless legs syndrome with transdermal rotigotine.

PubMed

Beneš, Heike; García-Borreguero, Diego; Ferini-Strambi, Luigi; Schollmayer, Erwin; Fichtner, Andreas; Kohnen, Ralf

2012-06-01

To assess the risk of augmentation under treatment with the transdermally delivered dopamine agonist rotigotine for restless legs syndrome (RLS). Experts in RLS augmentation retrospectively reviewed data from two double-blind, placebo-controlled 6-month trials (745 rotigotine and 214 placebo subjects, NCT00136045 and NCT00135993) and from two open-label 1-year trials (620 rotigotine subjects, NCT00498108 and NCT00263068). All study visits were systematically evaluated applying the Max Planck Institute (MPI) criteria for the diagnosis of both augmentation and clinically relevant augmentation. MPI criteria for augmentation were met on at least one visit by 8.2% of all subjects in the double-blind trials with 12 subjects meeting the criteria for clinically relevant augmentation: 11 under rotigotine (1.5%) and one under placebo treatment. In the open-label trials, 9.7% of all subjects met the MPI criteria for augmentation and 2.9% met the criteria for clinically relevant augmentation. None of the patients treated with rotigotine for up to 1.5 years (double-blind plus open-label trial) discontinued prematurely owing to augmentation. Neither could dose-dependency or a time pattern for clinically relevant augmentation episodes be detected. Our analyses suggest that the risk for clinically relevant augmentation for the duration of up to 18 months of rotigotine treatment is low. Copyright © 2012 Elsevier B.V. All rights reserved.

Heterosexual Men's Ratings of Sexual Attractiveness of Adolescent Girls: A Cross-Cultural Analysis.

PubMed

Bennett, Paul; Lowe, Rob; Petrova, Hristina

2015-11-01

Following an identical procedure to the one we previously reported (O'Donnell, Lowe, Brotherton, & Bennett, 2014), we examined ratings of sexual attraction to photographs of (the same) adolescent girls (Tanner stages 3-4) labelled as either 14-15 years or 16-17 years old, women, and men. Ratings were made by Bulgarian heterosexual men by pressing buttons on a response box which recorded the ratings made and the time in milliseconds taken to respond. Despite the age of sexual consent in Bulgaria being 14 years, the pattern of findings did not differ from those found in the UK, where the age of consent is 16 years. That is, mean ratings of the sexual attractiveness of the girls labelled as younger were lower than those of the (same) girls labelled as older, and those of the women. In addition, correlations revealed significantly longer responding times when younger girls (and men) were rated as more highly sexually attractive. These associations were reversed in response to the photographs of women. We take these findings to indicate an inhibitory effect arising from generalized sexual norms relating to the inappropriateness of sexual attraction to young girls; the greater the attraction, the higher the inhibition. This second replication of our initial findings suggests a robust effect that may be of benefit in exploration of pedophile or sex offender groups.

Extensive cortical rewiring after brain injury.

PubMed

Dancause, Numa; Barbay, Scott; Frost, Shawn B; Plautz, Erik J; Chen, Daofen; Zoubina, Elena V; Stowe, Ann M; Nudo, Randolph J

2005-11-02

Previously, we showed that the ventral premotor cortex (PMv) underwent neurophysiological remodeling after injury to the primary motor cortex (M1). In the present study, we examined cortical connections of PMv after such lesions. The neuroanatomical tract tracer biotinylated dextran amine was injected into the PMv hand area at least 5 months after ischemic injury to the M1 hand area. Comparison of labeling patterns between experimental and control animals demonstrated extensive proliferation of novel PMv terminal fields and the appearance of retrogradely labeled cell bodies within area 1/2 of the primary somatosensory cortex after M1 injury. Furthermore, evidence was found for alterations in the trajectory of PMv intracortical axons near the site of the lesion. The results suggest that M1 injury results in axonal sprouting near the ischemic injury and the establishment of novel connections within a distant target. These results support the hypothesis that, after a cortical injury, such as occurs after stroke, cortical areas distant from the injury undergo major neuroanatomical reorganization. Our results reveal an extraordinary anatomical rewiring capacity in the adult CNS after injury that may potentially play a role in recovery.

The role of health consciousness in predicting attention to health warning messages.

PubMed

Kaskutas, L A; Greenfield, T K

1997-01-01

Guided by information processing theory and the health belief model, this paper considers the relationship between health consciousness among the general population and attention to environmental health warnings about alcohol consumption. Mechanisms of exposure to three dominant types of impersonal alcohol-related health messages in the environment are explored. Cross-sectional survey using telephone interview data. A representative nationwide sample of adults was interviewed in 1993 (n = 1026), with a response rate of 63%. Key variables include exposure to warning labels on alcoholic beverages, to point-of-sale posters, and to advertisements in the media, as well as respondents' alcohol consumption, health problems (indicative of salience of health warnings), and level of health consciousness assessed by items tapping concern with nutrition and seeking information on health topics. In the total sample, over a third had seen a warning label or poster and almost all had seen an advertisement about the risks associated with alcohol consumption in 1993. Survey respondents scored very high on five individual items that make up the health consciousness scale introduced here, with 69% endorsing all items. The scale demonstrated good internal reliability (alpha = .70) and was significantly correlated (p < .01) with not enjoying getting drunk and with usually reading product warning labels, suggesting construct validity. Yet the hypothesized strong relationships between health consciousness and attention to health warnings about drinking were not observed; nor was salience of messages a predictor of recall. Importantly, high proportions of underage drinkers and young adults at elevated risk for drinking problems are reached by container warning label messages. Mechanisms of exposure recall vary based on message source, with "container label recall" associated with heavier drinking, younger age, and purchasing patterns; "poster recall" associated with purchasing and health consciousness; and "advertisement recall" associated with heavy consumption and younger age. These results are contrary to predictions from skeptics of broad-based informational interventions, who argue that only the already-health conscious are attentive to health warnings about the risks of alcohol consumption. These data suggest that the label is reaching intended target audiences, especially younger people, males, and heavier alcohol consumers. Future research in predicting attention to impersonal health warnings in the environment should continue to improve the assessment of constructs such as salience and health consciousness, and should further test the applicability of available theoretical models. Subsequent research should also consider additional measures to tap mechanisms of exposure to impersonal health messages to enable a better understanding of the population that is not being reached by such public health interventions.

Off-Label Prescribing for Children with Migraines in U.S. Ambulatory Care Settings.

PubMed

Lai, L Leanne; Koh, Leroy; Ho, Jane Ai-Chen; Ting, Alexander; Obi, Augustine

2017-03-01

Migraines, Which Affect About 10% Of School-Age Children In The United States, Can Significantly Impair Quality Of Life. Despite Potential Disability, Many Children Do Not Receive Treatment Or Prophylaxis, Since Medications Specifically Approved For Children Are Significantly Less Than For Adults. There Is Also Controversy Surrounding The Apparent Widespread Practice Of Prescribing Off-Label Medications For Children With Migraines. However, Little Research Has Been Done To Identify Physician-Prescribing Patterns Of Migraine Medication For Children. To Investigate The Prevalence And Pattern Of Off-Label Prescribing For Children With Migraines. A Secondary Data Analysis Was Conducted Using The Pooled National Ambulatory Medical Care Survey (Namcs) 2011 And 2012. Patients Aged 17 Years Or Younger With A Migraine Diagnosis Were Included. A Series Of Weighted Descriptive Analyses Were Used To Estimate The Prevalence Of Migraine Drugs Prescribed During Pediatric Office Visits. A Weighted Logistic Regression Was Constructed To Compare The Prescribing Patterns Between Off-Label And Fda-Approved Medications. Analyses Used Sas 9.4 Methodology And Incorporated Sample Weights To Adjust For The Complex Sampling Design Employed By Namcs. Of The 12.9 Million Outpatient Visits With A Migraine Diagnosis That Took Place Between 2010 And 2012, 1.2 Million Were Pediatric Visits. Females Accounted For Nearly Twice The Number Of Migraine Visits Than Males (66% Vs. 34%). Children Aged 12-17 Years Accounted For The Highest Frequency Of Visits (84%), Compared With Those Aged Under 12 Years (16%). 66.7% Of These Pediatric Patients Received At Least 1 Migraine Drug. Of These, Off-Label Medications Were Prescribed 1.5 Times More Than Fda-Approved Medications For Children (60.34% Vs. 39.65%). The Results Of Logistic Regression Showed A Significant Likelihood Of Prescribing Off-Label Medications Based On Physician Specialty, Patient Race, And Reason For Visit. Neurologists (Or = 0.028, P < 0.05) And Pediatricians (Or = 0.095, P < 0.05) Were Less Likely To Prescribe Off-Label Drugs Than General And Family Practitioners. Visits For Preventive Care (Or = 5.8, P < 0.05) And Flare-Ups From Chronic Migraines (Or = 5.0, P < 0.05) Were More Likely To Result In Off-Label Drug Prescriptions Than Visits For New Migraine Incidence. This Study Provides Significant Real-World Evidence Of The Widespread Practice Of Prescribing Off-Label Drugs To Children With Migraines. Although Medical Literature Shows That Off-Label Prescribing May Not Be Harmful, There Is A Dearth Of Research And Practice Guidelines To Help Practitioners Uphold Safety Standards And Ensure The Prescription Of Age-Appropriate Medications To Children. No outside funding supported this study. The authors report no potential conflicts of interest relevant to this research. Lai and Ting contributed to study concept and design and collected the data, along with the other authors. Data interpretation was performed by Lai, Koh, Obi, Ho, and Ting. The manuscript was written and revised by Lai, Koh, and Ho, with assistance from Ting and Obi.

Appearance of acute gouty arthritis on indium-111-labeled leukocyte scintigraphy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palestro, C.J.; Vega, A.; Kim, C.K.

1990-05-01

Indium-111-labeled leukocyte scintigraphy was performed on a 66-yr-old male with polyarticular acute gouty arthritis. Images revealed intense labeled leukocyte accumulation in a pattern indistinguishable from septic arthritis, in both knees and ankles, and the metatarsophalangeal joint of both great toes, all of which were involved in the acute gouty attack. Joint aspirate as well as blood cultures were reported as no growth; the patient was treated with intravenous colchicine and ACTH for 10 days with dramatic improvement noted. Labeled leukocyte imaging, repeated 12 days after the initial study, revealed near total resolution of joint abnormalities, concordant with the patient's clinicalmore » improvement. This case demonstrates that while acute gouty arthritis is a potential pitfall in labeled leukocyte imaging, in the presence of known gout, it may provide a simple, objective, noninvasive method of evaluating patient response to therapy.« less

Phosphatidylglycerol Synthesis in Spinach Chloroplasts: Characterization of the Newly Synthesized Molecule

PubMed Central

Sparace, Salvatore A.; Mudd, J. Brian

1982-01-01

Intact chloroplasts from spinach (Spinacia oleracea L., hybrid 424) readily incorporate [14C]glycerol-3-phosphate and [14C]acetate into diacylglycerol, monoacylglycerol, diacylglycrol, free fatty acids (only when acetate is the precursor), phosphatidic acid, phosphatidylcholine, and most notably phosphatidylglycerol. The fraction of phosphatidylglycerol synthesized is greatly increased by the presence of manganese chloride in the reaction mixture. Glycerol-3-phosphate-labeled phosphatidylglycerol is equally labeled in the two glycerol moieties of the molecule. Acetate-labeled phosphatidylglycerol is equally labeled in both acyl groups. Position one contains primarily oleate, linoleate and small amounts of palmitate. Position two contains primarily palmitate. No radioactive trans-Δ3-hexadecenoate was detected. The labeling patterns indicate that the radioactive phosphatidylglycerol is the product of de novo chloroplast lipid biosynthesis and furthermore, phosphatidylglycerol may be a substrate for fatty acid desaturation. Images Fig. 1 PMID:16662664

Decomposition and nitrogen dynamics of 15N-labeled leaf, root, and twig litter in temperate coniferous forests

USGS Publications Warehouse

van Huysen, Tiff L.; Harmon, Mark E.; Perakis, Steven S.; Chen, Hua

2013-01-01

Litter nutrient dynamics contribute significantly to biogeochemical cycling in forest ecosystems. We examined how site environment and initial substrate quality influence decomposition and nitrogen (N) dynamics of multiple litter types. A 2.5-year decomposition study was installed in the Oregon Coast Range and West Cascades using 15N-labeled litter from Acer macrophyllum, Picea sitchensis, and Pseudotsuga menziesii. Mass loss for leaf litter was similar between the two sites, while root and twig litter exhibited greater mass loss in the Coast Range. Mass loss was greatest from leaves and roots, and species differences in mass loss were more prominent in the Coast Range. All litter types and species mineralized N early in the decomposition process; only A. macrophyllum leaves exhibited a net N immobilization phase. There were no site differences with respect to litter N dynamics despite differences in site N availability, and litter N mineralization patterns were species-specific. For multiple litter × species combinations, the difference between gross and net N mineralization was significant, and gross mineralization was 7–20 % greater than net mineralization. The mineralization results suggest that initial litter chemistry may be an important driver of litter N dynamics. Our study demonstrates that greater amounts of N are cycling through these systems than may be quantified by only measuring net mineralization and challenges current leaf-based biogeochemical theory regarding patterns of N immobilization and mineralization.

Closely related glycosylation patterns of recombinant human IL-2 expressed in a CHO cell line and natural IL-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vita, N.; Magazin, M.; Marchese, E.

We report here the study of the glycosylation pattern of human recombinant (r) IL2 expressed in a Chinese hamster ovary (CHO) cell line. The human rIL2 secreted by this high-producing recombinant CHO cell line was metabolically radiolabelled with (35S)-methionine, or with (3H)-glucosamine and (3H)-galactose, purified to homogeneity, and then characterized. The electrophoretic analysis of the (35S)-methionine-labelled proteins present in the culture medium of the CHO cell line showed that the rIL2 represents approximately 12% of the total secreted proteins. Furthermore, pulse-chase experiments showed that the glycosylated rIL2 is synthesized and secreted within 30 min. The point of attachment and themore » structure of the carbohydrate moiety of the rIL2 was determined by: amino-terminal sequencing and fingerprint analysis of the 3H-labelled rIL2, mass spectroscopy of the amino-terminal tryptic octapeptide, and carbohydrate analysis after enzymatic (Vibrio cholerae neuraminidase and Aspergillus oryzae beta-galactosidase) or sulfuric acid hydrolysis. The results indicate that the recombinant protein possesses a sugar moiety O-linked to the threonine residue at position 3 of the polypeptide chain, and that sialic acid, galactose and N-acetyl galactosamine are components of this carbohydrate moiety. Taken together these results suggest that the recombinant molecule is identical to natural IL2.« less

Comparing cerebral perfusion in Alzheimer's disease and Parkinson's disease dementia: an ASL-MRI study.

PubMed

Le Heron, Campbell J; Wright, Sarah L; Melzer, Tracy R; Myall, Daniel J; MacAskill, Michael R; Livingston, Leslie; Keenan, Ross J; Watts, Richard; Dalrymple-Alford, John C; Anderson, Tim J

2014-06-01

Emerging evidence suggests that Alzheimer's disease (AD) and Parkinson's disease dementia (PDD) share neurodegenerative mechanisms. We sought to directly compare cerebral perfusion in these two conditions using arterial spin labeling magnetic resonance imaging (ASL-MRI). In total, 17 AD, 20 PDD, and 37 matched healthy controls completed ASL and structural MRI, and comprehensive neuropsychological testing. Alzheimer's disease and PDD perfusion was analyzed by whole-brain voxel-based analysis (to assess absolute blood flow), a priori specified region of interest analysis, and principal component analysis (to generate a network differentiating the two groups). Corrections were made for cerebral atrophy, age, sex, education, and MRI scanner software version. Analysis of absolute blood flow showed no significant differences between AD and PDD. Comparing each group with controls revealed an overlapping, posterior pattern of hypoperfusion, including posterior cingulate gyrus, precuneus, and occipital regions. The perfusion network that differentiated AD and PDD groups identified relative differences in medial temporal lobes (AD

Direct assessment of the metabolic origin of carbon atoms in glutamate from illuminated leaves using 13 C-NMR.

PubMed

Abadie, Cyril; Lothier, Jérémy; Boex-Fontvieille, Edouard; Carroll, Adam; Tcherkez, Guillaume

2017-12-01

Glutamate (Glu) is the cornerstone of nitrogen assimilation and photorespiration in illuminated leaves. Despite this crucial role, our knowledge of the flux to Glu de novo synthesis is rather limited. Here, we used isotopic labelling with 13 CO 2 and 13 C-NMR analyses to examine the labelling pattern and the appearance of multi-labelled species of Glu molecules to trace the origin of C-atoms found in Glu. We also compared this with 13 C-labelling patterns in Ala and Asp, which reflect citrate (and thus Glu) precursors, that is, pyruvate and oxaloacetate. Glu appeared to be less 13 C-labelled than Asp and Ala, showing that the Glu pool was mostly formed by 'old' carbon atoms. There were modest differences in intramolecular 13 C- 13 C couplings between Glu C-2 and Asp C-3, showing that oxaloacetate metabolism to Glu biosynthesis did not involve C-atom redistribution by the Krebs cycle. The apparent carbon allocation increased with carbon net photosynthesis. However, when expressed relative to CO 2 fixation, it was clearly higher at low CO 2 while it did not change in 2% O 2 , as compared to standard conditions. We conclude that Glu production from current photosynthetic carbon represents a small flux that is controlled by the gaseous environment, typically upregulated at low CO 2 . © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Do nutrition labels influence healthier food choices? Analysis of label viewing behaviour and subsequent food purchases in a labelling intervention trial.

PubMed

Ni Mhurchu, Cliona; Eyles, Helen; Jiang, Yannan; Blakely, Tony

2018-02-01

There are few objective data on how nutrition labels are used in real-world shopping situations, or how they affect dietary choices and patterns. The Starlight study was a four-week randomised, controlled trial of the effects of three different types of nutrition labels on consumer food purchases: Traffic Light Labels, Health Star Rating labels, or Nutrition Information Panels (control). Smartphone technology allowed participants to scan barcodes of packaged foods and receive randomly allocated labels on their phone screen, and to record their food purchases. The study app therefore provided objectively recorded data on label viewing behaviour and food purchases over a four-week period. A post-hoc analysis of trial data was undertaken to assess frequency of label use, label use by food group, and association between label use and the healthiness of packaged food products purchased. Over the four-week intervention, study participants (n = 1255) viewed nutrition labels for and/or purchased 66,915 barcoded packaged products. Labels were viewed for 23% of all purchased products, with decreasing frequency over time. Shoppers were most likely to view labels for convenience foods, cereals, snack foods, bread and bakery products, and oils. They were least likely to view labels for sugar and honey products, eggs, fish, fruit and vegetables, and meat. Products for which participants viewed the label and subsequently purchased the product during the same shopping episode were significantly healthier than products where labels were viewed but the product was not subsequently purchased: mean difference in nutrient profile score -0.90 (95% CI -1.54 to -0.26). In a secondary analysis of a nutrition labelling intervention trial, there was a significant association between label use and the healthiness of products purchased. Nutrition label use may therefore lead to healthier food purchases. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

The Effect of Labeling on Preschool Children's Performance in the Dimensional Change Card Sort Task

ERIC Educational Resources Information Center

Muller, Ulrich; Zelazo, Philip D.; Lurye, Leah E.; Liebermann, Dana P.

2008-01-01

Previous research suggests that experimenter-induced labeling of test cards improves preschoolers' performance on the Dimensional Change Card Sort Task (DCCS), a measure of flexible rule use. Three experiments attempted to further clarify how labeling aids performance on the DCCS. Experiment 1 examined the nature of the labeling effect but failed…

Single-cell measurement of archaeal and bacterial carbon assimilation in dark Pacific Ocean waters

NASA Astrophysics Data System (ADS)

Dekas, A. E.; Mayali, X.; Parada, A. E.; Fuhrman, J. A.; Weber, P. K.; Pett-Ridge, J.

2016-02-01

Microbial activity in the dark ocean plays a critical role in nutrient and elemental cycling. Here, we investigated the activity of archaea and bacteria on the single-cell level during dark incubations of Pacific Ocean water, and specifically their capacity for chemoautotrophy. Samples were collected 19 km off the coast of Los Angeles, at a depth of 150 m, and off the coast of San Francisco, at the surface. Incubations were amended with isotopically-labeled organic or inorganic carbon (13C-bicarbonate, 15N-amino acids or dual-labeled 13C-15N-amino acids), and uptake was detected using nanoscale secondary ion mass spectrometry (NanoSIMS). We analyzed 4,968 individual cells using an automated NanoSIMS analysis with particle-recognition software. After 7 days, 95% and 89% of cells (deep and shallow, respectively) demonstrated anabolic activity, i.e., incorporation of at least one isotopically-labeled substrate. Chemoautotrophy was detected at both sites, with 36% and 9% of cells (deep and shallow, respectively) assimilating 13C-bicarbonate in the dark. Fluorescence in situ hybridization coupled to NanoSIMS analysis was performed to link 16S rRNA phylogeny to patterns of C-assimilation. Thaumarchaea were found to dominate chemoautotrophy at both sites, with 13C-bicarbonate assimilation in nearly all cells hybridized with the Cren537 probe, but none hybridized with a general bacterial probe (Eub338). Conversely, widespread assimilation of both 15N and 13C from 15N-13C-amino acids was observed in the bacterial assemblage, but not in the Thaumarchaea. Interestingly, Thaumarchaeal cells were enriched in 15N after incubation with 15N-13C-amino acids, but not 13C, suggesting selective N assimilation from amino acids or substrate recycling. Together, our results demonstrate the value of single-cell measurements in characterizing patterns of C metabolism in mixed microbial community, and underscore the importance of Thaumarchaea in marine chemoautotrophy.

Use of Bisphenol A-containing baby bottles in Cameroon and Nigeria and possible risk management and mitigation measures: community as milestone for prevention.

PubMed

Pouokam, Guy Bertrand; Ajaezi, Godwin Chukwuebuka; Mantovani, Alberto; Orisakwe, Orish Ebere; Frazzoli, Chiara

2014-05-15

The plasticizer Bisphenol A (BPA) is banned in baby bottles in many industrialized countries due to safety concerns. We provide a pilot view on the potential BPA exposure of bottle-fed children in sub-Saharan Africa through an enquiry on availability, accessibility and affordability of plastic baby bottles, usage pattern, and risk perception. An observational survey was conducted in a randomized group of vending sites (34 pharmacies; 87 shops and markets), in three cities (Yaoundé, Foumbot, Bafoussam) in Cameroon (two regions), and in two cities (Lagos, Port Harcourt) in Nigeria (two states). Interviews in vending sites and group discussions were conducted with 248 mothers. Cameroon and Nigeria showed a largely comparable situation. Plastic baby bottles are largely imported from industrialized countries, where a label indicates the presence/absence of BPA. In pharmacies most plastic baby bottles are labeled as BPA-free, whereas most bottles sold in shops are not BPA-free. BPA-containing bottles are more accessible and affordable, due to sale in common shops and lower costs. The meaning of the label BPA-free is unknown to both vendors and customers: the BPA issue is also largely unknown to policy makers and media and no regulation exists on food contact materials. The wide availability of BPA-containing baby bottles, lack of information and usage patterns (e.g. temperature and duration of heating) suggest a likely widespread exposure of African infants. Possible usage recommendations to mitigate exposure are indicated. Risk communication to policy makers, sellers and citizens is paramount to raise awareness and to oppose possible dumping from countries where BPA-containing materials are banned. Our pilot study points out relevant global health issues such as the capacity building of African communities on informed choices and usage of baby products, and the exploitation of international knowledge by African scientists and risk managers. Copyright © 2014 Elsevier B.V. All rights reserved.

Glial-released proteins in clonal cultures and their modulation by hydrocortisone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arenander, A.T.; de Vellis, J.

Rat glial C6 cells release into the culture medium a reproducible spectrum of soluble proteins of 12 major peaks over a broad molecular weight range as determined by fractionation on SDS-gel electrophoresis. Exposing C6 monolayers to hydrocortisone (HC) results in a selective alteration in the pattern of glial-released protein (GRP). The selective HC-induced increase or decrease in GRP peaks is specific to HC in that 17 ..beta..-estradiol, dibutyryl cyclic AMP, isoproterenol, and melatonin exert either no detectable or a qualitatively different influence on the GRP pattern. The HC influence is dose dependent over a physiological range of concentrations from 10/supmore » -9/ to 10/sup -6/ M. Differences in culture age and in subclones of C6 can influence both the normal and the HC-induced pattern of GRP. The origin of the GRP is unknown, but pattern reproducibility, viability tests, surface labelling studies, and metabolic labelling studies of soluble and particulate compartment proteins and glycoproteins support the position that cell lysis is not an important source of GRP. More importantly, these studies indicate that GRP and HC-induced changes in GRP pattern are physiologically significant aspects of glial cell behavior.« less

Multivariate analysis of fMRI time series: classification and regression of brain responses using machine learning.

PubMed

Formisano, Elia; De Martino, Federico; Valente, Giancarlo

2008-09-01

Machine learning and pattern recognition techniques are being increasingly employed in functional magnetic resonance imaging (fMRI) data analysis. By taking into account the full spatial pattern of brain activity measured simultaneously at many locations, these methods allow detecting subtle, non-strictly localized effects that may remain invisible to the conventional analysis with univariate statistical methods. In typical fMRI applications, pattern recognition algorithms "learn" a functional relationship between brain response patterns and a perceptual, cognitive or behavioral state of a subject expressed in terms of a label, which may assume discrete (classification) or continuous (regression) values. This learned functional relationship is then used to predict the unseen labels from a new data set ("brain reading"). In this article, we describe the mathematical foundations of machine learning applications in fMRI. We focus on two methods, support vector machines and relevance vector machines, which are respectively suited for the classification and regression of fMRI patterns. Furthermore, by means of several examples and applications, we illustrate and discuss the methodological challenges of using machine learning algorithms in the context of fMRI data analysis.

Category labels versus feature labels: category labels polarize inferential predictions.

PubMed

Yamauchi, Takashi; Yu, Na-Yung

2008-04-01

What makes category labels different from feature labels in predictive inference? This study suggests that category labels tend to make inductive reasoning polarized and homogeneous. In two experiments, participants were shown two schematic pictures of insects side by side and predicted the value of a hidden feature of one insect on the basis of the other insect. Arbitrary verbal labels were shown above the two pictures, and the meanings of the labels were manipulated in the instructions. In one condition, the labels represented the category membership of the insects, and in the other conditions, the same labels represented attributes of the insects. When the labels represented category membership, participants' responses became substantially polarized and homogeneous, indicating that the mere reference to category membership can modify reasoning processes.

Semi-automatic ground truth generation using unsupervised clustering and limited manual labeling: Application to handwritten character recognition

PubMed Central

Vajda, Szilárd; Rangoni, Yves; Cecotti, Hubert

2015-01-01

For training supervised classifiers to recognize different patterns, large data collections with accurate labels are necessary. In this paper, we propose a generic, semi-automatic labeling technique for large handwritten character collections. In order to speed up the creation of a large scale ground truth, the method combines unsupervised clustering and minimal expert knowledge. To exploit the potential discriminant complementarities across features, each character is projected into five different feature spaces. After clustering the images in each feature space, the human expert labels the cluster centers. Each data point inherits the label of its cluster’s center. A majority (or unanimity) vote decides the label of each character image. The amount of human involvement (labeling) is strictly controlled by the number of clusters – produced by the chosen clustering approach. To test the efficiency of the proposed approach, we have compared, and evaluated three state-of-the art clustering methods (k-means, self-organizing maps, and growing neural gas) on the MNIST digit data set, and a Lampung Indonesian character data set, respectively. Considering a k-nn classifier, we show that labeling manually only 1.3% (MNIST), and 3.2% (Lampung) of the training data, provides the same range of performance than a completely labeled data set would. PMID:25870463

Science Majors and Degrees among Asian-American Students: Influences of Race and Sex in "model Minority" Experiences

NASA Astrophysics Data System (ADS)

Meng, Yu; Hanson, Sandra L.

Both race and sex continue to be factors that stratify entry into science education and occupations in the United States. Asian-Americans (men and women) have experienced considerable success in the sciences and have earned the label of "model minority." The complexities and patterns involved in this success remain elusive. We use several concepts coming out of the status attainment framework and a multicultural gender perspective to explore the way in which race and sex come together to influence choices of science major and degree. Our sample consists of Asian-American and white students in the National Educational Longitudinal Study. Findings suggest that being male and being Asian-American are both associated with higher chances of pursuing majors and degrees in science. The male advantage is greater than the Asian-American advantage. Findings also suggest that race and sex interact in the science decision. For example, race differences (with an Asian-American advantage) in choice of science major are significant for women but not men. Sex differences (with a male advantage) in choice of science major are significant in the white, but not the Asian-American sample. A different set of race and sex patterns is revealed in the science degree models. Processes associated with family socioeconomic status and student characteristics help to explain race and sex patterns. Findings suggest that when Asian-American youths have closer ties to the Asian culture, they are more likely to choose science majors and degrees. Implications for policy, practice, and research in science education are discussed.

Energy and traffic light labelling have no impact on parent and child fast food selection.

PubMed

Dodds, Pennie; Wolfenden, Luke; Chapman, Kathy; Wellard, Lyndal; Hughes, Clare; Wiggers, John

2013-10-25

Labelling of food from fast food restaurants at point-of-purchase has been suggested as one strategy to reduce population energy consumption and contribute to reductions in obesity prevalence. The aim of this study was to examine the effects of energy and single traffic light labelling systems on the energy content of child and adult intended food purchases. The study employed a randomised controlled trial design. English speaking parents of children aged between three and 12 years were recruited from an existing research cohort. Participants were mailed one of three hypothetical fast food menus. Menus differed in their labelling technique- either energy labels, single traffic light labels, or a no-label control. Participants then completed a telephone survey which assessed intended food purchases for both adult and child. The primary trial outcome was total energy of intended food purchase. A total of 329 participants completed the follow-up telephone interview. Eighty-two percent of the energy labelling group and 96% of the single traffic light labelling group reported noticing labelling information on their menu. There were no significant differences in total energy of intended purchases of parents, or intended purchases made by parents for children, between the menu labelling groups, or between menu labelling groups by socio-demographic subgroups. This study provided no evidence to suggest that energy labelling or single traffic light labelling alone were effective in reducing the energy of fast food items selected from hypothetical fast food menus for purchase. Additional complementary public health initiatives promoting the consumption of healthier foods identified by labelling, and which target other key drivers of menu item selection in this setting may be required. Copyright © 2013. Published by Elsevier Ltd.

The effect of energy and traffic light labelling on parent and child fast food selection: a randomised controlled trial.

PubMed

Dodds, Pennie; Wolfenden, Luke; Chapman, Kathy; Wellard, Lyndal; Hughes, Clare; Wiggers, John

2014-02-01

Labelling of food from fast food restaurants at point-of-purchase has been suggested as one strategy to reduce population energy consumption and contribute to reductions in obesity prevalence. The aim of this study was to examine the effects of energy and single traffic light labelling systems on the energy content of child and adult intended food purchases. The study employed a randomised controlled trial design. English speaking parents of children aged between three and 12 years were recruited from an existing research cohort. Participants were mailed one of three hypothetical fast food menus. Menus differed in their labelling technique – either energy labels, single traffic light labels, or a no-label control. Participants then completed a telephone survey which assessed intended food purchases for both adult and child. The primary trial outcome was total energy of intended food purchase. A total of 329 participants completed the follow-up telephone interview. Eighty-two percent of the energy labelling group and 96% of the single traffic light labelling group reported noticing labelling information on their menu. There were no significant differences in total energy of intended purchases of parents, or intended purchases made by parents for children, between the menu labelling groups, or between menu labelling groups by socio-demographic subgroups. This study provided no evidence to suggest that energy labelling or single traffic light labelling alone were effective in reducing the energy of fast food items selected from hypothetical fast food menus for purchase. Additional complementary public health initiatives promoting the consumption of healthier foods identified by labelling, and which target other key drivers of menu item selection in this setting may be required.

Sexually Dimorphic Patterns of Cell Proliferation in the Brain Are Linked to Seasonal Life-History Transitions in Red-Sided Garter Snakes.

PubMed

Lutterschmidt, Deborah I; Lucas, Ashley R; Karam, Ritta A; Nguyen, Vicky T; Rasmussen, Meghann R

2018-01-01

Seasonal rhythms in physiology and behavior are widespread across diverse taxonomic groups and may be mediated by seasonal changes in neurogenesis, including cell proliferation, migration, and differentiation. We examined if cell proliferation in the brain is associated with the seasonal life-history transition from spring breeding to migration and summer foraging in a free-ranging population of red-sided garter snakes ( Thamnophis sirtalis ) in Manitoba, Canada. We used the thymidine analog 5-bromo-2'-deoxyuridine (BrdU) to label newly proliferated cells within the brain of adult snakes collected from the den during the mating season or from a road located along their migratory route. To assess rates of cell migration, we further categorized BrdU-labeled cells according to their location within the ventricular zone or parenchymal region of the nucleus sphericus (homolog of the amygdala), preoptic area/hypothalamus, septal nucleus, and cortex (homolog of the hippocampus). We found that cell proliferation and cell migration varied significantly with sex, the migratory status of snakes, and reproductive behavior in males. In most regions of interest, patterns of cell proliferation were sexually dimorphic, with males having significantly more BrdU-labeled cells than females prior to migration. However, during the initial stages of migration, females exhibited a significant increase in cell proliferation within the nucleus sphericus, hypothalamus, and septal nucleus, but not in any subregion of the cortex. In contrast, migrating males exhibited a significant increase in cell proliferation within the medial cortex but no other brain region. Because it is unlikely that the medial cortex plays a sexually dimorphic role in spatial memory during spring migration, we speculate that cell proliferation within the male medial cortex is associated with regulation of the hypothalamus-pituitary-adrenal axis. Finally, the only brain region where cell migration into the parenchymal region varied significantly with sex or migratory status was the hypothalamus. These results suggest that the migration of newly proliferated cells and/or the continued division of undifferentiated cells are activated earlier or to a greater extent in the hypothalamus. Our data suggest that sexually dimorphic changes in cell proliferation and cell migration in the adult brain may mediate sex differences in the timing of seasonal life-history transitions.

Sexually Dimorphic Patterns of Cell Proliferation in the Brain Are Linked to Seasonal Life-History Transitions in Red-Sided Garter Snakes

PubMed Central

Lutterschmidt, Deborah I.; Lucas, Ashley R.; Karam, Ritta A.; Nguyen, Vicky T.; Rasmussen, Meghann R.

2018-01-01

Seasonal rhythms in physiology and behavior are widespread across diverse taxonomic groups and may be mediated by seasonal changes in neurogenesis, including cell proliferation, migration, and differentiation. We examined if cell proliferation in the brain is associated with the seasonal life-history transition from spring breeding to migration and summer foraging in a free-ranging population of red-sided garter snakes (Thamnophis sirtalis) in Manitoba, Canada. We used the thymidine analog 5-bromo-2′-deoxyuridine (BrdU) to label newly proliferated cells within the brain of adult snakes collected from the den during the mating season or from a road located along their migratory route. To assess rates of cell migration, we further categorized BrdU-labeled cells according to their location within the ventricular zone or parenchymal region of the nucleus sphericus (homolog of the amygdala), preoptic area/hypothalamus, septal nucleus, and cortex (homolog of the hippocampus). We found that cell proliferation and cell migration varied significantly with sex, the migratory status of snakes, and reproductive behavior in males. In most regions of interest, patterns of cell proliferation were sexually dimorphic, with males having significantly more BrdU-labeled cells than females prior to migration. However, during the initial stages of migration, females exhibited a significant increase in cell proliferation within the nucleus sphericus, hypothalamus, and septal nucleus, but not in any subregion of the cortex. In contrast, migrating males exhibited a significant increase in cell proliferation within the medial cortex but no other brain region. Because it is unlikely that the medial cortex plays a sexually dimorphic role in spatial memory during spring migration, we speculate that cell proliferation within the male medial cortex is associated with regulation of the hypothalamus-pituitary-adrenal axis. Finally, the only brain region where cell migration into the parenchymal region varied significantly with sex or migratory status was the hypothalamus. These results suggest that the migration of newly proliferated cells and/or the continued division of undifferentiated cells are activated earlier or to a greater extent in the hypothalamus. Our data suggest that sexually dimorphic changes in cell proliferation and cell migration in the adult brain may mediate sex differences in the timing of seasonal life-history transitions.

Clinicopathologic Association and Prognostic Value of Microcystic, Elongated, and Fragmented (MELF) Pattern in Endometrial Endometrioid Carcinoma.

PubMed

Kihara, Atsushi; Yoshida, Hiroshi; Watanabe, Reiko; Takahashi, Kenta; Kato, Tomoyasu; Ino, Yoshinori; Kitagawa, Masanobu; Hiraoka, Nobuyoshi

2017-07-01

Microcystic, elongated, and fragmented (MELF) pattern is seen in the invasive front of some endometrial endometrioid carcinomas. Although MELF pattern can be expected as an indicator of patient outcomes, its prognostic significance remains unclear. This study was conducted to elucidate clinicopathologic features and the prognostic impact of MELF pattern in patients with endometrial endometrioid carcinoma. We retrospectively analyzed data of 479 consecutive patients with endometrial endometrioid carcinoma that had been surgically resected. In 45 of 427 patients (11%) with low-grade endometrioid carcinoma, MELF pattern was found, but it was found in none of the 52 patients with high-grade endometrioid carcinoma. Among the patients with low-grade endometrioid carcinoma, MELF pattern was associated significantly with larger tumor size, myometrial invasion of more than 50%, advanced International Federation of Gynecology and Obstetrics stages, lymphovascular space invasion, lymph node metastasis, papillary architecture, and mucinous differentiation. However, survival analysis revealed that the patients with MELF pattern showed no significantly worse prognosis than those without MELF pattern either in disease-specific survival or in recurrence-free survival. MELF was not a significant prognosticator after adjustment for International Federation of Gynecology and Obstetrics stage (disease-specific survival [hazard ratio, 1.47; 95% confidence interval, 0.28-7.67; P=0.64], recurrence-free survival [hazard ratio, 0.98, 95% confidence interval, 0.32-2.99, P=0.98]). Immunohistochemical analysis revealed that MELF pattern was positive for p16 and p21 and almost negative for Ki-67 labeling, which suggested that tumor cells in MELF pattern were involved in growth arrest or cellular senescence. We conclude that MELF pattern could have little impact on outcomes of patients with low-grade endometrial endometrioid carcinoma.

Off-label use of recombinant factor VIIa in U.S. hospitals: analysis of hospital records.

PubMed

Logan, Aaron C; Yank, Veronica; Stafford, Randall S

2011-04-19

Recombinant factor VIIa (rFVIIa) is approved for treatment of bleeding in patients who have hemophilia with inhibitors but has been applied to a wide range of off-label indications. To estimate patterns of off-label rFVIIa use in U.S. hospitals. Retrospective database analysis. Data were extracted from the Premier Perspectives database (Premier, Charlotte, North Carolina), which contains discharge records from a sample of academic and nonacademic U.S. hospitals. 12 644 hospitalizations for patients who received rFVIIa during a hospital stay. Hospital diagnoses and patient dispositions from 1 January 2000 to 31 December 2008. Statistical weights for each hospital were used to provide national estimates of rFVIIa use. From 2000 to 2008, off-label use of rFVIIa in hospitals increased more than 140-fold, such that in 2008, 97% (95% CI, 96% to 98%) of 18 311 in-hospital uses were off-label. In contrast, in-hospital use for hemophilia increased less than 4-fold and accounted for 2.7% (CI, 1.9% to 3.5%) of use in 2008. Adult and pediatric cardiovascular surgery (29% [CI, 21% to 33%]), body and brain trauma (29% [CI, 19% to 38%]), and intracranial hemorrhage (11% [CI, 7.7% to 14%]) were the most common indications for rFVIIa use. Across all indications, in-hospital mortality was 27% (CI, 19% to 34%) and 43% (CI, 26% to 59%) of patients were discharged to home. Accuracy and completeness of the discharge diagnoses and patient medication records in the database sample cannot be verified. Off-label use of rFVIIa in the hospital setting far exceeds use for approved indications. These patterns raise concern about the application of rFVIIa to conditions for which strong supporting evidence is lacking.

Studies on the biosynthesis of taxol: the taxane carbon skeleton is not of mevalonoid origin.

PubMed Central

Eisenreich, W; Menhard, B; Hylands, P J; Zenk, M H; Bacher, A

1996-01-01

A cell culture of Taxus chinensis was established to produce the diterpene 2alpha,5alpha,10beta,14beta-tetra-acetoxy4 ++ +(20),11-taxadiene (taxuyunnanine C) in 2.6% (dry weight) yield. The incorporation of [U-13C6]glucose, [1-13C]glucose, and [1,2-13C2]acetate into this diterpene was analyzed by NMR spectroscopy. Label from [1,2-13C2]acetate was diverted to the four acetyl groups of taxuyunnanine C, but not to the taxane ring system. Label from [1-13C]glucose and [U-13C6]glucose was efficiently incorporated into both the taxane ring system and the acetyl groups. The four isoprenoid moieties of the diterpene showed identical labeling patterns. The analysis of long-range 13C13C couplings in taxuyunnanine C obtained from an experiment with [U-13C6]glucose documents the involvement of an intramolecular rearrangement in the biosynthesis of the isoprenoid precursor. The labeling patterns are inconsistent with the mevalonate pathway. The taxoid data share important features with the alternative pathway of isoprenoid biosynthesis operating in certain eubacteria Rohmer, M., Knani, M., Simonin, P., Sutter, B. & Sahm, H. (1993) Biochem. J. 295, 517-524]. Images Fig. 1 Fig. 4 PMID:8692832

Prediction of black box warning by mining patterns of Convergent Focus Shift in clinical trial study populations using linked public data.

