Levraud, Jean-Pierre; Adam, Myriam; Luciani, Marie-Françoise; de Chastellier, Chantal; Blanton, Richard L.; Golstein, Pierre
2003-01-01
Cell death in the stalk of Dictyostelium discoideum, a prototypic vacuolar cell death, can be studied in vitro using cells differentiating as a monolayer. To identify early events, we examined potentially dying cells at a time when the classical signs of Dictyostelium cell death, such as heavy vacuolization and membrane lesions, were not yet apparent. We observed that most cells proceeded through a stereotyped series of differentiation stages, including the emergence of “paddle” cells showing high motility and strikingly marked subcellular compartmentalization with actin segregation. Paddle cell emergence and subsequent demise with paddle-to-round cell transition may be critical to the cell death process, as they were contemporary with irreversibility assessed through time-lapse videos and clonogenicity tests. Paddle cell demise was not related to formation of the cellulose shell because cells where the cellulose-synthase gene had been inactivated underwent death indistinguishable from that of parental cells. A major subcellular alteration at the paddle-to-round cell transition was the disappearance of F-actin. The Dictyostelium vacuolar cell death pathway thus does not require cellulose synthesis and includes early actin rearrangements (F-actin segregation, then depolymerization), contemporary with irreversibility, corresponding to the emergence and demise of highly polarized paddle cells. PMID:12654899
Regulation of cell-fate determination in Dictyostelium.
Brown, J M; Firtel, R A
1999-12-15
A key step in the development of all multicellular organisms is the differentiation of specialized cell types. The eukaryotic microorganism Dictyostelium discoideum provides a unique experimental system for studying cell-type determination and spatial patterning in a developing multicellular organism. Unlike metazoans, which become multicellular by undergoing many rounds of cell division after fertilization of an egg, the social amoeba Dictyostelium achieves multicellularity by the aggregation of approximately 10(5) cells in response to nutrient depletion. Following aggregation, cell-type differentiation and morphogenesis result in a multicellular organism with only a few cell types that exhibit a defined patterning along the anterior-posterior axis of the organism. Analysis of the mechanisms that control these processes is facilitated by the relative simplicity of Dictyostelium development and the availability of molecular, genetic, and cell biological tools. Interestingly, analysis has shown that many molecules that play integral roles in the development of higher eukaryotes, such as PKA, STATs, and GSK-3, are also essential for cell-type differentiation and patterning in Dictyostelium. The role of these and other signaling pathways in the induction, maintenance, and patterning of cell types during Dictyostelium development is discussed.
Naringenin is a novel inhibitor of Dictyostelium cell proliferation and cell migration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Russ, Misty; Martinez, Raquel; Ali, Hind
2006-06-23
Naringenin is a flavanone compound that alters critical cellular processes such as cell multiplication, glucose uptake, and mitochondrial activity. In this study, we used the social amoeba, Dictyostelium discoideum, as a model system for examining the cellular processes and signaling pathways affected by naringenin. We found that naringenin inhibited Dictyostelium cell division in a dose-dependent manner (IC{sub 5} {approx} 20 {mu}M). Assays of Dictyostelium chemotaxis and multicellular development revealed that naringenin possesses a previously unrecognized ability to suppress amoeboid cell motility. We also found that naringenin, which is known to inhibit phosphatidylinositol 3-kinase activity, had no apparent effect on phosphatidylinositolmore » 3,4,5-trisphosphate synthesis in live Dictyostelium cells; suggesting that this compound suppresses cell growth and migration via alternative signaling pathways. In another context, the discoveries described here highlight the value of using the Dictyostelium model system for identifying and characterizing the mechanisms by which naringenin, and related compounds, exert their effects on eukaryotic cells.« less
Poloz, Yekaterina; Catalano, Andrew
2012-01-01
Bestatin methyl ester (BME) is an inhibitor of Zn2+-binding aminopeptidases that inhibits cell proliferation and induces apoptosis in normal and cancer cells. We have used Dictyostelium as a model organism to study the effects of BME. Only two Zn2+-binding aminopeptidases have been identified in Dictyostelium to date, puromycin-sensitive aminopeptidase A and B (PsaA and PsaB). PSA from other organisms is known to regulate cell division and differentiation. Here we show that PsaA is differentially expressed throughout growth and development of Dictyostelium, and its expression is regulated by developmental morphogens. We present evidence that BME specifically interacts with PsaA and inhibits its aminopeptidase activity. Treatment of cells with BME inhibited the rate of cell growth and the frequency of cell division in growing cells and inhibited spore cell differentiation during late development. Overexpression of PsaA-GFP (where GFP is green fluorescent protein) also inhibited spore cell differentiation but did not affect growth. Using chimeras, we have identified that nuclear versus cytoplasmic localization of PsaA affects the choice between stalk or spore cell differentiation pathway. Cells that overexpressed PsaA-GFP (primarily nuclear) differentiated into stalk cells, while cells that overexpressed PsaAΔNLS2-GFP (cytoplasmic) differentiated into spores. In conclusion, we have identified that BME inhibits cell growth, division, and differentiation in Dictyostelium likely through inhibition of PsaA. PMID:22345351
Dictyostelium cell death: early emergence and demise of highly polarized paddle cells.
Levraud, Jean-Pierre; Adam, Myriam; Luciani, Marie-Françoise; de Chastellier, Chantal; Blanton, Richard L; Golstein, Pierre
2003-03-31
Cell death in the stalk of Dictyostelium discoideum, a prototypic vacuolar cell death, can be studied in vitro using cells differentiating as a monolayer. To identify early events, we examined potentially dying cells at a time when the classical signs of Dictyostelium cell death, such as heavy vacuolization and membrane lesions, were not yet apparent. We observed that most cells proceeded through a stereotyped series of differentiation stages, including the emergence of "paddle" cells showing high motility and strikingly marked subcellular compartmentalization with actin segregation. Paddle cell emergence and subsequent demise with paddle-to-round cell transition may be critical to the cell death process, as they were contemporary with irreversibility assessed through time-lapse videos and clonogenicity tests. Paddle cell demise was not related to formation of the cellulose shell because cells where the cellulose-synthase gene had been inactivated underwent death indistinguishable from that of parental cells. A major subcellular alteration at the paddle-to-round cell transition was the disappearance of F-actin. The Dictyostelium vacuolar cell death pathway thus does not require cellulose synthesis and includes early actin rearrangements (F-actin segregation, then depolymerization), contemporary with irreversibility, corresponding to the emergence and demise of highly polarized paddle cells.
Shiozawa, J A; Jelenska, M M; Jacobson, B S
1987-07-28
Through the application of a unique method for isolating plasma membranes, it was possible to specifically iodinate cytoplasm-exposed plasma membrane proteins in vegetative cells of the cellular slime mold Dictyostelium discoideum. The original procedure [Chaney, L. K., & Jacobson, B. S. (1983) J. Biol. Chem. 258, 10062] which involved coating cells with colloidal silica has been modified to yield a more pure preparation. The presence of the continuous and dense silica pellicle on the outside surface of the isolated plasma membrane permitted the specific labeling of cytoplasm-exposed membrane proteins. Lactoperoxidase-catalyzed iodination was employed to label cell-surface and cytoplasm-exposed membrane proteins. The isolated and radioiodinated membranes were then compared and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The cell-surface and cytoplasmic face labeling patterns were distinct. A total of 65 proteins were found to be accessible to at least one surface of the membrane. Sixteen intermolecular disulfide bond complexes were observed in the plasma membrane of Dictyostelium; most of these complexes involved glycoproteins and, hence, were exposed to the cell surface.
Simple system--substantial share: the use of Dictyostelium in cell biology and molecular medicine.
Müller-Taubenberger, Annette; Kortholt, Arjan; Eichinger, Ludwig
2013-02-01
Dictyostelium discoideum offers unique advantages for studying fundamental cellular processes, host-pathogen interactions as well as the molecular causes of human diseases. The organism can be easily grown in large amounts and is amenable to diverse biochemical, cell biological and genetic approaches. Throughout their life cycle Dictyostelium cells are motile, and thus are perfectly suited to study random and directed cell motility with the underlying changes in signal transduction and the actin cytoskeleton. Dictyostelium is also increasingly used for the investigation of human disease genes and the crosstalk between host and pathogen. As a professional phagocyte it can be infected with several human bacterial pathogens and used to study the infection process. The availability of a large number of knock-out mutants renders Dictyostelium particularly useful for the elucidation and investigation of host cell factors. A powerful armory of molecular genetic techniques that have been continuously expanded over the years and a well curated genome sequence, which is accessible via the online database dictyBase, considerably strengthened Dictyostelium's experimental attractiveness and its value as model organism. Copyright © 2012 Elsevier GmbH. All rights reserved.
Input-output relationship in galvanotactic response of Dictyostelium cells.
Sato, Masayuki J; Ueda, Michihito; Takagi, Hiroaki; Watanabe, Tomonobu M; Yanagida, Toshio; Ueda, Masahiro
2007-04-01
Under a direct current electric field, Dictyostelium cells exhibit migration towards the cathode. To determine the input-output relationship of the cell's galvanotactic response, we developed an experimental instrument in which electric signals applied to the cells are highly reproducible and the motile response are analyzed quantitatively. With no electric field, the cells moved randomly in all directions. Upon applying an electric field, cell migration speeds became about 1.3 times faster than those in the absence of an electric field. Such kinetic effects of electric fields on the migration were observed for cells stimulated between 0.25 and 10 V/cm of the field strength. The directions of cell migrations were biased toward the cathode in a positive manner with field strength, showing galvanotactic response in a dose-dependent manner. Quantitative analysis of the relationship between field strengths and directional movements revealed that the biased movements of the cells depend on the square of electric field strength, which can be described by one simple phenomenological equation. The threshold strength for the galvanotaxis was between 0.25 and 1 V/cm. Galvanotactic efficiency reached to half-maximum at 2.6 V/cm, which corresponds to an approximate 8 mV voltage difference between the cathode and anode direction of 10 microm wide, round cells. Based on these results, possible mechanisms of galvanotaxis in Dictyostelium cells were discussed. This development of experimental system, together with its good microscopic accessibility for intracellular signaling molecules, makes Dictyostelium cells attractive as a model organism for elucidating stochastic processes in the signaling systems responsible for cell motility and its regulations.
Siegert, F; Weijer, C J; Nomura, A; Miike, H
1994-01-01
We describe the application of a novel image processing method, which allows quantitative analysis of cell and tissue movement in a series of digitized video images. The result is a vector velocity field showing average direction and velocity of movement for every pixel in the frame. We apply this method to the analysis of cell movement during different stages of the Dictyostelium developmental cycle. We analysed time-lapse video recordings of cell movement in single cells, mounds and slugs. The program can correctly assess the speed and direction of movement of either unlabelled or labelled cells in a time series of video images depending on the illumination conditions. Our analysis of cell movement during multicellular development shows that the entire morphogenesis of Dictyostelium is characterized by rotational cell movement. The analysis of cell and tissue movement by the velocity field method should be applicable to the analysis of morphogenetic processes in other systems such as gastrulation and neurulation in vertebrate embryos.
Kubohara, Y; Okamoto, K; Tanaka, Y; Asahi, K; Sakurai, A; Takahashi, N
1993-05-03
Differanisole A isolated from the conditioned medium of a soil microorganism, Chaetomium strain RB-001, is an inducer of the differentiation of the Friend leukemic cells (mouse leukemia cells). The chemical structure of this substance is very similar to that of stalk cell differentiation-inducing factor (DIF) isolated from the cellular slime mould, Dictyostelium discoideum. We examined the effects of differanisole A on Dictyostelium HM44 cells, a mutant strain which is defective in DIF production, and found this substance to be an inducer of stalk cell differentiation in D. discoideum.
Spectral characterization of Dictyostelium autofluorescence.
Engel, Ruchira; Van Haastert, Peter J M; Visser, Antonie J W G
2006-03-01
Dictyostelium discoideum is used extensively as a model organism for the study of chemotaxis. In recent years, an increasing number of studies of Dictyostelium chemotaxis have made use of fluorescence-based techniques. One of the major factors that can interfere with the application of these techniques in cells is the cellular autofluorescence. In this study, the spectral properties of Dictyostelium autofluorescence have been characterized using fluorescence microscopy. Whole cell autofluorescence spectra obtained using spectral imaging microscopy show that Dictyostelium autofluorescence covers a wavelength range from approximately 500 to 650 nm with a maximum at approximately 510 nm, and thus, potentially interferes with measurements of green fluorescent protein (GFP) fusion proteins with fluorescence microscopy techniques. Further characterization of the spatial distribution, intensity, and brightness of the autofluorescence was performed with fluorescence confocal microscopy and fluorescence fluctuation spectroscopy (FFS). The autofluorescence in both chemotaxing and nonchemotaxing cells is localized in discrete areas. The high intensity seen in cells incubated in the growth medium HG5 reduces by around 50% when incubated in buffer, and can be further reduced by around 85% by photobleaching cells for 5-7 s. The average intensity and spatial distribution of the autofluorescence do not change with long incubations in the buffer. The cellular autofluorescence has a seven times lower molecular brightness than eGFP. The influence of autofluorescence in FFS measurements can be minimized by incubating cells in buffer during the measurements, pre-bleaching, and making use of low excitation intensities. The results obtained in this study thus offer guidelines to the design of future fluorescence studies of Dictyostelium. Microsc. Res. Tech. 69:168-174, 2006. (c) 2006 Wiley-Liss, Inc.
1993-01-01
Coronin is an actin-binding protein in Dictyostelium discoideum that is enriched at the leading edge of the cells and in projections of the cell surface called crowns. The polypeptide sequence of coronin is distinguished by its similarities to the beta-subunits of trimeric G proteins (E. L. de Hostos, B. Bradtke, F. Lottspeich, R. Guggenheim, and G. Gerisch, 1991. EMBO (Eur. Mol. Biol. Organ.) J. 10:4097-4104). To elucidate the in vivo function of coronin, null mutants have been generated by gene replacement. The mutant cells lacking coronin grow and migrate more slowly than wild-type cells. When these cor- cells grow in liquid medium they become multinucleate, indicating a role of coronin in cytokinesis. To explore this role, coronin has been localized in mitotic wild-type cells by immunofluorescence labeling. During separation of the daughter cells, coronin is strongly accumulated at their distal portions including the leading edges. This contrasts with the localization of myosin II in the cleavage furrow and suggests that coronin functions independently of the conventional myosin in facilitating cytokinesis. PMID:8380174
Nanovesicles released by Dictyostelium cells: a potential carrier for drug delivery.
Lavialle, Françoise; Deshayes, Sophie; Gonnet, Florence; Larquet, Eric; Kruglik, Sergei G; Boisset, Nicolas; Daniel, Régis; Alfsen, Annette; Tatischeff, Irène
2009-10-01
Nanovesicles released by Dictyostelium discoideum cells grown in the presence of the DNA-specific dye Hoechst 33342 have been previously shown to mediate the transfer of the dye into the nuclei of Hoechst-resistant cells. The present investigation extends this work by conducting experiments in the presence of hypericin, a fluorescent therapeutic photosensitizer assayed for antitumoral photodynamic therapy. Nanovesicles released by Dictyostelium cells exhibit an averaged diameter between 50 and 150 nm, as measured by transmission cryoelectron microscopy. A proteomic analysis reveals a predominance of actin and actin-related proteins. The detection of a lysosomal membrane protein (LIMP II) indicates that these vesicles are likely generated in the late endosomal compartment. The use of the hypericin-containing nanovesicles as nanodevices for in vitro drug delivery was investigated by fluorescence microscopy. The observed signal was almost exclusively located in the perinuclear area of two human cell lines, skin fibroblasts (HS68) and cervix carcinoma (HeLa) cells. Studies by confocal microscopy with specific markers of cell organelles, provided evidence that hypericin was accumulated in the Golgi apparatus. All these data shed a new light on in vitro drug delivery by using cell-released vesicles as carriers.
A study of wound repair in Dictyostelium cells by using novel laserporation.
Pervin, Mst Shaela; Itoh, Go; Talukder, Md Shahabe Uddin; Fujimoto, Koushiro; Morimoto, Yusuke V; Tanaka, Masamitsu; Ueda, Masahiro; Yumura, Shigehiko
2018-05-22
We examined the mechanism of cell membrane repair in Dictyostelium cells by using a novel laser-based cell poration method. The dynamics of wound pores opening and closing were characterized by live imaging of fluorescent cell membrane proteins, influx of fluorescent dye, and Ca 2+ imaging. The wound closed within 2-4 sec, depending on the wound size. Cells could tolerate a wound size of less than 2.0 µm. In the absence of Ca 2+ in the external medium, the wound pore did not close and cells ruptured. The release of Ca 2+ from intracellular stores also contributed to the elevation of cytoplasmic Ca 2+ but not to wound repair. Annexin C1 immediately accumulated at the wound site depending on the external Ca 2+ concentration, and annexin C1 knockout cells had a defect in wound repair, but it was not essential. Dictyostelium cells were able to respond to multiple repeated wounds with the same time courses, in contrast to previous reports showing that the first wound accelerates the second wound repair in fibroblasts.
Baviskar, Sandhya N; Shields, Malcolm S
2010-01-01
Glucose-regulated 94 kDa protein (Grp94) is a resident of the endoplasmic reticulum (ER) of multicellular eukaryotes. It is a constitutively expressed protein that is overexpressed in certain abnormal conditions of the cell such as depletion of glucose and calcium, and low oxygen and pH. The protein is also implicated in diseased conditions like cancer and Alzheimer's disease. In this study, the consequences of downregulation of Grp94 were investigated at both unicellular and multicellular stages of Dictyostelium discoideum. Previous studies have shown the expression of Dd-Grp94 (Dictyostelium discoideum glucose-regulated 94 kDa protein) in wild-type cells varies during development, and overexpression of Dd-Grp94 leads to abnormal cell shape and inhibition of development (i.e., formation of fruiting bodies). Grp94 is a known calcium binding protein and an efficient calcium buffer. Therefore, in the present study we hypothesized that downregulation of Dd-Grp94 protein would affect Dictyostelium cell structure, growth, and development. We found that Dd-grp94 RNAi recombinants exhibited reduced growth rate, cell size, and a subtle change in cell motility compared to the parental cells. The recombinants also exhibited a delay in development and small fruiting bodies. These results establish that Dd-grp94 plays a crucial role in determining normal cell structure, growth and differentiation.
Iwadate, Yoshiaki; Okimura, Chika; Sato, Katsuya; Nakashima, Yuta; Tsujioka, Masatsune; Minami, Kazuyuki
2013-01-01
Living cells are constantly subjected to various mechanical stimulations, such as shear flow, osmotic pressure, and hardness of substratum. They must sense the mechanical aspects of their environment and respond appropriately for proper cell function. Cells adhering to substrata must receive and respond to mechanical stimuli from the substrata to decide their shape and/or migrating direction. In response to cyclic stretching of the elastic substratum, intracellular stress fibers in fibroblasts and endothelial, osteosarcoma, and smooth muscle cells are rearranged perpendicular to the stretching direction, and the shape of those cells becomes extended in this new direction. In the case of migrating Dictyostelium cells, cyclic stretching regulates the direction of migration, and not the shape, of the cell. The cells migrate in a direction perpendicular to that of the stretching. However, the molecular mechanisms that induce the directional migration remain unknown. Here, using a microstretching device, we recorded green fluorescent protein (GFP)-myosin-II dynamics in Dictyostelium cells on an elastic substratum under cyclic stretching. Repeated stretching induced myosin II localization equally on both stretching sides in the cells. Although myosin-II-null cells migrated randomly, myosin-II-null cells expressing a variant of myosin II that cannot hydrolyze ATP migrated perpendicular to the stretching. These results indicate that Dictyostelium cells accumulate myosin II at the portion of the cell where a large strain is received and migrate in a direction other than that of the portion where myosin II accumulated. This polarity generation for migration does not require the contraction of actomyosin. PMID:23442953
Modeling oscillations and spiral waves in Dictyostelium populations
NASA Astrophysics Data System (ADS)
Noorbakhsh, Javad; Schwab, David J.; Sgro, Allyson E.; Gregor, Thomas; Mehta, Pankaj
2015-06-01
Unicellular organisms exhibit elaborate collective behaviors in response to environmental cues. These behaviors are controlled by complex biochemical networks within individual cells and coordinated through cell-to-cell communication. Describing these behaviors requires new mathematical models that can bridge scales—from biochemical networks within individual cells to spatially structured cellular populations. Here we present a family of "multiscale" models for the emergence of spiral waves in the social amoeba Dictyostelium discoideum. Our models exploit new experimental advances that allow for the direct measurement and manipulation of the small signaling molecule cyclic adenosine monophosphate (cAMP) used by Dictyostelium cells to coordinate behavior in cellular populations. Inspired by recent experiments, we model the Dictyostelium signaling network as an excitable system coupled to various preprocessing modules. We use this family of models to study spatially unstructured populations of "fixed" cells by constructing phase diagrams that relate the properties of population-level oscillations to parameters in the underlying biochemical network. We then briefly discuss an extension of our model that includes spatial structure and show how this naturally gives rise to spiral waves. Our models exhibit a wide range of novel phenomena. including a density-dependent frequency change, bistability, and dynamic death due to slow cAMP dynamics. Our modeling approach provides a powerful tool for bridging scales in modeling of Dictyostelium populations.
Adenylyl cyclase localization to the uropod of aggregating Dictyostelium cells requires RacC
Wang, C.; Jung, D.; Cao, Z.; Chung, C. Y.
2015-01-01
The localization of adenylyl cyclase A (ACA) to uropod of cells is required for the stream formation during Dictyostelium development. RacC is a Dictyostelium orthologue of Cdc42. We identified a streaming defect of racC− cells as they are clearly less polarized and form smaller and fragmented streams. ACA-YFP is mainly associated with intracellular vesicular structures, but not with the plasma membrane in racC− cells. racC− cells have a slightly higher number of vesicles than Ax3 cells, suggesting that the defect of ACA trafficking is not simply due to the lack of vesicle formation. While the ACA-YFP vesicles traveled with an average velocity of 9.1 µm/min in Ax3 cells, a slow and diffusional movement without direction with an average velocity of 4 µm/min was maintained in racC− cells. Images acquired by using total internal reflection fluorescence (TIRF) microscopy and fluorescence recovery after photobleaching (FRAP) analysis revealed that a significantly decreased number of ACA-YFP vesicles appeared near the cell membrane, indicating a defect in ACA-YFP vesicle trafficking. These results suggest an important role of RacC in the rapid and directional movements of ACA vesicles on microtubules to the plasma membrane, especially to the back of polarized cell. PMID:26315268
Chemotaxis of Dictyostelium discoideum: Collective Oscillation of Cellular Contacts
Schäfer, Edith; Tarantola, Marco; Polo, Elena; Westendorf, Christian; Oikawa, Noriko; Bodenschatz, Eberhard; Geil, Burkhard; Janshoff, Andreas
2013-01-01
Chemotactic responses of Dictyostelium discoideum cells to periodic self-generated signals of extracellular cAMP comprise a large number of intricate morphological changes on different length scales. Here, we scrutinized chemotaxis of single Dictyostelium discoideum cells under conditions of starvation using a variety of optical, electrical and acoustic methods. Amebas were seeded on gold electrodes displaying impedance oscillations that were simultaneously analyzed by optical video microscopy to relate synchronous changes in cell density, morphology, and distance from the surface to the transient impedance signal. We found that starved amebas periodically reduce their overall distance from the surface producing a larger impedance and higher total fluorescence intensity in total internal reflection fluorescence microscopy. Therefore, we propose that the dominant sources of the observed impedance oscillations observed on electric cell-substrate impedance sensing electrodes are periodic changes of the overall cell-substrate distance of a cell. These synchronous changes of the cell-electrode distance were also observed in the oscillating signal of acoustic resonators covered with amebas. We also found that periodic cell-cell aggregation into transient clusters correlates with changes in the cell-substrate distance and might also contribute to the impedance signal. It turned out that cell-cell contacts as well as cell-substrate contacts form synchronously during chemotaxis of Dictyostelium discoideum cells. PMID:23349816
Flow-driven instabilities during pattern formation of Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
Gholami, A.; Steinbock, O.; Zykov, V.; Bodenschatz, E.
2015-06-01
The slime mold Dictyostelium discoideum is a well known model system for the study of biological pattern formation. In the natural environment, aggregating populations of starving Dictyostelium discoideum cells may experience fluid flows that can profoundly change the underlying wave generation process. Here we study the effect of advection on the pattern formation in a colony of homogeneously distributed Dictyostelium discoideum cells described by the standard Martiel-Goldbeter model. The external flow advects the signaling molecule cyclic adenosine monophosphate (cAMP) downstream, while the chemotactic cells attached to the solid substrate are not transported with the flow. The evolution of small perturbations in cAMP concentrations is studied analytically in the linear regime and by corresponding numerical simulations. We show that flow can significantly influence the dynamics of the system and lead to a flow-driven instability that initiate downstream traveling cAMP waves. We also show that boundary conditions have a significant effect on the observed patterns and can lead to a new kind of instability.
Takahashi, Kei; Toyota, Taro
2015-01-01
The cytosol of amoeba cells controls the membrane deformation during their motion in vivo. To investigate such ability of the cytosol of amoeba cell, Dictyostelium discoideum (Dictyostelium), in vitro, we used lipids extracted from Dictyostelium and commercially available phospholipids, and prepared substrate-supported lipid membrane patches on the micrometer scale by spin coating. We found that the spin coater holder, which has pores (pore size = 3.1 mm) of negative pressure to hold the cover glass induced the concave surface of the cover glass. The membrane lipid patches were formed at each position in the vicinity of the holder pores and their sizes were in the range of 2.7 to 3.2 × 10(4) μm(2). After addition of the cytosol extracted from Dictyostelium to the lipid membrane patches, through time-lapse observation with a confocal laser scanning fluorescence microscope, we observed an autonomous buckling of the Dictyostelium lipid patches and localized behaviours of proteins found within. The current method serves as the novel technique for the preparation of film patches in which the positions of patches are controlled by the holder pores without fabricating, modifying, and arranging the chemical properties of the solution components of lipids. The findings imply that lipid-binding proteins in the cytosol were adsorbed and accumulated within the Dictyostelium lipid patches, inducing the transformation of the cell-sized patch.
Insights into the Cell Shape Dynamics of Migrating Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
Driscoll, Meghan; Homan, Tess; McCann, Colin; Parent, Carole; Fourkas, John; Losert, Wolfgang
2010-03-01
Dynamic cell shape is a highly visible manifestation of the interaction between the internal biochemical state of a cell and its external environment. We analyzed the dynamic cell shape of migrating cells using the model system Dictyostelium discoideum. Applying a snake algorithm to experimental movies, we extracted cell boundaries in each frame and followed local boundary motion over long time intervals. Using a local motion measure that corresponds to protrusive/retractive activity, we found that protrusions are intermittent and zig-zag, whereas retractions are more sustained and straight. Correlations of this local motion measure reveal that protrusions appear more localized than retractions. Using a local shape measure, curvature, we also found that small peaks in boundary curvature tend to originate at the front of cells and propagate backwards. We will review the possible cytoskeletal origin of these mechanical waves.
Dispatch. Dictyostelium chemotaxis: fascism through the back door?
Insall, Robert
2003-04-29
Aggregating Dictyostelium cells secrete cyclic AMP to attract their neighbours by chemotaxis. It has now been shown that adenylyl cyclase is enriched in the rear of cells, and this localisation is required for normal aggregation.
Bitter tastant responses in the amoeba Dictyostelium correlate with rat and human taste assays.
Cocorocchio, Marco; Ives, Robert; Clapham, David; Andrews, Paul L R; Williams, Robin S B
2016-01-01
Treatment compliance is reduced when pharmaceutical compounds have a bitter taste and this is particularly marked for paediatric medications. Identification of bitter taste liability during drug discovery utilises the rat in vivo brief access taste aversion (BATA) test which apart from animal use is time consuming with limited throughput. We investigated the suitability of using a simple, non-animal model, the amoeba Dictyostelium discoideum to investigate taste-related responses and particularly identification of compounds with a bitter taste liability. The effect of taste-related compounds on Dictyostelium behaviour following acute exposure (15 minutes) was monitored. Dictyostelium did not respond to salty, sour, umami or sweet tasting compounds, however, cells rapidly responded to bitter tastants. Using time-lapse photography and computer-generated quantification to monitor changes in cell membrane movement, we developed an assay to assess the response of Dictyostelium to a wide range of structurally diverse known bitter compounds and blinded compounds. Dictyostelium showed varying responses to the bitter tastants, with IC50 values providing a rank order of potency. Comparison of Dictyostelium IC50 values to those observed in response to a similar range of compounds in the rat in vivo brief access taste aversion test showed a significant (p = 0.0172) positive correlation between the two models, and additionally a similar response to that provided by a human sensory panel assessment test. These experiments demonstrate that Dictyostelium may provide a suitable model for early prediction of bitterness for novel tastants and drugs. Interestingly, a response to bitter tastants appears conserved from single-celled amoebae to humans.
Mitochondrial Stress Tests Using Seahorse Respirometry on Intact Dictyostelium discoideum Cells.
Lay, Sui; Sanislav, Oana; Annesley, Sarah J; Fisher, Paul R
2016-01-01
Mitochondria not only play a critical and central role in providing metabolic energy to the cell but are also integral to the other cellular processes such as modulation of various signaling pathways. These pathways affect many aspects of cell physiology, including cell movement, growth, division, differentiation, and death. Mitochondrial dysfunction which affects mitochondrial bioenergetics and causes oxidative phosphorylation defects can thus lead to altered cellular physiology and manifest in disease. The assessment of the mitochondrial bioenergetics can thus provide valuable insights into the physiological state, and the alterations to the state of the cells. Here, we describe a method to successfully use the Seahorse XF(e)24 Extracellular Flux Analyzer to assess the mitochondrial respirometry of the cellular slime mold Dictyostelium discoideum.
Deficiency of Huntingtin Has Pleiotropic Effects in the Social Amoeba Dictyostelium discoideum
Myre, Michael A.; Lumsden, Amanda L.; Thompson, Morgan N.; Wasco, Wilma; MacDonald, Marcy E.; Gusella, James F.
2011-01-01
Huntingtin is a large HEAT repeat protein first identified in humans, where a polyglutamine tract expansion near the amino terminus causes a gain-of-function mechanism that leads to selective neuronal loss in Huntington's disease (HD). Genetic evidence in humans and knock-in mouse models suggests that this gain-of-function involves an increase or deregulation of some aspect of huntingtin's normal function(s), which remains poorly understood. As huntingtin shows evolutionary conservation, a powerful approach to discovering its normal biochemical role(s) is to study the effects caused by its deficiency in a model organism with a short life-cycle that comprises both cellular and multicellular developmental stages. To facilitate studies aimed at detailed knowledge of huntingtin's normal function(s), we generated a null mutant of hd, the HD ortholog in Dictyostelium discoideum. Dictyostelium cells lacking endogenous huntingtin were viable but during development did not exhibit the typical polarized morphology of Dictyostelium cells, streamed poorly to form aggregates by accretion rather than chemotaxis, showed disorganized F-actin staining, exhibited extreme sensitivity to hypoosmotic stress, and failed to form EDTA-resistant cell–cell contacts. Surprisingly, chemotactic streaming could be rescued in the presence of the bivalent cations Ca2+ or Mg2+ but not pulses of cAMP. Although hd − cells completed development, it was delayed and proceeded asynchronously, producing small fruiting bodies with round, defective spores that germinated spontaneously within a glassy sorus. When developed as chimeras with wild-type cells, hd − cells failed to populate the pre-spore region of the slug. In Dictyostelium, huntingtin deficiency is compatible with survival of the organism but renders cells sensitive to low osmolarity, which produces pleiotropic cell autonomous defects that affect cAMP signaling and as a consequence development. Thus, Dictyostelium provides a novel haploid
Strassmann, Joan E; Queller, David C
2011-05-01
Dictyostelium discoideum has been very useful for elucidating principles of development over the last 50 years, but a key attribute means there is a lot to be learned from a very different intellectual tradition: social evolution. Because Dictyostelium arrives at multicellularity by aggregation instead of through a single-cell bottleneck, the multicellular body could be made up of genetically distinct cells. If they are genetically distinct, natural selection will result in conflict over which cells become fertile spores and which become dead stalk cells. Evidence for this conflict includes unequal representation of two genetically different clones in spores of a chimera, the poison-like differentiation inducing factor (DIF) system that appears to involve some cells forcing others to become stalk, and reduced functionality in migrating chimeras. Understanding how selection operates on chimeras of genetically distinct clones is crucial for a comprehensive view of Dictyostelium multicellularity. In nature, Dictyostelium fruiting bodies are often clonal, or nearly so, meaning development will often be very cooperative. Relatedness levels tell us what benefits must be present for sociality to evolve. Therefore it is important to measure relatedness in nature, show that it has an impact on cooperation in the laboratory, and investigate genes that Dictyostelium uses to discriminate between relatives and non-relatives. Clearly, there is a promising future for research at the interface of development and social evolution in this fascinating group. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.
Signal relay during the life cycle of Dictyostelium.
Mahadeo, Dana C; Parent, Carole A
2006-01-01
A fundamental property of multicellular organisms is signal relay, the process by which information is transmitted from one cell to another. The integration of external information, such as nutritional status or developmental cues, is critical to the function of organisms. In addition, the spatial organizations of multicellular organisms require intricate signal relay mechanisms. Signal relay is remarkably exhibited during the life cycle of the social amoebae Dictyostelium discoideum, a eukaryote that retains a simple way of life, yet it has greatly contributed to our knowledge of the mechanisms cells use to communicate and integrate information. This chapter focuses on the molecules and mechanisms that Dictyostelium employs during its life cycle to relay temporal and spatial cues that are required for survival.
Intracellular dynamics during directional sensing of chemotactic cells
NASA Astrophysics Data System (ADS)
Amselem, Gabriel; Bodenschatz, Eberhard; Beta, Carsten
2007-03-01
We use an experimental approach based on the photo-chemical release of signaling molecules in microfluidic environments to expose chemotactic cells to well controlled chemoattractant stimuli. We apply this technique to study intracellular translocation of fluorescently labeled PH-domain proteins in the social ameba Dictyostelium discoideum. Single chemotactic Dictyostelium cells are exposed to localized, well defined gradients in the chemoattractant cAMP and their translocation response is quantified as a function of the external gradient.
A secreted protein is an endogenous chemorepellant in Dictyostelium discoideum
Phillips, Jonathan E.; Gomer, Richard H.
2012-01-01
Chemorepellants may play multiple roles in physiological and pathological processes. However, few endogenous chemorepellants have been identified, and how they function is unclear. We found that the autocrine signal AprA, which is produced by growing Dictyostelium discoideum cells and inhibits their proliferation, also functions as a chemorepellant. Wild-type cells at the edge of a colony show directed movement outward from the colony, whereas cells lacking AprA do not. Cells show directed movement away from a source of recombinant AprA and dialyzed conditioned media from wild-type cells, but not dialyzed conditioned media from aprA− cells. The secreted protein CfaD, the G protein Gα8, and the kinase QkgA are necessary for the chemorepellant activity of AprA as well as its proliferation-inhibiting activity, whereas the putative transcription factor BzpN is dispensable for the chemorepellant activity of AprA but necessary for inhibition of proliferation. Phospholipase C and PI3 kinases 1 and 2, which are necessary for the activity of at least one other chemorepellant in Dictyostelium, are not necessary for recombinant AprA chemorepellant activity. Starved cells are not repelled by recombinant AprA, suggesting that aggregation-phase cells are not sensitive to the chemorepellant effect. Cell tracking indicates that AprA affects the directional bias of cell movement, but not cell velocity or the persistence of cell movement. Together, our data indicate that the endogenous signal AprA acts as an autocrine chemorepellant for Dictyostelium cells. PMID:22711818
Dictyostelium discoideum mutants with temperature-sensitive defects in endocytosis
1994-01-01
We have isolated and characterized temperature-sensitive endocytosis mutants in Dictyostelium discoideum. Dictyostelium is an attractive model for genetic studies of endocytosis because of its high rates of endocytosis, its reliance on endocytosis for nutrient uptake, and tractable molecular genetics. Endocytosis-defective mutants were isolated by a fluorescence-activated cell sorting (FACS) as cells unable to take up a fluorescent marker. One temperature-sensitive mutant (indy1) was characterized in detail and found to exhibit a complete block in fluid phase endocytosis at the restrictive temperature, but normal rates of endocytosis at the permissive temperature. Likewise, a potential cell surface receptor that was rapidly internalized in wild-type cells and indy1 cells at the permissive temperature was poorly internalized in indy1 under restrictive conditions. Growth was also completely arrested at the restrictive temperature. The endocytosis block was rapidly induced upon shift to the restrictive temperature and reversed upon return to normal conditions. Inhibition of endocytosis was also specific, as other membrane-trafficking events such as phagocytosis, secretion of lysosomal enzymes, and contractile vacuole function were unaffected at the restrictive temperature. Because recycling and transport to late endocytic compartments were not affected, the site of the defect's action is probably at an early step in the endocytic pathway. Additionally, indy1 cells were unable to proceed through the normal development program at the restrictive temperature. Given the tight functional and growth phenotypes, the indy1 mutant provides an opportunity to isolate genes responsible for endocytosis in Dictyostelium by complementation cloning. PMID:7929583
Early, A; Gamper, M; Moniakis, J; Kim, E; Hunter, T; Williams, J G; Firtel, R A
2001-04-01
The protein tyrosine phosphatase PTP1, which mediates reversible phosphorylation on tyrosine, has been shown to play an important regulatory role during Dictyostelium development. Mutants lacking PTP1 develop more rapidly than normal, while strains that overexpress PTP1 display aberrant morphology. However, the signalling pathways involved have not been characterised. In reexamining these strains, we have found that there is an inverse correlation between levels of PTP1 activity, the extent of tyrosine phosphorylation on Dictyostelium STATa after treatment with cAMP, and the proportion of the slug population exhibiting STATa nuclear enrichment in vivo. This suggests that PTP1 acts to attenuate the tyrosine phosphorylation of STATa and downstream STATa-mediated pathways. Consistent with this, we show that when PTP1 is overexpressed, there is increased expression of a prestalk cell marker at the slug posterior, a phenocopy of STATa null slugs. In ptp1 null strains, STATa tyrosine phosphorylation and nuclear enrichment in the slug anterior is increased. There is also a change in the prestalk to prespore cell ratio. Synergy experiments suggest that this is due to a cell-autonomous defect in forming the subset of prespore cells that are located in the anterior prespore region. Copyright 2001 Academic Press.
An autoregulatory circuit for long-range self-organization in Dictyostelium cell populations.
Sawai, Satoshi; Thomason, Peter A; Cox, Edward C
2005-01-20
Nutrient-deprived Dictyostelium amoebae aggregate to form a multicellular structure by chemotaxis, moving towards propagating waves of cyclic AMP that are relayed from cell to cell. Organizing centres are not formed by founder cells, but are dynamic entities consisting of cores of outwardly rotating spiral waves that self-organize in a homogeneous cell population. Spiral waves are ubiquitously observed in chemical reactions as well as in biological systems. Although feedback control of spiral waves in spatially extended chemical reactions has been demonstrated in recent years, the mechanism by which control is achieved in living systems is unknown. Here we show that mutants of the cyclic AMP/protein kinase A pathway show periodic signalling, but fail to organize coherent long-range wave territories, owing to the appearance of numerous spiral cores. A theoretical model suggests that autoregulation of cell excitability mediated by protein kinase A acts to optimize the number of signalling centres.
Huber, Robert; O'Day, Danton H
2011-04-01
Current knowledge suggests that cell movement in the eukaryotic slime mold Dictyostelium discoideum is mediated by different signaling pathways involving a number of redundant components. Our previous research has identified a specific motility-enhancing function for epidermal growth factor-like (EGFL) repeats in Dictyostelium, specifically for the EGFL repeats of cyrA, a matricellular, calmodulin (CaM)-binding protein in Dictyostelium. Using mutants of cAMP signaling (carA(-), carC(-), gpaB(-), gpbA(-)), the endogenous calcium (Ca(2+)) release inhibitor TMB-8, the CaM antagonist W-7, and a radial motility bioassay, we show that DdEGFL1, a synthetic peptide whose sequence is obtained from the first EGFL repeat of cyrA, functions independently of the cAMP-mediated signaling pathways to enhance cell motility through a mechanism involving Ca(2+) signaling, CaM, and RasG. We show that DdEGFL1 increases the amounts of polymeric myosin II heavy chain and actin in the cytoskeleton by 24.1±10.7% and 25.9±2.1% respectively and demonstrate a link between Ca(2+)/CaM signaling and cytoskeletal dynamics. Finally, our findings suggest that carA and carC mediate a brake mechanism during chemotaxis since DdEGFL1 enhanced the movement of carA(-)/carC(-) cells by 844±136% compared to only 106±6% for parental DH1 cells. Based on our data, this signaling pathway also appears to involve the G-protein β subunit, RasC, RasGEFA, and protein kinase B. Together, our research provides insight into the functionality of EGFL repeats in Dictyostelium and the signaling pathways regulating cell movement in this model organism. It also identifies several mechanistic components of DdEGFL1-enhanced cell movement, which may ultimately provide a model system for understanding EGFL repeat function in higher organisms. Copyright © 2010 Elsevier Inc. All rights reserved.
Self-organized Motion During Dictyostelium amoebae aggregation
NASA Astrophysics Data System (ADS)
Levine, Herbert
2004-03-01
After starvation, amoeba of the cellular slime mold Dictyostelium discoideum aggregate to form rudimentary multicellular organisms. The coordination of the individual motions of hundreds of thousands of individual cells is an important ingredient in the success of this process. This coordination is accomplished by chemical signaling during the early stages and by direct cell-cell interactions once the cells reach the nascent mound. This talk will review the basic nonequilibrium physics underlying the spatial patterns formed by these cooperative motions, including high-density incoming streams and spontaneously rotating mounds.
Knecht, David A.; Silale, Augustinas; Traynor, David; Williams, Thomas D.; Thomason, Peter A.; Insall, Robert H.; Chubb, Jonathan R.; Kay, Robert R.; Veltman, Douwe M.
2018-01-01
Dictyostelium has a mature technology for molecular-genetic manipulation based around transfection using several different selectable markers, marker re-cycling, homologous recombination and insertional mutagenesis, all supported by a well-annotated genome. However this technology is optimized for mutant, axenic cells that, unlike non-axenic wild type, can grow in liquid medium. There is a pressing need for methods to manipulate wild type cells and ones with defects in macropinocytosis, neither of which can grow in liquid media. Here we present a panel of molecular genetic techniques based on the selection of Dictyostelium transfectants by growth on bacteria rather than liquid media. As well as extending the range of strains that can be manipulated, these techniques are faster than conventional methods, often giving usable numbers of transfected cells within a few days. The methods and plasmids described here allow efficient transfection with extrachromosomal vectors, as well as chromosomal integration at a ‘safe haven’ for relatively uniform cell-to-cell expression, efficient gene knock-in and knock-out and an inducible expression system. We have thus created a complete new system for the genetic manipulation of Dictyostelium cells that no longer requires cell feeding on liquid media. PMID:29847546
Stadler, J; Keenan, T W; Bauer, G; Gerisch, G
1989-01-01
The contact site A glycoprotein, a cell adhesion protein of aggregating Dictyostelium cells, was labeled with fatty acid, myo-inositol, phosphate and ethanolamine in vivo, indicating that the protein is anchored in the membrane by a lipid. This lipid was not susceptible to phosphatidyl inositol specific phospholipase C. When cleaved with nitrous acid or when subjected to acetolysis, the anchor released lipids which were different from those released from Trypanosoma variant cell surface glycoprotein, a protein with a known phosphatidyl inositol-glycan anchor. Resistance to weak and sensitivity to strong alkali indicated that the fatty acid in the contact site A glycolipid anchor was in an amide bond. On incubation with sphingomyelinase, a lipid with the chromatographic behavior of ceramide was released. These results suggest that the contact site A glycoprotein is anchored by a ceramide based lipid glycan. Images PMID:2721485
Sun, Tong; Kim, Bohye; Kim, Lou W.
2013-01-01
Glycogen Synthase Kinase 3 (GSK3) is a multifunctional kinase involved in diverse cellular activities such as metabolism, differentiation, and morphogenesis. Recent studies showed that GSK3 in Dictyostelium affects chemotaxis via TorC2 pathway and Daydreamer. Now we report that GSK3 affects PI3K membrane localization, of which mechanism has remained to be fully understood in Dictyostelium. The membrane localization domain (LD) of Phosphatidylinositol-3-kinase 1 (PI3K1) is phosphorylated on serine residues in a GSK3 dependent mechanism and PI3K1-LD exhibited biased membrane localization in gsk3− cells compared to the wild type cells. Furthermore, multiple GSK3-phosphorylation consensus sites exist in PI3K1-LD, of which phosphomimetic substitutions restored cAMP induced transient membrane localization of PI3K1-LD in gsk3− cells. Serine to alanine substitution mutants of PI3K1-LD, in contrast, displayed constitutive membrane localization in wild type cells. Biochemical analysis revealed that GSK3 dependent serine phosphorylation of PI3K1-LD is constitutive during the course of cAMP stimulation. Together, these data suggest that GSK3 dependent serine phosphorylation is a prerequisite for chemoattractant cAMP induced PI3K membrane localization. PMID:24102085
Spontaneous Symmetry Breaking Turing-Type Pattern Formation in a Confined Dictyostelium Cell Mass
NASA Astrophysics Data System (ADS)
Sawai, Satoshi; Maeda, Yasuo; Sawada, Yasuji
2000-09-01
We have discovered a new type of patterning which occurs in a two-dimensionally confined cell mass of the cellular slime mold Dictyostelium discoideum. Besides the longitudinal structure reported earlier, we observed a spontaneous symmetry breaking spot pattern whose wavelength shows similar strain dependency to that of the longitudinal pattern. We propose that these structures are due to a reaction-diffusion Turing instability similar to the one which has been exemplified by CIMA (chlorite-iodide-malonic acid) reaction. The present finding may exhibit the first biochemical Turing structure in a developmental system with a controllable boundary condition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schoenitzer, Veronika; Universitaet Regensburg, Biochemie I, Universitaetsstrasse 31, D-93053 Regensburg; Eichner, Norbert
Highlights: Black-Right-Pointing-Pointer Dictyostelium produces the 264 kDa myosin chitin synthase of bivalve mollusc Atrina. Black-Right-Pointing-Pointer Chitin synthase activity releases chitin, partly associated with the cell surface. Black-Right-Pointing-Pointer Membrane extracts of transgenic slime molds produce radiolabeled chitin in vitro. Black-Right-Pointing-Pointer Chitin producing Dictyostelium cells can be characterized by atomic force microscopy. Black-Right-Pointing-Pointer This model system enables us to study initial processes of chitin biomineralization. -- Abstract: Several mollusc shells contain chitin, which is formed by a transmembrane myosin motor enzyme. This protein could be involved in sensing mechanical and structural changes of the forming, mineralizing extracellular matrix. Here we report themore » heterologous expression of the transmembrane myosin chitin synthase Ar-CS1 of the bivalve mollusc Atrina rigida (2286 amino acid residues, M.W. 264 kDa/monomer) in Dictyostelium discoideum, a model organism for myosin motor proteins. Confocal laser scanning immunofluorescence microscopy (CLSM), chitin binding GFP detection of chitin on cells and released to the cell culture medium, and a radiochemical activity assay of membrane extracts revealed expression and enzymatic activity of the mollusc chitin synthase in transgenic slime mold cells. First high-resolution atomic force microscopy (AFM) images of Ar-CS1 transformed cellulose synthase deficient D. discoideumdcsA{sup -} cell lines are shown.« less
A discrete cell model with adaptive signalling for aggregation of Dictyostelium discoideum.
Dallon, J C; Othmer, H G
1997-01-01
Dictyostelium discoideum (Dd) is a widely studied model system from which fundamental insights into cell movement, chemotaxis, aggregation and pattern formation can be gained. In this system aggregation results from the chemotactic response by dispersed amoebae to a travelling wave of the chemoattractant cAMP. We have developed a model in which the cells are treated as discrete points in a continuum field of the chemoattractant, and transduction of the extracellular cAMP signal into the intracellular signal is based on the G protein model developed by Tang & Othmer. The model reproduces a number of experimental observations and gives further insight into the aggregation process. We investigate different rules for cell movement the factors that influence stream formation the effect on aggregation of noise in the choice of the direction of movement and when spiral waves of chemoattractant and cell density are likely to occur. Our results give new insight into the origin of spiral waves and suggest that streaming is due to a finite amplitude instability. PMID:9134569
Garcia, Gene L; Rericha, Erin C; Heger, Christopher D; Goldsmith, Paul K; Parent, Carole A
2009-07-01
Starvation of Dictyostelium induces a developmental program in which cells form an aggregate that eventually differentiates into a multicellular structure. The aggregate formation is mediated by directional migration of individual cells that quickly transition to group migration in which cells align in a head-to-tail manner to form streams. Cyclic AMP acts as a chemoattractant and its production, secretion, and degradation are highly regulated. A key protein is the extracellular phosphodiesterase PdsA. In this study we examine the role and localization of PdsA during chemotaxis and streaming. We find that pdsA(-) cells respond chemotactically to a narrower range of chemoattractant concentrations compared with wild-type (WT) cells. Moreover, unlike WT cells, pdsA(-) cells do not form streams at low cell densities and form unusual thick and transient streams at high cell densities. We find that the intracellular pool of PdsA is localized to the endoplasmic reticulum, which may provide a compartment for storage and secretion of PdsA. Because we find that cAMP synthesis is normal in cells lacking PdsA, we conclude that signal degradation regulates the external cAMP gradient field generation and that the group migration behavior of these cells is compromised even though their signaling machinery is intact.
The Group Migration of Dictyostelium Cells Is Regulated by Extracellular Chemoattractant Degradation
Garcia, Gene L.; Rericha, Erin C.; Heger, Christopher D.; Goldsmith, Paul K.
2009-01-01
Starvation of Dictyostelium induces a developmental program in which cells form an aggregate that eventually differentiates into a multicellular structure. The aggregate formation is mediated by directional migration of individual cells that quickly transition to group migration in which cells align in a head-to-tail manner to form streams. Cyclic AMP acts as a chemoattractant and its production, secretion, and degradation are highly regulated. A key protein is the extracellular phosphodiesterase PdsA. In this study we examine the role and localization of PdsA during chemotaxis and streaming. We find that pdsA− cells respond chemotactically to a narrower range of chemoattractant concentrations compared with wild-type (WT) cells. Moreover, unlike WT cells, pdsA− cells do not form streams at low cell densities and form unusual thick and transient streams at high cell densities. We find that the intracellular pool of PdsA is localized to the endoplasmic reticulum, which may provide a compartment for storage and secretion of PdsA. Because we find that cAMP synthesis is normal in cells lacking PdsA, we conclude that signal degradation regulates the external cAMP gradient field generation and that the group migration behavior of these cells is compromised even though their signaling machinery is intact. PMID:19477920
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kubohara, Yuzuru, E-mail: ykuboha@juntendo.ac.jp; Department of Health Science, Juntendo University Graduate School of Health and Sports Science, Inzai 270-1695; Komachi, Mayumi
Osteosarcoma is a common metastatic bone cancer that predominantly develops in children and adolescents. Metastatic osteosarcoma remains associated with a poor prognosis; therefore, more effective anti-metastatic drugs are needed. Differentiation-inducing factor-1 (DIF-1), −2, and −3 are novel lead anti-tumor agents that were originally isolated from the cellular slime mold Dictyostelium discoideum. Here we investigated the effects of a panel of DIF derivatives on lysophosphatidic acid (LPA)-induced migration of mouse osteosarcoma LM8 cells by using a Boyden chamber assay. Some DIF derivatives such as Br-DIF-1, DIF-3(+2), and Bu-DIF-3 (5–20 μM) dose-dependently suppressed LPA-induced cell migration with associated IC{sub 50} values of 5.5, 4.6, andmore » 4.2 μM, respectively. On the other hand, the IC{sub 50} values of Br-DIF-1, DIF-3(+2), and Bu-DIF-3 versus cell proliferation were 18.5, 7.2, and 2.0 μM, respectively, in LM8 cells, and >20, 14.8, and 4.3 μM, respectively, in mouse 3T3-L1 fibroblasts (non-transformed). Together, our results demonstrate that Br-DIF-1 in particular may be a valuable tool for the analysis of cancer cell migration, and that DIF derivatives such as DIF-3(+2) and Bu-DIF-3 are promising lead anti-tumor agents for the development of therapies that suppress osteosarcoma cell proliferation, migration, and metastasis. - Highlights: • LPA induces cell migration (invasion) in murine osteosarcoma LM8 cells. • DIFs are novel lead anti-tumor agents found in Dictyostelium discoideum. • We examined the effects of DIF derivatives on LPA-induced LM8 cell migration in vitro. • Some of the DIF derivatives inhibited LPA-induced LM8 cell migration.« less
Dictyostelium discoideum mutants with conditional defects in phagocytosis
1994-01-01
We have isolated and characterized Dictyostelium discoideum mutants with conditional defects in phagocytosis. Under suspension conditions, the mutants exhibited dramatic reductions in the uptake of bacteria and polystyrene latex beads. The initial binding of these ligands was unaffected, however, indicating that the defect was not in a plasma membrane receptor: Because of the phagocytosis defect, the mutants were unable to grow when cultured in suspensions of heat-killed bacteria. The mutants exhibited normal capacities for fluid phase endocytosis and grew as rapidly as parental (AX4) cells in axenic medium. Both the defects in phagocytosis and growth on bacteria were corrected when the mutant Dictyostelium cells were cultured on solid substrates. Reversion and genetic complementation analysis suggested that the mutant phenotypes were caused by single gene defects. While the precise site of action of the mutations was not established, the mutations are likely to affect an early signaling event because the binding of bacteria to mutant cells in suspension was unable to trigger the localized polymerization of actin filaments required for ingestion; other aspects of actin function appeared normal. This class of conditional phagocytosis mutant should prove to be useful for the expression cloning of the affected gene(s). PMID:7519624
Mound-Interface Kinetics in Dictyostelium Aggregation
NASA Astrophysics Data System (ADS)
Tutu, Hiroki
2002-09-01
The mound development of the cellular slime mold amoebae Dictyostelium discoideum is studied with an interface kinetic model for the height of cell layers. As a competitive role for the chemotaxis, we compare two types of curvature relaxations; the surface relaxation induced by cell-substrate affinity (model A), and that comes from a cell-cell adhesive effect (model B). It is found that both models are characterized by the growth law for the maximum mound height. Based on a self-similarity scaling hypothesis for the spatial structure of streaming pattern, we suggest a scaling law for the growth of mound-height hmax ˜ t1-1/α+β/α with α = 2 (4) for the model A (B) and a number 0 ≤ β < 1.
Localization of palmitoylated and activated G protein α-subunit in Dictyostelium discoideum.
Alamer, Sarah; Kageyama, Yusuke; Gundersen, Robert E
2018-06-01
Guanine nucleotide-binding proteins (G proteins) act as molecular switches to regulate many fundamental cellular processes. The lipid modification, palmitoylation, can be considered as a key factor for proper G protein function and plasma membrane localization. In Dictyostelium discoidum, Gα2 is essential for the chemotactic response to cAMP in their developmental life cycle. However, the regulation of Gα2 with respect to palmitoylation, activation and Gβγ association is less clear. In this study, Gα2 is shown to be palmitoylated on Cys-4 by [ 3 H]palmitate labeling. Loss of this palmitoylation site results in redistribution of Gα2 within the cell and poor D. discoideum development. Cellular re-localization is also observed for activated Gα2. In the membrane fraction, Gα2-wt (YFP) is highly enriched in a low-density membrane fraction, which is palmitoylation-dependent. Activated Gα2 monomer and heterotrimer are shifted to two different higher-density fractions. These results broaden our understanding of how G protein localization and function are regulated inside the cells. © 2018 Wiley Periodicals, Inc.
Okuwa, Takako; Katayama, Takahiro; Takano, Akinori; Yasukawa, Hiroo
2002-10-01
Genes for the cell-counting factors in Dictyostelium discoideum, countin and countin2, are considered to control the size of the multicellular structure of this organism. A novel gene, countin3, that is homologous to countin and countin2 genes (49 and 39% identity in amino acid sequence, respectively) was identified in the D. discoideum genome. The expression of countin3 was observed in the vegetatively growing cells, decreased in the aggregating stage, increased in the mid-developmental stage and decreased again in subsequent stages. This expression pattern is different from that of countin and countin2. The distinct expression kinetics of three genes suggests that they would have unique roles in size control of D. discoideum.
Ras proteins have multiple functions in vegetative cells of Dictyostelium.
Bolourani, Parvin; Spiegelman, George; Weeks, Gerald
2010-11-01
During the aggregation of Dictyostelium cells, signaling through RasG is more important in regulating cyclic AMP (cAMP) chemotaxis, whereas signaling through RasC is more important in regulating the cAMP relay. However, RasC is capable of substituting for RasG for chemotaxis, since rasG⁻ cells are only partially deficient in chemotaxis, whereas rasC⁻/rasG⁻ cells are totally incapable of chemotaxis. In this study we have examined the possible functional overlap between RasG and RasC in vegetative cells by comparing the vegetative cell properties of rasG⁻, rasC⁻, and rasC⁻/rasG⁻ cells. In addition, since RasD, a protein not normally found in vegetative cells, is expressed in vegetative rasG⁻ and rasC⁻/rasG⁻ cells and appears to partially compensate for the absence of RasG, we have also examined the possible functional overlap between RasG and RasD by comparing the properties of rasG⁻ and rasC⁻/rasG⁻ cells with those of the mutant cells expressing higher levels of RasD. The results of these two lines of investigation show that RasD is capable of totally substituting for RasG for cytokinesis and growth in suspension, whereas RasC is without effect. In contrast, for chemotaxis to folate, RasC is capable of partially substituting for RasG, but RasD is totally without effect. Finally, neither RasC nor RasD is able to substitute for the role that RasG plays in regulating actin distribution and random motility. These specificity studies therefore delineate three distinct and none-overlapping functions for RasG in vegetative cells.
Waligórska, Agnieszka; Wianecka-Skoczeń, Magdalena; Korohoda, Włodzimierz
2007-01-01
Cell movement in the amoebae Dictyostelium discoideum has been examined in media differing in monovalent cation concentration (i.e. Na+ and K+). Under isotonic or even slightly hypertonic conditions, the cells move equally well in solutions in which either potassium or sodium ions dominate. However, in strongly hypertonic solutions the amoebae showed motility in a 2% potassium chloride solution, but remained motionless in a hypertonic 2% sodium chloride solution. This inhibition of D. discoideum amoebae movement in a hypertonic sodium chloride solution was fully reversible. Such behaviour corresponds to that of plant, fungi, and some invertebrate animal cells rather than protozoan or vertebrate cells. These observations suggest that studies using D. discoideum as a model for cell motility in vertebrate animal tissue cells should be considered with caution, and would seem to confirm the classification of cellular slime moulds as related rather to Fungi than to Protista. This also shows that the cell membrane models should consider the asymmetry in sodium/potassium ion concentrations found in vertebrate animal cells as one of various possibilities.
BTG interacts with retinoblastoma to control cell fate in Dictyostelium.
Conte, Daniele; MacWilliams, Harry K; Ceccarelli, Adriano
2010-03-12
In the genesis of many tissues, a phase of cell proliferation is followed by cell cycle exit and terminal differentiation. The latter two processes overlap: genes involved in the cessation of growth may also be important in triggering differentiation. Though conceptually distinct, they are often causally related and functional interactions between the cell cycle machinery and cell fate control networks are fundamental to coordinate growth and differentiation. A switch from proliferation to differentiation may also be important in the life cycle of single-celled organisms, and genes which arose as regulators of microbial differentiation may be conserved in higher organisms. Studies in microorganisms may thus contribute to understanding the molecular links between cell cycle machinery and the determination of cell fate choice networks. Here we show that in the amoebozoan D. discoideum, an ortholog of the metazoan antiproliferative gene btg controls cell fate, and that this function is dependent on the presence of a second tumor suppressor ortholog, the retinoblastoma-like gene product. Specifically, we find that btg-overexpressing cells preferentially adopt a stalk cell (and, more particularly, an Anterior-Like Cell) fate. No btg-dependent preference for ALC fate is observed in cells in which the retinoblastoma-like gene has been genetically inactivated. Dictyostelium btg is the only example of non-metazoan member of the BTG family characterized so far, suggesting that a genetic interaction between btg and Rb predated the divergence between dictyostelids and metazoa. While the requirement for retinoblastoma function for BTG antiproliferative activity in metazoans is known, an interaction of these genes in the control of cell fate has not been previously documented. Involvement of a single pathway in the control of mutually exclusive processes may have relevant implication in the evolution of multicellularity.
Stochastic Noise and Synchronisation during Dictyostelium Aggregation Make cAMP Oscillations Robust
Kim, Jongrae; Heslop-Harrison, Pat; Postlethwaite, Ian; Bates, Declan G
2007-01-01
Stable and robust oscillations in the concentration of adenosine 3′, 5′-cyclic monophosphate (cAMP) are observed during the aggregation phase of starvation-induced development in Dictyostelium discoideum. In this paper we use mathematical modelling together with ideas from robust control theory to identify two factors which appear to make crucial contributions to ensuring the robustness of these oscillations. Firstly, we show that stochastic fluctuations in the molecular interactions play an important role in preserving stable oscillations in the face of variations in the kinetics of the intracellular network. Secondly, we show that synchronisation of the aggregating cells through the diffusion of extracellular cAMP is a key factor in ensuring robustness of the oscillatory waves of cAMP observed in Dictyostelium cell cultures to cell-to-cell variations. A striking and quite general implication of the results is that the robustness analysis of models of oscillating biomolecular networks (circadian clocks, Ca2+ oscillations, etc.) can only be done reliably by using stochastic simulations, even in the case where molecular concentrations are very high. PMID:17997595
NASA Technical Reports Server (NTRS)
Hanely, Julia C.; Reinsch, Sigrid; Myers, Zachary A.; Freeman, John; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David G.
2014-01-01
The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. To expand the use of flight verified hardware for various model organisms, we performed ground experiments to determine whether ARC EMCS Seed Cassettes could be adapted for use with cellular slime mold for future space flight experiments. Dictyostelium is a cellular slime mold that can exist both as a single-celled independent organism and as a part of a multicellular colony which functions as a unit (pseudoplasmodium). Under certain stress conditions, individual amoebae will aggregate to form multicellular structures. Developmental pathways are very similar to those found in Eukaryotic organisms, making this a uniquely interesting organism for use in genetic studies. Dictyostelium has been used as a genetic model organism for prior space flight experiments. Due to the formation of spores that are resistant to unfavorable conditions such as desiccation, Dictyostelium is also a good candidate for use in the EMCS Seed Cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membranes contains dried growth medium. The goals of this study were to (1) verify that Dictyostelium are capable of normal growth and development on PES membranes, (2) develop a method for dehydration of Dictyostelium spores with successful recovery and development after rehydration, and (3) successful mock rehydration experiments in cassettes. Our results show normal developmental progression in two strains of Dictyostelium discoideum on PES membranes with a bacterial food source. We have successfully performed a mock rehydration of spores with developmental progression from aggregation to slug formation, and production of morphologically normal spores within 9 days of rehydration. Our results indicate that experiments on the ISS using the slime mold, Dictyostelium discoideum could potentially be performed in the flight verified hardware of
Functional Properties of Five Dictyostelium discoideum P2X Receptors*
Baines, Abigail; Parkinson, Katie; Sim, Joan A.; Bragg, Laricia; Thompson, Christopher R. L.; North, R. Alan
2013-01-01
The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors. PMID:23740252
Functional properties of five Dictyostelium discoideum P2X receptors.
Baines, Abigail; Parkinson, Katie; Sim, Joan A; Bragg, Laricia; Thompson, Christopher R L; North, R Alan
2013-07-19
The Dictyostelium discoideum genome encodes five proteins that share weak sequence similarity with vertebrate P2X receptors. Unlike vertebrate P2X receptors, these proteins are not expressed on the surface of cells, but populate the tubules and bladders of the contractile vacuole. In this study, we expressed humanized cDNAs of P2XA, P2XB, P2XC, P2XD, and P2XE in human embryonic kidney cells and altered the ionic and proton environment in an attempt to reflect the situation in amoeba. Recording of whole-cell membrane currents showed that four receptors operated as ATP-gated channels (P2XA, P2XB, P2XD, and P2XE). At P2XA receptors, ATP was the only effective agonist of 17 structurally related putative ligands that were tested. Extracellular sodium, compared with potassium, strongly inhibited ATP responses in P2XB, P2XD, and P2XE receptors. Increasing the proton concentration (pH 6.2) accelerated desensitization at P2XA receptors and decreased currents at P2XD receptors, but increased the currents at P2XB and P2XE receptors. Dictyostelium lacking P2XA receptors showed impaired regulatory volume decrease in hypotonic solution. This phenotype was readily rescued by overexpression of P2XA and P2XD receptors, partially rescued by P2XB and P2XE receptors, and not rescued by P2XC receptors. The failure of the nonfunctional receptor P2XC to restore the regulatory volume decrease highlights the importance of ATP activation of P2X receptors for a normal response to hypo-osmotic shock, and the weak rescue by P2XB and P2XE receptors indicates that there is limited functional redundancy among Dictyostelium P2X receptors.
Evidence for nucleolar subcompartments in Dictyostelium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Catalano, Andrew, E-mail: acatalano@ccny.cuny.edu; O’Day, Danton H., E-mail: danton.oday@utoronto.ca; Department of Cell and Systems Biology, University of Toronto, 25 Harbord St., Toronto, Ontario M5S 3G5
2015-01-24
Highlights: • Two nucleolar subcompartments (NoSC1, NoSC2) were found in Dictyostelium. • Specific nucleolar proteins localize to different nucleolar subcompartments. • Specific proteins exit NoSC1 and NoSC2 differently upon Actinomycin D treatment. • KRKR appears to function as an NoSC2 nucleolar subcompartment localization signal. - Abstract: The nucleolus is a multifunctional nuclear compartment usually consisting of two to three subcompartments which represent stages of ribosomal biogenesis. It is linked to several human diseases including viral infections, cancer, and neurodegeneration. Dictyostelium is a model eukaryote for the study of fundamental biological processes as well as several human diseases however comparatively littlemore » is known about its nucleolus. Unlike most nucleoli it does not possess visible subcompartments at the ultrastructural level. Several recently identified nucleolar proteins in Dictyostelium leave the nucleolus after treatment with the rDNA transcription inhibitor actinomycin-D (AM-D). Different proteins exit in different ways, suggesting that previously unidentified nucleolar subcompartments may exist. The identification of nucleolar subcompartments would help to better understand the nucleolus in this model eukaryote. Here, we show that Dictyostelium nucleolar proteins nucleomorphin isoform NumA1 and Bud31 localize throughout the entire nucleolus while calcium-binding protein 4a localizes to only a portion, representing nucleolar subcompartment 1 (NoSC1). SWI/SNF complex member Snf12 localizes to a smaller area within NoSC1 representing a second nucleolar subcompartment, NoSC2. The nuclear/nucleolar localization signal KRKR from Snf12 localized GFP to NoSC2, and thus also appears to function as a nucleolar subcompartment localization signal. FhkA localizes to the nucleolar periphery displaying a similar pattern to that of Hsp32. Similarities between the redistribution patterns of Dictyostelium nucleolar proteins
Evaluation of the mechanisms of intron loss and gain in the social amoebae Dictyostelium.
Ma, Ming-Yue; Che, Xun-Ru; Porceddu, Andrea; Niu, Deng-Ke
2015-12-18
Spliceosomal introns are a common feature of eukaryotic genomes. To approach a comprehensive understanding of intron evolution on Earth, studies should look beyond repeatedly studied groups such as animals, plants, and fungi. The slime mold Dictyostelium belongs to a supergroup of eukaryotes not covered in previous studies. We found 441 precise intron losses in Dictyostelium discoideum and 202 precise intron losses in Dictyostelium purpureum. Consistent with these observations, Dictyostelium discoideum was found to have significantly more copies of reverse transcriptase genes than Dictyostelium purpureum. We also found that the lost introns are significantly further from the 5' end of genes than the conserved introns. Adjacent introns were prone to be lost simultaneously in Dictyostelium discoideum. In both Dictyostelium species, the exonic sequences flanking lost introns were found to have a significantly higher GC content than those flanking conserved introns. Together, these observations support a reverse-transcription model of intron loss in which intron losses were caused by gene conversion between genomic DNA and cDNA reverse transcribed from mature mRNA. We also identified two imprecise intron losses in Dictyostelium discoideum that may have resulted from genomic deletions. Ninety-eight putative intron gains were also observed. Consistent with previous studies of other lineages, the source sequences were found in only a small number of cases, with only two instances of intron gain identified in Dictyostelium discoideum. Although they diverged very early from animals and fungi, Dictyostelium species have similar mechanisms of intron loss.
Correlated waves of actin filaments and PIP3 in Dictyostelium cells.
Asano, Yukako; Nagasaki, Akira; Uyeda, Taro Q P
2008-12-01
Chemotaxis-deficient amiB-null mutant Dictyostelium cells show two distinct movements: (1) they extend protrusions randomly without net displacements; (2) they migrate persistently and unidirectionally in a keratocyte-like manner. Here, we monitored the intracellular distribution of phosphatidylinositol (3,4,5)-trisphosphate (PIP(3)) to gain insight into roles PIP(3) plays in those spontaneous motilities. In keratocyte-like cells, PIP(3) showed convex distribution over the basal membrane, with no anterior enrichment. In stalled cells, as well as in wild type cells, PIP(3) repeated wave-like changes, including emergence, expansion and disappearance, on the basal membrane. The waves induced lamellipodia when they approached the cell edge, and the advancing speed of the waves was comparable to the migration speed of the keratocyte-like cells. LY294002, an inhibitor of PI3 kinase, abolished PIP(3) waves in stalled cells and stopped keratocyte-like cells. These results together suggested that keratocyte-like cells are "surfing" on the PIP(3) waves by coupling steady lamellipodial protrusions to the PIP(3) waves. Simultaneous live observation of actin filaments and PIP(3) in wild type or stalled amiB(-) cells indicated that the PIP(3) waves were correlated with wave-like distributions of actin filaments. Most notably, PIP(3) waves often followed actin waves, suggesting that PIP(3) induces local depolymerization of actin filaments. Consistent with this idea, cortical accumulation of PIP(3) was often correlated with local retraction of the periphery. We propose that the waves of PIP(3) and actin filaments are loosely coupled with each other and play important roles in generating spontaneous cell polarity. Copyright 2008 Wiley-Liss, Inc.
Cytochemical study of the nucleolus of the slime mold Dictyostelium discoideum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benichou, J.C.; Quiviger, B.; Ryter, A.
1983-07-01
The nucleus of the slime mold Dictyostelium discoideum is characterized by the presence of several large dense masses which are all in tight contact with the nuclear membrane. These dense masses, considered as nucleoli, present a rather homogeneous texture, in which dense chromatin, fibrillar, and granular material are not easily detected. The autoradiographic study of (/sup 3/H)uridine pulse-labeled cells showed that the majority of the silver grains were located inside these masses. The use of EDTA regressive-staining, acetylation and enzymatic digestion indicated that they are mostly composed of RNP and are totally devoid of dense chromatin as the rest ofmore » the nucleus is. After treatment with actinomycin D, fibrillar and granular material segregated but no chromatin could be found. All these observations confirmed that the dense masses correspond to nucleoli despite their peculiar ultrastructure. It can also be concluded that this type of nucleoli cannot be considered as a taxonomic character of the slime molds because it does not exist in all slime molds and was observed in some dinoflagellates, and ascomycetes.« less
De Palo, Giovanna; Yi, Darvin; Endres, Robert G.
2017-01-01
The transition from single-cell to multicellular behavior is important in early development but rarely studied. The starvation-induced aggregation of the social amoeba Dictyostelium discoideum into a multicellular slug is known to result from single-cell chemotaxis towards emitted pulses of cyclic adenosine monophosphate (cAMP). However, how exactly do transient, short-range chemical gradients lead to coherent collective movement at a macroscopic scale? Here, we developed a multiscale model verified by quantitative microscopy to describe behaviors ranging widely from chemotaxis and excitability of individual cells to aggregation of thousands of cells. To better understand the mechanism of long-range cell—cell communication and hence aggregation, we analyzed cell—cell correlations, showing evidence of self-organization at the onset of aggregation (as opposed to following a leader cell). Surprisingly, cell collectives, despite their finite size, show features of criticality known from phase transitions in physical systems. By comparing wild-type and mutant cells with impaired aggregation, we found the longest cell—cell communication distance in wild-type cells, suggesting that criticality provides an adaptive advantage and optimally sized aggregates for the dispersal of spores. PMID:28422986
Extracellular calmodulin regulates growth and cAMP-mediated chemotaxis in Dictyostelium discoideum
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Day, Danton H., E-mail: danton.oday@utoronto.ca; Department of Biology, University of Toronto Mississauga, 3359 Mississauga Rd. N., Mississauga, Ontario, Canada L5L 1C6; Huber, Robert J.
2012-09-07
Highlights: Black-Right-Pointing-Pointer Extracellular calmodulin is present throughout growth and development in Dictyostelium. Black-Right-Pointing-Pointer Extracellular calmodulin localizes within the ECM during development. Black-Right-Pointing-Pointer Extracellular calmodulin inhibits cell proliferation and increases chemotaxis. Black-Right-Pointing-Pointer Extracellular calmodulin exists in eukaryotic microbes. Black-Right-Pointing-Pointer Extracellular calmodulin may be functionally as important as intracellular calmodulin. -- Abstract: The existence of extracellular calmodulin (CaM) has had a long and controversial history. CaM is a ubiquitous calcium-binding protein that has been found in every eukaryotic cell system. Calcium-free apo-CaM and Ca{sup 2+}/CaM exert their effects by binding to and regulating the activity of CaM-binding proteins (CaMBPs). Most of themore » research done to date on CaM and its CaMBPs has focused on their intracellular functions. The presence of extracellular CaM is well established in a number of plants where it functions in proliferation, cell wall regeneration, gene regulation and germination. While CaM has been detected extracellularly in several animal species, including frog, rat, rabbit and human, its extracellular localization and functions are less well established. In contrast the study of extracellular CaM in eukaryotic microbes remains to be done. Here we show that CaM is constitutively expressed and secreted throughout asexual development in Dictyostelium where the presence of extracellular CaM dose-dependently inhibits cell proliferation but increases cAMP mediated chemotaxis. During development, extracellular CaM localizes within the slime sheath where it coexists with at least one CaMBP, the matricellular CaM-binding protein CyrA. Coupled with previous research, this work provides direct evidence for the existence of extracellular CaM in the Dictyostelium and provides insight into its functions in this model
1989-01-01
A severin deficient mutant of Dictyostelium discoideum has been isolated by the use of colony immunoblotting after chemical mutagenesis. In homogenates of wild-type cells, severin is easily detected as a very active F-actin fragmenting protein. Tests for severin in the mutant, HG1132, included viscometry for the assay of F- actin fragmentation in fractions from DEAE-cellulose columns, labeling of blots with monoclonal and polyclonal antibodies, and immunofluorescent-labeling of cryosections. Severin could not be detected in the mutant using these methods. The mutation in HG1132 is recessive and has been mapped to linkage group VII. The mutant failed to produce the normal severin mRNA, but small amounts of a transcript that was approximately 100 bases larger than the wild-type mRNA were detected in the mutant throughout all stages of development. On the DNA level a new Mbo II restriction site was found in the mutant within the coding region of the severin gene. The severin deficient mutant cells grew at an approximately normal rate, aggregated and formed fruiting bodies with viable spores. By the use of an image processing system, speed of cell movement, turning rates, and precision of chemotactic orientation in a stable gradient of cyclic AMP were quantitated, and no significant differences between wild-type and mutant cells were found. Thus, under the culture conditions used, severin proved to be neither essential for growth of D. discoideum nor for any cell function that is important for aggregation or later development. PMID:2537840
Huber, Robert J; O'Day, Danton H
2011-08-01
The Dictyostelium discoideum homolog of mammalian cyclin dependent kinase 5 (Cdk5) has previously been shown to be required for optimal growth and differentiation in this model organism, however, the subcellular localization of the protein has not previously been studied. In this study, immunolocalizations and a GFP fusion construct localized Cdk5 predominantly to the nucleus of vegetative cells. Western blots showed that Cdk5 was present in both nuclear and non-nuclear fractions, suggesting a functional role in both cellular locales. During the early stages of mitosis, Cdk5 gradually moved from a punctate nucleoplasmic distribution to localize adjacent to the inner nuclear envelope. During anaphase and telophase, Cdk5 localized to the cytoplasm and was not detected in the nucleoplasm. Cdk5 returned to the nucleus during cytokinesis. Proteolytic activity has been shown to be a critical regulator of the cell cycle. Immunoprecipitations coupled with immunolocalizations identified puromycin-sensitive aminopeptidase A (PsaA) as a potential Cdk5 binding partner in Dictyostelium. Immunoprecipitations also identified two phosphotyrosine proteins (35 and 18 kDa) that may interact with Cdk5 in vivo. Together, this work provides new insight into the localization of Cdk5, its function during cell division, and its binding to a proteolytic enzyme in Dictyostelium.
Lee, Hyang-Mi; Kim, Ji-Sun; Kang, Sa-Ouk
2016-12-01
Despite the importance of glutathione in Dictyostelium, the role of glutathione synthetase (gshB/GSS) has not been clearly investigated. In this study, we observed that increasing glutathione content by constitutive expression of gshB leads to mound-arrest and defects in 3',5'-cyclic adenosine monophosphate (cAMP)-mediated aggregation and developmental gene expression. The overexpression of gpaB encoding G protein alpha 2 (Gα2), an essential component of the cAMP signalling pathway, results in a phenotype similar to that caused by gshB overexpression, whereas gpaB knockdown in gshB-overexpressing cells partially rescues the above-mentioned phenotypic defects. Furthermore, Gα2 is highly enriched at the plasma membrane of gshB-overexpressing cells compared to wild-type cells. Therefore, our findings suggest that glutathione upregulates cAMP signalling via Gα2 modulation during Dictyostelium development. © 2016 Federation of European Biochemical Societies.
External stimulation strength controls actin response dynamics in Dictyostelium cells
NASA Astrophysics Data System (ADS)
Hsu, Hsin-Fang; Westendorf, Christian; Tarantola, Marco; Zykov, Vladimir; Bodenschatz, Eberhard; Beta, Carsten
2015-03-01
Self-sustained oscillation and the resonance frequency of the cytoskeletal actin polymerization/depolymerization have recently been observed in Dictyostelium, a model system for studying chemotaxis. Here we report that the resonance frequency is not constant but rather varies with the strength of external stimuli. To understand the underlying mechanism, we analyzed the polymerization and depolymerization time at different levels of external stimulation. We found that polymerization time is independent of external stimuli but the depolymerization time is prolonged as the stimulation increases. These observations can be successfully reproduced in the frame work of our time delayed differential equation model.
Rizzo, Stefania; Petrella, Francesco; Zucca, Ileana; Rinaldi, Elena; Barbaglia, Andrea; Padelli, Francesco; Baggi, Fulvio; Spaggiari, Lorenzo; Bellomi, Massimo; Bruzzone, Maria Grazia
2017-01-01
Among the various stem cell populations used for cell therapy, adult mesenchymal stromal cells (MSCs) have emerged as a major new cell technology. These cells must be tracked after transplantation to monitor their migration within the body and quantify their accumulation at the target site. This study assessed whether rat bone marrow MSCs can be labelled with superparamagnetic iron oxide (SPIO) nanoparticles and perfluorocarbon (PFC) nanoemulsion formulations without altering cell viability and compared magnetic resonance imaging (MRI) and magnetic resonance spectroscopy (MRS) results from iron-labelled and fluorine-labelled MSCs, respectively. Of MSCs, 2 × 10 6 were labelled with Molday ION Rhodamine-B (MIRB) and 2 × 10 6 were labelled with Cell Sense. Cell viability was evaluated by trypan blue exclusion method. Labelled MSCs were divided into four samples containing increasing cell numbers (0.125 × 10 6 , 0.25 × 10 6 , 0.5 × 10 6 , 1 × 10 6 ) and scanned on a 7T MRI: for MIRB-labelled cells, phantoms and cells negative control, T1, T2 and T2* maps were acquired; for Cell Sense labelled cells, phantoms and unlabelled cells, a 19 F non-localised single-pulse MRS sequence was acquired. In total, 86.8% and 83.6% of MIRB-labelled cells and Cell Sense-labelled cells were viable, respectively. MIRB-labelled cells were visible in all samples with different cell numbers; pellets containing 0.5 × 10 6 and 1 × 10 6 of Cell Sense-labelled cells showed a detectable 19 F signal. Our data support the use of both types of contrast material (SPIO and PFC) for MSCs labelling, although further efforts should be dedicated to improve the efficiency of PFC labelling.
Loss of Cln3 impacts protein secretion in the social amoeba Dictyostelium.
Huber, Robert J
2017-07-01
Neuronal ceroid lipofuscinosis (NCL), also referred to as Batten disease, is the most common form of childhood neurodegeneration. Mutations in CLN3 cause the most prevalent subtype of the disease, which manifests during early childhood and is currently untreatable. The precise function of the CLN3 protein is still not known, which has inhibited the development of targeted therapies. In the social amoeba Dictyostelium discoideum, loss of the CLN3 homolog, Cln3, reduces adhesion during early development, which delays streaming and aggregation. The results of the present study indicate that this phenotype may be at least partly due to aberrant protein secretion in cln3 - cells. It is well-established that Cln3 localizes primarily to the contractile vacuole (CV) system in Dictyostelium, and to a lesser extent, compartments of the endocytic pathway. Intriguingly, the CV system has been linked to the secretion of proteins that do not contain a signal peptide for secretion (i.e., unconventional protein secretion). Proteins that do contain a signal peptide are secreted via a conventional mechanism involving the endoplasmic reticulum, transport through the Golgi, and secretion via vesicle release. In this study, Cln3 was observed to co-localize with the Golgi marker wheat germ agglutinin suggesting that Cln3 participates in both secretion mechanisms. Chimeras of wild-type (WT) and cln3 - cells displayed delayed streaming and aggregation, and interestingly, cln3 - cells starved in conditioned media (CM) harvested from starving WT cells showed near normal timing of streaming and aggregation suggesting aberrant protein secretion in Cln3-deficient cells. Based on these observations, LC-MS/MS was used to reveal the protein content of CM from starved cells (mass spectrometry data are available via ProteomeXchange with identifier PXD004897). A total of 450 proteins were detected in WT and cln3 - CM, of which 3 were absent in cln3 - CM. Moreover, 12 proteins that were present in
Wang, Weiye; Chen, Song; Das, Satarupa; Losert, Wolfgang; Parent, Carole A
2018-05-04
Dictyostelium discoideum cells transport adenylyl cyclase A (ACA)-containing vesicles to the back of polarized cells to relay exogenous cAMP signals during chemotaxis. Fluorescence in situ hybridization (FISH) experiments showed that ACA mRNA is also asymmetrically distributed at the back of polarized cells. By using the MS2 bacteriophage system, we now visualize the distribution of ACA mRNA in live chemotaxing cells. We found that the ACA mRNA localization is not dependent on the translation of the protein product and requires multiple cis-acting elements within the ACA-coding sequence. We show that ACA mRNA is associated with actively translating ribosomes and is transported along microtubules towards the back of cells. By monitoring the recovery of ACA-YFP after photobleaching, we observed that local translation of ACA-YFP occurs at the back of cells. These data represent a novel functional role for localized translation in the relay of chemotactic signals during chemotaxis. © 2018. Published by The Company of Biologists Ltd.
Tanaka, Takeshi; Shima, Yasuyuki; Ogawa, Naoki; Nagayama, Koki; Yoshida, Takashi; Ohmachi, Tetsuo
2011-01-01
Acetoacetyl-CoA thiolase (AT) is an enzyme that catalyses the CoA-dependent thiolytic cleavage of acetoacetyl-CoA to yield 2 molecules of acetyl-CoA, or the reverse condensation reaction. A full-length cDNA clone pBSGT-3, which has homology to known thiolases, was isolated from Dictyostelium cDNA library. Expression of the protein encoded in pBSGT-3 in Escherichia coli, its thiolase enzyme activity, and the amino acid sequence homology search revealed that pBSGT-3 encodes an AT. The recombinant AT (r-thiolase) was expressed in an active form in an E. coli expression system, and purified to homogeneity by selective ammonium sulfate fractionation and two steps of column chromatography. The purified enzyme exhibited a specific activity of 4.70 mU/mg protein. Its N-terminal sequence was (NH2)-Arg-Met-Tyr-Thr-Thr-Ala-Lys-Asn-Leu-Glu-, which corresponds to the sequence from positions 15 to 24 of the amino acid sequence deduced from pBSGT-3 clone. The r-thiolase in the inclusion body expressed highly in E. coli was the precursor form, which is slightly larger than the purified r-thiolase. When incubated with the cell-free extract of Dictyostelium cells, the precursor was converted to the same size to the purified r-thiolase, suggesting that the presequence at the N-terminus is removed by a Dictyostelium processing peptidase. PMID:21209787
Okuwa, T; Katayama, T; Takano, A; Kodaira, K; Yasukawa, H
2001-12-01
Countin, a cell-counting factor in Dictyostelium discoideum, is considered to limit the maximum size of the multicellular structure, because a countin null strain forms a huge fruiting body compared to that of the wild-type. A novel gene, countin2, that is highly homologous to countin (40% identity in amino acid sequence) was identified in the D. discoideum genome. The countin2 null strain formed a 1.7-fold higher number of the aggregates, resulting in smaller fruiting bodies compared with those of wild-type cells. Thus, the Countin2 protein is thought to limit the minimum size of the multicellular structure. The size and number of aggregates formed by a mixture of countin null and countin2 null strains were the same as those of the wild-type. These findings demonstrate that a combination of Countin and Countin2 proteins determines the appropriate size of the multicellular structure of D. discoideum.
A RabGAP Regulates Life-Cycle Duration via Trimeric G-protein Cascades in Dictyostelium discoideum
Kuwayama, Hidekazu; Miyanaga, Yukihiro; Urushihara, Hideko; Ueda, Masahiro
2013-01-01
Background The life-cycle of cellular slime molds comprises chronobiologically regulated processes. During the growth phase, the amoeboid cells proliferate at a definite rate. Upon starvation, they synthesize cAMP as both first and second messengers in signalling pathways and form aggregates, migrating slugs, and fruiting bodies, consisting of spores and stalk cells, within 24 h. In Dictyostelium discoideum, because most growth-specific events cease during development, proliferative and heterochronic mutations are not considered to be interrelated and no genetic factor governing the entire life-cycle duration has ever been identified. Methodology/Principal Findings Using yeast 2-hybrid library screening, we isolated a Dictyostelium discoideum RabGAP, Dd Rbg-3, as a candidate molecule by which the Dictyostelium Gα2 subunit directs its effects. Rab GTPase-activating protein, RabGAP, acts as a negative regulator of Rab small GTPases, which orchestrate the intracellular membrane trafficking involved in cell proliferation. Deletion mutants of Dd rbg-3 exhibited an increased growth rate and a shortened developmental period, while an overexpression mutant demonstrated the opposite effects. We also show that Dd Rbg-3 interacts with 2 Gα subunits in an activity-dependent manner in vitro. Furthermore, both human and Caenorhabditis elegans rbg-3 homologs complemented the Dd rbg-3–deletion phenotype in D. discoideum, indicating that similar pathways may be generally conserved in multicellular organisms. Conclusions/Significance Our findings suggest that Dd Rbg-3 acts as a key element regulating the duration of D. discoideum life-span potentially via trimeric G-protein cascades. PMID:24349132
The real factor for polypeptide elongation in Dictyostelium cells is EF-2B, not EF-2A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshino, Tomoko; Maeda, Yasuo; Amagai, Aiko
2007-08-03
Polypeptide elongation factor 2 (EF-2) plays an essential role in protein synthesis and is believed to be indispensable for cell proliferation. Recently, it has been demonstrated that there are two kinds of EF-2 (EF-2A and EF-2B with 76.6% of sequence identity at the amino acid level) in Dictyostelium discoideum. Although the knockout of EF-2A slightly impaired cytokinesis, EF-2A null cells exhibited almost normal protein synthesis and cell growth, suggesting that there is another molecule capable of compensating for EF-2 function. Since EF-2B is the most likely candidate, we examined its function using ef-2b knockdown cells prepared by the RNAi method.more » Our results strongly suggest that EF-2B is required for protein synthesis and cell proliferation, functioning as the real EF-2. Interestingly, the expressions of ef-2a and ef-2b mRNAs during development are reversely regulated, and the ef-2b expression is greatly augmented in ef-2a null cells.« less
High-throughput analysis of spatio-temporal dynamics in Dictyostelium
Sawai, Satoshi; Guan, Xiao-Juan; Kuspa, Adam; Cox, Edward C
2007-01-01
We demonstrate a time-lapse video approach that allows rapid examination of the spatio-temporal dynamics of Dictyostelium cell populations. Quantitative information was gathered by sampling life histories of more than 2,000 mutant clones from a large mutagenesis collection. Approximately 4% of the clonal lines showed a mutant phenotype at one stage. Many of these could be ordered by clustering into functional groups. The dataset allows one to search and retrieve movies on a gene-by-gene and phenotype-by-phenotype basis. PMID:17659086
Huber, Robert J
2016-11-24
Neuronal ceroid lipofuscinosis (NCL), also known as Batten disease, is a debilitating neurological disorder that affects both children and adults. Thirteen genetically distinct genes have been identified that when mutated, result in abnormal lysosomal function and an excessive accumulation of ceroid lipofuscin in neurons, as well as other cell types outside of the central nervous system. The NCL family of proteins is comprised of lysosomal enzymes (PPT1/CLN1, TPP1/CLN2, CTSD/CLN10, CTSF/CLN13), proteins that peripherally associate with membranes (DNAJC5/CLN4, KCTD7/CLN14), a soluble lysosomal protein (CLN5), a protein present in the secretory pathway (PGRN/CLN11), and several proteins that display different subcellular localizations (CLN3, CLN6, MFSD8/CLN7, CLN8, ATP13A2/CLN12). Unfortunately, the precise functions of many of the NCL proteins are still unclear, which has made targeted therapy development challenging. The social amoeba Dictyostelium discoideum has emerged as an excellent model system for studying the normal functions of proteins linked to human neurological disorders. Intriguingly, the genome of this eukaryotic soil microbe encodes homologs of 11 of the 13 known genes linked to NCL. The genetic tractability of the organism, combined with its unique life cycle, makes Dictyostelium an attractive model system for studying the functions of NCL proteins. Moreover, the ability of human NCL proteins to rescue gene-deficiency phenotypes in Dictyostelium suggests that the biological pathways regulating NCL protein function are likely conserved from Dictyostelium to human. In this review, I will discuss each of the NCL homologs in Dictyostelium in turn and describe how future studies can exploit the advantages of the system by testing new hypotheses that may ultimately lead to effective therapy options for this devastating and currently untreatable neurological disorder.
Chaney, L K; Jacobson, B S
1983-08-25
Plasma membrane (PM) can be isolated by binding to a positively charged solid support. Using this concept, we have developed a novel method of PM isolation using cationic colloidal silica. The method is designed for the comparative study of various physiological states of PM and for transbilayer protein mapping. The procedure consists of coating intact cells with a dense pellicle of silica particles and polyanion. Since cells remain intact during pellicle formation, the external face of the PM is selectively coated. The pellicle greatly enhances PM density and stabilizes it against vesiculation or lateral reorientation. Upon cell lysis, large open sheets of PM are rapidly isolated by centrifugation. PM from Dictyostelium discoideum was prepared by this method. Marker enzymes, cell surface labeling and microscopy demonstrate that the PM was isolated in high yield (70-80%) with a 10-17-fold purification and only low levels of cytoplasmic contamination. The pellicle remains intact during cell lysis and membrane isolation, shielding the external surface of the membranes up to 92% from chemical or enzymatic attack. The PM can thus be labeled selectively from inside and/or outside. Transmembrane proteins were identified in Dictyostelium PM by means of lactoperoxidase iodination and autoradiography.
Kikuchi, H; Saito, Y; Komiya, J; Takaya, Y; Honma, S; Nakahata, N; Ito, A; Oshima, Y
2001-10-19
We investigated the constituents of Dictyostelium discoideum to clarify the diversity of secondary metabolites of Dictyostelium cellular slime molds and to explore biologically active substances that could be useful in the development of novel drugs. From a methanol extract of the multicellular fruit body of D. discoideum, we isolated two novel amino sugar analogues, furanodictine A (1) and B (2). They are the first 3,6-anhydrosugars to be isolated from natural sources. Their relative structures were elucidated by spectral means, and the absolute configurations were confirmed by asymmetric syntheses of 1 and 2. These furanodictines potently induce neuronal differentiation of rat pheochromocytoma (PC-12) cells.
Dormann, D; Abe, T; Weijer, C J; Williams, J
2001-04-01
Dd-STATa, the Dictyostelium STAT (signal transducer and activator of transcription) protein, is selectively localised in the nuclei of a small subset of prestalk cells located in the slug tip. Injection of cAMP into the extracellular spaces in the rear of the slug induces rapid nuclear translocation of a Dd-GFP:STATa fusion protein in prespore cells surrounding the site of injection. This suggests that cAMP signals that emanate from the tip direct the localised nuclear accumulation of Dd-STATa. It also shows that prespore cells are competent to respond to cAMP, by Dd-STATa activation, and it implies that cAMP signalling is in some way limiting in the rear of the slug. Co-injection of a specific inhibitor of the cAR1 serpentine cAMP receptor almost completely prevents the cAMP-induced nuclear translocation, showing that most or all of the cAMP signal is transduced by cAR1. Dd-GFP:STATa also rapidly translocates into the nuclei of cells adjoining the front and back cut edges when a slug is bisected. Less severe mechanical disturbances, such as pricking the rear of a slug with an unfilled micropipette, also cause a more limited nuclear translocation of Dd-GFP:STATa. We propose that these signalling events form part of a repair mechanism that is activated when the migrating slug suffers mechanical damage.
Practical cell labeling with magnetite cationic liposomes for cell manipulation.
Ito, Hiroshi; Nonogaki, Yurika; Kato, Ryuji; Honda, Hiroyuki
2010-07-01
Personalization of the cell culture process for cell therapy is an ideal strategy to obtain maximum treatment effects. In a previous report, we proposed a strategy using a magnetic manipulation device that combined a palm-top size device and a cell-labeling method using magnetite cationic liposomes (MCLs) to enable feasible personalized cell processing. In the present study, we focused on optimizing the MCL-labeling technique with respect to cell manipulation in small devices. From detailed analysis with different cell types, 4 pg/cell of MCL-label was found to be obtained immediately after mixing with MCLs, which was sufficient for magnetic cell manipulation. The amount of label increased within 24 h depending on cell type, although in all cases it decreased along with cell doubling, indicating that the labeling potential of MCLs was limited. The role of free MCLs not involved in labeling was also investigated; MCLs' role was found to be a supportive one that maximized the manipulation performance up to 100%. We also determined optimum conditions to manipulate adherent cells by MCL labeling using the MCL dispersed in trypsin solution. Considering labeling feasibility and practical performance with 10(3)-10(5) cells for personalized cell processing, we determined that 10 microg/ml of label without incubation time (0 h incubation) was the universal MCL-labeling condition. We propose the optimum specifications for a device to be combined with this method. 2010. Published by Elsevier B.V.
Shimada, Nao; Nishio, Keiko; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi
2004-10-01
Dd-STATa is a functional Dictyostelium homologue of metazoan STAT (signal transducers and activators of transcription) proteins, which is activated by cAMP and is thereby translocated into the nuclei of anterior tip cells of the prestalk region of the slug. By using in situ hybridization analyses, we found that the SLF308 cDNA clone, which contains the ecmF gene that encodes a putative extracellular matrix protein and is expressed in the anterior tip cells, was greatly down-regulated in the Dd-STATa-null mutant. Disruption of the ecmF gene, however, resulted in almost no phenotypic change. The absence of any obvious mutant phenotype in the ecmF-null mutant could be due to a redundancy of similar genes. In fact, a search of the Dictyostelium whole genome database demonstrates the existence of an additional 16 homologues, all of which contain a cellulose-binding module. Among these homologues, four genes show Dd-STATa-dependent expression, while the others are Dd-STATa-independent. We discuss the potential role of Dd-STATa in morphogenesis via its effect on the interaction between cellulose and these extracellular matrix family proteins.
Developmental lineage priming in Dictyostelium by heterogeneous Ras activation.
Chattwood, Alex; Nagayama, Koki; Bolourani, Parvin; Harkin, Lauren; Kamjoo, Marzieh; Weeks, Gerald; Thompson, Christopher R L
2013-11-26
In cell culture, genetically identical cells often exhibit heterogeneous behavior, with only 'lineage primed' cells responding to differentiation inducing signals. It has recently been proposed that such heterogeneity exists during normal embryonic development to allow position independent patterning based on 'salt and pepper' differentiation and sorting out. However, the molecular basis of lineage priming and how it leads to reproducible cell type proportioning are poorly understood. To address this, we employed a novel forward genetic approach in the model organism Dictyostelium discoideum. These studies reveal that the Ras-GTPase regulator gefE is required for normal lineage priming and salt and pepper differentiation. This is because Ras-GTPase activity sets the intrinsic response threshold to lineage specific differentiation signals. Importantly, we show that although gefE expression is uniform, transcription of its target, rasD, is both heterogeneous and dynamic, thus providing a novel mechanism for heterogeneity generation and position-independent differentiation. DOI: http://dx.doi.org/10.7554/eLife.01067.001.
Amaroli, Andrea; Trielli, Francesca; Bianco, Bruno; Giordano, Stefano; Moggia, Elsa; Corrado, Maria U Delmonte
2005-12-15
Recently, we detected propionylcholinesterase (PrChE) activity in single-cell amoebae of Dictyostelium discoideum using cytochemical, electrophoretic, and spectrophotometric methods. The involvement of this enzyme activity in cell-cell and cell-environment interactions was suggested. In this work, we found that exposure of single-cell amoebae to an extremely low-frequency electromagnetic fields (ELF-EMF) of 300 microT, 50 Hz, from 1 h up to 48 h at 21 +/- 1 degrees C affected PrChE activity.
Robery, Steven; Mukanowa, Janina; Percie du Sert, Nathalie; Andrews, Paul L R; Williams, Robin S B
2011-01-01
Novel chemical entities (NCEs) may be investigated for emetic liability in a range of unpleasant experiments involving retching, vomiting or conditioned taste aversion/food avoidance in sentient animals. We have used a range of compounds with known emetic /aversive properties to examine the possibility of using the social amoeba, Dictyostelium discoideum, for research into identifying and understanding emetic liability, and hence reduce adverse animal experimentation in this area. Twenty eight emetic or taste aversive compounds were employed to investigate the acute (10 min) effect of compounds on Dictyostelium cell behaviour (shape, speed and direction of movement) in a shallow chemotaxic gradient (Dunn chamber). Compound concentrations were chosen based on those previously reported to be emetic or aversive in in vivo studies and results were recorded and quantified by automated image analysis. Dictyostelium cell motility was rapidly and strongly inhibited by four structurally distinct tastants (three bitter tasting compounds--denatonium benzoate, quinine hydrochloride, phenylthiourea, and the pungent constituent of chilli peppers--capsaicin). In addition, stomach irritants (copper chloride and copper sulphate), and a phosphodiesterase IV inhibitor also rapidly blocked movement. A concentration-dependant relationship was established for five of these compounds, showing potency of inhibition as capsaicin (IC(50) = 11.9 ± 4.0 µM) > quinine hydrochloride (IC(50) = 44.3 ± 6.8 µM) > denatonium benzoate (IC(50) = 129 ± 4 µM) > phenylthiourea (IC(50) = 366 ± 5 µM) > copper sulphate (IC(50) = 1433 ± 3 µM). In contrast, 21 compounds within the cytotoxic and receptor agonist/antagonist classes did not affect cell behaviour. Further analysis of bitter and pungent compounds showed that the effect on cell behaviour was reversible and not cytotoxic, suggesting an uncharacterised molecular mechanism of action for these compounds. These results therefore demonstrate
Robery, Steven; Mukanowa, Janina; Percie du Sert, Nathalie; Andrews, Paul L. R.; Williams, Robin S. B.
2011-01-01
Novel chemical entities (NCEs) may be investigated for emetic liability in a range of unpleasant experiments involving retching, vomiting or conditioned taste aversion/food avoidance in sentient animals. We have used a range of compounds with known emetic /aversive properties to examine the possibility of using the social amoeba, Dictyostelium discoideum, for research into identifying and understanding emetic liability, and hence reduce adverse animal experimentation in this area. Twenty eight emetic or taste aversive compounds were employed to investigate the acute (10 min) effect of compounds on Dictyostelium cell behaviour (shape, speed and direction of movement) in a shallow chemotaxic gradient (Dunn chamber). Compound concentrations were chosen based on those previously reported to be emetic or aversive in in vivo studies and results were recorded and quantified by automated image analysis. Dictyostelium cell motility was rapidly and strongly inhibited by four structurally distinct tastants (three bitter tasting compounds - denatonium benzoate, quinine hydrochloride, phenylthiourea, and the pungent constituent of chilli peppers - capsaicin). In addition, stomach irritants (copper chloride and copper sulphate), and a phosphodiesterase IV inhibitor also rapidly blocked movement. A concentration-dependant relationship was established for five of these compounds, showing potency of inhibition as capsaicin (IC50 = 11.9±4.0 µM) > quinine hydrochloride (IC50 = 44.3±6.8 µM) > denatonium benzoate (IC50 = 129±4 µM) > phenylthiourea (IC50 = 366±5 µM) > copper sulphate (IC50 = 1433±3 µM). In contrast, 21 compounds within the cytotoxic and receptor agonist/antagonist classes did not affect cell behaviour. Further analysis of bitter and pungent compounds showed that the effect on cell behaviour was reversible and not cytotoxic, suggesting an uncharacterised molecular mechanism of action for these compounds. These results therefore demonstrate
Zhang, Dongmei; van der Wel, Hanke; Johnson, Jennifer M; West, Christopher M
2012-01-13
Cytoplasmic prolyl 4-hydroxylases (PHDs) have a primary role in O(2) sensing in animals via modification of the transcriptional factor subunit HIFα, resulting in its polyubiquitination by the E3(VHL)ubiquitin (Ub) ligase and degradation in the 26 S proteasome. Previously thought to be restricted to animals, a homolog (P4H1) of HIFα-type PHDs is expressed in the social amoeba Dictyostelium where it also exhibits characteristics of an O(2) sensor for development. Dictyostelium lacks HIFα, and P4H1 modifies a different protein, Skp1, an adaptor of the SCF class of E3-Ub ligases related to the E3(VHL)Ub ligase that targets animal HIFα. Normally, the HO-Skp1 product of the P4H1 reaction is capped by a GlcNAc sugar that can be subsequently extended to a pentasaccharide by novel glycosyltransferases. To analyze the role of glycosylation, the Skp1 GlcNAc-transferase locus gnt1 was modified with a missense mutation to block catalysis or a stop codon to truncate the protein. Despite the accumulation of the hydroxylated form of Skp1, Skp1 was not destabilized based on metabolic labeling. However, hydroxylation alone allowed for partial correction of the high O(2) requirement of P4H1-null cells, therefore revealing both glycosylation-independent and glycosylation-dependent roles for hydroxylation. Genetic complementation of the latter function required an enzymatically active form of Gnt1. Because the effect of the gnt1 deficiency depended on P4H1, and Skp1 was the only protein labeled when the GlcNAc-transferase was restored to mutant extracts, Skp1 apparently mediates the cellular functions of both P4H1 and Gnt1. Although Skp1 stability itself is not affected by hydroxylation, its modification may affect the stability of targets of Skp1-dependent Ub ligases.
Du, Xiaoli; Herrfurth, Cornelia; Gottlieb, Thomas; Kawelke, Steffen; Feussner, Kristin; Rühling, Harald; Feussner, Ivo
2014-01-01
Triacylglycerol (TAG), the common energy storage molecule, is formed from diacylglycerol and a coenzyme A-activated fatty acid by the action of an acyl coenzyme A:diacylglycerol acyltransferase (DGAT). In order to conduct this step, most organisms rely on more than one enzyme. The two main candidates in Dictyostelium discoideum are Dgat1 and Dgat2. We show, by creating single and double knockout mutants, that the endoplasmic reticulum (ER)-localized Dgat1 enzyme provides the predominant activity, whereas the lipid droplet constituent Dgat2 contributes less activity. This situation may be opposite from what is seen in mammalian cells. Dictyostelium Dgat2 is specialized for the synthesis of TAG, as is the mammalian enzyme. In contrast, mammalian DGAT1 is more promiscuous regarding its substrates, producing diacylglycerol, retinyl esters, and waxes in addition to TAG. The Dictyostelium Dgat1, however, produces TAG, wax esters, and, most interestingly, also neutral ether lipids, which represent a significant constituent of lipid droplets. Ether lipids had also been found in mammalian lipid droplets, but the role of DGAT1 in their synthesis was unknown. The ability to form TAG through either Dgat1 or Dgat2 activity is essential for Dictyostelium to grow on bacteria, its natural food substrate. PMID:24562909
Dannat, K; Tillner, J; Winckler, T; Weiss, M; Eger, K; Dingermann, T
2003-03-01
Dictyostelium discoideum is a single-cell, eukaryotic microorganism that can undergo multicellular development in order to produce dormant spores. We investigated the capacity of D. discoideum to be used as a rapid screening system for potential developmental toxicity of compounds under development as pharmaceuticals. We used a set of four transgenic D. discoideum strains that expressed a reporter gene under the control of promoters that are active at certain time periods and in distinct cell types during D. discoideum development. We found that teratogens such as valproic acid, tretinoin, or thalidomide interfered to various extents with D. discoideum development, and had different effects on prestalk and prespore cell-specific reporter gene expression. Phenytoin was inactive in this assay, which may point to limitations in metabolization of the compound in Dictyostelium required to exert developmental toxicity. D. discoideum cell culture is cheap and easy to handle compared to mammalian cell cultures or animal teratogenicity models. Although the Dictyostelium-based assay described in this report may not securely predict the teratogenic potential of these drugs in humans, this organism may be qualified for rapid large-scale screenings of synthetic compounds under development as new pharmaceuticals for their potential to interfere with developmental processes and thus help to reduce the amount of teratogenicity tests in animal models.
Yasukawa, Hiro; Kuroita, Toshihiro; Tamura, Kentaro; Yamaguchi, Kazuo
2003-07-01
Penicillin binding proteins (PBPs) are penicillin-sensitive DD-peptidases catalyzing the terminal stages of bacterial cell wall assembly. We identified a Dictyostelium discoideum gene that encodes a protein of 522 amino acids showing similarity to Escherichia coli PBP4. The D. discoideum protein conserves three consensus sequences (SXXK, SXN and KTG) that are responsible for the catalytic activities of PBPs. The gene product prepared in the cell-free translation system showed carboxypeptidase activity but the activity was not detected in the presence of penicillin G. These results demonstrate that the D. discoideum gene encodes a eukaryotic form of penicillin-sensitive carboxypeptidase.
Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano
2009-12-01
Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.
Gao, Tong; Knecht, David; Tang, Lei; Hatton, R. Diane; Gomer, Richard H.
2004-01-01
Little is known about how individual cells can organize themselves to form structures of a given size. During development, Dictyostelium discoideum aggregates in dendritic streams and forms groups of ∼20,000 cells. D. discoideum regulates group size by secreting and simultaneously sensing a multiprotein complex called counting factor (CF). If there are too many cells in a stream, the associated high concentration of CF will decrease cell-cell adhesion and increase cell motility, causing aggregation streams to break up. The pulses of cyclic AMP (cAMP) that mediate aggregation cause a transient translocation of Akt/protein kinase B (Akt/PKB) to the leading edge of the plasma membrane and a concomitant activation of the kinase activity, which in turn stimulates motility. We found that countin− cells (which lack bioactive CF) and wild-type cells starved in the presence of anticountin antibodies (which block CF activity) showed a decreased level of cAMP-stimulated Akt/PKB membrane translocation and kinase activity compared to parental wild-type cells. Recombinant countin has the bioactivity of CF, and a 1-min treatment of cells with recombinant countin potentiated Akt/PKB translocation to membranes and Akt/PKB activity. Western blotting of total cell lysates indicated that countin does not affect the total level of Akt/PKB. Fluorescence microscopy of cells expressing an Akt/PKB pleckstrin homology domain-green fluorescent protein (PH-GFP) fusion protein indicated that recombinant countin and anti-countin antibodies do not obviously alter the distribution of Akt/PKB PH-GFP when it translocates to the membrane. Our data indicate that CF increases motility by potentiating the cAMP-stimulated activation and translocation of Akt/PKB. PMID:15470246
Froquet, Romain; le Coadic, Marion; Perrin, Jackie; Cherix, Nathalie; Cornillon, Sophie; Cosson, Pierre
2012-02-01
TM9 proteins form a family of conserved proteins with nine transmembrane domains essential for cellular adhesion in many biological systems, but their exact role in this process remains unknown. In this study, we found that genetic inactivation of the TM9 protein Phg1A dramatically decreases the surface levels of the SibA adhesion molecule in Dictyostelium amoebae. This is due to a decrease in sibA mRNA levels, in SibA protein stability, and in SibA targeting to the cell surface. A similar phenotype was observed in cells devoid of SadA, a protein that does not belong to the TM9 family but also exhibits nine transmembrane domains and is essential for cellular adhesion. A contact site A (csA)-SibA chimeric protein comprising only the transmembrane and cytosolic domains of SibA and the extracellular domain of the Dictyostelium surface protein csA also showed reduced stability and relocalization to endocytic compartments in phg1A knockout cells. These results indicate that TM9 proteins participate in cell adhesion by controlling the levels of adhesion proteins present at the cell surface.
Phillips, Jonathan E.; Gomer, Richard H.