PubMed

Ma, Handong; Weng, Chunhua

2016-04-01

To link public data resources for predicting post-marketing drug safety label changes by analyzing the Convergent Focus Shift patterns among drug testing trials. We identified 256 top-selling prescription drugs between 2003 and 2013 and divided them into 83 BBW drugs (drugs with at least one black box warning label) and 173 ROBUST drugs (drugs without any black box warning label) based on their FDA black box warning (BBW) records. We retrieved 7499 clinical trials that each had at least one of these drugs for intervention from the ClinicalTrials.gov. We stratified all the trials by pre-marketing or post-marketing status, study phase, and study start date. For each trial, we retrieved drug and disease concepts from clinical trial summaries to model its study population using medParser and SNOMED-CT. Convergent Focus Shift (CFS) pattern was calculated and used to assess the temporal changes in study populations from pre-marketing to post-marketing trials for each drug. Then we selected 68 candidate drugs, 18 with BBW warning and 50 without, that each had at least nine pre-marketing trials and nine post-marketing trials for predictive modeling. A random forest predictive model was developed to predict BBW acquisition incidents based on CFS patterns among these drugs. Pre- and post-marketing trials of BBW and ROBUST drugs were compared to look for their differences in CFS patterns. Among the 18 BBW drugs, we consistently observed that the post-marketing trials focused more on recruiting patients with medical conditions previously unconsidered in the pre-marketing trials. In contrast, among the 50 ROBUST drugs, the post-marketing trials involved a variety of medications for testing their associations with target intervention(s). We found it feasible to predict BBW acquisitions using different CFS patterns between the two groups of drugs. Our random forest predictor achieved an AUC of 0.77. We also demonstrated the feasibility of the predictor for identifying long-term BBW acquisition events without compromising prediction accuracy. This study contributes a method for post-marketing pharmacovigilance using Convergent Focus Shift (CFS) patterns in clinical trial study populations mined from linked public data resources. These signals are otherwise unavailable from individual data resources. We demonstrated the added value of linked public data and the feasibility of integrating ClinicalTrials.gov summaries and drug safety labels for post-marketing surveillance. Future research is needed to ensure better accessibility and linkage of heterogeneous drug safety data for efficient pharmacovigilance. Copyright © 2016 Elsevier Inc. All rights reserved.

Does the visual system of the flying fox resemble that of primates? The distribution of calcium-binding proteins in the primary visual pathway of Pteropus poliocephalus.

PubMed

Ichida, J M; Rosa, M G; Casagrande, V A

2000-01-31

It has been proposed that flying foxes and echolocating bats evolved independently from early mammalian ancestors in such a way that flying foxes form one of the suborders most closely related to primates. A major piece of evidence offered in support of a flying fox-primate link is the highly developed visual system of flying foxes, which is theorized to be primate-like in several different ways. Because the calcium-binding proteins parvalbumin (PV) and calbindin (CB) show distinct and consistent distributions in the primate visual system, the distribution of these same proteins was examined in the flying fox (Pteropus poliocephalus) visual system. Standard immunocytochemical techniques reveal that PV labeling within the lateral geniculate nucleus (LGN) of the flying fox is sparse, with clearly labeled cells located only within layer 1, adjacent to the optic tract. CB labeling in the LGN is profuse, with cells labeled in all layers throughout the nucleus. Double labeling reveals that all PV+ cells also contain CB, and that these cells are among the largest in the LGN. In primary visual cortex (V1) PV and CB label different classes of non-pyramidal neurons. PV+ cells are found in all cortical layers, although labeled cells are found only rarely in layer I. CB+ cells are found primarily in layers II and III. The density of PV+ neuropil correlates with the density of cytochrome oxidase staining; however, no CO+ or PV+ or CB+ patches or blobs are found in V1. These results show that the distribution of calcium-binding proteins in the flying fox LGN is unlike that found in primates, in which antibodies for PV and CB label specific separate populations of relay cells that exist in different layers. Indeed, the pattern of calcium-binding protein distribution in the flying fox LGN is different from that reported in any other terrestrial mammal. Within V1 no PV+ patches, CO blobs, or patchy distribution of CB+ neuropil that might reveal interblobs characteristic of primate V1 are found; however, PV and CB are found in separate populations of non-pyramidal neurons. The types of V1 cells labeled with antibodies to PV and CB in all mammals examined including the flying fox suggest that the similarities in the cellular distribution of these proteins in cortex reflect the fact that this feature is common to all mammals.

Inheritance pattern of platelet membrane fluidity in Alzheimer disease.

PubMed Central

Chakravarti, A; Slaugenhaupt, S A; Zubenko, G S

1989-01-01

The fluorescence anisotropy of 1,6-diphenyl-1,3,5-hexatriene in labeled platelet membranes, an index of membrane fluidity, is a stable, familial trait that is associated with a clinically distinct subtype of Alzheimer disease. Complex segregation analysis of this continuous variable was performed on 95 members of 14 pedigrees identified through probands who had autopsy-confirmed or clinically diagnosed Alzheimer disease. The results suggest that platelet membrane fluidity is controlled by a single genetic locus, PMF, with two alleles that have additive effects. The PMF locus appears to explain approximately 80% of the total variation in platelet membrane fluidity within the families of patients with Alzheimer disease. PMID:2729275

Tuning the brain for motherhood: prolactin-like central signalling in virgin, pregnant, and lactating female mice.

PubMed

Salais-López, Hugo; Lanuza, Enrique; Agustín-Pavón, Carmen; Martínez-García, Fernando

2017-03-01

Prolactin is fundamental for the expression of maternal behaviour. In virgin female rats, prolactin administered upon steroid hormone priming accelerates the onset of maternal care. By contrast, the role of prolactin in mice maternal behaviour remains unclear. This study aims at characterizing central prolactin activity patterns in female mice and their variation through pregnancy and lactation. This was revealed by immunoreactivity of phosphorylated (active) signal transducer and activator of transcription 5 (pSTAT5-ir), a key molecule in the signalling cascade of prolactin receptors. We also evaluated non-hypophyseal lactogenic activity during pregnancy by administering bromocriptine, which suppresses hypophyseal prolactin release. Late-pregnant and lactating females showed significantly increased pSTAT5-ir resulting in a widespread pattern of immunostaining with minor variations between pregnant and lactating animals, which comprises nuclei of the sociosexual and maternal brain, including telencephalic (septum, nucleus of the stria terminalis, and amygdala), hypothalamic (preoptic, paraventricular, supraoptic, and ventromedial), and midbrain (periaqueductal grey) regions. During late pregnancy, this pattern was not affected by the administration of bromocriptine, suggesting it to be elicited mostly by non-hypophyseal lactogenic agents, likely placental lactogens. Virgin females displayed, instead, a variable pattern of pSTAT5-ir restricted to a subset of the brain nuclei labelled in pregnant and lactating mice. A hormonal substitution experiment confirmed that estradiol and progesterone contribute to the variability found in virgin females. Our results reflect how the shaping of the maternal brain takes place prior to parturition and suggest that lactogenic agents are important candidates in the development of maternal behaviours already during pregnancy.

TestSTORM: Simulator for optimizing sample labeling and image acquisition in localization based super-resolution microscopy

PubMed Central

Sinkó, József; Kákonyi, Róbert; Rees, Eric; Metcalf, Daniel; Knight, Alex E.; Kaminski, Clemens F.; Szabó, Gábor; Erdélyi, Miklós

2014-01-01

Localization-based super-resolution microscopy image quality depends on several factors such as dye choice and labeling strategy, microscope quality and user-defined parameters such as frame rate and number as well as the image processing algorithm. Experimental optimization of these parameters can be time-consuming and expensive so we present TestSTORM, a simulator that can be used to optimize these steps. TestSTORM users can select from among four different structures with specific patterns, dye and acquisition parameters. Example results are shown and the results of the vesicle pattern are compared with experimental data. Moreover, image stacks can be generated for further evaluation using localization algorithms, offering a tool for further software developments. PMID:24688813

Intracellular distributions and putative functions of calcium-binding proteins in the bullfrog vestibular otolith organs

NASA Technical Reports Server (NTRS)

Baird, R. A.; Steyger, P. S.; Schuff, N. R.

1997-01-01

Hair cells in the bullfrog vestibular otolith organs were immunolabeled by monoclonal and polyclonal antisera against calbindin (CaB), calmodulin (CaM), calretinin (CaR), and parvalbumin (PA). S-100, previously shown to immunolabel striolar hair cells in fish vestibular organs, only weakly immunolabeled hair cells in the bullfrog vestibular otolith organs. Immunolabeling was not detected in supporting cells. With the exception of CaR, myelinated axons and unmyelinated nerve terminals were immunolabeled by all of the above antisera. Immunolabeling was seen in all saccular hair cells, although hair cells at the macular margins were immunolabeled more intensely for CaB, CaM, and PA than more centrally located hair cells. As the macula margins are known to be a growth zone, this labeling pattern suggests that marginal hair cells up-regulate their calcium-binding proteins during hair cell development. In the utriculus, immunolabeling for CaM and PA was generally restricted to striolar hair cells. CaR immunolabeling was restricted to the stereociliary array. Immunolabeling for other calcium-binding proteins was generally seen in both the cell body and hair bundles of hair cells, although this labeling was often localized to the stereociliary array and the apical portion of the cell body. CaM and PA immunolabeling in the stereociliary array in saccular and utricular striolar cells suggests a functional role for these proteins in mechanoelectric transduction and adaptation.

Influence of Food Labels on Adolescent Diet.

ERIC Educational Resources Information Center

Misra, Ranjita

2002-01-01

Provides information on food nutrition labels and discusses the benefits of adolescents' using them to plan healthy diets. Suggests that teachers and educators should encourage appropriate label reading education for adolescents to promote healthy eating practices. Provides definitions of nutrient content claims. (SG)

Covalent modification of proteins by ligands of steroid hormone receptors.

PubMed

Takahashi, N; Breitman, T R

1992-11-15

Retinoylation, acylation with retinoic acid (RA), is a covalent modification of proteins occurring in a variety of eukaryotic cell lines. In this study, we found that proteins in HL-60 cells were labeled by 17 beta-[3H]estradiol (E2), [3H]progesterone (Pg), 1 alpha,25-dihydroxy[3H]vitamin D3 [1,25(OH)2D3], [125I]triiodothyronine (T3), [125I]thyroxine (T4), and [3H]prostaglandin E2 (PGE2). All of these hormones, except PGE2, are ligands of the steroid hormone receptor family. Addition to the growth medium of 5 microM ketoconazole, an inhibitor of cytochrome P450-dependent enzymes, increased about 2-fold the labeling of proteins by T3, T4, 1,25(OH)2D3, and PGE2. In contrast, ketoconazole did not change markedly the extent of labeling by RA, E2, or Pg. Alkaline methanolysis, which cleaves ester bonds, released variable percentages of the radioactive ligands bound to protein. These values were about 80% for RA and PGE2; 50% for T3, T4, and Pg; and 20% for E2 and 1,25(OH)2D3. Treatment with thioether-cleavage reagents, iodomethane or Raney nickel catalyst, released < 2% of the covalently bound ligands. Two-dimensional polyacrylamide gel electrophoresis patterns of labeled proteins were unique for each ligand. Proteins of M(r) 47,000 and 51,000 were labeled by RA, E2, T3, and T4. These proteins had the same mobilities as RI and RII, the cAMP-binding regulatory subunits of type I and type II cAMP-dependent protein kinases. 1,25(OH)2D3 also bound to proteins of M(r) 47,000 and 51,000. However, these proteins had pI values different from those of RI or RII. These results suggest that some activities of ligands of the steroid hormone receptor family and of PGE2 may be mediated by their covalent modification of proteins.

Category Learning Research in the Interactive Online Environment Second Life

NASA Technical Reports Server (NTRS)

Andrews, Jan; Livingston, Ken; Sturm, Joshua; Bliss, Daniel; Hawthorne, Daniel

2011-01-01

The interactive online environment Second Life allows users to create novel three-dimensional stimuli that can be manipulated in a meaningful yet controlled environment. These features suggest Second Life's utility as a powerful tool for investigating how people learn concepts for unfamiliar objects. The first of two studies was designed to establish that cognitive processes elicited in this virtual world are comparable to those tapped in conventional settings by attempting to replicate the established finding that category learning systematically influences perceived similarity . From the perspective of an avatar, participants navigated a course of unfamiliar three-dimensional stimuli and were trained to classify them into two labeled categories based on two visual features. Participants then gave similarity ratings for pairs of stimuli and their responses were compared to those of control participants who did not learn the categories. Results indicated significant compression, whereby objects classified together were judged to be more similar by learning than control participants, thus supporting the validity of using Second Life as a laboratory for studying human cognition. A second study used Second Life to test the novel hypothesis that effects of learning on perceived similarity do not depend on the presence of verbal labels for categories. We presented the same stimuli but participants classified them by selecting between two complex visual patterns designed to be extremely difficult to label. While learning was more challenging in this condition , those who did learn without labels showed a compression effect identical to that found in the first study using verbal labels. Together these studies establish that at least some forms of human learning in Second Life parallel learning in the actual world and thus open the door to future studies that will make greater use of the enriched variety of objects and interactions possible in simulated environments compared to traditional experimental situations.

Beta-Galactosidase Staining in the Nucleus of the Solitary Tract of Fos-Tau-LacZ Mice Is Unaffected by Monosodium Glutamate Taste Stimulation

PubMed Central

Stratford, Jennifer M.; Thompson, John A.

2014-01-01

Fos-Tau-LacZ (FTL) transgenic mice are used to visualize the anatomical connectivity of neurons that express c-Fos, an immediate early gene, in response to activation. In contrast to typical c-Fos protein expression, which is localized to the nucleus of stimulated neurons, activation of the c-Fos gene results in beta galactosidase (β-gal) expression throughout the entire cytoplasm of activated cells in FTL mice; thereby making it possible to discern the morphology of c-Fos expressing cells. This can be an especially important tool in brain areas in which function may be related to cell morphology, such as the primary taste/viscerosensory brainstem nucleus of the solitary tract (nTS). Thus, to further characterize FTL activity in the brain, the current study quantified both β-gal enzymatic activity as well as c-Fos protein expression in the nTS under a variety of experimental conditions (no stimulation, no stimulation with prior overnight food and water restriction, monosodium glutamate taste stimulation, and monosodium glutamate taste stimulation with perfusion 5 h post stimulation). Contrary to previous research, we found that β-gal activity (both labeled cell bodies and overall number of labeled pixels) was unchanged across all experimental conditions. However, traditional c-Fos protein activity (both cell bodies and number of activated pixels) varied significantly across experimental conditions, with the greatest amount of c-Fos protein label found in the group that received monosodium glutamate taste stimulation. Interestingly, although many c-Fos positive cells were also β-gal positive in the taste stimulated group, some c-Fos protein labeled cells were not co-labeled with β-gal. Together, these data suggest that β-gal staining within the nTS reflects a stable population of β-gal- positive neurons whose pattern of expression is unaffected by experimental condition. PMID:25192442

Use of a machine learning algorithm to classify expertise: analysis of hand motion patterns during a simulated surgical task.

PubMed

Watson, Robert A

2014-08-01

To test the hypothesis that machine learning algorithms increase the predictive power to classify surgical expertise using surgeons' hand motion patterns. In 2012 at the University of North Carolina at Chapel Hill, 14 surgical attendings and 10 first- and second-year surgical residents each performed two bench model venous anastomoses. During the simulated tasks, the participants wore an inertial measurement unit on the dorsum of their dominant (right) hand to capture their hand motion patterns. The pattern from each bench model task performed was preprocessed into a symbolic time series and labeled as expert (attending) or novice (resident). The labeled hand motion patterns were processed and used to train a Support Vector Machine (SVM) classification algorithm. The trained algorithm was then tested for discriminative/predictive power against unlabeled (blinded) hand motion patterns from tasks not used in the training. The Lempel-Ziv (LZ) complexity metric was also measured from each hand motion pattern, with an optimal threshold calculated to separately classify the patterns. The LZ metric classified unlabeled (blinded) hand motion patterns into expert and novice groups with an accuracy of 70% (sensitivity 64%, specificity 80%). The SVM algorithm had an accuracy of 83% (sensitivity 86%, specificity 80%). The results confirmed the hypothesis. The SVM algorithm increased the predictive power to classify blinded surgical hand motion patterns into expert versus novice groups. With further development, the system used in this study could become a viable tool for low-cost, objective assessment of procedural proficiency in a competency-based curriculum.

Dual-process theory and consumer response to front-of-package nutrition label formats.

PubMed

Sanjari, S Setareh; Jahn, Steffen; Boztug, Yasemin

2017-11-01

Nutrition labeling literature yields fragmented results about the effect of front-of-package (FOP) nutrition label formats on healthy food choice. Specifically, it is unclear which type of nutrition label format is effective across different shopping situations. To address this gap, the present review investigates the available nutrition labeling literature through the prism of dual-process theory, which posits that decisions are made either quickly and automatically (system 1) or slowly and deliberately (system 2). A systematically performed review of nutrition labeling literature returned 59 papers that provide findings that can be explained according to dual-process theory. The findings of these studies suggest that the effectiveness of nutrition label formats is influenced by the consumer's dominant processing system, which is a function of specific contexts and personal variables (eg, motivation, nutrition knowledge, time pressure, and depletion). Examination of reported findings through a situational processing perspective reveals that consumers might prefer different FOP nutrition label formats in different situations and can exhibit varying responses to the same label format across situations. This review offers several suggestions for policy makers and researchers to help improve current FOP nutrition label formats. © The Author(s) 2017. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Traffic-Light Labels and Choice Architecture Promoting Healthy Food Choices

PubMed Central

Thorndike, Anne N.; Riis, Jason; Sonnenberg, Lillian M.; Levy, Douglas E.

2014-01-01

Background Preventing obesity requires maintenance of healthy eating behaviors over time. Food labels and strategies that increase visibility and convenience of healthy foods (choice architecture) promote healthier choices, but long-term effectiveness is unknown. Purpose Assess effectiveness of traffic-light labeling and choice architecture cafeteria intervention over 24 months. Design Longitudinal pre–post cohort follow-up study between December 2009 and February 2012. Data were analyzed in 2012. Setting/participants Large hospital cafeteria with mean of 6511 transactions daily. Cafeteria sales were analyzed for: (1) all cafeteria customers and (2) longitudinal cohort of 2285 hospital employees who used the cafeteria regularly. Intervention After 3-month baseline period, cafeteria items were labeled green (healthy), yellow (less healthy) or red (unhealthy) and rearranged to make healthy items more accessible. Main outcome measures Proportion of cafeteria sales that were green or red during each 3-month period from baseline to 24 months. Changes in 12- and 24-month sales were compared to baseline for all transactions and transactions by the employee cohort. Results The proportion of sales of red items decreased from 24% at baseline to 20% at 24 months (p<0.001), and green sales increased from 41% to 46% (p<0.001). Red beverages decreased from 26% of beverage sales at baseline to 17% at 24 months (p<0.001); green beverages increased from 52% to 60% (p<0.001). Similar patterns were observed for the cohort of employees, with largest change for red beverages (23% to 14%, p<0.001). Conclusions A traffic-light and choice architecture cafeteria intervention resulted in sustained healthier choices over 2 years, suggesting food environment interventions can promote long-term changes in population eating behaviors. PMID:24439347

Accuracy of emotion labeling in children of parents diagnosed with bipolar disorder.

PubMed

Hanford, Lindsay C; Sassi, Roberto B; Hall, Geoffrey B

2016-04-01

Emotion labeling deficits have been posited as an endophenotype for bipolar disorder (BD) as they have been observed in both patients and their first-degree relatives. It remains unclear whether these deficits exist secondary to the development of psychiatric symptoms or whether they can be attributed to risk for psychopathology. To explore this, we investigated emotion processing in symptomatic and asymptomatic high-risk bipolar offspring (HRO) and healthy children of healthy parents (HCO). Symptomatic (n:18, age: 13.8 ± 2.6 years, 44% female) and asymptomatic (n:12, age: 12.8 ± 3.0 years, 42% female) HRO and age- and sex-matched HCO (n:20, age: 13.3 ± 2.5 years, 45% female) performed an emotion-labeling task. Total number of errors, emotion category and intensity of emotion error scores were compared. Correlations between total error scores and symptom severity were also investigated. Compared to HCO, both HRO groups made more errors on the adult face task (pcor=0.014). The HRO group were 2.3 times [90%CI:0.9-6.3] more likely and 4.3 times [90%CI:1.3-14.3] more likely to make errors on sad and angry faces, respectively. With the exception of sad face type errors, we observed no significant differences in error patterns between symptomatic and asymptomatic HRO, and no correlations between symptom severity and total number of errors. This study was cross-sectional in design, limiting our ability to infer trajectories or heritability of these deficits. This study provides further support for emotion labeling deficits as a candidate endophenotype for BD. Our study also suggests these deficits are not attributable to the presence of psychiatric symptoms. Copyright © 2016 Elsevier B.V. All rights reserved.

Axonal ramification of neurons in the nucleus reticularis tegmenti pontis projecting to the paramedian lobule in the rabbit cerebellum.

PubMed

Bukowska, Dorota; Mierzejewska-Krzyzowska, Barbara; Zguczyński, Leszek

2005-01-01

Projections of the nucleus reticularis tegmenti pontis (NRTP) to the cerebellar paramedian lobule were examined in the rabbit by means of the double fluorescent retrograde tract-tracing method. The rabbit NRTP is composed of a medial, large part comprising zones A (dorsomedial), B (central) and C (lateral), and of a lateral, small part (the processus tegmentosus lateralis; PTL). Following unilateral injections of Fast Blue (FB) into the rostral part of the paramedian lobule (rPML) and of Diamidino Yellow (DY) into the caudal part (cPML), known to receive spinal inputs from forelimb and hindlimb, respectively, substantial numbers of single labeled neurons were found in all bilateral NRTP divisions, apart from the zone C. Most projection neurons to the PML were located in the medial and medioventral regions of the zone B. Smaller numbers of projection neurons were located in the PTL, zone A and outside the zone B among fibers of the medial lemniscus. The pattern of FB and DY labeling suggested that neurons projecting to the rPML and cPML originated in common rather than separate regions within the NRTP. In addition, a small percentage (mean 1.3%) of double FB+DY labeled neurons were detected with a clear contralateral preponderance, among single labeled FB or DY cells. In spite of the rarity, all the NRTP neurons giving rise to intralobular collateral projections can be regarded as potential sources of simultaneous modulating influences upon two functional different forelimb (rPML) and hindlimb (cPML) regions. The findings have been discussed in relation to earlier studies in other species and commented on with respect to the possible functional meaning of these projections.

Effects of season and nitrogen supply on the partitioning of recently fixed carbon in understory vegetation using a 13CO2 pulse labeling technique

NASA Astrophysics Data System (ADS)

Hasselquist, Niles; Metcalfe, Daniel; Högberg, Peter

2013-04-01

Vegetation research in boreal forests has traditionally been focused on trees, with little attention given to understory vegetation. However, understory vegetation has been identified as a key driver for the functioning of boreal forests and may play an important role in the amount of carbon (C) that is entering and leaving these forested ecosystems. We conducted a large-scale 13C pulse labeling experiment to better understand how recently fixed C is allocated in the understory vegetation characteristic of boreal forests. We used transparent plastic chambers to pulse label the understory vegetation with enriched 13CO2 in the early (June) and late (August) growing seasons. This study was also replicated across a nitrogen (N) fertilization treatment to better understand the effects of N availability on C allocation patterns. We present data on the amount of 13C label found in different components of the understory vegetation (i.e. leaves, stems, lichens, mosses, rhizomes and fine roots) as well as CO2 efflux. Additionally, we provide estimates of C residence time (MRT) among the different components and examine how MRT of C is affected by seasonality and N availability. Seasonality had a large effect on how recently fixed C is allocated in understory vegetation, whereas N fertilization influenced the MRT of C in the different components of ericaceous vegetation. Moreover, there was a general trend that N additions increased the amount of 13C in CO2 efflux compared to the amount of 13C in biomass, suggesting that N fertilization may lead to an increase in the utilization of recently fixed C, whereas N-limitation promotes the storage of recently fixed C.

Traffic-light labels and choice architecture: promoting healthy food choices.

PubMed

Thorndike, Anne N; Riis, Jason; Sonnenberg, Lillian M; Levy, Douglas E

2014-02-01

Preventing obesity requires maintenance of healthy eating behaviors over time. Food labels and strategies that increase visibility and convenience of healthy foods (choice architecture) promote healthier choices, but long-term effectiveness is unknown. Assess effectiveness of traffic-light labeling and choice architecture cafeteria intervention over 24 months. Longitudinal pre-post cohort follow-up study between December 2009 and February 2012. Data were analyzed in 2012. Large hospital cafeteria with a mean of 6511 transactions daily. Cafeteria sales were analyzed for (1) all cafeteria customers and (2) a longitudinal cohort of 2285 hospital employees who used the cafeteria regularly. After a 3-month baseline period, cafeteria items were labeled green (healthy); yellow (less healthy); or red (unhealthy) and rearranged to make healthy items more accessible. Proportion of cafeteria sales that were green or red during each 3-month period from baseline to 24 months. Changes in 12- and 24-month sales were compared to baseline for all transactions and transactions by the employee cohort. The proportion of sales of red items decreased from 24% at baseline to 20% at 24 months (p<0.001), and green sales increased from 41% to 46% (p<0.001). Red beverages decreased from 26% of beverage sales at baseline to 17% at 24 months (p<0.001); green beverages increased from 52% to 60% (p<0.001). Similar patterns were observed for the cohort of employees, with the largest change for red beverages (23%-14%, p<0.001). A traffic-light and choice architecture cafeteria intervention resulted in sustained healthier choices over 2 years, suggesting that food environment interventions can promote long-term changes in population eating behaviors. © 2013 American Journal of Preventive Medicine Published by American Journal of Preventive Medicine All rights reserved.

Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

PubMed

Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

2017-11-01

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

The "PHS Increased Risk" Label Is Associated With Nonutilization of Hundreds of Organs per Year.

PubMed

Volk, Michael L; Wilk, Amber R; Wolfe, Cameron; Kaul, Daniel R

2017-07-01

The Public Health Service "Increased Risk" (PHS IR) designation identifies donors at increased risk of transmitting hepatitis B, C, and human immunodeficiency virus. Although the risk remains very low in the era of nucleic acid testing, we hypothesized that this label may result in decreased organ utilization. Organ Procurement and Transplantation Network data were used to compare utilization rates between PHS-IR and non-PHS-IR donors, as well as to compare export rates and variation in utilization. Among adult standard criteria donors between 2010 and 2013 with a known PHS-IR status, covariate-adjusted utilization rates were lower among PHS-IR donors than non-PHS-IR donors for all organs. For example, 4073 (76.7%) of 5314 PHS-IR kidneys were used, compared with 25 490 (83.7%) of 30 456 non-PHS-IR kidneys-an absolute difference of 7%. Furthermore, all PHS-IR organs had higher export rates than non-PHS-IR organs. For example, 28.7% of PHS-IR kidneys were exported versus 19.7% of non-PHS-IR kidneys. Finally, the utilization rate of PHS-IR organs varied by Donation Service Area; utilization ranged from 20% to 100% among adult kidneys, suggesting significant variation in practices. Similar patterns were seen among pediatric donors. Based on the covariate-adjusted model, if the PHS-IR label did not exist, there could be an additional 313 transplants performed in the United States each year. The PHS "increased risk" label appears to be associated with nonutilization of hundreds of organs per year, despite the very low risk of disease transmission. Better tools are needed to communicate the magnitude of risk to patients and their families.

Benefits of using culturally unfamiliar stimuli in ambiguous emotion identification: A cross-cultural study.

PubMed

Koelkebeck, Katja; Kohl, Waldemar; Luettgenau, Julia; Triantafillou, Susanna; Ohrmann, Patricia; Satoh, Shinji; Minoshita, Seiko

2015-07-30

A novel emotion recognition task that employs photos of a Japanese mask representing a highly ambiguous stimulus was evaluated. As non-Asians perceive and/or label emotions differently from Asians, we aimed to identify patterns of task-performance in non-Asian healthy volunteers with a view to future patient studies. The Noh mask test was presented to 42 adult German participants. Reaction times and emotion attribution patterns were recorded. To control for emotion identification abilities, a standard emotion recognition task was used among others. Questionnaires assessed personality traits. Finally, results were compared to age- and gender-matched Japanese volunteers. Compared to other tasks, German participants displayed slowest reaction times on the Noh mask test, indicating higher demands of ambiguous emotion recognition. They assigned more positive emotions to the mask than Japanese volunteers, demonstrating culture-dependent emotion identification patterns. As alexithymic and anxious traits were associated with slower reaction times, personality dimensions impacted on performance, as well. We showed an advantage of ambiguous over conventional emotion recognition tasks. Moreover, we determined emotion identification patterns in Western individuals impacted by personality dimensions, suggesting performance differences in clinical samples. Due to its properties, the Noh mask test represents a promising tool in the differential diagnosis of psychiatric disorders, e.g. schizophrenia. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Association of Perception of Front-of-Pack Labels with Dietary, Lifestyle and Health Characteristics

PubMed Central

Méjean, Caroline; Macouillard, Pauline; Péneau, Sandrine; Lassale, Camille; Hercberg, Serge; Castetbon, Katia

2014-01-01

Objective To identify patterns of perception of front-of-pack (FOP) nutrition labels and determine dietary, lifestyle and health profiles related to such patterns. Design Cross-sectional. Participants/Setting 28,952 French adults participating in the web-based Nutrinet-Santé cohort. Outcome measures Perception was measured using indicators of understanding and acceptability for three simple FOP labels (“green tick”, the logo of the French Nutrition and Health Program and “simple traffic lights” (STL)), and two detailed FOP formats (“multiple traffic lights” (MTL) and “color range” logo (CR)), placed on ready-to-eat soup packages. Dietary intake data were collected using three web-based 24 h records. Statistical analyses Associations of perception patterns with individual characteristics, including diet, lifestyle and health status, were examined using analysis of covariance and logistic regression, adjusted for socio-demographic and economic factors. Results No clear trend emerged concerning differences in dietary intake between perception groups. Low physical activity and obesity were more frequent in the ‘favorable to STL’ group (respectively, 20.7% and 10.7%). The ‘favorable to MTL’ group included the highest percentage of individuals who declared type 2 diabetes (2.2%). Persons with hypertension were proportionally more numerous in the ‘favorable to MTL’ and the ‘favorable to CR logo’ groups (respectively, 9.5% and 9.3%). Conclusions After adjustment for socio-demographic and economic factors, no FOP label stood out as being more suitable than another for reaching populations with poor diet. However, both STL and MTL may be most appropriate for increasing awareness of healthy eating among groups at higher risk of nutrition-related chronic diseases. PMID:24621617

Ionotropic crustacean olfactory receptors.

PubMed

Corey, Elizabeth A; Bobkov, Yuriy; Ukhanov, Kirill; Ache, Barry W

2013-01-01

The nature of the olfactory receptor in crustaceans, a major group of arthropods, has remained elusive. We report that spiny lobsters, Panulirus argus, express ionotropic receptors (IRs), the insect chemosensory variants of ionotropic glutamate receptors. Unlike insects IRs, which are expressed in a specific subset of olfactory cells, two lobster IR subunits are expressed in most, if not all, lobster olfactory receptor neurons (ORNs), as confirmed by antibody labeling and in situ hybridization. Ligand-specific ORN responses visualized by calcium imaging are consistent with a restricted expression pattern found for other potential subunits, suggesting that cell-specific expression of uncommon IR subunits determines the ligand sensitivity of individual cells. IRs are the only type of olfactory receptor that we have detected in spiny lobster olfactory tissue, suggesting that they likely mediate olfactory signaling. Given long-standing evidence for G protein-mediated signaling in activation of lobster ORNs, this finding raises the interesting specter that IRs act in concert with second messenger-mediated signaling.

Conflict of Interest Reporting by Authors Involved in Promotion of Off-Label Drug Use: An Analysis of Journal Disclosures

PubMed Central

Kesselheim, Aaron S.; Wang, Bo; Studdert, David M.; Avorn, Jerry

2012-01-01

Background Litigation documents reveal that pharmaceutical companies have paid physicians to promote off-label uses of their products through a number of different avenues. It is unknown whether physicians and scientists who have such conflicts of interest adequately disclose such relationships in the scientific publications they author. Methods and Findings We collected whistleblower complaints alleging illegal off-label marketing from the US Department of Justice and other publicly available sources (date range: 1996–2010). We identified physicians and scientists described in the complaints as having financial relationships with defendant manufacturers, then searched Medline for articles they authored in the subsequent three years. We assessed disclosures made in articles related to the off-label use in question, determined the frequency of adequate disclosure statements, and analyzed characteristics of the authors (specialty, author position) and articles (type, connection to off-label use, journal impact factor, citation count/year). We identified 39 conflicted individuals in whistleblower complaints. They published 404 articles related to the drugs at issue in the whistleblower complaints, only 62 (15%) of which contained an adequate disclosure statement. Most articles had no disclosure (43%) or did not mention the pharmaceutical company (40%). Adequate disclosure rates varied significantly by article type, with commentaries less likely to have adequate disclosure compared to articles reporting original studies or trials (adjusted odds ratio [OR] = 0.10, 95%CI = 0.02–0.67, p = 0.02). Over half of the authors (22/39, 56%) made no adequate disclosures in their articles. However, four of six authors with ≥25 articles disclosed in about one-third of articles (range: 10/36–8/25 [28%–32%]). Conclusions One in seven authors identified in whistleblower complaints as involved in off-label marketing activities adequately disclosed their conflict of interest in subsequent journal publications. This is a much lower rate of adequate disclosure than has been identified in previous studies. The non-disclosure patterns suggest shortcomings with authors and the rigor of journal practices. Please see later in the article for the Editors' Summary PMID:22899894

Conflict of interest reporting by authors involved in promotion of off-label drug use: an analysis of journal disclosures.

PubMed

Kesselheim, Aaron S; Wang, Bo; Studdert, David M; Avorn, Jerry

2012-01-01

Litigation documents reveal that pharmaceutical companies have paid physicians to promote off-label uses of their products through a number of different avenues. It is unknown whether physicians and scientists who have such conflicts of interest adequately disclose such relationships in the scientific publications they author. We collected whistleblower complaints alleging illegal off-label marketing from the US Department of Justice and other publicly available sources (date range: 1996-2010). We identified physicians and scientists described in the complaints as having financial relationships with defendant manufacturers, then searched Medline for articles they authored in the subsequent three years. We assessed disclosures made in articles related to the off-label use in question, determined the frequency of adequate disclosure statements, and analyzed characteristics of the authors (specialty, author position) and articles (type, connection to off-label use, journal impact factor, citation count/year). We identified 39 conflicted individuals in whistleblower complaints. They published 404 articles related to the drugs at issue in the whistleblower complaints, only 62 (15%) of which contained an adequate disclosure statement. Most articles had no disclosure (43%) or did not mention the pharmaceutical company (40%). Adequate disclosure rates varied significantly by article type, with commentaries less likely to have adequate disclosure compared to articles reporting original studies or trials (adjusted odds ratio [OR] = 0.10, 95%CI = 0.02-0.67, p = 0.02). Over half of the authors (22/39, 56%) made no adequate disclosures in their articles. However, four of six authors with ≥ 25 articles disclosed in about one-third of articles (range: 10/36-8/25 [28%-32%]). One in seven authors identified in whistleblower complaints as involved in off-label marketing activities adequately disclosed their conflict of interest in subsequent journal publications. This is a much lower rate of adequate disclosure than has been identified in previous studies. The non-disclosure patterns suggest shortcomings with authors and the rigor of journal practices. Please see later in the article for the Editors' Summary.

Social-Identity and Self-Efficacy Concern for Disability Labels

ERIC Educational Resources Information Center

Jodrell, David

2010-01-01

Introduction: Educational policy in the UK has moved towards inclusion (Lindsay, 2003), resulting in debate over the use of disability labels (Lauchlan & Boyle, 2007). Labelling influences social-identity (Olney & Brockelman, 2003), this paper suggests social-identity influences self-efficacy and, therefore, academic performance…

Labeling and intergenerational transmission of crime: The interaction between criminal justice intervention and a convicted parent

PubMed Central

Farrington, David P.; Bijleveld, Catrien C. J. H.

2017-01-01

Labeling theory suggests that criminal justice interventions amplify offending behavior. Theories of intergenerational transmission suggest why children of convicted parents have a higher risk of offending. This paper combines these two perspectives and investigates whether labeling effects might be stronger for children of convicted parents. We first investigated labeling effects within the individual: we examined the impact of a conviction between ages 19–26 on self-reported offending behavior between 27–32 while controlling for self-reported behavior between 15–18. Our results show that a conviction predicted someone’s later self-reported offending behavior, even when previous offending behavior was taken into account. Second, we investigated whether having a convicted parent influenced this association. When we added this interaction to the analysis, a labeling effect was only visible among people with convicted parents. This supports the idea of cumulative disadvantage: Labeling seems stronger for people who are already in a disadvantaged situation having a convicted parent. PMID:28273104

Transfer Learning for Adaptive Relation Extraction

DTIC Science & Technology

2011-09-13

other NLP tasks, however, supervised learning approach fails when there is not a sufficient amount of labeled data for training, which is often the case...always 12 Syntactic Pattern Relation Instance Relation Type (Subtype) arg-2 arg-1 Arab leaders OTHER-AFF (Ethnic) his father PER-SOC (Family) South...for x. For sequence labeling tasks in NLP , linear-chain conditional random field has been rather suc- cessful. It is an undirected graphical model in

Do consumers 'Get the facts'? A survey of alcohol warning label recognition in Australia.

PubMed

Coomber, Kerri; Martino, Florentine; Barbour, I Robert; Mayshak, Richelle; Miller, Peter G

2015-08-22

There is limited research on awareness of alcohol warning labels and their effects. The current study examined the awareness of the Australian voluntary warning labels, the 'Get the facts' logo (a component of current warning labels) that directs consumers to an industry-designed informational website, and whether alcohol consumers visited this website. Participants aged 18-45 (unweighted n = 561; mean age = 33.6 years) completed an online survey assessing alcohol consumption patterns, awareness of the 'Get the facts' logo and warning labels, and use of the website. No participants recalled the 'Get the facts' logo, and the recall rate of warning labels was 16% at best. A quarter of participants recognised the 'Get the facts' logo, and awareness of the warning labels ranged from 13.1-37.9%. Overall, only 7.3% of respondents had visited the website. Multivariable logistic regression models indicated that younger drinkers, increased frequency of binge drinking, consuming alcohol directly from the bottle or can, and support for warning labels were significantly, positively associated with awareness of the logo and warning labels. While an increased frequency of binge drinking, consuming alcohol directly from the container, support for warning labels, and recognition of the 'Get the facts' logo increased the odds of visiting the website. Within this sample, recall of the current, voluntary warning labels on Australian alcohol products was non-existent, overall awareness was low, and few people reported visiting the DrinkWise website. It appears that current warning labels fail to effectively transmit health messages to the general public.

A monoclonal IgM smooth muscle antibody reactive with fibroblast stress fibres produced by immunization with Treponema pallidum.

PubMed Central

Strugnell, R A; Underwood, J R; Clarke, F M; Pedersen, J S; Chalmers, P J; Faine, S; Toh, B H

1983-01-01

A monoclonal IgM smooth muscle antibody secreted by a hybrid (MMI-1) of mouse plasmacytoma NS-1 with spleen cells from mouse immunized with Treponema pallidum was detected by indirect immunofluorescence tests on frozen tissue sections and on acetone fixed monolayers of rat and human fibroblasts. The antibody did not react with acetone fixed smears of T. pallidum but reacted with smooth muscle fibres and with striations of skeletal and cardiac muscle. In non-muscle cells, the antibody stained liver in a 'polygonal' pattern, thymus with accentuated staining of the thymic medulla, renal glomeruli and the brush border and peritubular fibrils of renal tubules. In fibroblast monolayers, the antibody stained stress fibres in an interrupted pattern. Immunoblotting with muscle proteins and the antibody showed labelling of a 100K molecule. The cellular distribution of the mouse monoclonal antibody is similar to that obtained with anti-actin antibody suggesting that the corresponding antigen may be an actin binding protein. Images Fig. 3 PMID:6347470

Notochord-derived Shh concentrates in close association with the apically positioned basal body in neural target cells and forms a dynamic gradient during neural patterning.

PubMed

Chamberlain, Chester E; Jeong, Juhee; Guo, Chaoshe; Allen, Benjamin L; McMahon, Andrew P

2008-03-01

Sonic hedgehog (Shh) ligand secreted by the notochord induces distinct ventral cell identities in the adjacent neural tube by a concentration-dependent mechanism. To study this process, we genetically engineered mice that produce bioactive, fluorescently labeled Shh from the endogenous locus. We show that Shh ligand concentrates in close association with the apically positioned basal body of neural target cells, forming a dynamic, punctate gradient in the ventral neural tube. Both ligand lipidation and target field response influence the gradient profile, but not the ability of Shh to concentrate around the basal body. Further, subcellular analysis suggests that Shh from the notochord might traffic into the neural target field by means of an apical-to-basal-oriented microtubule scaffold. This study, in which we directly observe, measure, localize and modify notochord-derived Shh ligand in the context of neural patterning, provides several new insights into mechanisms of Shh morphogen action.

Taste Bud Labeling in Whole Tongue Epithelial Sheet in Adult Mice.