2015-01-01
Neuronal ceroid lipofuscinosis (NCL) is the most common childhood-onset neurodegenerative disease. NCL is inevitably fatal, and there is currently no treatment available. Children with NCL show a progressive decline in movement, vision and mental abilities, and an accumulation of autofluorescent deposits in neurons and other cell types. Late-infantile NCL is caused by mutations in the lysosomal protease tripeptidyl peptidase 1 (TPP1). TPP1 cleaves tripeptides from the N-terminus of proteins in vitro, but little is known about the physiological function of TPP1. TPP1 shows wide conservation in vertebrates but it is not found in Drosophila, Caenorhabditis elegans or Saccharomyces cerevisiae. Here, we characterize ddTpp1, a TPP1 ortholog present in the social amoeba Dictyostelium discoideum. Lysates from cells lacking ddTpp1 show a reduced but not abolished ability to cleave a TPP1 substrate, suggesting that other Dictyostelium enzymes can perform this cleavage. ddTpp1 and human TPP1 localize to the lysosome in Dictyostelium, indicating conserved function and trafficking. Cells that lack ddTpp1 show precocious multicellular development and a reduced ability to form spores during development. When cultured in autophagy-stimulating conditions, cells lacking ddTpp1 rapidly decrease in size and are less viable than wild-type cells, suggesting that one function of ddTpp1 could be to limit autophagy. Cells that lack ddTpp1 exhibit strongly impaired development in the presence of the lysosome-perturbing drug chloroquine, and this phenotype can be suppressed through a secondary mutation in the gene that we name suppressor of tpp1− A (stpA), which encodes a protein with some similarity to mammalian oxysterol-binding proteins (OSBPs). Taken together, these results suggest that targeting specific proteins could be a viable way to suppress the effects of loss of TPP1 function. PMID:25540127
Self-organized, near-critical behavior during aggregation in Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
de Palo, Giovanna; Yi, Darvin; Gregor, Thomas; Endres, Robert
During starvation, the social amoeba Dictyostelium discoideum aggregates artfully via pattern formation into a multicellular slug and finally spores. The aggregation process is mediated by the secretion and sensing of cyclic adenosine monophosphate, leading to the synchronized movement of cells. The whole process is a remarkable example of collective behavior, spontaneously emerging from single-cell chemotaxis. Despite this phenomenon being broadly studied, a precise characterization of the transition from single cells to multicellularity has been elusive. Here, using fluorescence imaging data of thousands of cells, we investigate the role of cell shape in aggregation, demonstrating remarkable transitions in cell behavior. To better understand their functional role, we analyze cell-cell correlations and provide evidence for self-organization at the onset of aggregation (as opposed to leader cells), with features of criticality in this finite system. To capture the mechanism of self-organization, we extend a detailed single-cell model of D.discoideum chemotaxis by adding cell-cell communication. We then use these results to extract a minimal set of rules leading to aggregation in the population model. If universal, similar rules may explain other types of collective cell behavior.
Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.
Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M
1996-01-01
The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645
Shimada, Nao; Maruo, Toshinari; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi
2005-02-01
Dd-STATa, a Dictyostelium homolog of the metazoan STAT (signal transducers and activators of transcription) proteins, is necessary in the slug for correct entry into culmination. Dd-STATa-null mutant fails to culminate and its phenotype correlates with the loss of a funnel-shaped core region, the pstAB core region, which expresses both the ecmA and ecmB genes. To understand how the differentiation of pstAB core cells is regulated, we identified an EST that is expressed in the core cells of normal slugs but down-regulated in the Dd-STATa-null mutant. This EST, SSK348, encodes a close homolog of the Dictyostelium acetyl-CoA synthetase (ACS). A promoter fragment of the cognate gene, aslA (acetyl-CoA synthetase-like A), was fused to a lacZ reporter and the expression pattern determined. As expected from the behavior of the endogenous aslA gene, the aslA::lacZ fusion gene is not expressed in Dd-STATa-null slugs. In parental cells, the aslA promoter is first activated in the funnel-shaped core cells located at the slug anterior, the "pstAB core." During culmination, the pstAB core cells move down, through the prespore cells, to form the inner part of the basal disc. As the spore mass climbs the stalk, the aslA gene comes to be expressed in cells of the upper and lower cups, structures that cradle the spore head. Deletion and point mutation analyses of the promoter identified an AT-rich sequence that is necessary for expression in the pstAB core. This acts in combination with repressor regions that prevent ectopic aslA expression in the pre-stalk regions of slugs and the stalks of culminants. Thus, this study confirms that Dd-STATa is necessary for the differentiation of pstAB core cells, by showing that it is needed for the activation of the aslA gene. It also identifies aslA promoter elements that are likely to be regulated, directly or indirectly, by Dd-STATa.
Isolation of Latex Bead Phagosomes from Dictyostelium for in vitro Functional Assays.
D'Souza, Ashwin; Sanghavi, Paulomi; Rai, Ashim; Pathak, Divya; Mallik, Roop
2016-12-05
We describe a protocol to purify latex bead phagosomes (LBPs) from Dictyostelium cells. These can be later used for various in vitro functional assays. For instance, we use these LBPs to understand the microtubule motor-driven transport on in vitro polymerized microtubules. Phagosomes are allowed to mature for defined periods inside cells before extraction for in vitro motility. These assays allow us to probe how lipids on the phagosome membrane recruit and organize motors, and also measure the motion and force generation resulting from underlying lipid-motor interactions. This provides a unique opportunity to interrogate native-like organelles using biophysical and biochemical assays, and understand the role of motor proteins in phagosome maturation and pathogen clearance.
Ginsburg, G T; Kimmel, A R
1997-08-15
Early during Dictyostelium development a fundamental cell-fate decision establishes the anteroposterior (prestalk/prespore) axis. Signaling via the 7-transmembrane cAMP receptor CAR4 is essential for creating and maintaining a normal pattern; car4-null alleles have decreased levels of prestalk-specific mRNAs but enhanced expression of prespore genes. car4- cells produce all of the signals required for prestalk differentiation but lack an extracellular factor necessary for prespore differentiation of wild-type cells. This secreted factor decreases the sensitivity of prespore cells to inhibition by the prestalk morphogen DIF-1. At the cell autonomous level, CAR4 is linked to intracellular circuits that activate prestalk but inhibit prespore differentiation. The autonomous action of CAR4 is antagonistic to the positive intracellular signals mediated by another cAMP receptor, CAR1 and/or CAR3. Additional data indicate that these CAR-mediated pathways converge at the serine/threonine protein kinase GSK3, suggesting that the anterior (prestalk)/posterior (prespore) axis of Dictyostelium is regulated by an ancient mechanism that is shared by the Wnt/Fz circuits for dorsoventral patterning during early Xenopus development and establishing Drosophila segment polarity.
Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J
2017-04-01
Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.
The genome of the social amoeba Dictyostelium discoideum
Eichinger, L.; Pachebat, J.A.; Glöckner, G.; Rajandream, M.-A.; Sucgang, R.; Berriman, M.; Song, J.; Olsen, R.; Szafranski, K.; Xu, Q.; Tunggal, B.; Kummerfeld, S.; Madera, M.; Konfortov, B. A.; Rivero, F.; Bankier, A. T.; Lehmann, R.; Hamlin, N.; Davies, R.; Gaudet, P.; Fey, P.; Pilcher, K.; Chen, G.; Saunders, D.; Sodergren, E.; Davis, P.; Kerhornou, A.; Nie, X.; Hall, N.; Anjard, C.; Hemphill, L.; Bason, N.; Farbrother, P.; Desany, B.; Just, E.; Morio, T.; Rost, R.; Churcher, C.; Cooper, J.; Haydock, S.; van Driessche, N.; Cronin, A.; Goodhead, I.; Muzny, D.; Mourier, T.; Pain, A.; Lu, M.; Harper, D.; Lindsay, R.; Hauser, H.; James, K.; Quiles, M.; Babu, M. Madan; Saito, T.; Buchrieser, C.; Wardroper, A.; Felder, M.; Thangavelu, M.; Johnson, D.; Knights, A.; Loulseged, H.; Mungall, K.; Oliver, K.; Price, C.; Quail, M.A.; Urushihara, H.; Hernandez, J.; Rabbinowitsch, E.; Steffen, D.; Sanders, M.; Ma, J.; Kohara, Y.; Sharp, S.; Simmonds, M.; Spiegler, S.; Tivey, A.; Sugano, S.; White, B.; Walker, D.; Woodward, J.; Winckler, T.; Tanaka, Y.; Shaulsky, G.; Schleicher, M.; Weinstock, G.; Rosenthal, A.; Cox, E.C.; Chisholm, R. L.; Gibbs, R.; Loomis, W. F.; Platzer, M.; Kay, R. R.; Williams, J.; Dear, P. H.; Noegel, A. A.; Barrell, B.; Kuspa, A.
2005-01-01
The social amoebae are exceptional in their ability to alternate between unicellular and multicellular forms. Here we describe the genome of the best-studied member of this group, Dictyostelium discoideum. The gene-dense chromosomes encode ~12,500 predicted proteins, a high proportion of which have long repetitive amino acid tracts. There are many genes for polyketide synthases and ABC transporters, suggesting an extensive secondary metabolism for producing and exporting small molecules. The genome is rich in complex repeats, one class of which is clustered and may serve as centromeres. Partial copies of the extrachromosomal rDNA element are found at the ends of each chromosome, suggesting a novel telomere structure and the use of a common mechanism to maintain both the rDNA and chromosomal termini. A proteome-based phylogeny shows that the amoebozoa diverged from the animal/fungal lineage after the plant/animal split, but Dictyostelium appears to have retained more of the diversity of the ancestral genome than either of these two groups. PMID:15875012
Huber, Robert J.; Myre, Michael A.; Cotman, Susan L.
2017-01-01
ABSTRACT Neuronal ceroid lipofuscinosis (NCL), also known as Batten disease, refers to a group of severe neurodegenerative disorders that primarily affect children. The most common subtype of the disease is caused by loss-of-function mutations in CLN3, which is conserved across model species from yeast to human. The precise function of the CLN3 protein is not known, which has made targeted therapy development challenging. In the social amoeba Dictyostelium discoideum, loss of Cln3 causes aberrant mid-to-late stage multicellular development. In this study, we show that Cln3-deficiency causes aberrant adhesion and aggregation during the early stages of Dictyostelium development. cln3− cells form ∼30% more multicellular aggregates that are comparatively smaller than those formed by wild-type cells. Loss of Cln3 delays aggregation, but has no significant effect on cell speed or cAMP-mediated chemotaxis. The aberrant aggregation of cln3− cells cannot be corrected by manually pulsing cells with cAMP. Moreover, there are no significant differences between wild-type and cln3− cells in the expression of genes linked to cAMP chemotaxis (e.g., adenylyl cyclase, acaA; the cAMP receptor, carA; cAMP phosphodiesterase, pdsA; g-protein α 9 subunit, gpaI). However, during this time in development, cln3− cells show reduced cell-substrate and cell-cell adhesion, which correlate with changes in the levels of the cell adhesion proteins CadA and CsaA. Specifically, loss of Cln3 decreases the intracellular level of CsaA and increases the amount of soluble CadA in conditioned media. Together, these results suggest that the aberrant aggregation of cln3− cells is due to reduced adhesion during the early stages of development. Revealing the molecular basis underlying this phenotype may provide fresh new insight into CLN3 function. PMID:27669405
Kowal, Anthony S; Chisholm, Rex L
2011-05-01
Previous work from our laboratory showed that the Dictyostelium discoideum SadA protein plays a central role in cell-substrate adhesion. SadA null cells exhibit a loss of adhesion, a disrupted actin cytoskeleton, and a cytokinesis defect. How SadA mediates these phenotypes is unknown. This work addresses the mechanism of SadA function, demonstrating an important role for the C-terminal cytoplasmic tail in SadA function. We found that a SadA tailless mutant was unable to rescue the sadA adhesion deficiency, and overexpression of the SadA tail domain reduced adhesion in wild-type cells. We also show that SadA is closely associated with the actin cytoskeleton. Mutagenesis studies suggested that four serine residues in the tail, S924/S925 and S940/S941, may regulate association of SadA with the actin cytoskeleton. Glutathione S-transferase pull-down assays identified at least one likely interaction partner of the SadA tail, cortexillin I, a known actin bundling protein. Thus, our data demonstrate an important role for the carboxy-terminal cytoplasmic tail in SadA function and strongly suggest that a phosphorylation event in this tail regulates an interaction with cortexillin I. Based on our data, we propose a model for the function of SadA.
Optimization and validation of FePro cell labeling method.
Janic, Branislava; Rad, Ali M; Jordan, Elaine K; Iskander, A S M; Ali, Md M; Varma, N Ravi S; Frank, Joseph A; Arbab, Ali S
2009-06-11
Current method to magnetically label cells using ferumoxides (Fe)-protamine (Pro) sulfate (FePro) is based on generating FePro complexes in a serum free media that are then incubated overnight with cells for the efficient labeling. However, this labeling technique requires long (>12-16 hours) incubation time and uses relatively high dose of Pro (5-6 microg/ml) that makes large extracellular FePro complexes. These complexes can be difficult to clean with simple cell washes and may create low signal intensity on T2* weighted MRI that is not desirable. The purpose of this study was to revise the current labeling method by using low dose of Pro and adding Fe and Pro directly to the cells before generating any FePro complexes. Human tumor glioma (U251) and human monocytic leukemia cell (THP-1) lines were used as model systems for attached and suspension cell types, respectively and dose dependent (Fe 25 to 100 microg/ml and Pro 0.75 to 3 microg/ml) and time dependent (2 to 48 h) labeling experiments were performed. Labeling efficiency and cell viability of these cells were assessed. Prussian blue staining revealed that more than 95% of cells were labeled. Intracellular iron concentration in U251 cells reached approximately 30-35 pg-iron/cell at 24 h when labeled with 100 microg/ml of Fe and 3 microg/ml of Pro. However, comparable labeling was observed after 4 h across the described FePro concentrations. Similarly, THP-1 cells achieved approximately 10 pg-iron/cell at 48 h when labeled with 100 microg/ml of Fe and 3 microg/ml of Pro. Again, comparable labeling was observed after 4 h for the described FePro concentrations. FePro labeling did not significantly affect cell viability. There was almost no extracellular FePro complexes observed after simple cell washes. To validate and to determine the effectiveness of the revised technique, human T-cells, human hematopoietic stem cells (hHSC), human bone marrow stromal cells (hMSC) and mouse neuronal stem cells (mNSC C17
Ma, H; Gamper, M; Parent, C; Firtel, R A
1997-01-01
We have identified a MAP kinase kinase (DdMEK1) that is required for proper aggregation in Dictyostelium. Null mutations produce extremely small aggregate sizes, resulting in the formation of slugs and terminal fruiting bodies that are significantly smaller than those of wild-type cells. Time-lapse video microscopy and in vitro assays indicate that the cells are able to produce cAMP waves that move through the aggregation domains. However, these cells are unable to undergo chemotaxis properly during aggregation in response to the chemoattractant cAMP or activate guanylyl cyclase, a known regulator of chemotaxis in Dictyostelium. The activation of guanylyl cyclase in response to osmotic stress is, however, normal. Expression of putative constitutively active forms of DdMEK1 in a ddmek1 null background is capable, at least partially, of complementing the small aggregate size defect and the ability to activate guanylyl cyclase. However, this does not result in constitutive activation of guanylyl cyclase, suggesting that DdMEK1 activity is necessary, but not sufficient, for cAMP activation of guanylyl cyclase. Analysis of a temperature-sensitive DdMEK1 mutant suggests that DdMEK1 activity is required throughout aggregation at the time of guanylyl cyclase activation, but is not essential for proper morphogenesis during the later multicellular stages. The activation of the MAP kinase ERK2, which is essential for chemoattractant activation of adenylyl cyclase, is not affected in ddmek1 null strains, indicating that DdMEK1 does not regulate ERK2 and suggesting that at least two independent MAP kinase cascades control aggregation in Dictyostelium. PMID:9250676
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1986-01-05
The N-linked oligosaccharides found on the lysosomal enzymes from Dictyostelium discoideum are highly sulfated and contain methylphosphomannosyl residues. Here the authors report studies done on the structure of N-linked oligosaccharides found on proteins secreted during growth, a major portion of which are lysosomal enzymes. Cells were metabolically labeled with (2-/sup 3/H)Man and /sup 35/SO/sub 4/ and a portion of the oligosaccharides were released by a sequential digestion with endoglycosidase H followed by endoglycosidase/peptide N-glycosidase F preparations. The oligosaccharides were separated by anion exchange high performance liquid chromatography into fractions containing from one up to six negative charges. Some of themore » oligosaccharides contained only sulfate esters or phosphodiesters, but most contained both. Less than 2% of the oligosaccharides contained a phosphomonoester or an acid-sensitive phosphodiester typical of the mammalian lysosomal enzymes. A combination of acid and base hydrolysis suggested that most of the sulfate esters were linked to primary hydroxyl groups. The presence of Man-6-SO/sub 4/ was demonstrated by the appearance of 3,6-anhydromannose in acid hydrolysates of base-treated, reduced oligosaccharides.« less
Katayama, Takahiro; Yasukawa, Hiro
2008-01-01
The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.
Dictyostelium RasG Is Required for Normal Motility and Cytokinesis, But Not Growth
Tuxworth, Richard I.; Cheetham, Janet L.; Machesky, Laura M.; Spiegelmann, George B.; Weeks, Gerald; Insall, Robert H.
1997-01-01
RasG is the most abundant Ras protein in growing Dictyostelium cells and the closest relative of mammalian Ras proteins. We have generated null mutants in which expression of RasG is completely abolished. Unexpectedly, RasG − cells are able to grow at nearly wild-type rates. However, they exhibit defective cell movement and a wide range of defects in the control of the actin cytoskeleton, including a loss of cell polarity, absence of normal lamellipodia, formation of unusual small, punctate polymerized actin structures, and a large number of abnormally long filopodia. Despite their lack of polarity and abnormal cytoskeleton, mutant cells perform normal chemotaxis. However, rasG − cells are unable to perform normal cytokinesis, becoming multinucleate when grown in suspension culture. Taken together, these data suggest a principal role for RasG in coordination of cell movement and control of the cytoskeleton. PMID:9245789
Pattern formation in Dictyostelium discoideum aggregates in confined microenvironments
NASA Astrophysics Data System (ADS)
Hallou, Adrien; Hersen, Pascal; di Meglio, Jean-Marc; Kabla, Alexandre
Dictyostelium Discoideum (Dd) is often viewed as a model system to study the complex collective cell behaviours which shape an embryo. Under starvation, Dd cells form multicellular aggregates which soon elongate, starting to display an anterior-posterior axis by differentiating into two distinct cell populations; prestalk (front) and prespore (rear) cells zones. Different models, either based on positional information or on differentiation followed up by cell sorting, have been proposed to explain the origin and the regulation of this spatial pattern.To decipher between the proposed hypotheses, we have developed am experimental platform where aggregates, made of genetically engineered Dd cells to express fluorescent reporters of cell differentiation in either prestalk or prespore cells, are allowed to develop in 20 to 400 μm wide hydrogel channels. Such a setup allows us to both mimic Dd confined natural soil environment and to follow the patterning dynamics using time-lapse microscopy. Tracking cell lineage commitments and positions in space and time, we demonstrate that Dd cells differentiate first into prestalk and prespore cells prior to sorting into an organized spatial pattern on the basis of collective motions based on differential motility and adhesion mechanisms. A. Hallou would like to thank the University of Cambridge for the Award of an ``Oliver Gatty Studentship in Biophysical and Colloid Science''.
Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi
2009-02-01
Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.
How actin binds and assembles onto plasma membranes from Dictyostelium discoideum
1988-01-01
We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099
Labeling of lectin receptors during the cell cycle.
Garrido, J
1976-12-01
Labeling of lectin receptors during the cell cycle. (Localizabión de receptores para lectinas durante el ciclo celular). Arch. Biol. Med. Exper. 10: 100-104, 1976. The topographic distribution of specific cell surface receptors for concanavalin A and wheat germ agglutinin was studied by ultrastructural labeling in the course of the cell cycle. C12TSV5 cells were synchronized by double thymidine block or mechanical selection (shakeoff). They were labeled by means of lectin-peroxidase techniques while in G1 S, G2 and M phases of the cycle. The results obtained were similar for both lectins employed. Interphase cells (G1 S, G2) present a stlihtly discontinous labeling pattern that is similar to the one observed on unsynchronized cells of the same line. Cells in mitosis, on the contrary, present a highly discontinous distribution of reaction product. This pattern disappears after the cells enters G1 and is not present on mitotic cells fixed in aldehyde prior to labeling.
CyrA, a matricellular protein that modulates cell motility in Dictyostelium discoideum.
Huber, Robert J; Suarez, Andres; O'Day, Danton H
2012-05-01
CyrA, an extracellular matrix (slime sheath), calmodulin (CaM)-binding protein in Dictyostelium discoideum, possesses four tandem EGF-like repeats in its C-terminus and is proteolytically cleaved during asexual development. A previous study reported the expression and localization of CyrA cleavage products CyrA-C45 and CyrA-C40. In this study, an N-terminal antibody was produced that detected the full-length 63kDa protein (CyrA-C63). Western blot analyses showed that the intracellular expression of CyrA-C63 peaked between 12 and 16h of development, consistent with the time that cells are developing into a motile, multicellular slug. CyrA immunolocalization and CyrA-GFP showed that the protein localized to the endoplasmic reticulum, particularly its perinuclear component. CyrA-C63 secretion began shortly after the onset of starvation peaking between 8 and 16h of development. A pharmacological analysis showed that CyrA-C63 secretion was dependent on intracellular Ca(2+) release and active CaM, PI3K, and PLA2. CyrA-C63 bound to CaM both intra- and extracellularly and both proteins were detected in the slime sheath deposited by migrating slugs. In keeping with its purported function, CyrA-GFP over-expression enhanced cAMP-mediated chemotaxis and CyrA-C45 was detected in vinculin B (VinB)-GFP immunoprecipitates, thus providing a link between the increase in chemotaxis and a specific cytoskeletal component. Finally, DdEGFL1-FITC was detected on the membranes of cells capped with concanavalin A suggesting that a receptor exists for this peptide sequence. Together with previous studies, the data presented here suggests that CyrA is a bona fide matricellular protein in D. discoideum. Copyright © 2012 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.
Origin and evolution of circular waves and spirals in Dictyostelium discoideum territories.
Pálsson, E; Cox, E C
1996-02-06
Randomly distributed Dictyostelium discoideum cells form cooperative territories by signaling to each other with cAMP. Cells initiate the process by sending out pulsatile signals, which propagate as waves. With time, circular and spiral patterns form. We show that by adding spatial and temporal noise to the levels of an important regulator of external cAMP levels, the cAMP phosphodiesterase inhibitor, we can explain the natural progression of the system from randomly firing cells to circular waves whose symmetries break to form double- and single- or multi-armed spirals. When phosphodiesterase inhibitor is increased with time, mimicking experimental data, the wavelength of the spirals shortens, and a proportion of them evolve into pairs of connected spirals. We compare these results to recent experiments, finding that the temporal and spatial correspondence between experiment and model is very close.
Carbon "Quantum" Dots for Fluorescence Labeling of Cells.
Liu, Jia-Hui; Cao, Li; LeCroy, Gregory E; Wang, Ping; Meziani, Mohammed J; Dong, Yiyang; Liu, Yuanfang; Luo, Pengju G; Sun, Ya-Ping
2015-09-02
The specifically synthesized and selected carbon dots of relatively high fluorescence quantum yields were evaluated in their fluorescence labeling of cells. For the cancer cell lines, the cellular uptake of the carbon dots was generally efficient, resulting in the labeling of the cells with bright fluorescence emissions for both one- and two-photon excitations from predominantly the cell membrane and cytoplasm. In the exploration on labeling the live stem cells, the cellular uptake of the carbon dots was relatively less efficient, though fluorescence emissions could still be adequately detected in the labeled cells, with the emissions again predominantly from the cell membrane and cytoplasm. This combined with the observed more efficient internalization of the same carbon dots by the fixed stem cells might suggest some significant selectivity of the stem cells toward surface functionalities of the carbon dots. The needs and possible strategies for more systematic and comparative studies on the fluorescence labeling of different cells, including especially live stem cells, by carbon dots as a new class of brightly fluorescent probes are discussed.
Kubohara, Yuzuru; Komachi, Mayumi; Homma, Yoshimi; Kikuchi, Haruhisa; Oshima, Yoshiteru
2015-08-07
Osteosarcoma is a common metastatic bone cancer that predominantly develops in children and adolescents. Metastatic osteosarcoma remains associated with a poor prognosis; therefore, more effective anti-metastatic drugs are needed. Differentiation-inducing factor-1 (DIF-1), -2, and -3 are novel lead anti-tumor agents that were originally isolated from the cellular slime mold Dictyostelium discoideum. Here we investigated the effects of a panel of DIF derivatives on lysophosphatidic acid (LPA)-induced migration of mouse osteosarcoma LM8 cells by using a Boyden chamber assay. Some DIF derivatives such as Br-DIF-1, DIF-3(+2), and Bu-DIF-3 (5-20 μM) dose-dependently suppressed LPA-induced cell migration with associated IC50 values of 5.5, 4.6, and 4.2 μM, respectively. On the other hand, the IC50 values of Br-DIF-1, DIF-3(+2), and Bu-DIF-3 versus cell proliferation were 18.5, 7.2, and 2.0 μM, respectively, in LM8 cells, and >20, 14.8, and 4.3 μM, respectively, in mouse 3T3-L1 fibroblasts (non-transformed). Together, our results demonstrate that Br-DIF-1 in particular may be a valuable tool for the analysis of cancer cell migration, and that DIF derivatives such as DIF-3(+2) and Bu-DIF-3 are promising lead anti-tumor agents for the development of therapies that suppress osteosarcoma cell proliferation, migration, and metastasis. Copyright © 2015 Elsevier Inc. All rights reserved.
Coukell, Barrie; Li, Yi; Moniakis, John; Cameron, Anne
2004-01-01
Changes in free intracellular Ca2+ are thought to regulate several major processes during Dictyostelium development, including cell aggregation and cell type-specific gene expression, but the mechanisms involved are unclear. To learn more about Ca2+ signaling and Ca2+ homeostasis in this organism, we used suppression subtractive hybridization to identify genes up-regulated by high extracellular Ca2+. Unexpectedly, many of the genes identified belong to a novel gene family (termed cup) with seven members. In vegetative cells, the cup genes were up-regulated by high Ca2+ but not by other ions or by heat, oxidative, or osmotic stress. cup induction by Ca2+ was blocked completely by inhibitors of calcineurin and protein synthesis. In developing cells, cup expression was high during aggregation and late development but low during the slug stage. This pattern correlates closely with reported levels of free intracellular Ca2+ during development. The cup gene products are highly homologous, acidic proteins possessing putative ricin domains. BLAST searches failed to reveal homologs in other organisms, but Western analyses suggested that Cup-like proteins might exist in certain other cellular slime mold species. Localization experiments indicated that Cup proteins are primarily cytoplasmic but become cell membrane-associated during Ca2+ stress and cell aggregation. When cup expression was down-regulated by antisense RNA, the cells failed to aggregate. However, this developmental block was overcome by partially up-regulating cup expression. Together, these results suggest that the Cup proteins in Dictyostelium might play an important role in stabilizing and/or regulating the cell membrane during Ca2+ stress and/or certain stages of development. PMID:14871937
Lauzeral, J; Halloy, J; Goldbeter, A
1997-08-19
Whereas it is relatively easy to account for the formation of concentric (target) waves of cAMP in the course of Dictyostelium discoideum aggregation after starvation, the origin of spiral waves remains obscure. We investigate a physiologically plausible mechanism for the spontaneous formation of spiral waves of cAMP in D. discoideum. The scenario relies on the developmental path associated with the continuous changes in the activity of enzymes such as adenylate cyclase and phosphodiesterase observed during the hours that follow starvation. These changes bring the cells successively from a nonexcitable state to an excitable state in which they relay suprathreshold cAMP pulses, and then to autonomous oscillations of cAMP, before the system returns to an excitable state. By analyzing a model for cAMP signaling based on receptor desensitization, we show that the desynchronization of cells on this developmental path triggers the formation of fully developed spirals of cAMP. Developmental paths that do not correspond to the sequence of dynamic transitions no relay-relay-oscillations-relay are less able or fail to give rise to the formation of spirals.
Green, Anita A.; Newell, Peter C.
1974-01-01
A procedure for the isolation and separation of three different subfractions of plasma membrane from the cellular slime mould Dictyostelium discoideum is described. The cells were disrupted by freeze-thawing in liquid N2 and plasma membranes were purified by equilibrium centrifugation in a sucrose gradient. The cell surface was labelled with radioactive iodide by using the lactoperoxidase iodination method. Alkaline phosphatase was identified as a plasma-membrane marker by its co-distribution with [125I]iodide. 5′-Nucleotidase, which has been widely described as a plasma-membrane marker enzyme in mammalian tissues, was not localized to any marked extent in D. discoideum plasma membrane. The isolated plasma membranes showed a 24-fold enrichment of alkaline phosphatase specific activity relative to the homogenate and a yield of 50% of the total plasma membranes. Determination of succinate dehydrogenase and NADPH–cytochrome c reductase activities indicated that the preparation contained 2% of the total mitochondria and 3% of the endoplasmic reticulum. When the plasma-membrane preparation was further disrupted in a tight-fitting homogenizer, three plasma-membrane subfractions of different densities were obtained by isopycnic centrifugation. The enrichment of alkaline phosphatase was greatest in the subfraction with the lowest density. This fraction was enriched 36-fold relative to the homogenate and contained 19% of the total alkaline phosphatase activity but only 0.08% of the succinate dehydrogenase activity and 0.34% of the NADPH–cytochrome c reductase activity. Electron microscopy of this fraction showed it to consist of smooth membrane vesicles with no recognizable contaminants. ImagesPLATE 1 PMID:4156170
2013-01-01
This tutorial describes a method of controlled cell labeling with citrate-coated ultra small superparamagnetic iron oxide nanoparticles. This method may provide basically all kinds of cells with sufficient magnetization to allow cell detection by high-resolution magnetic resonance imaging (MRI) and to enable potential magnetic manipulation. In order to efficiently exploit labeled cells, quantify the magnetic load and deliver or follow-up magnetic cells, we herein describe the main requirements that should be applied during the labeling procedure. Moreover we present some recommendations for cell detection and quantification by MRI and detail magnetic guiding on some real-case studies in vitro and in vivo. PMID:24564857
Chen, Gong; Wang, Jun; Xu, Xiaoqun; Wu, Xiangfu; Piao, Ruihan; Siu, Chi-Hung
2013-06-01
Cell-cell adhesion plays crucial roles in cell differentiation and morphogenesis during development of Dictyostelium discoideum. The heterophilic adhesion protein TgrC1 (Tgr is transmembrane, IPT, IG, E-set, repeat protein) is expressed during cell aggregation, and disruption of the tgrC1 gene results in the arrest of development at the loose aggregate stage. We have used far-Western blotting coupled with MS to identify TgrB1 as the heterophilic binding partner of TgrC1. Co-immunoprecipitation and pull-down studies showed that TgrB1 and TgrC1 are capable of binding with each other in solution. TgrB1 and TgrC1 are encoded by a pair of adjacent genes which share a common promoter. Both TgrB1 and TgrC1 are type I transmembrane proteins, which contain three extracellular IPT/TIG (immunoglobulin, plexin, transcription factor-like/transcription factor immunoglobulin) domains. Antibodies raised against TgrB1 inhibit cell reassociation at the post-aggregation stage of development and block fruiting body formation. Ectopic expression of TgrB1 and TgrC1 driven by the actin15 promoter leads to heterotypic cell aggregation of vegetative cells. Using recombinant proteins that cover different portions of TgrB1 and TgrC1 in binding assays, we have mapped the cell-binding regions in these two proteins to Lys(537)-Ala(783) in TgrB1 and Ile(336)-Val(360) in TgrC1, corresponding to their respective TIG3 and TIG2 domain.
Maeda, Yasuo
2015-02-10
Apoptosis (programmed cell death) is regarded as ultimate differentiation of the cell. We have recently demonstrated that a targeted delivery of Dd-MRP4 (Dictyostelium mitochondrial ribosomal protein S4) suppresses specifically the proliferation of the human cancer cells, by inducing their apoptotic cell death (Chida et al., 2014, doi:10.1186/1475-2867-14-56). This amazing fact was discovered, simply based on the finding that Dd-MRP4 expression is absolutely required for transition of Dictyostelium cells from growth to differentiation (Chida et al., 2008, doi:10.1186/1471-2156-9-25; Maeda et al., 2013, doi:10.3390/biom3040943). Dd-MRP4 protein has quite unique structural characters, in that it is highly basic (pI: about 11.5) and interestingly has several nuclear-localization signals within the molecule. In this review, we introduce briefly the efficacy of several apoptosis-inducing substances reported thus far for cancer therapy, and speculate the possible mechanisms, by which apoptosis is specifically induced by Dd-MRP4, on the basis of its structural uniqueness. We also discuss several issues to be solved for the medical application of ectopically expressed Dd-MRP4 in human cancer cells.
Quantification of Superparamagnetic Iron Oxide (SPIO)-labeled Cells Using MRI
Rad, Ali M; Arbab, Ali S; Iskander, ASM; Jiang, Quan; Soltanian-Zadeh, Hamid
2015-01-01
Purpose To show the feasibility of using magnetic resonance imaging (MRI) to quantify superparamagnetic iron oxide (SPIO)-labeled cells. Materials and Methods Lymphocytes and 9L rat gliosarcoma cells were labeled with Ferumoxides-Protamine Sulfate complex (FE-PRO). Cells were labeled efficiently (more than 95%) and iron concentration inside each cell was measured by spectrophotometry (4.77-30.21 picograms). Phantom tubes containing different number of labeled or unlabeled cells as well as different concentrations of FE-PRO were made. In addition, labeled and unlabeled cells were injected into fresh and fixed rat brains. Results Cellular viability and proliferation of labeled and unlabeled cells were shown to be similar. T2-weighted images were acquired using 7 T and 3 T MRI systems and R2 maps of the tubes containing cells, free FE-PRO, and brains were made. There was a strong linear correlation between R2 values and labeled cell numbers but the regression lines were different for the lymphocytes and gliosarcoma cells. Similarly, there was strong correlation between R2 values and free iron. However, free iron had higher R2 values than the labeled cells for the same concentration of iron. Conclusion Our data indicated that in vivo quantification of labeled cells can be done by careful consideration of different factors and specific control groups. PMID:17623892
Cell-specific Labeling Enzymes for Analysis of Cell–Cell Communication in Continuous Co-culture*
Tape, Christopher J.; Norrie, Ida C.; Worboys, Jonathan D.; Lim, Lindsay; Lauffenburger, Douglas A.; Jørgensen, Claus
2014-01-01
We report the orthologous screening, engineering, and optimization of amino acid conversion enzymes for cell-specific proteomic labeling. Intracellular endoplasmic-reticulum-anchored Mycobacterium tuberculosis diaminopimelate decarboxylase (DDCM.tub-KDEL) confers cell-specific meso-2,6-diaminopimelate-dependent proliferation to multiple eukaryotic cell types. Optimized lysine racemase (LyrM37-KDEL) supports D-lysine specific proliferation and efficient cell-specific isotopic labeling. When ectopically expressed in discrete cell types, these enzymes confer 90% cell-specific isotopic labeling efficiency after 10 days of co-culture. Moreover, DDCM.tub-KDEL and LyrM37-KDEL facilitate equally high cell-specific labeling fidelity without daily media exchange. Consequently, the reported novel enzyme pairing can be used to study cell-specific signaling in uninterrupted, continuous co-cultures. Demonstrating the importance of increased labeling stability for addressing novel biological questions, we compare the cell-specific phosphoproteome of fibroblasts in direct co-culture with epithelial tumor cells in both interrupted (daily media exchange) and continuous (no media exchange) co-cultures. This analysis identified multiple cell-specific phosphorylation sites specifically regulated in the continuous co-culture. Given their applicability to multiple cell types, continuous co-culture labeling fidelity, and suitability for long-term cell–cell phospho-signaling experiments, we propose DDCM.tub-KDEL and LyrM37-KDEL as excellent enzymes for cell-specific labeling with amino acid precursors. PMID:24820872
Stajdohar, Miha; Rosengarten, Rafael D; Kokosar, Janez; Jeran, Luka; Blenkus, Domen; Shaulsky, Gad; Zupan, Blaz
2017-06-02
Dictyostelium discoideum, a soil-dwelling social amoeba, is a model for the study of numerous biological processes. Research in the field has benefited mightily from the adoption of next-generation sequencing for genomics and transcriptomics. Dictyostelium biologists now face the widespread challenges of analyzing and exploring high dimensional data sets to generate hypotheses and discovering novel insights. We present dictyExpress (2.0), a web application designed for exploratory analysis of gene expression data, as well as data from related experiments such as Chromatin Immunoprecipitation sequencing (ChIP-Seq). The application features visualization modules that include time course expression profiles, clustering, gene ontology enrichment analysis, differential expression analysis and comparison of experiments. All visualizations are interactive and interconnected, such that the selection of genes in one module propagates instantly to visualizations in other modules. dictyExpress currently stores the data from over 800 Dictyostelium experiments and is embedded within a general-purpose software framework for management of next-generation sequencing data. dictyExpress allows users to explore their data in a broader context by reciprocal linking with dictyBase-a repository of Dictyostelium genomic data. In addition, we introduce a companion application called GenBoard, an intuitive graphic user interface for data management and bioinformatics analysis. dictyExpress and GenBoard enable broad adoption of next generation sequencing based inquiries by the Dictyostelium research community. Labs without the means to undertake deep sequencing projects can mine the data available to the public. The entire information flow, from raw sequence data to hypothesis testing, can be accomplished in an efficient workspace. The software framework is generalizable and represents a useful approach for any research community. To encourage more wide usage, the backend is open
Stem Cell Monitoring with a Direct or Indirect Labeling Method.
Kim, Min Hwan; Lee, Yong Jin; Kang, Joo Hyun
2016-12-01
The molecular imaging techniques allow monitoring of the transplanted cells in the same individuals over time, from early localization to the survival, migration, and differentiation. Generally, there are two methods of stem cell labeling: direct and indirect labeling methods. The direct labeling method introduces a labeling agent into the cell, which is stably incorporated or attached to the cells prior to transplantation. Direct labeling of cells with radionuclides is a simple method with relatively fewer adverse events related to genetic responses. However, it can only allow short-term distribution of transplanted cells because of the decreasing imaging signal with radiodecay, according to the physical half-lives, or the signal becomes more diffuse with cell division and dispersion. The indirect labeling method is based on the expression of a reporter gene transduced into the cell before transplantation, which is then visualized upon the injection of an appropriate probe or substrate. In this review, various imaging strategies to monitor the survival and behavior change of transplanted stem cells are covered. Taking these new approaches together, the direct and indirect labeling methods may provide new insights on the roles of in vivo stem cell monitoring, from bench to bedside.
Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J
2000-12-01
The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.
Cell-selective metabolic labeling of biomolecules with bioorthogonal functionalities.
Xie, Ran; Hong, Senlian; Chen, Xing
2013-10-01
Metabolic labeling of biomolecules with bioorthogonal functionalities enables visualization, enrichment, and analysis of the biomolecules of interest in their physiological environments. This versatile strategy has found utility in probing various classes of biomolecules in a broad range of biological processes. On the other hand, metabolic labeling is nonselective with respect to cell type, which imposes limitations for studies performed in complex biological systems. Herein, we review the recent methodological developments aiming to endow metabolic labeling strategies with cell-type selectivity. The cell-selective metabolic labeling strategies have emerged from protein and glycan labeling. We envision that these strategies can be readily extended to labeling of other classes of biomolecules. Copyright © 2013 Elsevier Ltd. All rights reserved.
Rai, Amrita; Fedorov, Roman; Manstein, Dietmar J
2014-02-01
Dye-decolourizing peroxidases are haem-containing peroxidases with broad substrate specificity. Using H2O2 as an electron acceptor, they efficiently decolourize various dyes that are of industrial and environmental relevance, such as anthraquninone- and azo-based dyes. In this study, the dye-decolourizing peroxidase DdDyP from Dictyostelium discoideum was overexpressed in Escherichia coli strain Rosetta(DE3)pLysS, purified and crystallized using the vapour-diffusion method. A native crystal diffracted to 1.65 Å resolution and belonged to space group P4(1)2(1)2, with unit-cell parameters a = b = 141.03, c = 95.56 Å, α = β = γ = 90°. The asymmetric unit contains two molecules.
Design of polymeric immunomicrospheres for cell labelling and cell separation
NASA Technical Reports Server (NTRS)
Rembaum, A.; Margel, S.
1978-01-01
Synthesis of several classes of hydrophylic microspheres applied to cell labeling and cell separation is described. Five classes of cross-linked microspheres with functional groups such as carboxyl, hydroxyl, amide and/or pyridine groups were synthesized. These functional groups were used to bind covalently antibodies and other proteins to the surface of the microspheres. To optimize the derivatisation technique, polyglutaraldehyde immunomicrospheres were prepared and utilized. Specific populations of human and murine lymphocytes were labelled with microspheres synthesized by the emulsion of the ionizing radiation technique. The labelling of the cells by means of microspheres containing an iron core produced successful separation of B from T lymphocytes by means of a magnetic field.
Modelling of Dictyostelium discoideum movement in a linear gradient of chemoattractant.
Eidi, Zahra; Mohammad-Rafiee, Farshid; Khorrami, Mohammad; Gholami, Azam
2017-11-15
Chemotaxis is a ubiquitous biological phenomenon in which cells detect a spatial gradient of chemoattractant, and then move towards the source. Here we present a position-dependent advection-diffusion model that quantitatively describes the statistical features of the chemotactic motion of the social amoeba Dictyostelium discoideum in a linear gradient of cAMP (cyclic adenosine monophosphate). We fit the model to experimental trajectories that are recorded in a microfluidic setup with stationary cAMP gradients and extract the diffusion and drift coefficients in the gradient direction. Our analysis shows that for the majority of gradients, both coefficients decrease over time and become negative as the cells crawl up the gradient. The extracted model parameters also show that besides the expected drift in the direction of the chemoattractant gradient, we observe a nonlinear dependency of the corresponding variance on time, which can be explained by the model. Furthermore, the results of the model show that the non-linear term in the mean squared displacement of the cell trajectories can dominate the linear term on large time scales.
Lee, Susan; Parent, Carole A.; Insall, Robert; Firtel, Richard A.
1999-01-01
We have identified a novel Ras-interacting protein from Dictyostelium, RIP3, whose function is required for both chemotaxis and the synthesis and relay of the cyclic AMP (cAMP) chemoattractant signal. rip3 null cells are unable to aggregate and lack receptor activation of adenylyl cyclase but are able, in response to cAMP, to induce aggregation-stage, postaggregative, and cell-type-specific gene expression in suspension culture. In addition, rip3 null cells are unable to properly polarize in a cAMP gradient and chemotaxis is highly impaired. We demonstrate that cAMP stimulation of guanylyl cyclase, which is required for chemotaxis, is reduced ∼60% in rip3 null cells. This reduced activation of guanylyl cyclase may account, in part, for the defect in chemotaxis. When cells are pulsed with cAMP for 5 h to mimic the endogenous cAMP oscillations that occur in wild-type strains, the cells will form aggregates, most of which, however, arrest at the mound stage. Unlike the response seen in wild-type strains, the rip3 null cell aggregates that form under these experimental conditions are very small, which is probably due to the rip3 null cell chemotaxis defect. Many of the phenotypes of the rip3 null cell, including the inability to activate adenylyl cyclase in response to cAMP and defects in chemotaxis, are very similar to those of strains carrying a disruption of the gene encoding the putative Ras exchange factor AleA. We demonstrate that aleA null cells also exhibit a defect in cAMP-mediated activation of guanylyl cyclase similar to that of rip3 null cells. A double-knockout mutant (rip3/aleA null cells) exhibits a further reduction in receptor activation of guanylyl cyclase, and these cells display almost no cell polarization or movement in cAMP gradients. As RIP3 preferentially interacts with an activated form of the Dictyostelium Ras protein RasG, which itself is important for cell movement, we propose that RIP3 and AleA are components of a Ras-regulated pathway
Lee, S; Parent, C A; Insall, R; Firtel, R A
1999-09-01
We have identified a novel Ras-interacting protein from Dictyostelium, RIP3, whose function is required for both chemotaxis and the synthesis and relay of the cyclic AMP (cAMP) chemoattractant signal. rip3 null cells are unable to aggregate and lack receptor activation of adenylyl cyclase but are able, in response to cAMP, to induce aggregation-stage, postaggregative, and cell-type-specific gene expression in suspension culture. In addition, rip3 null cells are unable to properly polarize in a cAMP gradient and chemotaxis is highly impaired. We demonstrate that cAMP stimulation of guanylyl cyclase, which is required for chemotaxis, is reduced approximately 60% in rip3 null cells. This reduced activation of guanylyl cyclase may account, in part, for the defect in chemotaxis. When cells are pulsed with cAMP for 5 h to mimic the endogenous cAMP oscillations that occur in wild-type strains, the cells will form aggregates, most of which, however, arrest at the mound stage. Unlike the response seen in wild-type strains, the rip3 null cell aggregates that form under these experimental conditions are very small, which is probably due to the rip3 null cell chemotaxis defect. Many of the phenotypes of the rip3 null cell, including the inability to activate adenylyl cyclase in response to cAMP and defects in chemotaxis, are very similar to those of strains carrying a disruption of the gene encoding the putative Ras exchange factor AleA. We demonstrate that aleA null cells also exhibit a defect in cAMP-mediated activation of guanylyl cyclase similar to that of rip3 null cells. A double-knockout mutant (rip3/aleA null cells) exhibits a further reduction in receptor activation of guanylyl cyclase, and these cells display almost no cell polarization or movement in cAMP gradients. As RIP3 preferentially interacts with an activated form of the Dictyostelium Ras protein RasG, which itself is important for cell movement, we propose that RIP3 and AleA are components of a Ras
Sensing of substratum rigidity and directional migration by fast-crawling cells
NASA Astrophysics Data System (ADS)
Okimura, Chika; Sakumura, Yuichi; Shimabukuro, Katsuya; Iwadate, Yoshiaki
2018-05-01
Living cells sense the mechanical properties of their surrounding environment and respond accordingly. Crawling cells detect the rigidity of their substratum and migrate in certain directions. They can be classified into two categories: slow-moving and fast-moving cell types. Slow-moving cell types, such as fibroblasts, smooth muscle cells, mesenchymal stem cells, etc., move toward rigid areas on the substratum in response to a rigidity gradient. However, there is not much information on rigidity sensing in fast-moving cell types whose size is ˜10 μ m and migration velocity is ˜10 μ m /min . In this study, we used both isotropic substrata with different rigidities and an anisotropic substratum that is rigid on the x axis but soft on the y axis to demonstrate rigidity sensing by fast-moving Dictyostelium cells and neutrophil-like differentiated HL-60 cells. Dictyostelium cells exerted larger traction forces on a more rigid isotropic substratum. Dictyostelium cells and HL-60 cells migrated in the "soft" direction on the anisotropic substratum, although myosin II-null Dictyostelium cells migrated in random directions, indicating that rigidity sensing of fast-moving cell types differs from that of slow types and is induced by a myosin II-related process.
Sensing of substratum rigidity and directional migration by fast-crawling cells.
Okimura, Chika; Sakumura, Yuichi; Shimabukuro, Katsuya; Iwadate, Yoshiaki
2018-05-01
Living cells sense the mechanical properties of their surrounding environment and respond accordingly. Crawling cells detect the rigidity of their substratum and migrate in certain directions. They can be classified into two categories: slow-moving and fast-moving cell types. Slow-moving cell types, such as fibroblasts, smooth muscle cells, mesenchymal stem cells, etc., move toward rigid areas on the substratum in response to a rigidity gradient. However, there is not much information on rigidity sensing in fast-moving cell types whose size is ∼10 μm and migration velocity is ∼10 μm/min. In this study, we used both isotropic substrata with different rigidities and an anisotropic substratum that is rigid on the x axis but soft on the y axis to demonstrate rigidity sensing by fast-moving Dictyostelium cells and neutrophil-like differentiated HL-60 cells. Dictyostelium cells exerted larger traction forces on a more rigid isotropic substratum. Dictyostelium cells and HL-60 cells migrated in the "soft" direction on the anisotropic substratum, although myosin II-null Dictyostelium cells migrated in random directions, indicating that rigidity sensing of fast-moving cell types differs from that of slow types and is induced by a myosin II-related process.
Effects of a 50 Hz magnetic field on Dictyostelium discoideum (Protista).
Amaroli, Andrea; Trielli, Francesca; Bianco, Bruno; Giordano, Stefano; Moggia, Elsa; Corrado, Maria Umberta Delmonte
2006-10-01
Some studies have demonstrated that a few biological systems are affected by weak, extremely low frequency (ELF) electromagnetic fields (EMFs), lower than 10 mT. However, to date there is scanty evidence of this effect on Protists in the literature. Due to their peculiarity as single-cell eukaryotic organisms, Protists respond directly to environmental stimuli, thus appearing as very suitable experimental systems. Recently, we showed the presence of propionylcholinesterase (PrChE) activity in single-cell amoebae of Dictyostelium discoideum. This enzyme activity was assumed to be involved in cell-cell and cell-environment interactions, as its inhibition affects cell aggregation and differentiation. In this work, we have exposed single-cell amoebae of D. discoideum to an ELF-EMF of about 200 microT, 50 Hz, for 3 h or 24 h at 21 degrees C. A delay in the early phase of the differentiation was observed in 3 h exposed cells, and a significant decrease in the fission rate appeared in 24 h exposed cells. The PrChE activity was significantly lower in 3 h exposed cells than in the controls, whereas 24 h exposed cells exhibited an increase in this enzyme activity. However, such effects appeared to be transient, as the fission rate and PrChE activity values returned to the respective control values after a 24 h stay under standard conditions.
Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta
2014-03-01
Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.
Cost, Hoa N.; Noratel, Elizabeth F.; Blumberg, Daphne D.
2013-01-01
The Dictyostelium discoideum ampA gene encodes a multifunctional regulator protein that modulates cell–cell and cell–substrate adhesions and actin polymerization during growth and is necessary for correct cell type specification and patterning during development. Insertional inactivation of the ampA gene results in defects that define two distinct roles for the ampA gene during development. AmpA is necessary in a non-cell autonomous manner to prevent premature expression of a prespore gene marker. It is also necessary in a cell autonomous manner for the anterior like cells, which express the ampA gene, to migrate to the upper cup during culmination. It is also necessary to prevent excessive cell–cell agglutination when cells are developed in a submerged suspension culture. Here, we demonstrate that a supernatant source of AmpA protein, added extracellularly, can prevent the premature mis-expression of the prespore marker. Synthetic oligopeptides are used to identify the domain of the AmpA protein that is important for preventing cells from mis-expressing the prespore gene. We further demonstrate that a factor capable of inducing additional cells to express the prespore gene marker accumulates extracellularly in the absence of AmpA protein. While the secreted AmpA acts extracellularly to suppress prespore gene expression, the effects of AmpA on cell agglutination and on actin polymerization in growing cells are not due to an extracellular role of secreted AmpA protein. Rather, these effects appear to reflect a distinct cell autonomous role of the ampA gene. Finally, we show that secretion of AmpA protein is brought about by elevating the levels of expression of ampA so that the protein accumulates to an excessive level. PMID:23911723
Kowal, Anthony S.; Chisholm, Rex L.