PubMed

Venkatesan, Nandakumar; Boggs, Kristin; Liu, Hong-Xiang

2016-04-01

Molecular labeling in whole-mount tissues provides an efficient way to obtain general information about the formation, maintenance, degeneration, and regeneration of many organs and tissues. However, labeling of lingual taste buds in whole tongue tissues in adult mice has been problematic because of the strong permeability barrier of the tongue epithelium. In this study, we present a simple method for labeling taste buds in the intact tongue epithelial sheet of an adult mouse. Following intralingual protease injection and incubation, immediate fixation of the tongue on mandible in 4% paraformaldehyde enabled the in situ shape of the tongue epithelium to be well maintained after peeling. The peeled epithelium was accessible to taste bud labeling with a pan-taste cell marker, keratin 8, and a type II taste cell marker, α-gustducin, in all three types of taste papillae, that is, fungiform, foliate, and circumvallate. Overnight incubation of tongue epithelial sheets with primary and secondary antibodies was sufficient for intense labeling of taste buds with both fluorescent and DAB visualizations. Labeled individual taste buds were easy to identify and quantify. This protocol provides an efficient way for phenotypic analyses of taste buds, especially regarding distribution pattern and number.

Heterogeneity across the dorso-ventral axis in zebrafish EVL is regulated by a novel module consisting of sox, snail1a and max genes.

PubMed

Chen, Yi-Yen; Harris, Matthew P; Levesque, Mitchell P; Nüsslein-Volhard, Christiane; Sonawane, Mahendra

2012-01-01

In vertebrates, the dorso-ventral (DV) axis is defined by the combinatorial action of localised Wnt, FGF and Nodal signalling along with the antagonizing activities of Chordin and BMP pathways. Our knowledge of the factors that may act in concert with these core pathways to regulate early embryonic patterning is far from complete. Furthermore, while all three germ layers respond to these patterning cues, it is not clear whether in zebrafish the outermost protective epithelium, the enveloping layer (EVL), is also patterned along the DV axis. Here, we have identified a transgenic line driving GFP under a crestin promoter, which specifically labels the dorsal domain of the EVL suggesting heterogeneity in the EVL across the DV axis. Our attempts to understand how the expression from this promoter fragment is regulated specifically in the dorsal domain, have unravelled potential novel players involved in early EVL and embryonic patterning. We show that along with Nodal signalling components, four proteins Sox11b, Sox19b, Snail1a and Max are involved in regulating the size of this EVL domain. However, Chordin-BMP signalling might be dispensable for the dorso-ventral patterning of the EVL. For the first time, this transgenic line unravels the heterogeneity in the EVL and will serve as an important tool in understanding the molecular basis of the DV patterning of the EVL. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Patterns of EphA2 protein expression in primary and metastatic pancreatic carcinoma and correlation with genetic status

PubMed Central

Mudali, Shiyama V.; Fu, Baojin; Lakkur, Sindhu S.; Luo, Mingde; Embuscado, Erlinda E.

2009-01-01

EphA2 is a transmembrane receptor tyrosine kinase that functions in the regulation of cell growth, survival, angiogenesis, and migration and EphA2 targeting has been proposed as a novel therapeutic strategy for neoplasms that overexpress this protein. EphA2 overexpression has been correlated with increased invasive and metastatic ability in pancreatic cancer cell lines. However, the patterns of EphA2 expression in human pancreatic cancers and associated metastases is unknown, as are the genetics of EphA2 in this tumor type. We collected clinicopathologic data and paraffin-embedded materials from 98 patients with primary and/or metastatic pancreatic cancer and performed immunohistochemical labeling for EphA2 protein. EphA2 protein immunolabeling was found in 207 of 219 samples (95%). The expression was predominantly cytoplasmic, although predominant membranous staining was observed in a minority of cases. When evaluated specifically for labeling intensity, primary and metastatic carcinomas were more strongly positive compared to benign ducts and PanIN lesions (P < 0.00001 and P < 0.01, respectively) and poorly differentiated carcinomas were more strongly positive for EphA2 than well and moderately differentiated tumors (P < 0.005). When primary carcinomas without metastatic disease were specifically compared to carcinomas with associated metastatic disease, the advanced carcinomas showed relatively less strong positive labeling for EphA2 (P < 0.008). Moreover, decreased EphA2 labeling was more commonly found in liver (P < 0.002), lung (P < 0.004) or peritoneal metastases (P < 0.01) as compared to distant lymph node metastases (P < 0.01). Genetic sequencing of the tyrosine kinase domain of EPHA2 in 22 samples of xenograft enriched pancreatic cancer did not reveal any inactivating mutations. However, EPHA2 amplification was found in 1 of 33 pancreatic cancers corresponding to a lymph node metastasis, indicating EPHA2 genomic amplification may underlie EphA2 overexpression in a minority of patients. Our data confirms that EphA2 is overexpressed in pancreatic cancer, but suggests a relative loss of EphA2 in co-existent pancreatic cancer metastases as well as a role for EPHA2 in organ specific metastasis. PMID:17146615

A general soft label based linear discriminant analysis for semi-supervised dimensionality reduction.

PubMed

Zhao, Mingbo; Zhang, Zhao; Chow, Tommy W S; Li, Bing

2014-07-01

Dealing with high-dimensional data has always been a major problem in research of pattern recognition and machine learning, and Linear Discriminant Analysis (LDA) is one of the most popular methods for dimension reduction. However, it only uses labeled samples while neglecting unlabeled samples, which are abundant and can be easily obtained in the real world. In this paper, we propose a new dimension reduction method, called "SL-LDA", by using unlabeled samples to enhance the performance of LDA. The new method first propagates label information from the labeled set to the unlabeled set via a label propagation process, where the predicted labels of unlabeled samples, called "soft labels", can be obtained. It then incorporates the soft labels into the construction of scatter matrixes to find a transformed matrix for dimension reduction. In this way, the proposed method can preserve more discriminative information, which is preferable when solving the classification problem. We further propose an efficient approach for solving SL-LDA under a least squares framework, and a flexible method of SL-LDA (FSL-LDA) to better cope with datasets sampled from a nonlinear manifold. Extensive simulations are carried out on several datasets, and the results show the effectiveness of the proposed method. Copyright © 2014 Elsevier Ltd. All rights reserved.

Regional differences in lectin binding patterns of vestibular hair cells

NASA Technical Reports Server (NTRS)

Baird, R. A.; Schuff, N. R.; Bancroft, J.

1993-01-01

Surface glycoconjugates of hair cells and supporting cells in the vestibular endorgans of the bullfrog were identified using biotinylated lectins with different carbohydrate specificities. Lectin binding in hair cells was consistent with the presence of glucose and mannose (CON A), galactose (RCA-I), N-acetylglucosamine (WGA), N-acetylgalactosamine (VVA), but not fucose (UEA-I) residues. Hair cells in the bullfrog sacculus, unlike those in the utriculus and semicircular canals, did not strain for N-acetylglucosamine (WGA) or N-acetylgalactosamine (VVA). By contrast, WGA and, to a lesser extent, VVA, differentially stained utricular and semicircular canal hair cells, labeling hair cells located in peripheral, but not central, regions. In mammals, WGA uniformly labeled Type I hair cells while labeling, as in the bullfrog, Type II hair cells only in peripheral regions. These regional variations were retained after enzymatic digestion. We conclude that vestibular hair cells differ in their surface glycoconjugates and that differences in lectin binding patterns can be used to identify hair cell types and to infer the epithelial origin of isolated vestibular hair cells.

A descriptive and comparative lectin histochemical study of the vomeronasal system in pigs and sheep

PubMed Central

SALAZAR, IGNACIO; SANCHEZ-QUINTEIRO, PABLO; LOMBARDERO, MATILDE; CIFUENTES, JOSE MANUEL

2000-01-01

The accessory olfactory bulb (AOB) is the primary target of the sensory epithelium of the vomeronasal organ (VNO), and thus constitutes a fundamental component of the accessory olfactory system, which is involved in responses to behaviour-related olfactory stimuli. In this study we investigated the characteristics of the AOB, VNO, vomeronasal nerves (VNNs) and caudal nasal nerve (CdNN) in pigs and sheep, species in which olfaction plays a key behavioural role both in the neonatal period and in adulthood. The patterns of staining of the AOB by the Bandeiraea simplicifolia and Lycopersicon esculentum lectins were the same in the 2 species, whereas the Ulex europeus and Dolichos biflorus lectins gave different patterns. In both species, lectin staining of the AOB was consistent with that of the VNNs, while the CdNN did not label any of the structures studied. The entire sensory epithelium of the pig was labelled by Ulex europeus and Lycopersicum esculentum lectins, and all 4 lectins used labelled the mucomicrovillar surface of the sensory epithelium in sheep. PMID:10697284

Block Copolymer Patterns as Templates for the Electrocatalyzed Deposition of Nanostructures on Electrodes and for the Generation of Surfaces of Controlled Wettability.

PubMed

Chandaluri, Chanchayya Gupta; Pelossof, Gilad; Tel-Vered, Ran; Shenhar, Roy; Willner, Itamar

2016-01-20

ITO electrodes modified with a nanopatterned film of polystyrene-block-poly(2-vinylpyridine), PS-b-P2VP, where the P2VP domains are quaternized with iodomethane, are used for selective deposition of redox-active materials. Electrochemical studies (cyclic voltammetry, Faradaic impedance measurements) indicate that the PS domains insulate the conductive surface toward redox labels in solution. In turn, the quaternized P2VP domains electrostatically attract negatively charged redox labels solubilized in the electrolyte solution, resulting in an effective electron transfer between the electrode and the redox label. This phenomenon is implemented for the selective deposition of the electroactive Prussian blue on the nanopatterned surface and for the electrochemical deposition of Au nanoparticles, modified with a monolayer of p-aminothiophenol/2-mercaptoethanesulfonic acid, on the quaternized P2VP domains. The patterned Prussian blue-modified surface enables controlling the wettability properties by the content of the electrochemically deposited Prussian blue. Controlled wettability is unattainable with the homopolymer-modified surface, attesting to the role of the nanopattern.

[Food labeling in Ecuador: implementation, results, and pending actions].

PubMed

Díaz, Adrián Alberto; Veliz, Paula Mariana; Rivas-Mariño, Gabriela; Mafla, Carina Vance; Altamirano, Luz María Martínez; Jones, Cecilia Vaca

2017-06-08

Noncommunicable diseases are the world's leading cause of death, responsible for 38 million deaths in 2012. This epidemic is primarily associated with smoking, excessive alcohol consumption, sedentary lifestyle, and changes in dietary patterns, characterized by diets high in sugar and saturated fat, typical of processed foods and sugar-sweetened beverages, plus low intake of fruits and vegetables. Ecuador is no exception to this epidemiological profile or to changes in eating patterns. Thus, Ecuador's government designed and implemented an action plan aimed at changing the obesogenic environment, which includes six strategic lines. One of these is implementation of a traffic-light nutritional labeling system for processed foods, in late 2014, aimed at guaranteeing people's right to timely, clear, accurate, and non-deceptive information on the content and characteristics of these foods. This article analyzes implementation of processed food labeling and results to date, and proposes complementary measures needed to reach the goal in the National Plan for Good Living, in light of new scientific evidence and different agreements and regulatory frameworks in our Region. Methods included a literature and documentary review, key informant interviews, and analysis and processing of secondary sources.

A RADIOAUTOGRAPHIC STUDY OF GLYCERIDE SYNTHESIS IN VIVO DURING INTESTINAL ABSORPTION OF FATS AND LABELED GLUCOSE

PubMed Central

Jersild, Ralph A.

1966-01-01

Radioautography was used to detect the synthesis of labeled glycerides in intestinal absorptive cells following injections of fatty chyme and glucose-6-H3 into ligated segments of upper jejunum of fasting rats. Absorption intervals ranged from 2 to 20 min. Labeling is evident throughout the cells in as short a time as 2 min. Most grains are present over droplets of absorbed fat beginning with those in the endoplasmic reticulum immediately subjacent to the terminal web. With longer absorption periods, frequent grains are present over accumulations of fat droplets in the Golgi cisternae and intercellular spaces. A similar pattern of grains is seen following absorption of either linoleic acid or safflower oil. By comparison, considerably less label is present in the cells when the fat is extracted with alcohol prior to radioautographic procedures, or when labeled glucose alone is absorbed. A significant incorporation of glucose label into newly synthesized glycerides is indicated and confirmed by scintillation counts on saponified lipid extracts. The grain distribution implies an involvement of the extreme apical endoplasmic reticulum in this synthesis. PMID:5971642

Depletion of penicillin G residues in heavy sows after intramuscular injection. Part I: Tissue residue depletion

USDA-ARS?s Scientific Manuscript database

Heavy sows (n=126) were treated with penicillin G procaine at a 5x label dose (33,000 IU/kg) for 3 consecutive days by intramuscular (IM) injection using 3 separate patterns (treatments) of drug administration (42 sows per treatment). Treatments differed by pattern and maximum injection volume per s...

Are Dietary Patterns Associated with Depression in U.S. Adults?

PubMed

Kim, Woo Kyoung; Shin, Dayeon; Song, Won O

2016-11-01

Nutrition is one of the most important modifiable determinants for and consequences of both mental and physical heath. Depression has become an increasingly important public health issue. We tested whether dietary patterns derived from food group intake are associated with depression in U.S. adults in a cross-sectional study with national population. This study included 4180 men and 4196 women aged 20-79 years in the 2007-2010 National Health and Nutrition Examination Surveys (NHANES), with complete data of one 24-h dietary recall, sociodemographics, lifestyles, and Patient Health Questionnaires (PHQ-9) for screening depression. Two major dietary patterns identified by factor analysis were investigated for their associations with presence of depression (PHQ-9 score ≥10) by using linear and multivariate logistic regressions. One of two major patterns, labeled "Western" dietary pattern was characterized by high intakes of nonwhole grain, white potatoes, cheese, meat, discretionary oil and fat, and added sugar; the second dietary pattern that was labeled "Healthy" dietary pattern was characterized by high intakes of whole grains, vegetables, fruits, fish, nuts and seeds. The "Western" dietary pattern was not significantly associated with depression in both men and women. The "Healthy" dietary pattern scores were inversely associated with the PHQ-9 depression scores and odd ratios (ORs) of depression after adjustment for covariates in women but not in men. The OR of depression in women with the highest quintile of "Healthy" dietary pattern scores was 0.60 (95% confidence interval [CI]: 0.42-0.85, P < .001) compared to the lowest quintile as a reference. These findings warrant future interventions or clinical trials in elucidating causal and effect relations of depression and dietary patterns, an important public health concern.

Afferent and Efferent Connections of the Cortex-Amygdala Transition Zone in Mice

PubMed Central

Cádiz-Moretti, Bernardita; Abellán-Álvaro, María; Pardo-Bellver, Cecília; Martínez-García, Fernando; Lanuza, Enrique

2016-01-01

The transitional zone between the ventral part of the piriform cortex and the anterior cortical nucleus of the amygdala, named the cortex-amygdala transition zone (CxA), shows two differential features that allow its identification as a particular structure. First, it receives dense cholinergic and dopaminergic innervations as compared to the adjacent piriform cortex and amygdala, and second, it receives projections from the main and accessory olfactory bulbs. In this work we have studied the pattern of afferent and efferent projections of the CxA, which are mainly unknown, by using the retrograde tracer Fluorogold and the anterograde tracer biotinylated dextranamine. The results show that the CxA receives a relatively restricted set of intratelencephalic connections, originated mainly by the olfactory system and basal forebrain, with minor afferents from the amygdala. The only relevant extratelencephalic afference originates in the ventral tegmental area (VTA). The efferent projections of the CxA reciprocate the inputs from the piriform cortex and olfactory amygdala. In addition, the CxA projects densely to the basolateral amygdaloid nucleus and the olfactory tubercle. The extratelencephalic projections of the CxA are very scarce, and target mainly hypothalamic structures. The pattern of connections of the CxA suggests that it is indeed a transitional area between the piriform cortex and the cortical amygdala. Double labeling with choline acetyltransferase indicates that the afferent projection from the basal forebrain is the origin of its distinctive cholinergic innervation, and double labeling with dopamine transporter shows that the projection from the VTA is the source of dopaminergic innervation. These connectivity and neurochemical features, together with the fact that it receives vomeronasal in addition to olfactory information, suggest that the CxA may be involved in processing olfactory information endowed with relevant biological meaning, such as odors related to reproductive or defensive behaviors. PMID:28066196

Afferent and Efferent Connections of the Cortex-Amygdala Transition Zone in Mice.

PubMed

Cádiz-Moretti, Bernardita; Abellán-Álvaro, María; Pardo-Bellver, Cecília; Martínez-García, Fernando; Lanuza, Enrique

2016-01-01

The transitional zone between the ventral part of the piriform cortex and the anterior cortical nucleus of the amygdala, named the cortex-amygdala transition zone (CxA), shows two differential features that allow its identification as a particular structure. First, it receives dense cholinergic and dopaminergic innervations as compared to the adjacent piriform cortex and amygdala, and second, it receives projections from the main and accessory olfactory bulbs. In this work we have studied the pattern of afferent and efferent projections of the CxA, which are mainly unknown, by using the retrograde tracer Fluorogold and the anterograde tracer biotinylated dextranamine. The results show that the CxA receives a relatively restricted set of intratelencephalic connections, originated mainly by the olfactory system and basal forebrain, with minor afferents from the amygdala. The only relevant extratelencephalic afference originates in the ventral tegmental area (VTA). The efferent projections of the CxA reciprocate the inputs from the piriform cortex and olfactory amygdala. In addition, the CxA projects densely to the basolateral amygdaloid nucleus and the olfactory tubercle. The extratelencephalic projections of the CxA are very scarce, and target mainly hypothalamic structures. The pattern of connections of the CxA suggests that it is indeed a transitional area between the piriform cortex and the cortical amygdala. Double labeling with choline acetyltransferase indicates that the afferent projection from the basal forebrain is the origin of its distinctive cholinergic innervation, and double labeling with dopamine transporter shows that the projection from the VTA is the source of dopaminergic innervation. These connectivity and neurochemical features, together with the fact that it receives vomeronasal in addition to olfactory information, suggest that the CxA may be involved in processing olfactory information endowed with relevant biological meaning, such as odors related to reproductive or defensive behaviors.

Planning-free cerebral blood flow territory mapping in patients with intracranial arterial stenosis

PubMed Central

Arteaga, Daniel F; Strother, Megan K; Davis, L Taylor; Fusco, Matthew R; Faraco, Carlos C; Roach, Brent A; Scott, Allison O

2016-01-01

A noninvasive method for quantifying cerebral blood flow and simultaneously visualizing cerebral blood flow territories is vessel-encoded pseudocontinuous arterial spin labeling MRI. However, obstacles to acquiring such information include limited access to the methodology in clinical centers and limited work on how clinically acquired vessel-encoded pseudocontinuous arterial spin labeling data correlate with gold-standard methods. The purpose of this work is to develop and validate a semiautomated pipeline for the online quantification of cerebral blood flow maps and cerebral blood flow territories from planning-free vessel-encoded pseudocontinuous arterial spin labeling MRI with gold-standard digital subtraction angiography. Healthy controls (n = 10) and intracranial atherosclerotic disease patients (n = 34) underwent 3.0 T MRI imaging including vascular (MR angiography) and hemodynamic (cerebral blood flow-weighted arterial spin labeling) MRI. Patients additionally underwent catheter and/or CT angiography. Variations in cross-territorial filling were grouped according to diameters of circle of Willis vessels in controls. In patients, Cohen’s k-statistics were computed to quantify agreement in perfusion patterns between vessel-encoded pseudocontinuous arterial spin labeling and angiography. Cross-territorial filling patterns were consistent with circle of Willis anatomy. The intraobserver Cohen's k-statistics for cerebral blood flow territory and digital subtraction angiography perfusion agreement were 0.730 (95% CI = 0.593–0.867; reader one) and 0.708 (95% CI = 0.561–0.855; reader two). These results support the feasibility of a semiautomated pipeline for evaluating major neurovascular cerebral blood flow territories in patients with intracranial atherosclerotic disease. PMID:27389177

A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

PubMed

Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

2017-01-11

We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

Calorie Labeling in Chain Restaurants and Body Weight: Evidence from New York.

PubMed

Restrepo, Brandon J

2017-10-01

This study analyzes the impact of local mandatory calorie labeling laws implemented by New York jurisdictions on body weight. The analysis indicates that on average the point-of-purchase provision of calorie information on chain restaurant menus reduced body mass index (BMI) by 1.5% and lowered the risk of obesity by 12%. Quantile regression results indicate that calorie labeling has similar impacts across the BMI distribution. An analysis of heterogeneity suggests that calorie labeling has a larger impact on the body weight of lower income individuals, especially lower income minorities. The estimated impacts of calorie labeling on physical activity, smoking, and the consumption of alcoholic beverages, fruits, and vegetables are small in magnitude, which suggests that other margins of adjustment drive the body-weight impacts estimated here. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Evidence that Surface Proteins Sn14 and Sn16 of Sarcocystis neurona Merozoites Are Involved in Infection and Immunity†

PubMed Central

Liang, Fang Ting; Granstrom, David E.; Zhao, Xiao Min; Timoney, John F.

1998-01-01

Sarcocystis neurona is the etiologic agent of equine protozoal myeloencephalitis (EPM). Based on an analysis of 25,000 equine serum and cerebrospinal fluid (CSF) samples, including samples from horses with neurologic signs typical of EPM or with histologically or parasitologically confirmed EPM, four major immunoblot band patterns have been identified. Twenty-three serum and CSF samples representing each of the four immunoblot patterns were selected from 220 samples from horses with neurologic signs resembling EPM and examined for inhibitory effects on the infectivity of S. neurona by an in vitro neutralization assay. A high correlation between immunoblot band pattern and neutralizing activity was detected. Two proteins, Sn14 and Sn16 (14 and 16 kDa, respectively), appeared to be important for in vitro infection. A combination of the results of surface protein labeling, immunoprecipitation, Western blotting, and trypsin digestion suggests that these molecules are surface proteins and may be useful components of a vaccine against S. neurona infection. Although S. neurona is an obligate intracellular parasite, it is potentially a target for specific antibodies which may lyse merozoites via complement or inhibit their attachment and penetration to host cells. PMID:9573058

A Review of Pacific Interdecadal Climate Variability: Possible Mechanisms and Surface Climate Signatures in the Pacific Sector

NASA Astrophysics Data System (ADS)

Mantua, N. J.

2004-12-01

Many investigators have examined historical surface climate records from the Pacific sector and identified a relatively small number of spatial patterns varying at decadal to interdecadal time scales. "Pacific Decadal Variability" (PDV) is a label that has been used to describe this family of climate variations. Some patterns of PDV are contained completely within the northern extratropics, while others have signatures throughout the Pacific hemisphere on both sides of the equator. Mechanisms for observed patterns of PDV are not yet known, though a wide variety of hypotheses have been proposed. Various ocean-atmosphere mechanisms for PDV are contained within the extratropics, others within the tropics, while others involve tropical-extratropical interactions. Some investigators have proposed external forcing (solar, lunar, or volcanic) as potentially important for driving PDV. A relatively simple hypothesis couples ENSO forcing with upper ocean heat storage for extratropical PDV, and it suggests PDV predictability may be limited to ~2 year lead times. Paleo-PDV reconstructions have been based on materials throughout the Pacific sector using such things as extratropical tree-rings, tropical corals, extratropical clam shell growth rings, and ice cores. These different proxy records have generally provided different perspectives on paleo-PDV behavior.

The acetabulum: A prospective study of three-phase bone and indium white blood cell scintigraphy following porous-coated hip arthroplasty

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oswald, S.G.; Van Nostrand, D.; Savory, C.G.

1990-03-01

Although few studies address the use of three-phase bone scanning (TPBS) and indium-111-labeled white blood cell scintigraphy ({sup 111}In-WBC) in hip arthroplasty utilizing a porous-coated prosthesis, the literature suggests that scintigraphic patterns in the uncomplicated patient may differ from that seen with the cemented prosthesis. In an attempt to determine the scintigraphic natural history, 25 uncomplicated porous-coated hip arthroplasties in 21 patients were prospectively studied with serial TPBS and {sup 111I}n-WBC at approximately 7 days, and 3, 6, 12, 18, and 24 mo postoperatively. This report deals with findings related to the acetabulum. All 25 prostheses (144 of 144 scans)more » demonstrated increased uptake on the bone-phase images. Although this activity decreased with time, 76% had persistent uptake at 24 mo. Twenty-three of 25 prostheses (126 of 140 scans) showed increased uptake on {sup 111}In-WBC scintigraphy, invariably decreasing with time, but with 37% having significant uptake at 24 mo. Scintigraphic patterns in the uncomplicated porous-coated hip arthroplasty patient appear to differ from patterns described in cemented prostheses.« less

Automaticity of Basic-Level Categorization Accounts for Labeling Effects in Visual Recognition Memory

ERIC Educational Resources Information Center

Richler, Jennifer J.; Gauthier, Isabel; Palmeri, Thomas J.

2011-01-01

Are there consequences of calling objects by their names? Lupyan (2008) suggested that overtly labeling objects impairs subsequent recognition memory because labeling shifts stored memory representations of objects toward the category prototype (representational shift hypothesis). In Experiment 1, we show that processing objects at the basic…

A study of the nonprescription drug consumer's understanding of the ranitidine product label and actual product usage patterns in the treatment of episodic heartburn.

PubMed

Ciociola, A A; Sirgo, M A; Pappa, K A; McGuire, J A; Fung, K

2001-01-01

A study of the consumer's understanding of the product label instructions and the resulting product use were conducted to support the switch of a product from prescription to nonprescription status. H2 receptor antagonists have recently been approved for nonprescription use. This study evaluated the consumer's understanding of the product label for ranitidine hydrochloride (Zantac 75) and the product usage pattern in the treatment of episodic heartburn. Our objectives were to evaluate each aspect of the communication of labeled indications, contraindications, and directions for use of two label formats (old and new) for a new nonprescription preparation of ranitidine (Zantac) and to evaluate nonprescription consumers' use of ranitidine 75-mg tablets (as Zantac 75) in a medically unsupervised, at-home setting to observe whether these consumers used the product appropriately and followed directions as written on the package label. Adult male and female consumers (n = 1405) in a shopping mall environment who were attracted to a poster asking, "Do you have stomach problems?" were recruited for the label comprehension phase (two different label formats) and the 3-week usage phase if after reading the Zantac 75 package label they decided the product was appropriate for them. No instructions regarding the use of Zantac 75 were provided beyond what was printed on the package label. Subjects recorded use in a diary and tablet counts were performed at the end of the study period. A medical history was also taken at this time and an assessment of product use was performed by a physician. In at least 84% of all subjects, both formats were effective in the communication of label objectives for the contraindication against concurrent prescription stomach ulcer medication, maximum daily dose, and maximum duration of dosing at maximum daily doses. The direction to take one tablet per dose was adhered to by 90% of consumers, and 90% of consumers followed the instructions to take no more than two tablets in 24 hours. Ninety-six percent of consumers complied with the direction not to take the maximum daily dose for more than 14 consecutive days. Notably, the maximum daily dose was taken for < or =3 consecutive days by 79% of consumers. The most frequently reported adverse events were headache, acute nasopharyngitis, upper respiratory tract infection, diarrhea, nausea, and menstrual cramps. The study demonstrated that the vast majority of a large sample of unsupervised consumers understood the package label and fully complied with the package directions by not exceeding the maximum daily dosage and length of use. Nonprescription consumers safely used Zantac 75 without medical supervision.

Labeling of sexual assault and its relationship with sexual functioning: the mediating role of coping.

PubMed

Kelley, Erika L; Gidycz, Christine A

2015-01-01

Little research has examined the relationship between women's labeling of their sexual assault experiences and sexual functioning, as well as identification of variables that may mediate the labeling-trauma outcome relationship. The purpose of this study was to fill this gap in the literature, by examining the potential mediating role of coping strategies in response to sexual assault in the relationship between labeling and sexual functioning. The sample included 135 college women with a history of adolescent/early adulthood sexual assault. Labeling was not bivariately related to sexual functioning outcomes; however, anxious coping mediated the relationships between labeling and both sexual lubrication and sexual satisfaction. This suggests that correlational analyses between labeling and trauma outcomes may not capture the complexity of this relationship, as it may be more indirect. Furthermore, results suggest that labeling is part of the coping process in response to sexual assault; some women who consider their experience to be sexual assault may engage in anxious coping efforts, contributing to difficulties with sexual lubrication and sexual dissatisfaction. Victims actively working to integrate their sexual assault experience with prior beliefs and self-concept may benefit from treatment focused on decreasing anxious coping, especially as it relates to sexual functioning. © The Author(s) 2014.

Prescribing Pattern of Antidepressants in Children and Adolescents: Findings from the Research on Asia Psychotropic Prescription Pattern.

PubMed

Chee, K Y; Tripathi, A; Avasthi, A; Chong, M Y; Xiang, Y T; Sim, K; Kanba, S; He, Y L; Lee, M S; Chiu, H F K; Yang, S Y; Kuga, H; Udomratn, P; Tanra, A J; Maramis, M M; Grover, S; Mahendran, R; Kallivayalil, R A; Shen, W W; Shinfuku, N; Tan, C H; Sartorius, N

2016-03-01

Pharmacotherapy of depression in children and adolescents is complex. In the absence of research into the efficacy and safety of antidepressants in this group of patients, their off-label prescription is common. This paper aimed to illustrate the prescription pattern of antidepressants in children and adolescents from major psychiatric centres in Asia. The Research on Asia Psychotropic Prescription Pattern on Antidepressants worked collaboratively in 2013 to study the prescription pattern of antidepressants in Asia using a unified research protocol and questionnaire. Forty psychiatric centres from 10 Asian countries / regions participated and 2321 antidepressant prescriptions were analysed. A total of 4.7% antidepressant prescriptions were for children and adolescents. Fluoxetine, sertraline, and escitalopram were the most common antidepressants prescribed for children and adolescents. Almost one-third (30.3%) of prescriptions were for diagnoses other than depressive and anxiety disorders. There was less antidepressant polypharmacy and concomitant use of benzodiazepine, but more concomitant use of antipsychotics in children and adolescents compared with adults. Off-label use of antidepressants in children and adolescents was reported by 40 Asian psychiatric institutions that participated in the study. In-service education and regulatory mechanisms should be reinforced to ensure efficacy and safety of antidepressants in children and adolescents.

76 FR 26927 - National Organic Program; Notice on the Ruminant Slaughter Stock Provision of the Access to...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-10

... Received on Labeling and Grass-Fed Products Many commenters suggested that there is a place for both grass... labeling system: ``Organic--Grass Fed/Grain Finished,'' ``Organic--Grass Fed/Finished on Pasture with Supplemental Grain Feeding,'' ``Organic--100% Grass Fed/Grass Finished.'' Their recommendation suggested that...

Different patterns of vein loading of exogenous ( sup 14 C)sucrose in leaves of pisum sativum and coleus blumei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Turgeon, R.; Wimmers, L.E.

1988-05-01

Vein loading of exogenous ({sup 14}C)sucrose was studied using short uptake and wash periods to distinguish between direct loading into veins and loading via mesophyll tissue. Mature leaf tissue of Pisum sativum L. cv Little Marvel, or Coleus blumei Benth. cv Candidum, was abraded and leaf discs were floated on ({sup 14}C)sucrose solution for 1 or 2 minutes. Discs were then washed for 1 to 30 min either at room temperature or in the cold and were frozen, lyophilized, and autoradiographed. In P. sativum, veins were clearly labeled after 1 minute uptake and 1 minute wash periods. Autoradiographic images didmore » not change appreciably with longer times of uptake or wash. Vein loading was inhibited by p-chloromercuribenzenesulfonic acid. These results indicate that uptake of exogenous sucrose occurs directly into the veins in this species. When C. blumei leaf discs were floated on ({sup 14}C)sucrose for 2 minutes and washed in the cold, the mesophyll was labeled but little, if any, minor vein loading occurred. When discs were labeled for 2 minutes and washed at room temperature, label was transferred from the mesophyll to the veins within minutes. These results indicate that there may be different patterns of phloem loading of photosynthetically derived sucrose in these two species.« less

Food label use and its relation to dietary intake among US adults.

PubMed

Ollberding, Nicholas Jay; Wolf, Randi L; Contento, Isobel

2010-08-01

Rates of diet-related chronic disease combined with the lack of current data on patterns of food label use by the US population warrant re-examination of the use and potential influence of this public health tool. The purpose of this study was to describe the prevalence of food label use and the association between food label use and nutrient intake in a nationally representative sample of US adults who participated in the 2005-2006 National Health and Nutrition Examination Survey. Data on food label use were collected during the interview portion of the survey, and nutrient intake was estimated using the average of two 24-hour dietary recalls. In this sample, 61.6% of participants reported using the Nutrition Facts panel, 51.6% looked at the list of ingredients, 47.2% looked at serving size, and 43.8% reviewed health claims at least sometimes when deciding to purchase a food product. There were significant differences (P<0.05) in food label use across all demographic characteristics examined. Significant differences (P<0.05) in mean nutrient intake of total energy, total fat, saturated fat, cholesterol, sodium, dietary fiber, and sugars were observed between food label users and non-users with label users reporting healthier nutrient consumption. The greatest differences observed were for total energy and fat and for use of specific nutrient information on the food label. Despite food label use being associated with improved dietary factors, label use alone is not expected to be sufficient in modifying behavior ultimately leading to improved health outcomes. 2010 American Dietetic Association. Published by Elsevier Inc. All rights reserved.

Raman Spectroscopic Imaging of the Whole Ciona intestinalis Embryo during Development

PubMed Central

Nakamura, Mitsuru J.; Hotta, Kohji; Oka, Kotaro

2013-01-01

Intracellular composition and the distribution of bio-molecules play central roles in the specification of cell fates and morphogenesis during embryogenesis. Consequently, investigation of changes in the expression and distribution of bio-molecules, especially mRNAs and proteins, is an important challenge in developmental biology. Raman spectroscopic imaging, a non-invasive and label-free technique, allows simultaneous imaging of the intracellular composition and distribution of multiple bio-molecules. In this study, we explored the application of Raman spectroscopic imaging in the whole Ciona intestinalis embryo during development. Analysis of Raman spectra scattered from C. intestinalis embryos revealed a number of localized patterns of high Raman intensity within the embryo. Based on the observed distribution of bio-molecules, we succeeded in identifying the location and structure of differentiated muscle and endoderm within the whole embryo, up to the tailbud stage, in a label-free manner. Furthermore, during cell differentiation, we detected significant differences in cell state between muscle/endoderm daughter cells and daughter cells with other fates that had divided from the same mother cells; this was achieved by focusing on the Raman intensity of single Raman bands at 1002 or 1526 cm−1, respectively. This study reports the first application of Raman spectroscopic imaging to the study of identifying and characterizing differentiating tissues in a whole chordate embryo. Our results suggest that Raman spectroscopic imaging is a feasible label-free technique for investigating the developmental process of the whole embryo of C. intestinalis. PMID:23977129

The cholinergic basal forebrain in the ferret and its inputs to the auditory cortex

PubMed Central

Bajo, Victoria M; Leach, Nicholas D; Cordery, Patricia M; Nodal, Fernando R; King, Andrew J

2014-01-01

Cholinergic inputs to the auditory cortex can modulate sensory processing and regulate stimulus-specific plasticity according to the behavioural state of the subject. In order to understand how acetylcholine achieves this, it is essential to elucidate the circuitry by which cholinergic inputs influence the cortex. In this study, we described the distribution of cholinergic neurons in the basal forebrain and their inputs to the auditory cortex of the ferret, a species used increasingly in studies of auditory learning and plasticity. Cholinergic neurons in the basal forebrain, visualized by choline acetyltransferase and p75 neurotrophin receptor immunocytochemistry, were distributed through the medial septum, diagonal band of Broca, and nucleus basalis magnocellularis. Epipial tracer deposits and injections of the immunotoxin ME20.4-SAP (monoclonal antibody specific for the p75 neurotrophin receptor conjugated to saporin) in the auditory cortex showed that cholinergic inputs originate almost exclusively in the ipsilateral nucleus basalis. Moreover, tracer injections in the nucleus basalis revealed a pattern of labelled fibres and terminal fields that resembled acetylcholinesterase fibre staining in the auditory cortex, with the heaviest labelling in layers II/III and in the infragranular layers. Labelled fibres with small en-passant varicosities and simple terminal swellings were observed throughout all auditory cortical regions. The widespread distribution of cholinergic inputs from the nucleus basalis to both primary and higher level areas of the auditory cortex suggests that acetylcholine is likely to be involved in modulating many aspects of auditory processing. PMID:24945075

The origin of mesoderm in phoronids

NASA Technical Reports Server (NTRS)

Freeman, Gary; Martindale, Mark Q.

2002-01-01

Descriptive studies of phoronid development have concluded that the mesoderm of these animals originates from the endoderm during gastrulation. This interpretation has been tested by labeling one blastomere of 4- through 16-cell embryos and examining the position and germ layers occupied by the labeled clones of cells in the larva. No 2 injections gave rise to identical clones of cells, suggesting that the cleavage program does not generate cells of unique identity and that cell fates are established at later developmental time points. In many cases, a relatively large sector composed of ectodermal cells was labeled. When these labeled cells were adjacent to the mouth or anus of the larva, muscle and mesenchyme cells originated from the labeled clones. Under these circumstances, nerve cells also originated from these labeled sectors. These labeling studies also showed that endodermal cells can give rise to mesodermal and neural cells. These results suggest that nerve and muscle cells are induced to form at ectodermal-endodermal boundaries from both germ layers. These marking experiments also confirmed the observation that nerve cells originate both from the apical organ and the trunk region and show for the first time that the intestine originates by ingression of posterior ectoderm.

Food Labeling and Consumer Associations with Health, Safety, and Environment.

PubMed

Sax, Joanna K; Doran, Neal

2016-12-01

The food supply is complicated and consumers are increasingly calling for labeling on food to be more informative. In particular, consumers are asking for the labeling of food derived from genetically modified organisms (GMO) based on health, safety, and environmental concerns. At issue is whether the labels that are sought would accurately provide the information desired. The present study examined consumer (n = 181) perceptions of health, safety and the environment for foods labeled organic, natural, fat free or low fat, GMO, or non-GMO. Findings indicated that respondents consistently believed that foods labeled GMO are less healthy, safe and environmentally-friendly compared to all other labels (ps < .05). These results suggest that labels mean something to consumers, but that a disconnect may exist between the meaning associated with the label and the scientific consensus for GMO food. These findings may provide insight for the development of labels that provide information that consumers seek.

Evaluating the Impact of Menu Labeling on Food Choices and Intake

PubMed Central

Larsen, Peter D.; Agnew, Henry; Baik, Jenny; Brownell, Kelly D.

2010-01-01

Objectives. We assessed the impact of restaurant menu calorie labels on food choices and intake. Methods. Participants in a study dinner (n = 303) were randomly assigned to either (1) a menu without calorie labels (no calorie labels), (2) a menu with calorie labels (calorie labels), or (3) a menu with calorie labels and a label stating the recommended daily caloric intake for an average adult (calorie labels plus information). Food choices and intake during and after the study dinner were measured. Results. Participants in both calorie label conditions ordered fewer calories than those in the no calorie labels condition. When calorie label conditions were combined, that group consumed 14% fewer calories than the no calorie labels group. Individuals in the calorie labels condition consumed more calories after the study dinner than those in both other conditions. When calories consumed during and after the study dinner were combined, participants in the calorie labels plus information group consumed an average of 250 fewer calories than those in the other groups. Conclusions. Calorie labels on restaurant menus impacted food choices and intake; adding a recommended daily caloric requirement label increased this effect, suggesting menu label legislation should require such a label. Future research should evaluate menu labeling's impact on children's food choices and consumption. PMID:20019307

Immunoelectron microscopy in embryos.

PubMed

Sierralta, W D

2001-05-01

Immunogold labeling of proteins in sections of embryos embedded in acrylate media provides an important analytical tool when the resolving power of the electron microscope is required to define sites of protein function. The protocol presented here was established to analyze the role and dynamics of the activated protein kinase C/Rack1 regulatory system in the patterning and outgrowth of limb bud mesenchyme. With minor changes, especially in the composition of the fixative solution, the protocol should be easily adaptable for the postembedding immunogold labeling of any other antigen in tissues of embryos of diverse species. Quantification of the labeling can be achieved by using electron microscope systems capable of supporting digital image analysis. Copyright 2001 Academic Press.

Novel HLA-G-Binding Leukocyte Immunoglobulin-Like Receptor (LILR) Expression Patterns in Human Placentas and Umbilical Cords

PubMed Central

McIntire, Ramsey H.; Sifers, Travis; Platt, J. Sue; Ganacias, Karen G.; Langat, Daudi K.; Hunt, Joan S.