2011-01-01
Previous work from our laboratory showed that the Dictyostelium discoideum SadA protein plays a central role in cell-substrate adhesion. SadA null cells exhibit a loss of adhesion, a disrupted actin cytoskeleton, and a cytokinesis defect. How SadA mediates these phenotypes is unknown. This work addresses the mechanism of SadA function, demonstrating an important role for the C-terminal cytoplasmic tail in SadA function. We found that a SadA tailless mutant was unable to rescue the sadA adhesion deficiency, and overexpression of the SadA tail domain reduced adhesion in wild-type cells. We also show that SadA is closely associated with the actin cytoskeleton. Mutagenesis studies suggested that four serine residues in the tail, S924/S925 and S940/S941, may regulate association of SadA with the actin cytoskeleton. Glutathione S-transferase pull-down assays identified at least one likely interaction partner of the SadA tail, cortexillin I, a known actin bundling protein. Thus, our data demonstrate an important role for the carboxy-terminal cytoplasmic tail in SadA function and strongly suggest that a phosphorylation event in this tail regulates an interaction with cortexillin I. Based on our data, we propose a model for the function of SadA. PMID:21441344
Acanthamoeba and Dictyostelium as Cellular Models for Legionella Infection
Swart, A. Leoni; Harrison, Christopher F.; Eichinger, Ludwig; Steinert, Michael; Hilbi, Hubert
2018-01-01
Environmental bacteria of the genus Legionella naturally parasitize free-living amoebae. Upon inhalation of bacteria-laden aerosols, the opportunistic pathogens grow intracellularly in alveolar macrophages and can cause a life-threatening pneumonia termed Legionnaires' disease. Intracellular replication in amoebae and macrophages takes place in a unique membrane-bound compartment, the Legionella-containing vacuole (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system, which translocates literally hundreds of “effector” proteins into host cells, where they modulate crucial cellular processes for the pathogen's benefit. The mechanism of LCV formation appears to be evolutionarily conserved, and therefore, amoebae are not only ecologically significant niches for Legionella spp., but also useful cellular models for eukaryotic phagocytes. In particular, Acanthamoeba castellanii and Dictyostelium discoideum emerged over the last years as versatile and powerful models. Using genetic, biochemical and cell biological approaches, molecular interactions between amoebae and Legionella pneumophila have recently been investigated in detail with a focus on the role of phosphoinositide lipids, small and large GTPases, autophagy components and the retromer complex, as well as on bacterial effectors targeting these host factors. PMID:29552544
The Dictyostelium discoideum RACK1 orthologue has roles in growth and development
2014-01-01
Background The receptor for activated C-kinase 1 (RACK1) is a conserved protein belonging to the WD40 repeat family of proteins. It folds into a beta propeller with seven blades which allow interactions with many proteins. Thus it can serve as a scaffolding protein and have roles in several cellular processes. Results We identified the product of the Dictyostelium discoideum gpbB gene as the Dictyostelium RACK1 homolog. The protein is mainly cytosolic but can also associate with cellular membranes. DdRACK1 binds to phosphoinositides (PIPs) in protein-lipid overlay and liposome-binding assays. The basis of this activity resides in a basic region located in the extended loop between blades 6 and 7 as revealed by mutational analysis. Similar to RACK1 proteins from other organisms DdRACK1 interacts with G protein subunits alpha, beta and gamma as shown by yeast two-hybrid, pulldown, and immunoprecipitation assays. Unlike the Saccharomyces cerevisiae and Cryptococcus neoformans RACK1 proteins it does not appear to take over Gβ function in D. discoideum as developmental and other defects were not rescued in Gβ null mutants overexpressing GFP-DdRACK1. Overexpression of GFP-tagged DdRACK1 and a mutant version (DdRACK1mut) which carried a charge-reversal mutation in the basic region in wild type cells led to changes during growth and development. Conclusion DdRACK1 interacts with heterotrimeric G proteins and can through these interactions impact on processes specifically regulated by these proteins. PMID:24930026
Snap-, CLIP- and Halo-Tag Labelling of Budding Yeast Cells
Stagge, Franziska; Mitronova, Gyuzel Y.; Belov, Vladimir N.; Wurm, Christian A.; Jakobs, Stefan
2013-01-01
Fluorescence microscopy of the localization and the spatial and temporal dynamics of specifically labelled proteins is an indispensable tool in cell biology. Besides fluorescent proteins as tags, tag-mediated labelling utilizing self-labelling proteins as the SNAP-, CLIP-, or the Halo-tag are widely used, flexible labelling systems relying on exogenously supplied fluorophores. Unfortunately, labelling of live budding yeast cells proved to be challenging with these approaches because of the limited accessibility of the cell interior to the dyes. In this study we developed a fast and reliable electroporation-based labelling protocol for living budding yeast cells expressing SNAP-, CLIP-, or Halo-tagged fusion proteins. For the Halo-tag, we demonstrate that it is crucial to use the 6′-carboxy isomers and not the 5′-carboxy isomers of important dyes to ensure cell viability. We report on a simple rule for the analysis of 1H NMR spectra to discriminate between 6′- and 5′-carboxy isomers of fluorescein and rhodamine derivatives. We demonstrate the usability of the labelling protocol by imaging yeast cells with STED super-resolution microscopy and dual colour live cell microscopy. The large number of available fluorophores for these self-labelling proteins and the simplicity of the protocol described here expands the available toolbox for the model organism Saccharomyces cerevisiae. PMID:24205303
Rivero, Francisco; Muramoto, Tetsuya; Meyer, Ann-Kathrin; Urushihara, Hideko; Uyeda, Taro QP; Kitayama, Chikako
2005-01-01
Background Formins are multidomain proteins defined by a conserved FH2 (formin homology 2) domain with actin nucleation activity preceded by a proline-rich FH1 (formin homology 1) domain. Formins act as profilin-modulated processive actin nucleators conserved throughout a wide range of eukaryotes. Results We present a detailed sequence analysis of the 10 formins (ForA to J) identified in the genome of the social amoeba Dictyostelium discoideum. With the exception of ForI and ForC all other formins conform to the domain structure GBD/FH3-FH1-FH2-DAD, where DAD is the Diaphanous autoinhibition domain and GBD/FH3 is the Rho GTPase-binding domain/formin homology 3 domain that we propose to represent a single domain. ForC lacks a FH1 domain, ForI lacks recognizable GBD/FH3 and DAD domains and ForA, E and J have additional unique domains. To establish the relationship between formins of Dictyostelium and other organisms we constructed a phylogenetic tree based on the alignment of FH2 domains. Real-time PCR was used to study the expression pattern of formin genes. Expression of forC, D, I and J increased during transition to multi-cellular stages, while the rest of genes displayed less marked developmental variations. During sexual development, expression of forH and forI displayed a significant increase in fusion competent cells. Conclusion Our analysis allows some preliminary insight into the functionality of Dictyostelium formins: all isoforms might display actin nucleation activity and, with the exception of ForI, might also be susceptible to autoinhibition and to regulation by Rho GTPases. The architecture GBD/FH3-FH1-FH2-DAD appears common to almost all Dictyostelium, fungal and metazoan formins, for which we propose the denomination of conventional formins, and implies a common regulatory mechanism. PMID:15740615
Rivero, Francisco; Muramoto, Tetsuya; Meyer, Ann-Kathrin; Urushihara, Hideko; Uyeda, Taro Q P; Kitayama, Chikako
2005-03-01
Formins are multidomain proteins defined by a conserved FH2 (formin homology 2) domain with actin nucleation activity preceded by a proline-rich FH1 (formin homology 1) domain. Formins act as profilin-modulated processive actin nucleators conserved throughout a wide range of eukaryotes. We present a detailed sequence analysis of the 10 formins (ForA to J) identified in the genome of the social amoeba Dictyostelium discoideum. With the exception of ForI and ForC all other formins conform to the domain structure GBD/FH3-FH1-FH2-DAD, where DAD is the Diaphanous autoinhibition domain and GBD/FH3 is the Rho GTPase-binding domain/formin homology 3 domain that we propose to represent a single domain. ForC lacks a FH1 domain, ForI lacks recognizable GBD/FH3 and DAD domains and ForA, E and J have additional unique domains. To establish the relationship between formins of Dictyostelium and other organisms we constructed a phylogenetic tree based on the alignment of FH2 domains. Real-time PCR was used to study the expression pattern of formin genes. Expression of forC, D, I and J increased during transition to multi-cellular stages, while the rest of genes displayed less marked developmental variations. During sexual development, expression of forH and forI displayed a significant increase in fusion competent cells. Our analysis allows some preliminary insight into the functionality of Dictyostelium formins: all isoforms might display actin nucleation activity and, with the exception of ForI, might also be susceptible to autoinhibition and to regulation by Rho GTPases. The architecture GBD/FH3-FH1-FH2-DAD appears common to almost all Dictyostelium, fungal and metazoan formins, for which we propose the denomination of conventional formins, and implies a common regulatory mechanism.
High efficiency labeling of glycoproteins on living cells
Zeng, Ying; Ramya, T. N. C.; Dirksen, Anouk; Dawson, Philip E.; Paulson, James C.
2010-01-01
We describe a simple method for efficiently labeling cell surface glycans on virtually any living animal cell. The method employs mild Periodate oxidation to generate an aldehyde on sialic acids, followed by Aniline-catalyzed oxime Ligation with a suitable tag (PAL). Aniline catalysis dramatically accelerates oxime ligation, allowing use of low concentrations of aminooxy-biotin at neutral pH to label the majority of cell surface glycoproteins while maintaining high cell viability. PMID:19234450
Deep Learning in Label-free Cell Classification
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia
Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individualmore » cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. In conclusion, this system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells.« less
Deep Learning in Label-free Cell Classification
Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia; Blaby, Ian K.; Huang, Allen; Niazi, Kayvan Reza; Jalali, Bahram
2016-01-01
Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individual cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. This system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells. PMID:26975219
Deep Learning in Label-free Cell Classification
Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia; ...
2016-03-15
Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individualmore » cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. In conclusion, this system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells.« less
Deep Learning in Label-free Cell Classification
NASA Astrophysics Data System (ADS)
Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia; Blaby, Ian K.; Huang, Allen; Niazi, Kayvan Reza; Jalali, Bahram
2016-03-01
Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individual cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. This system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells.
Viscoelastic Mapping of Living Cell Interiors
NASA Astrophysics Data System (ADS)
Heinrich, Doris; Sackmann, Erich; Koehler, Jana; Gerisch, Guenther
2004-03-01
We performed spatially resolved mapping of the viscoelastic properties of the cytoplasm of living cell interiors. A magnetic tweezer was applied as a local probe for the investigation of active and passive transport inside the slime mold cells Dictyostelium discoideum. Fluorescence labeled components, i.e. the microtubulins, the endoplasmatic reticulum or the core, allow for the determination of the interaction of the magnetic probes with the cytoplasm. By comparing the trajectories of the magnetic beads in the presence of an external magnetic force and in the absence of an external force, we can measure the viscosity at any given position within the cell. These experiments show that the cytoplasm consists of soft pathways (yield stress less or equal 10 Pa) and hard pathways (yield stress less or equal 500 Pa). Selective actin, myosin II or microtubulin network removal in the living cells allows for the determination of the influence of these cell parts on the viscoelastic properties.
Lentivirus-mediated bifunctional cell labeling for in vivo melanoma study
Day, Chi-Ping; Carter, John; Bonomi, Carrie; Esposito, Dominic; Crise, Bruce; Ortiz-Conde, Betty; Hollingshead, Melinda; Merlino, Glenn
2009-01-01
SUMMARY Lentiviral vectors (LVs) are capable of labeling a broad spectrum of cell types, achieving stable expression of transgenes. However, for in vivo studies, the duration of marker gene expression has been highly variable. We have developed a series of LVs harboring different promoters for expressing reporter gene in mouse cells. Long-term culture and colony formation of several LV-labeled mouse melanoma cells showed that promoters derived from mammalian house-keeping genes, especially those encoding RNA polymerase II (Pol2) and ferritin (FerH), provided the highest consistency for reporter expression. For in vivo studies, primary B16BL6 mouse melanoma were infected with LVs whose luciferase-GFP fusion gene (Luc/GFP) was driven by either Pol2 or FerH promoters. When transplanted into syngeneic C57BL/6 mice, Luc/GFP-labeled B16BL6 mouse melanoma cells can be monitored by bioluminescence imaging in vivo, and GFP-positive cells can be isolated from the tumors by FACS. Pol2-Luc/GFP labeling, while lower in activity, was more sustainable than FerH-Luc/GFP labeling in B16BL6 over consecutive passages into mice. We conclude that Pol-2-Luc/GFP labeling allows long-term in vivo monitoring and tumor cell isolation in immunocompetent mouse melanoma models. SIGNIFICANCE In this study we have developed and identified lentiviral vectors that allow labeled mouse melanoma cells to maintain long-term and consistent expression of a bifunctional luciferase-GFP marker gene, even in syngeneic mice with an intact immune function. This cell-labeling system can be used to build immunocompetent mouse melanoma models that permit both tumor monitoring and FACS-based tumor cell isolation from tissues, greatly facilitating the in vivo study of melanoma. PMID:19175523
El-Halawany, Medhat S; Ohkouchi, Susumu; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi
2004-06-01
Family 1 cystatins are cytosolic inhibitors of cysteine proteases, and they are conserved in higher eukaryotes. We characterized two newly identified family 1 cystatins of the cellular slime mold Dictyostelium discoideum, cystatin A1 and A2. Their recombinant proteins showed specific inhibitory activity against papain and cathepsin B, respectively. Using specific polyclonal antibodies, we found that cystatin A1 is stably expressed throughout the life cycle of Dictyostelium, whereas cystatin A2 expression is up-regulated during the course of development.
Influence of fast advective flows on pattern formation of Dictyostelium discoideum
Bae, Albert; Zykov, Vladimir; Bodenschatz, Eberhard
2018-01-01
We report experimental and numerical results on pattern formation of self-organizing Dictyostelium discoideum cells in a microfluidic setup under a constant buffer flow. The external flow advects the signaling molecule cyclic adenosine monophosphate (cAMP) downstream, while the chemotactic cells attached to the solid substrate are not transported with the flow. At high flow velocities, elongated cAMP waves are formed that cover the whole length of the channel and propagate both parallel and perpendicular to the flow direction. While the wave period and transverse propagation velocity are constant, parallel wave velocity and the wave width increase linearly with the imposed flow. We also observe that the acquired wave shape is highly dependent on the wave generation site and the strength of the imposed flow. We compared the wave shape and velocity with numerical simulations performed using a reaction-diffusion model and found excellent agreement. These results are expected to play an important role in understanding the process of pattern formation and aggregation of D. discoideum that may experience fluid flows in its natural habitat. PMID:29590179
Venkataramani, Varun; Kardorff, Markus; Herrmannsdörfer, Frank; Wieneke, Ralph; Klein, Alina; Tampé, Robert; Heilemann, Mike; Kuner, Thomas
2018-04-03
With continuing advances in the resolving power of super-resolution microscopy, the inefficient labeling of proteins with suitable fluorophores becomes a limiting factor. For example, the low labeling density achieved with antibodies or small molecule tags limits attempts to reveal local protein nano-architecture of cellular compartments. On the other hand, high laser intensities cause photobleaching within and nearby an imaged region, thereby further reducing labeling density and impairing multi-plane whole-cell 3D super-resolution imaging. Here, we show that both labeling density and photobleaching can be addressed by repetitive application of trisNTA-fluorophore conjugates reversibly binding to a histidine-tagged protein by a novel approach called single-epitope repetitive imaging (SERI). For single-plane super-resolution microscopy, we demonstrate that, after multiple rounds of labeling and imaging, the signal density is increased. Using the same approach of repetitive imaging, washing and re-labeling, we demonstrate whole-cell 3D super-resolution imaging compensated for photobleaching above or below the imaging plane. This proof-of-principle study demonstrates that repetitive labeling of histidine-tagged proteins provides a versatile solution to break the 'labeling barrier' and to bypass photobleaching in multi-plane, whole-cell 3D experiments.
Selective in vivo metabolic cell-labeling-mediated cancer targeting
Wang, Hua; Wang, Ruibo; Cai, Kaimin; He, Hua; Liu, Yang; Yen, Jonathan; Wang, Zhiyu; Xu, Ming; Sun, Yiwen; Zhou, Xin; Yin, Qian; Tang, Li; Dobrucki, Iwona T; Dobrucki, Lawrence W; Chaney, Eric J; Boppart, Stephen A; Fan, Timothy M; Lezmi, Stéphane; Chen, Xuesi; Yin, Lichen; Cheng, Jianjun
2017-01-01
Distinguishing cancer cells from normal cells through surface receptors is vital for cancer diagnosis and targeted therapy. Metabolic glycoengineering of unnatural sugars provides a powerful tool to manually introduce chemical receptors onto the cell surface; however, cancer-selective labeling still remains a great challenge. Herein we report the design of sugars that can selectively label cancer cells both in vitro and in vivo. Specifically, we inhibit the cell-labeling activity of tetraacetyl-N-azidoacetylmannosamine (Ac4ManAz) by converting its anomeric acetyl group to a caged ether bond that can be selectively cleaved by cancer-overexpressed enzymes and thus enables the overexpression of azido groups on the surface of cancer cells. Histone deacetylase and cathepsin L-responsive acetylated azidomannosamine, one such enzymatically activatable Ac4ManAz analog developed, mediated cancer-selective labeling in vivo, which enhanced tumor accumulation of a dibenzocyclooctyne–doxorubicin conjugate via click chemistry and enabled targeted therapy against LS174T colon cancer, MDA-MB-231 triple-negative breast cancer and 4T1 metastatic breast cancer in mice. PMID:28192414
The GATA transcription factor gene gtaG is required for terminal differentiation in Dictyostelium.
Katoh-Kurasawa, Mariko; Santhanam, Balaji; Shaulsky, Gad
2016-03-09
The GATA transcription factor GtaG is conserved in Dictyostelids and essential for terminal differentiation in Dictyostelium discoideum, but its function is not well understood. Here we show that gtaG is expressed in prestalk cells at the anterior region of fingers and in the extending stalk during culmination. The gtaG - phenotype is cell-autonomous in prestalk cells and non-cell-autonomous in prespore cells. Transcriptome analyses reveal that GtaG regulates prestalk gene expression during cell differentiation before culmination and is required for progression into culmination. GtaG-dependent genes include genetic suppressors of the Dd-STATa-defective phenotype as well as Dd-STATa target-genes, including extra cellular matrix genes. We show that GtaG may be involved in the production of two culmination-signaling molecules, cyclic di-GMP and the spore differentiation factor SDF-1 and that addition of c-di-GMP rescues the gtaG - culmination and spore formation deficiencies. We propose that GtaG is a regulator of terminal differentiation that functions in concert with Dd-STATa and controls culmination through regulating c-di-GMP and SDF-1 production in prestalk cells. © 2016. Published by The Company of Biologists Ltd.
Ferritin conjugates as specific magnetic labels. Implications for cell separation.
Odette, L L; McCloskey, M A; Young, S H
1984-01-01
Concanavalin A coupled to the naturally occurring iron storage protein ferritin is used to label rat erythrocytes and increase the cells' magnetic susceptibility. Labeled cells are introduced into a chamber containing spherical iron particles and the chamber is placed in a uniform 5.2 kG (gauss) magnetic field. The trajectory of cells in the inhomogeneous magnetic field around the iron particles and the polar distributions of cells bound to the iron particles compare well with the theoretical predictions for high gradient magnetic systems. On the basis of these findings we suggest that ferritin conjugated ligands can be used for selective magnetic separation of labeled cells. Images FIGURE 2 PMID:6743752
Activation of G-proteins by receptor-stimulated nucleoside diphosphate kinase in Dictyostelium.
Bominaar, A A; Molijn, A C; Pestel, M; Veron, M; Van Haastert, P J
1993-01-01
Recently, interest in the enzyme nucleoside diphosphate kinase (EC2.7.4.6) has increased as a result of its possible involvement in cell proliferation and development. Since NDP kinase is one of the major sources of GTP in cells, it has been suggested that the effects of an altered NDP kinase activity on cellular processes might be the result of altered transmembrane signal transduction via guanine nucleotide-binding proteins (G-proteins). In the cellular slime mould Dictyostelium discoideum, extracellular cAMP induces an increase of phospholipase C activity via a surface cAMP receptor and G-proteins. In this paper it is demonstrated that part of the cellular NDP kinase is associated with the membrane and stimulated by cell surface cAMP receptors. The GTP produced by the action of NDP kinase is capable of activating G-proteins as monitored by altered G-protein-receptor interaction and the activation of the effector enzyme phospholipase C. Furthermore, specific monoclonal antibodies inhibit the effect of NDP kinase on G-protein activation. These results suggest that receptor-stimulated NDP kinase contributes to the mediation of hormone action by producing GTP for the activation of GTP-binding proteins. Images PMID:8389692
Signaling molecules involved in the transition of growth to development of Dictyostelium discoideum.
Mir, Hina A; Rajawat, Jyotika; Pradhan, Shalmali; Begum, Rasheedunnisa
2007-03-01
The social amoeba Dictyostelium discoideum, a powerful paradigm provides clear insights into the regulation of growth and development. In addition to possessing complex individual cellular functions like a unicellular eukaryote, D. discoideum cells face the challenge of multicellular development. D. discoideum undergoes a relatively simple differentiation process mainly by cAMP mediated pathway. Despite this relative simplicity, the regulatory signaling pathways are as complex as those seen in metazoan development. However, the introduction of restriction-enzyme-mediated integration (REMI) technique to produce developmental gene knockouts has provided novel insights into the discovery of signaling molecules and their role in D. discoideum development. Cell cycle phase is an important aspect for differentiation of D. discoideum, as cells must reach a specific stage to enter into developmental phase and specific cell cycle regulators are involved in arresting growth phase genes and inducing the developmental genes. In this review, we present an overview of the signaling molecules involved in the regulation of growth to differentiation transition (GDT), molecular mechanism of early developmental events leading to generation of cAMP signal and components of cAMP relay system that operate in this paradigm.
Flow-driven waves and sink-driven oscillations during aggregation of Dictyostelium discoideum
NASA Astrophysics Data System (ADS)
Gholami, Azam; Zykov, Vladimir; Steinbock, Oliver; Bodenschatz, Eberhard
The slime mold Dictyostelium discoideum (D.d) is a well-known model system for the study of biological pattern formation. Under starvation, D.d. cells aggregate chemotactically towards cAMP signals emitted periodically from an aggregation center. In the natural environment, D.d cells may experience fluid flows that can profoundly change the underlying wave generation process. We investigate spatial-temporal dynamics of a uniformly distributed population of D.d. cells in a flow-through narrow microfluidic channel with a cell-free inlet area. We show that flow can significantly influence the dynamics of the system and lead to a flow- driven instability that initiate downstream traveling cAMP waves. We also show that cell-free boundary regions have a significant effect on the observed patterns and can lead to a new kind of instability. Since there are no cells in the inlet to produce cAMP, the points in the vicinity of the inlet lose cAMP due to advection or diffusion and gain only a little from the upstream of the channel (inlet). In other words, there is a large negative flux of cAMP in the neighborhood close to the inlet, which can be considered as a sink. This negative flux close to the inlet drives a new kind of instability called sink-driven oscillations. Financial support of the MaxSynBio Consortium is acknowledged.
O'Day, Danton H; Budniak, Aldona
2015-02-01
Mitosis is a fundamental and essential life process. It underlies the duplication and survival of all cells and, as a result, all eukaryotic organisms. Since uncontrolled mitosis is a dreaded component of many cancers, a full understanding of the process is critical. Evolution has led to the existence of three types of mitosis: closed, open, and semi-open. The significance of these different mitotic species, how they can lead to a full understanding of the critical events that underlie the asexual duplication of all cells, and how they may generate new insights into controlling unregulated cell division remains to be determined. The eukaryotic microbe Dictyostelium discoideum has proved to be a valuable biomedical model organism. While it appears to utilize closed mitosis, a review of the literature suggests that it possesses a form of mitosis that lies in the middle between truly open and fully closed mitosis-it utilizes a form of semi-open mitosis. Here, the nucleocytoplasmic translocation patterns of the proteins that have been studied during mitosis in the social amoebozoan D. discoideum are detailed followed by a discussion of how some of them provide support for the hypothesis of semi-open mitosis. © 2014 The Authors. Biological Reviews published by John Wiley & Sons Ltd on behalf of Cambridge Philosophical Society.
Labeling proteins on live mammalian cells using click chemistry.
Nikić, Ivana; Kang, Jun Hee; Girona, Gemma Estrada; Aramburu, Iker Valle; Lemke, Edward A
2015-05-01
We describe a protocol for the rapid labeling of cell-surface proteins in living mammalian cells using click chemistry. The labeling method is based on strain-promoted alkyne-azide cycloaddition (SPAAC) and strain-promoted inverse-electron-demand Diels-Alder cycloaddition (SPIEDAC) reactions, in which noncanonical amino acids (ncAAs) bearing ring-strained alkynes or alkenes react, respectively, with dyes containing azide or tetrazine groups. To introduce ncAAs site specifically into a protein of interest (POI), we use genetic code expansion technology. The protocol can be described as comprising two steps. In the first step, an Amber stop codon is introduced--by site-directed mutagenesis--at the desired site on the gene encoding the POI. This plasmid is then transfected into mammalian cells, along with another plasmid that encodes an aminoacyl-tRNA synthetase/tRNA (RS/tRNA) pair that is orthogonal to the host's translational machinery. In the presence of the ncAA, the orthogonal RS/tRNA pair specifically suppresses the Amber codon by incorporating the ncAA into the polypeptide chain of the POI. In the second step, the expressed POI is labeled with a suitably reactive dye derivative that is directly supplied to the growth medium. We provide a detailed protocol for using commercially available ncAAs and dyes for labeling the insulin receptor, and we discuss the optimal surface-labeling conditions and the limitations of labeling living mammalian cells. The protocol involves an initial cloning step that can take 4-7 d, followed by the described transfections and labeling reaction steps, which can take 3-4 d.
Fluorescent Photo-conversion: A second chance to label unique cells
Mellott, Adam J.; Shinogle, Heather E.; Moore, David S.; Detamore, Michael S.
2014-01-01
Not all cells behave uniformly after treatment in tissue engineering studies. In fact, some treated cells display no signs of treatment or show unique characteristics not consistent with other treated cells. What if the “unique” cells could be isolated from a treated population, and further studied? Photo-convertible reporter proteins, such as Dendra2, allow for the ability to selectively identify unique cells with a secondary label within a primary labeled treated population. In the current study, select cells were identified and labeled through photo-conversion of Dendra2-transfected human Wharton's Jelly cells (hWJCs) for the first time. Robust photo-conversion of green-to-red fluorescence was achieved consistently in arbitrarily selected cells, allowing for precise cell identification of select hWJCs. The current study demonstrates a method that offers investigators the opportunity to selectively label and identify unique cells within a treated population for further study or isolation from the treatment population. Photo-convertible reporter proteins, such as Dendra2, offer the ability over non-photo-convertible reporter proteins, such as green fluorescent protein, to analyze unique individual cells within a treated population, which allows investigators to gain more meaningful information on how a treatment affects all cells within a target population. PMID:25914756
Fluorescent Photo-conversion: A second chance to label unique cells.
Mellott, Adam J; Shinogle, Heather E; Moore, David S; Detamore, Michael S
2015-03-01
Not all cells behave uniformly after treatment in tissue engineering studies. In fact, some treated cells display no signs of treatment or show unique characteristics not consistent with other treated cells. What if the "unique" cells could be isolated from a treated population, and further studied? Photo-convertible reporter proteins, such as Dendra2 , allow for the ability to selectively identify unique cells with a secondary label within a primary labeled treated population. In the current study, select cells were identified and labeled through photo-conversion of Dendra2 -transfected human Wharton's Jelly cells (hWJCs) for the first time. Robust photo-conversion of green-to-red fluorescence was achieved consistently in arbitrarily selected cells, allowing for precise cell identification of select hWJCs. The current study demonstrates a method that offers investigators the opportunity to selectively label and identify unique cells within a treated population for further study or isolation from the treatment population. Photo-convertible reporter proteins, such as Dendra2 , offer the ability over non-photo-convertible reporter proteins, such as green fluorescent protein, to analyze unique individual cells within a treated population, which allows investigators to gain more meaningful information on how a treatment affects all cells within a target population.
Label Structured Cell Proliferation Models
2010-06-16
and (, + ) are the cell proliferation and death rates , respectively, relative to the moving label coordinate system + . Daughter...proliferation and death rates relative to this new coordinate system. While not common in the biological sciences, it is altogether common in the physical
Traceless affinity labeling of endogenous proteins for functional analysis in living cells.
Hayashi, Takahiro; Hamachi, Itaru
2012-09-18
Protein labeling and imaging techniques have provided tremendous opportunities to study the structure, function, dynamics, and localization of individual proteins in the complex environment of living cells. Molecular biology-based approaches, such as GFP-fusion tags and monoclonal antibodies, have served as important tools for the visualization of individual proteins in cells. Although these techniques continue to be valuable for live cell imaging, they have a number of limitations that have only been addressed by recent progress in chemistry-based approaches. These chemical approaches benefit greatly from the smaller probe sizes that should result in fewer perturbations to proteins and to biological systems as a whole. Despite the research in this area, so far none of these labeling techniques permit labeling and imaging of selected endogenous proteins in living cells. Researchers have widely used affinity labeling, in which the protein of interest is labeled by a reactive group attached to a ligand, to identify and characterize proteins. Since the first report of affinity labeling in the early 1960s, efforts to fine-tune the chemical structures of both the reactive group and ligand have led to protein labeling with excellent target selectivity in the whole proteome of living cells. Although the chemical probes used for affinity labeling generally inactivate target proteins, this strategy holds promise as a valuable tool for the labeling and imaging of endogenous proteins in living cells and by extension in living animals. In this Account, we summarize traceless affinity labeling, a technique explored mainly in our laboratory. In our overview of the different labeling techniques, we emphasize the challenge of designing chemical probes that allow for dissociation of the affinity module (often a ligand) after the labeling reaction so that the labeled protein retains its native function. This feature distinguishes the traceless labeling approach from the traditional
Ho, Yin Ying; Penno, Megan; Perugini, Michelle; Lewis, Ian; Hoffmann, Peter
2012-01-01
Labeling of exposed cell surface proteins of live cells using CyDye DIGE fluor minimal dyes is an efficient strategy for cell surface proteome profiling and quantifying differentially expressed proteins in diseases. Here we describe a strategy to evaluate a two-step detergent-based protein fractionation method using live cell labeling followed by visualization of the fluorescently labeled cell surface proteins and fractionated proteins within a single 2D gel.
Nanoscale Label-free Bioprobes to Detect Intracellular Proteins in Single Living Cells
Hong, Wooyoung; Liang, Feng; Schaak, Diane; Loncar, Marko; Quan, Qimin
2014-01-01
Fluorescent labeling techniques have been widely used in live cell studies; however, the labeling processes can be laborious and challenging for use in non-transfectable cells, and labels can interfere with protein functions. While label-free biosensors have been realized by nanofabrication, a method to track intracellular protein dynamics in real-time, in situ and in living cells has not been found. Here we present the first demonstration of label-free detection of intracellular p53 protein dynamics through a nanoscale surface plasmon-polariton fiber-tip-probe (FTP). PMID:25154394
Schvartz, Tomer; Aloush, Noa; Goliand, Inna; Segal, Inbar; Nachmias, Dikla; Arbely, Eyal; Elia, Natalie
2017-01-01
Genetic code expansion and bioorthogonal labeling provide for the first time a way for direct, site-specific labeling of proteins with fluorescent-dyes in live cells. Although the small size and superb photophysical parameters of fluorescent-dyes offer unique advantages for high-resolution microscopy, this approach has yet to be embraced as a tool in live cell imaging. Here we evaluated the feasibility of this approach by applying it for α-tubulin labeling. After a series of calibrations, we site-specifically labeled α-tubulin with silicon rhodamine (SiR) in live mammalian cells in an efficient and robust manner. SiR-labeled tubulin successfully incorporated into endogenous microtubules at high density, enabling video recording of microtubule dynamics in interphase and mitotic cells. Applying this labeling approach to structured illumination microscopy resulted in an increase in resolution, highlighting the advantages in using a smaller, brighter tag. Therefore, using our optimized assay, genetic code expansion provides an attractive tool for labeling proteins with a minimal, bright tag in quantitative high-resolution imaging. PMID:28835375
Dictyostelium LvsB has a regulatory role in endosomal vesicle fusion
Falkenstein, Kristin; De Lozanne, Arturo
2014-01-01
ABSTRACT Defects in human lysosomal-trafficking regulator (Lyst) are associated with the lysosomal disorder Chediak–Higashi syndrome. The absence of Lyst results in the formation of enlarged lysosome-related compartments, but the mechanism for how these compartments arise is not well established. Two opposing models have been proposed to explain Lyst function. The fission model describes Lyst as a positive regulator of fission from lysosomal compartments, whereas the fusion model identifies Lyst as a negative regulator of fusion between lysosomal vesicles. Here, we used assays that can distinguish between defects in vesicle fusion versus fission. We compared the phenotype of Dictyostelium discoideum cells defective in LvsB, the ortholog of Lyst, with that of two known fission defect mutants (μ3- and WASH-null mutants). We found that the temporal localization characteristics of the post-lysosomal marker vacuolin, as well as vesicular acidity and the fusion dynamics of LvsB-null cells are distinct from those of both μ3- and WASH-null fission defect mutants. These distinctions are predicted by the fusion defect model and implicate LvsB as a negative regulator of vesicle fusion. PMID:25086066
Selective dye-labeling of newly synthesized proteins in bacterial cells.
Beatty, Kimberly E; Xie, Fang; Wang, Qian; Tirrell, David A
2005-10-19
We describe fluorescence labeling of newly synthesized proteins in Escherichia coli cells by means of Cu(I)-catalyzed cycloaddition between alkynyl amino acid side chains and the fluorogenic dye 3-azido-7-hydroxycoumarin. The method involves co-translational labeling of proteins by the non-natural amino acids homopropargylglycine (Hpg) or ethynylphenylalanine (Eth) followed by treatment with the dye. As a demonstration, the model protein barstar was expressed and treated overnight with Cu(I) and 3-azido-7-hydroxycoumarin. Examination of treated cells by confocal microscopy revealed that strong fluorescence enhancement was observed only for alkynyl-barstar treated with Cu(I) and the reactive dye. The cellular fluorescence was punctate, and gel electrophoresis confirmed that labeled barstar was localized in inclusion bodies. Other proteins showed little fluorescence. Examination of treated cells by fluorimetry demonstrated that cultures supplemented with Eth or Hpg showed an 8- to 14-fold enhancement in fluorescence intensity after labeling. Addition of a protein synthesis inhibitor reduced the emission intensity to levels slightly above background, confirming selective labeling of newly synthesized proteins in the bacterial cell.
Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.
Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad
2016-09-01
Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.
The GATA transcription factor gene gtaG is required for terminal differentiation in Dictyostelium
2016-01-01
ABSTRACT The GATA transcription factor GtaG is conserved in Dictyostelids and is essential for terminal differentiation in Dictyostelium discoideum, but its function is not well understood. Here, we show that gtaG is expressed in prestalk cells at the anterior region of fingers and in the extending stalk during culmination. The gtaG− phenotype is cell-autonomous in prestalk cells and non-cell-autonomous in prespore cells. Transcriptome analyses reveal that GtaG regulates prestalk gene expression during cell differentiation before culmination and is required for progression into culmination. GtaG-dependent genes include genetic suppressors of the Dd-STATa-defective phenotype (Dd-STATa is also known as DstA) as well as Dd-STATa target-genes, including extracellular matrix genes. We show that GtaG might be involved in the production of two culmination-signaling molecules, cyclic di-GMP (c-di-GMP) and the spore differentiation factor SDF-1, and that addition of c-di-GMP rescues the gtaG− culmination and spore formation deficiencies. We propose that GtaG is a regulator of terminal differentiation that functions in concert with Dd-STATa and controls culmination through regulating c-di-GMP and SDF-1 production in prestalk cells. PMID:26962009
Shen, Wei-Bin; Vaccaro, Dennis E; Fishman, Paul S; Groman, Ernest V; Yarowsky, Paul
2016-05-01
This is the first report of the synthesis of a new nanoparticle, sans iron oxide rhodamine B (SIRB), an example of a new class of nanoparticles. SIRB is designed to provide all of the cell labeling properties of the ultrasmall superparamagnetic iron oxide (USPIO) nanoparticle Molday ION Rhodamine B (MIRB) without containing the iron oxide core. MIRB was developed to label cells and allow them to be tracked by MRI or to be manipulated by magnetic gradients. SIRB possesses a similar size, charge and cross-linked dextran coating as MIRB. Of great interest is understanding the biological and physiological changes in cells after they are labeled with a USPIO. Whether these effects are due to the iron oxide buried within the nanoparticle or to the surface coating surrounding the iron oxide core has not been considered previously. MIRB and SIRB represent an ideal pairing of nanoparticles to identify nanoparticle anatomy responsible for post-labeling cytotoxicity. Here we report the effects of SIRB labeling on the SH-SY5Y neuroblastoma cell line and primary human neuroprogenitor cells (hNPCs). These effects are contrasted with the effects of labeling SH-SY5Y cells and hNPCs with MIRB. We find that SIRB labeling, like MIRB labeling, (i) occurs without the use of transfection reagents, (ii) is packaged within lysosomes distributed within cell cytoplasm, (iii) is retained within cells with no loss of label after cell storage, and (iv) does not alter cellular viability or proliferation, and (v) SIRB labeled hNPCs differentiate normally into neurons or astrocytes. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
CDK5RAP2 Is an Essential Scaffolding Protein of the Corona of the Dictyostelium Centrosome.
Pitzen, Valentin; Askarzada, Sophie; Gräf, Ralph; Meyer, Irene
2018-04-23
Dictyostelium centrosomes consist of a nucleus-associated cylindrical, three-layered core structure surrounded by a corona consisting of microtubule-nucleation complexes embedded in a scaffold of large coiled-coil proteins. One of them is the conserved CDK5RAP2 protein. Here we focus on the role of Dictyostelium CDK5RAP2 for maintenance of centrosome integrity, its interaction partners and its dynamic behavior during interphase and mitosis. GFP-CDK5RAP2 is present at the centrosome during the entire cell cycle except from a short period during prophase, correlating with the normal dissociation of the corona at this stage. RNAi depletion of CDK5RAP2 results in complete disorganization of centrosomes and microtubules suggesting that CDK5RAP2 is required for organization of the corona and its association to the core structure. This is in line with the observation that overexpressed GFP-CDK5RAP2 elicited supernumerary cytosolic MTOCs. The phenotype of CDK5RAP2 depletion was very reminiscent of that observed upon depletion of CP148, another scaffolding protein of the corona. BioID interaction assays revealed an interaction of CDK5RAP2 not only with the corona markers CP148, γ-tubulin, and CP248, but also with the core components Cep192, CP75, and CP91. Furthermore, protein localization studies in both depletion strains revealed that CP148 and CDK5RAP2 cooperate in corona organization.
Pulse labeling of RNA of mammalian cells.
Rovera, G; Berman, S; Baserga, R
1970-04-01
When cells from a hypotetraploid strain of Ehrlich ascites tumor are exposed to uridine-(3)H either in vivo or in vitro, the amount of radioactivity incorporated into RNA reaches a maximum within ten minutes, after which any further incorporation stops. (3)H-uridine triphosphate disappears from the acid soluble pool within 30 minutes and the findings indicate that the RNA of these cells can be pulse labeled without the use of any antibiotic or the need of a "chase." The stability of the pulse labeled RNA in the presence of pentobarbital (an inhibitor of RNA synthesis) indicates the virtual absence of RNA breakdown. However, actinomycin D, at a dosage of 250 mug/mouse in vivo and 10 mug/ml in vitro produces breakdown of labeled RNA, thus confirming earlier observations that the drug is not a suitable tool for RNA kinetics determinations. The pulse-labeled RNA leaves the nucleus slowly and some radioactive RNA is still present in the nuclear fraction after 24 hours. Radioactivity begins to appear in cytoplasmic ribosomal RNA after 20 minutes and continues to increase up to six hours.
Siloxane nanoprobes for labeling and dual modality imaging of neural stem cells
Addington, Caroline P.; Cusick, Alex; Shankar, Rohini Vidya; Agarwal, Shubhangi; Stabenfeldt, Sarah E.; Kodibagkar, Vikram D.
2015-01-01
Cell therapy represents a promising therapeutic for a myriad of medical conditions, including cancer, traumatic brain injury, and cardiovascular disease among others. A thorough understanding of the efficacy and cellular dynamics of these therapies necessitates the ability to non-invasively track cells in vivo. Magnetic resonance imaging (MRI) provides a platform to track cells as a non-invasive modality with superior resolution and soft tissue contrast. We recently reported a new nanoprobe platform for cell labeling and imaging using fluorophore doped siloxane core nanoemulsions as dual modality (1H MRI/Fluorescence), dual-functional (oximetry/detection) nanoprobes. Here, we successfully demonstrate the labeling, dual-modality imaging, and oximetry of neural progenitor/stem cells (NPSCs) in vitro using this platform. Labeling at a concentration of 10 μl/104 cells with a 40%v/v polydimethylsiloxane core nanoemulsion, doped with rhodamine, had minimal effect on viability, no effect on migration, proliferation and differentiation of NPSCs and allowed for unambiguous visualization of labeled NPSCs by 1H MR and fluorescence and local pO2 reporting by labeled NPSCs. This new approach for cell labeling with a positive contrast 1H MR probe has the potential to improve mechanistic knowledge of current therapies, and guide the design of future cell therapies due to its clinical translatability. PMID:26597417
Mesenchymal Stem Cell Preparation and Transfection-free Ferumoxytol Labeling for MRI Cell Tracking.
Liu, Li; Ho, Chien
2017-11-15
Mesenchymal stem cells (MSCs) are multipotent cells and are the most widely studied cell type for stem cell therapies. In vivo cell tracking of MSCs labeled with an FDA-approved superparamagnetic iron-oxide (SPIO) particle by magnetic resonance imaging (MRI) provides essential information, e.g., MSC engraftment, survival, and fate, thus improving cell therapy accuracy. However, current methodology for labeling MSCs with Ferumoxytol (Feraheme ® ), the only FDA-approved SPIO particle, needs transfection agents. This unit describes a new "bio-mimicry" protocol to prepare more native MSCs by using more "in vivo environment" of MSCs, so that the phagocytic activity of cultured MSCs is restored and expanded MSCs can be labeled with Ferumoxytol, without the need for transfection agents and/or electroporation. Moreover, MSCs re-size to a more native size, reducing from 32.0 to 19.5 μm. The MSCs prepared from this protocol retain more native properties and would be useful for biomedical applications and MSC-tracking studies by MRI. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Magneto-optical labeling of fetal neural stem cells for in vivo MRI tracking.
Flexman, J A; Minoshima, S; Kim, Y; Cross, D J
2006-01-01
Neural stem cell therapy for neurological pathologies, such as Alzheimer's and Parkinson's disease, may delay the onset of symptoms, replace damaged neurons and/or support the survival of endogenous cells. Magnetic resonance imaging (MRI) can be used to track magnetically labeled cells in vivo to observe migration. Prior to transplantation, labeled cells must be characterized to show that they retain their intrinsic properties, such as cell proliferation into neurospheres in a supplemented environment. In vivo images must also be correlated to sensitive, histological markers. In this study, we show that fetus-derived neural stem cells can be co-labeled with superparamagnetic iron oxide and PKH26, a fluorescent dye. Labeled cells retain the ability to proliferate into neurospheres in culture, but labeling prevents neurospheres from merging in a non-adherent culture environment. After labeled NSCs were transplantation into the rat brain, their location and subsequent migration along the corpus callosum was detected using MRI. This study demonstrates an imaging paradigm with which to develop an in vivo assay for quantitatively evaluating fetal neural stem cell migration.
Schvartz, Tomer; Aloush, Noa; Goliand, Inna; Segal, Inbar; Nachmias, Dikla; Arbely, Eyal; Elia, Natalie
2017-10-15
Genetic code expansion and bioorthogonal labeling provide for the first time a way for direct, site-specific labeling of proteins with fluorescent-dyes in live cells. Although the small size and superb photophysical parameters of fluorescent-dyes offer unique advantages for high-resolution microscopy, this approach has yet to be embraced as a tool in live cell imaging. Here we evaluated the feasibility of this approach by applying it for α-tubulin labeling. After a series of calibrations, we site-specifically labeled α-tubulin with silicon rhodamine (SiR) in live mammalian cells in an efficient and robust manner. SiR-labeled tubulin successfully incorporated into endogenous microtubules at high density, enabling video recording of microtubule dynamics in interphase and mitotic cells. Applying this labeling approach to structured illumination microscopy resulted in an increase in resolution, highlighting the advantages in using a smaller, brighter tag. Therefore, using our optimized assay, genetic code expansion provides an attractive tool for labeling proteins with a minimal, bright tag in quantitative high-resolution imaging. © 2017 Schvartz et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Shammas, Ronnie L; Fales, Andrew M; Crawford, Bridget M; Wisdom, Amy J; Devi, Gayathri R; Brown, David A; Vo-Dinh, Tuan; Hollenbeck, Scott T
2017-04-01
Gold nanostars are unique nanoplatforms that can be imaged in real time and transform light energy into heat to ablate cells. Adipose-derived stem cells migrate toward tumor niches in response to chemokines. The ability of adipose-derived stem cells to migrate and integrate into tumors makes them ideal vehicles for the targeted delivery of cancer nanotherapeutics. To test the labeling efficiency of gold nanostars, undifferentiated adipose-derived stem cells were incubated with gold nanostars and a commercially available nanoparticle (Qtracker), then imaged using two-photon photoluminescence microscopy. The effects of gold nanostars on cell phenotype, proliferation, and viability were assessed with flow cytometry, 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide metabolic assay, and trypan blue, respectively. Trilineage differentiation of gold nanostar-labeled adipose-derived stem cells was induced with the appropriate media. Photothermolysis was performed on adipose-derived stem cells cultured alone or in co-culture with SKBR3 cancer cells. Efficient uptake of gold nanostars occurred in adipose-derived stem cells, with persistence of the luminescent signal over 4 days. Labeling efficiency and signal quality were greater than with Qtracker. Gold nanostars did not affect cell phenotype, viability, or proliferation, and exhibited stronger luminescence than Qtracker throughout differentiation. Zones of complete ablation surrounding the gold nanostar-labeled adipose-derived stem cells were observed following photothermolysis in both monoculture and co-culture models. Gold nanostars effectively label adipose-derived stem cells without altering cell phenotype. Once labeled, photoactivation of gold nanostar-labeled adipose-derived stem cells ablates neighboring cancer cells, demonstrating the potential of adipose-derived stem cells as a vehicle for the delivery of site-specific cancer therapy.
Labeling tetracysteine-tagged proteins with biarsenical dyes for live cell imaging.
Gaietta, Guido M; Deerinck, Thomas J; Ellisman, Mark H
2011-01-01
Correlation of real-time or time-lapse light microscopy (LM) with electron microscopy (EM) of cells can be performed with biarsenical dyes. These dyes fluorescently label tetracysteine-tagged proteins so that they can be imaged with LM and, upon fluorescent photoconversion of 3,3'-diaminobenzidine tetrahydrochloride (DAB), with EM as well. In the following protocol, cells expressing tetracysteine-tagged proteins are labeled for 1 h with biarsenical dyes. The volumes indicated are for a single 30-mm culture dish containing 2 mL of labeling medium. Scale the suggested volumes up or down depending upon the size of the culture dish used in the labeling. The same procedure can be adapted for longer labeling times by lowering the amount of dye used to 50-100 nM; however, the amount of the competing dithiol EDT is maintained at 10-20 μM. Longer labeling times often produce higher signal-to-noise ratios and cause less trauma to the treated cells prior to imaging.
Fruiting bodies of the social amoeba Dictyostelium discoideum increase spore transport by Drosophila
2014-01-01
Background Many microbial phenotypes are the product of cooperative interactions among cells, but their putative fitness benefits are often not well understood. In the cellular slime mold Dictyostelium discoideum, unicellular amoebae aggregate when starved and form multicellular fruiting bodies in which stress-resistant spores are held aloft by dead stalk cells. Fruiting bodies are thought to be adaptations for dispersing spores to new feeding sites, but this has not been directly tested. Here we experimentally test whether fruiting bodies increase the rate at which spores are acquired by passing invertebrates. Results Drosophila melanogaster accumulate spores on their surfaces more quickly when exposed to intact fruiting bodies than when exposed to fruiting bodies physically disrupted to dislodge spore masses from stalks. Flies also ingest and excrete spores that still express a red fluorescent protein marker. Conclusions Multicellular fruiting bodies created by D. discoideum increase the likelihood that invertebrates acquire spores that can then be transported to new feeding sites. These results thus support the long-hypothesized dispersal benefits of altruism in a model system for microbial cooperation. PMID:24884856
Elhami, Esmat; Goertzen, Andrew L; Xiang, Bo; Deng, Jixian; Stillwell, Chris; Mzengeza, Shadreck; Arora, Rakesh C; Freed, Darren; Tian, Ganghong
2011-07-01
Adipose-derived stem cells (ASCs) have promising potential in regenerative medicine and cell therapy. Our objective is to examine the biological function of the labeled stem cells following labeling with a readily available positron emission tomography (PET) tracer, (18)F-fluoro-2-deoxy-D: -glucose (FDG). In this work we characterize labeling efficiency through assessment of FDG uptake and retention by the ASCs and the effect of FDG on cell viability, proliferation, transdifferentiation, and cell function in vitro using rat ASCs. Samples of 10(5) ASCs (from visceral fat tissue) were labeled with concentrations of FDG (1-55 Bq/cell) in 0.75 ml culture medium. Label uptake and retention, as a function of labeling time, FDG concentration, and efflux period were measured to determine optimum cell labeling conditions. Cell viability, proliferation, DNA structure damage, cell differentiation, and other cell functions were examined. Non-labeled ASC samples were used as a control for all experimental groups. Labeled ASCs were injected via tail vein in several healthy rats and initial cell biodistribution was assessed. Our results showed that FDG uptake and retention by the stem cells did not depend on FDG concentration but on labeling and efflux periods and glucose content of the labeling and efflux media. Cell viability, transdifferentiation, and cell function were not greatly affected. DNA damage due to FDG radioactivity was acute, but reversible; cells managed to repair the damage and continue with cell cycles. Over all, FDG (up to 25 Bq/cell) did not impose severe cytotoxicity in rat ASCs. Initial biodistribution of the FDG-labeled ASCs was 80% + retention in the lungs. In the delayed whole-body images (2-3 h postinjection) there was some activity distribution resembling typical FDG uptake patterns. For in vivo cell tracking studies with PET tracers, the parameter of interest is the amount of radiotracer that is present in the cells being labeled and consequent
Label-free and live cell imaging by interferometric scattering microscopy.
Park, Jin-Sung; Lee, Il-Buem; Moon, Hyeon-Min; Joo, Jong-Hyeon; Kim, Kyoung-Hoon; Hong, Seok-Cheol; Cho, Minhaeng
2018-03-14
Despite recent remarkable advances in microscopic techniques, it still remains very challenging to directly observe the complex structure of cytoplasmic organelles in live cells without a fluorescent label. Here we report label-free and live-cell imaging of mammalian cell, Escherischia coli , and yeast, using interferometric scattering microscopy, which reveals the underlying structures of a variety of cytoplasmic organelles as well as the underside structure of the cells. The contact areas of the cells attached onto a glass substrate, e.g. , focal adhesions and filopodia, are clearly discernible. We also found a variety of fringe-like features in the cytoplasmic area, which may reflect the folded structures of cytoplasmic organelles. We thus anticipate that the label-free interferometric scattering microscopy can be used as a powerful tool to shed interferometric light on in vivo structures and dynamics of various intracellular phenomena.
Dictyostelium myosin I double mutants exhibit conditional defects in pinocytosis.
Novak, K D; Peterson, M D; Reedy, M C; Titus, M A
1995-12-01
The functional relationship between three Dictyostelium myosin Is, myoA, myoB, and myoC, has been examined through the creation of double mutants. Two double mutants, myoA-/B- and myoB-/C-, exhibit similar conditional defects in fluid-phase pinocytosis. Double mutants grown in suspension culture are significantly impaired in their ability to take in nutrients from the medium, whereas they are almost indistinguishable from wild-type and single mutant strains when grown on a surface. The double mutants are also found to internalize gp126, a 116-kD membrane protein, at a slower rate than either the wild-type or single mutant cells. Ultrastructural analysis reveals that both double mutants possess numerous small vesicles, in contrast to the wild-type or myosin I single mutants that exhibit several large, clear vacuoles. The alterations in fluid and membrane internalization in the suspension-grown double mutants, coupled with the altered vesicular profile, suggest that these cells may be compromised during the early stages of pinocytosis, a process that has been proposed to occur via actin-based cytoskeletal rearrangements. Scanning electron microscopy and rhodamine-phalloidin staining indicates that the myosin I double mutants appear to extend a larger number of actin-filled structures, such as filopodia and crowns, than wild-type cells. Rhodamine-phalloidin staining of the F-actin cytoskeleton of these suspension-grown cells also reveals that the double mutant cells are delayed in the rearrangement of cortical actin-rich structures upon adhesion to a substrate. We propose that myoA, myoB, and myoC play roles in controlling F-actin filled membrane projections that are required for pinosome internalization in suspension.
Magnetic field design for selecting and aligning immunomagnetic labeled cells.
Tibbe, Arjan G J; de Grooth, Bart G; Greve, Jan; Dolan, Gerald J; Rao, Chandra; Terstappen, Leon W M M
2002-03-01
Recently we introduced the CellTracks cell analysis system, in which samples are prepared based on a combination of immunomagnetic selection, separation, and alignment of cells along ferromagnetic lines. Here we describe the underlying magnetic principles and considerations made in the magnetic field design to achieve the best possible cell selection and alignment of magnetically labeled cells. Materials and Methods Computer simulations, in combination with experimental data, were used to optimize the design of the magnets and Ni lines to obtain the optimal magnetic configuration. A homogeneous cell distribution on the upper surface of the sample chamber was obtained with a magnet where the pole faces were tilted towards each other. The spatial distribution of magnetically aligned objects in between the Ni lines was dependent on the ratio of the diameter of the aligned object and the line spacing, which was tested with magnetically and fluorescently labeled 6 microm polystyrene beads. The best result was obtained when the line spacing was equal to or smaller than the diameter of the aligned object. The magnetic gradient of the designed permanent magnet extracts magnetically labeled cells from any cell suspension to a desired plane, providing a homogeneous cell distribution. In addition, it magnetizes ferro-magnetic Ni lines in this plane whose additional local gradient adds to the gradient of the permanent magnet. The resultant gradient aligns the magnetically labeled cells first brought to this plane. This combination makes it possible, in a single step, to extract and align cells on a surface from any cell suspension. Copyright 2002 Wiley-Liss, Inc.
Developments in label-free microfluidic methods for single-cell analysis and sorting.
Carey, Thomas R; Cotner, Kristen L; Li, Brian; Sohn, Lydia L
2018-04-24
Advancements in microfluidic technologies have led to the development of many new tools for both the characterization and sorting of single cells without the need for exogenous labels. Label-free microfluidics reduce the preparation time, reagents needed, and cost of conventional methods based on fluorescent or magnetic labels. Furthermore, these devices enable analysis of cell properties such as mechanical phenotype and dielectric parameters that cannot be characterized with traditional labels. Some of the most promising technologies for current and future development toward label-free, single-cell analysis and sorting include electronic sensors such as Coulter counters and electrical impedance cytometry; deformation analysis using optical traps and deformation cytometry; hydrodynamic sorting such as deterministic lateral displacement, inertial focusing, and microvortex trapping; and acoustic sorting using traveling or standing surface acoustic waves. These label-free microfluidic methods have been used to screen, sort, and analyze cells for a wide range of biomedical and clinical applications, including cell cycle monitoring, rapid complete blood counts, cancer diagnosis, metastatic progression monitoring, HIV and parasite detection, circulating tumor cell isolation, and point-of-care diagnostics. Because of the versatility of label-free methods for characterization and sorting, the low-cost nature of microfluidics, and the rapid prototyping capabilities of modern microfabrication, we expect this class of technology to continue to be an area of high research interest going forward. New developments in this field will contribute to the ongoing paradigm shift in cell analysis and sorting technologies toward label-free microfluidic devices, enabling new capabilities in biomedical research tools as well as clinical diagnostics. This article is categorized under: Diagnostic Tools > Biosensing Diagnostic Tools > Diagnostic Nanodevices. © 2018 Wiley Periodicals, Inc.
Peng, Tao; Hang, Howard C
2016-11-02
Over the past years, fluorescent proteins (e.g., green fluorescent proteins) have been widely utilized to visualize recombinant protein expression and localization in live cells. Although powerful, fluorescent protein tags are limited by their relatively large sizes and potential perturbation to protein function. Alternatively, site-specific labeling of proteins with small-molecule organic fluorophores using bioorthogonal chemistry may provide a more precise and less perturbing method. This approach involves site-specific incorporation of unnatural amino acids (UAAs) into proteins via genetic code expansion, followed by bioorthogonal chemical labeling with small organic fluorophores in living cells. While this approach has been used to label extracellular proteins for live cell imaging studies, site-specific bioorthogonal labeling and fluorescence imaging of intracellular proteins in live cells is still challenging. Herein, we systematically evaluate site-specific incorporation of diastereomerically pure bioorthogonal UAAs bearing stained alkynes or alkenes into intracellular proteins for inverse-electron-demand Diels-Alder cycloaddition reactions with tetrazine-functionalized fluorophores for live cell labeling and imaging in mammalian cells. Our studies show that site-specific incorporation of axial diastereomer of trans-cyclooct-2-ene-lysine robustly affords highly efficient and specific bioorthogonal labeling with monosubstituted tetrazine fluorophores in live mammalian cells, which enabled us to image the intracellular localization and real-time dynamic trafficking of IFITM3, a small membrane-associated protein with only 137 amino acids, for the first time. Our optimized UAA incorporation and bioorthogonal labeling conditions also enabled efficient site-specific fluorescence labeling of other intracellular proteins for live cell imaging studies in mammalian cells.