2008-01-01

Human placentas are sources of cytokines, hormones and other substances that program receptive cells. One of these substances is HLA-G, which influences the functioning of both leukocytes and endothelial cells. In this study we investigated the possibility that these and/or other types of cells in extraembryonic fetal tissues might respond to HLA-G by interacting with one or another of the leukocyte immunoglobulin-like receptors (LILR). LILRB1 is expressed by most leukocytes and LILRB2 is expressed primarily by monocytes, macrophages and dendritic cells. Analysis of term placentas by immunohistochemistry and Real Time PCR demonstrated that LILRB1 and LILRB2 protein and specific messages are produced in the mesenchyme of term villous placenta but are differently localized. LILRB1 was abundant in stromal cells and LILRB2 was prominent perivascularly. Neither receptor was identified in trophoblast. Further investigation using double label immunofluorescence indicated that placental vascular smooth muscle but not endothelia exhibit LILRB2. Term umbilical cord exhibited the same LILRB2 patterns as term placenta. Samples obtained by laser capture dissection of vascular smooth muscle in umbilical cords demonstrated LILRB2 mRNA, and double labeling immunofluorescence showed that cord vascular smooth muscle but not endothelium exhibited LILRB2 protein. The presence of LILRB1 in placental stromal cells and LILRB2 in vascular smooth muscle strongly suggest that HLA-G has novel functions in these tissues that could include regulation of placental immunity as well as development and function of the extraembryonic vasculature. PMID:18538388

Structural Basis of Cerebellar Microcircuits in the Rat

PubMed Central

Cerminara, Nadia L.; Aoki, Hanako; Loft, Michaela; Apps, Richard

2013-01-01

The topography of the cerebellar cortex is described by at least three different maps, with the basic units of each map termed “microzones,” “patches,” and “bands.” These are defined, respectively, by different patterns of climbing fiber input, mossy fiber input, and Purkinje cell (PC) phenotype. Based on embryological development, the “one-map” hypothesis proposes that the basic units of each map align in the adult animal and the aim of the present study was to test this possibility. In barbiturate anesthetized adult rats, nanoinjections of bidirectional tracer (Retrobeads and biotinylated dextran amine) were made into somatotopically identified regions within the hindlimb C1 zone in copula pyramidis. Injection sites were mapped relative to PC bands defined by the molecular marker zebrin II and were correlated with the pattern of retrograde cell labeling within the inferior olive and in the basilar pontine nuclei to determine connectivity of microzones and patches, respectively, and also with the distributions of biotinylated dextran amine-labeled PC terminals in the cerebellar nuclei. Zebrin bands were found to be related to both climbing fiber and mossy fiber inputs and also to cortical representation of different parts of the ipsilateral hindpaw, indicating a precise spatial organization within cerebellar microcircuitry. This precise connectivity extends to PC terminal fields in the cerebellar nuclei and olivonuclear projections. These findings strongly support the one-map hypothesis and suggest that, at the microcircuit level of resolution, the cerebellar cortex has a common plan of spatial organization for major inputs, outputs, and PC phenotype. PMID:24133249

Ethnicity and Sex Distinctions in Patterns of Aptitude Factor Scores in a Sample of Urban High School Seniors

ERIC Educational Resources Information Center

Hennessy, James J.; Merrifield, Philip R.

1978-01-01

Three aptitude factor scores for each of 2,985 college bound urban high school seniors were used to compare patterns and levels of performance by sex and ethnic group membership. Significant differences in levels of performance between Blacks, Hispanics, Caucasian Jewish, and Caucasian Gentile were found on factors labeled Verbal, Reasoning, and…

Mechanism of Activation of Enteric Nociceptive Neurons via Interaction of TLR4 and TRPV1 Receptors.

PubMed

Filippova, L V; Fedorova, A V; Nozdrachev, A D

2018-03-01

Evidence obtained by immunohistochemical double labeling and confocal laser scanning microscopy suggests that capsaicin, a ligand of the TRPV1 nociceptive vanilloid receptor, increases the number of TLR4-positive neurons in the rat colon myenteric plexus. In colitis caused by trinitrobenzene sulfonate, an increase in TRPV1 expression was more significant in both plexuses. Specific inhibitor of the TLR4 (C34) pattern-recognition receptor reduces TRPV1 expression in enteric neurons of both intact rats and rats with induced acute colitis. Thus, stimulation of nociceptive neurons by means of direct activation of their receptors of innate immunity (TLR4) is one of the possible mechanisms underlying the visceral pain in bacterial invasion and inflammatory bowel diseases.

"He Never Did Anything You Typically Think of as Abuse": Experiences With Violence in Controlling and Non-Controlling Relationships in a Non-Agency Sample of Women.

PubMed

Velonis, Alisa J

2016-08-01

Traditionally, any physical aggression within intimate relationships has been labeled "domestic violence," even as researchers and advocates continue to disagree about the nature of that phenomenon vis-à-vis gender and control. As part of a larger mixed-methods study, 22 women from a non-agency, community-based sample who reported experience with relationship violence were interviewed. The existence of patterned coercive and controlling behaviors substantially differentiated experiences with violence, suggesting this dynamic is at least as important to identify as physical violence. Although preliminary, the impact of these findings on intervention and prevention strategies and on the debate surrounding gender symmetry is discussed. © The Author(s) 2016.

Youths of Mexican Descent of the Southwest: Exploring Differences in Ethnic Labels

ERIC Educational Resources Information Center

Holley, Lynn C.; Salas, Lorraine Moya; Marsiglia, Flavio F.; Yabiku, Scott T.; Fitzharris, Blythe; Jackson, Kelly F.

2009-01-01

Knowledge of the factors that influence youths' choice of racial or ethnic labels would help us understand intragroup diversity, suggest ways in which school social workers can support youths' ethnic identity development, and learn whether youths who choose different combinations of labels may be grouped together for research purposes. This study…

Minding the gap between feminist identity and attitudes: the behavioral and ideological divide between feminists and non-labelers.

PubMed

Zucker, Alyssa N; Bay-Cheng, Laina Y

2010-12-01

Sexism persists in the contemporary United States and has deleterious effects on women and girls. This suggests that feminism--as a movement, a set of attitudes, or an explicit identity--is still warranted. Although feminist attitudes may buffer against the effects of sexism, notably in health domains, we suggest that there may be an ideological divide between those who hold such attitudes while rejecting the identity (non-labelers) and self-identified feminists. Non-labelers engage in less collective action on behalf of women's rights. On the basis of survey responses of 276 college students, non-labelers appear to be self-interested. We argue that disentangling attitudes from identity is crucial for sharpening predictions about the relation of feminism to other psychological and behavioral variables, and for engaging in broader social change. Furthermore, understanding whether non-labelers' rejection of feminist identity is rooted in fear of stigma associated with the label, neoliberal beliefs, or other explanations is important to those organizing for reform. © 2010 The Authors. Journal of Personality © 2010, Wiley Periodicals, Inc.

Taxonomic evaluation of selected Ganoderma species and database sequence validation

PubMed Central

Jargalmaa, Suldbold; Eimes, John A.; Park, Myung Soo; Park, Jae Young; Oh, Seung-Yoon

2017-01-01

Species in the genus Ganoderma include several ecologically important and pathogenic fungal species whose medicinal and economic value is substantial. Due to the highly similar morphological features within the Ganoderma, identification of species has relied heavily on DNA sequencing using BLAST searches, which are only reliable if the GenBank submissions are accurately labeled. In this study, we examined 113 specimens collected from 1969 to 2016 from various regions in Korea using morphological features and multigene analysis (internal transcribed spacer, translation elongation factor 1-α, and the second largest subunit of RNA polymerase II). These specimens were identified as four Ganoderma species: G. sichuanense, G. cf. adspersum, G. cf. applanatum, and G. cf. gibbosum. With the exception of G. sichuanense, these species were difficult to distinguish based solely on morphological features. However, phylogenetic analysis at three different loci yielded concordant phylogenetic information, and supported the four species distinctions with high bootstrap support. A survey of over 600 Ganoderma sequences available on GenBank revealed that 65% of sequences were either misidentified or ambiguously labeled. Here, we suggest corrected annotations for GenBank sequences based on our phylogenetic validation and provide updated global distribution patterns for these Ganoderma species. PMID:28761785

Collateralization of cerebellar output to functionally distinct brainstem areas. A retrograde, non-fluorescent tracing study in the rat

PubMed Central

Ruigrok, Tom J. H.; Teune, Thea M.

2014-01-01

The organization of the cerebellum is characterized by a number of longitudinally organized connection patterns that consist of matching olivo-cortico-nuclear zones. These entities, referred to as modules, have been suggested to act as functional units. The various parts of the cerebellar nuclei (CN) constitute the output of these modules. We have studied to what extent divergent and convergent patterns in the output of the modules to four, functionally distinct brain areas can be recognized. Two retrograde tracers were injected in various combinations of the following nuclei: the red nucleus (RN), as a main premotor nucleus; the prerubral area, as a main supplier of afferents to the inferior olive (IO); the nucleus reticularis tegmenti pontis (NRTP), as a main source of cerebellar mossy fibers; and the IO, as the source of climbing fibers. For all six potential combinations three cases were examined. All nine cases with combinations that involved the IO did not, or hardly, resulted in double labeled neurons. In contrast, all other combinations resulted in at least 10% and up to 67% of double labeled neurons in cerebellar nuclear areas where both tracers were found. These results show that the cerebellar nuclear neurons that terminate within the studied areas represent basically two intermingled populations of projection cells. One population corresponds to the small nucleo-olivary neurons whereas the other consists of medium- to large-sized neurons which are likely to distribute their axons to several other areas. Despite some consistent differences between the output patterns of individual modules we propose that modular cerebellar output to premotor areas such as the RN provides simultaneous feedback to both the mossy fiber and the climbing fiber system and acts in concert with a designated GABAergic nucleo-olivary circuit. These features seem to form a basic characteristic of cerebellar operation. PMID:24600356

Localisation pattern of homogalacturonan and arabinogalactan proteins in developing ovules of the gymnosperm plant Larix decidua Mill.

PubMed

Rafińska, Katarzyna; Bednarska, Elżbieta

2011-03-01

We have identified and characterised the temporal and spatial distribution of the homogalacturonan (HG) and arabinogalactan proteins (AGP) epitopes that are recognised by the antibodies JIM5, JIM7, LM2, JIM4, JIM8 and JIM13 during ovule differentiation in Larix decidua Mill. The results obtained clearly show differences in the pattern of localisation of specific HG epitopes between generative and somatic cells of the ovule. Immunocytochemical studies revealed that the presence of low-esterified HG is characteristic only of the wall of megasporocyte and megaspores. In maturing female gametophytes, highly esterified HG was the main form present, and the central vacuole of free nuclear gametophytes was particularly rich in this category of HG. This pool will probably be used in cell wall building during cellularisation. The selective labelling obtained with AGP antibodies indicates that some AGPs can be used as markers for gametophytic and sporophytic cells differentiation. Our results demonstrated that the AGPs recognised by JIM4 may constitute molecules determining changes in ovule cell development programs. Just after the end of meiosis, the signal detected with JIM4 labelling appeared only in functional and degenerating megaspores. This suggests that the antigens bound by JIM4 are involved in the initiation of female gametogenesis in L. decidua. Moreover, the analysis of AGPs distribution showed that differentiation of the nucellus cells occurs in the very young ovule stage before megasporogenesis. Throughout the period of ovule development, the pattern of localisation of the studied AGPs was different both in tapetum cells surrounding the gametophyte and in nucellus cells. Changes in the distribution of AGPs were also observed in the nucellus of the mature ovule, and they could represent an indicator of tissue arrangement to interact with the growing pollen tube. The possible role of AGPs in fertilisation is also discussed.

Advancing understanding of affect labeling with dynamic causal modeling

PubMed Central

Torrisi, Salvatore J.; Lieberman, Matthew D.; Bookheimer, Susan Y.; Altshuler, Lori L.

2013-01-01

Mechanistic understandings of forms of incidental emotion regulation have implications for basic and translational research in the affective sciences. In this study we applied Dynamic Causal Modeling (DCM) for fMRI to a common paradigm of labeling facial affect to elucidate prefrontal to subcortical influences. Four brain regions were used to model affect labeling, including right ventrolateral prefrontal cortex (vlPFC), amygdala and Broca’s area. 64 models were compared, for each of 45 healthy subjects. Family level inference split the model space to a likely driving input and Bayesian Model Selection within the winning family of 32 models revealed a strong pattern of endogenous network connectivity. Modulatory effects of labeling were most prominently observed following Bayesian Model Averaging, with the dampening influence on amygdala originating from Broca’s area but much more strongly from right vlPFC. These results solidify and extend previous correlation and regression-based estimations of negative corticolimbic coupling. PMID:23774393

The forced-choice paradigm and the perception of facial expressions of emotion.

PubMed

Frank, M G; Stennett, J

2001-01-01

The view that certain facial expressions of emotion are universally agreed on has been challenged by studies showing that the forced-choice paradigm may have artificially forced agreement. This article addressed this methodological criticism by offering participants the opportunity to select a none of these terms are correct option from a list of emotion labels in a modified forced-choice paradigm. The results show that agreement on the emotion label for particular facial expressions is still greater than chance, that artifactual agreement on incorrect emotion labels is obviated, that participants select the none option when asked to judge a novel expression, and that adding 4 more emotion labels does not change the pattern of agreement reported in universality studies. Although the original forced-choice format may have been prone to artifactual agreement, the modified forced-choice format appears to remedy that problem.

Enhancing the effectiveness of tobacco package warning labels: a social psychological perspective

PubMed Central

Strahan, E; White, K; Fong, G; Fabrigar, L; Zanna, M; Cameron, R

2002-01-01

Objective: To outline social psychological principles that could influence the psychosocial and behavioural effects of tobacco warning labels, and to inform the development of more effective tobacco warning labels. Data sources: PsycInfo and Medline literature searches and expert guided selection of principles and theories in social psychology and of tobacco warning labels, including articles, books, and reports. Conclusions: Tobacco warning labels represent a potentially effective method of influencing attitudes and behaviours. This review describes social psychological principles that could be used to guide the creation of more effective warning labels. The potential value of incorporating warning labels into a broader public health education campaign is discussed, and directions for future research are suggested. PMID:12198266

Empirical Determination of Pattern Match Confidence in Labeled Graphs

DTIC Science & Technology

2014-02-07

were explored; Erdős–Rényi [6] random graphs, Barabási–Albert preferential attachment graphs [2], and Watts– Strogatz [18] small world graphs. The ER...B. Erdos - Renyi Barabasi - Albert Gr ap h Ty pe Strogatz - Watts Direct Within 2 nodes Within 4 nodes Search Limit 1 10 100 1000 10000 100000 100...Barabási–Albert (BA, crosses) and Watts– Strogatz (WS, trian- gles) graphs were generated with sizes ranging from 50 to 2500 nodes, and labeled

Microtubules and cellulose microfibrils: how intimate is their relationship?

PubMed

Emons, Anne Mie C; Höfte, Herman; Mulder, Bela M

2007-07-01

The recent visualization of the motion of fluorescently labeled cellulose synthase complexes by Alexander Paredez and colleagues heralds the start of a new era in the science of the plant cell wall. Upon drug-induced complete depolymerization, the movement of the complexes does not become disordered but instead establishes an apparently self-organized novel pattern. The ability to label complexes in vivo has provided us with the ideal tool for tackling the intriguing question of the underlying default mechanisms at play.

Analysis of scanner data for crop inventories

NASA Technical Reports Server (NTRS)

Horvath, R. (Principal Investigator); Cicone, R. C.; Kauth, R. J.; Malila, W. A.; Pont, W.; Thelen, B.; Sellman, A.

1981-01-01

Accomplishments for a machine-oriented small grains labeler T&E, and for Argentina ground data collection are reported. Features of the small grains labeler include temporal-spectral profiles, which characterize continuous patterns of crop spectral development, and crop calendar shift estimation, which adjusts for planting date differences of fields within a crop type. Corn and soybean classification technology development for area estimation for foreign commodity production forecasting is reported. Presentations supporting quarterly project management reviews and a quarterly technical interchange meeting are also included.

In vitro transcription of two human rotaviruses.

PubMed Central

Flores, J; Myslinski, J; Kalica, A R; Greenberg, H B; Wyatt, R G; Kapikian, A Z; Chanock, R M

1982-01-01

The RNA polymerase activities of a cultivatable (Wa) and a noncultivatable (DS-1) strain of human rotavirus were studied. Under optimal conditions, transcription of all of their RNA segments occurred, as evidenced by the hybridization of labeled transcripts to genomic RNA. Cross-hybridization between the two viruses showed that none of their 11 genes were completely homologous. The transcription products could be translated in vitro, yielding proteins with an electrophoretic pattern resembling that obtained with proteins labeled in vivo during infection with the Wa virus. Images PMID:6292446

Effects of alternative label formats on choice of high- and low-sodium products in a New Zealand population sample.

PubMed

McLean, Rachael; Hoek, Janet; Hedderley, Duncan

2012-05-01

Dietary sodium reduction is a cost-effective public health intervention to reduce chronic disease. In response to calls for further research into front-of-pack labelling systems, we examined how alternative sodium nutrition label formats and nutrition claims influenced consumers' choice behaviour and whether consumers with or without a diagnosis of hypertension differed in their choice patterns. An anonymous online experiment in which participants viewed ten choice sets featuring three fictitious brands of baked beans with varied label formats and nutritional profiles (high and low sodium) and indicated which brand in each set they would purchase if shopping for this product. Participants were recruited from New Zealand's largest online nationwide research panel. Five hundred people with self-reported hypertension and 191 people without hypertension aged 18 to 79 years. The addition of a front-of-pack label increased both groups' ability to discriminate between products with high and low sodium, while the Traffic Light label enabled better identification of the high-sodium product. Both front-of-pack formats enhanced discrimination in the presence of a reduced salt claim, but the Traffic Light label also performed better than the Percentage Daily Intake label in moderating the effect of the claim for the high-sodium product. Front-of-pack labels, particularly those with simple visual cues, enhance consumers' ability to discriminate between high- and low-sodium products, even when those products feature nutrition claims.

Family food involvement and frequency of family dinner meals among Australian children aged 10-12years. Cross-sectional and longitudinal associations with dietary patterns.

PubMed

Leech, Rebecca M; McNaughton, Sarah A; Crawford, David A; Campbell, Karen J; Pearson, Natalie; Timperio, Anna

2014-04-01

Involvement in meal preparation and eating meals with the family are associated with better dietary patterns in adolescents, however little research has included older children or longitudinal study designs. This 3-year longitudinal study examines cross-sectional and longitudinal associations between family food involvement, family dinner meal frequency and dietary patterns during late childhood. Questionnaires were completed by parents of 188 children from Greater Melbourne, Australia at baseline in 2002 (mean age=11.25years) and at follow-up in 2006 (mean age=14.16years). Principal components analysis (PCA) was used to identify dietary patterns. Factor analysis (FA) was used to determine the principal factors from six indicators of family food involvement. Multiple linear regression models were used to predict the dietary patterns of children and adolescents at baseline and at follow-up, 3years later, from baseline indicators of family food involvement and frequency of family dinner meals. PCA revealed two dietary patterns, labeled a healthful pattern and an energy-dense pattern. FA revealed one factor for family food involvement. Cross-sectionally among boys, family food involvement score (β=0.55, 95% CI: 0.02, 1.07) and eating family dinner meals daily (β=1.11, 95% CI: 0.27, 1.96) during late childhood were positively associated with the healthful pattern. Eating family dinner meals daily was inversely associated with the energy-dense pattern, cross-sectionally among boys (β=-0.56, 95% CI: -1.06, -0.06). No significant cross-sectional associations were found among girls and no significant longitudinal associations were found for either gender. Involvement in family food and eating dinner with the family during late childhood may have a positive influence on dietary patterns of boys. No evidence was found to suggest the effects on dietary patterns persist into adolescence. Copyright © 2014 Elsevier Ltd. All rights reserved.

Food patterns of Australian children ages 9 to 13 y in relation to ω-3 long chain polyunsaturated intake.

PubMed

Rahmawaty, Setyaningrum; Lyons-Wall, Philippa; Batterham, Marijka; Charlton, Karen; Meyer, Barbara J

2014-02-01

The aim of this study was to examine food patterns of Australian children ages 9 to 13 y in relation to ω-3 long-chain polyunsaturated fatty acid (ω-3 LCPUFA) intake. Secondary analysis was conducted on nationally representative food data of 1110 Australian children ages 9 to 13 y (525 boys and 585 girls) that was obtained using two 24-h recalls. Principle component factor analysis was used to identify food patterns. Discriminant function analysis was used to identify the relationship between the food patterns and total ω-3 LCPUFA intake. Four major food patterns emerged for each sex. For boys these were labeled: "snack foods," "soft drinks," "vegetables," and "pork and meat chops, steak, and mince." For girls they were labeled: "vegetables," "take-away," "tea, coffee, iced coffee drinks" and "canned meals and soup." Fish consumption bought from take-away outlets was more frequently consumed in the "soft drink" (r = 0.577) and take-away (r = 0.485) food pattern in boys and girls, respectively. In contrast, fish prepared at home was more often consumed in "vegetables" in both boys (r = 0.018) and girls (r = 0.106), as well as in the "pork and meat chops, steak and mince" food pattern in boys (r = 0.060). There was a trend that in boys, the "vegetables" group discriminated children who consumed ω-3 LCPUFA levels similar to adequate intakes (AI) (P = 0.067), whereas in girls, the take-away food pattern discriminated for being a fish consumer (P = 0.060). Dietary patterns associated with a high consumption of vegetables and "take-aways" food that include meat and fish are likely to positively influence dietary ω-3 LCPUFA intake in Australian children. Copyright © 2014 Elsevier Inc. All rights reserved.

Safety Case Patterns: Theory and Applications

NASA Technical Reports Server (NTRS)

Denney, Ewen W.; Pai, Ganesh J.

2015-01-01

We develop the foundations for a theory of patterns of safety case argument structures, clarifying the concepts involved in pattern specification, including choices, labeling, and well-founded recursion. We specify six new patterns in addition to those existing in the literature. We give a generic way to specify the data required to instantiate patterns and a generic algorithm for their instantiation. This generalizes earlier work on generating argument fragments from requirements tables. We describe an implementation of these concepts in AdvoCATE, the Assurance Case Automation Toolset, showing how patterns are defined and can be instantiated. In particular, we describe how our extended notion of patterns can be specified, how they can be instantiated in an interactive manner, and, finally, how they can be automatically instantiated using our algorithm.

The pattern of thalamocortical and brain stem projections to the vibrissae-related sensory and motor cortices in de-whiskered congenital hypothyroid rats.

PubMed

Afarinesh, Mohammad Reza; Behzadi, Gila

2017-08-01

The present study is designed to investigate the plastic organization of the thalamo-cortical (TC) and brain stem afferents of whisker primary sensory (wS1) and motor (wM1) cortical areas in congenital hypothyroid (CH) pups following whisker deprivation (WD) from neonatal to adolescence period. Maternal hypothyroidism was induced by adding propylthiouracil (PTU) to the drinking water from early embryonic day 16 to postnatal day (PND) 60. Pregnant rats were divided into intact and CH groups (n = 8). In each group, the total whiskers of pups (4 of 8) were trimmed continuously from PND 1 to PND 60. Retrograde tracing technique with WGA-HRP was performed in the present study. Retrogradely labeled neurons were observed in the specific thalamic nuclei (VPM and VL) following separately WGA-HRP injections into wS1/M1 cortical areas. The number of labeled cells in the VPM, VL, VM and PO nuclei of the thalamus significantly decreased in CH offsprings rats (P < 0.05). Neonatal WD did not show any significant effects on the number of VPM, VL, VM and PO labeled projection neurons to wS1 and wM1 cortical areas. In addition, retrogradely labeled neurons in dorsal raphe (DR) and locus coeruleus (LC) nuclei were observed in all experimental groups. The number of DR and LC labeled neurons were higher in the CH and whisker deprived groups compared to their matching controls (P < 0.05). Upon our results, CH and WD had no synergic or additive effects on the TC and brain stem afferent patterns of barrel sensory and motor cortices.

Glycoconjugate pattern of membranes in the acinar cell of the rat pancreas.

PubMed

Willemer, S; Köhler, H; Naumann, R; Kern, H F; Adler, G

1990-01-01

Lectin-binding studies were performed at the ultrastructural level to characterize glycoconjugate patterns on membrane systems in pancreatic acinar cells of the rat. Five lectins reacting with different sugar moieties were applied to ultrathin frozen sections: concanavalin A (ConA): glucose, mannose; wheat-germ agglutinin (WGA): N-acetylglucosamine, sialic acid; Ricinus communis agglutinin I (RCA I): galactose; Ulex europaeus agglutinin I (UEA I): L-fucose; soybean agglutinin (SBA): N-acetylgalactosamine). Binding sites of lectins were visualized either by direct conjugation to colloidal gold or by the use of a three-step procedure involving additional immune reactions. The rough endoplasmic reticulum and the nuclear envelope of acinar cells was selectively labelled for ConA. The membranes of the Golgi apparatus bound all lectins applied with an increasing intensity proceeding from the cis- to the trans-Golgi area for SBA, UEA I and WGA. In contrast RCA I selectively labelled the trans-Golgi cisternae. The membranes of condensing vacuoles and zymogen granules were labelled for all lectins used although the density of the label differed between the lectins. In contrast the content of zymogen granules failed to bind SBA and WGA. Lysosomal bodies (membranes and content) revealed binding sites for all lectins used. The plasma membranes were heavily labelled by all lectins except for SBA which showed only a weak binding to the lateral and the apical plasma membrane. These results are in accordance to current biochemical knowledge of the successive steps in the glycosylation of membrane proteins. It could be demonstrated, that the cryo-section technique is suitable for the fine structural localisation of surface glycoconjugates of plasma membranes and internal membranes in pancreatic acinar cells using plant lectins.

Effects of oxygen and redox oscillation on degradation of cell-associated lipids in surficial marine sediments

NASA Astrophysics Data System (ADS)

Sun, Ming-Y. i.; Aller, Robert C.; Lee, Cindy; Wakeham, Stuart G.

2002-06-01

Degradation patterns of sedimentary algal lipids were tracked with time under variable redox treatments designed to mimic conditions in organic-rich, bioturbated deposits. Uniformly 13C-labeled algae were mixed with Long Island Sound surface muddy sediments and exposed to different redox regimes, including continuously oxic and anoxic, and oscillated oxic: anoxic conditions. Concentrations of several 13C-labeled algal fatty acids (16:1, 16:0 and 18:1), phytol and an alkene were measured serially. Results showed a large difference (∼10×) in first-order degradation rate constants of cell-associated lipids between continuously oxic and anoxic conditions. Exposure to oxic conditions increased the degradation of cell-associated lipids, and degradation rate constants were positive functions (linear or nonlinear) of the fraction of time sediments were oxic. Production of two new 13C-labeled compounds (iso-15:0 fatty acid and hexadecanol) further indicated that redox conditions and oxic: anoxic oscillations strongly affect microbial degradation of algal lipids and net synthesis of bacterial biomass. Production of 13C-labeled iso-15:0 fatty acid (a bacterial biomarker) was inversely proportional to the fraction of time sediments were oxic, rapidly decreasing after 10 days of incubation under oxic and frequently oscillated conditions. Turnover of bacterial biomass was faster under continuously or occasionally oxic conditions than under continuously anoxic conditions. 13C-labeled hexadecanol, an intermediate degradation product, accumulated under anoxic conditions but not under oxic or periodically oxic conditions. The frequency of oxic: anoxic oscillation clearly alters both the rate and pathways of lipid degradation in surficial sediments. Terminal degradation efficiency and lipid products from degradation of algal material depend on specific patterns of redox fluctuations.

Carbon transitions from either Calvin cycle or transitory starch to heteroglycans as revealed by (14) C-labeling experiments using protoplasts from Arabidopsis.

PubMed

Malinova, Irina; Steup, Martin; Fettke, Joerg

2013-09-01

Plants metabolize transitory starch by precisely coordinated plastidial and cytosolic processes. The latter appear to include the action of water-soluble heteroglycans (SHGin ) whose monosaccharide pattern is similar to that of apoplastic glycans (SHGex ) but, unlike SHGex , SHGin strongly interacts with glucosyl transferases. In this study, we analyzed starch metabolism using mesophyll protoplasts from wild-type plants and two knock-out mutants [deficient in the cytosolic transglucosidase, disproportionating isoenzyme 2 (DPE2) or the plastidial phosphoglucomutase (PGM1)] from Arabidopsis thaliana. Protoplasts prelabeled by photosynthetic (14) CO2 fixation were transferred to an unlabeled medium and were darkened or illuminated. Carbon transitions from the Calvin cycle or from starch to both SHGin and SHGex were analyzed. In illuminated protoplasts, starch turn-over was undetectable but darkened protoplasts continuously degraded starch. During illumination, neither the total (14) C content nor the labeling patterns of the sugar residues of SHGin were significantly altered but both the total amount and the labeling of the constituents of SHGex increased with time. In darkened protoplasts, the (14) C-content of most of the sugar residues of SHGin transiently and strongly increased and then declined. This effect was not observed in any SHGex constituent. In darkened DPE2-deficient protoplasts, none of the SHGin constituents exhibited an essential transient increase in labeling. In contrast, some residues of SHGin from the PGM1 mutant exhibited a transient increase in label but this effect significantly differed from that of the wild type. Two conclusions are reached: first, SHGin and SHGex exert different metabolic functions and second, SHGin is directly involved in starch degradation. © 2013 Scandinavian Plant Physiology Society.

Food and the consumer: could labelling be the answer?

PubMed

Kerr, Maeve A; McCann, Mary T; Livingstone, M Barbara E

2015-05-01

Extensive research into the impact of nutrition labelling across Europe has shown that many consumers can effectively use a nutrition label to rank a food for healthiness. The present paper considers observational and laboratory evidence which has examined the impact of nutrition labelling (on food packaging and at point of purchase) on dietary behaviour. In addition, the potential counterproductive effects of foods bearing 'healthy' nutrition labels are examined. The observational evidence provides a useful insight into the key characteristics of nutrition label use. Those most likely to engage with nutrition labels are more likely to have a diet related disease and/or be on a weight loss diet and have a good overall diet quality. Experimental evidence, while limited, suggests that serving size information may be overlooked by consumers. In fact, there may be a tendency among consumers to overeat foods that are perceived to be healthier. The findings from the present paper suggest that if nutrition labelling is to be considered a strategy to facilitate consumers in managing their energy intake, it must coincide with salient, consistent and simple serving size information on the front of food packages and at the point of purchase. There is a clear need for more experimental research using robust methodologies, to examine the impact of nutrition information on dietary intake. In the meantime, there should be greater attention given to portion size within national dietary guidance.

Localization and characterization of angiotensin II receptor binding and angiotensin converting enzyme in the human medulla oblongata.

PubMed

Allen, A M; Chai, S Y; Clevers, J; McKinley, M J; Paxinos, G; Mendelsohn, F A

1988-03-08

Angiotensin II receptor and angiotensin converting enzyme distributions in the human medulla oblongata were localised by quantitative in vitro autoradiography. Angiotensin II receptors were labelled with the antagonist analogue 125I-[Sar1, Ile8] AII while angiotensin converting enzyme was labelled with 125I-351A, a derivative of the specific converting enzyme inhibitor, lisinopril. Angiotensin II receptor binding and angiotensin converting enzyme are present in high concentrations in the nucleus of the solitary tract, the dorsal motor nucleus of vagus, the rostral and caudal ventrolateral reticular nucleus, and in a band connecting the dorsal and ventral regions. In the rostral and caudal ventrolateral reticular nucleus, angiotensin II receptors are distributed in a punctate pattern that registers with neuronal cell bodies. The distribution and density of these cell bodies closely resemble those of catecholamine-containing neurones mapped by others. In view of the known interactions of angiotensin II with both central and peripheral catecholamine-containing neurons of laboratory animals, the current anatomical findings suggest similar interactions between these neuroactive compounds in the human central nervous system. The presence of angiotensin II receptors and angiotensin converting enzyme in the nucleus of the solitary tract, dorsal motor nucleus of vagus, and rostral and caudal ventrolateral reticular nucleus demonstrates sites for central angiotensin II to exert its known actions on vasopressin release and autonomic functions including blood pressure control. These data also suggest a possible interaction between angiotensin II and central catecholeminergic systems.

Sensing site-specific structural characteristics and chirality using vibrational circular dichroism of isotope labeled peptides.

PubMed

Keiderling, Timothy A

2017-12-01

Isotope labeling has a long history in chemistry as a tool for probing structure, offering enhanced sensitivity, or enabling site selection with a wide range of spectroscopic tools. Chirality sensitive methods such as electronic circular dichroism are global structural tools and have intrinsically low resolution. Consequently, they are generally insensitive to modifications to enhance site selectivity. The use of isotope labeling to modify vibrational spectra with unique resolvable frequency shifts can provide useful site-specific sensitivity, and these methods have been recently more widely expanded in biopolymer studies. While the spectral shifts resulting from changes in isotopic mass can provide resolution of modes from specific parts of the molecule and can allow detection of local change in structure with perturbation, these shifts alone do not directly indicate structure or chirality. With vibrational circular dichroism (VCD), the shifted bands and their resultant sign patterns can be used to indicate local conformations in labeled biopolymers, particularly if multiple labels are used and if their coupling is theoretically modeled. This mini-review discusses selected examples of the use of labeling specific amides in peptides to develop local structural insight with VCD spectra. © 2017 Wiley Periodicals, Inc.

Subcellular localization of proteins in the anaerobic sulfate reducer Desulfovibrio vulgaris via SNAP-tag labeling and photoconversion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gorur, A.; Leung, C. M.; Jorgens, D.

2010-06-01

Systems Biology studies the temporal and spatial 3D distribution of macromolecular complexes with the aim that such knowledge will allow more accurate modeling of biological function and will allow mathematical prediction of cellular behavior. However, in order to accomplish accurate modeling precise knowledge of spatial 3D organization and distribution inside cells is necessary. And while a number of macromolecular complexes may be identified by its 3D structure and molecular characteristics alone, the overwhelming number of proteins will need to be localized using a reporter tag. GFP and its derivatives (XFPs) have been traditionally employed for subcelllar localization using photoconversion approaches,more » but this approach cannot be taken for obligate anaerobic bacteria, where the intolerance towards oxygen prevents XFP approaches. As part of the GTL-funded PCAP project (now ENIGMA) genetic tools have been developed for the anaerobe sulfate reducer Desulfovibrio vulgaris that allow the high-throughput generation of tagged-protein mutant strains, with a focus on the commercially available SNAP-tag cell system (New England Biolabs, Ipswich, MA), which is based on a modified O6-alkylguanine-DNA alkyltransferase (AGT) tag, that has a dead-end reaction with a modified O6-benzylguanine (BG) derivative and has been shown to function under anaerobic conditions. After initial challenges with respect to variability, robustness and specificity of the labeling signal we have optimized the labeling. Over the last year, as a result of the optimized labeling protocol, we now obtain robust labeling of 20 out of 31 SNAP strains. Labeling for 13 strains were confirmed at least five times. We have also successfully performed photoconversion on 5 of these 13 strains, with distinct labeling patterns for different strains. For example, DsrC robustly localizes to the periplasmic portion of the inner membrane, where as a DNA-binding protein localizes to the center of the cell, where the chromosome is located. Two other proteins - Thiosulfate reductase and ATP binding protein were found to be cytoplasmically distributed, whereas a molybdenum transporter was found to locate to the cell periphery. We judge labeling outcome by (1) SDS gel electrophoresis, followed by direct fluorescence imaging of the gel to address specificity of labeling/confirm expected molecular weight, and subsequent Coomassie analysis to ensure comparable protein levels (2) fluorescence intensity of culture by plate reader for statistical sampling (after adjustment for respective cell numbers) and (3) fluorescence microscopy for addressing cell-to-cell signal variation and potential localization patterns. All three assays were usually found to be consistent with one another. While we have been able to improve the efficacy of photoconversion by drastically reducing (eliminating) non-specific binding with our altered labeling protocol, we are currently working on reducing non-specific photoconversion reaction arising occasionally in non-labeled cells. In addition, we have confirmed the presence of SNAP tagged constructs in three recently cloned E.coli strains under promotor control, and are in the process of utilizing them for evaluating the sensitivity of the photoconversion protocol. Fluorescent Activated Cell Sorting was successfully applied to labeled E.coli cells containing SNAP tagged AtpA protein. Different batches of sorted cells, representing low and high labeling intensity, were re-grown and re-labeled and displayed a labeling efficiency similar to the starter culture, supporting the notion that cell-to-cell differences in labeling reflect difference in protein expression, rather then genetic differences.« less

Backbone dynamics of a model membrane protein: assignment of the carbonyl carbon /sup 13/C NMR resonances in detergent-solubilized M13 coat protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, G.D.; Weiner, J.H.; Sykes, B.D.

The major coat protein of the filamentous bacteriophage M13 is a 50-residue amphiphilic polypeptide which is inserted, as an integral membrane-spanning protein, in the inner membrane of the Escherichia coli host during infection. /sup 13/C was incorporated biosynthetically into a total of 23 of the peptide carbonyls using labeled amino acids (alanine, glycine, lysine, phenylalanine, and proline). The structure and dynamics of carbonyl-labeled M13 coat protein were monitored by /sup 13/C nuclear magnetic resonance (NMR) spectroscopy. Assignment of many resonances was achieved by using protease digestion, pH titration, or labeling of the peptide bond with both /sup 13/C and /supmore » 15/N. The carbonyl region of the natural-abundance /sup 13/C NMR spectrum of M13 coat protein in sodium dodecyl sulfate solution shows approximately eight backbone carbonyl resonances with line widths much narrower than the rest. Three of these more mobile residues correspond to assigned peaks (glycine-3, lysine-48, and alanine-49) in the individual amino acid spectra, and another almost certainly arises from glutamic acid-2. A ninth residue, alanine-1, also gives rise to a very narrow carbonyl resonance if the pH is well above or below the pK/sub a/ of the terminal amino group. These data suggest that only about four residues at either end of the protein experience large-amplitude spatial fluctuations; the rest of the molecule is essentially rigid on the time scale of the overall rotational tumbling of the protein-detergent complex. The relative exposure of different regions of detergent-bound protein was monitored by limited digestion with proteinase K. Comparable spectra and digestion patterns were obtained when the protein was solubilized in sodium deoxycholate, suggesting that the coat protein binds both amphiphiles in a similar fashion.« less

Lung respiratory rhythm and pattern generation in the bullfrog: role of neurokinin-1 and mu-opioid receptors.

PubMed

Davies, B L; Brundage, C M; Harris, M B; Taylor, B E

2009-07-01

Location of the lung respiratory rhythm generator (RRG) in the bullfrog brainstem was investigated by examining neurokinin-1 and mu-opioid receptor (NK1R, muOR) colocalization by immunohistochemistry and characterizing the role of these receptors in lung rhythm and episodic pattern generation. NK1R and muOR occurred in brainstems from all developmental stages. In juvenile bullfrogs a distinct area of colocalization was coincident with high-intensity fluorescent labeling of muOR; high-intensity labeling of muOR was not distinctly and consistently localized in tadpole brainstems. NK1R labeling intensity did not change with development. Similarity in colocalization is consistent with similarity in responses to substance P (SP, NK1R agonist) and DAMGO (muOR agonist) when bath applied to bullfrog brainstems of different developmental stages. In early stage tadpoles and juvenile bullfrogs, SP increased and DAMGO decreased lung burst frequency. In juvenile bullfrogs, SP increased lung burst frequency, episode frequency, but decreased number of lung bursts per episode and lung burst duration. In contrast, DAMGO decreased lung burst frequency and burst cycle frequency, episode frequency, and number of lung bursts per episode but increased all other lung burst parameters. Based on these results, we hypothesize that NK1R and muOR colocalization together with a metamorphosis-related increase in muOR intensity marks the location of the lung RRG but not necessarily the lung episodic pattern generator.

ALE: automated label extraction from GEO metadata.

PubMed

Giles, Cory B; Brown, Chase A; Ripperger, Michael; Dennis, Zane; Roopnarinesingh, Xiavan; Porter, Hunter; Perz, Aleksandra; Wren, Jonathan D

2017-12-28

NCBI's Gene Expression Omnibus (GEO) is a rich community resource containing millions of gene expression experiments from human, mouse, rat, and other model organisms. However, information about each experiment (metadata) is in the format of an open-ended, non-standardized textual description provided by the depositor. Thus, classification of experiments for meta-analysis by factors such as gender, age of the sample donor, and tissue of origin is not feasible without assigning labels to the experiments. Automated approaches are preferable for this, primarily because of the size and volume of the data to be processed, but also because it ensures standardization and consistency. While some of these labels can be extracted directly from the textual metadata, many of the data available do not contain explicit text informing the researcher about the age and gender of the subjects with the study. To bridge this gap, machine-learning methods can be trained to use the gene expression patterns associated with the text-derived labels to refine label-prediction confidence. Our analysis shows only 26% of metadata text contains information about gender and 21% about age. In order to ameliorate the lack of available labels for these data sets, we first extract labels from the textual metadata for each GEO RNA dataset and evaluate the performance against a gold standard of manually curated labels. We then use machine-learning methods to predict labels, based upon gene expression of the samples and compare this to the text-based method. Here we present an automated method to extract labels for age, gender, and tissue from textual metadata and GEO data using both a heuristic approach as well as machine learning. We show the two methods together improve accuracy of label assignment to GEO samples.

50 CFR 216.91 - Dolphin-safe labeling standards.

Code of Federal Regulations, 2013 CFR

2013-10-01

... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of..., distributor, or seller of any tuna products that are exported from or offered for sale in the United States to... suggests that the tuna contained in the products were harvested using a method of fishing that is not...

50 CFR 216.91 - Dolphin-safe labeling standards.

Code of Federal Regulations, 2010 CFR

2010-10-01

... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of..., distributor, or seller of any tuna products that are exported from or offered for sale in the United States to... suggests that the tuna contained in the products were harvested using a method of fishing that is not...

50 CFR 216.91 - Dolphin-safe labeling standards.

Code of Federal Regulations, 2012 CFR

2012-10-01

... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of..., distributor, or seller of any tuna products that are exported from or offered for sale in the United States to... suggests that the tuna contained in the products were harvested using a method of fishing that is not...

50 CFR 216.91 - Dolphin-safe labeling standards.

Code of Federal Regulations, 2014 CFR

2014-10-01

... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of..., distributor, or seller of any tuna products that are exported from or offered for sale in the United States to... suggests that the tuna contained in the products were harvested using a method of fishing that is not...