Sawarkar, Ritwick; Visweswariah, Sandhya S; Nellen, Wolfgang; Nanjundiah, Vidyanand
2009-09-04
Epigenetic modifications of histones regulate gene expression and lead to the establishment and maintenance of cellular phenotypes during development. Histone acetylation depends on a balance between the activities of histone acetyltransferases and histone deacetylases (HDACs) and influences transcriptional regulation. In this study, we analyse the roles of HDACs during growth and development of one of the cellular slime moulds, the social amoeba Dictyostelium discoideum. The inhibition of HDAC activity by trichostatin A results in histone hyperacetylation and a delay in cell aggregation and differentiation. Cyclic AMP oscillations are normal in starved amoebae treated with trichostatin A but the expression of a subset of cAMP-regulated genes is delayed. Bioinformatic analysis indicates that there are four genes encoding putative HDACs in D. discoideum. Using biochemical, genetic and developmental approaches, we demonstrate that one of these four genes, hdaB, is dispensable for growth and development under laboratory conditions. A knockout of the hdaB gene results in a social context-dependent phenotype: hdaB(-) cells develop normally but sporulate less efficiently than the wild type in chimeras. We infer that HDAC activity is important for regulating the timing of gene expression during the development of D. discoideum and for defining aspects of the phenotype that mediate social behaviour in genetically heterogeneous groups.
Ultra-fast stem cell labelling using cationised magnetoferritin
NASA Astrophysics Data System (ADS)
Correia Carreira, S.; Armstrong, J. P. K.; Seddon, A. M.; Perriman, A. W.; Hartley-Davies, R.; Schwarzacher, W.
2016-03-01
Magnetic cell labelling with superparamagnetic iron oxide nanoparticles (SPIONs) facilitates many important biotechnological applications, such as cell imaging and remote manipulation. However, to achieve adequate cellular loading of SPIONs, long incubation times (24 hours and more) or laborious surface functionalisation are often employed, which can adversely affect cell function. Here, we demonstrate that chemical cationisation of magnetoferritin produces a highly membrane-active nanoparticle that can magnetise human mesenchymal stem cells (hMSCs) using incubation times as short as one minute. Magnetisation persisted for several weeks in culture and provided significant T2* contrast enhancement during magnetic resonance imaging. Exposure to cationised magnetoferritin did not adversely affect the membrane integrity, proliferation and multi-lineage differentiation capacity of hMSCs, which provides the first detailed evidence for the biocompatibility of magnetoferritin. The combination of synthetic ease and flexibility, the rapidity of labelling and absence of cytotoxicity make this novel nanoparticle system an easily accessible and versatile platform for a range of cell-based therapies in regenerative medicine.Magnetic cell labelling with superparamagnetic iron oxide nanoparticles (SPIONs) facilitates many important biotechnological applications, such as cell imaging and remote manipulation. However, to achieve adequate cellular loading of SPIONs, long incubation times (24 hours and more) or laborious surface functionalisation are often employed, which can adversely affect cell function. Here, we demonstrate that chemical cationisation of magnetoferritin produces a highly membrane-active nanoparticle that can magnetise human mesenchymal stem cells (hMSCs) using incubation times as short as one minute. Magnetisation persisted for several weeks in culture and provided significant T2* contrast enhancement during magnetic resonance imaging. Exposure to cationised
Stripe-patterned thermo-responsive cell culture dish for cell separation without cell labeling.
Kumashiro, Yoshikazu; Ishihara, Jun; Umemoto, Terumasa; Itoga, Kazuyoshi; Kobayashi, Jun; Shimizu, Tatsuya; Yamato, Masayuki; Okano, Teruo
2015-02-11
A stripe-patterned thermo-responsive surface is prepared to enable cell separation without labeling. The thermo-responsive surface containing a 3 μm striped pattern exhibits various cell adhesion and detachment properties. A mixture of three cell types is separated on the patterned surface based on their distinct cell-adhesion properties, and the composition of the cells is analyzed by flow cytometry. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Labeling proteins inside living cells using external fluorophores for microscopy.
Teng, Kai Wen; Ishitsuka, Yuji; Ren, Pin; Youn, Yeoan; Deng, Xiang; Ge, Pinghua; Lee, Sang Hak; Belmont, Andrew S; Selvin, Paul R
2016-12-09
Site-specific fluorescent labeling of proteins inside live mammalian cells has been achieved by employing Streptolysin O, a bacterial enzyme which forms temporary pores in the membrane and allows delivery of virtually any fluorescent probes, ranging from labeled IgG's to small ligands, with high efficiency (>85% of cells). The whole process, including recovery, takes 30 min, and the cell is ready to be imaged immediately. A variety of cell viability tests were performed after treatment with SLO to ensure that the cells have intact membranes, are able to divide, respond normally to signaling molecules, and maintains healthy organelle morphology. When combined with Oxyrase, a cell-friendly photostabilizer, a ~20x improvement in fluorescence photostability is achieved. By adding in glutathione, fluorophores are made to blink, enabling super-resolution fluorescence with 20-30 nm resolution over a long time (~30 min) under continuous illumination. Example applications in conventional and super-resolution imaging of native and transfected cells include p65 signal transduction activation, single molecule tracking of kinesin, and specific labeling of a series of nuclear and cytoplasmic protein complexes.
Nicholls, Francesca J.; Liu, Jessie R.; Modo, Michel
2017-01-01
The interpretation of cell transplantation experiments is often dependent on the presence of an exogenous label for the identification of implanted cells. The exogenous labels Hoechst 33342, 5-bromo-2′-deoxyuridine (BrdU), PKH26, and Qtracker were compared for their labeling efficiency, cellular effects, and reliability to identify a human neural stem cell (hNSC) line implanted intracerebrally into the rat brain. Hoechst 33342 (2 mg/ml) exhibited a delayed cytotoxicity that killed all cells within 7 days. This label was hence not progressed to in vivo studies. PKH26 (5 μM), Qtracker (15 nM), and BrdU (0.2 μM) labeled 100% of the cell population at day 1, although BrdU labeling declined by day 7. BrdU and Qtracker exerted effects on proliferation and differentiation. PKH26 reduced viability and proliferation at day 1, but this normalized by day 7. In an in vitro coculture assay, all labels transferred to unlabeled cells. After transplantation, the reliability of exogenous labels was assessed against the gold standard of a human-specific nuclear antigen (HNA) antibody. BrdU, PKH26, and Qtracker resulted in a very small proportion (<2%) of false positives, but a significant amount of false negatives (~30%), with little change between 1 and 7 days. Exogenous labels can therefore be reliable to identify transplanted cells without exerting major cellular effects, but validation is required. The interpretation of cell transplantation experiments should be presented in the context of the label's limitations. PMID:27938486
Cryo-imaging of fluorescently labeled single cells in a mouse
NASA Astrophysics Data System (ADS)
Steyer, Grant J.; Roy, Debashish; Salvado, Olivier; Stone, Meredith E.; Wilson, David L.
2009-02-01
We developed a cryo-imaging system to provide single-cell detection of fluorescently labeled cells in mouse, with particular applicability to stem cells and metastatic cancer. The Case cryoimaging system consists of a fluorescence microscope, robotic imaging positioner, customized cryostat, PC-based control system, and visualization/analysis software. The system alternates between sectioning (10-40 μm) and imaging, collecting color brightfield and fluorescent blockface image volumes >60GB. In mouse experiments, we imaged quantum-dot labeled stem cells, GFP-labeled cancer and stem cells, and cell-size fluorescent microspheres. To remove subsurface fluorescence, we used a simplified model of light-tissue interaction whereby the next image was scaled, blurred, and subtracted from the current image. We estimated scaling and blurring parameters by minimizing entropy of subtracted images. Tissue specific attenuation parameters were found [uT : heart (267 +/- 47.6 μm), liver (218 +/- 27.1 μm), brain (161 +/- 27.4 μm)] to be within the range of estimates in the literature. "Next image" processing removed subsurface fluorescence equally well across multiple tissues (brain, kidney, liver, adipose tissue, etc.), and analysis of 200 microsphere images in the brain gave 97+/-2% reduction of subsurface fluorescence. Fluorescent signals were determined to arise from single cells based upon geometric and integrated intensity measurements. Next image processing greatly improved axial resolution, enabled high quality 3D volume renderings, and improved enumeration of single cells with connected component analysis by up to 24%. Analysis of image volumes identified metastatic cancer sites, found homing of stem cells to injury sites, and showed microsphere distribution correlated with blood flow patterns. We developed and evaluated cryo-imaging to provide single-cell detection of fluorescently labeled cells in mouse. Our cryo-imaging system provides extreme (>60GB), micron
In Situ Live-Cell Nucleus Fluorescence Labeling with Bioinspired Fluorescent Probes.
Ding, Pan; Wang, Houyu; Song, Bin; Ji, Xiaoyuan; Su, Yuanyuan; He, Yao
2017-08-01
Fluorescent imaging techniques for visualization of nuclear structure and function in live cells are fundamentally important for exploring major cellular events. The ideal cellular labeling method is capable of realizing label-free, in situ, real-time, and long-term nucleus labeling in live cells, which can fully obtain the nucleus-relative information and effectively alleviate negative effects of alien probes on cellular metabolism. However, current established fluorescent probes-based strategies (e.g., fluorescent proteins-, organic dyes-, fluorescent organic/inorganic nanoparticles-based imaging techniques) are unable to simultaneously realize label-free, in situ, long-term, and real-time nucleus labeling, resulting in inevitable difficulties in fully visualizing nuclear structure and function in live cells. To this end, we present a type of bioinspired fluorescent probes, which are highly efficacious for in situ and label-free tracking of nucleus in long-term and real-time manners. Typically, the bioinspired polydopamine (PDA) nanoparticles, served as fluorescent probes, can be readily synthesized in situ within live cell nucleus without any further modifications under physiological conditions (37 °C, pH ∼7.4). Compared with other conventional nuclear dyes (e.g., propidium iodide (PI), Hoechst), superior spectroscopic properties (e.g., quantum yield of ∼35.8% and high photostability) and low cytotoxicity of PDA-based probes enable long-term (e.g., 3 h) fluorescence tracking of nucleus. We also demonstrate the generality of this type of bioinspired fluorescent probes in different cell lines and complex biological samples.
Polyelectrolyte coating of ferumoxytol nanoparticles for labeling of dendritic cells
NASA Astrophysics Data System (ADS)
Celikkin, Nehar; Jakubcová, Lucie; Zenke, Martin; Hoss, Mareike; Wong, John Erik; Hieronymus, Thomas
2015-04-01
Engineered magnetic nanoparticles (MNPs) are emerging to be used as cell tracers, drug delivery vehicles, and contrast agents for magnetic resonance imaging (MRI) for enhanced theragnostic applications in biomedicine. In vitro labeling of target cell populations with MNPs and their implantation into animal models and patients shows promising outcomes in monitoring successful cell engraftment, differentiation and migration by using MRI. Dendritic cells (DCs) are professional antigen-presenting cells that initiate adaptive immune responses. Thus, DCs have been the focus of cellular immunotherapy and are increasingly applied in clinical trials. Here, we addressed the coating of different polyelectrolytes (PE) around ferumoxytol particles using the layer-by-layer technique. The impact of PE-coated ferumoxytol particles for labeling of DCs and Flt3+ DC progenitors was then investigated. The results from our studies revealed that PE-coated ferumoxytol particles can be readily employed for labeling of DC and DC progenitors and thus are potentially suitable as contrast agents for MRI tracking.
Labeling single cell for in-vivo study of cell fate mapping and lineage tracing
NASA Astrophysics Data System (ADS)
He, Sicong; Xu, Jin; Wu, Yi; Tian, Ye; Sun, Qiqi; Wen, Zilong; Qu, Jianan Y.
2018-02-01
Cell fate mapping and lineage tracing are significant ways to understanding the developmental origins of biological tissues. It requires labeling individual cells and tracing the development of their progeny. We develop an infrared laser-evoked gene operator heat-shock microscope system to achieve single-cell labeling in zebrafish. With a fluorescent thermometry technique, we measure the temperature increase in zebrafish tissues induced by infrared laser and identify the optimal heat shock conditions for single-cell gene induction in different types of zebrafish cells. We use this technique to study the fate mapping of T lymphocytes and discover the distinct waves of lymphopoiesis during the zebrafish development.
Hobdey, Sarah E.; Knott, Brandon C.; Momeni, Majid Haddad; ...
2016-04-01
Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes often employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7Amore » and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7A CBM and DpuCel7A CBM, which were recombinantly expressed in T. reesei. DdiCel7A CBM and DpuCel7A CBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The K i of cellobiose was significantly higher for DdiCel7A CBM and DpuCel7A CBM than for TreCel7A: 205, 130, and 29 μM, respectively. Finally, taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hobdey, Sarah E.; Knott, Brandon C.; Momeni, Majid Haddad
Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes often employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7Amore » and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7A CBM and DpuCel7A CBM, which were recombinantly expressed in T. reesei. DdiCel7A CBM and DpuCel7A CBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The K i of cellobiose was significantly higher for DdiCel7A CBM and DpuCel7A CBM than for TreCel7A: 205, 130, and 29 μM, respectively. Finally, taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life.« less
Single cell systems biology by super-resolution imaging and combinatorial labeling
Lubeck, Eric; Cai, Long
2012-01-01
Fluorescence microscopy is a powerful quantitative tool for exploring regulatory networks in single cells. However, the number of molecular species that can be measured simultaneously is limited by the spectral separability of fluorophores. Here we demonstrate a simple but general strategy to drastically increase the capacity for multiplex detection of molecules in single cells by using optical super-resolution microscopy (SRM) and combinatorial labeling. As a proof of principle, we labeled mRNAs with unique combinations of fluorophores using Fluorescence in situ Hybridization (FISH), and resolved the sequences and combinations of fluorophores with SRM. We measured the mRNA levels of 32 genes simultaneously in single S. cerevisiae cells. These experiments demonstrate that combinatorial labeling and super-resolution imaging of single cells provides a natural approach to bring systems biology into single cells. PMID:22660740
Subcellular SIMS imaging of isotopically labeled amino acids in cryogenically prepared cells
NASA Astrophysics Data System (ADS)
Chandra, Subhash
2004-06-01
Ion microscopy is a potentially powerful technique for localization of isotopically labeled molecules. In this study, L-arginine and phenylalanine amino acids labeled with stable isotopes 13C and 15N were localized in cultured cells with the ion microscope at 500 nm spatial resolution. Cells were exposed to the labeled amino acids and cryogenically prepared. SIMS analyses were made in fractured freeze-dried cells. A dynamic distribution was observed from labeled arginine-treated LLC-PK 1 kidney cells at mass 28 ( 13C15N) in negative secondaries, revealing cell-to-cell heterogeneity and preferential accumulation of the amino acid (or its metabolite) in the nucleus and nucleolus of some cells. The smaller nucleolus inside the nucleus was clearly resolved in SIMS images and confirmed by correlative light microscopy. The distribution of labeled phenylalanine contrasted with arginine as it was rather homogeneously distributed in T98G human glioblastoma cells. Images of 39K, 23Na and 40Ca were also recorded to confirm the reliability of sample preparation and authenticity of the observed amino acid distributions. These observations indicate that SIMS techniques can provide a valuable technology for subcellular localization of nitrogen-containing molecules in proteomics since nitrogen does not have a radionuclide tracer isotope. Amino acids labeled with stable isotopes can be used as tracers for studying their transport and metabolism in distinct subcellular compartments with SIMS. Further studies of phenylalanine uptake in human glioblastoma cells may have special significance in boron neutron capture therapy (BNCT) as a boron analogue of phenylalanine, boronophenylalanine is a clinically approved compound for the treatment of brain tumors.
The Protein Corona around Nanoparticles Facilitates Stem Cell Labeling for Clinical MR Imaging.
Nejadnik, Hossein; Taghavi-Garmestani, Seyed-Meghdad; Madsen, Steven J; Li, Kai; Zanganeh, Saeid; Yang, Phillip; Mahmoudi, Morteza; Daldrup-Link, Heike E
2018-03-01
Purpose To evaluate if the formation of a protein corona around ferumoxytol nanoparticles can facilitate stem cell labeling for in vivo tracking with magnetic resonance (MR) imaging. Materials and Methods Ferumoxytol was incubated in media containing human serum (group 1), fetal bovine serum (group 2), StemPro medium (group 3), protamine (group 4), and protamine plus heparin (group 5). Formation of a protein corona was characterized by means of dynamic light scattering, ζ potential, and liquid chromatography-mass spectrometry. Iron uptake was evaluated with 3,3'-diaminobenzidine-Prussian blue staining, lysosomal staining, and inductively coupled plasma spectrometry. To evaluate the effect of a protein corona on stem cell labeling, human mesenchymal stem cells (hMSCs) were labeled with the above formulations, implanted into pig knee specimens, and investigated with T2-weighted fast spin-echo and multiecho spin-echo sequences on a 3.0-T MR imaging unit. Data in different groups were compared by using a Kruskal-Wallis test. Results Compared with bare nanoparticles, all experimental groups showed significantly increased negative ζ values (from -37 to less than -10; P = .008). Nanoparticles in groups 1-3 showed an increased size because of the formation of a protein corona. hMSCs labeled with group 1-5 media showed significantly shortened T2 relaxation times compared with unlabeled control cells (P = .0012). hMSCs labeled with group 3 and 5 media had the highest iron uptake after cells labeled with group 1 medium. After implantation into pig knees, hMSCs labeled with group 1 medium showed significantly shorter T2 relaxation times than hMSCs labeled with group 2-5 media (P = .0022). Conclusion The protein corona around ferumoxytol nanoparticles can facilitate stem cell labeling for clinical cell tracking with MR imaging. © RSNA, 2017 Online supplemental material is available for this article.
Lee, Jinwoo; Miyanaga, Yukihiro; Ueda, Masahiro; Hohng, Sungchul
2012-01-01
There is no confocal microscope optimized for single-molecule imaging in live cells and superresolution fluorescence imaging. By combining the swiftness of the line-scanning method and the high sensitivity of wide-field detection, we have developed a, to our knowledge, novel confocal fluorescence microscope with a good optical-sectioning capability (1.0 μm), fast frame rates (<33 fps), and superior fluorescence detection efficiency. Full compatibility of the microscope with conventional cell-imaging techniques allowed us to do single-molecule imaging with a great ease at arbitrary depths of live cells. With the new microscope, we monitored diffusion motion of fluorescently labeled cAMP receptors of Dictyostelium discoideum at both the basal and apical surfaces and obtained superresolution fluorescence images of microtubules of COS-7 cells at depths in the range 0–85 μm from the surface of a coverglass. PMID:23083712
Basu, Sankha S; Mesaros, Clementina; Gelhaus, Stacy L; Blair, Ian A
2011-02-15
Stable isotope dilution mass spectrometry (MS) represents the gold standard for quantification of endogenously formed cellular metabolites. Although coenzyme A (CoA) and acyl-CoA thioester derivatives are central players in numerous metabolic pathways, the lack of a commercially available isotopically labeled CoA limits the development of rigorous MS-based methods. In this study, we adapted stable isotope labeling by amino acids in cell culture (SILAC) methodology to biosynthetically generate stable isotope labeled CoA and thioester analogues for use as internal standards in liquid chromatography/multiple reaction monitoring mass spectrometry (LC/MRM-MS) assays. This was accomplished by incubating murine hepatocytes (Hepa 1c1c7) in media in which pantothenate (a precursor of CoA) was replaced with [(13)C(3)(15)N(1)]-pantothenate. Efficient incorporation into various CoA species was optimized to >99% [(13)C(3)(15)N(1)]-pantothenate after three passages of the murine cells in culture. Charcoal-dextran-stripped fetal bovine serum (FBS) was found to be more efficient for serum supplementation than dialyzed or undialyzed FBS, due to lower contaminating unlabeled pantothenate content. Stable isotope labeled CoA species were extracted and utilized as internal standards for CoA thioester analysis in cell culture models. This methodology of stable isotope labeling by essential nutrients in cell culture (SILEC) can serve as a paradigm for using vitamins and other essential nutrients to generate stable isotope standards that cannot be readily synthesized.
Escherichia coli cell-free protein synthesis and isotope labeling of mammalian proteins.
Terada, Takaho; Yokoyama, Shigeyuki
2015-01-01
This chapter describes the cell-free protein synthesis method, using an Escherichia coli cell extract. This is a cost-effective method for milligram-scale protein production and is particularly useful for the production of mammalian proteins, protein complexes, and membrane proteins that are difficult to synthesize by recombinant expression methods, using E. coli and eukaryotic cells. By adjusting the conditions of the cell-free method, zinc-binding proteins, disulfide-bonded proteins, ligand-bound proteins, etc., may also be produced. Stable isotope labeling of proteins can be accomplished by the cell-free method, simply by using stable isotope-labeled amino acid(s) in the cell-free reaction. Moreover, the cell-free protein synthesis method facilitates the avoidance of stable isotope scrambling and dilution over the recombinant expression methods and is therefore advantageous for amino acid-selective stable isotope labeling. Site-specific stable isotope labeling is also possible with a tRNA molecule specific to the UAG codon. By the cell-free protein synthesis method, coupled transcription-translation is performed from a plasmid vector or a PCR-amplified DNA fragment encoding the protein. A milligram quantity of protein can be produced with a milliliter-scale reaction solution in the dialysis mode. More than a thousand solution structures have been determined by NMR spectroscopy for uniformly labeled samples of human and mouse functional domain proteins, produced by the cell-free method. Here, we describe the practical aspects of mammalian protein production by the cell-free method for NMR spectroscopy. © 2015 Elsevier Inc. All rights reserved.
Algal autolysate medium to label proteins for NMR in mammalian cells.
Fuccio, Carmelo; Luchinat, Enrico; Barbieri, Letizia; Neri, Sara; Fragai, Marco
2016-04-01
In-cell NMR provides structural and functional information on proteins directly inside living cells. At present, the high costs of the labeled media for mammalian cells represent a limiting factor for the development of this methodology. Here we report a protocol to prepare a homemade growth medium from Spirulina platensis autolysate, suitable to express uniformly labeled proteins inside mammalian cells at a reduced cost-per-sample. The human proteins SOD1 and Mia40 were overexpressed in human cells grown in (15)N-enriched S. platensis algal-derived medium, and high quality in-cell NMR spectra were obtained.
A genetically encoded and gate for cell-targeted metabolic labeling of proteins.
Mahdavi, Alborz; Segall-Shapiro, Thomas H; Kou, Songzi; Jindal, Granton A; Hoff, Kevin G; Liu, Shirley; Chitsaz, Mohsen; Ismagilov, Rustem F; Silberg, Jonathan J; Tirrell, David A
2013-02-27
We describe a genetic AND gate for cell-targeted metabolic labeling and proteomic analysis in complex cellular systems. The centerpiece of the AND gate is a bisected methionyl-tRNA synthetase (MetRS) that charges the Met surrogate azidonorleucine (Anl) to tRNA(Met). Cellular protein labeling occurs only upon activation of two different promoters that drive expression of the N- and C-terminal fragments of the bisected MetRS. Anl-labeled proteins can be tagged with fluorescent dyes or affinity reagents via either copper-catalyzed or strain-promoted azide-alkyne cycloaddition. Protein labeling is apparent within 5 min after addition of Anl to bacterial cells in which the AND gate has been activated. This method allows spatial and temporal control of proteomic labeling and identification of proteins made in specific cellular subpopulations. The approach is demonstrated by selective labeling of proteins in bacterial cells immobilized in the center of a laminar-flow microfluidic channel, where they are exposed to overlapping, opposed gradients of inducers of the N- and C-terminal MetRS fragments. The observed labeling profile is predicted accurately from the strengths of the individual input signals.
A Genetically Encoded AND Gate for Cell-Targeted Metabolic Labeling of Proteins
Mahdavi, Alborz; Segall-Shapiro, Thomas H.; Kou, Songzi; Jindal, Granton A.; Hoff, Kevin G.; Liu, Shirley; Chitsaz, Mohsen; Ismagilov, Rustem F.; Silberg, Jonathan J.; Tirrell, David A.
2013-01-01
We describe a genetic AND gate for cell-targeted metabolic labeling and proteomic analysis in complex cellular systems. The centerpiece of the AND gate is a bisected methionyl-tRNA synthetase (MetRS) that charges the Met surrogate azidonorleucine (Anl) to tRNAMet. Cellular protein labeling occurs only upon activation of two different promoters that drive expression of the N- and C-terminal fragments of the bisected MetRS. Anl-labeled proteins can be tagged with fluorescent dyes or affinity reagents via either copper-catalyzed or strain-promoted azide-alkyne cycloaddition. Protein labeling is apparent within five minutes after addition of Anl to bacterial cells in which the AND gate has been activated. This method allows spatial and temporal control of proteomic labeling and identification of proteins made in specific cellular subpopulations. The approach is demonstrated by selective labeling of proteins in bacterial cells immobilized in the center of a laminar-flow microfluidic channel, where they are exposed to overlapping, opposed gradients of inducers of the N- and C-terminal MetRS fragments. The observed labeling profile is predicted accurately from the strengths of the individual input signals. PMID:23406315
NASA Astrophysics Data System (ADS)
Kemper, Björn; Bauwens, Andreas; Vollmer, Angelika; Ketelhut, Steffi; Langehanenberg, Patrik; Müthing, Johannes; Karch, Helge; von Bally, Gert
2010-05-01
Digital holographic microscopy (DHM) enables quantitative multifocus phase contrast imaging for nondestructive technical inspection and live cell analysis. Time-lapse investigations on human brain microvascular endothelial cells demonstrate the use of DHM for label-free dynamic quantitative monitoring of cell division of mother cells into daughter cells. Cytokinetic DHM analysis provides future applications in toxicology and cancer research.
Snyder, Nathaniel W.; Tombline, Gregory; Worth, Andrew J.; Parry, Robert C.; Silvers, Jacob A.; Gillespie, Kevin P.; Basu, Sankha S.; Millen, Jonathan; Goldfarb, David S.; Blair, Ian A.
2015-01-01
Acyl-coenzyme A (CoA) thioesters are key metabolites in numerous anabolic and catabolic pathways, including fatty acid biosynthesis and β-oxidation, the Krebs cycle, and cholesterol and isoprenoid biosynthesis. Stable isotope dilution-based methodology is the gold standard for quantitative analyses by mass spectrometry. However, chemical synthesis of families of stable isotope labeled metabolites such as acyl-coenzyme A thioesters is impractical. Previously, we biosynthetically generated a library of stable isotope internal standard analogs of acyl-CoA thioesters by exploiting the essential requirement in mammals and insects for pantothenic acid (vitamin B5) as a metabolic precursor for the CoA backbone. By replacing pantothenic acid in the cell media with commercially available [13C3 15N1]-pantothenic acid, mammalian cells exclusively incorporated [13C3 15N1]-pantothenate into the biosynthesis of acyl-CoA and acyl-CoA thioesters. We have now developed a much more efficient method for generating stable isotope labeled CoA and acyl-CoAs from [13C3 15N1]-pantothenate using Stable Isotope Labeling by Essential nutrients in Cell culture (SILEC) in Pan6 deficient yeast cells. Efficiency and consistency of labeling were also increased, likely due to the stringently defined and reproducible conditions used for yeast culture. The yeast SILEC method greatly enhances the ease of use and accessibility of labeled CoA thioesters and also provides proof-of-concept for generating other labeled metabolites in yeast mutants. PMID:25572876
Fate of 3H-thymidine labelled myogenic cells in regeneration of muscle isografts.
Gutmann, E; Mares, V; Stichová, J
1976-03-05
Intact and denervated extensor digitorum longus (EDL) muscles of 20-day-old inbred Lewis-Wistar rats were labelled with 3H-thymidine. Ninety minutes after the injection of the isotope 4.0% of the nuclei were labelled in the intact (i.e. innervated) and 9.6% in the muscles, denervated 3 days before administration of the isotope. The labelled EDL muscles were grafted into the bed of the previously removed EDL muscles of inbred animals and these isografts were studied 30 days later. In the EDL muscles, regenerated from innervated isografts only occasionally labelled endothelial cells were found whereas in the muscles regenerated from denervated isografts also parenchymal muscle nuclei were regularly labelled. The incidence of labelled nuclei in the regenerated EDL muscles was, however, about 20 times lower than in the donor EDL muscles. The presen experiments provide a direct proof of utilization of donor satelite cell nuclei for regeneration in grafted muscle tissue. With respect to the low incidence of labelled nuclei in regenerated EDL muscles, other sources of cells apparently also contribute to the regeneration process.
Technetium-99m labeled red blood cells in the evaluation of hemangiosarcoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Joseph, U.A.; Jhingran, S.G.
Imaging with Tc-99m labeled red blood cells (RBC) is increasingly being used in the detection of acute gastro-intestinal bleeding, especially in patients with intermittent bleeding. A patient is presented in whom the labeled RBC scan was helpful in the incidental discovery of a previously unsuspected probable angiosarcoma of the right femur and adjacent soft tissues of the right hip due to the blood pool or blush effect of the labeled cells. The labeled RBC scan also identified extravasation due to active gastrointestinal bleeding from a previously unknown angiosarcoma of the ascending colon. Thus, the Tc-99m labeled RBC scan was usefulmore » in simultaneously detecting extravasation and blood pool effect at two remote tumor sites in the same patient.« less
Peckys, Diana B; Dukes, Madeline J; de Jonge, Niels
2014-01-01
Correlative fluorescence microscopy and scanning transmission electron microscopy (STEM) of cells fully immersed in liquid is a new methodology with many application areas. Proteins, in live cells immobilized on microchips, are labeled with fluorescent quantum dot (QD) nanoparticles. In this protocol, the epidermal growth factor receptor (EGFR) is labeled. The cells are fixed after a selected labeling time, for example, 5 min as needed to form EGFR dimers. The microchip with cells is then imaged with fluorescence microscopy. Thereafter, the microchip with the labeled cells and one with a spacer are assembled in a special microfluidic device and imaged with STEM.
Dictyostelium mobile elements: strategies to amplify in a compact genome.
Winckler, T; Dingermann, T; Glöckner, G
2002-12-01
Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.
Fluorine-19 Labeling of Stromal Vascular Fraction Cells for Clinical Imaging Applications
Rose, Laura C.; Kadayakkara, Deepak K.; Wang, Guan; Bar-Shir, Amnon; Helfer, Brooke M.; O’Hanlon, Charles F.; Kraitchman, Dara L.; Rodriguez, Ricardo L.
2015-01-01
Stromal vascular fraction (SVF) cells are used clinically for various therapeutic targets. The location and persistence of engrafted SVF cells are important parameters for determining treatment failure versus success. We used the GID SVF-1 platform and a clinical protocol to harvest and label SVF cells with the fluorinated (19F) agent CS-1000 as part of a first-in-human phase I trial (clinicaltrials.gov identifier NCT02035085) to track SVF cells with magnetic resonance imaging during treatment of radiation-induced fibrosis in breast cancer patients. Flow cytometry revealed that SVF cells consisted of 25.0% ± 15.8% CD45+, 24.6% ± 12.5% CD34+, and 7.5% ± 3.3% CD31+ cells, with 2.1 ± 0.7 × 105 cells per cubic centimeter of adipose tissue obtained. Fluorescent CS-1000 (CS-ATM DM Green) labeled 87.0% ± 13.5% of CD34+ progenitor cells compared with 47.8% ± 18.5% of hematopoietic CD45+ cells, with an average of 2.8 ± 2.0 × 1012 19F atoms per cell, determined using nuclear magnetic resonance spectroscopy. The vast majority (92.7% ± 5.0%) of CD31+ cells were also labeled, although most coexpressed CD34. Only 16% ± 22.3% of CD45−/CD31−/CD34− (triple-negative) cells were labeled with CS-ATM DM Green. After induction of cell death by either apoptosis or necrosis, >95% of 19F was released from the cells, indicating that fluorine retention can be used as a surrogate marker for cell survival. Labeled-SVF cells engrafted in a silicone breast phantom could be visualized with a clinical 3-Tesla magnetic resonance imaging scanner at a sensitivity of approximately 2 × 106 cells at a depth of 5 mm. The current protocol can be used to image transplanted SVF cells at clinically relevant cell concentrations in patients. Significance Stromal vascular fraction (SVF) cells harvested from adipose tissue offer great promise in regenerative medicine, but methods to track such cell therapies are needed to ensure correct administration and monitor survival. A clinical protocol
Label-free density difference amplification-based cell sorting.
Song, Jihwan; Song, Minsun; Kang, Taewook; Kim, Dongchoul; Lee, Luke P
2014-11-01
The selective cell separation is a critical step in fundamental life sciences, translational medicine, biotechnology, and energy harvesting. Conventional cell separation methods are fluorescent activated cell sorting and magnetic-activated cell sorting based on fluorescent probes and magnetic particles on cell surfaces. Label-free cell separation methods such as Raman-activated cell sorting, electro-physiologically activated cell sorting, dielectric-activated cell sorting, or inertial microfluidic cell sorting are, however, limited when separating cells of the same kind or cells with similar sizes and dielectric properties, as well as similar electrophysiological phenotypes. Here we report a label-free density difference amplification-based cell sorting (dDACS) without using any external optical, magnetic, electrical forces, or fluidic activations. The conceptual microfluidic design consists of an inlet, hydraulic jump cavity, and multiple outlets. Incoming particles experience gravity, buoyancy, and drag forces in the separation chamber. The height and distance that each particle can reach in the chamber are different and depend on its density, thus allowing for the separation of particles into multiple outlets. The separation behavior of the particles, based on the ratio of the channel heights of the inlet and chamber and Reynolds number has been systematically studied. Numerical simulation reveals that the difference between the heights of only lighter particles with densities close to that of water increases with increasing the ratio of the channel heights, while decreasing Reynolds number can amplify the difference in the heights between the particles considered irrespective of their densities.
Interfacial Polymerization for Colorimetric Labeling of Protein Expression in Cells
Lilly, Jacob L.; Sheldon, Phillip R.; Hoversten, Liv J.; Romero, Gabriela; Balasubramaniam, Vivek; Berron, Brad J.
2014-01-01
Determining the location of rare proteins in cells typically requires the use of on-sample amplification. Antibody based recognition and enzymatic amplification is used to produce large amounts of visible label at the site of protein expression, but these techniques suffer from the presence of nonspecific reactivity in the biological sample and from poor spatial control over the label. Polymerization based amplification is a recently developed alternative means of creating an on-sample amplification for fluorescence applications, while not suffering from endogenous labels or loss of signal localization. This manuscript builds upon polymerization based amplification by developing a stable, archivable, and colorimetric mode of amplification termed Polymer Dye Labeling. The basic concept involves an interfacial polymer grown at the site of protein expression and subsequent staining of this polymer with an appropriate dye. The dyes Evans Blue and eosin were initially investigated for colorimetric response in a microarray setting, where both specifically stained polymer films on glass. The process was translated to the staining of protein expression in human dermal fibroblast cells, and Polymer Dye Labeling was specific to regions consistent with desired protein expression. The labeling is stable for over 200 days in ambient conditions and is also compatible with modern mounting medium. PMID:25536421
Interfacial polymerization for colorimetric labeling of protein expression in cells.
Lilly, Jacob L; Sheldon, Phillip R; Hoversten, Liv J; Romero, Gabriela; Balasubramaniam, Vivek; Berron, Brad J
2014-01-01
Determining the location of rare proteins in cells typically requires the use of on-sample amplification. Antibody based recognition and enzymatic amplification is used to produce large amounts of visible label at the site of protein expression, but these techniques suffer from the presence of nonspecific reactivity in the biological sample and from poor spatial control over the label. Polymerization based amplification is a recently developed alternative means of creating an on-sample amplification for fluorescence applications, while not suffering from endogenous labels or loss of signal localization. This manuscript builds upon polymerization based amplification by developing a stable, archivable, and colorimetric mode of amplification termed Polymer Dye Labeling. The basic concept involves an interfacial polymer grown at the site of protein expression and subsequent staining of this polymer with an appropriate dye. The dyes Evans Blue and eosin were initially investigated for colorimetric response in a microarray setting, where both specifically stained polymer films on glass. The process was translated to the staining of protein expression in human dermal fibroblast cells, and Polymer Dye Labeling was specific to regions consistent with desired protein expression. The labeling is stable for over 200 days in ambient conditions and is also compatible with modern mounting medium.
Fink, Corby; Gaudet, Jeffrey M; Fox, Matthew S; Bhatt, Shashank; Viswanathan, Sowmya; Smith, Michael; Chin, Joseph; Foster, Paula J; Dekaban, Gregory A
2018-01-12
A 19 Fluorine ( 19 F) perfluorocarbon cell labeling agent, when employed with an appropriate cellular MRI protocol, allows for in vivo cell tracking. 19 F cellular MRI can be used to non-invasively assess the location and persistence of cell-based cancer vaccines and other cell-based therapies. This study was designed to determine the feasibility of labeling and tracking peripheral blood mononuclear cells (PBMC), a heterogeneous cell population. Under GMP-compliant conditions human PBMC were labeled with a 19 F-based MRI cell-labeling agent in a manner safe for autologous re-injection. Greater than 99% of PBMC labeled with the 19 F cell-labeling agent without affecting functionality or affecting viability. The 19 F-labeled PBMC were detected in vivo in a mouse model at the injection site and in a draining lymph node. A clinical cellular MR protocol was optimized for the detection of PBMC injected both at the surface of a porcine shank and at a depth of 1.2 cm, equivalent to depth of a human lymph node, using a dual 1 H/ 19 F dual switchable surface radio frequency coil. This study demonstrates it is feasible to label and track 19 F-labeled PBMC using clinical MRI protocols. Thus, 19 F cellular MRI represents a non-invasive imaging technique suitable to assess the effectiveness of cell-based cancer vaccines.
Lee, Jinwoo; Miyanaga, Yukihiro; Ueda, Masahiro; Hohng, Sungchul
2012-10-17
There is no confocal microscope optimized for single-molecule imaging in live cells and superresolution fluorescence imaging. By combining the swiftness of the line-scanning method and the high sensitivity of wide-field detection, we have developed a, to our knowledge, novel confocal fluorescence microscope with a good optical-sectioning capability (1.0 μm), fast frame rates (<33 fps), and superior fluorescence detection efficiency. Full compatibility of the microscope with conventional cell-imaging techniques allowed us to do single-molecule imaging with a great ease at arbitrary depths of live cells. With the new microscope, we monitored diffusion motion of fluorescently labeled cAMP receptors of Dictyostelium discoideum at both the basal and apical surfaces and obtained superresolution fluorescence images of microtubules of COS-7 cells at depths in the range 0-85 μm from the surface of a coverglass. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Quantum dot labeling and tracking of cultured limbal epithelial cell transplants in-vitro
Genicio, Nuria; Paramo, Juan Gallo; Shortt, Alex J.
2015-01-01
PURPOSE Cultured human limbal epithelial cells (HLEC) have shown promise in the treatment of limbal stem cell deficiency but little is known about their survival, behaviour and long-term fate post transplantation. The aim of this research was to evaluate, in-vitro, quantum dot (QDot) technology as a tool for tracking transplanted HLEC. METHODS In-vitro cultured HLEC were labeled with Qdot nanocrystals. Toxicity was assessed using live-dead assays. The effect on HLEC function was assessed using colony forming efficiency assays and expression of CK3, P63alpha and ABCG2. Sheets of cultured HLEC labeled with Qdot nanocrystals were transplanted onto decellularised human corneo-scleral rims in an organ culture model and observed to investigate the behaviour of transplanted cells. RESULTS Qdot labeling had no detrimental effect on HLEC viability or function in-vitro. Proliferation resulted in a gradual reduction in Qdot signal but sufficient signal was present to allow tracking of cells through multiple generations. Cells labeled with Qdots could be reliably detected and observed using confocal microscopy for at least 2 weeks post transplantation in our organ culture model. In addition it was possible to label and observe epithelial cells in intact human corneas using the Rostock corneal module adapted for use with the Heidelberg HRA. CONCLUSIONS This work demonstrates that Qdots combined with existing clinical equipment could be used to track HLEC for up to 2 weeks post transplantation, however, our model does not permit the assessment of cell labeling beyond 2 weeks. Further characterisation in in-vivo models are required. PMID:26024089
Tikhonenko, Irina; Irizarry, Karen; Khodjakov, Alexey; Koonce, Michael P.
2015-01-01
It has long been known that the interphase microtubule (MT) array is a key cellular scaffold that provides structural support and directs organelle trafficking in eukaryotic cells. Although in animal cells, a combination of centrosome nucleating properties and polymer dynamics at the distal microtubule ends is generally sufficient to establish a radial, polar array of MTs, little is known about how effector proteins (motors and crosslinkers) are coordinated to produce the diversity of interphase MT array morphologies found in nature. This diversity is particularly important in multinucleated environments where multiple MT arrays must coexist and function. We initiate here a study to address the higher ordered coordination of multiple, independent MT arrays in a common cytoplasm. Deletion of a MT crosslinker of the MAP65/Ase1/PRC1 family disrupts the spatial integrity of multiple arrays in Dictyostelium discoideum, reducing the distance between centrosomes and increasing the intermingling of MTs with opposite polarity. This result, coupled with previous dynein disruptions suggest a robust mechanism by which interphase MT arrays can utilize motors and crosslinkers to sense their position and minimize overlap in a common cytoplasm. PMID:26298292
Hitchens, T. Kevin; Liu, Li; Foley, Lesley M.; Simplaceanu, Virgil; Ahrens, Eric T.; Ho, Chien
2014-01-01
Purpose The ability to detect the migration of cells in living organisms is fundamental in understanding biological processes and important for the development of novel cell-based therapies to treat disease. MRI can be used to detect the migration of cells labeled with superparamagnetic iron-oxide (SPIO) or perfluorocarbon (PFC) agents. In this study, we explored combining these two cell-labeling approaches to overcome current limitations and enable new applications for cellular MRI. Methods We characterized 19F-NMR relaxation properties of PFC-labeled cells in the presence of SPIO and imaged cells both ex vivo and in vivo in a rodent inflammation model to demonstrate selective visualization of cell populations. Results We show that with UTE3D, RARE and FLASH 19F images one can uniquely identify PFC-labeled cells, co-localized PFC- and SPIO-labeled cells, and PFC/SPIO co-labeled cells. Conclusion This new methodology has the ability to improve and expand applications of MRI cell tracking. Combining PFC and SPIO strategies can potentially provide a method to quench PFC signal transferred from dead cells to macrophages, thereby eliminating false positives. In addition, combining these techniques could also be used to track two cell types simultaneously and probe cell-cell proximity in vivo with MRI. PMID:24478194
Amaike, Kazuma; Tamura, Tomonori; Hamachi, Itaru
2017-11-14
Endogenous protein labeling is one of the most invaluable methods for studying the bona fide functions of proteins in live cells. However, multi-molecular crowding conditions, such as those that occur in live cells, hamper the highly selective chemical labeling of a protein of interest (POI). We herein describe how the efficient coupling of molecular recognition with a chemical reaction is crucial for selective protein labeling. Recognition-driven protein labeling is carried out by a synthetic labeling reagent containing a protein (recognition) ligand, a reporter tag, and a reactive moiety. The molecular recognition of a POI can be used to greatly enhance the reaction kinetics and protein selectivity, even under live cell conditions. In this review, we also briefly discuss how such selective chemical labeling of an endogenous protein can have a variety of applications at the interface of chemistry and biology.
A pretargeted nanoparticle system for tumor cell labeling
Gunn, Jonathan; Park, Steven I.; Veiseh, Omid; Press, Oliver W.; Zhang, Miqin
2011-01-01
Nanoparticle-based cancer diagnostics and therapeutics can be significantly enhanced by selective tissue localization, but the strategy can be complicated by the requirement of a targeting ligand conjugated on nanoparticles, that is specific to only one or a limited few types of neoplastic cells, necessitating the development of multiple nanoparticle systems for different diseases. Here, we present a new nanoparticle system that capitalizes on a targeting pretreatment strategy, where a circulating fusion protein (FP) selectively prelabels the targeted cellular epitope, and a biotinylated iron oxide nanoparticle serves as a secondary label that binds to the FP on the target cell. This approach enables a single nanoparticle formulation to be used with any one of existing fusion proteins to bind a variety of target cells. We demonstrated this approach with two fusion proteins against two model cancer cell lines: lymphoma (Ramos) and leukemia (Jurkat), which showed 72.2% and 91.1% positive labeling, respectively. Notably, TEM analysis showed that a large nanoparticle population was endocytosed via attachment to the non-internalizing CD20 epitope. PMID:21107453
A pretargeted nanoparticle system for tumor cell labeling.
Gunn, Jonathan; Park, Steven I; Veiseh, Omid; Press, Oliver W; Zhang, Miqin
2011-03-01
Nanoparticle-based cancer diagnostics and therapeutics can be significantly enhanced by selective tissue localization, but the strategy can be complicated by the requirement of a targeting ligand conjugated on nanoparticles, that is specific to only one or a limited few types of neoplastic cells, necessitating the development of multiple nanoparticle systems for different diseases. Here, we present a new nanoparticle system that capitalizes on a targeting pretreatment strategy, where a circulating fusion protein (FP) selectively prelabels the targeted cellular epitope, and a biotinylated iron oxide nanoparticle serves as a secondary label that binds to the FP on the target cell. This approach enables a single nanoparticle formulation to be used with any one of existing fusion proteins to bind a variety of target cells. We demonstrated this approach with two fusion proteins against two model cancer cell lines: lymphoma (Ramos) and leukemia (Jurkat), which showed 72.2% and 91.1% positive labeling, respectively. Notably, TEM analysis showed that a large nanoparticle population was endocytosed via attachment to the non-internalizing CD20 epitope.
Kuwayama, Hidekazu; Kikuchi, Haruhisa; Oshima, Yoshiteru; Kubohara, Yuzuru
2016-12-01
In the development of the cellular slime mold Dictyostelium discoideum , two chlorinated compounds, the differentiation-inducing factors DIF-1 and DIF-2, play important roles in the regulation of both cell differentiation and chemotactic cell movement. However, the receptors of DIFs and the components of DIF signaling systems have not previously been elucidated. To identify the receptors for DIF-1 and DIF-2, we here performed DIF-conjugated affinity gel chromatography and liquid chromatography-tandem mass spectrometry and identified the glutathione S-transferase GST4 as a major DIF-binding protein. Knockout and overexpression mutants of gst4 ( gst4 - and gst4 OE , respectively) formed fruiting bodies, but the fruiting bodies of gst4 - cells were smaller than those of wild-type Ax2 cells, and those of gst4 OE cells were larger than those of Ax2 cells. Both chemotaxis regulation and in vitro stalk cell formation by DIFs in the gst4 mutants were similar to those of Ax2 cells. These results suggest that GST4 is a DIF-binding protein that regulates the sizes of cell aggregates and fruiting bodies in D. discoideum .
NASA Astrophysics Data System (ADS)
Taik Lim, Yong; Cho, Mi Young; Noh, Young-Woock; Chung, Jin Woong; Chung, Bong Hyun
2009-11-01
This study describes the development of near-infrared optical imaging technology for the monitoring of immunotherapeutic cell-based cancer therapy using natural killer (NK) cells labeled with fluorescent nanocrystals. Although NK cell-based immunotherapeutic strategies have drawn interest as potent preclinical or clinical methods of cancer therapy, there are few reports documenting the molecular imaging of NK cell-based cancer therapy, primarily due to the difficulty of labeling of NK cells with imaging probes. Human natural killer cells (NK92MI) were labeled with anti-human CD56 antibody-coated quantum dots (QD705) for fluorescence imaging. FACS analysis showed that the NK92MI cells labeled with anti-human CD56 antibody-coated QD705 have no effect on the cell viability. The effect of anti-human CD56 antibody-coated QD705 labeling on the NK92MI cell function was investigated by measuring interferon gamma (IFN- γ) production and cytolytic activity. Finally, the NK92MI cells labeled with anti-human CD56 antibody-coated QD705 showed a therapeutic effect similar to that of unlabeled NK92MI cells. Images of intratumorally injected NK92MI cells labeled with anti-human CD56 antibody-coated could be acquired using near-infrared optical imaging both in vivo and in vitro. This result demonstrates that the immunotherapeutic cells labeled with fluorescent nanocrystals can be a versatile platform for the effective tracking of injected therapeutic cells using optical imaging technology, which is very important in cell-based cancer therapies.
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
Xiao, Z; Devreotes, P N
1997-05-01
Unlike most other cellular proteins, the chemoattractant receptor, cAR1, of Dictyostelium is resistant to extraction by the zwitterionic detergent, CHAPS. We exploited this property to isolate a subcellular fraction highly enriched in cAR1 by flotation of CHAPS lysates of cells in sucrose density gradients. Immunogold electron microscopy studies revealed a homogeneous preparation of membrane bilayer sheets. This preparation, designated CHAPS-insoluble floating fraction (CHIEF), also contained a defined set of 20 other proteins and a single uncharged lipid. Cell surface biotinylation and preembedding immunoelectron microscopy both confirmed the plasma membrane origin of this preparation. The cell surface phosphodiesterase (PDE) and a downstream effector of cAR1, adenylate cyclase (ACA), were specifically localized in these structures, whereas the cell adhesion molecule gp80, most of the major cell surface membrane proteins, cytoskeletal components, the actin-binding integral membrane protein ponticulin, and G-protein alpha- and beta-subunits were absent. Overall, CHIFF represents about 3-5% of cell externally exposed membrane proteins. All of these results indicate that CHIFF is derived from specialized microdomains of the plasma membrane. The method of isolation is analogous to that of caveolae. However, we were unable to detect distinct caveolae-like structures on the cell surface associated with cAR1, which showed a diffuse staining profile. The discovery of CHIFF facilitates the purification of cAR1 and related signaling proteins and the biochemical characterization of receptor-mediated processes such as G-protein activation and desensitization. It also has important implications for the "fluid mosaic" model of the plasma membrane structures.
Xin, Hong-Wu; Hari, Danielle M.; Mullinax, John E.; Ambe, Chenwi M.; Koizumi, Tomotake; Ray, Satyajit; Anderson, Andrew J.; Wiegand, Gordon W.; Garfield, Susan H.; Thorgeirsson, Snorri S.; Avital, Itzhak
2012-01-01
Label-retaining cells (LRCs) have been proposed to represent adult tissue stem cells. LRCs are hypothesized to result from either slow cycling or asymmetric cell division (ACD). However, the stem cell nature and whether LRC undergo ACD remain controversial. Here, we demonstrate label-retaining cancer cells (LRCCs) in several gastrointestinal (GI) cancers including fresh surgical specimens. Using a novel method for isolation of live LRCC, we demonstrate that a subpopulation of LRCC is actively dividing and exhibits stem cells and pluripotency gene expression profiles. Using real-time confocal microscopic cinematography, we show live LRCC undergoing asymmetric nonrandom chromosomal cosegregation LRC division. Importantly, LRCCs have greater tumor-initiating capacity than non-LRCCs. Based on our data and that cancers develop in tissues that harbor normal-LRC, we propose that LRCC might represent a novel population of GI stem-like cancer cells. LRCC may provide novel mechanistic insights into the biology of cancer and regenerative medicine and present novel targets for cancer treatment. PMID:22331764
Sukumaran, Salil K.; Blau-Wasser, Rosemarie; Rohlfs, Meino; Gallinger, Christoph; Schleicher, Michael; Noegel, Angelika A
2015-01-01
CEP161 is a novel component of the Dictyostelium discoideum centrosome which was identified as binding partner of the pericentriolar component CP250. Here we show that the amino acids 1-763 of the 1381 amino acids CEP161 are sufficient for CP250 binding, centrosomal targeting and centrosome association. Analysis of AX2 cells over-expressing truncated and full length CEP161 proteins revealed defects in growth and development. By immunoprecipitation experiments we identified the Hippo related kinase SvkA (Hrk-svk) as binding partner for CEP161. Both proteins colocalize at the centrosome. In in vitro kinase assays the N-terminal domain of CEP161 (residues 1-763) inhibited the kinase activity of Hrk-svk. A comparison of D. discoideum Hippo kinase mutants with mutants overexpressing CEP161 polypeptides revealed similar defects. We propose that the centrosomal component CEP161 is a novel player in the Hippo signaling pathway and affects various cellular properties through this interaction. PMID:25607232
Stöhr, Katharina; Siegberg, Daniel; Ehrhard, Tanja; Lymperopoulos, Konstantinos; Öz, Simin; Schulmeister, Sonja; Pfeifer, Andrea C; Bachmann, Julie; Klingmüller, Ursula; Sourjik, Victor; Herten, Dirk-Peter
2010-10-01
Recent developments in fluorescence microscopy raise the demands for bright and photostable fluorescent tags for specific and background free labeling in living cells. Aside from fluorescent proteins and other tagging methods, labeling of SNAP-tagged proteins has become available thereby increasing the pool of potentially applicable fluorescent dyes for specific labeling of proteins. Here, we report on novel conjugates of benzylguanine (BG) which are quenched in their fluorescence and become highly fluorescent upon labeling of the SNAP-tag, the commercial variant of the human O(6)-alkylguanosyltransferase (hAGT). We identified four conjugates showing a strong increase, i.e., >10-fold, in fluorescence intensity upon labeling of SNAP-tag in vitro. Moreover, we screened a subset of nine BG-dye conjugates in living Escherichia coli and found them all suited for labeling of the SNAP-tag. Here, quenched BG-dye conjugates yield a higher specificity due to reduced contribution from excess conjugate to the fluorescence signal. We further extended the application of these conjugates by labeling a SNAP-tag fusion of the Tar chemoreceptor in live E. coli cells and the eukaryotic transcription factor STAT5b in NIH 3T3 mouse fibroblast cells. Aside from the labeling efficiency and specificity in living cells, we discuss possible mechanisms that might be responsible for the changes in fluorescence emission upon labeling of the SNAP-tag, as well as problems we encountered with nonspecific labeling with certain conjugates in eukaryotic cells.
Label-free measurements on cell apoptosis using a terahertz metamaterial-based biosensor
NASA Astrophysics Data System (ADS)
Zhang, Caihong; Liang, Lanju; Ding, Liang; Jin, Biaobing; Hou, Yayi; Li, Chun; Jiang, Ling; Liu, Weiwei; Hu, Wei; Lu, Yanqing; Kang, Lin; Xu, Weiwei; Chen, Jian; Wu, Peiheng
2016-06-01
Label-free, real-time, and in-situ measurement on cell apoptosis is highly desirable in cell biology. We propose here a design of terahertz (THz) metamaterial-based biosensor for meeting this requirement. This metamaterial consists of a planar array of five concentric subwavelength gold ring resonators on a 10 μm-thick polyimide substrate, which can sense the change of dielectric environment above the metamaterial. We employ this sensor to an oral cancer cell (SCC4) with and without cisplatin, a chemotherapy drug for cancer treatment, and find a linear relation between cell apoptosis measured by Flow Cytometry and the relative change of resonant frequencies of the metamaterial measured by THz time-domain spectroscopy. This implies that we can determine the cell apoptosis in a label-free manner. We believe that this metamaterial-based biosensor can be developed into a cheap, label-free, real-time, and in-situ detection tool, which is of significant impact on the study of cell biology.
Label-free cell separation and sorting in microfluidic systems
Gossett, Daniel R.; Weaver, Westbrook M.; Mach, Albert J.; Hur, Soojung Claire; Tse, Henry Tat Kwong; Lee, Wonhee; Amini, Hamed
2010-01-01
Cell separation and sorting are essential steps in cell biology research and in many diagnostic and therapeutic methods. Recently, there has been interest in methods which avoid the use of biochemical labels; numerous intrinsic biomarkers have been explored to identify cells including size, electrical polarizability, and hydrodynamic properties. This review highlights microfluidic techniques used for label-free discrimination and fractionation of cell populations. Microfluidic systems have been adopted to precisely handle single cells and interface with other tools for biochemical analysis. We analyzed many of these techniques, detailing their mode of separation, while concentrating on recent developments and evaluating their prospects for application. Furthermore, this was done from a perspective where inertial effects are considered important and general performance metrics were proposed which would ease comparison of reported technologies. Lastly, we assess the current state of these technologies and suggest directions which may make them more accessible. Figure A wide range of microfluidic technologies have been developed to separate and sort cells by taking advantage of differences in their intrinsic biophysical properties PMID:20419490
A microfluidics-based technique for automated and rapid labeling of cells for flow cytometry
NASA Astrophysics Data System (ADS)
Patibandla, Phani K.; Estrada, Rosendo; Kannan, Manasaa; Sethu, Palaniappan
2014-03-01
Flow cytometry is a powerful technique capable of simultaneous multi-parametric analysis of heterogeneous cell populations for research and clinical applications. In recent years, the flow cytometer has been miniaturized and made portable for application in clinical- and resource-limited settings. The sample preparation procedure, i.e. labeling of cells with antibodies conjugated to fluorescent labels, is a time consuming (˜45 min) and labor-intensive procedure. Microfluidics provides enabling technologies to accomplish rapid and automated sample preparation. Using an integrated microfluidic device consisting of a labeling and washing module, we demonstrate a new protocol that can eliminate sample handling and accomplish sample and reagent metering, high-efficiency mixing, labeling and washing in rapid automated fashion. The labeling module consists of a long microfluidic channel with an integrated chaotic mixer. Samples and reagents are precisely metered into this device to accomplish rapid and high-efficiency mixing. The mixed sample and reagents are collected in a holding syringe and held for up to 8 min following which the mixture is introduced into an inertial washing module to obtain ‘analysis-ready’ samples. The washing module consists of a high aspect ratio channel capable of focusing cells to equilibrium positions close to the channel walls. By introducing the cells and labeling reagents in a narrow stream at the center of the channel flanked on both sides by a wash buffer, the elution of cells into the wash buffer away from the free unbound antibodies is accomplished. After initial calibration experiments to determine appropriate ‘holding time’ to allow antibody binding, both modules were used in conjunction to label MOLT-3 cells (T lymphoblast cell line) with three different antibodies simultaneously. Results confirm no significant difference in mean fluorescence intensity values for all three antibodies labels (p < 0.01) between the
Cima, Igor; Wen Yee, Chay; Iliescu, Florina S; Phyo, Wai Min; Lim, Kiat Hon; Iliescu, Ciprian; Tan, Min Han
2013-01-01
This review will cover the recent advances in label-free approaches to isolate and manipulate circulating tumor cells (CTCs). In essence, label-free approaches do not rely on antibodies or biological markers for labeling the cells of interest, but enrich them using the differential physical properties intrinsic to cancer and blood cells. We will discuss technologies that isolate cells based on their biomechanical and electrical properties. Label-free approaches to analyze CTCs have been recently invoked as a valid alternative to "marker-based" techniques, because classical epithelial and tumor markers are lost on some CTC populations and there is no comprehensive phenotypic definition for CTCs. We will highlight the advantages and drawbacks of these technologies and the status on their implementation in the clinics.
Livermore, Thomas Miles; Chubb, Jonathan Robert; Saiardi, Adolfo
2016-01-01
Inorganic polyphosphate (polyP) is composed of linear chains of phosphate groups linked by high-energy phosphoanhydride bonds. However, this simple, ubiquitous molecule remains poorly understood. The use of nonstandardized analytical methods has contributed to this lack of clarity. By using improved polyacrylamide gel electrophoresis we were able to visualize polyP extracted from Dictyostelium discoideum. We established that polyP is undetectable in cells lacking the polyphosphate kinase (DdPpk1). Generation of this ppk1 null strain revealed that polyP is important for the general fitness of the amoebae with the mutant strain displaying a substantial growth defect. We discovered an unprecedented accumulation of polyP during the developmental program, with polyP increasing more than 100-fold. The failure of ppk1 spores to accumulate polyP results in a germination defect. These phenotypes are underpinned by the ability of polyP to regulate basic energetic metabolism, demonstrated by a 2.5-fold decrease in the level of ATP in vegetative ppk1. Finally, the lack of polyP during the development of ppk1 mutant cells is partially offset by an increase of both ATP and inositol pyrophosphates, evidence for a model in which there is a functional interplay between inositol pyrophosphates, ATP, and polyP. PMID:26755590
Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L
1989-09-01
A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.
GBF-dependent family genes morphologically suppress the partially active Dictyostelium STATa strain.
Shimada, Nao; Kanno-Tanabe, Naoko; Minemura, Kakeru; Kawata, Takefumi
2008-02-01
Transcription factor Dd-STATa, a functional Dictyostelium homologue of metazoan signal transducers and activators of transcription proteins, is necessary for culmination during development. We have isolated more than 18 putative multicopy suppressors of Dd-STATa using genetic screening. One was hssA gene, whose expression is known to be G-box-binding-factor-dependent and which was specific to prestalk A (pstA) cells, where Dd-STATa is activated. Also, hssA mRNA was expressed in pstA cells in the Dd-STATa-null mutant. At least 40 hssA-related genes are present in the genome and constitute a multigene family. The tagged HssA protein was translated; hssA encodes an unusually high-glycine-serine-rich small protein (8.37 kDa), which has strong homology to previously reported cyclic-adenosine-monophosphate-inducible 2C and 7E proteins. Overexpression of hssA mRNA as well as frame-shifted versions of hssA RNA suppressed the phenotype of the partially active Dd-STATa strain, suggesting that translation is not necessary for suppression. Although overexpression of prespore-specific genes among the family did not suppress the parental phenotype, prestalk-specific family members did. Although overexpression of the hssA did not revert the expression of Dd-STATa target genes, and although its suppression mechanism remains unknown, morphological reversion implies functional relationships between Dd-STATa and hssA.
Adams, Christopher F; Rai, Ahmad; Sneddon, Gregor; Yiu, Humphrey H P; Polyak, Boris; Chari, Divya M
2015-01-01
Safe and efficient delivery of therapeutic cells to sites of injury/disease in the central nervous system is a key goal for the translation of clinical cell transplantation therapies. Recently, 'magnetic cell localization strategies' have emerged as a promising and safe approach for targeted delivery of magnetic particle (MP) labeled stem cells to pathology sites. For neuroregenerative applications, this approach is limited by the lack of available neurocompatible MPs, and low cell labeling achieved in neural stem/precursor populations. We demonstrate that high magnetite content, self-sedimenting polymeric MPs [unfunctionalized poly(lactic acid) coated, without a transfecting component] achieve efficient labeling (≥90%) of primary neural stem cells (NSCs)-a 'hard-to-label' transplant population of major clinical relevance. Our protocols showed high safety with respect to key stem cell regenerative parameters. Critically, labeled cells were effectively localized in an in vitro flow system by magnetic force highlighting the translational potential of the methods used. Copyright © 2015 Elsevier Inc. All rights reserved.
Cocorocchio, Marco; Baldwin, Amy J.; Stewart, Balint; Kim, Lou; Harwood, Adrian J.; Thompson, Christopher R. L.; Andrews, Paul L. R.
2018-01-01
ABSTRACT Natural compounds often have complex molecular structures and unknown molecular targets. These characteristics make them difficult to analyse using a classical pharmacological approach. Curcumin, the main curcuminoid of turmeric, is a complex molecule possessing wide-ranging biological activities, cellular mechanisms and roles in potential therapeutic treatment, including Alzheimer's disease and cancer. Here, we investigate the physiological effects and molecular targets of curcumin in Dictyostelium discoideum. We show that curcumin exerts acute effects on cell behaviour, reduces cell growth and slows multicellular development. We employed a range of structurally related compounds to show the distinct role of different structural groups in curcumin's effects on cell behaviour, growth and development, highlighting active moieties in cell function, and showing that these cellular effects are unrelated to the well-known antioxidant activity of curcumin. Molecular mechanisms underlying the effect of curcumin and one synthetic analogue (EF24) were then investigated to identify a curcumin-resistant mutant lacking the protein phosphatase 2A regulatory subunit (PsrA) and an EF24-resistant mutant lacking the presenilin 1 orthologue (PsenB). Using in silico docking analysis, we then showed that curcumin might function through direct binding to a key regulatory region of PsrA. These findings reveal novel cellular and molecular mechanisms for the function of curcumin and related compounds. PMID:29361519
Cocorocchio, Marco; Baldwin, Amy J; Stewart, Balint; Kim, Lou; Harwood, Adrian J; Thompson, Christopher R L; Andrews, Paul L R; Williams, Robin S B
2018-01-29
Natural compounds often have complex molecular structures and unknown molecular targets. These characteristics make them difficult to analyse using a classical pharmacological approach. Curcumin, the main curcuminoid of turmeric, is a complex molecule possessing wide-ranging biological activities, cellular mechanisms and roles in potential therapeutic treatment, including Alzheimer's disease and cancer. Here, we investigate the physiological effects and molecular targets of curcumin in Dictyostelium discoideum We show that curcumin exerts acute effects on cell behaviour, reduces cell growth and slows multicellular development. We employed a range of structurally related compounds to show the distinct role of different structural groups in curcumin's effects on cell behaviour, growth and development, highlighting active moieties in cell function, and showing that these cellular effects are unrelated to the well-known antioxidant activity of curcumin. Molecular mechanisms underlying the effect of curcumin and one synthetic analogue (EF24) were then investigated to identify a curcumin-resistant mutant lacking the protein phosphatase 2A regulatory subunit (PsrA) and an EF24-resistant mutant lacking the presenilin 1 orthologue (PsenB). Using in silico docking analysis, we then showed that curcumin might function through direct binding to a key regulatory region of PsrA. These findings reveal novel cellular and molecular mechanisms for the function of curcumin and related compounds. © 2018. Published by The Company of Biologists Ltd.
D-Serine Metabolism and Its Importance in Development of Dictyostelium discoideum
Ito, Tomokazu; Hamauchi, Natsuki; Hagi, Taisuke; Morohashi, Naoya; Hemmi, Hisashi; Sato, Yukie G.; Saito, Tamao; Yoshimura, Tohru
2018-01-01
In mammals, D-Ser is synthesized by serine racemase (SR) and degraded by D-amino acid oxidase (DAO). D-Ser acts as an endogenous ligand for N-methyl-D-aspartate (NMDA)- and δ2 glutamate receptors, and is involved in brain functions such as learning and memory. Although SR homologs are highly conserved in eukaryotes, little is known about the significance of D-Ser in non-mammals. In contrast to mammals, the slime mold Dictyostelium discoideum genome encodes SR, DAO, and additionally D-Ser specific degradation enzyme D-Ser dehydratase (DSD), but not NMDA- and δ2 glutamate receptors. Here, we studied the significances of D-Ser and DSD in D. discoideum. Enzymatic assays demonstrated that DSD is 460- and 1,700-fold more active than DAO and SR, respectively, in degrading D-Ser. Moreover, in dsd-null cells D-Ser degradation activity is completely abolished. In fact, while in wild-type D. discoideum intracellular D-Ser levels were considerably low, dsd-null cells accumulated D-Ser. These results indicated that DSD but not DAO is the primary enzyme responsible for D-Ser decomposition in D. discoideum. We found that dsd-null cells exhibit delay in development and arrest at the early culmination stage. The efficiency of spore formation was considerably reduced in the mutant cells. These phenotypes were further pronounced by exogenous D-Ser but rescued by plasmid-borne expression of dsd. qRT-PCR analysis demonstrated that mRNA expression of key genes in the cAMP signaling relay is perturbed in the dsd knockout. Our data indicate novel roles for D-Ser and/or DSD in the regulation of cAMP signaling in the development processes of D. discoideum. PMID:29740415
Self-Assembled Superparamagnetic Iron Oxide Nanoclusters for Universal Cell Labeling and MRI
NASA Astrophysics Data System (ADS)
Chen, Shuzhen; Zhang, Jun; Jiang, Shengwei; Lin, Gan; Luo, Bing; Yao, Huan; Lin, Yuchun; He, Chengyong; Liu, Gang; Lin, Zhongning
2016-05-01
Superparamagnetic iron oxide (SPIO) nanoparticles have been widely used in a variety of biomedical applications, especially as contrast agents for magnetic resonance imaging (MRI) and cell labeling. In this study, SPIO nanoparticles were stabilized with amphiphilic low molecular weight polyethylenimine (PEI) in an aqueous phase to form monodispersed nanocomposites with a controlled clustering structure. The iron-based nanoclusters with a size of 115.3 ± 40.23 nm showed excellent performance on cellular uptake and cell labeling in different types of cells, moreover, which could be tracked by MRI with high sensitivity. The SPIO nanoclusters presented negligible cytotoxicity in various types of cells as detected using MTS, LDH, and flow cytometry assays. Significantly, we found that ferritin protein played an essential role in protecting stress from SPIO nanoclusters. Taken together, the self-assembly of SPIO nanoclusters with good magnetic properties provides a safe and efficient method for universal cell labeling with noninvasive MRI monitoring capability.
1983-01-01
Amoebae of Dictyostelium discoideum produce tracks with two distinct morphologies on gold-coated coverslips. The wild-type strain and other strains that feed only by phagocytosis produced indistinct, fuzzy tracks, whereas mutants capable of axenic growth produced clear, sharp tracks. The sharp track morphology was found to be a recessive phenotype that segregates with axenicity and probably requires a previously unidentified axenic mutation. Axenic and nonaxenic strains also differed in their ability to pinocytose. When the two types of cells were shifted from bacterial growth plates to nutrient media, within 24 h the axenic strain established a rapid rate of pinocytosis, approximately 100-fold higher than the low rate detectable for the nonaxenic strain. However, track formation did not appear to be directly related to endocytosis. Electron microscopic examination of cells during track formation showed that both axenic and nonaxenic strains accumulated gold particles on their surfaces, but neither strain internalized the gold to any significant degree. Observation of living cells revealed that axenic strains collected all particles that they contacted, whereas wild-type strains left many particles undisturbed. The size of the gold particle clusters discarded by the cells also contributed to track morphology. PMID:6619183
Functionalized magnetic-fluorescent hybrid nanoparticles for cell labelling.
Lou, Lei; Yu, Ke; Zhang, Zhengli; Li, Bo; Zhu, Jianzhong; Wang, Yiting; Huang, Rong; Zhu, Ziqiang
2011-05-01
A facile method of synthesizing 60 nm magnetic-fluorescent core-shell bifunctional nanocomposites with the ability to label cells is presented. Hydrophobic trioctylphosphine oxide (TOPO)-capped CdSe@ZnS quantum dots (QDs) were assembled on polyethyleneimine (PEI)-coated Fe(3)O(4) nanoparticles (MNP). Polyethyleneimine was utilized for the realization of multifunction, including attaching 4 nm TOPO capped CdSe@ZnS quantum dots onto magnetite particles, altering the surface properties of quantum dots from hydrophobic to hydrophilic as well as preventing the formation of large aggregates. Results show that these water-soluble hybrid nanocomposites exhibit good colloidal stability and retain good magnetic and fluorescent properties. Because TOPO-capped QDs are assembled instead of their water-soluble equivalents, the nanocomposites are still highly luminescent with no shift in the PL peak position and present long-term fluorescence stability. Moreover, TAT peptide (GRKKRRQRRRPQ) functionalized hybrid nanoparticles were also studied due to their combined magnetic enrichment and optical detection for cell separation and rapid cell labelling. A cell viability assay revealed good biocompatibility of these hybrid nanoparticles. The potential application of the new magnetic-fluorescent nanocomposites in biological and medicine is demonstrated. © The Royal Society of Chemistry 2011
Cell Blebbing in Confined Microfluidic Environments
Ibo, Markela; Srivastava, Vasudha; Robinson, Douglas N.; Gagnon, Zachary R.
2016-01-01
Migrating cells can extend their leading edge by forming myosin-driven blebs and F-actin-driven pseudopods. When coerced to migrate in resistive environments, Dictyostelium cells switch from using predominately pseudopods to blebs. Bleb formation has been shown to be chemotactic and can be influenced by the direction of the chemotactic gradient. In this study, we determine the blebbing responses of developed cells of Dictyostelium discoideum to cAMP gradients of varying steepness produced in microfluidic channels with different confining heights, ranging between 1.7 μm and 3.8 μm. We show that microfluidic confinement height, gradient steepness, buffer osmolarity and Myosin II activity are important factors in determining whether cells migrate with blebs or with pseudopods. Dictyostelium cells were observed migrating within the confines of microfluidic gradient channels. When the cAMP gradient steepness is increased from 0.7 nM/μm to 20 nM/μm, cells switch from moving with a mixture of blebs and pseudopods to moving only using blebs when chemotaxing in channels with confinement heights less than 2.4 μm. Furthermore, the size of the blebs increases with gradient steepness and correlates with increases in myosin-II localization at the cell cortex. Reduction of intracellular pressure by high osmolarity buffer or inhibition of myosin-II by blebbistatin leads to a decrease in bleb formation and bleb size. Together, our data reveal that the protrusion type formed by migrating cells can be influenced by the channel height and the steepness of the cAMP gradient, and suggests that a combination of confinement-induced myosin-II localization and cAMP-regulated cortical contraction leads to increased intracellular fluid pressure and bleb formation. PMID:27706201
15N-metabolic labeling for comparative plasma membrane proteomics in Arabidopsis cells.
Lanquar, Viviane; Kuhn, Lauriane; Lelièvre, Françoise; Khafif, Mehdi; Espagne, Christelle; Bruley, Christophe; Barbier-Brygoo, Hélène; Garin, Jérôme; Thomine, Sébastien
2007-03-01
An important goal for proteomic studies is the global comparison of proteomes from different genotypes, tissues, or physiological conditions. This has so far been mostly achieved by densitometric comparison of spot intensities after protein separation by 2-DE. However, the physicochemical properties of membrane proteins preclude the use of 2-DE. Here, we describe the use of in vivo labeling by the stable isotope 15N as an alternative approach for comparative membrane proteomic studies in plant cells. We confirm that 15N-metabolic labeling of proteins is possible and efficient in Arabidopsis suspension cells. Quantification of 14N versus 15N MS signals reflects the relative abundance of 14N and 15N proteins in the sample analyzed. We describe the use of 15N-metabolic labeling to perform a partial comparative analysis of Arabidopsis cells following cadmium exposure. By focusing our attention on plasma membrane proteins, we were able to confidently identify proteins showing up to 5-fold regulation compared to unexposed cells. This study provides a proof of principle that 15N-metabolic labeling is a useful technique for comparative membrane proteome studies.
The Non-Specific Binding of Fluorescent-Labeled MiRNAs on Cell Surface by Hydrophobic Interaction.
Lu, Ting; Lin, Zongwei; Ren, Jianwei; Yao, Peng; Wang, Xiaowei; Wang, Zhe; Zhang, Qunye
2016-01-01
MicroRNAs are small noncoding RNAs about 22 nt long that play key roles in almost all biological processes and diseases. The fluorescent labeling and lipofection are two common methods for changing the levels and locating the position of cellular miRNAs. Despite many studies about the mechanism of DNA/RNA lipofection, little is known about the characteristics, mechanisms and specificity of lipofection of fluorescent-labeled miRNAs. Therefore, miRNAs labeled with different fluorescent dyes were transfected into adherent and suspension cells using lipofection reagent. Then, the non-specific binding and its mechanism were investigated by flow cytometer and laser confocal microscopy. The results showed that miRNAs labeled with Cy5 (cyanine fluorescent dye) could firmly bind to the surface of adherent cells (Hela) and suspended cells (K562) even without lipofection reagent. The binding of miRNAs labeled with FAM (carboxyl fluorescein) to K562 cells was obvious, but it was not significant in Hela cells. After lipofectamine reagent was added, most of the fluorescently labeled miRNAs binding to the surface of Hela cells were transfected into intra-cell because of the high transfection efficiency, however, most of them were still binding to the surface of K562 cells. Moreover, the high-salt buffer which could destroy the electrostatic interactions did not affect the above-mentioned non-specific binding, but the organic solvent which could destroy the hydrophobic interactions eliminated it. These results implied that the fluorescent-labeled miRNAs could non-specifically bind to the cell surface by hydrophobic interaction. It would lead to significant errors in the estimation of transfection efficiency only according to the cellular fluorescence intensity. Therefore, other methods to evaluate the transfection efficiency and more appropriate fluorescent dyes should be used according to the cell types for the accuracy of results.
Skelton, Rhys J P; Khoja, Suhail; Almeida, Shone; Rapacchi, Stanislas; Han, Fei; Engel, James; Zhao, Peng; Hu, Peng; Stanley, Edouard G; Elefanty, Andrew G; Kwon, Murray; Elliott, David A; Ardehali, Reza
2016-01-01
Given the limited regenerative capacity of the heart, cellular therapy with stem cell-derived cardiac cells could be a potential treatment for patients with heart disease. However, reliable imaging techniques to longitudinally assess engraftment of the transplanted cells are scant. To address this issue, we used ferumoxytol as a labeling agent of human embryonic stem cell-derived cardiac progenitor cells (hESC-CPCs) to facilitate tracking by magnetic resonance imaging (MRI) in a large animal model. Differentiating hESCs were exposed to ferumoxytol at different time points and varying concentrations. We determined that treatment with ferumoxytol at 300 μg/ml on day 0 of cardiac differentiation offered adequate cell viability and signal intensity for MRI detection without compromising further differentiation into definitive cardiac lineages. Labeled hESC-CPCs were transplanted by open surgical methods into the left ventricular free wall of uninjured pig hearts and imaged both ex vivo and in vivo. Comprehensive T2*-weighted images were obtained immediately after transplantation and 40 days later before termination. The localization and dispersion of labeled cells could be effectively imaged and tracked at days 0 and 40 by MRI. Thus, under the described conditions, ferumoxytol can be used as a long-term, differentiation-neutral cell-labeling agent to track transplanted hESC-CPCs in vivo using MRI. The development of a safe and reproducible in vivo imaging technique to track the fate of transplanted human embryonic stem cell-derived cardiac progenitor cells (hESC-CPCs) is a necessary step to clinical translation. An iron oxide nanoparticle (ferumoxytol)-based approach was used for cell labeling and subsequent in vivo magnetic resonance imaging monitoring of hESC-CPCs transplanted into uninjured pig hearts. The present results demonstrate the use of ferumoxytol labeling and imaging techniques in tracking the location and dispersion of cell grafts, highlighting its
Xiao, Z; Devreotes, P N
1997-01-01
Unlike most other cellular proteins, the chemoattractant receptor, cAR1, of Dictyostelium is resistant to extraction by the zwitterionic detergent, CHAPS. We exploited this property to isolate a subcellular fraction highly enriched in cAR1 by flotation of CHAPS lysates of cells in sucrose density gradients. Immunogold electron microscopy studies revealed a homogeneous preparation of membrane bilayer sheets. This preparation, designated CHAPS-insoluble floating fraction (CHIEF), also contained a defined set of 20 other proteins and a single uncharged lipid. Cell surface biotinylation and preembedding immunoelectron microscopy both confirmed the plasma membrane origin of this preparation. The cell surface phosphodiesterase (PDE) and a downstream effector of cAR1, adenylate cyclase (ACA), were specifically localized in these structures, whereas the cell adhesion molecule gp80, most of the major cell surface membrane proteins, cytoskeletal components, the actin-binding integral membrane protein ponticulin, and G-protein alpha- and beta-subunits were absent. Overall, CHIFF represents about 3-5% of cell externally exposed membrane proteins. All of these results indicate that CHIFF is derived from specialized microdomains of the plasma membrane. The method of isolation is analogous to that of caveolae. However, we were unable to detect distinct caveolae-like structures on the cell surface associated with cAR1, which showed a diffuse staining profile. The discovery of CHIFF facilitates the purification of cAR1 and related signaling proteins and the biochemical characterization of receptor-mediated processes such as G-protein activation and desensitization. It also has important implications for the "fluid mosaic" model of the plasma membrane structures. Images PMID:9168471
Ackerman, G A; Wolken, K W
1981-10-01
A colloidal gold-labeled insulin-bovine serum albumin (GIA) reagent has been developed for the ultrastructural visualization of insulin binding sites on the cell surface and for tracing the pathway of intracellular insulin translocation. When applied to normal human blood cells, it was demonstrated by both visual inspection and quantitative analysis that the extent of surface labeling, as well as the rate and degree of internalization of the insulin complex, was directly related to cell type. Further, the pathway of insulin (GIA) transport via round vesicles and by tubulo-vesicles and saccules and its subsequent fate in the hemic cells was also related to cell variety. Monocytes followed by neutrophils bound the greatest amount of labeled insulin. The majority of lymphocytes bound and internalized little GIA, however, between 5-10% of the lymphocytes were found to bind considerable quantities of GIA. Erythrocytes rarely bound the labeled insulin complex, while platelets were noted to sequester large quantities of the GIA within their extracellular canalicular system. GIA uptake by the various types of leukocytic cells appeared to occur primarily by micropinocytosis and by the direct opening of cytoplasmic tubulo-vesicles and saccules onto the cell surface in regions directly underlying surface-bound GIA. Control procedures, viz., competitive inhibition of GIA labeling using an excess of unlabeled insulin in the incubation medium, preincubation of the GIA reagent with an antibody directed toward porcine insulin, and the incorporation of 125I-insulin into the GIA reagent, indicated the specificity and selectivity of the GIA histochemical procedure for the localization of insulin binding sites.
Faklaris, Orestis; Joshi, Vandana; Irinopoulou, Theano; Tauc, Patrick; Sennour, Mohamed; Girard, Hugues; Gesset, Céline; Arnault, Jean-Charles; Thorel, Alain; Boudou, Jean-Paul; Curmi, Patrick A; Treussart, François
2009-12-22
Diamond nanoparticles (nanodiamonds) have been recently proposed as new labels for cellular imaging. For small nanodiamonds (size <40 nm), resonant laser scattering and Raman scattering cross sections are too small to allow single nanoparticle observation. Nanodiamonds can, however, be rendered photoluminescent with a perfect photostability at room temperature. Such a remarkable property allows easier single-particle tracking over long time scales. In this work, we use photoluminescent nanodiamonds of size <50 nm for intracellular labeling and investigate the mechanism of their uptake by living cells. By blocking selectively different uptake processes, we show that nanodiamonds enter cells mainly by endocytosis, and converging data indicate that it is clathrin-mediated. We also examine nanodiamond intracellular localization in endocytic vesicles using immunofluorescence and transmission electron microscopy. We find a high degree of colocalization between vesicles and the biggest nanoparticles or aggregates, while the smallest particles appear free in the cytosol. Our results pave the way for the use of photoluminescent nanodiamonds in targeted intracellular labeling or biomolecule delivery.
Wolfs, Esther; Struys, Tom; Notelaers, Tineke; Roberts, Scott J; Sohni, Abhishek; Bormans, Guy; Van Laere, Koen; Luyten, Frank P; Gheysens, Olivier; Lambrichts, Ivo; Verfaillie, Catherine M; Deroose, Christophe M
2013-03-01
Because of their extended differentiation capacity, stem cells have gained great interest in the field of regenerative medicine. For the development of therapeutic strategies, more knowledge on the in vivo fate of these cells has to be acquired. Therefore, stem cells can be labeled with radioactive tracer molecules such as (18)F-FDG, a positron-emitting glucose analog that is taken up and metabolically trapped by the cells. The aim of this study was to optimize the radioactive labeling of mesenchymal stem cells (MSCs) and multipotent adult progenitor cells (MAPCs) in vitro with (18)F-FDG and to investigate the potential radiotoxic effects of this labeling procedure with a range of techniques, including transmission electron microscopy (TEM). Mouse MSCs and rat MAPCs were used for (18)F-FDG uptake kinetics and tracer retention studies. Cell metabolic activity, proliferation, differentiation and ultrastructural changes after labeling were evaluated using an Alamar Blue reagent, doubling time calculations and quantitative TEM, respectively. Additionally, mice were injected with MSCs and MAPCs prelabeled with (18)F-FDG, and stem cell biodistribution was investigated using small-animal PET. The optimal incubation period for (18)F-FDG uptake was 60 min. Significant early tracer washout was observed, with approximately 30%-40% of the tracer being retained inside the cells 3 h after labeling. Cell viability, proliferation, and differentiation capacity were not severely affected by (18)F-FDG labeling. No major changes at the ultrastructural level, considering mitochondrial length, lysosome size, the number of lysosomes, the number of vacuoles, and the average rough endoplasmic reticulum width, were observed with TEM. Small-animal PET experiments with radiolabeled MAPCs and MSCs injected intravenously in mice showed a predominant accumulation in the lungs and a substantial elution of (18)F-FDG from the cells. MSCs and MAPCs can be successfully labeled with (18)F-FDG for
In Silico Labeling: Predicting Fluorescent Labels in Unlabeled Images.
Christiansen, Eric M; Yang, Samuel J; Ando, D Michael; Javaherian, Ashkan; Skibinski, Gaia; Lipnick, Scott; Mount, Elliot; O'Neil, Alison; Shah, Kevan; Lee, Alicia K; Goyal, Piyush; Fedus, William; Poplin, Ryan; Esteva, Andre; Berndl, Marc; Rubin, Lee L; Nelson, Philip; Finkbeiner, Steven
2018-04-19
Microscopy is a central method in life sciences. Many popular methods, such as antibody labeling, are used to add physical fluorescent labels to specific cellular constituents. However, these approaches have significant drawbacks, including inconsistency; limitations in the number of simultaneous labels because of spectral overlap; and necessary perturbations of the experiment, such as fixing the cells, to generate the measurement. Here, we show that a computational machine-learning approach, which we call "in silico labeling" (ISL), reliably predicts some fluorescent labels from transmitted-light images of unlabeled fixed or live biological samples. ISL predicts a range of labels, such as those for nuclei, cell type (e.g., neural), and cell state (e.g., cell death). Because prediction happens in silico, the method is consistent, is not limited by spectral overlap, and does not disturb the experiment. ISL generates biological measurements that would otherwise be problematic or impossible to acquire. Copyright © 2018 Elsevier Inc. All rights reserved.
A rapid and fluorogenic TMP-AcBOPDIPY probe for covalent labeling of proteins in live cells.
Liu, Wei; Li, Fu; Chen, Xi; Hou, Jian; Yi, Long; Wu, Yao-Wen
2014-03-26
Protein labeling is enormously useful for characterizing protein function in cells and organisms. Chemical tagging methods have emerged as a new generation protein labeling strategy in live cells. Here we have developed a novel and versatile TMP-AcBOPDIPY probe for selective and turn-on labeling of proteins in live cells. A small monomeric tag, E. coli dihydrofolate reductase (eDHFR), was rationally designed to introduce a cysteine in the vicinity of the ligand binding site. Trimethoprim (TMP) that specifically binds to eDHFR was linked to the BOPDIPY fluorophore containing a mildly thiol-reactive acrylamide group. TMP-AcBOPDIPY rapidly labeled engineered eDHFR tags via a reaction termed affinity conjugation (a half-life of ca. 2 min), which is one of the top fast chemical probes for protein labeling. The probe displays 2-fold fluorescence enhancement upon labeling of proteins. We showed that the probe specifically labeled intracellular proteins in live cells without and with washing out the dye. We demonstrated its utility in visualizing intracellular processes by fluorescence-lifetime imaging microscopy (FLIM) measurements.
40 CFR 600.304-12 - Fuel economy label-special requirements for hydrogen fuel cell vehicles.
Code of Federal Regulations, 2012 CFR
2012-07-01
... requirements for hydrogen fuel cell vehicles. 600.304-12 Section 600.304-12 Protection of Environment... MOTOR VEHICLES Fuel Economy Labeling § 600.304-12 Fuel economy label—special requirements for hydrogen fuel cell vehicles. Fuel economy labels for hydrogen fuel cell vehicles must meet the specifications...
40 CFR 600.304-12 - Fuel economy label-special requirements for hydrogen fuel cell vehicles.
Code of Federal Regulations, 2014 CFR
2014-07-01
... requirements for hydrogen fuel cell vehicles. 600.304-12 Section 600.304-12 Protection of Environment... MOTOR VEHICLES Fuel Economy Labeling § 600.304-12 Fuel economy label—special requirements for hydrogen fuel cell vehicles. Fuel economy labels for hydrogen fuel cell vehicles must meet the specifications...
40 CFR 600.304-12 - Fuel economy label-special requirements for hydrogen fuel cell vehicles.
Code of Federal Regulations, 2013 CFR
2013-07-01
... requirements for hydrogen fuel cell vehicles. 600.304-12 Section 600.304-12 Protection of Environment... MOTOR VEHICLES Fuel Economy Labeling § 600.304-12 Fuel economy label—special requirements for hydrogen fuel cell vehicles. Fuel economy labels for hydrogen fuel cell vehicles must meet the specifications...
NASA Astrophysics Data System (ADS)
Wang, Qiu-Yue; Huang, Wei; Jiang, Xing-Lin; Kang, Yan-Jun
2018-01-01
In this work, an efficient method based on biotin-labeled aptamer and streptavidin-conjugated fluorescence-magnetic silica nanoprobes (FITC@Fe3O4@SiNPs-SA) has been established for human breast carcinoma MCF-7 cells synchronous labeling and separation. Carboxyl-modified fluorescence-magnetic silica nanoparticles (FITC@Fe3O4@SiNPs-COOH) were first synthesized using the Stöber method. Streptavidin (SA) was then conjugated to the surface of FITC@Fe3O4@SiNPs-COOH. The MCF-7 cell suspension was incubated with biotin-labeled MUC-1 aptamer. After centrifugation and washing, the cells were then treated with FITC@Fe3O4@SiNPs-SA. Afterwards, the mixtures were separated by a magnet. The cell-probe conjugates were then imaged using fluorescent microscopy. The results show that the MUC-1 aptamer could recognize and bind to the targeted cells with high affinity and specificity, indicating the prepared FITC@Fe3O4@SiNPs-SA with great photostability and superparamagnetism could be applied effectively in labeling and separation for MCF-7 cell in suspension synchronously. In addition, the feasibility of MCF-7 cells detection in peripheral blood was assessed. The results indicate that the method above is also applicable for cancer cells synchronous labeling and separation in complex biological system.
Witte, Christopher; Martos, Vera; Rose, Honor May; Reinke, Stefan; Klippel, Stefan; Schröder, Leif; Hackenberger, Christian P R
2015-02-23
The targeting of metabolically labeled glycans with conventional MRI contrast agents has proved elusive. In this work, which further expands the utility of xenon Hyper-CEST biosensors in cell experiments, we present the first successful molecular imaging of such glycans using MRI. Xenon Hyper-CEST biosensors are a novel class of MRI contrast agents with very high sensitivity. We designed a multimodal biosensor for both fluorescent and xenon MRI detection that is targeted to metabolically labeled sialic acid through bioorthogonal chemistry. Through the use of a state of the art live-cell bioreactor, it was demonstrated that xenon MRI biosensors can be used to image cell-surface glycans at nanomolar concentrations. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Labeling and Magnetic Resonance Imaging of Exosomes Isolated from Adipose Stem Cells.
Busato, Alice; Bonafede, Roberta; Bontempi, Pietro; Scambi, Ilaria; Schiaffino, Lorenzo; Benati, Donatella; Malatesta, Manuela; Sbarbati, Andrea; Marzola, Pasquina; Mariotti, Raffaella
2017-06-19
Adipose stem cells (ASC) represent a promising therapeutic approach for neurodegenerative diseases. Most biological effects of ASC are probably mediated by extracellular vesicles, such as exosomes, which influence the surrounding cells. Current development of exosome therapies requires efficient and noninvasive methods to localize, monitor, and track the exosomes. Among imaging methods used for this purpose, magnetic resonance imaging (MRI) has advantages: high spatial resolution, rapid in vivo acquisition, and radiation-free operation. To be detectable with MRI, exosomes must be labeled with MR contrast agents, such as ultra-small superparamagnetic iron oxide nanoparticles (USPIO). Here, we set up an innovative approach for exosome labeling that preserves their morphology and physiological characteristics. We show that by labeling ASC with USPIO before extraction of nanovesicles, the isolated exosomes retain nanoparticles and can be visualized by MRI. The current work aims at validating this novel USPIO-based exosome labeling method by monitoring the efficiency of the labeling with MRI both in ASC and in exosomes. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Super-Chelators for Advanced Protein Labeling in Living Cells.
Gatterdam, Karl; Joest, Eike F; Dietz, Marina S; Heilemann, Mike; Tampé, Robert
2018-05-14
Live-cell labeling, super-resolution microscopy, single-molecule applications, protein localization, or chemically induced assembly are emerging approaches, which require specific and very small interaction pairs. The minimal disturbance of protein function is essential to derive unbiased insights into cellular processes. Herein, we define a new class of hexavalent N-nitrilotriacetic acid (hexaNTA) chelators, displaying the highest affinity and stability of all NTA-based small interaction pairs described so far. Coupled to bright organic fluorophores with fine-tuned photophysical properties, the super-chelator probes were delivered into human cells by chemically gated nanopores. These super-chelators permit kinetic profiling, multiplexed labeling of His 6 - and His 12 -tagged proteins as well as single-molecule-based super-resolution imaging. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Li, Ming-wei; Bai, Yu; Guo, Hui-hui
2017-01-01
Tracking transplanted stem cells is necessary to clarify cellular properties and improve transplantation success. In this study, we investigate the effects of fluorescent superparamagnetic iron oxide particles (SPIO) (Molday ION Rhodamine-B™, MIRB) on biological properties of human dental pulp stem cells (hDPSCs) and monitor hDPSCs in vitro and in vivo using magnetic resonance imaging (MRI). Morphological analysis showed that intracellular MIRB particles were distributed in the cytoplasm surrounding the nuclei of hDPSCs. 12.5–100 μg/mL MIRB all resulted in 100% labeling efficiency. MTT showed that 12.5–50 μg/mL MIRB could promote cell proliferation and MIRB over 100 μg/mL exhibited toxic effect on hDPSCs. In vitro MRI showed that 1 × 106 cells labeled with various concentrations of MIRB (12.5–100 μg/mL) could be visualized. In vivo MRI showed that transplanted cells could be clearly visualized up to 60 days after transplantation. These results suggest that 12.5–50 μg/mL MIRB is a safe range for labeling hDPSCs. MIRB labeled hDPSCs cell can be visualized by MRI in vitro and in vivo. These data demonstrate that MIRB is a promising candidate for hDPSCs tracking in hDPSCs based dental pulp regeneration therapy. PMID:28298928
Salamon, J; Wicklein, D; Didié, M; Lange, C; Schumacher, U; Adam, G; Peldschus, K
2014-04-01
The aim of this study was to establish co-labeling of mesenchymal stromal cells (MSC) for the detection of single MSC in-vivo by MRI and histological validation. Mouse MSC were co-labeled with fluorescent iron oxide micro-particles and carboxyfluorescein succinimidyl ester (CFSE). The cellular iron content was determined by atomic absorption spectrometry. Cell proliferation and expression of characteristic surface markers were determined by flow cytometry. The chondrogenic differentiation capacity was assessed. Different amounts of cells (n1 = 5000, n2 = 15 000, n3 = 50 000) were injected into the left heart ventricle of 12 mice. The animals underwent sequential MRI on a clinical 3.0 T scanner (Intera, Philips Medical Systems, Best, The Netherlands). For histological validation cryosections were examined by fluorescent microscopy. Magnetic and fluorescent labeling of MSC was established (mean cellular iron content 23.6 ± 3 pg). Flow cytometry showed similar cell proliferation and receptor expression of labeled and unlabeled MSC. Chondrogenic differentiation of labeled MSC was verified. After cell injection MRI revealed multiple signal voids in the brain and fewer signal voids in the kidneys. In the brain, an average of 4.6 ± 1.2 (n1), 9.0 ± 3.6 (n2) and 25.0 ± 1.0 (n3) signal voids were detected per MRI slice. An average of 8.7 ± 3.1 (n1), 22.0 ± 6.1 (n2) and 89.8 ± 6.5 (n3) labeled cells per corresponding stack of adjacent cryosections could be detected in the brain. Statistical correlation of the numbers of MRI signal voids in the brain and single MSC found by histology revealed a correlation coefficient of r = 0.91. The study demonstrates efficient magnetic and fluorescent co-labeling of MSC and their detection on a single cell level in mice by in-vivo MRI and histology. The described techniques may broaden the methods for in-vivo tracking of MSC. • Detection of single magnetically labeled MSC in
Calzi, Sergio Li; Kent, David L.; Chang, Kyung-Hee; Padgett, Kyle R.; Afzal, Aqeela; Chandra, Saurav B.; Caballero, Sergio; English, Denis; Garlington, Wendy; Hiscott, Paul S.; Sheridan, Carl M.; Grant, Maria B.; Forder, John R.
2013-01-01
Precise localization of exogenously delivered stem cells is critical to our understanding of their reparative response. Our current inability to determine the exact location of small numbers of cells may hinder optimal development of these cells for clinical use. We describe a method using magnetic resonance imaging to track and localize small numbers of stem cells following transplantation. Endothelial progenitor cells (EPC) were labeled with monocrystalline iron oxide nanoparticles (MIONs) which neither adversely altered their viability nor their ability to migrate in vitro and allowed successful detection of limited numbers of these cells in muscle. MION-labeled stem cells were also injected into the vitreous cavity of mice undergoing the model of choroidal neovascularization, laser rupture of Bruch’s membrane. Migration of the MION-labeled cells from the injection site towards the laser burns was visualized by MRI. In conclusion, MION labeling of EPC provides a non-invasive means to define the location of small numbers of these cells. Localization of these cells following injection is critical to their optimization for therapy. PMID:19345699
Development and testing of a new disposable sterile device for labelling white blood cells.
Signore, A; Glaudemans, A W J M; Malviya, G; Lazzeri, E; Prandini, N; Viglietti, A L; De Vries, E F J; Dierckx, R A J O
2012-08-01
White blood cell (WBC) labelling requires isolation of cells from patient's blood under sterile conditions using sterile materials, buffers and disposables under good manufacturing practice (GMP) conditions. Till now, this limited the use of white blood cell scintigraphy (WBC-S) only to well equipped laboratories with trained personnel. We invented, developed and tested a disposable, sterile, closed device for blood manipulation, WBC purification and radionuclide labelling without exposing patient's blood and the operator to contamination risks. This device prototype and a final industrialized device (Leukokit®) were tested for WBC labelling and compared to standard procedure. Leukokit® was also tested in an international multi-centre study for easiness of WBC purification and labelling. On the device prototype we tested in parallel, with blood samples from 7 volunteers, the labelling procedure compared to the standard procedure of the International Society of Radiolabeled Blood Elements (ISORBE) consensus protocol with respect to cell recovery, labelling efficiency (LE), cell viability (Trypan Blue test) and sterility (haemoculture). On the final Leukokit® we tested the biocompatibility of all components, and again the LE, erythro-sedimentation rate, cell viability, sterility and apyrogenicity. ACD-A, HES and PBS provided by Leukokit® were also compared to Heparin, Dextran and autologous plasma, respectively. In 4 samples, we tested the chemotactic activity of purified WBC against 1 mg/ml of lipopolysaccharide (LPS) and chemotaxis of 99mTc-HMPAO-labelled WBC (925 MBq) was compared to that of unlabelled cells. For the multi-centre study, 70 labellings were performed with the Leukokit® by 9 expert operators and 3 beginners from five centers using blood from both patients and volunteers. Finally, Media-Fill tests were performed by 3 operators on two different days (11 procedures) by replacing blood and kit reagents with bacterial culture media (Tryptic Soy Broth
Chen, Gang; Zhu, Jun-Yi; Zhang, Zhi-Ling; Zhang, Wei; Ren, Jian-Gang; Wu, Min; Hong, Zheng-Yuan; Lv, Cheng; Pang, Dai-Wen; Zhao, Yi-Fang
2015-01-12
Cell-derived microparticles (MPs) have been recently recognized as critical intercellular information conveyors. However, further understanding of their biological behavior and potential application has been hampered by the limitations of current labeling techniques. Herein, a universal donor-cell-assisted membrane biotinylation strategy was proposed for labeling MPs by skillfully utilizing the natural membrane phospholipid exchange of their donor cells. This innovative strategy conveniently led to specific, efficient, reproducible, and biocompatible quantum dot (QD) labeling of MPs, thereby reliably conferring valuable traceability on MPs. By further loading with small interference RNA, QD-labeled MPs that had inherent cell-targeting and biomolecule-conveying ability were successfully employed for combined bioimaging and tumor-targeted therapy. This study provides the first reliable and biofriendly strategy for transforming biogenic MPs into functionalized nanovectors. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Labeling of neuronal differentiation and neuron cells with biocompatible fluorescent nanodiamonds
Hsu, Tzu-Chia; Liu, Kuang-Kai; Chang, Huan-Cheng; Hwang, Eric; Chao, Jui-I
2014-01-01
Nanodiamond is a promising carbon nanomaterial developed for biomedical applications. Here, we show fluorescent nanodiamond (FND) with the biocompatible properties that can be used for the labeling and tracking of neuronal differentiation and neuron cells derived from embryonal carcinoma stem (ECS) cells. The fluorescence intensities of FNDs were increased by treatment with FNDs in both the mouse P19 and human NT2/D1 ECS cells. FNDs were taken into ECS cells; however, FNDs did not alter the cellular morphology and growth ability. Moreover, FNDs did not change the protein expression of stem cell marker SSEA-1 of ECS cells. The neuronal differentiation of ECS cells could be induced by retinoic acid (RA). Interestingly, FNDs did not affect on the morphological alteration, cytotoxicity and apoptosis during the neuronal differentiation. Besides, FNDs did not alter the cell viability and the expression of neuron-specific marker β-III-tubulin in these differentiated neuron cells. The existence of FNDs in the neuron cells can be identified by confocal microscopy and flow cytometry. Together, FND is a biocompatible and readily detectable nanomaterial for the labeling and tracking of neuronal differentiation process and neuron cells from stem cells. PMID:24830447
Labeling of neuronal differentiation and neuron cells with biocompatible fluorescent nanodiamonds.
Hsu, Tzu-Chia; Liu, Kuang-Kai; Chang, Huan-Cheng; Hwang, Eric; Chao, Jui-I
2014-05-16
Nanodiamond is a promising carbon nanomaterial developed for biomedical applications. Here, we show fluorescent nanodiamond (FND) with the biocompatible properties that can be used for the labeling and tracking of neuronal differentiation and neuron cells derived from embryonal carcinoma stem (ECS) cells. The fluorescence intensities of FNDs were increased by treatment with FNDs in both the mouse P19 and human NT2/D1 ECS cells. FNDs were taken into ECS cells; however, FNDs did not alter the cellular morphology and growth ability. Moreover, FNDs did not change the protein expression of stem cell marker SSEA-1 of ECS cells. The neuronal differentiation of ECS cells could be induced by retinoic acid (RA). Interestingly, FNDs did not affect on the morphological alteration, cytotoxicity and apoptosis during the neuronal differentiation. Besides, FNDs did not alter the cell viability and the expression of neuron-specific marker β-III-tubulin in these differentiated neuron cells. The existence of FNDs in the neuron cells can be identified by confocal microscopy and flow cytometry. Together, FND is a biocompatible and readily detectable nanomaterial for the labeling and tracking of neuronal differentiation process and neuron cells from stem cells.
Controlled viable release of selectively captured label-free cells in microchannels.
Gurkan, Umut Atakan; Anand, Tarini; Tas, Huseyin; Elkan, David; Akay, Altug; Keles, Hasan Onur; Demirci, Utkan
2011-12-07
Selective capture of cells from bodily fluids in microchannels has broadly transformed medicine enabling circulating tumor cell isolation, rapid CD4(+) cell counting for HIV monitoring, and diagnosis of infectious diseases. Although cell capture methods have been demonstrated in microfluidic systems, the release of captured cells remains a significant challenge. Viable retrieval of captured label-free cells in microchannels will enable a new era in biological sciences by allowing cultivation and post-processing. The significant challenge in release comes from the fact that the cells adhere strongly to the microchannel surface, especially when immuno-based immobilization methods are used. Even though fluid shear and enzymes have been used to detach captured cells in microchannels, these methods are known to harm cells and affect cellular characteristics. This paper describes a new technology to release the selectively captured label-free cells in microchannels without the use of fluid shear or enzymes. We have successfully released the captured CD4(+) cells (3.6% of the mononuclear blood cells) from blood in microfluidic channels with high specificity (89% ± 8%), viability (94% ± 4%), and release efficiency (59% ± 4%). We have further validated our system by specifically capturing and controllably releasing the CD34(+) stem cells from whole blood, which were quantified to be 19 cells per million blood cells in the blood samples used in this study. Our results also indicated that both CD4(+) and CD34(+) cells released from the microchannels were healthy and amenable for in vitro culture. Manual flow based microfluidic method utilizes inexpensive, easy to fabricate microchannels allowing selective label-free cell capture and release in less than 10 minutes, which can also be used at the point-of-care. The presented technology can be used to isolate and purify a broad spectrum of cells from mixed populations offering widespread applications in applied biological
Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.
Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad
2015-04-13
Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing
Smith, Derek D. N.; Nickzad, Arvin
2016-01-01
ABSTRACT Pantoea is a versatile genus of bacteria with both plant- and animal-pathogenic strains, some of which have been suggested to cause human infections. There is, however, limited knowledge on the potential determinants used for host association and pathogenesis in animal systems. In this study, we used the model host Dictyostelium discoideum to show that isolates of Pantoea ananatis exhibit differential grazing susceptibility, with some being resistant to grazing by the amoebae. We carried out a high-throughput genetic screen of one grazing-resistant isolate, P. ananatis BRT175, using the D. discoideum pathosystem to identify genes responsible for the resistance phenotype. Among the 26 candidate genes involved in grazing resistance, we identified rhlA and rhlB, which we show are involved in the biosynthesis of a biosurfactant that enables swarming motility in P. ananatis BRT175. Using liquid chromatography-mass spectrometry (LC-MS), the biosurfactant was shown to be a glycolipid with monohexose-C10-C10 as the primary congener. We show that this novel glycolipid biosurfactant is cytotoxic to the amoebae and is capable of compromising cellular integrity, leading to cell lysis. The production of this biosurfactant may be important for bacterial survival in the environment and could contribute to the establishment of opportunistic infections. IMPORTANCE The genetic factors used for host interaction by the opportunistic human pathogen Pantoea ananatis are largely unknown. We identified two genes that are important for the production of a biosurfactant that confers grazing resistance against the social amoeba Dictyostelium discoideum. We show that the biosurfactant, which exhibits cytotoxicity toward the amoebae, is a glycolipid that incorporates a hexose rather than rhamnose. The production of this biosurfactant may confer a competitive advantage in the environment and could potentially contribute to the establishment of opportunistic infections. PMID
Vicente, Juan J; Galardi-Castilla, María; Escalante, Ricardo; Sastre, Leandro
2008-01-03
The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N), that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87-89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.
Affimer proteins for F-actin: novel affinity reagents that label F-actin in live and fixed cells.
Lopata, Anna; Hughes, Ruth; Tiede, Christian; Heissler, Sarah M; Sellers, James R; Knight, Peter J; Tomlinson, Darren; Peckham, Michelle
2018-04-26
Imaging the actin cytoskeleton in cells uses a wide range of approaches. Typically, a fluorescent derivative of the small cyclic peptide phalloidin is used to image F-actin in fixed cells. Lifeact and F-tractin are popular for imaging the cytoskeleton in live cells. Here we characterised novel affinity reagents called Affimers that specifically bind to F-actin in vitro to determine if they are suitable alternatives as eGFP-fusion proteins, to label actin in live cells, or for labeling F-actin in fixed cells. In vitro experiments showed that 3 out of the 4 Affimers (Affimers 6, 14 and 24) tested bind tightly to purified F-actin, and appear to have overlapping binding sites. As eGFP-fusion proteins, the same 3 Affimers label F-actin in live cells. FRAP experiments suggest that eGFP-Affimer 6 behaves most similarly to F-tractin and Lifeact. However, it does not colocalise with mCherry-actin in dynamic ruffles, and may preferentially bind stable actin filaments. All 4 Affimers label F-actin in methanol fixed cells, while only Affimer 14 labels F-actin after paraformaldehyde fixation. eGFP-Affimer 6 has potential for use in selectively imaging the stable actin cytoskeleton in live cells, while all 4 Affimers are strong alternatives to phalloidin for labelling F-actin in fixed cells.
Sibov, Tatiana T; Pavon, Lorena F; Miyaki, Liza A; Mamani, Javier B; Nucci, Leopoldo P; Alvarim, Larissa T; Silveira, Paulo H; Marti, Luciana C; Gamarra, LF
2014-01-01
Here we describe multimodal iron oxide nanoparticles conjugated to Rhodamine-B (MION-Rh), their stability in culture medium, and subsequent validation of an in vitro protocol to label mesenchymal stem cells from umbilical cord blood (UC-MSC) with MION-Rh. These cells showed robust labeling in vitro without impairment of their functional properties, the viability of which were evaluated by proliferation kinetic and ultrastructural analyzes. Thus, labeled cells were infused into striatum of adult male rats of animal model that mimic late onset of Parkinson’s disease and, after 15 days, it was observed that cells migrated along the medial forebrain bundle to the substantia nigra as hypointense spots in T2 magnetic resonance imaging. These data were supported by short-term magnetic resonance imaging. Studies were performed in vivo, which showed that about 5 × 105 cells could be efficiently detected in the short term following infusion. Our results indicate that these labeled cells can be efficiently tracked in a neurodegenerative disease model. PMID:24531365
Mok, Pooi Ling; Leow, Sue Ngein; Koh, Avin Ee-Hwan; Mohd Nizam, Hairul Harun; Ding, Suet Lee Shirley; Luu, Chi; Ruhaslizan, Raduan; Wong, Hon Seng; Halim, Wan Haslina Wan Abdul; Ng, Min Hwei; Idrus, Ruszymah Binti Hj; Chowdhury, Shiplu Roy; Bastion, Catherine Mae-Lynn; Subbiah, Suresh Kumar; Higuchi, Akon; Alarfaj, Abdullah A; Then, Kong Yong
2017-02-08
Mesenchymal stem cells are widely used in many pre-clinical and clinical settings. Despite advances in molecular technology; the migration and homing activities of these cells in in vivo systems are not well understood. Labelling mesenchymal stem cells with gold nanoparticles has no cytotoxic effect and may offer suitable indications for stem cell tracking. Here, we report a simple protocol to label mesenchymal stem cells using 80 nm gold nanoparticles. Once the cells and particles were incubated together for 24 h, the labelled products were injected into the rat subretinal layer. Micro-computed tomography was then conducted on the 15th and 30th day post-injection to track the movement of these cells, as visualized by an area of hyperdensity from the coronal section images of the rat head. In addition, we confirmed the cellular uptake of the gold nanoparticles by the mesenchymal stem cells using transmission electron microscopy. As opposed to other methods, the current protocol provides a simple, less labour-intensive and more efficient labelling mechanism for real-time cell tracking. Finally, we discuss the potential manipulations of gold nanoparticles in stem cells for cell replacement and cancer therapy in ocular disorders or diseases.