50 CFR 216.91 - Dolphin-safe labeling standards.

Code of Federal Regulations, 2011 CFR

2011-10-01

... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of..., distributor, or seller of any tuna products that are exported from or offered for sale in the United States to... suggests that the tuna contained in the products were harvested using a method of fishing that is not...

Use of Questions in Exhibit Labels to Generate Explanatory Conversation among Science Museum Visitors

ERIC Educational Resources Information Center

Hohenstein, Jill; Tran, Lynn Uyen

2007-01-01

Research suggests that conversations at museums contribute to, as well as serve as evidence for, learning. Many museums use labels to provide visitors with information as well as stimulate conversation about exhibit topics. However, most studies on exhibit labels do not centre on conversations. This investigation uses a Vygotskian framework to…

Serotonin projection patterns to the cochlear nucleus.

PubMed

Thompson, A M; Thompson, G C

2001-07-13

The cochlear nucleus is well known as an obligatory relay center for primary auditory nerve fibers. Perhaps not so well known is the neural input to the cochlear nucleus from cells containing serotonin that reside near the midline in the midbrain raphe region. Although the specific locations of the main, if not sole, sources of serotonin within the dorsal cochlear nucleus subdivision are known to be the dorsal and median raphe nuclei, sources of serotonin located within other cochlear nucleus subdivisions are not currently known. Anterograde tract tracing was used to label fibers originating from the dorsal and median raphe nuclei while fluorescence immunohistochemistry was used to simultaneously label specific serotonin fibers in cat. Biotinylated dextran amine was injected into the dorsal and median raphe nuclei and was visualized with Texas Red, while serotonin was visualized with fluorescein. Thus, double-labeled fibers were unequivocally identified as serotoninergic and originating from one of the labeled neurons within the dorsal and median raphe nuclei. Double-labeled fiber segments, typically of fine caliber with oval varicosities, were observed in many areas of the cochlear nucleus. They were found in the molecular layer of the dorsal cochlear nucleus, in the small cell cap region, and in the granule cell and external regions of the cochlear nuclei, bilaterally, of all cats. However, the density of these double-labeled fiber segments varied considerably depending upon the exact region in which they were found. Fiber segments were most dense in the dorsal cochlear nucleus (especially in the molecular layer) and the large spherical cell area of the anteroventral cochlear nucleus; they were moderately dense in the small cell cap region; and fiber segments were least dense in the octopus and multipolar cell regions of the posteroventral cochlear nucleus. Because of the presence of labeled fiber segments in subdivisions of the cochlear nucleus other than the dorsal cochlear nucleus, we concluded that the serotoninergic projection pattern to the cochlear nucleus is divergent and non-specific. Double-labeled fiber segments were also present, but sparse, in the superior olive, localized mainly in periolivary regions; this indicated that the divergence of dorsal and median raphe neurons that extends throughout regions of the cochlear nucleus also extended well beyond the cochlear nucleus to include at least the superior olivary complex as well.

Butch bottom-femme top? An exploration of lesbian stereotypes.

PubMed

Walker, Ja'Nina J; Golub, Sarit A; Bimbi, David S; Parsons, Jeffrey T

2012-01-01

Lesbian gender labels (i.e., butch, soft butch, butch/femme, femme, and high femme) have set the stage for assumptions about lesbian attractions to sexual behaviors. This study explored the intersection of lesbian gender labels and attraction to sexual behaviors in 214 lesbian-identified women. Participants ranged in age from 18 to 69 with 48% being women of color. Contrary to stereotypes about sexual behavior in the lesbian community, very few differences emerged in regard to lesbian gender label. Overall, results do not support stereotypes about lesbian gender labels and suggest that behaviors in the lesbian community are fluid across labels.

Patterns in clinical students' self-regulated learning behavior: a Q-methodology study.

PubMed

Berkhout, Joris J; Teunissen, Pim W; Helmich, Esther; van Exel, Job; van der Vleuten, Cees P M; Jaarsma, Debbie A D C

2017-03-01

Students feel insufficiently supported in clinical environments to engage in active learning and achieve a high level of self-regulation. As a result clinical learning is highly demanding for students. Because of large differences between students, supervisors may not know how to support them in their learning process. We explored patterns in undergraduate students' self-regulated learning behavior in the clinical environment, to improve tailored supervision, using Q-methodology. Q-methodology uses features of both qualitative and quantitative methods for the systematic investigation of subjective issues by having participants sort statements along a continuum to represent their opinion. We enrolled 74 students between December 2014 and April 2015 and had them characterize their learning behavior by sorting 52 statements about self-regulated learning behavior and explaining their response. The statements used for the sorting were extracted from a previous study. The data was analyzed using by-person factor analysis to identify clusters of individuals with similar sorts of the statements. The resulting factors and qualitative data were used to interpret and describe the patterns that emerged. Five resulting patterns were identified in students' self-regulated learning behavior in the clinical environment, which we labelled: Engaged, Critically opportunistic, Uncertain, Restrained and Effortful. The five patterns varied mostly regarding goals, metacognition, communication, effort, and dependence on external regulation for learning. These discrete patterns in students' self-regulated learning behavior in the clinical environment are part of a complex interaction between student and learning context. The results suggest that developing self-regulated learning behavior might best be supported regarding individual students' needs.

The influence of personal patterns of behavior on the physiological effects of woodland walking.

PubMed

Toda, Masahiro; Takeshita, Tatsuya

2015-01-01

The effects of forest walking are once again being recognized; however, few studies have investigated individual variations in the effects of forest walking. The objective of the current study was to investigate the influence of individual patterns of behavior on the physiological effects of walking through woodland. The study employed a crossover, open-label, single-group, self-controlled design. This study was conducted in the forest on Ikoma Mountain, at the eastern edge of Osaka Prefecture in Japan. Participants were 20 healthy males, selected randomly from a population of members at a nonprofit organization with a mean age of 67.6 y. Moving from the start of a mountain path to an observation platform, participants took a 1000-m walk through the forest. On another day, participants remained in their offices. Patterns of personal behavior were assessed preintervention by written questionnaire, identifying type A and type B behavior patterns. Salivary chromogranin A (CgA) levels were determined immediately before and after the walk as well as at 20 min after and 40 min after its end. On the day when participants sat in their offices, control samples were collected at the same times as on the day of the walk. In the type B-behavior pattern group, a significant increase in the levels of CgA occurred after the walk. No change was observed in the type A-behavior pattern group. The findings suggest that walking in woodland may bring about positive health benefits, particularly to individuals with type B characteristics.

Defining the "like" in "begetting the like": The development of inductive inference in the domain of biology

NASA Astrophysics Data System (ADS)

Lo, Ya-Fen

There are evidences that very young children consider linguistic labels when making similarity judgment and inductive inferences. However, it remains unclear how labels contribute to young children's similarity judgment and inductive inferences. It has been demonstrated that labels facilitate categorical memberships about objects in young children's similarity judgment and inductive inferences. It is also suggested that young children should rely on several sources of information when making similarity judgment and inductive inferences. Three experiments were conducted to examine these interpretations, in which biological information, labeling information, and perceptual similarity information were varied in a systematic manner. Three- to eleven-year-old children were asked to judge which of two Test animals a baby animals would share biological properties with. In Experiment 1, preschool children demonstrated a basic understanding of the importance of biological information for generalizing biological properties. In Experiment 2, when the labeling information became available, young children relied on linguistic labels rather than on biological information when generalizing biological properties. At the same time, 9- to 11-year-old children relied consistently on biological information. Experiment 3 supported the results of Experiment 2 and suggested that in addition to labels, perceptual similarity also contributed to children's inductive inferences.

Dietary patterns and the risk of esophageal squamous cell carcinoma: A population-based case-control study in a rural population.

PubMed

Liu, Xudong; Wang, Xiaorong; Lin, Sihao; Lao, Xiangqian; Zhao, Jin; Song, Qingkun; Su, Xuefen; Tak-Sun Yu, Ignatius

2017-02-01

Few studies were available in exploring the roles of dietary patterns in the development of esophageal cancer, especially in China. This study aimed to investigate the roles of dietary patterns in the risk of esophageal squamous cell carcinoma (ESCC) in a Chinese rural population. A population-based cases-control study was designed and conducted in Yanting County, Sichuan Province of China during two years (between June 2011 and May 2013). A total of 942 pairs of ESCC cases and controls were recruited. A food frequency questionnaire was adopted to collect information of dietary consumption. Dietary patterns were extracted by using principle component and factor analysis based on 24 dietary groups. Odds ratios (ORs) with 95% confidence intervals (95% CI) were calculated by using logistic regression model, with adjustment for possible confounding variables. Four major dietary patterns were identified, which were labeled as "prudent", "vegetable and fruits", "processed food" and "alcohol drinking". In comparison of the highest with the lowest quartiles of pattern scores, the processed food pattern (OR: 2.84, 95% CI: 2.13-3.80) and alcohol drinking pattern (OR: 2.69, 95% CI: 1.95-3.71) were significantly associated with an increased risk of ESCC, while the vegetable and fruit pattern (OR: 0.70, 95% CI: 0.53-0.92) was associated with reduced risk by 30%. The prudent pattern was associated with a reduced risk by 33% (OR: 0.67, 95% CI: 0.50-0.88) in a multivariate logistic regression model, but no statistical significance was reached in a composite model. The results suggest an important role of dietary patterns in ESCC. Diets rich in vegetables and fruits may decrease the risk of ESCC, whereas diets rich in processed food and drinking alcohol may increase the risk. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Isotopic studies of metabolic systems by mass spectrometry: using Pascal's triangle to produce biological standards with fully controlled labeling patterns.

PubMed

Millard, Pierre; Massou, Stéphane; Portais, Jean-Charles; Létisse, Fabien

2014-10-21

Mass spectrometry (MS) is widely used for isotopic studies of metabolism in which detailed information about biochemical processes is obtained from the analysis of isotope incorporation into metabolites. The biological value of such experiments is dependent on the accuracy of the isotopic measurements. Using MS, isotopologue distributions are measured from the quantitative analysis of isotopic clusters. These measurements are prone to various biases, which can occur during the experimental workflow and/or MS analysis. The lack of relevant standards limits investigations of the quality of the measured isotopologue distributions. To meet that need, we developed a complete theoretical and experimental framework for the biological production of metabolites with fully controlled and predictable labeling patterns. This strategy is valid for different isotopes and different types of metabolisms and organisms, and was applied to two model microorganisms, Pichia augusta and Escherichia coli, cultivated on (13)C-labeled methanol and acetate as sole carbon source, respectively. The isotopic composition of the substrates was designed to obtain samples in which the isotopologue distribution of all the metabolites should give the binomial coefficients found in Pascal's triangle. The strategy was validated on a liquid chromatography-tandem mass spectrometry (LC-MS/MS) platform by quantifying the complete isotopologue distributions of different intracellular metabolites, which were in close agreement with predictions. This strategy can be used to evaluate entire experimental workflows (from sampling to data processing) or different analytical platforms in the context of isotope labeling experiments.

Localization of Ulex europaeus agglutinin-I (UEA-I) in the developing gustatory epithelium of the rat.

PubMed

Taniguchi, Ryo; Shi, Lei; Honma, Shiho; Fujii, Masae; Ueda, Katsura; El-Sharaby, Ashraf; Wakisaka, Satoshi

2004-09-01

To understand the development of the gustatory structures necessitates a reliable marker for both immature and mature taste buds. It has been reported that the intragemmal cells within the taste buds of adult rats were bound to Ulex europaeus agglutinin-I (UEA-I), a specific lectin for alpha-linked fucose, but it has not been determined whether immature taste buds, i.e. taste buds without an apparent taste pore, are labeled with UEA-I. The present study was conducted to examine the UEA-I binding pattern during the development of the rat gustatory epithelium. In adult animals, UEA-I bound to the membrane of taste buds in all examined regions of the gustatory epithelium. Within the individual taste buds, UEA-I labeled almost all intragemmal cells. The binding of UEA-I was occasionally detected below the keratinized layer of the trench wall epithelium but could not be found in the lingual epithelium of the adult animal. During the development of circumvallate papilla, some cells within the immature taste buds were also labeled with UEA-I. The developmental changes in the UEA-I binding pattern in fungiform papillae were almost identical to those in the circumvallate papilla: both immature and mature taste buds were labeled with UEA-I. The present results indicate that UEA-I is a specific lectin for the intragemmal cells of both immature and mature taste buds and, thus, UEA-I can be used as a reliable marker for all taste buds in the rat.

Cell type-specific expression of FoxP2 in the ferret and mouse retina.

PubMed

Sato, Chihiro; Iwai-Takekoshi, Lena; Ichikawa, Yoshie; Kawasaki, Hiroshi

2017-04-01

Although the anatomical and physiological properties of subtypes of retinal ganglion cells (RGCs) have been extensively investigated, their molecular properties are still unclear. Here, we examined the expression patterns of FoxP2 in the retina of ferrets and mice. We found that FoxP2 was expressed in small subsets of neurons in the adult ferret retina. FoxP2-positive neurons in the ganglion cell layer were divided into two groups. Large FoxP2-positive neurons expressed Brn3a and were retrogradely labeled with cholera toxin subunit B injected into the optic nerve, indicating that they are RGCs. The soma size and the projection pattern of FoxP2-positive RGCs were consistent with those of X cells. Because we previously reported that FoxP2 was selectively expressed in X cells in the ferret lateral geniculate nucleus (LGN), our findings indicate that FoxP2 is specifically expressed in the parvocellular pathway from the retina to the LGN. Small FoxP2-positive neurons were positive for GAD65/67, suggesting that they are GABAergic amacrine cells. Most Foxp2-positive cells were RGCs in the adult mouse retina. Dendritic morphological analyses suggested that Foxp2-positive RGCs included direction-selective RGCs in mice. Thus, our findings suggest that FoxP2 is expressed in specific subtypes of RGCs in the retina of ferrets and mice. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

Pushing the limits for amplifying BrdU-labeled DNA encoding 16S rRNA: DNA polymerase as the determining factor.

PubMed

Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A

2010-12-01

Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.

Developmental differences in the neural mechanisms of facial emotion labeling

PubMed Central

Adleman, Nancy E.; Kim, Pilyoung; Oakes, Allison H.; Hsu, Derek; Reynolds, Richard C.; Chen, Gang; Pine, Daniel S.; Brotman, Melissa A.; Leibenluft, Ellen

2016-01-01

Adolescence is a time of increased risk for the onset of psychological disorders associated with deficits in face emotion labeling. We used functional magnetic resonance imaging (fMRI) to examine age-related differences in brain activation while adolescents and adults labeled the emotion on fearful, happy and angry faces of varying intensities [0% (i.e. neutral), 50%, 75%, 100%]. Adolescents and adults did not differ on accuracy to label emotions. In the superior temporal sulcus, ventrolateral prefrontal cortex and middle temporal gyrus, adults show an inverted-U-shaped response to increasing intensities of fearful faces and a U-shaped response to increasing intensities of happy faces, whereas adolescents show the opposite patterns. In addition, adults, but not adolescents, show greater inferior occipital gyrus activation to negative (angry, fearful) vs positive (happy) emotions. In sum, when subjects classify subtly varying facial emotions, developmental differences manifest in several ‘ventral stream’ brain regions. Charting the typical developmental course of the brain mechanisms of socioemotional processes, such as facial emotion labeling, is an important focus for developmental psychopathology research. PMID:26245836

Discriminant analysis for fast multiclass data classification through regularized kernel function approximation.

PubMed

Ghorai, Santanu; Mukherjee, Anirban; Dutta, Pranab K

2010-06-01

In this brief we have proposed the multiclass data classification by computationally inexpensive discriminant analysis through vector-valued regularized kernel function approximation (VVRKFA). VVRKFA being an extension of fast regularized kernel function approximation (FRKFA), provides the vector-valued response at single step. The VVRKFA finds a linear operator and a bias vector by using a reduced kernel that maps a pattern from feature space into the low dimensional label space. The classification of patterns is carried out in this low dimensional label subspace. A test pattern is classified depending on its proximity to class centroids. The effectiveness of the proposed method is experimentally verified and compared with multiclass support vector machine (SVM) on several benchmark data sets as well as on gene microarray data for multi-category cancer classification. The results indicate the significant improvement in both training and testing time compared to that of multiclass SVM with comparable testing accuracy principally in large data sets. Experiments in this brief also serve as comparison of performance of VVRKFA with stratified random sampling and sub-sampling.

An oligonucleotide array for the identification and differentiation of bacteria pathogenic on potato.

PubMed

Fessehaie, Anania; De Boer, Solke H; Lévesque, C André

2003-03-01

ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.

Multidimensionality of the relationship between social status and dietary patterns in early childhood: longitudinal results from the French EDEN mother-child cohort.

PubMed

Camara, Soumaïla; de Lauzon-Guillain, Blandine; Heude, Barbara; Charles, Marie-Aline; Botton, Jérémie; Plancoulaine, Sabine; Forhan, Anne; Saurel-Cubizolles, Marie-Josèphe; Dargent-Molina, Patricia; Lioret, Sandrine

2015-09-24

The association between socioeconomic position and diet in early childhood has mainly been addressed based on maternal education and household income. We aimed to assess the influence of a variety of social factors from different socio-ecological levels (parents, household and child-care) on multi-time point dietary patterns identified from 2 to 5 y. This study included 974 children from the French EDEN mother-child cohort. Two multi-time point dietary patterns were derived in a previous study: they correspond to consistent exposures to either core- or non-core foods across 2, 3 and 5 y and were labelled "Guidelines" and "Processed, fast-foods". The associations of various social factors collected during pregnancy (age, education level) or at 2-y follow-up (mother's single status, occupation, work commitments, household financial disadvantage, presence of older siblings and child-care arrangements) with each of the two dietary patterns, were assessed by multivariable linear regression analysis. The adherence to a diet close to "Guidelines" was positively and independently associated with both maternal and paternal education levels. The adherence to a diet consistently composed of processed and fast-foods was essentially linked with maternal variables (younger age and lower education level), household financial disadvantage, the presence of older sibling (s) and being cared for at home by someone other than the mother. Multiple social factors operating at different levels (parents, household, and child-care) were found to be associated with the diet of young children. Different independent predictors were found for each of the two longitudinal dietary patterns, suggesting distinct pathways of influence. Our findings further suggest that interventions promoting healthier dietary choices for young children should involve both parents and take into account not only household financial disadvantage but also maternal age, family size and options for child-care.

Do nutrition labels improve dietary outcomes?

PubMed

Variyam, Jayachandran N

2008-06-01

The disclosure of nutritional characteristics of most packaged foods became mandatory in the United States with the implementation of the Nutrition Labeling and Education Act (NLEA) in 1994. Under the NLEA regulations, a 'Nutrition Facts' panel displays information on nutrients such as calories, total and saturated fats, cholesterol, and sodium in a standardized format. By providing nutrition information in a credible, distinctive, and easy-to-read format, the new label was expected to help consumers choose healthier, more nutritious diets. This paper examines whether the disclosure of nutrition information through the mandatory labels impacted consumer diets. Assessing the dietary effects of labeling is problematic due to the confounding of the label effect with unobserved label user characteristics. This self-selection problem is addressed by exploiting the fact that the NLEA exempts away-from-home foods from mandatory labeling. Difference-in-differences models that account for zero away-from-home intakes suggest that the labels increase fiber and iron intakes of label users compared with label nonusers. In comparison, a model that does not account for self-selection implies significant label effects for all but two of the 13 nutrients that are listed on the label.

Distribution of fluorescently labeled tubulin injected into sand dollar eggs from fertilization through cleavage.

PubMed

Hamaguchi, Y; Toriyama, M; Sakai, H; Hiramoto, Y

1985-04-01

Porcine brain tubulin labeled with fluorescein isothiocyanate (FITC) was able to polymerize by itself and co-polymerize with tubulin purified from starfish sperm flagella. When we injected the FITC-labeled tubulin into unfertilized eggs of the sand dollar, Clypeaster japonicus, and the eggs were then fertilized, the labeled tubulin was incorporated into the sperm aster. When injected into fertilized eggs at streak stage, the tubulin was quickly incorporated into each central region of growing asters. It was clearly visualized that the labeled tubulin, upon reaching metaphase, accumulated in the mitotic apparatus and later disappeared over the cytoplasm during interphase. The accumulation of the fluorescence in the mitotic apparatus was observed repeatedly at successive cleavage. After lysis of the fertilized eggs with a microtubule-stabilizing solution, fluorescent fibrous structures around the nucleus and those of the sperm aster and the mitotic apparatus were preserved and coincided with the fibrous structures observed by polarization and differential interference microscopy. We found the FITC-labeled tubulin to be incorporated into the entire mitotic apparatus within 20-30 s when injected into the eggs at metaphase or anaphase. This rapid incorporation of the labeled tubulin into the mitotic apparatus suggests that the equilibrium between mitotic microtubules and tubulin is attained very rapidly in the living eggs. Axonemal tubulin purified from starfish sperm flagella and labeled with FITC was also incorporated into microtubular structures in the same fashion as the FITC-labeled brain tubulin. These results suggest that even FITC-labeled heterogeneous tubulins undergo spatial and stage-specific regulation of assembly-disassembly in the same manner as does sand dollar egg tubulin.

Distribution of fluorescently labeled tubulin injected into sand dollar eggs from fertilization through cleavage

PubMed Central

1985-01-01

Porcine brain tubulin labeled with fluorescein isothiocyanate (FITC) was able to polymerize by itself and co-polymerize with tubulin purified from starfish sperm flagella. When we injected the FITC- labeled tubulin into unfertilized eggs of the sand dollar, Clypeaster japonicus, and the eggs were then fertilized, the labeled tubulin was incorporated into the sperm aster. When injected into fertilized eggs at streak stage, the tubulin was quickly incorporated into each central region of growing asters. It was clearly visualized that the labeled tubulin, upon reaching metaphase, accumulated in the mitotic apparatus and later disappeared over the cytoplasm during interphase. The accumulation of the fluorescence in the mitotic apparatus was observed repeatedly at successive cleavage. After lysis of the fertilized eggs with a microtubule-stabilizing solution, fluorescent fibrous structures around the nucleus and those of the sperm aster and the mitotic apparatus were preserved and coincided with the fibrous structures observed by polarization and differential interference microscopy. We found the FITC-labeled tubulin to be incorporated into the entire mitotic apparatus within 20-30 s when injected into the eggs at metaphase or anaphase. This rapid incorporation of the labeled tubulin into the mitotic apparatus suggests that the equilibrium between mitotic microtubules and tubulin is attained very rapidly in the living eggs. Axonemal tubulin purified from starfish sperm flagella and labeled with FITC was also incorporated into microtubular structures in the same fashion as the FITC-labeled brain tubulin. These results suggest that even FITC-labeled heterogeneous tubulins undergo spatial and stage-specific regulation of assembly-disassembly in the same manner as does sand dollar egg tubulin. PMID:3920225

49 CFR 575.301 - Vehicle labeling of safety rating information (applicable unless a vehicle is subject to § 575.302).

Code of Federal Regulations, 2011 CFR

2011-10-01

.... The purpose of this section is to aid potential purchasers in the selection of new passenger motor vehicles by providing them with safety rating information developed by NHTSA in its New Car Assessment... label means the label placed on new automobiles with the manufacturer's suggested retail price and other...

The mechanism of vascular leakage induced by leukotriene E4. Endothelial contraction.

PubMed Central

Joris, I.; Majno, G.; Corey, E. J.; Lewis, R. A.

1987-01-01

This study identifies the microvascular target of leukotriene E4 (LTE4) by vascular labeling with carbon black and establishes the mechanism of its action at the cellular level by electron microscopy. LTE4 and its tripeptide precursor, leukotriene C4 (LTC4) were injected subcutaneously in guinea pigs. With LTE4, venular labeling was intense at 1000 and 100 ng and slight at 10 ng, with extinction at 1 ng. LTC4 induced a ring of labeled venules around a blank central area, suggestive of vasospasm. The nonpeptidyl leukotriene LTB4 induced no labeling. Histamine (1000 ng) induced an area of vascular labeling about equal to that by 1000 ng LTE4, but the labeling of individual venules was more intense. By electron microscopy, LTE4 was found to induce gaps in the endothelium of the venules; the endothelial cells adjacent to the gaps bulged into the lumen and showed wrinkled nuclei, consistent with cellular contraction. This ultrastructural evidence suggests that LTE4 increases vascular permeability by contraction of endothelial cells selectively, in the postcapillary venules, as was previously demonstrated for other inflammatory mediators, including histamine, serotonin, and bradykinin. Images Figure 2 Figure 3 Figure 4 PMID:3028143

High affinity receptor labeling based on basic leucine zipper domain peptides conjugated with pH-sensitive fluorescent dye: Visualization of AMPA-type glutamate receptor endocytosis in living neurons.

PubMed

Hayashi, Ayako; Asanuma, Daisuke; Kamiya, Mako; Urano, Yasuteru; Okabe, Shigeo

2016-01-01

Techniques to visualize receptor trafficking in living neurons are important, but currently available methods are limited in their labeling efficiency, specificity and reliability. Here we report a method for receptor labeling with a basic leucine zipper domain peptide (ZIP) and a binding cassette specific to ZIP. Receptors are tagged with a ZIP-binding cassette at their extracellular domain. Tagged receptors expressed in cultured cells were labeled with exogenously applied fluorescently labeled ZIP with low background and high affinity. To test if ZIP labeling is useful in monitoring endocytosis and intracellular trafficking, we next conjugated ZIP with a pH-sensitive dye RhP-M (ZIP-RhP-M). ZIP binding to its binding cassette was pH-resistant and RhP-M fluorescence dramatically increased in acidic environment. Thus AMPA-type glutamate receptors (AMPARs) labeled by ZIP-RhP-M can report receptor endocytosis and subsequent intracellular trafficking. Application of ZIP-RhP-M to cultured hippocampal neurons expressing AMPARs tagged with a ZIP-binding cassette resulted in appearance of fluorescent puncta in PSD-95-positive large spines, suggesting local endocytosis and acidification of AMPARs in individual mature spines. This spine pool of AMPARs in acidic environment was distinct from the early endosomes labeled by transferrin uptake. These results suggest that receptor labeling by ZIP-RhP-M is a useful technique for monitoring endocytosis and intracellular trafficking. This article is part of the Special Issue entitled 'Synaptopathy--from Biology to Therapy'. Copyright © 2015 Elsevier Ltd. All rights reserved.

Covalent modification of proteins by ligands of steroid hormone receptors.

PubMed Central

Takahashi, N; Breitman, T R

1992-01-01

Retinoylation, acylation with retinoic acid (RA), is a covalent modification of proteins occurring in a variety of eukaryotic cell lines. In this study, we found that proteins in HL-60 cells were labeled by 17 beta-[3H]estradiol (E2), [3H]progesterone (Pg), 1 alpha,25-dihydroxy[3H]vitamin D3 [1,25(OH)2D3], [125I]triiodothyronine (T3), [125I]thyroxine (T4), and [3H]prostaglandin E2 (PGE2). All of these hormones, except PGE2, are ligands of the steroid hormone receptor family. Addition to the growth medium of 5 microM ketoconazole, an inhibitor of cytochrome P450-dependent enzymes, increased about 2-fold the labeling of proteins by T3, T4, 1,25(OH)2D3, and PGE2. In contrast, ketoconazole did not change markedly the extent of labeling by RA, E2, or Pg. Alkaline methanolysis, which cleaves ester bonds, released variable percentages of the radioactive ligands bound to protein. These values were about 80% for RA and PGE2; 50% for T3, T4, and Pg; and 20% for E2 and 1,25(OH)2D3. Treatment with thioether-cleavage reagents, iodomethane or Raney nickel catalyst, released < 2% of the covalently bound ligands. Two-dimensional polyacrylamide gel electrophoresis patterns of labeled proteins were unique for each ligand. Proteins of M(r) 47,000 and 51,000 were labeled by RA, E2, T3, and T4. These proteins had the same mobilities as RI and RII, the cAMP-binding regulatory subunits of type I and type II cAMP-dependent protein kinases. 1,25(OH)2D3 also bound to proteins of M(r) 47,000 and 51,000. However, these proteins had pI values different from those of RI or RII. These results suggest that some activities of ligands of the steroid hormone receptor family and of PGE2 may be mediated by their covalent modification of proteins. Images PMID:1438281

A simple approach to patterned protein immobilization on silicon via electrografting from diazonium salt solutions.

PubMed

Flavel, Benjamin S; Gross, Andrew J; Garrett, David J; Nock, Volker; Downard, Alison J

2010-04-01

A highly versatile method utilizing diazonium salt chemistry has been developed for the fabrication of protein arrays. Conventional ultraviolet mask lithography was used to pattern micrometer sized regions into a commercial photoresist on a highly doped p-type silicon (100) substrate. These patterned regions were used as a template for the electrochemical grafting of the in situ generated p-aminobenzenediazonium cation to form patterns of aminophenyl film on silicon. Immobilization of biomolecules was demonstrated by coupling biotin to the aminophenyl regions followed by reaction with fluorescently labeled avidin and visualization with fluorescence microscopy. This simple patterning strategy is promising for future application in biosensor devices.

Carbon Allocation of 13CO2-labeled Photoassimilate in Larix gmelinii Saplings - A Physiological Basis for Isotope Dendroclimatology in Eastern Siberia.

NASA Astrophysics Data System (ADS)

Kagawa, A.; Sugimoto, A.; Maximov, T. C.

2006-12-01

Tree-ring density and widths have been successfully used to reconstruct summer temperatures in high- northern latitudes, although a discrepancy between tree-growth and temperature has been found for recent decades. The so-called "reduced sensitivity" of tree rings to summer temperatures has been observed especially strongly in northern Siberia (Briffa et al., 1998) and drought stress (increased water use efficiency) arose from global warming and/or increasing CO2 are suggested as causes (Barber et al. 2000, Saurer et al. 2004). By using carbon isotope ratio as an indicator of drought stress and ring-width/density as indicators of growth, we can clarify how drought stress caused by recent global warming affects wood formation of Siberian trees. However, isotope dendroclimatology is still in its infancy and our understanding of basic physiological processes of isotope signal transfer from leaves to tree rings is insufficient. In order to understand translocation, storage, and allocation of photoassimilate to different organs of trees, we pulse- labeled ten L. gmelinii growing in a continuous permafrost zone with stable 13CO2. We studied seasonal course of carbon allocation patterns of photoassimilate among needles, branches, stem and roots and also how spring, summer, and autumn photoassimilate is later used for both earlywood and latewood formation. About half of the carbon in new needles was derived from stored material. The starch pool in non- needle parts, which can be used for xylem formation, drew about 43 percent of its carbon from previous year's photoassimilate, suggesting that carbon storage is the key mechanism behind autocorrelation in (isotope) dendroclimatology. Analysis of intra-annual 13C of the tree rings formed after the labeling revealed that earlywood contained photoassimilate from the previous summer and autumn as well as from the current spring. Latewood was mainly composed of photoassimilate from the current year's summer/autumn, although it also relied on stored material in some cases. Carbon isotope chronology of recent 100 years shows that the latewood 13C contains stronger climate signal than the earlywood and is significantly correlated to July temperature and July precipitation, corresponding to the timing of carbon incorporation that constitutes latewood. The results suggest the need for separating earlywood and latewood for isotope dendroclimatological study in Siberia. References: 1) Kagawa A., Sugimoto A., & Maximov, T.C. (2006) 13CO2 pulse-labelling of photoassimilates reveals carbon allocation within and between tree rings. Plant, Cell and Environment 29, 1571-1584. 2) Kagawa A., Sugimoto A., & Maximov, T. C. (2006) Seasonal course of translocation, storage, and remobilization of 13C pulse-labeled photoassimilate in naturally growing Larix gmelinii saplings. New Phytologist 171, 793-804. 3) Kagawa A., Naito D., Sugimoto A. & Maximov T. C. (2003) Effects of spatial and temporal variability in soil moisture on widths and 13C values of eastern Siberian tree rings. Journal of Geophysical Research 108 (D16), 4500, doi:10.1029/2002JD003019.

Myosin isoform switching during assembly of the Drosophila flight muscle thick filament lattice.

PubMed

Orfanos, Zacharias; Sparrow, John C

2013-01-01

During muscle development myosin molecules form symmetrical thick filaments, which integrate with the thin filaments to produce the regular sarcomeric lattice. In Drosophila indirect flight muscles (IFMs) the details of this process can be studied using genetic approaches. The weeP26 transgenic line has a GFP-encoding exon inserted into the single Drosophila muscle myosin heavy chain gene, Mhc. The weeP26 IFM sarcomeres have a unique MHC-GFP-labelling pattern restricted to the sarcomere core, explained by non-translation of the GFP exon following alternative splicing. Characterisation of wild-type IFM MHC mRNA confirmed the presence of an alternately spliced isoform, expressed earlier than the major IFM-specific isoform. The two wild-type IFM-specific MHC isoforms differ by the presence of a C-terminal 'tailpiece' in the minor isoform. The sequential expression and assembly of these two MHCs into developing thick filaments suggest a role for the tailpiece in initiating A-band formation. The restriction of the MHC-GFP sarcomeric pattern in weeP26 is lifted when the IFM lack the IFM-specific myosin binding protein flightin, suggesting that it limits myosin dissociation from thick filaments. Studies of flightin binding to developing thick filaments reveal a progressive binding at the growing thick filament tips and in a retrograde direction to earlier assembled, proximal filament regions. We propose that this flightin binding restricts myosin molecule incorporation/dissociation during thick filament assembly and explains the location of the early MHC isoform pattern in the IFM A-band.

Interactions of Nitrifying Bacteria and Heterotrophs: Identification of a Micavibrio-Like Putative Predator of Nitrospira spp.

PubMed Central

Dolinšek, Jan; Lagkouvardos, Ilias; Wanek, Wolfgang; Wagner, Michael

2013-01-01

Chemolithoautotrophic nitrifying bacteria release soluble organic compounds, which can be substrates for heterotrophic microorganisms. The identities of these heterotrophs and the specificities of their interactions with nitrifiers are largely unknown. In this study, we incubated nitrifying activated sludge with 13C-labeled bicarbonate and used stable isotope probing of 16S rRNA to monitor the flow of carbon from uncultured nitrifiers to heterotrophs. To facilitate the identification of heterotrophs, the abundant 16S rRNA molecules from nitrifiers were depleted by catalytic oligonucleotides containing locked nucleic acids (LNAzymes), which specifically cut the 16S rRNA of defined target organisms. Among the 13C-labeled heterotrophs were organisms remotely related to Micavibrio, a microbial predator of Gram-negative bacteria. Fluorescence in situ hybridization revealed a close spatial association of these organisms with microcolonies of nitrite-oxidizing sublineage I Nitrospira in sludge flocs. The high specificity of this interaction was confirmed by confocal microscopy and a novel image analysis method to quantify the localization patterns of biofilm microorganisms in three-dimensional (3-D) space. Other isotope-labeled bacteria, which were affiliated with Thermomonas, colocalized less frequently with nitrifiers and thus were commensals or saprophytes rather than specific symbionts or predators. These results suggest that Nitrospira spp. are subject to bacterial predation, which may influence the abundance and diversity of these nitrite oxidizers and the stability of nitrification in engineered and natural ecosystems. In silico screening of published next-generation sequencing data sets revealed a broad environmental distribution of the uncultured Micavibrio-like lineage. PMID:23335755

Distinct neural representations of placebo and nocebo effect

PubMed Central

Freeman, Sonya; Yu, Rongjun; Egorova, Natalia; Chen, Xiaoyan; Kirsch, Irving; Claggett, Brian; Kaptchuk, Ted J.; Gollub, Randy L.; Kong, Jian

2015-01-01

Expectations shape the way we experience the world. In this study, we used fMRI to investigate how positive and negative expectation can changes pain experiences in the same cohort of subjects. We first manipulated subjects’ treatment expectation of the effectiveness of three inert creams, with one cream labeled “Lidocaine” (positive expectancy), one labeled “Capsaicin” (negative expectancy) and one labeled “Neutral” by surreptitiously decreasing, increasing, or not changing respectively, the intensity of the noxious stimuli administered following cream application. We then used fMRI to investigate the signal changes associated with administration of identical pain stimuli before and after the treatment and control creams. Twenty-four healthy adults completed the study. Results showed expectancy significantly modulated subjective pain ratings. After controlling for changes in the neutral condition, the subjective pain rating changes evoked by positive and negative expectancy were significantly associated. fMRI results showed that the expectation of an increase in pain induced significant fMRI signal changes in the insula, orbitofrontal cortex, and periaqueductal gray, whereas the expectation of pain relief evoked significant fMRI signal changes in the striatum. No brain regions were identified as common to both “Capsaicin” and “Lidocaine” conditioning. There was also no significant association between the brain response to identical noxious stimuli in the pain matrix evoked by positive and negative expectancy. Our findings suggest that positive and negative expectancy engage different brain networks to modulate our pain experiences, but, overall, these distinct patterns of neural activation result in a correlated placebo and nocebo behavioral response. PMID:25776211

Single-unit labeling of medial olivocochlear neurons: the cochlear frequency map for efferent axons.

PubMed

Brown, M Christian

2014-06-01

Medial olivocochlear (MOC) neurons are efferent neurons that project axons from the brain to the cochlea. Their action on outer hair cells reduces the gain of the "cochlear amplifier," which shifts the dynamic range of hearing and reduces the effects of noise masking. The MOC effects in one ear can be elicited by sound in that ipsilateral ear or by sound in the contralateral ear. To study how MOC neurons project onto the cochlea to mediate these effects, single-unit labeling in guinea pigs was used to study the mapping of MOC neurons for neurons responsive to ipsilateral sound vs. those responsive to contralateral sound. MOC neurons were sharply tuned to sound frequency with a well-defined characteristic frequency (CF). However, their labeled termination spans in the organ of Corti ranged from narrow to broad, innervating between 14 and 69 outer hair cells per axon in a "patchy" pattern. For units responsive to ipsilateral sound, the midpoint of innervation was mapped according to CF in a relationship generally similar to, but with more variability than, that of auditory-nerve fibers. Thus, based on CF mappings, most of the MOC terminations miss outer hair cells involved in the cochlear amplifier for their CF, which are located more basally. Compared with ipsilaterally responsive neurons, contralaterally responsive neurons had an apical offset in termination and a larger span of innervation (an average of 10.41% cochlear distance), suggesting that when contralateral sound activates the MOC reflex, the actions are different than those for ipsilateral sound. Copyright © 2014 the American Physiological Society.

Single-unit labeling of medial olivocochlear neurons: the cochlear frequency map for efferent axons

PubMed Central

2014-01-01

Medial olivocochlear (MOC) neurons are efferent neurons that project axons from the brain to the cochlea. Their action on outer hair cells reduces the gain of the “cochlear amplifier,” which shifts the dynamic range of hearing and reduces the effects of noise masking. The MOC effects in one ear can be elicited by sound in that ipsilateral ear or by sound in the contralateral ear. To study how MOC neurons project onto the cochlea to mediate these effects, single-unit labeling in guinea pigs was used to study the mapping of MOC neurons for neurons responsive to ipsilateral sound vs. those responsive to contralateral sound. MOC neurons were sharply tuned to sound frequency with a well-defined characteristic frequency (CF). However, their labeled termination spans in the organ of Corti ranged from narrow to broad, innervating between 14 and 69 outer hair cells per axon in a “patchy” pattern. For units responsive to ipsilateral sound, the midpoint of innervation was mapped according to CF in a relationship generally similar to, but with more variability than, that of auditory-nerve fibers. Thus, based on CF mappings, most of the MOC terminations miss outer hair cells involved in the cochlear amplifier for their CF, which are located more basally. Compared with ipsilaterally responsive neurons, contralaterally responsive neurons had an apical offset in termination and a larger span of innervation (an average of 10.41% cochlear distance), suggesting that when contralateral sound activates the MOC reflex, the actions are different than those for ipsilateral sound. PMID:24598524

The cholinergic basal forebrain in the ferret and its inputs to the auditory cortex.