Mok, Pooi Ling; Leow, Sue Ngein; Koh, Avin Ee-Hwan; Mohd Nizam, Hairul Harun; Ding, Suet Lee Shirley; Luu, Chi; Ruhaslizan, Raduan; Wong, Hon Seng; Halim, Wan Haslina Wan Abdul; Ng, Min Hwei; Idrus, Ruszymah Binti Hj.; Chowdhury, Shiplu Roy; Bastion, Catherine Mae-Lynn; Subbiah, Suresh Kumar; Higuchi, Akon; Alarfaj, Abdullah A.; Then, Kong Yong
2017-01-01
Mesenchymal stem cells are widely used in many pre-clinical and clinical settings. Despite advances in molecular technology; the migration and homing activities of these cells in in vivo systems are not well understood. Labelling mesenchymal stem cells with gold nanoparticles has no cytotoxic effect and may offer suitable indications for stem cell tracking. Here, we report a simple protocol to label mesenchymal stem cells using 80 nm gold nanoparticles. Once the cells and particles were incubated together for 24 h, the labelled products were injected into the rat subretinal layer. Micro-computed tomography was then conducted on the 15th and 30th day post-injection to track the movement of these cells, as visualized by an area of hyperdensity from the coronal section images of the rat head. In addition, we confirmed the cellular uptake of the gold nanoparticles by the mesenchymal stem cells using transmission electron microscopy. As opposed to other methods, the current protocol provides a simple, less labour-intensive and more efficient labelling mechanism for real-time cell tracking. Finally, we discuss the potential manipulations of gold nanoparticles in stem cells for cell replacement and cancer therapy in ocular disorders or diseases. PMID:28208719
Evidence for label-retaining tumour-initiating cells in human glioblastoma
Deleyrolle, Loic P.; Harding, Angus; Cato, Kathleen; Siebzehnrubl, Florian A.; Rahman, Maryam; Azari, Hassan; Olson, Sarah; Gabrielli, Brian; Osborne, Geoffrey; Vescovi, Angelo
2011-01-01
Individual tumour cells display diverse functional behaviours in terms of proliferation rate, cell–cell interactions, metastatic potential and sensitivity to therapy. Moreover, sequencing studies have demonstrated surprising levels of genetic diversity between individual patient tumours of the same type. Tumour heterogeneity presents a significant therapeutic challenge as diverse cell types within a tumour can respond differently to therapies, and inter-patient heterogeneity may prevent the development of general treatments for cancer. One strategy that may help overcome tumour heterogeneity is the identification of tumour sub-populations that drive specific disease pathologies for the development of therapies targeting these clinically relevant sub-populations. Here, we have identified a dye-retaining brain tumour population that displays all the hallmarks of a tumour-initiating sub-population. Using a limiting dilution transplantation assay in immunocompromised mice, label-retaining brain tumour cells display elevated tumour-initiation properties relative to the bulk population. Importantly, tumours generated from these label-retaining cells exhibit all the pathological features of the primary disease. Together, these findings confirm dye-retaining brain tumour cells exhibit tumour-initiation ability and are therefore viable targets for the development of therapeutics targeting this sub-population. PMID:21515906
Malviya, Gaurav; Nayak, Tapan; Gerdes, Christian; Dierckx, Rudi A J O; Signore, Alberto; de Vries, Erik F J
2016-04-04
A noninvasive in vivo imaging method for NK cell trafficking is essential to gain further understanding of the pathogenesis of NK cell mediated immune response to the novel cancer treatment strategies, and to discover the homing sites and physiological distribution of NK cells. Although human NK cells can be labeled for in vivo imaging, little is known about the murine NK cell labeling and its application in animal models. This study describes the isolation and ex vivo radiolabeling of murine NK cells for the evaluation of cell trafficking in an orthotopic model of human lung cancer in mice. Scid-Tg(FCGR3A)Blt transgenic SCID mice were used to isolate NK cells from mouse splenocytes using the CD49b (DX5) MicroBeads positive selection method. The purity and viability of the isolated NK cells were confirmed by FACS analysis. Different labeling buffers and incubation times were evaluated to optimize (111)In-oxine labeling conditions. Functionality of the radiolabeled NK cell was assessed by (51)Cr-release assay. We evaluated physiological distribution of (111)In-oxine labeled murine NK cells in normal SCID mice and biodistribution in irradiated and nonirradiated SCID mice with orthotopic A549 human lung tumor lesions. Imaging findings were confirmed by histology. Results showed that incubation with 0.011 MBq of (111)In-oxine per million murine NK cells in PBS (pH 7.4) for 20 min is the best condition that provides optimum labeling efficiency without affecting cell viability and functionality. Physiological distribution in normal SCID mice demonstrated NK cells homing mainly in the spleen, while (111)In released from NK cells was excreted via kidneys into urine. Biodistribution studies demonstrated a higher lung uptake in orthotopic lung tumor-bearing mice than control mice. In irradiated mice, lung tumor uptake of radiolabeled murine NK cells decreased between 24 h and 72 h postinjection (p.i.), which was accompanied by tumor regression, while in nonirradiated mice
Live cell imaging of phosphoinositide dynamics during Legionella infection.
Weber, Stephen; Hilbi, Hubert
2014-01-01
The "accidental" pathogen Legionella pneumophila replicates intracellularly in a distinct compartment, the Legionella-containing vacuole (LCV). To form this specific pathogen vacuole, the bacteria translocate via the Icm/Dot type IV secretion system approximately 300 different effector proteins into the host cell. Several of these secreted effectors anchor to the cytoplasmic face of the LCV membrane by binding to phosphoinositide (PI) lipids. L. pneumophila thus largely controls the localization of secreted bacterial effectors and the recruitment of host factors to the LCV through the modulation of the vacuole membrane PI pattern. The LCV PI pattern and its dynamics can be studied in real-time using fluorescently labeled protein probes stably produced by the soil amoeba Dictyostelium discoideum. In this chapter, we describe a protocol to (1) construct and handle amoeba model systems as a tool for observing PIs in live cell imaging, (2) capture rapid changes in membrane PI patterning during uptake events, and (3) observe the dynamics of LCV PIs over the course of a Legionella infection.
Yan, Yuanwei; Sart, Sébastien; Calixto Bejarano, Fabian; Muroski, Megan E; Strouse, Geoffrey F; Grant, Samuel C; Li, Yan
2015-01-01
Magnetic resonance imaging (MRI) provides an effective approach to track labeled pluripotent stem cell (PSC)-derived neural progenitor cells (NPCs) for neurological disorder treatments after cell labeling with a contrast agent, such as an iron oxide derivative. Cryopreservation of pre-labeled neural cells, especially in three-dimensional (3D) structure, can provide a uniform cell population and preserve the stem cell niche for the subsequent applications. In this study, the effects of cryopreservation on PSC-derived multicellular NPC aggregates labeled with micron-sized particles of iron oxide (MPIO) were investigated. These NPC aggregates were labeled prior to cryopreservation because labeling thawed cells can be limited by inefficient intracellular uptake, variations in labeling efficiency, and increased culture time before use, minimizing their translation to clinical settings. The results indicated that intracellular MPIO incorporation was retained after cryopreservation (70-80% labeling efficiency), and MPIO labeling had little adverse effects on cell recovery, proliferation, cytotoxicity and neural lineage commitment post-cryopreservation. MRI analysis showed comparable detectability for the MPIO-labeled cells before and after cryopreservation indicated by T2 and T2* relaxation rates. Cryopreserving MPIO-labeled 3D multicellular NPC aggregates can be applied in in vivo cell tracking studies and lead to more rapid translation from preservation to clinical implementation. © 2015 American Institute of Chemical Engineers.
NASA Astrophysics Data System (ADS)
Sebesta, Mikael; Egelberg, Peter J.; Langberg, Anders; Lindskov, Jens-Henrik; Alm, Kersti; Janicke, Birgit
2016-03-01
Live-cell imaging enables studying dynamic cellular processes that cannot be visualized in fixed-cell assays. An increasing number of scientists in academia and the pharmaceutical industry are choosing live-cell analysis over or in addition to traditional fixed-cell assays. We have developed a time-lapse label-free imaging cytometer HoloMonitorM4. HoloMonitor M4 assists researchers to overcome inherent disadvantages of fluorescent analysis, specifically effects of chemical labels or genetic modifications which can alter cellular behavior. Additionally, label-free analysis is simple and eliminates the costs associated with staining procedures. The underlying technology principle is based on digital off-axis holography. While multiple alternatives exist for this type of analysis, we prioritized our developments to achieve the following: a) All-inclusive system - hardware and sophisticated cytometric analysis software; b) Ease of use enabling utilization of instrumentation by expert- and entrylevel researchers alike; c) Validated quantitative assay end-points tracked over time such as optical path length shift, optical volume and multiple derived imaging parameters; d) Reliable digital autofocus; e) Robust long-term operation in the incubator environment; f) High throughput and walk-away capability; and finally g) Data management suitable for single- and multi-user networks. We provide examples of HoloMonitor applications of label-free cell viability measurements and monitoring of cell cycle phase distribution.
NASA Astrophysics Data System (ADS)
Nejadnik, Hossein; Lenkov, Olga; Gassert, Florian; Fretwell, Deborah; Lam, Isaac; Daldrup-Link, Heike E.
2016-05-01
Human mesenchymal stem cells (hMSCs) are a promising tool for cartilage regeneration in arthritic joints. hMSC labeling with iron oxide nanoparticles enables non-invasive in vivo monitoring of transplanted cells in cartilage defects with MR imaging. Since graft failure leads to macrophage phagocytosis of apoptotic cells, we evaluated in vitro and in vivo whether nanoparticle-labeled hMSCs show distinct MR signal characteristics before and after phagocytosis by macrophages. We found that apoptotic nanoparticle-labeled hMSCs were phagocytosed by macrophages while viable nanoparticle-labeled hMSCs were not. Serial MRI scans of hMSC transplants in arthritic joints of recipient rats showed that the iron signal of apoptotic, nanoparticle-labeled hMSCs engulfed by macrophages disappeared faster compared to viable hMSCs. This corresponded to poor cartilage repair outcomes of the apoptotic hMSC transplants. Therefore, rapid decline of iron MRI signal at the transplant site can indicate cell death and predict incomplete defect repair weeks later. Currently, hMSC graft failure can be only diagnosed by lack of cartilage defect repair several months after cell transplantation. The described imaging signs can diagnose hMSC transplant failure more readily, which could enable timely re-interventions and avoid unnecessary follow up studies of lost transplants.
Nejadnik, Hossein; Lenkov, Olga; Gassert, Florian; Fretwell, Deborah; Lam, Isaac; Daldrup-Link, Heike E
2016-05-13
Human mesenchymal stem cells (hMSCs) are a promising tool for cartilage regeneration in arthritic joints. hMSC labeling with iron oxide nanoparticles enables non-invasive in vivo monitoring of transplanted cells in cartilage defects with MR imaging. Since graft failure leads to macrophage phagocytosis of apoptotic cells, we evaluated in vitro and in vivo whether nanoparticle-labeled hMSCs show distinct MR signal characteristics before and after phagocytosis by macrophages. We found that apoptotic nanoparticle-labeled hMSCs were phagocytosed by macrophages while viable nanoparticle-labeled hMSCs were not. Serial MRI scans of hMSC transplants in arthritic joints of recipient rats showed that the iron signal of apoptotic, nanoparticle-labeled hMSCs engulfed by macrophages disappeared faster compared to viable hMSCs. This corresponded to poor cartilage repair outcomes of the apoptotic hMSC transplants. Therefore, rapid decline of iron MRI signal at the transplant site can indicate cell death and predict incomplete defect repair weeks later. Currently, hMSC graft failure can be only diagnosed by lack of cartilage defect repair several months after cell transplantation. The described imaging signs can diagnose hMSC transplant failure more readily, which could enable timely re-interventions and avoid unnecessary follow up studies of lost transplants.
Saga, Yukika; Inamura, Tomoka; Shimada, Nao; Kawata, Takefumi
2016-05-01
STATa, a Dictyostelium homologue of metazoan signal transducer and activator of transcription, is important for the organizer function in the tip region of the migrating Dictyostelium slug. We previously showed that ecmF gene expression depends on STATa in prestalk A (pstA) cells, where STATa is activated. Deletion and site-directed mutagenesis analysis of the ecmF/lacZ fusion gene in wild-type and STATa null strains identified an imperfect inverted repeat sequence, ACAAATANTATTTGT, as a STATa-responsive element. An upstream sequence element was required for efficient expression in the rear region of pstA zone; an element downstream of the inverted repeat was necessary for sufficient prestalk expression during culmination. Band shift analyses using purified STATa protein detected no sequence-specific binding to those ecmF elements. The only verified upregulated target gene of STATa is cudA gene; CudA directly activates expL7 gene expression in prestalk cells. However, ecmF gene expression was almost unaffected in a cudA null mutant. Several previously reported putative STATa target genes were also expressed in cudA null mutant but were downregulated in STATa null mutant. Moreover, mybC, which encodes another transcription factor, belonged to this category, and ecmF expression was downregulated in a mybC null mutant. These findings demonstrate the existence of a genetic hierarchy for pstA-specific genes, which can be classified into two distinct STATa downstream pathways, CudA dependent and independent. The ecmF expression is indirectly upregulated by STATa in a CudA-independent activation manner but dependent on MybC, whose expression is positively regulated by STATa. © 2016 Japanese Society of Developmental Biologists.
Antfolk, Maria; Kim, Soo Hyeon; Koizumi, Saori; Fujii, Teruo; Laurell, Thomas
2017-04-20
The incidence of cancer is increasing worldwide and metastatic disease, through the spread of circulating tumor cells (CTCs), is responsible for the majority of the cancer deaths. Accurate monitoring of CTC levels in blood provides clinical information supporting therapeutic decision making, and improved methods for CTC enumeration are asked for. Microfluidics has been extensively used for this purpose but most methods require several post-separation processing steps including concentration of the sample before analysis. This induces a high risk of sample loss of the collected rare cells. Here, an integrated system is presented that efficiently eliminates this risk by integrating label-free separation with single cell arraying of the target cell population, enabling direct on-chip tumor cell identification and enumeration. Prostate cancer cells (DU145) spiked into a sample with whole blood concentration of the peripheral blood mononuclear cell (PBMC) fraction were efficiently separated and trapped at a recovery of 76.2 ± 5.9% of the cancer cells and a minute contamination of 0.12 ± 0.04% PBMCs while simultaneously enabling a 20x volumetric concentration. This constitutes a first step towards a fully integrated system for rapid label-free separation and on-chip phenotypic characterization of circulating tumor cells from peripheral venous blood in clinical practice.
Zhang, Z; Mascheri, N; Dharmakumar, R; Fan, Z; Paunesku, T; Woloschak, G; Li, D
2010-01-01
Background Detection of a gene using magnetic resonance imaging (MRI) is hindered by the magnetic resonance (MR) targeting gene technique. Therefore it may be advantageous to image gene-expressing cells labeled with superparamagnetic iron oxide (SPIO) nanoparticles by MRI. Methods The GFP-R3230Ac (GFP) cell line was incubated for 24 h using SPIO nanoparticles at a concentration of 20 μg Fe/mL. Cell samples were prepared for iron content analysis and cell function evaluation. The labeled cells were imaged using fluorescent microscopy and MRI. Results SPIO was used to label GFP cells effectively, with no effects on cell function and GFP expression. Iron-loaded GFP cells were successfully imaged with both fluorescent microscopy and T2*-weighted MRI. Prussian blue staining showed intracellular iron accumulation in the cells. All cells were labeled (100% labeling efficiency). The average iron content per cell was 4.75±0.11 pg Fe/cell (P<0.05 versus control). Discussion This study demonstrates that the GFP expression of cells is not altered by the SPIO labeling process. SPIO-labeled GFP cells can be visualized by MRI; therefore, GFP, a gene marker, was tracked indirectly with the SPIO-loaded cells using MRI. The technique holds promise for monitoring the temporal and spatial migration of cells with a gene marker and enhancing the understanding of cell- and gene-based therapeutic strategies. PMID:18956269
Peckys, Diana B; Bandmann, Vera; de Jonge, Niels
2014-01-01
Correlative fluorescence microscopy combined with scanning transmission electron microscopy (STEM) of cells fully immersed in liquid is a new methodology with many application areas. Proteins, in live cells immobilized on microchips, are labeled with fluorescent quantum dot nanoparticles. In this protocol, the epidermal growth factor receptor (EGFR) is labeled. The cells are fixed after a selected labeling time, for example, 5 min as needed to form EGFR dimers. The microchip with cells is then imaged with fluorescence microscopy. Thereafter, STEM can be accomplished in two ways. The microchip with the labeled cells and one microchip with a spacer are assembled into a special microfluidic device and imaged with dedicated high-voltage STEM. Alternatively, thin edges of cells can be studied with environmental scanning electron microscopy with a STEM detector, by placing a microchip with cells in a cooled wet environment. © 2014 Elsevier Inc. All rights reserved.
Fluorescent labeling of tetracysteine-tagged proteins in intact cells.
Hoffmann, Carsten; Gaietta, Guido; Zürn, Alexander; Adams, Stephen R; Terrillon, Sonia; Ellisman, Mark H; Tsien, Roger Y; Lohse, Martin J
2010-09-01
In this paper, we provide a general protocol for labeling proteins with the membrane-permeant fluorogenic biarsenical dye fluorescein arsenical hairpin binder-ethanedithiol (FlAsH-EDT₂). Generation of the tetracysteine-tagged protein construct by itself is not described, as this is a protein-specific process. This method allows site-selective labeling of proteins in living cells and has been applied to a wide variety of proteins and biological problems. We provide here a generally applicable labeling procedure and discuss the problems that can occur as well as general considerations that must be taken into account when designing and implementing the procedure. The method can even be applied to proteins with expression below 1 pmol mg⁻¹ of protein, such as G protein-coupled receptors, and it can be used to study the intracellular localization of proteins as well as functional interactions in fluorescence resonance energy transfer experiments. The labeling procedure using FlAsH-EDT₂ as described takes 2-3 h, depending on the number of samples to be processed.
Fluorescent labeling of tetracysteine-tagged proteins in intact cells
Hoffmann, Carsten; Gaietta, Guido; Zürn, Alexander; Adams, Stephen R; Terrillon, Sonia; Ellisman, Mark H; Tsien, Roger Y; Lohse, Martin J
2011-01-01
In this paper, we provide a general protocol for labeling proteins with the membrane-permeant fluorogenic biarsenical dye fluorescein arsenical hairpin binder–ethanedithiol (FlAsH-EDT2). Generation of the tetracysteine-tagged protein construct by itself is not described, as this is a protein-specific process. This method allows site-selective labeling of proteins in living cells and has been applied to a wide variety of proteins and biological problems. We provide here a generally applicable labeling procedure and discuss the problems that can occur as well as general considerations that must be taken into account when designing and implementing the procedure. The method can even be applied to proteins with expression below 1 pmol mg−1 of protein, such as G protein–coupled receptors, and it can be used to study the intracellular localization of proteins as well as functional interactions in fluorescence resonance energy transfer experiments. The labeling procedure using FlAsH-EDT2 as described takes 2–3 h, depending on the number of samples to be processed. PMID:20885379
Hirose, Shigenori; Santhanam, Balaji; Katoh-Kurosawa, Mariko; Shaulsky, Gad; Kuspa, Adam
2015-01-01
The social amoeba Dictyostelium discoideum integrates into a multicellular organism when individual starving cells aggregate and form a mound. The cells then integrate into defined tissues and develop into a fruiting body that consists of a stalk and spores. Aggregation is initially orchestrated by waves of extracellular cyclic adenosine monophosphate (cAMP), and previous theory suggested that cAMP and other field-wide diffusible signals mediate tissue integration and terminal differentiation as well. Cooperation between cells depends on an allorecognition system comprising the polymorphic adhesion proteins TgrB1 and TgrC1. Binding between compatible TgrB1 and TgrC1 variants ensures that non-matching cells segregate into distinct aggregates prior to terminal development. Here, we have embedded a small number of cells with incompatible allotypes within fields of developing cells with compatible allotypes. We found that compatibility of the allotype encoded by the tgrB1 and tgrC1 genes is required for tissue integration, as manifested in cell polarization, coordinated movement and differentiation into prestalk and prespore cells. Our results show that the molecules that mediate allorecognition in D. discoideum also control the integration of individual cells into a unified developing organism, and this acts as a gating step for multicellularity. PMID:26395484
A novel label-free cell-based assay technology using biolayer interferometry.
Verzijl, D; Riedl, T; Parren, P W H I; Gerritsen, A F
2017-01-15
Biolayer interferometry (BLI) is a well-established optical label-free technique to study biomolecular interactions. Here we describe for the first time a cell-based BLI (cBLI) application that allows label-free real-time monitoring of signal transduction in living cells. Human A431 epidermoid carcinoma cells were captured onto collagen-coated biosensors and serum-starved, followed by exposure to agonistic compounds targeting various receptors, while recording the cBLI signal. Stimulation of the epidermal growth factor receptor (EGFR) with EGF, the β 2 -adrenoceptor with dopamine, or the hepatocyte growth factor receptor (HGFR/c-MET) with an agonistic antibody resulted in distinct cBLI signal patterns. We show that the mechanism underlying the observed changes in cBLI signal is mediated by rearrangement of the actin cytoskeleton, a process referred to as dynamic mass redistribution (DMR). A panel of ligand-binding blocking and non-blocking anti-EGFR antibodies was used to demonstrate that this novel BLI application can be efficiently used as a label-free cellular assay for compound screening and characterization. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Bae, Albert; Westendorf, Christian; Erlenkamper, Christoph; Galland, Edouard; Franck, Carl; Bodenschatz, Eberhard; Beta, Carsten
2010-03-01
Eukaryotic cell flattening is valuable for improving microscopic observations, ranging from bright field to total internal reflection fluorescence microscopy. In this talk, we will discuss traditional overlay techniques, and more modern, microfluidic based flattening, which provides a greater level of control. We demonstrate these techniques on the social amoebae Dictyostelium discoideum, comparing the advantages and disadvantages of each method.
Toxic effects of mercury on the cell nucleus of Dictyostelium discoideum.
Boatti, Lara; Rapallo, Fabio; Viarengo, Aldo; Marsano, Francesco
2017-02-01
Governmental agencies (www.epa.gov/mercury) and the scientific community have reported on the high toxicity due to mercury. Indeed, exposure to mercury can cause severe injury to the central nervous system and kidney in humans. Beyond its recognized toxicity, little is known regarding the molecular mechanisms involved in the actions of this heavy metal. Mercury has been also observed to form insoluble fibrous protein aggregates in the cell nucleus. We used D. discoideum to evaluate micronuclei formation and, since mercury is able to induce oxidative stress that could bring to protein aggregation, we assessed nuclear protein carbonylation by Western Blot. We observed a significant increase in micronuclei formation and 14 carbonylated proteins were identified. Moreover, we used isotope-coded protein label (ICPL) and mass spectrometry analysis of proteins obtained by lysis of purified nuclei, before of tryptic digestion to quantify nuclear proteins affected by mercury. In particular, we examined the effects of mercury that associate a classical genotoxic assay to proteomic effects into the nucleus. The data present direct evidences for mercury genotoxicity, nuclear protein carbonylation, quantitative change in core histones, and the involvement of pseudouridine synthase in mercury toxicity. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 417-425, 2017. © 2016 Wiley Periodicals, Inc.
Sociogenomics of self vs. non-self cooperation during development of Dictyostelium discoideum.
Li, Si I; Buttery, Neil J; Thompson, Christopher R L; Purugganan, Michael D
2014-07-21
Dictyostelium discoideum, a microbial model for social evolution, is known to distinguish self from non-self and show genotype-dependent behavior during chimeric development. Aside from a small number of cell-cell recognition genes, however, little is known about the genetic basis of self/non-self recognition in this species. Based on the key hypothesis that there should be differential expression of genes if D. discoideum cells were interacting with non-clone mates, we performed transcriptomic profiling study in this species during clonal vs. chimeric development. The transcriptomic profiles of D. discoideum cells in clones vs. different chimeras were compared at five different developmental stages using a customized microarray. Effects of chimerism on global transcriptional patterns associated with social interactions were observed. We find 1,759 genes significantly different between chimera and clone, 1,144 genes associated significant strain differences, and 6,586 genes developmentally regulated over time. Principal component analysis showed a small amount of the transcriptional variance to chimerism-related factors (Chimerism: 0.18%, Chimerism × Timepoint: 0.03%). There are 162 genes specifically regulated under chimeric development, with continuous small differences between chimera vs. clone over development. Almost 60% of chimera-associated differential genes were differentially expressed at the 4 h aggregate stage, which corresponds to the initial transition of D. discoideum from solitary life to a multicellular phase. A relatively small proportion of over-all variation in gene expression is explained by differences between chimeric and clonal development. The relatively small modifications in gene expression associated with chimerism is compatible with the high level of cooperation observed among different strains of D. discoideum; cells of distinct genetic backgrounds will co-aggregate indiscriminately and co-develop into fruiting bodies. Chimeric
High-resolution x-ray diffraction microscopy of specifically labeled yeast cells
Nelson, Johanna; Huang, Xiaojing; Steinbrener, Jan; Shapiro, David; Kirz, Janos; Marchesini, Stefano; Neiman, Aaron M.; Turner, Joshua J.; Jacobsen, Chris
2010-01-01
X-ray diffraction microscopy complements other x-ray microscopy methods by being free of lens-imposed radiation dose and resolution limits, and it allows for high-resolution imaging of biological specimens too thick to be viewed by electron microscopy. We report here the highest resolution (11–13 nm) x-ray diffraction micrograph of biological specimens, and a demonstration of molecular-specific gold labeling at different depths within cells via through-focus propagation of the reconstructed wavefield. The lectin concanavalin A conjugated to colloidal gold particles was used to label the α-mannan sugar in the cell wall of the yeast Saccharomyces cerevisiae. Cells were plunge-frozen in liquid ethane and freeze-dried, after which they were imaged whole using x-ray diffraction microscopy at 750 eV photon energy. PMID:20368463
High-resolution x-ray diffraction microscopy of specifically labeled yeast cells
Nelson, Johanna; Huang, Xiaojing; Steinbrener, Jan; ...
2010-04-20
X-ray diffraction microscopy complements other x-ray microscopy methods by being free of lens-imposed radiation dose and resolution limits, and it allows for high-resolution imaging of biological specimens too thick to be viewed by electron microscopy. We report here the highest resolution (11-13 nm) x-ray diffraction micrograph of biological specimens, and a demonstration of molecular-specific gold labeling at different depths within cells via through-focus propagation of the reconstructed wavefield. The lectin concanavalin A conjugated to colloidal gold particles was used to label the α-mannan sugar in the cell wall of the yeast Saccharomyces cerevisiae. Cells were plunge-frozen in liquid ethane andmore » freeze-dried, after which they were imaged whole using x-ray diffraction microscopy at 750 eV photon energy.« less
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report inmore » the interest of brevity.« less
Mohanty, S; Jermyn, K A; Early, A; Kawata, T; Aubry, L; Ceccarelli, A; Schaap, P; Williams, J G; Firtel, R A
1999-08-01
Dd-STATa is a structural and functional homologue of the metazoan STAT (Signal Transducer and Activator of Transcription) proteins. We show that Dd-STATa null cells exhibit several distinct developmental phenotypes. The aggregation of Dd-STATa null cells is delayed and they chemotax slowly to a cyclic AMP source, suggesting a role for Dd-STATa in these early processes. In Dd-STATa null strains, slug-like structures are formed but they have an aberrant pattern of gene expression. In such slugs, ecmB/lacZ, a marker that is normally specific for cells on the stalk cell differentiation pathway, is expressed throughout the prestalk region. Stalk cell differentiation in Dictyostelium has been proposed to be under negative control, mediated by repressor elements present in the promoters of stalk cell-specific genes. Dd-STATa binds these repressor elements in vitro and the ectopic expression of ecmB/lacZ in the null strain provides in vivo evidence that Dd-STATa is the repressor protein that regulates commitment to stalk cell differentiation. Dd-STATa null cells display aberrant behavior in a monolayer assay wherein stalk cell differentiation is induced using the stalk cell morphogen DIF. The ecmB gene, a general marker for stalk cell differentiation, is greatly overinduced by DIF in Dd-STATa null cells. Also, Dd-STATa null cells are hypersensitive to DIF for expression of ST/lacZ, a marker for the earliest stages in the differentiation of one of the stalk cell sub-types. We suggest that both these manifestations of DIF hypersensitivity in the null strain result from the balance between activation and repression of the promoter elements being tipped in favor of activation when the repressor is absent. Paradoxically, although Dd-STATa null cells are hypersensitive to the inducing effects of DIF and readily form stalk cells in monolayer assay, the Dd-STATa null cells show little or no terminal stalk cell differentiation within the slug. Dd-STATa null slugs remain
Hazum, E; Nimrod, A
1982-01-01
Photoaffinity labeling of rat ovarian granulosa cells and membrane preparations with a bioactive photoaffinity derivative of gonadotropin-releasing hormone resulted in identification of two specific components with apparent molecular weights of 60,000 and 54,000. Fluorescent visualization of gonadotropin-releasing hormone receptors in these cells, by using a bioactive rhodamine derivative of the hormone, indicated that the fluorescently labeled receptors were initially distributed uniformly on the cell surface and then formed patches that subsequently internalized (at 37 degrees C) into endocytic vesicles. These processes were dependent on specific binding sites for the rhodamine-labeled peptide on the granulosa cells. These studies may provide an experimental basis for understanding the molecular events involved in the action of the hormone in the ovary. Images PMID:6281784
Muselaers, Constantijn H J; Rijpkema, Mark; Bos, Desirée L; Langenhuijsen, Johan F; Oyen, Wim J G; Mulders, Peter F A; Oosterwijk, Egbert; Boerman, Otto C
2015-08-01
Tumor targeted optical imaging using antibodies labeled with near infrared fluorophores is a sensitive imaging modality that might be used during surgery to assure complete removal of malignant tissue. We evaluated the feasibility of dual modality imaging and image guided surgery with the dual labeled anti-carbonic anhydrase IX antibody preparation (111)In-DTPA-G250-IRDye800CW in mice with intraperitoneal clear cell renal cell carcinoma. BALB/c nu/nu mice with intraperitoneal SK-RC-52 lesions received 10 μg DTPA-G250-IRDye800CW labeled with 15 MBq (111)In or 10 μg of the dual labeled irrelevant control antibody NUH-82 (20 mice each). To evaluate when tumors could be detected, 4 mice per group were imaged weekly during 5 weeks with single photon emission computerized tomography/computerized tomography and the fluorescence imaging followed by ex vivo biodistribution studies. As early as 1 week after tumor cell inoculation single photon emission computerized tomography and fluorescence images showed clear delineation of intraperitoneal clear cell renal cell carcinoma with good concordance between single photon emission computerized tomography/computerized tomography and fluorescence images. The high and specific accumulation of the dual labeled antibody conjugate in tumors was confirmed in the biodistribution studies. Maximum tumor uptake was observed 1 week after inoculation (mean ± SD 58.5% ± 18.7% vs 5.6% ± 2.3% injected dose per gm for DTPA-G250-IRDye800CW vs NUH-82, respectively). High tumor uptake was also observed at other time points. This study demonstrates the feasibility of dual modality imaging with dual labeled antibody (111)In-DTPA-G250-IRDye800CW in a clear cell renal cell carcinoma model. Results indicate that preoperative and intraoperative detection of carbonic anhydrase IX expressing tumors, positive resection margins and metastasis might be feasible with this approach. Copyright © 2015 American Urological Association Education and Research
On-chip integrated labelling, transport and detection of tumour cells.
Woods, Jane; Docker, Peter T; Dyer, Charlotte E; Haswell, Stephen J; Greenman, John
2011-11-01
Microflow cytometry represents a promising tool for the investigation of diagnostic and prognostic cellular cancer markers, particularly if integrated within a device that allows primary cells to be freshly isolated from the solid tumour biopsies that more accurately reflect patient-specific in vivo tissue microenvironments at the time of staining. However, current tissue processing techniques involve several sequential stages with concomitant cell losses, and as such are inappropriate for use with small biopsies. Accordingly, we present a simple method for combined antibody-labelling and dissociation of heterogeneous cells from a tumour mass, which reduces the number of processing steps. Perfusion of ex vivo tissue at 4°C with antibodies and enzymes slows cellular activity while allowing sufficient time for the diffusion of minimally active enzymes. In situ antibody-labelled cells are then dissociated at 37°C from the tumour mass, whereupon hydrogel-filled channels allow the release of relatively low cell numbers (<1000) into a biomimetic microenvironment. This novel approach to sample processing is then further integrated with hydrogel-based electrokinetic transport of the freshly liberated fluorescent cells for downstream detection. It is anticipated that this integrated microfluidic methodology will have wide-ranging biomedical and clinical applications. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Verkerke-van Wijk, I; Fukuzawa, M; Devreotes, P N; Schaap, P
2001-06-01
cAMP oscillations, generated by adenylyl cyclase A (ACA), coordinate cell aggregation in Dictyostelium and have also been implicated in organizer function during multicellular development. We used a gene fusion of the ACA promoter with a labile lacZ derivative to study the expression pattern of ACA. During aggregation, most cells expressed ACA, but thereafter expression was lost in all cells except those of the anterior tip. Before aggregation, ACA transcription was strongly upregulated by nanomolar cAMP pulses. Postaggregative transcription was sustained by nanomolar cAMP pulses, but downregulated by a continuous micromolar cAMP stimulus and by the stalk-cell-inducing factor DIF. Earlier work showed that the transcription factor StatA displays tip-specific nuclear translocation and directs tip-specific expression of the nuclear protein CudA, which is essential for culmination. Both StatA and CudA were present in nuclei throughout the entire slug in an aca null mutant that expresses ACA from the constitutive actin15 promoter. This suggests that the tip-specific expression of ACA directs tip-specific nuclear translocation of StatA and tip-specific expression of CudA. Copyright 2001 Academic Press.
Uncovering stem-cell heterogeneity in the microniche with label-free microfluidics
NASA Astrophysics Data System (ADS)
Sohn, Lydia L.
2013-03-01
Better suited for large number of cells from bulk tissue, traditional cell-screening techniques, such as fluorescence-activated cell sorting (FACS) and magnetic-activated cell sorting (MACS), cannot easily screen stem or progenitor cells from minute populations found in their physiological niches. Furthermore, they rely upon irreversible antibody binding, potentially altering cell properties, including gene expression and regenerative capacity. We have developed a label-free, single-cell analysis microfluidic platform capable of quantifying cell-surface marker expression of functional organ stem cells directly isolated from their micro-anatomical niche. With this platform, we have screened single quiescent muscle stem (satellite) cells derived from single myofibers, and we have uncovered an important heterogeneity in the surface-marker expression of these cells. By sorting the screened cells with our microfluidic device, we have determined what this heterogeneity means in terms of muscle stem-cell functionality. For instance, we show that the levels of beta1-integrin can predict the differentiation capacity of quiescent satellite cells, and in contrast to recent literature, that some CXCR4 + cells are not myogenic. Our results provide the first direct demonstration of a microniche-specific variation in gene expression in stem cells of the same lineage. Overall, our label-free, single-cell analysis and cell-sorting platform could be extended to other systems involving rare-cell subsets. This work was funded by the W. M. Keck Foundation, NIH, and California Institute of Regenerative Medicine
Adeno Associated Viral-mediated intraosseus labeling of bone marrow derived cells for CNS tracking
Selenica, Maj-Linda B.; Reid, Patrick; Pena, Gabriela; Alvarez, Jennifer; Hunt, Jerry B.; Nash, Kevin R.; Morgan, Dave; Gordon, Marcia N.; Lee, Daniel C.
2016-01-01
Inflammation, including microglial activation in the CNS, is an important hallmark in many neurodegenerative diseases. Microglial stimuli not only impact the brain microenvironment by production and release of cytokines and chemokines, but also influence the activity of bone marrow derived cells and blood born macrophage populations. In many diseases including brain disorders and spinal cord injury, researchers have tried to harbor the neuroprotective and repair properties of these subpopulations. Hematopoietic bone marrow derived cells (BMDCs) are of great interest, especially during gene therapy because certain hematopoietic cell subpopulations traffic to the sites of injury and inflammation. The aim of this study was to develop a method of labeling endogenous bone marrow derived cells through intraosseus impregnation of recombinant adeno-associated virus (rAAV) or lentivirus. We utilized rAAV serotype 9 (rAAV-9) or lentivirus for gene delivery of green florescence protein (GFP) to the mouse bone marrow cells. Flow cytometry showed that both viruses were able to efficiently transduce mouse bone marrow cells in vivo. However, the rAAV9–GFP viral construct transduced BMDCs more efficiently than the lentivirus (11.2% vs. 6.8%), as indicated by cellular GFP expression. We also demonstrate that GFP labeled cells correspond to bone marrow cells of myeloid origin using CD11b as a marker. Additionally, we characterized the ability of bone marrow derived, GFP labeled cells to extravasate into the brain parenchyma upon acute and subchronic neuroinflammatory stimuli in the mouse CNS. Viral mediated over expression of chemokine (C-C motif) ligand 2 (CCL2) or intracranial injection of lipopolysaccharide (LPS) recruited GFP labeled BMDCs from the periphery into the brain parenchyma compared to vehicle treated mice. Altogether our findings demonstrate a useful method of labeling endogenous BMDCs via viral transduction and the ability to track subpopulations throughout the
Formation of a cylindrical bridge in cell division
NASA Astrophysics Data System (ADS)
Citron, Daniel; Schmidt, Laura E.; Reichl, Elizabeth; Ren, Yixin; Robinson, Douglas; Zhang, Wendy W.
2007-11-01
In nature, the shape transition associated with the division of a mother cell into two daughter cells proceeds via a variety of routes. In the cylinder-thinning route, which has been observed in Dictyostelium and most animal cells, the mother cell first forms a broad bridge-like region, also known as a furrow, between two daughter cells. The furrow then rapidly evolves into a cylindrical bridge, which thins and eventually severs the mother cell into two. The fundamental mechanism underlying this division route is not understood. Recent experiments on Dictyostelium found that, while the cylinder-thinning route persists even when key actin cross-linking proteins are missing, it is disrupted by the removal of force-generating myosin-II proteins. Other measurements revealed that mutant cells lacking myosin-II have a much more uniform tension over the cell surface than wild-type cells. This suggests that tension variation may be important. Here we use a fluid model, previously shown to reproduce the thinning dynamics [Zhang & Robinson, PNAS 102, 7186 (2005)], to test this idea. Consistent with the experiments, the model shows that the cylinder formation process occurs regardless of the exact viscoelastic properties of the cell. In contrast to the experiments, a tension variation in the model hinders, rather then expedites, the cylinder formation.
NASA Astrophysics Data System (ADS)
Guillet-Nicolas, Rémy; Laprise-Pelletier, Myriam; Nair, Mahesh M.; Chevallier, Pascale; Lagueux, Jean; Gossuin, Yves; Laurent, Sophie; Kleitz, Freddy; Fortin, Marc-André
2013-11-01
Mesoporous silica nanoparticles (MSNs) are used in drug delivery and cell tracking applications. As Mn2+ is already implemented as a ``positive'' cell contrast agent in preclinical imaging procedures (in the form of MnCl2 for neurological studies), the introduction of Mn in the porous network of MSNs would allow labelling cells and tracking them using MRI. These particles are in general internalized in endosomes, an acidic environment with high saline concentration. In addition, the available MSN porosity could also serve as a carrier to deliver medical/therapeutic substances through the labelled cells. In the present study, manganese oxide was introduced in the porous network of MCM-48 silica nanoparticles (Mn-M48SNs). The particles exhibit a narrow size distribution (~140 nm diam.) and high porosity (~60% vol.), which was validated after insertion of Mn. The resulting Mn-M48SNs were characterized by TEM, N2 physisorption, and XRD. Evidence was found with H2-TPR, and XPS characterization, that Mn(ii) is the main oxidation state of the paramagnetic species after suspension in water, most probably in the form of Mn-OOH. The colloidal stability as a function of time was confirmed by DLS in water, acetate buffer and cell culture medium. In NMR data, no significant evidence of Mn2+ leaching was found in Mn-M48SNs in acidic water (pH 6), up to 96 hours after suspension. High longitudinal relaxivity values of r1 = 8.4 mM-1 s-1 were measured at 60 MHz and 37 °C, with the lowest relaxometric ratios (r2/r1 = 2) reported to date for a Mn-MSN system. Leukaemia cells (P388) were labelled with Mn-M48SNs and nanoparticle cell internalization was confirmed by TEM. Finally, MRI contrast enhancement provided by cell labelling with escalated incubation concentrations of Mn-M48SNs was quantified at 1 T. This study confirmed the possibility of efficiently confining Mn into M48SNs using incipient wetness, while maintaining an open porosity and relatively high pore volume. Because
Grace, Miriam; Hütt, Marc-Thorsten
2015-01-01
Spatiotemporal patterns often emerge from local interactions in a self-organizing fashion. In biology, the resulting patterns are also subject to the influence of the systematic differences between the system’s constituents (biological variability). This regulation of spatiotemporal patterns by biological variability is the topic of our review. We discuss several examples of correlations between cell properties and the self-organized spatiotemporal patterns, together with their relevance for biology. Our guiding, illustrative example will be spiral waves of cAMP in a colony of Dictyostelium discoideum cells. Analogous processes take place in diverse situations (such as cardiac tissue, where spiral waves occur in potentially fatal ventricular fibrillation) so a deeper understanding of this additional layer of self-organized pattern formation would be beneficial to a wide range of applications. One of the most striking differences between pattern-forming systems in physics or chemistry and those in biology is the potential importance of variability. In the former, system components are essentially identical with random fluctuations determining the details of the self-organization process and the resulting patterns. In biology, due to variability, the properties of potentially very few cells can have a driving influence on the resulting asymptotic collective state of the colony. Variability is one means of implementing a few-element control on the collective mode. Regulatory architectures, parameters of signaling cascades, and properties of structure formation processes can be "reverse-engineered" from observed spatiotemporal patterns, as different types of regulation and forms of interactions between the constituents can lead to markedly different correlations. The power of this biology-inspired view of pattern formation lies in building a bridge between two scales: the patterns as a collective state of a very large number of cells on the one hand, and the internal
Antfolk, Maria; Kim, Soo Hyeon; Koizumi, Saori; Fujii, Teruo; Laurell, Thomas
2017-01-01
The incidence of cancer is increasing worldwide and metastatic disease, through the spread of circulating tumor cells (CTCs), is responsible for the majority of the cancer deaths. Accurate monitoring of CTC levels in blood provides clinical information supporting therapeutic decision making, and improved methods for CTC enumeration are asked for. Microfluidics has been extensively used for this purpose but most methods require several post-separation processing steps including concentration of the sample before analysis. This induces a high risk of sample loss of the collected rare cells. Here, an integrated system is presented that efficiently eliminates this risk by integrating label-free separation with single cell arraying of the target cell population, enabling direct on-chip tumor cell identification and enumeration. Prostate cancer cells (DU145) spiked into a sample with whole blood concentration of the peripheral blood mononuclear cell (PBMC) fraction were efficiently separated and trapped at a recovery of 76.2 ± 5.9% of the cancer cells and a minute contamination of 0.12 ± 0.04% PBMCs while simultaneously enabling a 20x volumetric concentration. This constitutes a first step towards a fully integrated system for rapid label-free separation and on-chip phenotypic characterization of circulating tumor cells from peripheral venous blood in clinical practice. PMID:28425472
Comparing the Dictyostelium and Entamoeba Genomes Reveals an Ancient Split in the Conosa Lineage
Song, Jie; Xu, Qikai; Olsen, Rolf; Loomis, William F; Shaulsky, Gad; Kuspa, Adam; Sucgang, Richard
2005-01-01
The Amoebozoa are a sister clade to the fungi and the animals, but are poorly sampled for completely sequenced genomes. The social amoeba Dictyostelium discoideum and amitochondriate pathogen Entamoeba histolytica are the first Amoebozoa with genomes completely sequenced. Both organisms are classified under the Conosa subphylum. To identify Amoebozoa-specific genomic elements, we compared these two genomes to each other and to other eukaryotic genomes. An expanded phylogenetic tree built from the complete predicted proteomes of 23 eukaryotes places the two amoebae in the same lineage, although the divergence is estimated to be greater than that between animals and fungi, and probably happened shortly after the Amoebozoa split from the opisthokont lineage. Most of the 1,500 orthologous gene families shared between the two amoebae are also shared with plant, animal, and fungal genomes. We found that only 42 gene families are distinct to the amoeba lineage; among these are a large number of proteins that contain repeats of the FNIP domain, and a putative transcription factor essential for proper cell type differentiation in D. discoideum. These Amoebozoa-specific genes may be useful in the design of novel diagnostics and therapies for amoebal pathologies. PMID:16362072
Zou, Yi; Liu, Qiao; Yang, Xia; Huang, Hua-Chuan; Li, Jiang; Du, Liang-Hui; Li, Ze-Ren; Zhao, Jian-Heng; Zhu, Li-Guo
2017-01-01
We demonstrated that attenuated total reflectance terahertz time-domain spectroscopy (ATR THz-TDS) is able to monitor oxidative stress response of living human cells, which is proven in this work that it is an efficient non-invasive, label-free, real-time and in situ monitoring of cell death. Furthermore, the dielectric constant and dielectric loss of cultured living human breast epithelial cells, and along with their evolution under oxidative stress response induced by high concentration of H2O2, were quantitatively determined in the work. Our observation and results were finally confirmed using standard fluorescence-labeled flow cytometry measurements and visible fluorescence imaging. PMID:29359084
Labelling and targeted ablation of specific bipolar cell types in the zebrafish retina
2009-01-01
Background Development of a functional retina depends on regulated differentiation of several types of neurons and generation of a highly complex network between the different types of neurons. In addition, each type of retinal neuron includes several distinct morphological types. Very little is known about the mechanisms responsible for generating this diversity of retinal neurons, which may also display specific patterns of regional distribution. Results In a screen in zebrafish, using a trapping vector carrying an engineered yeast Gal4 transcription activator and a UAS:eGFP reporter cassette, we have identified two transgenic lines of zebrafish co-expressing eGFP and Gal4 in specific subsets of retinal bipolar cells. The eGFP-labelling facilitated analysis of axon terminals within the inner plexiform layer of the adult retina and showed that the fluorescent bipolar cells correspond to previously defined morphological types. Strong regional restriction of eGFP-positive bipolar cells to the central part of the retina surrounding the optic nerve was observed in adult zebrafish. Furthermore, we achieved specific ablation of the labelled bipolar cells in 5 days old larvae, using a bacterial nitroreductase gene under Gal4-UAS control in combination with the prodrug metronidazole. Following prodrug treatment, nitroreductase expressing bipolar cells were efficiently ablated without affecting surrounding retina architecture, and recovery occurred within a few days due to increased generation of new bipolar cells. Conclusion This report shows that enhancer trapping can be applied to label distinct morphological types of bipolar cells in the zebrafish retina. The genetic labelling of these cells yielded co-expression of a modified Gal4 transcription activator and the fluorescent marker eGFP. Our work also demonstrates the potential utility of the Gal4-UAS system for induction of other transgenes, including a bacterial nitroreductase fusion gene, which can facilitate
Park, Ki-Soo; Tae, Jinsung; Choi, Bongkum; Kim, Young-Seok; Moon, Cheol; Kim, Sa-Hyun; Lee, Han-Sin; Kim, Jinhyun; Kim, Junsung; Park, Jaeberm; Lee, Jung-Hee; Lee, Jong Eun; Joh, Jae-Won; Kim, Sungjoo
2010-04-01
Live imaging is a powerful technique that can be used to characterize the fate and location of stem cells in animal models. Here we investigated the characteristics and in vitro cytotoxicity of human mesenchymal stem cells (MSCs) labeled with silica-coated magnetic nanoparticles incorporating rhodamine B isothiocyanate, MNPs@SiO2(RITC). We also conducted various in vivo-uptake tests with nanoparticle-labeled human MSCs. MNPs@SiO2(RITC) showed photostability against ultraviolet light exposure and were nontoxic to human MSCs, based on the MTT, apoptosis, and cell cycle arrest assays. In addition, MNPs@SiO2(RITC) did not affect the surface phenotype or morphology of human MSCs. We also demonstrated that MNPs@SiO2(RITC) have stable retention properties in MSCs in vitro. Furthermore, using optical and magnetic resonance imaging, we successfully detected a visible signal from labeled human MSCs that were transplanted into NOD.CB17-Prkdc(SCID) (NOD-SCID) mice. These results demonstrate that MNPs@SiO2(RITC) are biocompatible and useful tools for human MSC labeling and bioimaging. The characteristics and in vitro cytotoxicity of human mesenchymal stem cells (MSCs) labeled with silica-coated magnetic nanoparticles incorporating rhodamine B isothiocyanate, RITC were investigated in this study. RITC showed photostability against ultraviolet light exposure and was nontoxic to human MSCs. Using both optical and magnetic resonance imaging, successful detection of signal from labeled human MSCs transplanted into mice is demonstrated. Copyright 2010 Elsevier Inc. All rights reserved.
Detection of BrdU-label Retaining Cells in the Lacrimal Gland: Implications for Tissue Repair
You, Samantha; Tariq, Ayesha; Kublin, Claire L.; Zoukhri, Driss
2011-01-01
The purpose of the present study was to determine if the lacrimal gland contains 5-bromo-2’-deoxyuridine (BrdU)-label retaining cells and if they are involved in tissue repair. Animals were pulsed daily with BrdU injections for 7 consecutive days. After a chase period of 2, 4, or 12 weeks, the animals were sacrificed and the lacrimal glands were removed and processed for BrdU immunostaining. In another series of experiments, the lacrimal glands of 12-week chased animals were either left untreated or were injected with interleukin 1 (IL-1) to induce injury. Two and half day post-injection, the lacrimal glands were removed and processed for BrdU immunostaining. After 2 and 4 week of chase period, a substantial number of lacrimal gland cells were BrdU+ (11.98 ± 1.84 and 7.95 ± 1.83 BrdU+ cells/mm2, respectively). After 12 weeks of chase, there was a 97% decline in the number of BrdU+ cells (0.38 ± 0.06 BrdU+ cells/mm2), suggesting that these BrdU-label retaining cells may represent slow-cycling adult stem/progenitor cells. In support of this hypothesis, the number of BrdU labeled cells increased over 7-fold during repair of the lacrimal gland (control: 0.41 ± 0.09 BrdU+ cells/mm2, injured: 2.91 ± 0.62 BrdU+ cells/mm2). Furthermore, during repair, among BrdU+ cells 58.2 ± 3.6 % were acinar cells, 26.4 ± 4.1% were myoepithelial cells, 0.4 ± 0.4% were ductal cells, and 15.0 ± 3.0% were stromal cells. We conclude that the murine lacrimal gland contains BrdU-label retaining cells that are mobilized following injury to generate acinar, myoepithelial and ductal cells. PMID:22101331
Saldanha, Karl J; Doan, Ryan P; Ainslie, Kristy M; Desai, Tejal A; Majumdar, Sharmila
2011-01-01
To examine mesenchymal stem cell (MSC) labeling with micrometer-sized iron oxide particles (MPIOs) for magnetic resonance imaging (MRI)-based tracking and its application to monitoring articular cartilage regeneration. Rabbit MSCs were labeled using commercial MPIOs. In vitro MRI was performed with gradient echo (GRE) and spin echo (SE) sequences at 3T and quantitatively characterized using line profile and region of interest analysis. Ex vivo MRI of hydrogel-encapsulated labeled MSCs implanted within a bovine knee was performed with spoiled GRE (SPGR) and T(1ρ) sequences. Fluorescence microscopy, labeling efficiency, and chondrogenesis of MPIO-labeled cells were also examined. MPIO labeling results in efficient contrast uptake and signal loss that can be visualized and quantitatively characterized via MRI. SPGR imaging of implanted cells results in ex vivo detection within native tissue, and T(1ρ) imaging is unaffected by the presence of labeled cells immediately following implantation. MPIO labeling does not affect quantitative glycosaminoglycan production during chondrogenesis, but iron aggregation hinders extracellular matrix visualization. This aggregation may result from excess unincorporated particles following labeling and is an issue that necessitates further investigation. This study demonstrates the promise of MPIO labeling for monitoring cartilage regeneration and highlights its potential in the development of cell-based tissue engineering strategies. Published by Elsevier Inc.
Magnetic Resonance Imaging of Ferumoxytol-Labeled Human Mesenchymal Stem Cells in the Mouse Brain.
Lee, Na Kyung; Kim, Hyeong Seop; Yoo, Dongkyeom; Hwang, Jung Won; Choi, Soo Jin; Oh, Wonil; Chang, Jong Wook; Na, Duk L
2017-02-01
The success of stem cell therapy is highly dependent on accurate delivery of stem cells to the target site of interest. Possible ways to track the distribution of MSCs in vivo include the use of reporter genes or nanoparticles. The U.S. Food and Drug Administration (FDA) has approved ferumoxytol (Feraheme® [USA], Rienso® [UK]) as a treatment for iron deficiency anemia. Ferumoxytol is an ultrasmall superparamagnetic iron oxide nanoparticle (USPIO) that has recently been used to track the fate of transplanted cells using magnetic resonance imaging (MRI). The major objectives of this study were to demonstrate the feasibility of labeling hUCB-MSCs with ferumoxytol and to observe, through MRI, the engraftment of ferumoxytol-labeled human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs) delivered via stereotactic injection into the hippocampi of a transgenic mouse model of familial Alzheimer's disease (5XFAD). Ferumoxytol had no toxic effects on the viability or stemness of hUCB-MSCs when assessed in vitro. Through MRI, hypointense signals were discernible at the site where ferumoxytol-labeled human MSCs were injected. Iron-positive areas were also observed in the engrafted hippocampi. The results from this study support the use of nanoparticle labeling to monitor transplanted MSCs in real time as a follow-up for AD stem cell therapy in the clinical field.
Woda, Marcia; Mathew, Anuja
2015-01-01
Low frequencies of memory B cells in the peripheral blood make it challenging to measure the functional and phenotypic characteristics of this antigen experienced subset of B cells without in vitro culture. To date, reagents are lacking to measure ex vivo frequencies of dengue virus (DENV)-specific memory B cells. We wanted to explore the possibility of using fluorescently labeled DENV as probes to detect antigen-specific memory B cells in the peripheral blood of DENV immune individuals. Alexa Fluor dye-labeled DENV yielded viable virus that could be stored at -80°C for long periods of time. Using a careful gating strategy and methods to decrease non-specific binding, we were able to identify a small frequency of B cells from dengue immune individuals that bound labeled DENV. Sorted DENV(+) B cells from immune, but not naïve donors secreted antibodies that bound DENV after in vitro stimulation. Overall, Alexa Fluor dye-labeled DENVs are useful reagents to enable the detection and characterization of memory B cells in DENV immune individuals. Copyright © 2014 Elsevier B.V. All rights reserved.
Woda, Marcia; Mathew, Anuja
2015-01-01
Low frequencies of memory B cells in the peripheral blood make it challenging to measure the functional and phenotypic characteristics of this antigen experienced subset of B cells without in vitro culture. To date, reagents are lacking to measure ex vivo frequencies of dengue virus (DENV)-specific memory B cells. We wanted to explore the possibility of using fluorescently labeled DENV as probes to detect antigen-specific memory B cells in the peripheral blood of DENV immune individuals. Alexa Fluor dye-labeled DENV yielded viable virus that could be stored at −80°C for long periods of time. Using a careful gating strategy and methods to decrease non-specific binding, we were able to identify a small frequency of B cells from dengue immune individuals that bound labeled DENV. Sorted DENV+ B cells from immune, but not naïve donors secreted antibodies that bound intact virions after in vitro stimulation. Overall, Alexa Fluor dye labeled -DENV are useful reagents to enable the detection and characterization of memory B cells in DENV immune individuals. PMID:25497702
Isotope labeling of proteins in insect cells.