PubMed

Bajo, Victoria M; Leach, Nicholas D; Cordery, Patricia M; Nodal, Fernando R; King, Andrew J

2014-09-01

Cholinergic inputs to the auditory cortex can modulate sensory processing and regulate stimulus-specific plasticity according to the behavioural state of the subject. In order to understand how acetylcholine achieves this, it is essential to elucidate the circuitry by which cholinergic inputs influence the cortex. In this study, we described the distribution of cholinergic neurons in the basal forebrain and their inputs to the auditory cortex of the ferret, a species used increasingly in studies of auditory learning and plasticity. Cholinergic neurons in the basal forebrain, visualized by choline acetyltransferase and p75 neurotrophin receptor immunocytochemistry, were distributed through the medial septum, diagonal band of Broca, and nucleus basalis magnocellularis. Epipial tracer deposits and injections of the immunotoxin ME20.4-SAP (monoclonal antibody specific for the p75 neurotrophin receptor conjugated to saporin) in the auditory cortex showed that cholinergic inputs originate almost exclusively in the ipsilateral nucleus basalis. Moreover, tracer injections in the nucleus basalis revealed a pattern of labelled fibres and terminal fields that resembled acetylcholinesterase fibre staining in the auditory cortex, with the heaviest labelling in layers II/III and in the infragranular layers. Labelled fibres with small en-passant varicosities and simple terminal swellings were observed throughout all auditory cortical regions. The widespread distribution of cholinergic inputs from the nucleus basalis to both primary and higher level areas of the auditory cortex suggests that acetylcholine is likely to be involved in modulating many aspects of auditory processing. © 2014 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

A nodal domain theorem for integrable billiards in two dimensions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Samajdar, Rhine; Jain, Sudhir R., E-mail: srjain@barc.gov.in

Eigenfunctions of integrable planar billiards are studied — in particular, the number of nodal domains, ν of the eigenfunctions with Dirichlet boundary conditions are considered. The billiards for which the time-independent Schrödinger equation (Helmholtz equation) is separable admit trivial expressions for the number of domains. Here, we discover that for all separable and non-separable integrable billiards, ν satisfies certain difference equations. This has been possible because the eigenfunctions can be classified in families labelled by the same value of mmodkn, given a particular k, for a set of quantum numbers, m,n. Further, we observe that the patterns in a familymore » are similar and the algebraic representation of the geometrical nodal patterns is found. Instances of this representation are explained in detail to understand the beauty of the patterns. This paper therefore presents a mathematical connection between integrable systems and difference equations. - Highlights: • We find that the number of nodal domains of eigenfunctions of integrable, planar billiards satisfy a class of difference equations. • The eigenfunctions labelled by quantum numbers (m,n) can be classified in terms of mmodkn. • A theorem is presented, realising algebraic representations of geometrical patterns exhibited by the domains. • This work presents a connection between integrable systems and difference equations.« less

Externally disposed plasma membrane proteins. I. Enzymatic iodination of mouse L cells

PubMed Central

1975-01-01

The enzymatic iodination technique has been utilized in a study of the externally disposed membrane proteins of the mouse L cell. Iodination of cells in suspension results in lactoperoxidase-specific iodide incorporation with no loss of cell viability under the conditions employed, less than 3% lipid labeling, and more than 90% of the labeled species identifiable as monoiodotyrosine. 90% of the incorporated label is localized to the cell surface by electron microscope autoradiography, with 5-10% in the centrosphere region and postulated to represent pinocytic vesicles. Sodium dodecylsulfate-polyacrylamide gels of solubilized L-cell proteins reveals five to six labeled peaks ranging from 50,000 to 200,000 daltons. Increased resolution by use of gradient slab gels reveals 15-20 radioactive bands. Over 60% of the label resides in approximately nine polypeptides of 80,000 to 150,000 daltons. Various controls indicate that the labeling pattern reflects endogenous membrane proteins, not serum components. The incorporated 125-I, cholesterol, and one plasma membrane enzyme marker, alkaline phosphodiesterase I, are purified in parallel when plasma membranes are isolated from intact, iodinated L cells. The labeled components present in a plasma membrane-rich fraction from iodinated cells are identical to those of the total cell, with a 10- to 20-fold enrichment in specific activity of each radioactive peak in the membrane. PMID:163833

Scaffold-free, label-free and nozzle-free biofabrication technology using magnetic levitational assembly.

PubMed

Parfenov, Vladislav A; Koudan, Elizaveta V; Bulanova, Elena A; Karalkin, Pavel A; Pereira, Frederico DAS; Norkin, Nikita E; Knyazeva, Alisa D; Gryadunova, Anna A; Petrov, Oleg F; Vasiliev, M M; Myasnikov, Maxim; Chernikov, Valery P; Kasyanov, Vladimir A; Marchenkov, Artem Yu; Brakke, Kenneth A; Khesuani, Yusef D; Demirci, Utkan; Mironov, Vladimir A

2018-05-31

Tissue spheroids have been proposed as building blocks in 3D biofabrication. Conventional magnetic force-driven 2D patterning of tissue spheroids requires prior cell labeling by magnetic nanoparticles, meanwhile a label-free approach for 3D magnetic levitational assembly has been introduced. Here we present first-time report on rapid assembly of 3D tissue construct using scaffold-free, nozzle-free and label-free magnetic levitation of tissue spheroids. Chondrospheres of standard size, shape and capable to fusion have been biofabricated from primary sheep chondrocytes using non-adhesive technology. Label-free magnetic levitation was performed using a prototype device equipped with permanent magnets in presence of gadolinium (Gd3+) in culture media, which enables magnetic levitation. Mathematical modeling and computer simulations were used for prediction of magnetic field and kinetics of tissue spheroids assembly into 3D tissue constructs. First, we used polystyrene beads to simulate the assembly of tissue spheroids and to determine the optimal settings for magnetic levitation in presence of Gd3+. Second, we proved the ability of chondrospheres to assemble rapidly into 3D tissue construct in the permanent magnetic field in the presence of Gd3+. Thus, scaffold- and label-free magnetic levitation of tissue spheroids is a promising approach for rapid 3D biofabrication and attractive alternative to label-based magnetic force-driven tissue engineering. . © 2018 IOP Publishing Ltd.

Programmed cell death of tobacco BY-2 cells induced by still culture conditions is affected by the age of the culture under agitation.

PubMed

Hiraga, Asahi; Kaneta, Tsuyoshi; Sato, Yasushi; Sato, Seiichi

2010-01-25

Evans Blue staining indicated that actively growing tobacco BY-2 cells in the exponential phase died more rapidly than quiescent cells in the stationary phase when the cells cultured under agitation were placed under still conditions. Fifty percent cell death was induced at about 18, 26, 80 and 140 h for early, mid, late exponential- and stationary-phase cells, respectively. Actively growing cells became TUNEL (transferase-mediated dUTP nick end labelling)-positive more rapidly than quiescent cells, suggesting that the cell death evaluated by Evans Blue is accompanied by DNA cleavages. Electrophoresis of genomic DNA showed a typical 'DNA laddering' pattern formed by multiples of about 200 bp internucleosomal units. Chromatin condensation was first detected at least within 24 h by light microscopy, and then cell shrinkage followed. These findings suggest that the death of BY-2 cells induced by still conditions is PCD (programmed cell death).

Identification and quantification of the rat hepatocyte asialoglycoprotein receptor.

PubMed Central

Schwartz, A L; Marshak-Rothstein, A; Rup, D; Lodish, H F

1981-01-01

The asialoglycoprotein receptor from rat liver was purified by solubilization and affinity chromatography on asialoorosomucoid-Sepharose. The preparation yielded four distinct polypeptides of Mr 40,000-120,000. We prepared a monoclonal antibody that both immunoprecipitates solubilized receptor activity and blocks the binding of galactose-terminal glycoproteins to immobilized receptor. The monoclonal antibody and a rabbit antireceptor antiserum immunoprecipitated all four polypeptide species. Peptide analysis by two-dimensional chromatography of the individual 125I-labeled species showed nearly identical patterns, which also suggested that the four polypeptides have a similar primary structure. To identify and quantitate the asialoglycoprotein receptor on the hepatocyte cell surface, intact cells were iodinated with lactoperoxidase, and the solubilized membranes were treated with antireceptor antibody. The Mr 55,000 and Mr 65,000 species were the major species found. Our results suggest that the Mr of the surface receptor is at least 55,000 and that it comprises between 1-2% of the iodinated hepatocyte surface protein. Images PMID:6267585

GEO Label: User and Producer Perspectives on a Label for Geospatial Data

NASA Astrophysics Data System (ADS)

Lush, V.; Lumsden, J.; Masó, J.; Díaz, P.; McCallum, I.

2012-04-01

One of the aims of the Science and Technology Committee (STC) of the Group on Earth Observations (GEO) was to establish a GEO Label- a label to certify geospatial datasets and their quality. As proposed, the GEO Label will be used as a value indicator for geospatial data and datasets accessible through the Global Earth Observation System of Systems (GEOSS). It is suggested that the development of such a label will significantly improve user recognition of the quality of geospatial datasets and that its use will help promote trust in datasets that carry the established GEO Label. Furthermore, the GEO Label is seen as an incentive to data providers. At the moment GEOSS contains a large amount of data and is constantly growing. Taking this into account, a GEO Label could assist in searching by providing users with visual cues of dataset quality and possibly relevance; a GEO Label could effectively stand as a decision support mechanism for dataset selection. Currently our project - GeoViQua, - together with EGIDA and ID-03 is undertaking research to define and evaluate the concept of a GEO Label. The development and evaluation process will be carried out in three phases. In phase I we have conducted an online survey (GEO Label Questionnaire) to identify the initial user and producer views on a GEO Label or its potential role. In phase II we will conduct a further study presenting some GEO Label examples that will be based on Phase I. We will elicit feedback on these examples under controlled conditions. In phase III we will create physical prototypes which will be used in a human subject study. The most successful prototypes will then be put forward as potential GEO Label options. At the moment we are in phase I, where we developed an online questionnaire to collect the initial GEO Label requirements and to identify the role that a GEO Label should serve from the user and producer standpoint. The GEO Label Questionnaire consists of generic questions to identify whether users and producers believe a GEO Label is relevant to geospatial data; whether they want a single "one-for-all" label or separate labels that will serve a particular role; the function that would be most relevant for a GEO Label to carry; and the functionality that users and producers would like to see from common rating and review systems they use. To distribute the questionnaire, relevant user and expert groups were contacted at meetings or by email. At this stage we successfully collected over 80 valid responses from geospatial data users and producers. This communication will provide a comprehensive analysis of the survey results, indicating to what extent the users surveyed in Phase I value a GEO Label, and suggesting in what directions a GEO Label may develop. Potential GEO Label examples based on the results of the survey will be presented for use in Phase II.

Analyzing tree-shape anatomical structures using topological descriptors of branching and ensemble of classifiers.

PubMed

Skoura, Angeliki; Bakic, Predrag R; Megalooikonomou, Vasilis

2013-01-01

The analysis of anatomical tree-shape structures visualized in medical images provides insight into the relationship between tree topology and pathology of the corresponding organs. In this paper, we propose three methods to extract descriptive features of the branching topology; the asymmetry index, the encoding of branching patterns using a node labeling scheme and an extension of the Sholl analysis. Based on these descriptors, we present classification schemes for tree topologies with respect to the underlying pathology. Moreover, we present a classifier ensemble approach which combines the predictions of the individual classifiers to optimize the classification accuracy. We applied the proposed methodology to a dataset of x-ray galactograms, medical images which visualize the breast ductal tree, in order to recognize images with radiological findings regarding breast cancer. The experimental results demonstrate the effectiveness of the proposed framework compared to state-of-the-art techniques suggesting that the proposed descriptors provide more valuable information regarding the topological patterns of ductal trees and indicating the potential of facilitating early breast cancer diagnosis.

Analyzing tree-shape anatomical structures using topological descriptors of branching and ensemble of classifiers

PubMed Central

Skoura, Angeliki; Bakic, Predrag R.; Megalooikonomou, Vasilis

2014-01-01

The analysis of anatomical tree-shape structures visualized in medical images provides insight into the relationship between tree topology and pathology of the corresponding organs. In this paper, we propose three methods to extract descriptive features of the branching topology; the asymmetry index, the encoding of branching patterns using a node labeling scheme and an extension of the Sholl analysis. Based on these descriptors, we present classification schemes for tree topologies with respect to the underlying pathology. Moreover, we present a classifier ensemble approach which combines the predictions of the individual classifiers to optimize the classification accuracy. We applied the proposed methodology to a dataset of x-ray galactograms, medical images which visualize the breast ductal tree, in order to recognize images with radiological findings regarding breast cancer. The experimental results demonstrate the effectiveness of the proposed framework compared to state-of-the-art techniques suggesting that the proposed descriptors provide more valuable information regarding the topological patterns of ductal trees and indicating the potential of facilitating early breast cancer diagnosis. PMID:25414850

Placebo effects in spider phobia: an eye-tracking experiment.

PubMed

Gremsl, Andreas; Schwab, Daniela; Höfler, Carina; Schienle, Anne

2018-01-05

Several eye-tracking studies have revealed that spider phobic patients show a typical hypervigilance-avoidance pattern when confronted with images of spiders. The present experiment investigated if this pattern can be changed via placebo treatment. We conducted an eye-tracking experiment with 37 women with spider phobia. They looked at picture pairs (a spider paired with a neutral picture) for 7 s each in a retest design: once with and once without a placebo pill presented along with the verbal suggestion that it can reduce phobic symptoms. The placebo was labelled as Propranolol, a beta-blocker that has been successfully used to treat spider phobia. In the placebo condition, both the fixation count and the dwell time on the spider pictures increased, especially in the second half of the presentation time. This was associated with a slight decrease in self-reported symptom severity. In summary, we were able to show that a placebo was able to positively influence visual avoidance in spider phobia. This effect might help to overcome apprehension about engaging in exposure therapy, which is present in many phobic patients.

Contextualizing Informal Labeling Effect on Adolescent Recidivism in South Korea.

PubMed

Lee, Jonathan

2017-08-01

Symbolic interactionism argues that the effect of informal labeling by general others, such as family and friends, on behavior depends on the social context under which labeling takes place. Despite abundant research on informal labeling, little effort has been made to contextualize its impact on adolescent reoffending. Also, compared with other theories, only a few studies have been conducted among youths in Asian population. Using three consecutive waves of self-reported survey data from a nationally representative sample of 2,406 Korean adolescents, this study examined an interactional model for the informal labeling effect. Findings suggest that informal labeling, as well as school commitment and delinquent peer association, has an independent effect on delinquency. Also supported is the symbolic interactionist hypothesis that adolescents with greater involvement in delinquent subcultures were less susceptible to informal labeling. Implications of the findings are discussed.

[The influence of labeling format on use and understanding of nutrition information: results of an experiment in workplace restaurants].

PubMed

Gomez, P; Le Minous, A-E

2012-02-01

Nutrition labeling usually describes food product composition in terms of nutrients. This article aims at investigating the influence of nutrition labeling on use and understanding of nutrition information in workplace restaurants and comparing the difference between a nutrient-based labeling and an alternative labeling based on food groups. In this respect, an experiment was conducted in two workplace restaurants during 4 weeks. Then, a survey was carried out, covering 329 individuals, to assess use and understanding of nutrition information. We found that 42.9% of the sample saw the nutrient labeling and only 5.2% said they used it. Our results show that both labeling formats lead to high understanding. Nutrition labeling format was found to have no significant influence on use and understanding of nutrition information. In spite of these results, food groups labeling were perceived as easier to process than nutrient-based labeling. Understanding is more widespread than use among participants suggesting that the main hurdle to information use comes from a lack of motivation. Food groups labeling are of limited interest compared to nutrient-based labeling. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Evidence of plasticity in the pontocerebellar conditioned stimulus pathway during classical conditioning of the eyeblink response in the rabbit.

PubMed

Tracy, Jo Anne; Thompson, Judith K; Krupa, David J; Thompson, Richard F

2013-10-01

Electrical stimulation thresholds required to elicit eyeblinks with either pontine or cerebellar interpositus stimulation were measured before and after classical eyeblink conditioning with paired pontine stimulation (conditioned stimulus, CS) and corneal airpuff (unconditioned stimulus, US). Pontine stimulation thresholds dropped dramatically after training and returned to baseline levels following extinction, whereas interpositus thresholds and input-output functions remained stable across training sessions. Learning rate, magnitude of threshold change, and electrode placements were correlated. Pontine projection patterns to the cerebellum were confirmed with retrograde labeling techniques. These results add to the body of literature suggesting that the pons relays CS information to the cerebellum and provide further evidence of synaptic plasticity in the cerebellar network. 2013 APA, all rights reserved

Morphogenetic aspects in Macrocystis development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arzee, T.; Polne, M.; Neushul, M.

1985-09-01

Differential growth of the giant kelp Macrocystic pyrifera, was observed in frond meristems and in young sporophytes at their primary-blade stage. Autoradiographs of plants pulse-labeled with /sup 14/C showed both that the carbon was taken up and translocated and that the fixed carbon was diluted in regions of vigorous meristematic growth. Both labeling experiments and studies of changes in size and location of holes punched in the blades illustrated a pattern of basipetal maturation and determine growth. Size and distribution of mucilage ducts, as seen in cleared whole mounts of primary blades, point to a basipetal pattern of differentiation asmore » well. Alginase activity was relatively high in young pneumatocysts and may be involved in growth of the pneumatocyst and development of the medulla. Frond tips collected from various depths were morphologically different and maintained these differences in their growth potential, even under greenhouse conditions.« less

Cilia in vertebrate left–right patterning

PubMed Central

Dasgupta, Agnik

2016-01-01

Understanding how left–right (LR) asymmetry is generated in vertebrate embryos is an important problem in developmental biology. In humans, a failure to align the left and right sides of cardiovascular and/or gastrointestinal systems often results in birth defects. Evidence from patients and animal models has implicated cilia in the process of left–right patterning. Here, we review the proposed functions for cilia in establishing LR asymmetry, which include creating transient leftward fluid flows in an embryonic ‘left–right organizer’. These flows direct asymmetric activation of a conserved Nodal (TGFβ) signalling pathway that guides asymmetric morphogenesis of developing organs. We discuss the leading hypotheses for how cilia-generated asymmetric fluid flows are translated into asymmetric molecular signals. We also discuss emerging mechanisms that control the subcellular positioning of cilia and the cellular architecture of the left–right organizer, both of which are critical for effective cilia function during left–right patterning. Finally, using mosaic cell-labelling and time-lapse imaging in the zebrafish embryo, we provide new evidence that precursor cells maintain their relative positions as they give rise to the ciliated left–right organizer. This suggests the possibility that these cells acquire left–right positional information prior to the appearance of cilia. This article is part of the themed issue ‘Provocative questions in left–right asymmetry’. PMID:27821522

Cilia in vertebrate left-right patterning.

PubMed

Dasgupta, Agnik; Amack, Jeffrey D

2016-12-19

Understanding how left-right (LR) asymmetry is generated in vertebrate embryos is an important problem in developmental biology. In humans, a failure to align the left and right sides of cardiovascular and/or gastrointestinal systems often results in birth defects. Evidence from patients and animal models has implicated cilia in the process of left-right patterning. Here, we review the proposed functions for cilia in establishing LR asymmetry, which include creating transient leftward fluid flows in an embryonic 'left-right organizer'. These flows direct asymmetric activation of a conserved Nodal (TGFβ) signalling pathway that guides asymmetric morphogenesis of developing organs. We discuss the leading hypotheses for how cilia-generated asymmetric fluid flows are translated into asymmetric molecular signals. We also discuss emerging mechanisms that control the subcellular positioning of cilia and the cellular architecture of the left-right organizer, both of which are critical for effective cilia function during left-right patterning. Finally, using mosaic cell-labelling and time-lapse imaging in the zebrafish embryo, we provide new evidence that precursor cells maintain their relative positions as they give rise to the ciliated left-right organizer. This suggests the possibility that these cells acquire left-right positional information prior to the appearance of cilia.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

Ptychography: use of quantitative phase information for high-contrast label free time-lapse imaging of living cells

NASA Astrophysics Data System (ADS)

Suman, Rakesh; O'Toole, Peter

2014-03-01

Here we report a novel label free, high contrast and quantitative method for imaging live cells. The technique reconstructs an image from overlapping diffraction patterns using a ptychographical algorithm. The algorithm utilises both amplitude and phase data from the sample to report on quantitative changes related to the refractive index (RI) and thickness of the specimen. We report the ability of this technique to generate high contrast images, to visualise neurite elongation in neuronal cells, and to provide measure of cell proliferation.

Poor predictive value of breath hydrogen response for probiotic effects in IBS.

PubMed

Yao, Chu K; Barrett, Jacqueline S; Philpott, Hamish; Chung, Alvin R T; van Langenberg, Daniel; Garg, Mayur; Gibson, Peter R

2015-12-01

Previous observations suggested that an early rise in breath hydrogen after lactulose (ERBHAL) may identify patients with irritable bowel syndrome (IBS) likely to respond to probiotics. Therefore, we aimed to (i) investigate whether treatment with a probiotic changes breath hydrogen response in patients with ERBHAL and (ii) whether these changes identify patients who may benefit symptomatically from probiotics. In a randomized, double-blind, placebo-controlled trial, patients with IBS (Rome III) were randomized to either 65 mL/day fermented milk product containing probiotic (FMPP) or placebo for 6 weeks, followed by 6 weeks' open-label treatment and 6 weeks' withdrawal. Breath hydrogen responses to lactulose (15 g) and liquid-gastric emptying time were evaluated before and at the end of each treatment period. Symptoms were measured using a 100-mm visual analog scale. Loss of ERBHAL occurred in 36% of 23 patients receiving FMPP and 41% of 22 receiving placebo (P = 1.00). Amongst 40 patients who completed open-label FMPP treatment, ERBHAL was lost in a further 38%, continued in 25%, and regained in 10%. Similar variability occurred in the withdrawal phase. Variability was unrelated to changes in gastric emptying. No differences in symptom response were seen between treatment groups nor in relation to the loss or retention of ERBHAL. Breath hydrogen patterns after lactulose are poorly reproducible. No FMPP-specific effects on fermentation patterns or symptoms were observed. The presence of ERBHAL is not useful to predict symptomatic response to probiotic therapy in patients with IBS. © 2015 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

Aneurysmal and haemangiopericytoma-like fibrous histiocytoma.

PubMed Central

Zelger, B W; Zelger, B G; Steiner, H; Ofner, D

1996-01-01

AIM: To describe the clinicopathological features of 33 aneurysmal fibrous histiocytomas (AFH), including five cases with a haemangiopericytoma-like pattern. METHODS: Thirty three cases of AFH were studied by using routine histology and immunohistochemistry for factor XIIIa, the "cell activity marker" E9 (anti-metallothionein), NK1C3 (CD57), smooth muscle actin (SMA), factor VIII, ulex europaeus agglutinin, JC70A (CD31), and QBEND10 (CD34). The time dependent variation in histopathological features was evaluated by statistical methods (Pearson chi 2, likelihood ratio chi 2). RESULTS: Of the AFHs, 29 of 33 occurred on the extremities of adults (age range 30 to 50 years), six of which were associated with rapid growth, probably caused by trauma, and pain. Twenty one lesions were thought to be vascular and/or melanocytic lesions, including two melanomas, because of a bluish-black and/or cystic appearance. Histologically, large areas of haemorrhage, up to 50% of the tumour bulk, lacking an endothelial lining were seen in otherwise typical fibrous histiocytomas. Five cases resembled nodular stages of Kaposi's sarcoma. Variable haemosiderin deposition in histiocytes (18/33) and giant cells (11/33) was suggestive of haemosiderotic histiocytoma. A haemangiopericytoma-like pattern was seen in five otherwise indistinguishable cases. On immunohistochemistry, variable reactivity was seen for factor XIIIa (18/30), with E9 (18/30), NK1C3 (19/30), and for SMA (14/30), but labelling for vascular markers was not detected. Early lesions without iron deposition were factor XIIIa positive; late lesions with iron deposition were factor XIIIa negative. Labelling for SMA correlated with prominent sclerosis. CONCLUSION: AFHs, including a haemangiopericytoma-like variant, have a characteristic time dependent histological and immunophenotypic profile, clearly different from nodular type Kaposi's sarcoma. Images PMID:8655708

Up-regulated ephrinB3/EphB3 expression in intractable temporal lobe epilepsy patients and pilocarpine induced experimental epilepsy rat model.

PubMed

Huang, Hao; Li, Ruohan; Yuan, Jinxian; Zhou, Xin; Liu, Xi; Ou, Shu; Xu, Tao; Chen, Yangmei

2016-05-15

EphB family receptor tyrosine kinases, in cooperation with cell surface-bound ephrinB ligands, play a critical role in maintenance of dendritic spine morphogenesis, axons guidance, synaptogenesis, synaptic reorganization and plasticity in the central nervous system (CNS). However, the expression pattern of ephrinB/EphB in intractable temporal lobe epilepsy (TLE) and the underlying molecular mechanisms during epileptogenesis remain poorly understood. Here we investigated the expression pattern and cellular distribution of ephrinB/EphB in intractable TLE patients and lithium chloride-pilocarpine induced TLE rats using real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemistry, double-labeled immunofluorescence and Western blot analysis. Compared to control groups, ephrinB3 and EphB3 mRNA expression were significantly up-regulated in intractable TLE patients and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in intractable TLE patients and TLE rats were inconsistent. Western blot analysis and semi-quantitative immunohistochemistry confirmed that ephrinB3 and EphB3 protein level were up-regulated in intractable TLE patients and TLE rats. At the same time, double-labeled immunofluorescence indicate that ephrinB3 was expressed mainly in the cytoplasm and protrusions of glia and neurons, while EphB3 was expressed mainly in the cytoplasm of neurons. Taken together, up-regulated expression of ephrinB3/EphB3 in intractable TLE patients and experimental TLE rats suggested that ephrinB3/EphB3 might be involved in the pathogenesis of TLE. Copyright © 2016 Elsevier B.V. All rights reserved.

New markers of pancreatic cancer identified through differential gene expression analyses: claudin 18 and annexin A8.

PubMed

Karanjawala, Zarir E; Illei, Peter B; Ashfaq, Raheela; Infante, Jeffrey R; Murphy, Kathleen; Pandey, Akhilesh; Schulick, Richard; Winter, Jordan; Sharma, Rajni; Maitra, Anirban; Goggins, Michael; Hruban, Ralph H

2008-02-01

New markers to distinguish benign reactive glands from infiltrating ductal adenocarcinoma of the pancreas are needed. The gene expression patterns of 24 surgically resected primary infiltrating ductal adenocarcinomas of the pancreas were compared with 18 non-neoplastic samples using the Affymetrix U133 Plus 2.0 Arrays and the Gene Logic GeneExpress Software System. Gene fragments from 4 genes (annexin A8, claudin 18, CXCL5, and S100 A2) were selected from the fragments found to be highly expressed in infiltrating adenocarcinomas when compared with normal tissues. The protein expression of these genes was examined using immunohistochemical labeling of tissue microarrays. Claudin 18 labeled infiltrating carcinomas in a membranous pattern. When compared with normal and reactive ducts, claudin 18 was overexpressed, at least focally, in 159 of 166 evaluable carcinomas (96%). Strong and diffuse claudin 18 overexpression was most often seen in well-differentiated carcinomas (P=0.02). Claudin 18 was overexpressed in 51 of 52 cases (98%) of pancreatic intraepithelial neoplasia. Annexin A8 was at least focally overexpressed in 149 of 154 evaluable infiltrating carcinomas (97%). S100 A2 was at least focally overexpressed in 118 of 154 evaluable infiltrating carcinomas (77%). Non-neoplastic glands also frequently expressed S100 A2 diminishing its potential diagnostic utility. Immunolabeling with antibodies directed against CXCL5 did not reveal any significant differences in protein expression between infiltrating adenocarcinomas and normal pancreatic ducts. Claudin 18 and annexin A8 are frequently highly overexpressed in infiltrating ductal adenocarcinomas when compared with normal reactive ducts, suggesting a role for these molecules in pancreatic ductal adenocarcinomas. Furthermore, these may serve as diagnostic markers, as screening tests and as therapeutic targets.

Dendritic A-type potassium channel subunit expression in CA1 hippocampal interneurons.

PubMed

Menegola, M; Misonou, H; Vacher, H; Trimmer, J S

2008-06-26

Voltage-gated potassium (Kv) channels are important and diverse determinants of neuronal excitability and exhibit specific expression patterns throughout the brain. Among Kv channels, Kv4 channels are major determinants of somatodendritic A-type current and are essential in controlling the amplitude of backpropagating action potentials (BAPs) into neuronal dendrites. BAPs have been well studied in a variety of neurons, and have been recently described in hippocampal and cortical interneurons, a heterogeneous population of GABAergic inhibitory cells that regulate activity of principal cells and neuronal networks. We used well-characterized mouse monoclonal antibodies against the Kv4.3 and potassium channel interacting protein (KChIP) 1 subunits of A-type Kv channels, and antibodies against different interneuron markers in single- and double-label immunohistochemistry experiments to analyze the expression patterns of Kv4.3 and KChIP1 in hippocampal Ammon's horn (CA1) neurons. Immunohistochemistry was performed on 40 mum rat brain sections using nickel-enhanced diaminobenzidine staining or multiple-label immunofluorescence. Our results show that Kv4.3 and KChIP1 component subunits of A-type channels are co-localized in the soma and dendrites of a large number of GABAergic hippocampal interneurons. These subunits co-localize extensively but not completely with markers defining the four major interneuron subpopulations tested (parvalbumin, calbindin, calretinin, and somatostatin). These results suggest that CA1 hippocampal interneurons can be divided in two groups according to the expression of Kv4.3/KChIP1 channel subunits. Antibodies against Kv4.3 and KChIP1 represent an important new tool for identifying a subpopulation of hippocampal interneurons with a unique dendritic A-type channel complement and ability to control BAPs.

Patterns of human local cerebral glucose metabolism during epileptic seizures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Engel, J. Jr.; Kuhl, D.E.; Phelps, M.E.

1982-10-01

Ictal patterns of local cerebral metabolic rate have been studied in epileptic patients by positron computed tomography with /sup 18/F-labeled 2-fluoro-2-deoxy-D-glucose. Partial seizures were associated with activation of anatomic structures unique to each patient studied. Ictal increases and decreases in local cerebral metabolism were observed. Scans performed during generalized convulsions induced by electroshock demonstrated a diffuse ictal increase and postictal decrease in cerebral metabolism. Petit mal absences were associated with a diffuse increase in cerebral metabolic rate. The ictal fluorodeoxyglucose patterns obtained from patients do not resemble autoradiographic patterns obtained from common experimental animal models of epilepsy.

RELATIONSHIP OF GERMINAL CENTERS IN LYMPHOID TISSUE TO IMMUNOLOGICAL MEMORY

PubMed Central

Wakefield, J. D.; Thorbecke, G. J.

1968-01-01

The fate, proliferation, and developmental potentialities of cell suspensions made from white pulp containing large germinal centers have been studied in the mouse by transfer of cells labeled with thymidine-3H to lethally irradiated, syngeneic recipients. Radioautographic analyses were made using both smears and sections of a variety of tissues. Thymidine-3H-labeling patterns of white pulp showed that, initially, labeling occurred in a majority of blast and "intermediate cells" but in very few or no small lymphocytes. After intravenous transfer, most of the labeled cells localized in the lymphoid tissues of spleen, lymph nodes, and Peyer's patches. Few cells migrated to the thymus, lung, liver, and intestinal mucosa. Both after intravenous and after intraperitoneal transfer there was a rapid increase in the incidence of labeled small lymphocytes and a decrease of labeled blasts and intermediate cells. This was accompanied by an increase in the grain count of the small lymphocytes and a progressive decrease in the grain counts of the blast cells. Exposure of nonlabeled donor cells to thymidine-3H at various time intervals after transfer indicated that dividing cells were present early after transfer but that their incidence progressively decreased. Between 24 and 48 hr, very little cell division was detectable. PMID:5662013

The impacts of cigarette packaging pictorial warning labels on smokers in the city of tehran.

PubMed

Heydari, Gholam Reza; Ramezankhani, Ali; Talischi, Firoozeh

2011-01-01

Cigarette smoking is considered the first preventable cause of death in the world. Social, familial, and personal factors play an important role in prevention or cessation of smoking. Educating the public in order to enhance their knowledge, change their attitude and improve their habits is also effective in this respect. In 2007, the executive protocol of the Comprehensive Law on Smoking Control was compiled in the Ministry of Health and according to the Article 5 of this law pictorial health warning labels had to be applied on cigarette packaging. This study was designed and conducted in 2 phases of before and 9 months after the implementation of this law and evaluated the effect of it on smokers' knowledge, attitude and pattern of smoking. This was a cross-sectional descriptive study conducted to evaluate the effect of cigarette packs' pictorial health warning labels on the knowledge, attitude and smoking pattern of smokers residing in Tehran. After calculating the size of understudy population and estimation of the exclusions, 1731 subjects were randomly selected using the multiphase cluster method from the 22 districts of Tehran. Data were collected using a questionnaire designed according to the standard questionnaire of the World Health Organization (WHO) and International Union Against Tuberculosis and Lung Disease (IUATLD). Qualitative and quantitative value and reliability of the variables including cigarette consumption, knowledge about the law, and pattern of smoking were evaluated in 2 phases and the quality of pictures and their effects on the mentioned variables were assessed in the 2(nd) phase. Before adopting the pictorial warning labels in the first phase of the study, 1731 respondents were evaluated out of which 71.8% were males and 28.2% were females. These cases had an average of 17.6±12.3 years history of smoking. A total of 38% (675 subjects) used Iranian cigarette brands and 39.5% were aware of the implementation of pictorial health warning labels on cigarette packs. In terms of smokers' attitude towards the implementation of this law, they mostly had no opinion about it. A total of 33.3% stated that they may cut down on smoking as the result of this law. Men had a higher percentage of smoking a cigarette first thing in the morning before breakfast and women had a higher rate of consuming foreign cigarette brands (P < 0.001). In the second phase of the study, 1590 cases of the phase 1 subjects participated. Subjects had a significantly higher knowledge about the implementation of pictorial health warning labels on cigarette packs (P < 0.001). Attitude towards this law did not change significantly compared to the first phase although the mean score improved by 0.07%. Enforcement of this law resulted in decreased consumption in 7.6% of the participants. However, the Wilcoxon test did not show any significant difference. In terms of the quality of pictures, 61.6% had no opinion, and 28.7% expressed that the pictures had poor quality. No significant difference was observed between the Iranian or foreign brands in terms of smoking rate after applying the pictorial warning labels. We believed that the smoking rate would decrease after applying the pictorial health warning labels on cigarette packs. However, it did not happen. Also, adopting these labels did not have a significant effect on smokers changing their favorite brand from Iranian to foreign brands or vice versa. Type and quality of pictures require major revision and corrections.

Visualization of Ca2+-Induced Phospholipid Domains

NASA Astrophysics Data System (ADS)

Haverstick, Doris M.; Glaser, Michael

1987-07-01

Large vesicles (5-15 μ m) were formed by hydrating a dried lipid film containing phospholipids labeled with a fluorophore in one fatty acid chain. By using a fluorescence microscope attached to a low-light-intensity charge-coupled-device camera and digital-image processor, the vesicles were easily viewed and initially showed uniform fluorescence intensity across the surface. The fluorescence pattern of vesicles made with a fluorophore attached to phosphatidylcholine or phosphatidylethanolamine was unaffected by the presence of divalent cations such as Ca2+, Mg2+, Mn2+, Zn2+, or Cd2+. The fluorescence pattern of vesicles containing a fluorophore attached to the acidic phospholipids phosphatidylserine or phosphatidic acid showed distinct differences when treated with Ca2+ or Cd2+, although they were unaffected by Mg2+, Mn2+, or Zn2+. Treatment with 2.0 mM Ca2+ or Cd2+ resulted in the movement of the fluorophore to a single large patch on the surface of the vesicle. When vesicles were formed in the presence of 33 mol% cholesterol, patching was seen at a slightly lower Ca2+ concentration (1.0 mM). The possibility of interactions between Ca2+ and acidic phospholipids in plasma membranes was investigated by labeling erythrocytes and erythrocyte ghosts with fluorescent phosphatidic acid. When Ca2+ was added, multiple (five or six) small patches were seen per individual cell. The same pattern was observed when vesicles formed from whole lipid extracts of erythrocytes were labeled with fluorescent phosphatidic acid and then treated with Ca2+. This shows that the size and distribution of the Ca2+-induced domains depend on phospholipid composition.

Neuro-Compatible Metabolic Glycan Labeling of Primary Hippocampal Neurons in Noncontact, Sandwich-Type Neuron-Astrocyte Coculture.

PubMed

Choi, Ji Yu; Park, Matthew; Cho, Hyeoncheol; Kim, Mi-Hee; Kang, Kyungtae; Choi, Insung S

2017-12-20

Glycans are intimately involved in several facets of neuronal development and neuropathology. However, the metabolic labeling of surface glycans in primary neurons is a difficult task because of the neurotoxicity of unnatural monosaccharides that are used as a metabolic precursor, hindering the progress of metabolic engineering in neuron-related fields. Therefore, in this paper, we report a neurosupportive, neuron-astrocyte coculture system that neutralizes the neurotoxic effects of unnatural monosaccharides, allowing for the long-term observation and characterization of glycans in primary neurons in vitro. Polysialic acids in neurons are selectively imaged, via the metabolic labeling of sialoglycans with peracetylated N-azidoacetyl-d-mannosamine (Ac 4 ManNAz), for up to 21 DIV. Two-color labeling shows that neuronal activities, such as neurite outgrowth and recycling of membrane components, are highly dynamic and change over time during development. In addition, the insertion sites of membrane components are suggested to not be random, but be predominantly localized in developing neurites. This work provides a new research platform and also suggests advanced 3D systems for metabolic-labeling studies of glycans in primary neurons.

Recognition and Construction of Top, Bottom, and Versatile Orientations in Gay/Bisexual Men.

PubMed

Moskowitz, David A; Roloff, Michael E

2017-01-01

Research on gay and bisexual men's sexual position self-label (i.e., being a top, bottom, or versatile during anal sex) has revealed only independent snapshots of its development by focusing primarily on the influence of penis size. Moreover, the basic chronology of development of the sexual position self-label has barely been addressed. In response, we implemented a survey of 282 gay and bisexual men that measured demographics (including height and penis size), age of sexual recognitions, sexual position self-label, and attitudinal constructs suggested by previous literature as important (e.g., pleasure, control, anxieties, and gender typicality). Results suggested that men's sexual position self-label was learned over a 15-year timespan. Ages of first same-sex genital manipulation and first anal sex experiences were related to age at first self-labeling. With respect to predictors of labels, a multivariate path model was created. The model did not support the direct importance of penis size, but identified indirect paths that linked penis size to top/bottom identification (e.g., smaller penis sizes leading to topping-anxieties and thus, a bottom label). Finding bottoming to be pleasurable and the importance of sexual control dynamics were the only two direct predictors. The path model substantiated the reliance both bottoms and tops show towards seeking (or not seeking among tops) gender typical, sexually dominant partners. It also supported previous evidence regarding race; specifically, while race may activate differences in sexual behavioral dynamics, it is not a great predictor of the sexual position self-label. This study shows that sexual position self-labeling has enormous complexity and cannot be reduced down to penis size.

A Gaussian mixture model based adaptive classifier for fNIRS brain-computer interfaces and its testing via simulation

NASA Astrophysics Data System (ADS)

Li, Zheng; Jiang, Yi-han; Duan, Lian; Zhu, Chao-zhe

2017-08-01

Objective. Functional near infra-red spectroscopy (fNIRS) is a promising brain imaging technology for brain-computer interfaces (BCI). Future clinical uses of fNIRS will likely require operation over long time spans, during which neural activation patterns may change. However, current decoders for fNIRS signals are not designed to handle changing activation patterns. The objective of this study is to test via simulations a new adaptive decoder for fNIRS signals, the Gaussian mixture model adaptive classifier (GMMAC). Approach. GMMAC can simultaneously classify and track activation pattern changes without the need for ground-truth labels. This adaptive classifier uses computationally efficient variational Bayesian inference to label new data points and update mixture model parameters, using the previous model parameters as priors. We test GMMAC in simulations in which neural activation patterns change over time and compare to static decoders and unsupervised adaptive linear discriminant analysis classifiers. Main results. Our simulation experiments show GMMAC can accurately decode under time-varying activation patterns: shifts of activation region, expansions of activation region, and combined contractions and shifts of activation region. Furthermore, the experiments show the proposed method can track the changing shape of the activation region. Compared to prior work, GMMAC performed significantly better than the other unsupervised adaptive classifiers on a difficult activation pattern change simulation: 99% versus  <54% in two-choice classification accuracy. Significance. We believe GMMAC will be useful for clinical fNIRS-based brain-computer interfaces, including neurofeedback training systems, where operation over long time spans is required.

Viability and proliferation potential of adipose-derived stem cells following labeling with a positron-emitting radiotracer.

PubMed

Elhami, Esmat; Goertzen, Andrew L; Xiang, Bo; Deng, Jixian; Stillwell, Chris; Mzengeza, Shadreck; Arora, Rakesh C; Freed, Darren; Tian, Ganghong

2011-07-01

Adipose-derived stem cells (ASCs) have promising potential in regenerative medicine and cell therapy. Our objective is to examine the biological function of the labeled stem cells following labeling with a readily available positron emission tomography (PET) tracer, (18)F-fluoro-2-deoxy-D: -glucose (FDG). In this work we characterize labeling efficiency through assessment of FDG uptake and retention by the ASCs and the effect of FDG on cell viability, proliferation, transdifferentiation, and cell function in vitro using rat ASCs. Samples of 10(5) ASCs (from visceral fat tissue) were labeled with concentrations of FDG (1-55 Bq/cell) in 0.75 ml culture medium. Label uptake and retention, as a function of labeling time, FDG concentration, and efflux period were measured to determine optimum cell labeling conditions. Cell viability, proliferation, DNA structure damage, cell differentiation, and other cell functions were examined. Non-labeled ASC samples were used as a control for all experimental groups. Labeled ASCs were injected via tail vein in several healthy rats and initial cell biodistribution was assessed. Our results showed that FDG uptake and retention by the stem cells did not depend on FDG concentration but on labeling and efflux periods and glucose content of the labeling and efflux media. Cell viability, transdifferentiation, and cell function were not greatly affected. DNA damage due to FDG radioactivity was acute, but reversible; cells managed to repair the damage and continue with cell cycles. Over all, FDG (up to 25 Bq/cell) did not impose severe cytotoxicity in rat ASCs. Initial biodistribution of the FDG-labeled ASCs was 80% + retention in the lungs. In the delayed whole-body images (2-3 h postinjection) there was some activity distribution resembling typical FDG uptake patterns. For in vivo cell tracking studies with PET tracers, the parameter of interest is the amount of radiotracer that is present in the cells being labeled and consequent biological effects. From our study we developed a labeling protocol for labeling ASCs with a readily available PET tracer, FDG. Our results indicate that ASCs can be safely labeled with FDG concentration up to 25 Bq/cell, without compromising their biological function. A labeling period of 90 min in glucose-free medium and efflux of 60 min in complete media resulted in optimum label retention, i.e., 60% + by the stem cells. The initial biodistribution of the implanted FDG-labeled stem cells can be monitored using microPET imaging.

The occurrence of chitin in the hemocytes of invertebrates

PubMed Central

Heath-Heckman, Elizabeth A.C.; McFall-Ngai, Margaret J.

2011-01-01

The light-organ symbiosis of Euprymna scolopes, the Hawaiian bobtail squid, is a useful model for the study of animal–microbe interactions. Recent analyses have demonstrated that chitin breakdown products play a role in communication between E. scolopes and its bacterial symbiont Vibrio fischeri. In this study, we sought to determine the source of chitin in the symbiotic organ. We used a commercially available chitin-binding protein (CBP) conjugated to fluorescein to label the polymeric chitin in host tissues. Confocal microscopy revealed that the only cells in contact with the symbionts that labeled with the probe were the macrophage-like hemocytes, which traffic into the light-organ crypts where the bacteria reside. Labeling of extracted hemocytes by CBP was markedly decreased following treatment with purified chitinase, providing further evidence that the labeled molecule is polymeric chitin. Further, CBP-positive areas co-localized with both a halide peroxidase antibody and Lysotracker, a lysosomal marker, suggesting that the chitin-like biomolecule occurs in the lysosome or acidic vacuoles. Reverse transcriptase polymerase chain reaction (PCR) of hemocytes revealed mRNA coding for a chitin synthase, suggesting that the hemocytes synthesize chitin de novo. Finally, upon surveying blood cells from other invertebrate species, we observed CBP-positive regions in all granular blood cells examined, suggesting that this feature is a shared character among the invertebrates; the vertebrate blood cells that we sampled did not label with CBP. Although the function of the chitin-like material remains undetermined, its presence and subcellular location in invertebrate hemocytes suggests a conserved role for this polysaccharide in the immune system of diverse animals. PMID:21723107

Studies related to the development of the Viking 1975 labeled release experiment

NASA Technical Reports Server (NTRS)

Devincenzi, D. L.; Deal, P. H.

1976-01-01

The labeled release life detection experiment on the Viking 1975 Mars mission is based on the concept that microorganisms will metabolize radioactive organic substrates in a nutrient medium and release radioactive carbon dioxide. Several experiments, using laboratory equipment, were carried out to evaluate various aspects of the concept. Results indicate: (1) label is released by sterilization-treated soil, (2) substantial quantities of label are retained in solution under basic conditions, (3) the substrate used, as well as position of label in the molecule, affect release of label, (4) label release is depressed by radiolytic decomposition of substrates, and (5) About 100,000 organisms are required to produce a detectable response. These results, suggest additional areas for testing, add to the data base for interpretation of flight results, and have significance for broader application of this technique for assessing microbial activity.

Consumer opinion on social policy approaches to promoting positive body image: Airbrushed media images and disclaimer labels.

PubMed

Paraskeva, Nicole; Lewis-Smith, Helena; Diedrichs, Phillippa C

2017-02-01

Disclaimer labels on airbrushed media images have generated political attention and advocacy as a social policy approach to promoting positive body image. Experimental research suggests that labelling is ineffective and consumers' viewpoints have been overlooked. A mixed-method study explored British consumers' ( N = 1555, aged 11-78 years) opinions on body image and social policy approaches. Thematic analysis indicated scepticism about the effectiveness of labelling images. Quantitatively, adults, although not adolescents, reported that labelling was unlikely to improve body image. Appearance diversity in media and reorienting social norms from appearance to function and health were perceived as effective strategies. Social policy and research implications are discussed.

Probing soil C metabolism in response to temperature: results from experiments and modeling

NASA Astrophysics Data System (ADS)

Dijkstra, P.; Dalder, J.; Blankinship, J.; Selmants, P. C.; Schwartz, E.; Koch, G. W.; Hart, S.; Hungate, B. A.

2010-12-01

C use efficiency (CUE) is one of the least understood aspects of soil C cycling, has a very large effect on soil respiration and C sequestration, and decreases with elevated temperature. CUE is directly related to substrate partitioning over energy production and biosynthesis. The production of energy and metabolic precursors occurs in well-known processes such as glycolysis and Krebs cycle. We have developed a new stable isotope approach using position-specific 13C-labeled metabolic tracers to measure these fundamental metabolic processes in intact soil communities (1). We use this new approach, combined with models of soil metabolic flux patterns, to analyze the response of microbial energy production, biosynthesis, and CUE to temperature. The method consists of adding small but precise amounts of position-specific 13C -labeled metabolic tracers to parallel soil incubations, in this case 1-13C and 2,3-13C pyruvate and 1-13C and U-13C glucose. The measurement of CO2 released from the labeled tracers is used to calculate the C flux rates through various metabolic pathways. A simplified metabolic model consisting of 23 reactions is iteratively solved using results of the metabolic tracer experiments and information on microbial precursor demand under different temperatures. This new method enables direct study of fundamental aspects of microbial energy production, C use efficiency, and soil organic matter formation in response to temperature. (1) Dijkstra P, Blankinship JC, Selmants PC, Hart SC, Koch GW, Schwarz E and Hungate BA. Probing metabolic flux patterns of soil microbial communities using parallel position-specific tracer labeling. Soil Biology and Biochemistry (accepted)

Development of the Avian Dorsal Thalamus: Patterns and Gradients of Neurogenesis.

PubMed

Lynn, Allison M; Schneider, Danielle A; Bruce, Laura L

2015-01-01

The dorsal thalamus is a region of the diencephalon that relays sensory and motor information between areas of the brain stem and the telencephalon. Although a dorsal thalamic region is recognized in all vertebrates and believed to be homologous, little is known about how the regions within it evolved and whether some or all regions within the dorsal thalamus are homologous among different vertebrate species. To characterize the gradients and patterns of neurogenesis of the avian dorsal thalamus, a single application of a low dose of bromodeoxyuridine (BrdU) was delivered to each chick between embryonic day (E)3 and E8 (stages 21 and 34), and chicks were followed up to E8 or E10 (stage 34 or 36). Comparisons of anti-BrdU labeling patterns across the different injection days suggest that nearly all dorsal thalamic neurons are born early in chick embryogenesis, between E3 and E8. Furthermore, neurons in the lateral, dorsal, and posterior parts of the dorsal thalamus are generally born earlier than those in the medial, ventral, and anterior parts. Analyses of the birth dates for nine regions show that the general pattern of neurogenesis in the avian dorsal thalamus resembles that of homologous regions within the rodent thalamus, with the exception of the auditory region, the nucleus ovoidalis, which is born later than the mammalian auditory medial geniculate nucleus. The similar pattern of neurogenesis in birds and mammals may represent a highly conserved developmental pattern that was present in the common ancestor of living birds and mammals, or may represent independently derived states. Additional studies in reptiles and amphibians are needed to distinguish between these evolutionary histories. © 2015 S. Karger AG, Basel.

Retrobiosynthetic nuclear magnetic resonance analysis of amino acid biosynthesis and intermediary metabolism. Metabolic flux in developing maize kernels.

PubMed

Glawischnig, E; Gierl, A; Tomas, A; Bacher, A; Eisenreich, W

2001-03-01

Information on metabolic networks could provide the basis for the design of targets for metabolic engineering. To study metabolic flux in cereals, developing maize (Zea mays) kernels were grown in sterile culture on medium containing [U-(13)C(6)]glucose or [1,2-(13)C(2)]acetate. After growth, amino acids, lipids, and sitosterol were isolated from kernels as well as from the cobs, and their (13)C isotopomer compositions were determined by quantitative nuclear magnetic resonance spectroscopy. The highly specific labeling patterns were used to analyze the metabolic pathways leading to amino acids and the triterpene on a quantitative basis. The data show that serine is generated from phosphoglycerate, as well as from glycine. Lysine is formed entirely via the diaminopimelate pathway and sitosterol is synthesized entirely via the mevalonate route. The labeling data of amino acids and sitosterol were used to reconstruct the labeling patterns of key metabolic intermediates (e.g. acetyl-coenzyme A, pyruvate, phosphoenolpyruvate, erythrose 4-phosphate, and Rib 5-phosphate) that revealed quantitative information about carbon flux in the intermediary metabolism of developing maize kernels. Exogenous acetate served as an efficient precursor of sitosterol, as well as of amino acids of the aspartate and glutamate family; in comparison, metabolites formed in the plastidic compartments showed low acetate incorporation.

Magneto-impedance based detection of magnetically labeled cancer cells and bio-proteins

NASA Astrophysics Data System (ADS)

Devkota, J.; Howell, M.; Mohapatra, S.; Nhung, T. H.; Mukherjee, P.; Srikanth, H.; Phan, M. H.

2015-03-01

A magnetic biosensor with enhanced sensitivity and immobilized magnetic markers is essential for a reliable analysis of the presence of a biological entity in a fluid. Based on conventional approaches, however, it is quite challenging to create such a sensor. We report on a novel magnetic biosensor using the magneto-impedance (MI) effect of a Co-based amorphous ribbon with a microhole-patterned surface that fulfils these requirements. The sensor probe was fabricated by patterning four microholes, each of diameter 2 μm and depth 2 μm, on the ribbon surface using FIB lithography. The magnetically labeled Luis Lung Carcinoma (LLC) cancer cells and Bovine serum albumin (BSA) proteins were drop-casted on the ribbon surface, and MI was measured over 0.1 - 10 MHz frequency range. As the analytes were trapped into the microholes, their physical motion was minimized and interaction among the magnetic fields was strengthened, thus yielding a more reliable and sensitive detection of the biological entities. The presence of magnetically labeled LLC cells (8.25x105 cells/ml, 10 μl) and BSA proteins (2x1011 particles/ml, 10 μl) were found to result in a ~ 2% change in MI with respect to the reference signal.

Evidence for a universal pathway of abscisic acid biosynthesis in higher plants from sup 18 O incorporation patterns

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zeevaart, J.A.D.; Heath, T.G.; Gage, D.A.

1989-12-01

Previous labeling studies of abscisic acid (ABA) with {sup 18}O{sub 2} have been mainly conducted with water-stressed leaves. In this study, {sup 18}O incorporation into ABA of stressed leaves of various species was compared with {sup 18}O labeling of ABA of turgid leaves and of fruit tissue in different stages of ripening. In stressed leaves of all six species investigated, avocado (Persea americana), barley (Hordeum vulgare), bean (Phaseolus vulgaris), cocklebur (Xanthium strumarium), spinach (Spinacia oleracea), and tobacco (Nicotiana tabacum), {sup 18}O was most abundant in the carboxyl group, whereas incorporation of a second and third {sup 18}O in the oxygenmore » atoms on the ring of ABA was much less prominent after 24 h in {sup 18}O{sub 2}. ABA from turgid bean leaves showed significant {sup 18}O incorporation, again with highest {sup 18}O enrichment in the carboxyl group. On the basis of {sup 18}O-labeling patterns observed in ABA from different tissues it is concluded that, despite variations in precusor pool sizes and intermediate turnover rates, there is a universal pathway of ABA biosynthesis in higher plants which involves cleavage of a larger precursor molecule, presumably an oxygenated carotenoid.« less

Desired and Undesired Effects of Energy Labels--An Eye-Tracking Study.

PubMed

Waechter, Signe; Sütterlin, Bernadette; Siegrist, Michael

2015-01-01

Saving energy is an important pillar for the mitigation of climate change. Electric devices (e.g., freezer and television) are an important player in the residential sector in the final demand for energy. Consumers' purchase decisions are therefore crucial to successfully reach the energy-efficiency goals. Putting energy labels on products is often considered an adequate way of empowering consumers to make informed purchase decisions. Consequently, this approach should contribute to reducing overall energy consumption. The effectiveness of its measurement depends on consumers' use and interpretation of the information provided. Despite advances in energy efficiency and a mandatory labeling policy, final energy consumption per capita is in many countries still increasing. This paper provides a systematic analysis of consumers' reactions to one of the most widely used eco-labels, the European Union (EU) energy label, by using eye-tracking methodology as an objective measurement. The study's results partially support the EU's mandatory policy, showing that the energy label triggers attention toward energy information in general. However, the energy label's effect on consumers' actual product choices seems to be rather low. The study's results show that the currently used presentation format on the label is insufficient. The findings suggest that it does not facilitate the integration of energy-related information. Furthermore, the current format can attract consumers to focus more on energy-efficiency information, leading them to disregard information about actual energy consumption. As a result, the final energy consumption may increase because excellent ratings on energy efficiency (e.g., A++) do not automatically imply little consumption. Finally, implications for policymakers and suggestions for further research are discussed.

Specific photoaffinity labeling of two plasma membrane polypeptides with an azido auxin

NASA Technical Reports Server (NTRS)

Hicks, G. R.; Rayle, D. L.; Jones, A. M.; Lomax, T. L.

1989-01-01

Plasma membrane vesicles were isolated from zucchini (Cucurbita pepo) hypocotyl tissue by aqueous phase partitioning and assessed for homogeneity by the use of membrane-specific enzyme assays. The highly pure (ca. 95%) plasma membrane vesicles maintained a pH differential across the membrane and accumulated a tritiated azido analogue of 3-indoleacetic acid (IAA), 5-azido-[7-3H]IAA ([3H]N3IAA), in a manner similar to the accumulation of [3H]IAA. The association of the [3H]N3IAA with membrane vesicles was saturable and subject to competition by IAA and auxin analogues. Auxin-binding proteins were photoaffinity labeled by addition of [3H]N3IAA to plasma membrane vesicles prior to exposure to UV light (15 sec; 300 nm) and detected by subsequent NaDodSO4/PAGE and fluorography. When the reaction temperature was lowered to -196 degrees C, high-specific-activity labeling of a 40-kDa and a 42-kDa polypeptide was observed. Triton X-100 (0.1%) increased the specific activity of labeling and reduced the background, which suggests that the labeled polypeptides are intrinsic membrane proteins. The labeled polypeptides are of low abundance, as expected for auxin receptors. Further, the addition of IAA and auxin analogues to the photoaffinity reaction mixture resulted in reduced labeling that was qualitatively similar to their effects on the accumulation of radiolabeled IAA in membrane vesicles. Collectively, these results suggest that the radiolabeled polypeptides are auxin receptors. The covalent nature of the label should facilitate purification and further characterization of the receptors.

Specific photoaffinity labeling of two plasma membrane polypeptides with an azido auxin.

PubMed

Hicks, G R; Rayle, D L; Jones, A M; Lomax, T L

1989-07-01

Plasma membrane vesicles were isolated from zucchini (Cucurbita pepo) hypocotyl tissue by aqueous phase partitioning and assessed for homogeneity by the use of membrane-specific enzyme assays. The highly pure (ca. 95%) plasma membrane vesicles maintained a pH differential across the membrane and accumulated a tritiated azido analogue of 3-indoleacetic acid (IAA), 5-azido-[7-3H]IAA ([3H]N3IAA), in a manner similar to the accumulation of [3H]IAA. The association of the [3H]N3IAA with membrane vesicles was saturable and subject to competition by IAA and auxin analogues. Auxin-binding proteins were photoaffinity labeled by addition of [3H]N3IAA to plasma membrane vesicles prior to exposure to UV light (15 sec; 300 nm) and detected by subsequent NaDodSO4/PAGE and fluorography. When the reaction temperature was lowered to -196 degrees C, high-specific-activity labeling of a 40-kDa and a 42-kDa polypeptide was observed. Triton X-100 (0.1%) increased the specific activity of labeling and reduced the background, which suggests that the labeled polypeptides are intrinsic membrane proteins. The labeled polypeptides are of low abundance, as expected for auxin receptors. Further, the addition of IAA and auxin analogues to the photoaffinity reaction mixture resulted in reduced labeling that was qualitatively similar to their effects on the accumulation of radiolabeled IAA in membrane vesicles. Collectively, these results suggest that the radiolabeled polypeptides are auxin receptors. The covalent nature of the label should facilitate purification and further characterization of the receptors.

Is advising food allergic patients to avoid food with precautionary allergen labelling out of date?

PubMed

Zurzolo, Giovanni A; de Courten, Maximilian; Koplin, Jennifer; Mathai, Michael L; Allen, Katrina J

2016-06-01

Precautionary allergen labelling (PAL) continues to be used by the food manufacturing industry to alert the food allergic consumer that cross-contact may have occurred during the supply chain for ingredients or the manufacturing process. This review will summarize recent evidence regarding use and interpretation of precautionary labels by industry, healthcare professionals, and food allergic consumers. Consumers find precautionary labels difficult to interpret and often distrust them as disclaimers of product liability. It is unclear from a clinician's perspective how healthcare professionals should advise their patients regarding these statements. Recent studies suggest that consumers do not always read food labels and that these labels are difficult to interpret and are often distrusted by consumers as disclaimers of liability. There is evidence to suggest that this behaviour occurs in all countries assessed that use PAL. The healthcare professional remains confused about the interpretation and value of the current PAL system as it is unclear whether foods that contain no advisory labels are safe to consume. There is a need for improvement in the value and use of precautionary labelling for allergen risk assessment for allergic consumers. New studies have shown the confusion that currently exists in regard to PAL for the healthcare professional and the consumer alike. The studies have also highlighted certain gaps in the literature that, once addressed, will improve the uniformity of PAL and provide the healthcare professional with appropriate advice which they can in turn relay to the allergic consumer. Because of the global supply of food products there is a need for an international approach in improving PAL.

Evidence that glucose is the major transferred metabolite in dinoflagellate-cnidarian symbiosis.

PubMed

Burriesci, Matthew S; Raab, Theodore K; Pringle, John R

2012-10-01

Reef-building corals and many other cnidarians are symbiotic with dinoflagellates of the genus Symbiodinium. It has long been known that the endosymbiotic algae transfer much of their photosynthetically fixed carbon to the host and that this can provide much of the host's total energy. However, it has remained unclear which metabolite(s) are directly translocated from the algae into the host tissue. We reexamined this question in the small sea anemone Aiptasia using labeling of intact animals in the light with (13)C-bicarbonate, rapid homogenization and separation of animal and algal fractions, and analysis of metabolite labeling by gas chromatography-mass spectrometry. We found labeled glucose in the animal fraction within 2 min of exposure to (13)C-bicarbonate, whereas no significant labeling of other compounds was observed within the first 10 min. Although considerable previous evidence has suggested that glycerol might be a major translocated metabolite, we saw no significant labeling of glycerol within the first hour, and incubation of intact animals with (13)C-labeled glycerol did not result in a rapid production of (13)C-glucose. In contrast, when Symbiodinium cells freshly isolated from host tissue were exposed to light and (13)C-bicarbonate in the presence of host homogenate, labeled glycerol, but not glucose, was detected in the medium. We also observed early production of labeled glucose, but not glycerol, in three coral species. Taken together, the results suggest that glucose is the major translocated metabolite in dinoflagellate-cnidarian symbiosis and that the release of glycerol from isolated algae may be part of a stress response.

Labeling of genetically modified food: closer to reality in the United States?

PubMed

Wohlers, Anton E

2013-01-01

Within the broader context of several related biotech developments, including the proliferation of GM food in American grocery stories, the recent decision by Whole Foods Market, Inc. to require the labeling of all genetically modified (GM) organism products sold in its stores by 2018, and the development of GM animals for consumption, this essay asks whether the United States is inching towards a policy of mandatory GM food labeling. The analysis highlights aspects of the biotechnology policy debate in the United States and European Union, and traces public opinion as well as grassroots and legislative efforts aimed at GM food labeling. Findings show that activities at the federal level do not suggest any major regulatory changes regarding labeling in the near future; however, a growing number of individual states are considering GM food labeling legislation and political momentum in favor of labeling has picked up in recent years. Voluntary labeling by food companies may also become increasingly common.

Menu labeling perception and health behaviors among immigrant and US born minority populations: assessment in two Los Angeles public markets.

PubMed

Vargas-Bustamante, Arturo

2013-01-01

To analyze menu labeling perception and food choices/health behaviors in two Los Angeles public markets. Labels with food caloric content were displayed in the food court of one of these markets. Bivarate means analyses compared the surveyed population by market and by nativity status. The main predictors of menu-labeling influence were identified in the sample from the market that displayed labels. A separate analysis investigated food choices/health behaviors among immigrant cohorts by time of US residence. Reading labels when shopping was one of the main predictors associated with menu labeling influence. Longer-stayed immigrants were more likely to afford "balanced meals", but they were also more likely to eat in fast food restaurants and less likely to engage into moderate/intense physical activity. While nativity was not a significant predictor of menu labeling influence on food choices, our findings suggest food choices/behaviors convergence among immigrant and US-born populations.

Predictors of awareness of standard drink labelling and drinking guidelines to reduce negative health effects among Australian drinkers.

PubMed

Coomber, Kerri; Jones, Sandra C; Martino, Florentine; Miller, Peter G

2017-03-01

This study examined rates of awareness of standard drink labelling and drinking guidelines among Australian adult drinkers. Demographic predictors of these two outcomes were also explored. Online survey panel participants aged 18-45 years(n = 1061; mean age = 33.2 years) completed an online survey assessing demographics, alcohol consumption patterns, awareness of standard drink labels and the National Health and Medical Research Council (NHMRC) guidelines, and support for more detailed labels. The majority (80%) of participants had seen standard drink labels on alcohol products; with younger drinkers, those from a regional/rural location and high-risk drinkers significantly more likely to have seen such labelling. Most respondents estimated at or below the maximum number of drinks stipulated in the NHMRC guidelines. However, their estimates of the levels for male drinkers were significantly higher than for female drinkers. High-risk drinkers were significantly less likely to provide accurate estimates, while those who had seen the standard drink logo were significantly more likely to provide accurate estimates of drinking levels to reduce the risk of long-term harms only. Just under three-quarters of respondents supported the inclusion of more information on labels regarding guidelines to reduce negative health effects. The current standard drink labelling approach fails to address high-risk drinkers. The inclusion of information about NHMRC guidelines on alcohol labels, and placing standard drink labelling on the front of products could improve awareness of what constitutes a standard drink and safe levels of consumption among Australian drinkers.[Kerri Coomber, Sandra C. Jones, Florentine Martino, Peter G. Miller. Predictors of awareness of standard drink labelling and drinking guidelines to reduce negative health effects among Australian drinkers. Drug Alcohol Rev 2017;36:200-209]. © 2016 Australasian Professional Society on Alcohol and other Drugs.

The ``listener'' in the modeling of speech prosody

NASA Astrophysics Data System (ADS)

Kohler, Klaus J.

2004-05-01

Autosegmental-metrical modeling of speech prosody is principally speaker-oriented. The production of pitch patterns, in systematic lab speech experiments as well as in spontaneous speech corpora, is analyzed in f0 tracings, from which sequences of H(igh) and L(ow) are abstracted. The perceptual relevance of these pitch categories in the transmission from speakers to listeners is largely not conceptualized; thus their modeling in speech communication lacks an essential component. In the metalinguistic task of labeling speech data with the annotation system ToBI, the ``listener'' plays a subordinate role as well: H and L, being suggestive of signal values, are allocated with reference to f0 curves and little or no concern for perceptual classification by the trained labeler. The seriousness of this theoretical gap in the modeling of speech prosody is demonstrated by experimental data concerning f0-peak alignment. A number of papers in JASA have dealt with this topic from the point of synchronizing f0 with the vocal tract time course in acoustic output. However, perceptual experiments within the Kiel intonation model show that ``early,'' ``medial'' and ``late'' peak alignments need to be defined perceptually and that in doing so microprosodic variation has to be filtered out from the surface signal.

Posttranslational modifications of Sindbis virus glycoproteins: electrophoretic analysis of pulse-chase-labeled infected cells.

PubMed

Bonatti, S; Cancedda, F D

1982-04-01

Cytoplasmic extracts prepared from Sindbis virus-infected chicken embryo fibroblasts pulse-chase-labeled with [35S]methionine 6 h postinfection were analyzed on a highly resolving sodium dodecyl sulfate-gel either directly or after various treatments. The results we obtained suggest that (i) the proteolytic cleavage which converts PE2 to E2 glycoprotein takes place intracellularly, before or at least during the formation of complex-type oligosaccharide side chains; and (ii) E1 glycoprotein undergoes a complex maturation pattern. Newly synthesized E1 has a molecular weight of 53,000: shortly thereafter, this 53,000 (53K) form was converted to a 50K form. Subsequently, the 50K form decreased its apparent molecular weight progressively and eventually comigrated with E1 glycoprotein present in the extracellular virus, which displays a molecular weight of 51,000 to 52,000. The conversion of the 53K to the 50K form was not the result of a proteolytic processing and did not depend on glycosylation or disulfide bridge formation and exchange. The possible mechanisms of this conversion are discussed. The second conversion step (from the 50K to the 51-52K form) was due to the formation of complex-type oligosaccharide and was reversed by incubating the cellular extracts with neuraminidase before electrophoretic analysis.

Prenatal hormones and childhood sex-segregation: Playmate and play style preferences in girls with congenital adrenal hyperplasia

PubMed Central

Pasterski, Vickie; Geffner, Mitchell E.; Brain, Caroline; Hindmarsh, Peter; Brook, Charles; Hines, Melissa

2011-01-01

We investigated playmate and play style preference in children with congenital adrenal hyperplasia (CAH) (26 females, 31 males) and their unaffected siblings (26 females, 17 males) using the Playmate and Play Style Preferences Structured Interview (PPPSI). Both unaffected boys and girls preferred same-sex playmates and sex-typical play styles. In the conflict condition where children chose between a same-sex playmate engaged in an other-sex activity or an other-sex playmate engaged in a same-sex activity, boys (both CAH and unaffected brothers) almost exclusively chose playmates based on the preferred play style of the playmate as opposed to the preferred gender label of the playmate. By contrast, unaffected girls used play style and gender label about equally when choosing playmates. Girls with CAH showed a pattern similar to that of boys: their playmate selections were more masculine than unaffected girls, they preferred a boy-typical play style and, in the conflict condition, chose playmates engaged in a masculine activity. These findings suggest that prenatal androgen exposure contributes to sex differences in playmate selection observed in typically-developing children, and that, among boys and girls exposed to high levels of androgens prenatally, play style preferences drive sex segregation in play. PMID:21338606

Prenatal hormones and childhood sex segregation: playmate and play style preferences in girls with congenital adrenal hyperplasia.

PubMed

Pasterski, Vickie; Geffner, Mitchell E; Brain, Caroline; Hindmarsh, Peter; Brook, Charles; Hines, Melissa

2011-04-01

We investigated playmate and play style preference in children with congenital adrenal hyperplasia (CAH) (26 females, 31 males) and their unaffected siblings (26 females, 17 males) using the Playmate and Play Style Preferences Structured Interview (PPPSI). Both unaffected boys and girls preferred same-sex playmates and sex-typical play styles. In the conflict condition where children chose between a same-sex playmate engaged in an other-sex activity or an other-sex playmate engaged in a same-sex activity, boys (both CAH and unaffected brothers) almost exclusively chose playmates based on the preferred play style of the playmate as opposed to the preferred gender label of the playmate. By contrast, unaffected girls used play style and gender label about equally when choosing playmates. Girls with CAH showed a pattern similar to that of boys: their playmate selections were more masculine than unaffected girls, they preferred a boy-typical play style and, in the conflict condition, chose playmates engaged in a masculine activity. These findings suggest that prenatal androgen exposure contributes to sex differences in playmate selection observed in typically developing children and that, among boys and girls exposed to high levels of androgens prenatally, play style preferences drive sex segregation in play. Copyright © 2011 Elsevier Inc. All rights reserved.

Presence of closely spaced protein thiols on the surface of mammalian cells.

PubMed Central

Donoghue, N.; Yam, P. T.; Jiang, X. M.; Hogg, P. J.

2000-01-01

It has been proposed that certain cell-surface proteins undergo redox reactions, that is, transfer of hydrogens and electrons between closely spaced cysteine thiols that can lead to reduction, formation, or interchange of disulfide bonds. This concept was tested using a membrane-impermeable trivalent arsenical to identify closely spaced thiols in cell-surface proteins. We attached the trivalent arsenical, phenylarsenoxide, to the thiol of reduced glutathione to produce 4-(N-(S-glutathionylacetyl)amino)phenylarsenoxide (GSAO). GSAO bound tightly to synthetic, peptide, and protein dithiols like thioredoxin, but not to monothiols. To identify cell-surface proteins that contain closely spaced thiols, we attached a biotin moiety through a spacer arm to the primary amino group of the gamma-glutamyl residue of GSAO (GSAO-B). Incorporation of GSAO-B into proteins was assessed by measuring the biotin using streptavidin-peroxidase. Up to 12 distinct proteins were labeled with GSAO-B on the surface of endothelial and fibrosarcoma cells. The pattern of labeled proteins differed between the different cell types. Protein disulfide isomerase was one of the proteins on the endothelial and fibrosarcoma cell surface that incorporated GSAO-B. These findings demonstrate that the cell-surface environment can support the existence of closely spaced protein thiols and suggest that at least some of these thiols are redox active. PMID:11206065

Structural analysis of an HLA-B27 functional variant, B27d detected in American blacks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rojo, S.; Aparicio, P.; Hansen, J.A.

1987-11-15

The structure of a new functional variant B27d has been established by comparative peptide mapping and radiochemical sequencing. This analysis complete the structural characterization of the six know histocompatibility leukocyte antigen (HLA)-B27 subtypes. The only detected amino acid change between the main HLA-B27.1 subtype and B27d is that of Try/sub 59/ to His/sub 59/. Position 59 has not been previously found to vary among class I HLA or H-2 antigens. Such substitution accounts for the reported isoelectric focusing pattern of this variant. HLA-B27d is the only B27 variant found to differ from other subtypes by a single amino acid replacement.more » The nature of the change is compatible with its origin by a point mutation from HLB-B27.1. Because B27d was found only American blacks and in no other ethnic groups, it is suggested that this variant originated as a result of a mutation of the B27.1 gene that occurred within the black population. Structural analysis of B27d was done by comparative mapping. Radiochemical sequencing was carried out with /sup 14/C-labeled and /sup 3/H-labeled amino acids.« less

Label-free LC-MSMS analysis of vitreous from autoimmune uveitis reveals a significant decrease in secreted Wnt signalling inhibitors DKK3 and SFRP2.

PubMed

Hauck, Stefanie M; Hofmaier, Florian; Dietter, Johannes; Swadzba, Margarete E; Blindert, Marcel; Amann, Barbara; Behler, Jennifer; Kremmer, Elisabeth; Ueffing, Marius; Deeg, Cornelia A

2012-07-19

Equine recurrent uveitis is a severe and frequent blinding disease in horses which presents with auto-reactive invading T-cells, resulting in the destruction of the inner eye. Infiltration of inflammatory cells into the retina and vitreous is driven by currently unknown guidance cues, however surgical removal of the vitreous (vitrectomy) has proven therapeutically successful. Therefore, proteomic analyses of vitrectomy samples are likely to result in detection of proteins contributing to disease pathogenesis. Vitreous from healthy and ERU diseased horses were directly compared by quantitative mass spectrometry based on label-free quantification of peak intensities across samples. We found a significant upregulation of complement and coagulation cascades and downregulation of negative paracrine regulators of canonical Wnt signalling including the Wnt signalling inhibitors DKK3 and SFRP2. Based on immunohistochemistry, both proteins are expressed in equine retina and suggest localisation to retinal Müller glial cells (RMG), which may be the source cells for these proteins. Furthermore, retinal expression levels and patterns of DKK3 change in response to ERU. Since many other regulated proteins identified here are associated with RMG cells, these cells qualify as the prime responders to autoimmune triggers. Copyright © 2012 Elsevier B.V. All rights reserved.

Calreticulin mutation-specific immunostaining in myeloproliferative neoplasms: pathogenetic insight and diagnostic value

PubMed Central

Vannucchi, A M; Rotunno, G; Bartalucci, N; Raugei, G; Carrai, V; Balliu, M; Mannarelli, C; Pacilli, A; Calabresi, L; Fjerza, R; Pieri, L; Bosi, A; Manfredini, R; Guglielmelli, P

2014-01-01

Mutations in the gene calreticulin (CALR) occur in the majority of JAK2- and MPL-unmutated patients with essential thrombocythemia (ET) and primary myelofibrosis (PMF); identifying CALR mutations contributes to the diagnostic pathway of ET and PMF. CALR mutations are heterogeneous spanning over the exon 9, but all result in a novel common protein C terminus. We developed a polyclonal antibody against a 17-amino-acid peptide derived from mutated calreticulin that was used for immunostaining of bone marrow biopsies. We show that this antibody specifically recognized patients harboring different types of CALR mutation with no staining in healthy controls and JAK2- or MPL-mutated ET and PMF. The labeling was mostly localized in megakaryocytes, whereas myeloid and erythroid cells showed faint staining, suggesting a preferential expression of calreticulin in megakaryocytes. Megakaryocytic-restricted expression of calreticulin was also demonstrated using an antibody against wild-type calreticulin and by measuring the levels of calreticulin RNA by gene expression analysis. Immunostaining using an antibody specific for mutated calreticulin may become a rapid, simple and cost-effective method for identifying CALR-mutated patients complementing molecular analysis; furthermore, the labeling pattern supports the preferential expansion of megakaryocytic cell lineage as a result of CALR mutation in an immature hematopoietic stem cell. PMID:24618731

Distribution and change patterns of free IAA, ABP 1 and PM H⁺-ATPase during ovary and ovule development of Nicotiana tabacum L.

PubMed

Chen, Dan; Deng, Yingtian; Zhao, Jie

2012-01-15

Auxin plays key roles in flower induction, embryogenesis, seed formation and seedling development, but little is known about whether auxin regulates the development of ovaries and ovules before pollination. In the present report, we measured the content of free indole-3-acetic (IAA) in ovaries of Nicotiana tabacum L., and localized free IAA, auxin binding protein 1 (ABP1) and plasma membrane (PM) H⁺-ATPase in the ovaries and ovules. The level of free IAA in the developmental ovaries increased gradually from the stages of ovular primordium to the functional megaspore, but slightly decreased when the embryo sacs formed. Immunoenzyme labeling clearly showed that both IAA and ABP1 were distributed in the ovules, the edge of the placenta, vascular tissues and the ovary wall, while PM H⁺-ATPase was mainly localized in the ovules. By using immunogold labeling, the subcellular distributions of IAA, ABP1 and PM H⁺-ATPase in the ovules were also shown. The results suggest that IAA, ABP1 and PM H⁺-ATPase may play roles in the ovary and ovule initiation, formation and differentiation. Crown Copyright © 2011. Published by Elsevier GmbH. All rights reserved.

Similar GABAergic inputs in dentate granule cells born during embryonic and adult neurogenesis.

PubMed

Laplagne, Diego A; Kamienkowski, Juan E; Espósito, M Soledad; Piatti, Verónica C; Zhao, Chunmei; Gage, Fred H; Schinder, Alejandro F

2007-05-01

Neurogenesis in the dentate gyrus of the hippocampus follows a unique temporal pattern that begins during embryonic development, peaks during the early postnatal stages and persists through adult life. We have recently shown that dentate granule cells born in early postnatal and adult mice acquire a remarkably similar afferent connectivity and firing behavior, suggesting that they constitute a homogeneous functional population [Laplagne et al. (2006)PLoS Biol., 4, e409]. Here we extend our previous study by comparing mature neurons born in the embryonic and adult hippocampus, with a focus on intrinsic membrane properties and gamma-aminobutyric acid (GABA)ergic synaptic inputs. For this purpose, dividing neuroblasts of the ventricular wall were retrovirally labeled with green fluorescent protein at embryonic day 15 (E15), and progenitor cells of the subgranular zone were labeled with red fluorescent protein in the same mice at postnatal day 42 (P42, adulthood). Electrophysiological properties of mature neurons born at either stage were then compared in the same brain slices. Evoked and spontaneous GABAergic postsynaptic responses of perisomatic and dendritic origin displayed similar characteristics in both neuronal populations. Miniature GABAergic inputs also showed similar functional properties and pharmacological profile. A comparative analysis of the present data with our previous observations rendered no significant differences among GABAergic inputs recorded from neurons born in the embryonic, early postnatal and adult mice. Yet, embryo-born neurons showed a reduced membrane excitability, suggesting a lower engagement in network activity. Our results demonstrate that granule cells of different age, location and degree of excitability receive GABAergic inputs of equivalent functional characteristics.

Metabolic flux analysis of Cyanothece sp. ATCC 51142 under mixotrophic conditions.

PubMed

Alagesan, Swathi; Gaudana, Sandeep B; Sinha, Avinash; Wangikar, Pramod P

2013-11-01

Cyanobacteria are a group of photosynthetic prokaryotes capable of utilizing solar energy to fix atmospheric carbon dioxide to biomass. Despite several "proof of principle" studies, low product yield is an impediment in commercialization of cyanobacteria-derived biofuels. Estimation of intracellular reaction rates by (13)C metabolic flux analysis ((13)C-MFA) would be a step toward enhancing biofuel yield via metabolic engineering. We report (13)C-MFA for Cyanothece sp. ATCC 51142, a unicellular nitrogen-fixing cyanobacterium, known for enhanced hydrogen yield under mixotrophic conditions. Rates of reactions in the central carbon metabolism under nitrogen-fixing and -non-fixing conditions were estimated by monitoring the competitive incorporation of (12)C and (13)C from unlabeled CO2 and uniformly labeled glycerol, respectively, into terminal metabolites such as amino acids. The observed labeling patterns suggest mixotrophic growth under both the conditions, with a larger fraction of unlabeled carbon in nitrate-sufficient cultures asserting a greater contribution of carbon fixation by photosynthesis and an anaplerotic pathway. Indeed, flux analysis complements the higher growth observed under nitrate-sufficient conditions. On the other hand, the flux through the oxidative pentose phosphate pathway and tricarboxylic acid cycle was greater in nitrate-deficient conditions, possibly to supply the precursors and reducing equivalents needed for nitrogen fixation. In addition, an enhanced flux through fructose-6-phosphate phosphoketolase possibly suggests the organism's preferred mode under nitrogen-fixing conditions. The (13)C-MFA results complement the reported predictions by flux balance analysis and provide quantitative insight into the organism's distinct metabolic features under nitrogen-fixing and -non-fixing conditions.

Dynamic FtsA and FtsZ localization and outer membrane alterations during polar growth and cell division in Agrobacterium tumefaciens

PubMed Central

Zupan, John R.; Cameron, Todd A.; Anderson-Furgeson, James; Zambryski, Patricia C.

2013-01-01

Growth and cell division in rod-shaped bacteria have been primarily studied in species that grow predominantly by peptidoglycan (PG) synthesis along the length of the cell. Rhizobiales species, however, predominantly grow by PG synthesis at a single pole. Here we characterize the dynamic localization of several Agrobacterium tumefaciens components during the cell cycle. First, the lipophilic dye FM 4-64 predominantly stains the outer membranes of old poles versus growing poles. In cells about to divide, however, both poles are equally labeled with FM 4-64, but the constriction site is not. Second, the cell-division protein FtsA alternates from unipolar foci in the shortest cells to unipolar and midcell localization in cells of intermediate length, to strictly midcell localization in the longest cells undergoing septation. Third, the cell division protein FtsZ localizes in a cell-cycle pattern similar to, but more complex than, FtsA. Finally, because PG synthesis is spatially and temporally regulated during the cell cycle, we treated cells with sublethal concentrations of carbenicillin (Cb) to assess the role of penicillin-binding proteins in growth and cell division. Cb-treated cells formed midcell circumferential bulges, suggesting that interrupted PG synthesis destabilizes the septum. Midcell bulges contained bands or foci of FtsA-GFP and FtsZ-GFP and no FM 4-64 label, as in untreated cells. There were no abnormal morphologies at the growth poles in Cb-treated cells, suggesting unipolar growth uses Cb-insensitive PG synthesis enzymes. PMID:23674672

Off-label prescribing patterns of antiemetics in children: a multicenter study in Italy.

PubMed

Zanon, Davide; Gallelli, Luca; Rovere, Francesca; Paparazzo, Rossella; Maximova, Natalia; Lazzerini, Marzia; Reale, Antonio; Corsetti, Tiziana; Renna, Salvatore; Emanueli, Tullia; Mannelli, Francesco; Manteghetti, Francesco; Da Dalt, Liviana; Palleria, Caterina; Banchieri, Nicola; Urbino, Antonio; Miglietta, Mario; Cardoni, Giovanni; Pompilio, Adriana; Arrighini, Alberto; Lazzari, Clara; Messi, Gianni

2013-03-01

Acute gastroenteritis (AG) represents both the main cause of acute vomiting in children under 3 years old and a major cause of access to the emergency department. Even if several drugs may be able to reduce the emesis, the pharmacological treatment of vomiting in children remains a controversial issue, and several drugs are prescribed outside their authorized drug label with respect dosage, age, indication, or route of administration and are named as off-label. The aim of present study was to assess the off-label use of antiemetic drugs in patients less than 18 years with vomiting related to AG. This study was carried out in eight pediatric emergency departments in Italy. The following data were obtained crossing the pharmacy distribution records with emergency departments' patient data: sex and age of the patients and detailed information for each drug used (indication, dose, frequency, and route of administration). We recorded that antiemetic drugs were prescribed in every year, particularly in children up to 2 years old, and compared with both literature data and data sheet; 30 % of the administered antiemetics were used off-label. In particular, domperidone was the only antiemetic used labeled for AG treatment in pediatric patients, while metoclopramide and ondansetron have been off-label for both age and indications (i.e., AG treatment). In conclusion, we documented an off-label use of antiemetics in children, and this could represents a problem of safety for the patient and a legal risk for the prescribing physician if patients have an unwanted or bad outcome from treatment.

Developmental differences in the neural mechanisms of facial emotion labeling.

PubMed

Wiggins, Jillian Lee; Adleman, Nancy E; Kim, Pilyoung; Oakes, Allison H; Hsu, Derek; Reynolds, Richard C; Chen, Gang; Pine, Daniel S; Brotman, Melissa A; Leibenluft, Ellen

2016-01-01

Adolescence is a time of increased risk for the onset of psychological disorders associated with deficits in face emotion labeling. We used functional magnetic resonance imaging (fMRI) to examine age-related differences in brain activation while adolescents and adults labeled the emotion on fearful, happy and angry faces of varying intensities [0% (i.e. neutral), 50%, 75%, 100%]. Adolescents and adults did not differ on accuracy to label emotions. In the superior temporal sulcus, ventrolateral prefrontal cortex and middle temporal gyrus, adults show an inverted-U-shaped response to increasing intensities of fearful faces and a U-shaped response to increasing intensities of happy faces, whereas adolescents show the opposite patterns. In addition, adults, but not adolescents, show greater inferior occipital gyrus activation to negative (angry, fearful) vs positive (happy) emotions. In sum, when subjects classify subtly varying facial emotions, developmental differences manifest in several 'ventral stream' brain regions. Charting the typical developmental course of the brain mechanisms of socioemotional processes, such as facial emotion labeling, is an important focus for developmental psychopathology research. Published by Oxford University Press 2015. This work is written by US Government employees and is in the public domain in the US.

Nonenzymatic chemiluminescent detection and quantitation of total protein on Western and slot blots allowing subsequent immunodetection and sequencing.

PubMed

Alba, F J; Daban, J R

1997-10-01

We have studied the light emission efficiency of proteins labeled with different fluorescent dyes chemically excited by the bis(2,4,6-trichlorophenyl)oxalate (TCPO)-H2O2 reaction. Using this peroxyoxalate chemiluminescence system, the best results were obtained with proteins covalently labeled with 2-methoxy-2,4-diphenyl-3(2H)-furanone (MDPF). Blotted proteins on polyvinylidene difluoride (PVDF) membranes can be labeled rapidly with MDPF. Our results demonstrate that energy from the excited intermediate produced in the TCPO-H2O2 reaction can be efficiently transferred to MDPF-labeled proteins in solution and on PVDF membranes. Although this nonenzymatic chemiluminescent system produces a background emission that reduces the sensitivity, the method developed in this work allows detection of 5 ng of protein in blots after 5 min exposure to X-ray film. Chemiluminescence of MDPF-labeled proteins on Western and slot blots may also be detected and quantified using a charge-coupled device (CCD) camera or a storage phosphor imaging system. This chemiluminescent method allows the staining of the total electrophoretic pattern but does not preclude further N-terminal sequencing and immunodetection of specific bands.

Direct evidence of macrophage differentiation from bone marrow cells in the liver: a possible origin of Kupffer cells.

PubMed

Takezawa, R; Watanabe, Y; Akaike, T

1995-12-01

Controversy has surrounded origin and differentiation of tissue macrophages. We directly demonstrate the differentiation of bone marrow cells into macrophages in the liver in vivo using a cell-labeling fluorescence dye, PKH-26. Bone marrow cells labeled with PKH26 were intravenously injected into syngenic mice, and these cells were tracked by flow cytometric analysis. The majority of the labeled cells were detected only in the liver after 4 days. Interestingly, antigens specific for macrophage lineage cells (F4/80, Fc gamma RII, and CD14) were detected on the liver-accumulated cells only 4 h after the injection. The pattern of the antigen expression changed to that of Kupffer cells (F4/80+, Fc gamma RII+, Mac-1-) after 4 days and remained so thereafter. These labeled cells in the liver were esterase staining-positive and showed phagocytic activity at day 7. The number of labeled cells among the Kupffer cells in the liver increased with days after injection. This indicates that bone marrow cells accumulate in the liver and differentiate into liver macrophages on site. Roles of factors secreted from hepatocytes are also discussed.

Background and stimulus-induced patterns of high metabolic activity in the visual cortex (area 17) of the squirrel and macaque monkey

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humphrey, A.L.; Hendrickson, A.E.

1983-02-01

We have used 2-deoxy-D-(/sup 14/C)glucose (2-DG) autoradiography and cytochrome oxidase histochemistry to examine background and stimulus-induced patterns of metabolic activity in monkey striate cortex. In squirrel monkeys (Saimiri sciureus) that binocularly or monocularly viewed diffuse white light or binocularly viewed bars of many orientations and spatial frequencies, 2-DG consumption was not uniform across the cortex but consisted of regularly spaced radial zones of high uptake. The zones extended through all laminae except IVc beta and, when viewed tangentially, formed separate patches 500 microns apart. The cytochrome oxidase stain in these animals also revealed patches of high metabolism which coincided withmore » the 2-DG patches. Squirrel monkeys binocularly viewing vertical stripes showed parallel bands of increased 2-DG uptake in the cortex, while the cytochrome label in these animals remained patchy. When monkeys were kept in the dark during 2-DG exposure, 2-DG-labeled patches were not seen but cytochrome oxidase-positive patches remained. In macaque (Macaca nemestrina) monkeys, binocular stimulation with many orientations and spatial frequencies produced radial zones of high 2-DG uptake in layers I to IVa and VI. When viewed tangentially, these zones formed a dots-in-rows pattern with a spacing of 350 X 500 microns; cytochrome oxidase staining produced an identical pattern. Macaca differed from Saimiri in that monocular stimulation labeled alternate rows. These results indicate that there are radial zones of high background metabolism across squirrel and macaque monkey striate cortex. In Saimiri these zones do not appear to be related to an eye dominance system, while in Macaca they do. The presence of these zones of high metabolism may complicate the interpretation of 2-DG autoradiographs that result from specific visual stimuli.« less

The binding site on cochlear stereocilia for antisera raised against renal Na+ channels is blocked by amiloride and dihydrostreptomycin.

PubMed

Furness, D N; Hackney, C M; Benos, D J

1996-04-01

The mechanoelectrical transduction channels on hair cells have been suggested to be operated by tip links that are stretched when the hair bundle is deflected in the direction of the tallest row of stereocilia. Localising these channels is therefore an important test of this hypothesis. The transduction channels are known to be amiloride-sensitive and immunogold labelling with antibodies raised against the amiloride-sensitive epithelial Na+ channel from kidney (alpha NaCh), has suggested that sites with similar characteristics are located in the region where the tips of the shorter stereocilia appear to come into contact with the sides of the adjacent taller stereocilia rather than being associated directly with the tip links. Now, further immunocytochemical experiments have been performed to determine if amiloride and dihydrostreptomycin, both of which can block transduction, can affect this labelling. Immunofluorescent labelling of the stereocilia is obtained when surface preparations of the organ of Corti are fixed and incubated with alpha NaCh followed by an appropriate secondary antibody. This labelling is abolished by trypsinization prior to fixation but retained if the tissue is pretreated with amiloride and then trypsinized in its presence. Because amiloride is known to protect amiloride-binding sites from degradation by trypsin, these results suggest that alpha NaCh is revealing amiloride-binding sites on the stereocilia. Similarly, immunofluorescent labelling of the stereocilia is abolished if cochlear tissue is pretreated with dihydrostreptomycin (DHS) and fixed in its presence prior to incubation with alpha NaCh. Quantitative analysis of colloidal gold labelling using transmission electron microscopy shows that DHS treatment produces a significant reduction in the number of gold particles on stereocilia, especially in the region of contact between them. These results suggest that anti-Na+ recognises a site with characteristics similar to the mechanoelectrical transduction channels.

A qualitative study of consumer perceptions and use of traffic light food labelling in Ecuador.

PubMed

Freire, Wilma B; Waters, William F; Rivas-Mariño, Gabriela; Nguyen, Tien; Rivas, Patricio

2017-04-01

To analyse patterns of knowledge, comprehension, attitudes and practices regarding the traffic light label placed on processed food packages to inform Ecuadorian consumers about levels of added fat, sugar and salt. Twenty-one focus group discussions organized by age group, sex and place of residence. Interviews with representatives of companies that manufacture or market processed foods. Analysis of regulations and structured observations of processed food labels. Cities and towns in Ecuador's coastal, highland and eastern lowland regions. One hundred and seventy-eight participants in twenty-one focus group discussions and nine key informants. Focus group participants knew about the traffic light label and understood the information it conveys, but not all changed their attitudes and practices related to the purchase and consumption of processed foods. Children, adolescents and adult males reported using the information infrequently; adolescents interested in health and adult women used the label the most to select products. Representatives of companies that manufacture or market processed foods generally opposed the policy, stating that the information is misleading. Nevertheless, some companies have reduced levels of added fat, sugar or salt in their products. The traffic light label is an effective tool for conveying complex information. Its potential contribution to reduce consumption of products with high levels of fat, sugar and salt could be enhanced by promoting healthy diets among consumers who have not changed purchasing and consumption behaviour, by placing the label on front panels and by monitoring the production and marketing of processed foods.

Consumer use and understanding of labelling information on edible marijuana products sold for recreational use in the states of Colorado and Washington.

PubMed

Kosa, Katherine M; Giombi, Kristen C; Rains, Caroline B; Cates, Sheryl C

2017-05-01

In 2014, the states of Colorado and Washington began allowing retail sales of marijuana for recreational use. The regulatory agencies in these states have implemented specific labelling requirements for edible marijuana products sold for recreational use to help address concerns such as delayed activation time, accidental ingestion, and proper dosing. We conducted 12 focus groups with 94 adult consumers and nonconsumers of edibles in Denver and Seattle to collect information on their use and understanding of labelling information on edible marijuana products sold for recreational use. Specifically, we asked participants about the usefulness, attractiveness, ease of comprehension, relevancy, and acceptability of the label information. Some focus group participants look for and read specific information, such as the potency profile and serving size statement, but do not read or were unfamiliar with other labelling features. The focus groups revealed that participants have some concerns about the current labelling of edibles. In particular, participants were concerned that there is too much information on the labels so consumers may not read the label, there is no obvious indication that the product contains marijuana (e.g., a Universal Symbol), and the information on consumption advice is not clear. Participants in both locations suggested that education in a variety of formats, such as web- and video-based education, would be useful in informing consumers about the possible risks of edibles. The focus group findings suggest that improvements are needed in the labelling of edibles to prevent unintentional ingestion among adult nonusers and help ensure proper dosing and safe consumption among adult users. These findings, along with lessons learned from Colorado and Washington, can help inform the labelling of edibles as additional states allow the sale of edibles for recreational use. Copyright © 2017 Elsevier B.V. All rights reserved.

Regulation of Primary Metabolism in Response to Low Oxygen Availability as Revealed by Carbon and Nitrogen Isotope Redistribution.

PubMed

António, Carla; Päpke, Carola; Rocha, Marcio; Diab, Houssein; Limami, Anis M; Obata, Toshihiro; Fernie, Alisdair R; van Dongen, Joost T

2016-01-01

Based on enzyme activity assays and metabolic responses to waterlogging of the legume Lotus japonicus, it was previously suggested that, during hypoxia, the tricarboxylic acid cycle switches to a noncyclic operation mode. Hypotheses were postulated to explain the alternative metabolic pathways involved, but as yet, a direct analysis of the relative redistribution of label through the corresponding pathways was not made. Here, we describe the use of stable isotope-labeling experiments for studying metabolism under hypoxia using wild-type roots of the crop legume soybean (Glycine max). [(13)C]Pyruvate labeling was performed to compare metabolism through the tricarboxylic acid cycle, fermentation, alanine metabolism, and the γ-aminobutyric acid shunt, while [(13)C]glutamate and [(15)N]ammonium labeling were performed to address the metabolism via glutamate to succinate. Following these labelings, the time course for the redistribution of the (13)C/(15)N label throughout the metabolic network was evaluated with gas chromatography-time of flight-mass spectrometry. Our combined labeling data suggest the inhibition of the tricarboxylic acid cycle enzyme succinate dehydrogenase, also known as complex II of the mitochondrial electron transport chain, providing support for the bifurcation of the cycle and the down-regulation of the rate of respiration measured during hypoxic stress. Moreover, up-regulation of the γ-aminobutyric acid shunt and alanine metabolism explained the accumulation of succinate and alanine during hypoxia. © 2016 American Society of Plant Biologists. All Rights Reserved.

Refined avian risk assessment for chlorpyrifos in the United States.

PubMed

Moore, Dwayne R J; Teed, R Scott; Greer, Colleen D; Solomon, Keith R; Giesy, John P

2014-01-01

Refined risk assessments for birds exposed to flowable and granular formulations ofCPY were conducted for a range of current use patterns in the United States. Overall,the collective evidence from the modeling and field study lines of evidence indicate that flowable and granular CPY do not pose significant risks to the bird communities foraging in agro-ecosystems in the United States. The available information indicates that avian incidents resulting from the legal, registered uses of CPY have been very infrequent since 2002 (see SI Appendix 3). The small number of recent incidents suggests that the current labels for CPY are generally protective of birds.However, incident data are uncertain because of the difficulties associated with finding dead birds in the field and linking any mortality observed to CPY.Plowable CPY is registered for a variety of crops in the United States including alfalfa, brassica vegetables, citrus, corn, cotton, grape, mint, onion, peanut, pome and stone fruits, soybean, sugar beet, sunflower, sweet potato, tree nuts, and wheat under the trade name Lorsban Advanced. The major routes of exposure for birds to flowable CPY were consumption of treated dietary items and drinking water. The Liquid Pesticide Avian Risk Assessment Model (Liquid PARAM) was used to simulate avian ingestion of CPY by these routes of exposure. For acute exposure,Liquid PARAM estimated the maximum retained dose in each of 20 birds on each of1,000 fields that were treated with CPY over the 60-d period following initial application.The model used a 1-h time step. For species lacking acceptable acute oral toxicity data (all focal species except northern bobwhite (C. virginianus) and redwinged blackbird (A. phoeniceus)), a species sensitivity distribution (SSD) approach was used to generate hypothetical dose-response curves assuming high, median and low sensitivity to CPY. For acute risk, risk curves were generated for each use pattern and exposure scenario. The risk curves show the relationship between exceedence probability and percent mortality. The results of the Liquid PARAM modeling exercise indicate that flow able CPY poses an acute risk to some bird species, particularly those species that are highly sensitive and that forage extensively in crops with high maximum application rates (e.g., grapefruit, orange). Overall, most bird species would not experience significant mortality as a result of exposure to flowable CPY.The results of a number of field studies conducted at application rates comparable to those on the Lorsban Advanced label indicate that flowable CPY rarely causes avian mortality. The results of the field studies suggest that Liquid PARAM is likely over-estimating acute risk to birds for flowable CPY.For chronic exposure, Liquid PARAM estimated the maximum total daily intake (TDI) over a user-specified exposure duration (28-d in the case of CPY).The maximum average TDI was compared to the chronic NOEL and LOEL from the most sensitive species tested for CPY, the mallard. This comparison was done for each of the 20 birds in each of the 1000 fields simulated in Liquid PARAM.The outpu· ~ are estimates of the probabilities of exceeding the NOEL and LOEL.Liquid PAkAM did not predict significant adverse effects resulting from chronic exposure to flowable CPY. The small number of incidents (2) involving CPY reported since 2002 suggests that the current labels for CPY are generally protective of birds.Granular CPY is registered for a wide variety of crops including brassica vegetables, corn, onion, peanut, sugar beet, sunflower, and tobacco under the trade name Lorsban 15G. Consumption of grit is required by many birds to aid in digestion of hard dietary items such as seeds and insects. Because CPY granules are in the same size range as natural grit particles consumed by birds, there is a potential for birds to mistakenly ingest granular CPY instead of natural grit. We developed the Granular Pesticide Avian Risk Model (GranPARAM) to simulate grit ingestion behavior by birds. The model accounts for proportion of time that birds forage for grit in treated fields, relative proportions of natural grit versus pesticide granules onthe surface of treated fields, rates of ingestion of grit, attractiveness of pesticide granules relative to natural grit and so on. For CPY, each model simulation included20 birds on each of 1,000 fields to capture variability in rates of ingestion of grit and for aging behavior between birds within a focal species, and variability in soil composition between fields for the selected use pattern. The estimated dose for each birdwas compared with randomly chosen doses from relevant dose-response curves forCPY. Our analysis for a wide variety of use patterns on the Lorsban 15G label found that granular CPY poses little risk of causing mortality to bird species that frequent treated fields immediately after application. The predictions of the model have been confirmed in several avian field studies conducted with Lorsban 15G at application rates similar to or exceeding maximum application rates on the Lorsban 15G label.

Synthesis of carbon-11, fluorine-18, and nitrogen-13 labeled radiotracers for biomedical applications. Nuclear Science Series: Nuclear Medicine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowler, J.S.; Wolf, A.P.

1982-09-01

Carbon 11, Fluorine 18, and Nitrogen 13-labeled radiotracers are reviewed from the standpoint of synthetic organic chemistry while keeping in perspective the necessity of integrating the organic chemistry with the design and ultimate application of the radiotracer. The reactions used, the principles used to adapt these reactions to labeling with short-lived radionuclides, and the concepts of chemical reactivity form the framework upon which synthetic strategies for short-lived radiotracers are developed. Potentially new routes are suggested which may be applied to problems in labeling organic molecules. (ACR)

Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines

PubMed Central

Vuong, Helen E.; de Sevilla Müller, Luis Pérez; Hardi, Claudia N.; McMahon, Douglas G.; Brecha, Nicholas C.

2015-01-01

Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) line with three catecholamine-related Cre recombinase lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ~6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium somal diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines were generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. PMID:26335381

Heterogeneous transgene expression in the retinas of the TH-RFP, TH-Cre, TH-BAC-Cre and DAT-Cre mouse lines.

PubMed

Vuong, H E; Pérez de Sevilla Müller, L; Hardi, C N; McMahon, D G; Brecha, N C

2015-10-29

Transgenic mouse lines are essential tools for understanding the connectivity, physiology and function of neuronal circuits, including those in the retina. This report compares transgene expression in the retina of a tyrosine hydroxylase (TH)-red fluorescent protein (RFP) mouse line with three catecholamine-related Cre recombinase mouse lines [TH-bacterial artificial chromosome (BAC)-, TH-, and dopamine transporter (DAT)-Cre] that were crossed with a ROSA26-tdTomato reporter line. Retinas were evaluated and immunostained with commonly used antibodies including those directed to TH, GABA and glycine to characterize the RFP or tdTomato fluorescent-labeled amacrine cells, and an antibody directed to RNA-binding protein with multiple splicing to identify ganglion cells. In TH-RFP retinas, types 1 and 2 dopamine (DA) amacrine cells were identified by their characteristic cellular morphology and type 1 DA cells by their expression of TH immunoreactivity. In the TH-BAC-, TH-, and DAT-tdTomato retinas, less than 1%, ∼ 6%, and 0%, respectively, of the fluorescent cells were the expected type 1 DA amacrine cells. Instead, in the TH-BAC-tdTomato retinas, fluorescently labeled AII amacrine cells were predominant, with some medium diameter ganglion cells. In TH-tdTomato retinas, fluorescence was in multiple neurochemical amacrine cell types, including four types of polyaxonal amacrine cells. In DAT-tdTomato retinas, fluorescence was in GABA immunoreactive amacrine cells, including two types of bistratified and two types of monostratified amacrine cells. Although each of the Cre lines was generated with the intent to specifically label DA cells, our findings show a cellular diversity in Cre expression in the adult retina and indicate the importance of careful characterization of transgene labeling patterns. These mouse lines with their distinctive cellular labeling patterns will be useful tools for future studies of retinal function and visual processing. Published by Elsevier Ltd.

Investigation of hypoxia-inducible factor-1α in hippocampal sclerosis: a postmortem study.

PubMed

Feast, Alexandra; Martinian, Lillian; Liu, Joan; Catarino, Claudia B; Thom, Maria; Sisodiya, Sanjay M

2012-08-01

Hypoxia-inducible factor-1α (HIF-1α) is involved in critical aspects of cell survival in response to hypoxia and regulates vascular endothelial growth factor (VEGF) expression. Previous experimental and human studies in epilepsy show up-regulation of VEGF following seizures, although expression of HIF-1α as its potential regulator has not been explored. We used a postmortem (PM) series from patients with epilepsy and hippocampal sclerosis (HS) to investigate patterns of expression of HIF-1α and VEGF and their potential contribution to neuroprotection. In 33 PMs (17 cases with unilateral HS, 3 with bilateral HS, 3 with No-HS, and 10 controls), we quantified neuronal immunolabeling for HIF-1α and VEGF in hippocampal subfields. HIF-1α- and VEGF-immunopositive hippocampal neurones were observed in HS, No-HS, and also in control cases; there was no significant difference in overall labeling between epilepsy cases and controls. In positive cases, HIF-1α and VEGF neuronal labeling localized primarily in CA1, CA4, and CA3 subfields in all groups; significantly more positive neurons were seen in the entorhinal cortex in epilepsy cases (p < 0.05). Labeling lateralized to the side of sclerosis in unilateral HS cases, with significant differences between hemispheres (p < 0.05). There was a trend for high HIF-1α labeling scores in patients with Dravet syndrome without HS and sudden unexpected death in epilepsy (SUDEP) cases, and lower scores with long seizure-free periods prior to death. Hippocampal HIF-1α and VEGF labeling showed a significant correlation. There was neuronal colocalization of HIF-1α and VEGF. Regional expression patterns are in keeping with seizure-related activation of HIF-1α and VEGF. The prominent expression in non-HS cases could support an overall neuroprotective effect. Correlation between HIF-1α and VEGF neuronal immunolabeling supports HIF-1α-mediated induction of VEGF in epilepsy. Wiley Periodicals, Inc. © 2012 International League Against Epilepsy.

Warnings on alcohol containers and advertisements: international experience and evidence on effects.

PubMed

Wilkinson, Claire; Room, Robin

2009-07-01

In light of possible introduction of alcohol warning labels in Australia and New Zealand, this paper discusses the international experience with and evidence of effects of alcohol warning labels. The report describes international experience with providing information and warnings concerning the promotion or sale of alcoholic beverages, and considers the evidence on the effects of such information and warnings. The experience with and evaluations of the effects of tobacco warning labels are also considered. The most methodologically sound evaluations of alcohol warning labels are based on the US experience. Although these evaluations find little evidence that the introduction of the warning label in the USA had an impact on drinking behaviour, there is evidence that they led to an increase in awareness of the message they contained. In contrast, evaluations of tobacco warning labels find clear evidence of effects on behaviour. There is a need and opportunity for a rigorous evaluation of the impacts of introducing alcohol warning labels to add to the published work on their effectiveness. The experience with tobacco labels might guide the way for more effective alcohol warning labels. Alcohol warning labels are an increasingly popular alcohol policy initiative. It is clear that warning labels can be ineffective, but the tobacco experience suggests that effective warning labels are possible. Any introduction of alcohol warning labels should be evaluated in terms of effects on attitudes and behaviour.

Improving the design of nutrition labels to promote healthier food choices and reasonable portion sizes.

PubMed

Roberto, C A; Khandpur, N

2014-07-01

Accurate and easy-to-understand nutrition labeling is a worthy public health goal that should be considered an important strategy among many to address obesity and poor diet. Updating the Nutrition Facts Panel on packaged foods, developing a uniform front-of-package labeling system and providing consumers with nutrition information on restaurant menus offer important opportunities to educate people about food's nutritional content, increase awareness of reasonable portion sizes and motivate consumers to make healthier choices. The aims of this paper were to identify and discuss: (1) current concerns with nutrition label communication strategies; (2) opportunities to improve the communication of nutrition information via food labels, with a specific focus on serving size information; and (3) important future areas of research on nutrition labeling as a tool to improve diet. We suggest that research on nutrition labeling should focus on ways to improve food labels' ability to capture consumer attention, reduce label complexity and convey numeric nutrition information in simpler and more meaningful ways, such as through interpretive food labels, the addition of simple text, reduced use of percentages and easy-to-understand presentation of serving size information.

Forced Unfolding of Proteins Within Cells

PubMed Central

Johnson, Colin P.; Tang, Hsin-Yao; Carag, Christine; Speicher, David W.; Discher, Dennis E.

2009-01-01

To identify cytoskeletal proteins that change conformation or assembly within stressed cells, in situ labeling of sterically shielded cysteines with fluorophores was analyzed by fluorescence imaging, quantitative mass spectrometry, and sequential two-dye labeling. Within red blood cells, shotgun labeling showed that shielded cysteines in the two isoforms of the cytoskeletal protein spectrin were increasingly labeled as a function of shear stress and time, indicative of forced unfolding of specific domains. Within mesenchymal stem cells—as a prototypical adherent cell—nonmuscle myosin IIA and vimentin are just two of the cytoskeletal proteins identified that show differential labeling in tensed versus drug-relaxed cells. Cysteine labeling of proteins within live cells can thus be used to fluorescently map out sites of molecular-scale deformation, and the results also suggest means to colocalize signaling events such as phosphorylation with forced unfolding. PMID:17673662

Are Teens "Post-Gay"? Contemporary Adolescents' Sexual Identity Labels

ERIC Educational Resources Information Center

Russell, Stephen T.; Clarke, Thomas J.; Clary, Justin

2009-01-01

Recent reports suggest that historically typical sexual identity labels--"gay," "lesbian" and "bisexual"--have lost meaning and relevance for contemporary adolescents. Yet there is little empirical evidence that contemporary teenagers are "post-gay." In this brief study we investigate youths' sexual identity…

Role of protein sulfation in vasodilation induced by minoxidil sulfate, a K+ channel opener

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meisheri, K.D.; Oleynek, J.J.; Puddington, L.

Evidence from contractile, radioisotope ion flux and electrophysiological studies suggest that minoxidil sulfate (MNXS) acts as a K+ channel opener in vascular smooth muscle. This study was designed to examine possible biochemical mechanisms by which MNXS exerts such an effect. Experiments performed in the isolated rabbit mesenteric artery (RMA) showed that MNXS, 5 microM, but not the parent compound minoxidil, was a potent vasodilator. Whereas the relaxant effects of an another K+ channel opener vasodilator, BRL-34915 (cromakalim), were removed by washing with physiological saline solution, the effects of MNXS persisted after repeated washout attempts. Furthermore, after an initial exposure ofmore » segments of intact RMA to (35S) MNXS, greater than 30% of the radiolabel was retained 2 hr after removal of the drug. In contrast, retention of radiolabel was not detected with either (3H)MNXS (label on the piperidine ring of MNXS) or (3H)minoxidil (each less than 3% after a 2-hr washout). These data suggested that the sulfate moiety from MNXS was closely associated with the vascular tissue. To determine if proteins were the acceptors of sulfate from MNXS, intact RMAs were incubated with (35S)MNXS, and then 35S-labeled proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and analyzed by fluorography. Preferential labeling of a 116 kD protein was detected by 2 and 5 min of treatment. A 43 kD protein (resembling actin) also showed significant labeling. A similar profile of 35S-labeled proteins was observed in (35S) MNXS-treated A7r5 rat aortic smooth muscle cells, suggesting that the majority of proteins labeled by (35S)MNXS in intact RMA were components of smooth muscle cells.« less

Impact of food labelling systems on food choices and eating behaviours: a systematic review and meta-analysis of randomized studies.

PubMed

Cecchini, M; Warin, L

2016-03-01

Food labels are considered a crucial component of strategies tackling unhealthy diets and obesity. This study aims at assessing the effectiveness of food labelling in increasing the selection of healthier products and in reducing calorie intake. In addition, this study compares the relative effectiveness of traffic light schemes, Guideline Daily Amount and other food labelling schemes. A comprehensive set of databases were searched to identify randomized studies. Studies reporting homogeneous outcomes were pooled together and analysed through meta-analyses. Publication bias was evaluated with a funnel plot. Food labelling would increase the amount of people selecting a healthier food product by about 17.95% (confidence interval: +11.24% to +24.66%). Food labelling would also decrease calorie intake/choice by about 3.59% (confidence interval: -8.90% to +1.72%), but results are not statistically significant. Traffic light schemes are marginally more effective in increasing the selection of healthier options. Other food labels and Guideline Daily Amount follow. The available evidence did not allow studying the effects of single labelling schemes on calorie intake/choice. Findings of this study suggest that nutrition labelling may be an effective approach to empowering consumers in choosing healthier products. Interpretive labels, as traffic light labels, may be more effective. © 2015 World Obesity.

Imaging correlates of pathology in corticobasal syndrome(Podcast)

PubMed Central

Whitwell, J.L.; Jack, C.R.; Boeve, B.F.; Parisi, J.E.; Ahlskog, J.E.; Drubach, D.A.; Senjem, M.L.; Knopman, D.S.; Petersen, R.C.; Dickson, D.W.; Josephs, K.A.

2010-01-01

Background: Corticobasal syndrome (CBS) can be associated with different underlying pathologies that are difficult to predict based on clinical presentation. The aim of this study was to determine whether patterns of atrophy on imaging could be useful to help predict underlying pathology in CBS. Methods: This was a case-control study of 24 patients with CBS who had undergone MRI during life and came to autopsy. Pathologic diagnoses included frontotemporal lobar degeneration (FTLD) with TDP-43 immunoreactivity in 5 (CBS-TDP), Alzheimer disease (AD) in 6 (CBS-AD), corticobasal degeneration in 7 (CBS-CBD), and progressive supranuclear palsy in 6 (CBS-PSP). Voxel-based morphometry and atlas-based parcellation were used to assess atrophy across the CBS groups and compared to 24 age- and gender-matched controls. Results: All CBS pathologic groups showed gray matter loss in premotor cortices, supplemental motor area, and insula on imaging. However, CBS-TDP and CBS-AD showed more widespread patterns of loss, with frontotemporal loss observed in CBS-TDP and temporoparietal loss observed in CBS-AD. CBS-TDP showed significantly greater loss in prefrontal cortex than the other groups, whereas CBS-AD showed significantly greater loss in parietal lobe than the other groups. The focus of loss was similar in CBS-CBD and CBS-PSP, although more severe in CBS-CBD. Conclusions: Imaging patterns of atrophy in CBS vary according to pathologic diagnosis. Widespread atrophy points toward a pathologic diagnosis of FTLD-TDP or AD, with frontotemporal loss suggesting FTLD-TDP and temporoparietal loss suggesting AD. On the contrary, more focal atrophy predominantly involving the premotor and supplemental motor area suggests CBD or PSP pathology. GLOSSARY AAL = automated anatomic labeling; AD = Alzheimer disease; CBD = corticobasal degeneration; CBS = corticobasal syndrome; CDR-SB = Clinical Dementia Rating sum of boxes; FDR = false discovery rate; FTLD = frontotemporal lobar degeneration; MMSE = Mini-Mental State Examination; PSP = progressive supranuclear palsy; ROI = region of interest; SMA = supplemental motor area; TDP = TDP-43 immunoreactivity; TIV = total intracranial volume; VBM = voxel-based morphometry. PMID:21098403

Medicine and patriarchal violence: the social construction of a "private" event.

PubMed

Stark, E; Flitcraft, A; Frazier, W

1979-01-01

Our objectives are to describe the pattern of abuse associated with battering and to evaluate the contribution of the medical system and of broader social forces to its emergence. A pilot study of 481 women who used the emergency service of a large metropolitan hospital in the U.S. shows that battering includes a history of self-abuse and psychosocial problems, as well as repeated and escalating physical injury. In addition, although the number of battered women using the service is 10 times higher than medical personnel identify, the pattern of abuse that constitutes battering emerges only after its initial effects are presented and in conjunction with specific medical intervnetions and referrals. Examination of intervention and referral patterns suggests a staging process by which battering is socially constructed. At first, the physical trauma associated with abuse is medicated symptomatically. But the patient's persistence, the failure of the cure, and the incongruity between her problems and available medical explanations lead the provider to label the abused woman in ways that suggest she is personally responsible for her victimization. Although secondary problems such as depression, drug abuse, suicide attempts, or alcoholism derive as much from the intervention strategy adopted as from physical assault or psychopathology, they are treated as the primary problems at psychiatric and social service referral points where family maintenance is often the therapeutic goal. One consequence of this referral strategy is the stabilization of "violent families" in ways that virtually insure women will be abused in systematic and arbitrary ways. The use of patriarchal logic by medical providers ostensibly responding to physical trauma has less to do with individual "sexism" than with the political and economic constraints under which medicine operates as part of an "extended patriarchy." Medicine's role in battering suggests that the services function to reconstitute the "private" world of patriarchal authority, with violence if necessary, against demands to socialize the labors of love.

Layer-specific gene expression in epileptogenic type II focal cortical dysplasia: normal-looking neurons reveal the presence of a hidden laminar organization

PubMed Central

2014-01-01

Background Type II focal cortical dysplasias (FCDs) are malformations of cortical development characterised by the disorganisation of the normal neocortical structure and the presence of dysmorphic neurons (DNs) and balloon cells (BCs). The pathogenesis of FCDs has not yet been clearly established, although a number of histopathological patterns and molecular findings suggest that they may be due to abnormal neuronal and glial proliferation and migration processes. In order to gain further insights into cortical layering disruption and investigate the origin of DNs and BCs, we used in situ RNA hybridisation of human surgical specimens with a neuropathologically definite diagnosis of Type IIa/b FCD and a panel of layer-specific genes (LSGs) whose expression covers all cortical layers. We also used anti-phospho-S6 ribosomal protein antibody to investigate mTOR pathway hyperactivation. Results LSGs were expressed in both normal and abnormal cells (BCs and DNs) but their distribution was different. Normal-looking neurons, which were visibly reduced in the core of the lesion, were apparently located in the appropriate cortical laminae thus indicating a partial laminar organisation. On the contrary, DNs and BCs, labelled with anti-phospho-S6 ribosomal protein antibody, were spread throughout the cortex without any apparent rule and showed a highly variable LSG expression pattern. Moreover, LSGs did not reveal any differences between Type IIa and IIb FCD. Conclusion These findings suggest the existence of hidden cortical lamination involving normal-looking neurons, which retain their ability to migrate correctly in the cortex, unlike DNs which, in addition to their morphological abnormalities and mTOR hyperactivation, show an altered migratory pattern. Taken together these data suggest that an external or environmental hit affecting selected precursor cells during the very early stages of cortical development may disrupt normal cortical development. PMID:24735483

Detection of deoxynivalenol using biolayer interferometry

USDA-ARS?s Scientific Manuscript database

Biolayer interferometry allows for the real time monitoring of the interactions between molecules without the need for reagents with enzymatic, fluorescent, or radioactive labels. The technology is based upon the changes in interference pattern of light reflected from the surface of an optical fiber...

Visualizing Single Cell Biology: Nanosims Studies of Carbon and Nitrogen Metabolism in Diazotrophic Cyanobacteria

NASA Astrophysics Data System (ADS)

Pett-Ridge, J.; Finzi, J. A.; Capone, D. G.; Popa, R.; Nealson, K. H.; Ng, W.; Spormann, A. M.; Hutcheon, I. D.; Weber, P. K.

2007-12-01

Filamentous nitrogen fixing (diazotrophic) cyanobacteria are key players in global nutrient cycling, but the relationship between CO2- and N2-fixation and intercellular exchange of these elements remains poorly understood in many genera. These bacteria are faced with the challenge of isolating regions of N-fixation (O2 inhibited) and photosynthetic (O2 producing) activity. We used isotope labeling in conjunction with a high-resolution isotope and elemental mapping technique (NanoSIMS) to quantitatively describe 13C and 15N uptake and transport in two aquatic cyanobacteria grown on NaH13CO3 and 15N2. The technical challenges of tracing isotopes within individual bacteria can be overcome with high resolution Secondary Ion Mass Spectrometry (NanoSIMS). In NanoSIMS analysis, samples are sputtered with an energetic primary beam (Cs+, O-) liberating secondary ions that are separated by the mass spectrometer and detected in a suite of electron multipliers. Five isotopic species may be analyzed concurrently with spatial resolution as fine as 50nm. A high sensitivity isotope ratio 'map' can then be generated for the analyzed area. Using sequentially harvested cyanobacteria in conjunction with enriched H13CO3 and 15N2 incubations, we measured temporal enrichment patterns that evolve over the course of a day's growth and suggest tightly regulated changes in fixation kinetics. With a combination of TEM, SEM and NanoSIMS analyses, we also mapped the distribution of C, N and Mo (a critical nitrogenase co-factor) isotopes in intact cells. Our results suggest that NanoSIMS mapping of metal enzyme co-factors may be a powerful method of identifying physiological and morphological characteristics within individual bacterial cells, and could be used to provide a 3-dimensional context for more traditional analyses such as immunogold labeling. Finally, we resolved patterns of isotope enrichment at multiple spatial scales: sub-cellular variation, cell-cell differences along filaments, inter-species transfers (with Rhizobium epibionts), and within-cell depth profiles. Spatial enrichment patterns were correlated with morphological features evidenced in TEM images of microtomed filaments. These features indicate how 15N and 13C "hotspots" are dispersed throughout individual cells in different species, and may indicate isolated locations of increased N2 fixation, sites of amino acid/protein synthesis, or cyanophycin storage granules. This combination of Nano-Secondary Ion Mass Spectrometry (NanoSIMS) analysis and high resolution microscopy allows isotopic analysis to be linked to morphological features and holds great promise for fine-scale studies of bacteria metabolism.

Anatomical evidence for brainstem circuits mediating feeding motor programs in the leopard frog, Rana pipiens.

PubMed

Anderson, C W

2001-09-01

Using injections of small molecular weight fluorescein dextran amines, combined with activity-dependent uptake of sulforhodamine 101 (SR101), brainstem circuits presumed to be involved in feeding motor output were investigated. As has been shown previously in other studies, projections to the cerebellar nuclei were identified from the cerebellar cortex, the trigeminal motor nucleus, and the vestibular nuclei. Results presented here suggest an additional pathway from the hypoglossal motor nuclei to the cerebellar nucleus as well as an afferent projection from the peripheral hypoglossal nerve to the Purkinje cell layer of the cerebellar cortex. Injections in the cerebellar cortex combined with retrograde labeling of the peripheral hypoglossal nerve demonstrate anatomical convergence at the level of the medial reticular formation. This suggests a possible integrative region for afferent feedback from the hypoglossal nerve and information through the Purkinje cell layer of the cerebellar cortex. The activity-dependent uptake of SR101 additionally suggests a reciprocal, polysynaptic pathway between this same area of the medial reticular formation and the trigeminal motor nuclei. The trigeminal motor neurons innervate the m adductor mandibulae, the primary mouth-closing muscle. The SR101 uptake clearly labeled the ventrolateral hypoglossal nuclei, the medial reticular formation, and the Purkinje cell layer of the cerebellar cortex. Unlike retrograde labeling of the peripheral hypoglossal nerve, stimulating the hypoglossal nerve while SR101 was bath-applied labeled trigeminal motor neurons. This, combined with the dextran labeling, suggests a reciprocal connection between the trigeminal motor nuclei and the cerebellar nuclei, as well as the medulla. Taken together, these data are important for understanding the neurophysiological pathways used to coordinate the proper timing of an extremely rapid, goal-directed movement and may prove useful for elucidating some of the first principles of sensorimotor integration.

Regulation of Phospholipid Synthesis in Escherichia coli by Guanosine Tetraphosphate

PubMed Central

Merlie, John P.; Pizer, Lewis I.

1973-01-01

Phospholipid synthesis has been reported to be subject to stringent control in Escherichia coli. We present evidence that demonstrates a strict correlation between guanosine tetraphosphate accumulation and inhibition of phospholipid synthesis. In vivo experiments designed to examine the pattern of phospholipid labeling with 32P-inorganic phosphate and 32P-sn-glycerol-3-phosphate suggest that regulation must occur at the glycerol-3-phosphate acyltransferase step. Assay of phospholipid synthesis by cell-free extracts and semipurified preparations revealed that guanosine tetraphosphate inhibits at least two enzymes specific for the biosynthetic pathway, sn-glycerol-3-phosphate acyltransferase as well as sn-glycerol-3-phosphate phosphatidyl transferase. These findings provide a biochemical basis for the stringent control of lipid synthesis as well as regulation of steady-state levels of phospholipid in growing cells. Images PMID:4583220

Unsupervised daily routine and activity discovery in smart homes.

PubMed

Jie Yin; Qing Zhang; Karunanithi, Mohan

2015-08-01

The ability to accurately recognize daily activities of residents is a core premise of smart homes to assist with remote health monitoring. Most of the existing methods rely on a supervised model trained from a preselected and manually labeled set of activities, which are often time-consuming and costly to obtain in practice. In contrast, this paper presents an unsupervised method for discovering daily routines and activities for smart home residents. Our proposed method first uses a Markov chain to model a resident's locomotion patterns at different times of day and discover clusters of daily routines at the macro level. For each routine cluster, it then drills down to further discover room-level activities at the micro level. The automatic identification of daily routines and activities is useful for understanding indicators of functional decline of elderly people and suggesting timely interventions.

Molecular basis of autosomal dominant neurohypophyseal diabetes insipidus. Cellular toxicity caused by the accumulation of mutant vasopressin precursors within the endoplasmic reticulum.

PubMed Central

Ito, M; Jameson, J L; Ito, M

1997-01-01

Mutations in the arginine vasopressin (AVP) gene cause autosomal dominant familial neurohypophyseal diabetes insipidus (FNDI). The dominant inheritance pattern has been postulated to reflect neuronal toxicity of the mutant proteins, but the mechanism for such cytotoxicity is unknown. In this study, wild-type or several different mutant AVP genes were stably expressed in neuro2A neuroblastoma cells. When cells were treated with valproic acid to induce neuronal differentiation, each of the mutants caused reduced viability. Metabolic labeling revealed diminished intracellular trafficking of mutant AVP precursors and confirmed inefficient secretion of immunoreactive AVP. Immunofluorescence studies demonstrated marked accumulation of mutant AVP precursors within the endoplasmic reticulum. These studies suggest that the cellular toxicity in FNDI may be caused by the intracellular accumulation of mutant precursor proteins. PMID:9109434