Skora, Lukasz; Shrestha, Binesh; Gossert, Alvar D
2015-01-01
Protein targets of contemporary research are often membrane proteins, multiprotein complexes, secreted proteins, or other proteins of human origin. These are difficult to express in the standard expression host used for most nuclear magnetic resonance (NMR) studies, Escherichia coli. Insect cells represent an attractive alternative, since they have become a well-established expression system and simple solutions have been developed for generation of viruses to efficiently introduce the target protein DNA into cells. Insect cells enable production of a larger fraction of the human proteome in a properly folded way than bacteria, as insect cells have a very similar set of cytosolic chaperones and a closely related secretory pathway. Here, the limited and defined glycosylation pattern that insect cells produce is an advantage for structural biology studies. For these reasons, insect cells have been established as the most widely used eukaryotic expression host for crystallographic studies. In the past decade, significant advancements have enabled amino acid type-specific as well as uniform isotope labeling of proteins in insect cells, turning them into an attractive expression host for NMR studies. © 2015 Elsevier Inc. All rights reserved.
Gutova, Margarita; Frank, Joseph A.; D'Apuzzo, Massimo; Khankaldyyan, Vazgen; Gilchrist, Megan M.; Annala, Alexander J.; Metz, Marianne Z.; Abramyants, Yelena; Herrmann, Kelsey A.; Ghoda, Lucy Y.; Najbauer, Joseph; Brown, Christine E.; Blanchard, M. Suzette; Lesniak, Maciej S.; Kim, Seung U.; Barish, Michael E.
2013-01-01
Numerous stem cell-based therapies are currently under clinical investigation, including the use of neural stem cells (NSCs) as delivery vehicles to target therapeutic agents to invasive brain tumors. The ability to monitor the time course, migration, and distribution of stem cells following transplantation into patients would provide critical information for optimizing treatment regimens. No effective cell-tracking methodology has yet garnered clinical acceptance. A highly promising noninvasive method for monitoring NSCs and potentially other cell types in vivo involves preloading them with ultrasmall superparamagnetic iron oxide nanoparticles (USPIOs) to enable cell tracking using magnetic resonance imaging (MRI). We report here the preclinical studies that led to U.S. Food and Drug Administration approval for first-in-human investigational use of ferumoxytol to label NSCs prior to transplantation into brain tumor patients, followed by surveillance serial MRI. A combination of heparin, protamine sulfate, and ferumoxytol (HPF) was used to label the NSCs. HPF labeling did not affect cell viability, growth kinetics, or tumor tropism in vitro, and it enabled MRI visualization of NSC distribution within orthotopic glioma xenografts. MRI revealed dynamic in vivo NSC distribution at multiple time points following intracerebral or intravenous injection into glioma-bearing mice that correlated with histological analysis. Preclinical safety/toxicity studies of intracerebrally administered HPF-labeled NSCs in mice were also performed, and they showed no significant clinical or behavioral changes, no neuronal or systemic toxicities, and no abnormal accumulation of iron in the liver or spleen. These studies support the clinical use of ferumoxytol labeling of cells for post-transplant MRI visualization and tracking. PMID:24014682
The Long Noncoding RNA Transcriptome of Dictyostelium discoideum Development.
Rosengarten, Rafael D; Santhanam, Balaji; Kokosar, Janez; Shaulsky, Gad
2017-02-09
Dictyostelium discoideum live in the soil as single cells, engulfing bacteria and growing vegetatively. Upon starvation, tens of thousands of amoebae enter a developmental program that includes aggregation, multicellular differentiation, and sporulation. Major shifts across the protein-coding transcriptome accompany these developmental changes. However, no study has presented a global survey of long noncoding RNAs (ncRNAs) in D. discoideum To characterize the antisense and long intergenic noncoding RNA (lncRNA) transcriptome, we analyzed previously published developmental time course samples using an RNA-sequencing (RNA-seq) library preparation method that selectively depletes ribosomal RNAs (rRNAs). We detected the accumulation of transcripts for 9833 protein-coding messenger RNAs (mRNAs), 621 lncRNAs, and 162 putative antisense RNAs (asRNAs). The noncoding RNAs were interspersed throughout the genome, and were distinct in expression level, length, and nucleotide composition. The noncoding transcriptome displayed a temporal profile similar to the coding transcriptome, with stages of gradual change interspersed with larger leaps. The transcription profiles of some noncoding RNAs were strongly correlated with known differentially expressed coding RNAs, hinting at a functional role for these molecules during development. Examining the mitochondrial transcriptome, we modeled two novel antisense transcripts. We applied yet another ribosomal depletion method to a subset of the samples to better retain transfer RNA (tRNA) transcripts. We observed polymorphisms in tRNA anticodons that suggested a post-transcriptional means by which D. discoideum compensates for codons missing in the genomic complement of tRNAs. We concluded that the prevalence and characteristics of long ncRNAs indicate that these molecules are relevant to the progression of molecular and cellular phenotypes during development. Copyright © 2017 Rosengarten et al.
Mohamed, Wasima; Ray, Sibnath; Brazill, Derrick; Baskar, Ramamurthy
2017-01-01
A number of organisms possess several isoforms of protein kinase C but little is known about the significance of any specific isoform during embryogenesis and development. To address this we characterized a PKC ortholog (PkcA; DDB_G0288147) in Dictyostelium discoideum. pkcA expression switches from prestalk in mound to prespore in slug, indicating a dynamic expression pattern. Mutants lacking the catalytic domain of PkcA (pkcA−) did not exhibit tip dominance. A striking phenotype of pkcA− was the formation of an aggregate with a central hollow, and aggregates later fragmented to form small mounds, each becoming a fruiting body. Optical density wave patterns of cAMP in the late aggregates showed several cAMP wave generation centers. We attribute these defects in pkcA− to impaired cAMP signaling, altered cell motility and decreased expression of the cell adhesion molecules – CadA and CsaA. pkcA− slugs showed ectopic expression of ecmA in the prespore region. Further, the use of a PKC-specific inhibitor, GF109203X that inhibits the activity of catalytic domain phenocopied pkcA−. PMID:26183108
Glioblastoma cells labeled by robust Raman tags for enhancing imaging contrast.
Huang, Li-Ching; Chang, Yung-Ching; Wu, Yi-Syuan; Sun, Wei-Lun; Liu, Chan-Chuan; Sze, Chun-I; Chen, Shiuan-Yeh
2018-05-01
Complete removal of a glioblastoma multiforme (GBM), a highly malignant brain tumor, is challenging due to its infiltrative characteristics. Therefore, utilizing imaging agents such as fluorophores to increase the contrast between GBM and normal cells can help neurosurgeons to locate residual cancer cells during image guided surgery. In this work, Raman tag based labeling and imaging for GBM cells in vitro is described and evaluated. The cell membrane of a GBM adsorbs a substantial amount of functionalized Raman tags through overexpression of the epidermal growth factor receptor (EGFR) and "broadcasts" stronger pre-defined Raman signals than normal cells. The average ratio between Raman signals from a GBM cell and autofluorescence from a normal cell can be up to 15. In addition, the intensity of these images is stable under laser illuminations without suffering from the severe photo-bleaching that usually occurs in fluorescent imaging. Our results show that labeling and imaging GBM cells via robust Raman tags is a viable alternative method to distinguish them from normal cells. This Raman tag based method can be used solely or integrated into an existing fluorescence system to improve the identification of infiltrative glial tumor cells around the boundary, which will further reduce GBM recurrence. In addition, it can also be applied/extended to other types of cancer to improve the effectiveness of image guided surgery.
Glioblastoma cells labeled by robust Raman tags for enhancing imaging contrast
Huang, Li-Ching; Chang, Yung-Ching; Wu, Yi-Syuan; Sun, Wei-Lun; Liu, Chan-Chuan; Sze, Chun-I; Chen, Shiuan-Yeh
2018-01-01
Complete removal of a glioblastoma multiforme (GBM), a highly malignant brain tumor, is challenging due to its infiltrative characteristics. Therefore, utilizing imaging agents such as fluorophores to increase the contrast between GBM and normal cells can help neurosurgeons to locate residual cancer cells during image guided surgery. In this work, Raman tag based labeling and imaging for GBM cells in vitro is described and evaluated. The cell membrane of a GBM adsorbs a substantial amount of functionalized Raman tags through overexpression of the epidermal growth factor receptor (EGFR) and “broadcasts” stronger pre-defined Raman signals than normal cells. The average ratio between Raman signals from a GBM cell and autofluorescence from a normal cell can be up to 15. In addition, the intensity of these images is stable under laser illuminations without suffering from the severe photo-bleaching that usually occurs in fluorescent imaging. Our results show that labeling and imaging GBM cells via robust Raman tags is a viable alternative method to distinguish them from normal cells. This Raman tag based method can be used solely or integrated into an existing fluorescence system to improve the identification of infiltrative glial tumor cells around the boundary, which will further reduce GBM recurrence. In addition, it can also be applied/extended to other types of cancer to improve the effectiveness of image guided surgery. PMID:29760976
Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.
Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako
2011-09-01
Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.
Frequency-selective REDOR and spin-diffusion relays in uniformly labeled whole cells.
Rice, David M; Romaniuk, Joseph A H; Cegelski, Lynette
2015-11-01
Solid-state NMR is a powerful and non-perturbative method to measure and define chemical composition and architecture in bacterial cell walls, even in the context of whole cells. Most NMR studies on whole cells have used selectively labeled samples. Here, we introduce an NMR sequence relay using frequency-selective REDOR (fsREDOR) and spin diffusion elements to probe a unique amine contribution in uniformly (13)C- and (15)N-labeled Staphylococcus aureus whole cells that we attribute to the d-alanine of teichoic acid. In addition to the primary peptidoglycan structural scaffold, cell walls can contain significant amounts of teichoic acid that contribute to cell-wall function. When incorporated into teichoic acid, d-alanine is present as an ester, connected via its carbonyl to a ribitol carbon, and thus has a free amine. Teichoic acid d-Ala is removed during cell-wall isolations and can only be detected in the context of whole cells. The sequence presented here begins with fsREDOR and a chemical shift evolution period for 2D data acquisition, followed by DARR spin diffusion and then an additional fsREDOR period. fsREDOR elements were used for (13)C observation to avoid complications from (13)C-(13)C couplings due to uniform labeling and for (15)N dephasing to achieve selectivity in the nitrogens serving as dephasers. The results show that the selected amine nitrogen of interest is near to teichoic acid ribitol carbons and also the methyl group carbon associated with alanine. In addition, its carbonyl is not significantly dephased by amide nitrogens, consistent with the expected microenvironment around teichoic acid. Copyright © 2015 Elsevier Inc. All rights reserved.
Ganusov, Vitaly V.; De Boer, Rob J.
2013-01-01
Bromodeoxyuridine (BrdU) is widely used in immunology to detect cell division, and several mathematical models have been proposed to estimate proliferation and death rates of lymphocytes from BrdU labelling and de-labelling curves. One problem in interpreting BrdU data is explaining the de-labelling curves. Because shortly after label withdrawal, BrdU+ cells are expected to divide into BrdU+ daughter cells, one would expect a flat down-slope. As for many cell types, the fraction of BrdU+ cells decreases during de-labelling, previous mathematical models had to make debatable assumptions to be able to account for the data. We develop a mechanistic model tracking the number of divisions that each cell has undergone in the presence and absence of BrdU, and allow cells to accumulate and dilute their BrdU content. From the same mechanistic model, one can naturally derive expressions for the mean BrdU content (MBC) of all cells, or the MBC of the BrdU+ subset, which is related to the mean fluorescence intensity of BrdU that can be measured in experiments. The model is extended to include subpopulations with different rates of division and death (i.e. kinetic heterogeneity). We fit the extended model to previously published BrdU data from memory T lymphocytes in simian immunodeficiency virus-infected and uninfected macaques, and find that the model describes the data with at least the same quality as previous models. Because the same model predicts a modest decline in the MBC of BrdU+ cells, which is consistent with experimental observations, BrdU dilution seems a natural explanation for the observed down-slopes in self-renewing populations. PMID:23034350
Harrison, Richard; Markides, Hareklea; Morris, Robert H; Richards, Paula; El Haj, Alicia J; Sottile, Virginie
2017-08-01
Mesenchymal stem cells (MSCs) represent a valuable resource for regenerative medicine treatments for orthopaedic repair and beyond. Following developments in isolation, expansion and differentiation protocols, efforts to promote clinical translation of emerging cellular strategies now seek to improve cell delivery and targeting. This study shows efficient live MSC labelling using silica-coated magnetic particles (MPs), which enables 3D tracking and guidance of stem cells. A procedure developed for the efficient and unassisted particle uptake was shown to support MSC viability and integrity, while surface marker expression and MSC differentiation capability were also maintained. In vitro, MSCs showed a progressive decrease in labelling over increasing culture time, which appeared to be linked to the dilution effect of cell division, rather than to particle release, and did not lead to detectable secondary particle uptake. Labelled MSC populations demonstrated magnetic responsiveness in vitro through directed migration in culture and, when seeded onto a scaffold, supporting MP-based approaches to cell targeting. The potential of these silica-coated MPs for MRI cell tracking of MSC populations was validated in 2D and in a cartilage repair model following cell delivery. These results highlight silica-coated magnetic particles as a simple, safe and effective resource to enhance MSC targeting for therapeutic applications and improve patient outcomes. © 2016 The Authors Journal of Tissue Engineering and Regenerative Medicine Published by John Wiley & Sons Ltd. © 2016 The Authors Journal of Tissue Engineering and Regenerative Medicine Published by John Wiley & Sons Ltd.
Shen, Wei-Bin; Plachez, Celine; Chan, Amanda; Yarnell, Deborah; Puche, Adam C; Fishman, Paul S; Yarowsky, Paul
2013-01-01
Ultrasmall superparamagnetic iron-oxide particles (USPIOs) loaded into stem cells have been suggested as a way to track stem cell transplantation with magnetic resonance imaging, but the labeling, and post-labeling proliferation, viability, differentiation, and retention of USPIOs within the stem cells have yet to be determined for each type of stem cell and for each type of USPIO. Molday ION Rhodamine B™ (BioPAL, Worcester, MA, USA) (MIRB) has been shown to be a USPIO labeling agent for mesenchymal stem cells, glial progenitor cells, and stem cell lines. In this study, we have evaluated MIRB labeling in human neuroprogenitor cells and found that human neuroprogenitor cells are effectively labeled with MIRB without use of transfection reagents. Viability, proliferation, and differentiation properties are unchanged between MIRB-labeled neuroprogenitors cells and unlabeled cells. Moreover, MIRB-labeled human neuroprogenitor cells can be frozen, thawed, and replated without loss of MIRB or even without loss of their intrinsic biology. Overall, those results show that MIRB has advantageous properties that can be used for cell-based therapy. PMID:24348036
NASA Technical Reports Server (NTRS)
Mozdziak, P. E.; Pulvermacher, P. M.; Schultz, E.; Schell, K.
2000-01-01
BACKGROUND: 5-Bromo-2'-deoxyuridine (BrdU) is a powerful compound to study the mitotic activity of a cell. Most techniques that identify BrdU-labeled cells require conditions that kill the cells. However, the fluorescence intensity of the membrane-permeable Hoechst dyes is reduced by the incorporation of BrdU into DNA, allowing the separation of viable BrdU positive (BrdU+) cells from viable BrdU negative (BrdU-) cells. METHODS: Cultures of proliferating cells were supplemented with BrdU for 48 h and other cultures of proliferating cells were maintained without BrdU. Mixtures of viable BrdU+ and viable BrdU- cells from the two proliferating cultures were stained with Hoechst 33342. The viable BrdU+ and BrdU- cells were sorted into different fractions from a mixture of BrdU+ and BrdU- cells based on Hoechst fluorescence intensity and the ability to exclude the vital dye, propidium iodide. Subsequently, samples from the original mixture, the sorted BrdU+ cell population, and the sorted BrdU- cell population were immunostained using an anti-BrdU monoclonal antibody and evaluated using flow cytometry. RESULTS: Two mixtures consisting of approximately 55% and 69% BrdU+ cells were sorted into fractions consisting of greater than 93% BrdU+ cells and 92% BrdU- cells. The separated cell populations were maintained in vitro after sorting to demonstrate their viability. CONCLUSIONS: Hoechst fluorescence intensity in combination with cell sorting is an effective tool to separate viable BrdU+ from viable BrdU- cells for further study. The separated cell populations were maintained in vitro after sorting to demonstrate their viability. Copyright 2000 Wiley-Liss, Inc.
Fontanini, G.; Pingitore, R.; Bigini, D.; Vignati, S.; Pepe, S.; Ruggiero, A.; Macchiarini, P.
1992-01-01
Results generated by the immunohistochemical staining with PC10, a new monoclonal antibody recognizing PCNA (a nuclear protein associated with cell proliferation) in formalin-fixed and paraffin-embedded tissue were compared with those of Ki-67 labeling and DNA flow cytometry in 47 consecutive non-small cell lung cancer (NSCLC). PCNA reactivity was observed in all samples and confined to the nuclei of cancer cells. Its frequency ranged from 0 to 80% (37.7 +/- 23.6) and larger sized, early-staged and DNA aneuploid tumors expressed a significant higher number of PCNA-reactive cells. The PCNA and Ki-67 labeling rates were closely correlated (r = 0.383, P = 0.009). By flow cytometry, we observed a good correlation among PCNA labeling and S-phase fraction (r = 0.422, P = .0093) and G1 phase (r = 0.303, P = .051) of the cell cycle. Results indicate that PCNA labeling with PC10 is a simple method for assessing the proliferative activity in formalin-fixed, paraffin-embedded tissue of NSCLC and correlates well with Ki-67 labeling and S-phase fraction of the cell cycle. Images Figure 2 PMID:1361306
Label-Free Optofluidic Nanobiosensor Enables Real-Time Analysis of Single-Cell Cytokine Secretion.
Li, Xiaokang; Soler, Maria; Szydzik, Crispin; Khoshmanesh, Khashayar; Schmidt, Julien; Coukos, George; Mitchell, Arnan; Altug, Hatice
2018-06-01
Single-cell analysis of cytokine secretion is essential to understand the heterogeneity of cellular functionalities and develop novel therapies for multiple diseases. Unraveling the dynamic secretion process at single-cell resolution reveals the real-time functional status of individual cells. Fluorescent and colorimetric-based methodologies require tedious molecular labeling that brings inevitable interferences with cell integrity and compromises the temporal resolution. An innovative label-free optofluidic nanoplasmonic biosensor is introduced for single-cell analysis in real time. The nanobiosensor incorporates a novel design of a multifunctional microfluidic system with small volume microchamber and regulation channels for reliable monitoring of cytokine secretion from individual cells for hours. Different interleukin-2 secretion profiles are detected and distinguished from single lymphoma cells. The sensor configuration combined with optical spectroscopic imaging further allows us to determine the spatial single-cell secretion fingerprints in real time. This new biosensor system is anticipated to be a powerful tool to characterize single-cell signaling for basic and clinical research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
2013-01-01
Introduction The application of mesenchymal stem cells (MSCs) in treating rheumatoid arthritis (RA) has been made possible by the immunosuppressive and differentiation abilities of these cells. A non-invasive means of assessing cell integration and bio-distribution is fundamental in evaluating the risks and success of this therapy, thereby enabling clinical translation. This paper defines the use of superparamagnetic iron oxide nanoparticles (SPIONs) in conjunction with magnetic resonance imaging (MRI) to image and track MSCs in vivo within a murine model of RA. Methods Murine MSCs (mMSCs) were isolated, expanded and labelled with SiMAG, a commercially available particle. In vitro MRI visibility thresholds were investigated by labelling mMSCs with SiMAG with concentrations ranging from 0 to 10 μg/ml and resuspending varying cell doses (103 to 5 × 105 cells) in 2 mg/ml collagen prior to MR-imaging. Similarly, in vivo detection thresholds were identified by implanting 3 × 105 mMSCs labelled with 0 to 10 μg/ml SiMAG within the synovial cavity of a mouse and MR-imaging. Upon RA induction, 300,000 mMSCs labelled with SiMAG (10 μg/ml) were implanted via intra-articular injection and joint swelling monitored as an indication of RA development over seven days. Furthermore, the effect of SiMAG on cell viability, proliferation and differentiation was investigated. Results A minimum particle concentration of 1 μg/ml (300,000 cells) and cell dose of 100,000 cells (5 and 10 μg/ml) were identified as the in vitro MRI detection threshold. Cell viability, proliferation and differentiation capabilities were not affected, with labelled populations undergoing successful differentiation down osteogenic and adipogenic lineages. A significant decrease (P < 0.01) in joint swelling was measured in groups containing SiMAG-labelled and unlabelled mMSCs implying that the presence of SPIONs does not affect the immunomodulating properties of the cells. In vivo MRI
Code of Federal Regulations, 2010 CFR
2010-04-01
... STANDARDS FOR DIAGNOSTIC SUBSTANCES FOR LABORATORY TESTS Reagent Red Blood Cells § 660.35 Labeling. In... or end of the label, oustide of the main panel. (2) If washing the cells is required by the manufacturer, the container label shall include appropriate instructions; if the cells should not be washed...
In Vivo MR Imaging of Glioma Recruitment of Adoptive T-Cells Labeled with NaGdF4 -TAT Nanoprobes.
Zhang, Hua; Wu, Yue; Wang, Jing; Tang, Zhongmin; Ren, Yan; Ni, Dalong; Gao, Hongbo; Song, Ruixue; Jin, Teng; Li, Qiao; Bu, Wenbo; Yao, Zhenwei
2018-01-01
Adoptive T lymphocyte immunotherapy is one of the most promising methods to treat residual lesions after glioma surgery. However, the fate of the adoptively transferred T-cells in vivo is unclear, hampering the understanding of this emerging therapy. Thus, it is highly desirable to develop noninvasive and quantitative in vivo tracking of these T-cells to glioma for better identification of the migratory fate and to provide objective evaluation of outcomes of adoptive T-cell immunotherapy targeting glioma. In this work, ultrasmall T 1 MR-based nanoprobes, NaGdF 4 -TAT, as molecular probes with high longitudinal relaxivity (8.93 mm -1 s -1 ) are designed. By means of HIV-1 transactivator (TAT) peptides, nearly 95% of the adoptive T-cells are labeled with the NaGdF 4 -TAT nanoprobes without any measurable side effects on the labeled T-cells, which is remarkably superior to that of the control fluorescein isothiocyanate-NaGdF 4 concerning labeling efficacy. Labeled adoptive T-cell clusters can be sensitively tracked in an orthotopic GL261-glioma model 24 h after intravenous infusion of 10 7 labeled T-cells by T 1 -weighted MR imaging. Both in vitro and in vivo experiments show that the NaGdF 4 -TAT nanoprobes labeling of T-cells may be a promising method to track adoptive T-cells to improve our understanding of the pathophysiology in adoptive immunotherapy for gliomas. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cell-free measurements of brightness of fluorescently labeled antibodies
Zhou, Haiying; Tourkakis, George; Shi, Dennis; Kim, David M.; Zhang, Hairong; Du, Tommy; Eades, William C.; Berezin, Mikhail Y.
2017-01-01
Validation of imaging contrast agents, such as fluorescently labeled imaging antibodies, has been recognized as a critical challenge in clinical and preclinical studies. As the number of applications for imaging antibodies grows, these materials are increasingly being subjected to careful scrutiny. Antibody fluorescent brightness is one of the key parameters that is of critical importance. Direct measurements of the brightness with common spectroscopy methods are challenging, because the fluorescent properties of the imaging antibodies are highly sensitive to the methods of conjugation, degree of labeling, and contamination with free dyes. Traditional methods rely on cell-based assays that lack reproducibility and accuracy. In this manuscript, we present a novel and general approach for measuring the brightness using antibody-avid polystyrene beads and flow cytometry. As compared to a cell-based method, the described technique is rapid, quantitative, and highly reproducible. The proposed method requires less than ten microgram of sample and is applicable for optimizing synthetic conjugation procedures, testing commercial imaging antibodies, and performing high-throughput validation of conjugation procedures. PMID:28150730
Chemical biology-based approaches on fluorescent labeling of proteins in live cells.
Jung, Deokho; Min, Kyoungmi; Jung, Juyeon; Jang, Wonhee; Kwon, Youngeun
2013-05-01
Recently, significant advances have been made in live cell imaging owing to the rapid development of selective labeling of proteins in vivo. Green fluorescent protein (GFP) was the first example of fluorescent reporters genetically introduced to protein of interest (POI). While GFP and various types of engineered fluorescent proteins (FPs) have been actively used for live cell imaging for many years, the size and the limited windows of fluorescent spectra of GFP and its variants set limits on possible applications. In order to complement FP-based labeling methods, alternative approaches that allow incorporation of synthetic fluorescent probes to target POIs were developed. Synthetic fluorescent probes are smaller than fluorescent proteins, often have improved photochemical properties, and offer a larger variety of colors. These synthetic probes can be introduced to POIs selectively by numerous approaches that can be largely categorized into chemical recognition-based labeling, which utilizes metal-chelating peptide tags and fluorophore-carrying metal complexes, and biological recognition-based labeling, such as (1) specific non-covalent binding between an enzyme tag and its fluorophore-carrying substrate, (2) self-modification of protein tags using substrate variants conjugated to fluorophores, (3) enzymatic reaction to generate a covalent binding between a small molecule substrate and a peptide tag, and (4) split-intein-based C-terminal labeling of target proteins. The chemical recognition-based labeling reaction often suffers from compromised selectivity of metal-ligand interaction in the cytosolic environment, consequently producing high background signals. Use of protein-substrate interactions or enzyme-mediated reactions generally shows improved specificity but each method has its limitations. Some examples are the presence of large linker protein, restriction on the choice of introducible probes due to the substrate specificity of enzymes, and competitive
Rectified directional sensing in long-range cell migration
Nakajima, Akihiko; Ishihara, Shuji; Imoto, Daisuke; Sawai, Satoshi
2014-01-01
How spatial and temporal information are integrated to determine the direction of cell migration remains poorly understood. Here, by precise microfluidics emulation of dynamic chemoattractant waves, we demonstrate that, in Dictyostelium, directional movement as well as activation of small guanosine triphosphatase Ras at the leading edge is suppressed when the chemoattractant concentration is decreasing over time. This ‘rectification’ of directional sensing occurs only at an intermediate range of wave speed and does not require phosphoinositide-3-kinase or F-actin. From modelling analysis, we show that rectification arises naturally in a single-layered incoherent feedforward circuit with zero-order ultrasensitivity. The required stimulus time-window predicts ~5 s transient for directional sensing response close to Ras activation and inhibitor diffusion typical for protein in the cytosol. We suggest that the ability of Dictyostelium cells to move only in the wavefront is closely associated with rectification of adaptive response combined with local activation and global inhibition. PMID:25373620
Label free imaging of cell-substrate contacts by holographic total internal reflection microscopy.
Mandracchia, Biagio; Gennari, Oriella; Marchesano, Valentina; Paturzo, Melania; Ferraro, Pietro
2017-09-01
The study of cell adhesion contacts is pivotal to understand cell mechanics and interaction at substrates or chemical and physical stimuli. We designed and built a HoloTIR microscope for label-free quantitative phase imaging of total internal reflection. Here we show for the first time that HoloTIR is a good choice for label-free study of focal contacts and of cell/substrate interaction as its sensitivity is enhanced in comparison with standard TIR microscopy. Finally, the simplicity of implementation and relative low cost, due to the requirement of less optical components, make HoloTIR a reasonable alternative, or even an addition, to TIRF microscopy for mapping cell/substratum topography. As a proof of concept, we studied the formation of focal contacts of fibroblasts on three substrates with different levels of affinity for cell adhesion. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shimada, Nao; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi
2004-09-01
Signal Transducers and Activators of Transcription (STATs) are transcription factors which lie at the end of cytokine and growth signal transduction pathways. Dictyostelium Dd-STATa is a functional homologue of metazoan STATs. It is activated by cAMP and, at the slug stage, it translocates into the nuclei of the tip cells, which are a subset of the anterior, prestalk A (pstA) cells. Here we searched for novel Dd-STATa regulated genes by in situ hybridisation. A set of 54 cDNA clones whose gene expression patterns are known to be prestalk-specific (Maeda et al., 2003), were chosen as probes and we compared their expression patterns in parental and Dd-STATa-null strains. We identified 13 genes which are candidates for direct induction by Dd-STATa. In the parental strain, most of these genes are expressed in the cone shaped mass of pstAB cells which is located within the prestalk region. These cDNAs show little or no expression in the Dd-STATa-null strain. This contrasts markedly with the paradigmatic ecmB gene which is expressed in pstAB cells in parental cells, but which is expressed throughout the prestalk zone in the Dd-STATa-null strain. We also identified several genes which are normally expressed in pstA cells, or throughout the prestalk region, but whose expression is markedly down-regulated in the null mutant. Again, this contrasts with markers derived from the paradigmatic, ecmA gene which are expressed normally in the Dd-STATa-null strain. The identification of these novel genes provides valuable tools to investigate the role of Dd-STATa.
Functionalized nanopipettes: toward label-free, single cell biosensors.
Actis, Paolo; Mak, Andy C; Pourmand, Nader
2010-08-01
Nanopipette technology has been proven to be a label-free biosensor capable of identifying DNA and proteins. The nanopipette can include specific recognition elements for analyte discrimination based on size, shape, and charge density. The fully electrical read-out and the ease and low-cost fabrication are unique features that give this technology an enormous potential. Unlike other biosensing platforms, nanopipettes can be precisely manipulated with submicron accuracy and used to study single cell dynamics. This review is focused on creative applications of nanopipette technology for biosensing. We highlight the potential of this technology with a particular attention to integration of this biosensor with single cell manipulation platforms.
Functionalized nanopipettes: toward label-free, single cell biosensors
Actis, Paolo; Mak, Andy C.
2010-01-01
Nanopipette technology has been proven to be a label-free biosensor capable of identifying DNA and proteins. The nanopipette can include specific recognition elements for analyte discrimination based on size, shape, and charge density. The fully electrical read-out and the ease and low-cost fabrication are unique features that give this technology an enormous potential. Unlike other biosensing platforms, nanopipettes can be precisely manipulated with submicron accuracy and used to study single cell dynamics. This review is focused on creative applications of nanopipette technology for biosensing. We highlight the potential of this technology with a particular attention to integration of this biosensor with single cell manipulation platforms. PMID:20730113
Fukuta, Masahiro; Kanamori, Satoshi; Furukawa, Taichi; Nawa, Yasunori; Inami, Wataru; Lin, Sheng; Kawata, Yoshimasa; Terakawa, Susumu
2015-01-01
Optical microscopes are effective tools for cellular function analysis because biological cells can be observed non-destructively and non-invasively in the living state in either water or atmosphere condition. Label-free optical imaging technique such as phase-contrast microscopy has been analysed many cellular functions, and it is essential technology for bioscience field. However, the diffraction limit of light makes it is difficult to image nano-structures in a label-free living cell, for example the endoplasmic reticulum, the Golgi body and the localization of proteins. Here we demonstrate the dynamic imaging of a label-free cell with high spatial resolution by using an electron beam excitation-assisted optical (EXA) microscope. We observed the dynamic movement of the nucleus and nano-scale granules in living cells with better than 100 nm spatial resolution and a signal-to-noise ratio (SNR) around 10. Our results contribute to the development of cellular function analysis and open up new bioscience applications. PMID:26525841
Fukuta, Masahiro; Kanamori, Satoshi; Furukawa, Taichi; Nawa, Yasunori; Inami, Wataru; Lin, Sheng; Kawata, Yoshimasa; Terakawa, Susumu
2015-11-03
Optical microscopes are effective tools for cellular function analysis because biological cells can be observed non-destructively and non-invasively in the living state in either water or atmosphere condition. Label-free optical imaging technique such as phase-contrast microscopy has been analysed many cellular functions, and it is essential technology for bioscience field. However, the diffraction limit of light makes it is difficult to image nano-structures in a label-free living cell, for example the endoplasmic reticulum, the Golgi body and the localization of proteins. Here we demonstrate the dynamic imaging of a label-free cell with high spatial resolution by using an electron beam excitation-assisted optical (EXA) microscope. We observed the dynamic movement of the nucleus and nano-scale granules in living cells with better than 100 nm spatial resolution and a signal-to-noise ratio (SNR) around 10. Our results contribute to the development of cellular function analysis and open up new bioscience applications.
NASA Astrophysics Data System (ADS)
Fukuta, Masahiro; Kanamori, Satoshi; Furukawa, Taichi; Nawa, Yasunori; Inami, Wataru; Lin, Sheng; Kawata, Yoshimasa; Terakawa, Susumu
2015-11-01
Optical microscopes are effective tools for cellular function analysis because biological cells can be observed non-destructively and non-invasively in the living state in either water or atmosphere condition. Label-free optical imaging technique such as phase-contrast microscopy has been analysed many cellular functions, and it is essential technology for bioscience field. However, the diffraction limit of light makes it is difficult to image nano-structures in a label-free living cell, for example the endoplasmic reticulum, the Golgi body and the localization of proteins. Here we demonstrate the dynamic imaging of a label-free cell with high spatial resolution by using an electron beam excitation-assisted optical (EXA) microscope. We observed the dynamic movement of the nucleus and nano-scale granules in living cells with better than 100 nm spatial resolution and a signal-to-noise ratio (SNR) around 10. Our results contribute to the development of cellular function analysis and open up new bioscience applications.
Li, Chao; Ruan, Jing; Yang, Meng; Pan, Fei; Gao, Guo; Qu, Su; Shen, You-Lan; Dang, Yong-Jun; Wang, Kan; Jin, Wei-Lin; Cui, Da-Xiang
2015-09-01
Human induced pluripotent stem (iPS) cells exhibit great potential for generating functional human cells for medical therapies. In this paper, we report for use of human iPS cells labeled with fluorescent magnetic nanoparticles (FMNPs) for targeted imaging and synergistic therapy of gastric cancer cells in vivo. Human iPS cells were prepared and cultured for 72 h. The culture medium was collected, and then was co-incubated with MGC803 cells. Cell viability was analyzed by the MTT method. FMNP-labeled human iPS cells were prepared and injected into gastric cancer-bearing nude mice. The mouse model was observed using a small-animal imaging system. The nude mice were irradiated under an external alternating magnetic field and evaluated using an infrared thermal mapping instrument. Tumor sizes were measured weekly. iPS cells and the collected culture medium inhibited the growth of MGC803 cells. FMNP-labeled human iPS cells targeted and imaged gastric cancer cells in vivo, as well as inhibited cancer growth in vivo through the external magnetic field. FMNP-labeled human iPS cells exhibit considerable potential in applications such as targeted dual-mode imaging and synergistic therapy for early gastric cancer.
Illumination of growth, division and secretion by metabolic labeling of the bacterial cell surface
Siegrist, M. Sloan; Swarts, Benjamin M.; Fox, Douglas M.; Lim, Shion An; Bertozzi, Carolyn R.
2015-01-01
The cell surface is the essential interface between a bacterium and its surroundings. Composed primarily of molecules that are not directly genetically encoded, this highly dynamic structure accommodates the basic cellular processes of growth and division as well as the transport of molecules between the cytoplasm and the extracellular milieu. In this review, we describe aspects of bacterial growth, division and secretion that have recently been uncovered by metabolic labeling of the cell envelope. Metabolite derivatives can be used to label a variety of macromolecules, from proteins to non-genetically-encoded glycans and lipids. The embedded metabolite enables precise tracking in time and space, and the versatility of newer chemoselective detection methods offers the ability to execute multiple experiments concurrently. In addition to reviewing the discoveries enabled by metabolic labeling of the bacterial cell envelope, we also discuss the potential of these techniques for translational applications. Finally, we offer some guidelines for implementing this emerging technology. PMID:25725012
Zanzonico, Pat; Koehne, Guenther; Gallardo, Humilidad F; Doubrovin, Mikhail; Doubrovina, Ekaterina; Finn, Ronald; Blasberg, Ronald G; Riviere, Isabelle; O'Reilly, Richard J; Sadelain, Michel; Larson, Steven M
2006-09-01
Donor T cells have been shown to be reactive against and effective in adoptive immunotherapy of Epstein-Barr virus (EBV) lymphomas which develop in some leukemia patients post marrow transplantation. These T cells may be genetically modified by incorporation of a replication-incompetent viral vector (NIT) encoding both an inactive mutant nerve growth factor receptor (LNGFR), as an immunoselectable surface marker, and a herpes simplex virus thymidine kinase (HSV-TK), rendering the cells sensitive to ganciclovir. The current studies are based on the selective HSV-TK-catalyzed trapping (phosphorylation) of the thymidine analog [(131)I]-2'-fluoro-2'-deoxy-1-beta-D-arabinofuransyl-5-iodo-uracil (FIAU) as a means of stably labeling such T cells for in vivo trafficking (including tumor targeting) studies. Because of the radiosensitivity of lymphocytes and the potentially high absorbed dose to the nucleus from intracellular (131)I (even at tracer levels), the nucleus absorbed dose (D ( n )) and dose-dependent immune functionality were evaluated for NIT(+) T cells labeled ex vivo in [(131)I]FIAU-containing medium. Based on in vitro kinetic studies of [(131)I]FIAU uptake by NIT(+) T cells, D ( n ) was calculated using an adaptation of the MIRD formalism and the recently published MIRD cellular S factors. Immune cytotoxicity of [(131)I]FIAU-labeled cells was assayed against (51)Cr-labeled target cells [B-lymphoblastoid cells (BLCLs)] in a standard 4-h release assay. At median nuclear absorbed doses up to 830 cGy, a (51)Cr-release assay against BLCLs showed no loss of immune cytotoxicity, thus demonstrating the functional integrity of genetically transduced, tumor-reactive T cells labeled at this dose level for in vivo cell trafficking and tumor targeting studies.
Fluorescent Labeling of COS-7 Expressing SNAP-tag Fusion Proteins for Live Cell Imaging
Provost, Christopher R.; Sun, Luo
2010-01-01
SNAP-tag and CLIP-tag protein labeling systems enable the specific, covalent attachment of molecules, including fluorescent dyes, to a protein of interest in live cells. These systems offer a broad selection of fluorescent substrates optimized for a range of imaging instrumentation. Once cloned and expressed, the tagged protein can be used with a variety of substrates for numerous downstream applications without having to clone again. There are two steps to using this system: cloning and expression of the protein of interest as a SNAP-tag fusion, and labeling of the fusion with the SNAP-tag substrate of choice. The SNAP-tag is a small protein based on human O6-alkylguanine-DNA-alkyltransferase (hAGT), a DNA repair protein. SNAP-tag labels are dyes conjugated to guanine or chloropyrimidine leaving groups via a benzyl linker. In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the SNAP-tag. CLIP-tag is a modified version of SNAP-tag, engineered to react with benzylcytosine rather than benzylguanine derivatives. When used in conjunction with SNAP-tag, CLIP-tag enables the orthogonal and complementary labeling of two proteins simultaneously in the same cells. PMID:20485262
Bone marrow cells stained by azide-conjugated Alexa fluors in the absence of an alkyne label.
Lin, Guiting; Ning, Hongxiu; Banie, Lia; Qiu, Xuefeng; Zhang, Haiyang; Lue, Tom F; Lin, Ching-Shwun
2012-09-01
Thymidine analog 5-ethynyl-2'-deoxyuridine (EdU) has recently been introduced as an alternative to 5-bromo-2-deoxyuridine (BrdU) for cell labeling and tracking. Incorporation of EdU into replicating DNA can be detected by azide-conjugated fluors (eg, Alexa-azide) through a Cu(i)-catalyzed click reaction between EdU's alkyne moiety and azide. While this cell labeling method has proven to be valuable for tracking transplanted stem cells in various tissues, we have found that some bone marrow cells could be stained by Alexa-azide in the absence of EdU label. In intact rat femoral bone marrow, ~3% of nucleated cells were false-positively stained, and in isolated bone marrow cells, ~13%. In contrast to true-positive stains, which localize in the nucleus, the false-positive stains were cytoplasmic. Furthermore, while true-positive staining requires Cu(i), false-positive staining does not. Reducing the click reaction time or reducing the Alexa-azide concentration failed to improve the distinction between true- and false-positive staining. Hematopoietic and mesenchymal stem cell markers CD34 and Stro-1 did not co-localize with the false-positively stained cells, and these cells' identity remains unknown.
Tan, Priscilla Ern Zhi; Yu, Paula K; Yang, Hongfang; Cringle, Stephen J; Yu, Dao-Yi
2018-07-01
We previously demonstrated endothelial phenotype heterogeneity in the vortex vein system. This study is to further determine whether regional differences are present in the cytoskeleton, junctional proteins and phosphorylated tyrosine labeling within the system. The vortex vein system of twenty porcine eyes was perfused with labels for f-actin, claudin-5, VE-Cadherin, phosphorylated tyrosine and nucleic acid. The endothelial cells of eight different regions (choroidal veins, pre-ampulla, anterior ampulla, mid-ampulla, posterior ampulla, post-ampulla, intra-scleral canal and the extra-ocular vortex vein) were studied using confocal microscopy. There were regional differences in the endothelial cell structures. Cytoskeleton labeling was relatively even in intensity throughout Regions 1 to 6. Overall VE-Cadherin had a non-uniform distribution and thicker width endothelial cell border staining than claudin-5. Progressing downstream there was an increased variation in thickness of VE-cadherin labeling. There was an overlap in phosphorylated tyrosine and VE-Cadherin labeling in the post-ampulla, intra-scleral canal and extra-ocular vortex vein. Intramural cells were observed that were immune-positive for VE-Cadherin and phosphorylated tyrosine. There were significant differences in the number of intramural cells in different regions. Significant regional differences with endothelial cell labeling of cytoskeleton, junction proteins, and phosphorylated tyrosine were found within the vortex vein system. These findings support existing data on endothelial cell phenotype heterogeneity, and may aid in the knowledge of venous pathologies by understanding regions of vulnerability to endothelial damage within the vortex vein system. It could be valuable to further investigate and characterize the VE-cadherin and phosphotyrosine immune-positive intramural cells. Copyright © 2018. Published by Elsevier Ltd.
Kolecka, Malgorzata Anna; Arnhold, Stefan; Schmidt, Martin; Reich, Christine; Kramer, Martin; Failing, Klaus; von Pückler, Kerstin
2017-02-24
Therapy with mesenchymal stem cells (MSCs) has been reported to provide beneficial effects in the treatment of neurological and orthopaedic disorders in dogs. The exact mechanism of action is poorly understood. Magnetic resonance imaging (MRI) gives the opportunity to observe MSCs after clinical administration. To visualise MSCs with the help of MRI, labelling with an MRI contrast agent is necessary. However, it must be clarified whether there is any negative influence on cell function and viability after labelling prior to clinical administration. For the purpose of the study, seven samples with canine adipose-derived stem cells were incubated with superparamagnetic iron oxide nanoparticles (SPIO: 319.2 μg/mL Fe) for 24 h. The internalisation of the iron particles occurred via endocytosis. SPIO particles were localized as free clusters in the cytoplasm or within lysosomes depending on the time of investigation. The efficiency of the labelling was investigated using Prussian blue staining and MACS assay. After 3 weeks the percentage of SPIO labelled canine stem cells decreased. Phalloidin staining showed no negative effect on the cytoskeleton. Labelled cells underwent osteogenic and adipogenic differentiation. Chondrogenic differentiation occurred to a lesser extent compared with a control sample. MTT-Test and wound healing assay showed no influence of labelling on the proliferation. The duration of SPIO labelling was assessed using a 1 Tesla clinical MRI scanner and T2 weighted turbo spin echo and T2 weighted gradient echo MRI sequences 1, 2 and 3 weeks after labelling. The hypointensity caused by SPIO lasted for 3 weeks in both sequences. An Endorem labelling concentration of 319.2 μg/mL Fe (448 μg/mL SPIO) had no adverse effects on the viability of canine ASCs. Therefore, this contrast agent could be used as a model for iron oxide labelling agents. However, the tracking ability in vivo has to be evaluated in further studies.
Liao, Naishun; Wu, Ming; Pan, Fan; Lin, Jiumao; Li, Zuanfang; Zhang, Da; Wang, Yingchao; Zheng, Youshi; Peng, Jun; Liu, Xiaolong; Liu, Jingfeng
2016-01-05
Tracking and monitoring of cells in vivo after transplantation can provide crucial information for stem cell therapy. Magnetic resonance imaging (MRI) combined with contrast agents is believed to be an effective and non-invasive technique for cell tracking in living bodies. However, commercial superparamagnetic iron oxide nanoparticles (SPIONs) applied to label cells suffer from shortages such as potential toxicity, low labeling efficiency, and low contrast enhancing. Herein, the adipose tissue-derived stem cells (ADSCs) were efficiently labeled with SPIONs coated with poly (dopamine) (SPIONs cluster@PDA), without affecting their viability, proliferation, apoptosis, surface marker expression, as well as their self-renew ability and multi-differentiation potential. The labeled cells transplanted into the mice through tail intravenous injection exhibited a negative enhancement of the MRI signal in the damaged liver-induced by carbon tetrachloride, and subsequently these homed ADSCs with SPIONs cluster@PDA labeling exhibited excellent repair effects to the damaged liver. Moreover, the enhanced target-homing to tissue of interest and repair effects of SPIONs cluster@PDA-labeled ADSCs could be achieved by use of external magnetic field in the excisional skin wound mice model. Therefore, we provide a facile, safe, noninvasive and sensitive method for external magnetic field targeted delivery and MRI based tracking of transplanted cells in vivo.
Liao, Naishun; Wu, Ming; Pan, Fan; Lin, Jiumao; Li, Zuanfang; Zhang, Da; Wang, Yingchao; Zheng, Youshi; Peng, Jun; Liu, Xiaolong; Liu, Jingfeng
2016-01-01
Tracking and monitoring of cells in vivo after transplantation can provide crucial information for stem cell therapy. Magnetic resonance imaging (MRI) combined with contrast agents is believed to be an effective and non-invasive technique for cell tracking in living bodies. However, commercial superparamagnetic iron oxide nanoparticles (SPIONs) applied to label cells suffer from shortages such as potential toxicity, low labeling efficiency, and low contrast enhancing. Herein, the adipose tissue-derived stem cells (ADSCs) were efficiently labeled with SPIONs coated with poly (dopamine) (SPIONs cluster@PDA), without affecting their viability, proliferation, apoptosis, surface marker expression, as well as their self-renew ability and multi-differentiation potential. The labeled cells transplanted into the mice through tail intravenous injection exhibited a negative enhancement of the MRI signal in the damaged liver-induced by carbon tetrachloride, and subsequently these homed ADSCs with SPIONs cluster@PDA labeling exhibited excellent repair effects to the damaged liver. Moreover, the enhanced target-homing to tissue of interest and repair effects of SPIONs cluster@PDA-labeled ADSCs could be achieved by use of external magnetic field in the excisional skin wound mice model. Therefore, we provide a facile, safe, noninvasive and sensitive method for external magnetic field targeted delivery and MRI based tracking of transplanted cells in vivo. PMID:26728448
NASA Astrophysics Data System (ADS)
Liao, Naishun; Wu, Ming; Pan, Fan; Lin, Jiumao; Li, Zuanfang; Zhang, Da; Wang, Yingchao; Zheng, Youshi; Peng, Jun; Liu, Xiaolong; Liu, Jingfeng
2016-01-01
Tracking and monitoring of cells in vivo after transplantation can provide crucial information for stem cell therapy. Magnetic resonance imaging (MRI) combined with contrast agents is believed to be an effective and non-invasive technique for cell tracking in living bodies. However, commercial superparamagnetic iron oxide nanoparticles (SPIONs) applied to label cells suffer from shortages such as potential toxicity, low labeling efficiency, and low contrast enhancing. Herein, the adipose tissue-derived stem cells (ADSCs) were efficiently labeled with SPIONs coated with poly (dopamine) (SPIONs cluster@PDA), without affecting their viability, proliferation, apoptosis, surface marker expression, as well as their self-renew ability and multi-differentiation potential. The labeled cells transplanted into the mice through tail intravenous injection exhibited a negative enhancement of the MRI signal in the damaged liver-induced by carbon tetrachloride, and subsequently these homed ADSCs with SPIONs cluster@PDA labeling exhibited excellent repair effects to the damaged liver. Moreover, the enhanced target-homing to tissue of interest and repair effects of SPIONs cluster@PDA-labeled ADSCs could be achieved by use of external magnetic field in the excisional skin wound mice model. Therefore, we provide a facile, safe, noninvasive and sensitive method for external magnetic field targeted delivery and MRI based tracking of transplanted cells in vivo.
Flow-Mediated Stem Cell Labeling with Superparamagnetic Iron Oxide Nanoparticle Clusters
Shkumatov, Artem; Lai, Mei-Hsiu; Smith, Cartney E.; Rich, Max; Kong, Hyunjoon
2013-01-01
This study presents a strategy to enhance the uptake of superparamagnetic iron oxide nanoparticle (SPIO) clusters by manipulating the cellular mechanical environment. Specifically, stem cells exposed to an orbital flow ingested almost two-fold greater amount of SPIO clusters than those cultured statically. Improvements in MR contrast were subsequently achieved for labeled cells in collagen gels and a mouse model. Overall, this strategy will serve to improve the efficiency of cell tracking and therapies. PMID:24033276
The effect of selected monoterpenoids on the cellular slime mold, Dictyostelium discoideum NC4.
Hwang, J Y; Kim, J H; Yun, K W
2004-06-01
We tested the activity of 11 main compounds identified from Pinus plants on the growth of Dictyostelium discoideum NC4. Four concentrations (1, 0.1, 0.01, 0.001 microg/microl) of each compound were tested using a disk volatilization technique following germination of D. discoideum NC4 spores. Photographs of D. discoideum NC4 fruiting bodies were taken 2 days after treatment. Fenchone (at 0.1, 0.01, and 0.001 microg/microl) and camphene (at 0.01 microg/microl) stimulated growth of D. discoideum NC4. (1S)-(-)-verbenone, (1S)-(-)-alpha-pinene, (+)-beta-pinene, myrcene, (-)-menthone, (-)-bornyl acetate, (S)-(+)-carvone, (-)-camphene, and (R)-(+)-limonene inhibit its growth. All of the compounds at 1 microg/microl had a strong inhibitory effect on cell growth of D. discoideum NC4. Microscopic observation of the fruiting bodies matched the results of growth rate analysis. Most of the inhibitory effects were represented by changes in the shapes of the fruiting bodies. These changes include short sorophores, smaller sized sori, and sori without spores. Our results suggest that inhibition of growth is the most common effect of monoterpenoids on D. discoideum NC4. Nevertheless, some of them, like fenchone and camphene, seem to enhance its growth.
Tariqul Islam, A F M; Yue, Haicen; Scavello, Margarethakay; Haldeman, Pearce; Rappel, Wouter-Jan; Charest, Pascale G
2018-08-01
To study the dynamics and mechanisms controlling activation of the heterotrimeric G protein Gα2βγ in Dictyostelium in response to stimulation by the chemoattractant cyclic AMP (cAMP), we monitored the G protein subunit interaction in live cells using bioluminescence resonance energy transfer (BRET). We found that cAMP induces the cAR1-mediated dissociation of the G protein subunits to a similar extent in both undifferentiated and differentiated cells, suggesting that only a small number of cAR1 (as expressed in undifferentiated cells) is necessary to induce the full activation of Gα2βγ. In addition, we found that treating cells with caffeine increases the potency of cAMP-induced Gα2βγ activation; and that disrupting the microtubule network but not F-actin inhibits the cAMP-induced dissociation of Gα2βγ. Thus, microtubules are necessary for efficient cAR1-mediated activation of the heterotrimeric G protein. Finally, kinetics analyses of Gα2βγ subunit dissociation induced by different cAMP concentrations indicate that there are two distinct rates at which the heterotrimeric G protein subunits dissociate when cells are stimulated with cAMP concentrations above 500 nM versus only one rate at lower cAMP concentrations. Quantitative modeling suggests that the kinetics profile of Gα2βγ subunit dissociation results from the presence of both uncoupled and G protein pre-coupled cAR1 that have differential affinities for cAMP and, consequently, induce G protein subunit dissociation through different rates. We suggest that these different signaling kinetic profiles may play an important role in initial chemoattractant gradient sensing. Copyright © 2018 Elsevier Inc. All rights reserved.
Zhao, Wujun; Cheng, Rui; Lim, So Hyun; Miller, Joshua R; Zhang, Weizhong; Tang, Wei; Xie, Jin; Mao, Leidong
2017-06-27
This paper reports a biocompatible and label-free cell separation method using ferrofluids that can separate a variety of low-concentration cancer cells from cell culture lines (∼100 cancer cells per mL) from undiluted white blood cells, with a throughput of 1.2 mL h -1 and an average separation efficiency of 82.2%. The separation is based on the size difference of the cancer cells and white blood cells, and is conducted in a custom-made biocompatible ferrofluid that retains not only excellent short-term viabilities but also normal proliferations of 7 commonly used cancer cell lines. A microfluidic device is designed and optimized specifically to shorten the time of live cells' exposure to ferrofluids from hours to seconds, by eliminating time-consuming off-chip sample preparation and extraction steps and integrating them on-chip to achieve a one-step process. As a proof-of-concept demonstration, a ferrofluid with 0.26% volume fraction was used in this microfluidic device to separate spiked cancer cells from cell lines at a concentration of ∼100 cells per mL from white blood cells with a throughput of 1.2 mL h -1 . The separation efficiencies were 80 ± 3%, 81 ± 5%, 82 ± 5%, 82 ± 4%, and 86 ± 6% for A549 lung cancer, H1299 lung cancer, MCF-7 breast cancer, MDA-MB-231 breast cancer, and PC-3 prostate cancer cell lines, respectively. The separated cancer cells' purity was between 25.3% and 28.8%. In addition, the separated cancer cells from this strategy showed an average short-term viability of 94.4 ± 1.3%, and these separated cells were cultured and demonstrated normal proliferation to confluence even after the separation process. Owing to its excellent biocompatibility and label-free operation and its ability to recover low concentrations of cancer cells from white blood cells, this method could lead to a promising tool for rare cell separation.
Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz
2009-08-25
Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms.
Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz
2009-01-01
Background Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. Results We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. Conclusion dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms. PMID:19706156
D. M., Jayaseema; Lai, Jiann-Shiun; Hueng, Dueng-Yuan; Chang, Chen
2013-01-01
Cellular magnetic resonance imaging (MRI) has been well-established for tracking neural progenitor cells (NPC). Superparamagnetic iron oxide nanoparticles (SPIONs) approved for clinical application are the most common agents used for labeling. Conventionally, transfection agents (TAs) were added with SPIONs to facilitate cell labeling because SPIONs in the native unmodified form were deemed inefficient for intracellular labeling. However, compelling evidence also shows that simple SPION incubation is not invariably ineffective. The labeling efficiency can be improved by prolonged incubation and elevated iron doses. The goal of the present study was to establish simple SPION incubation as an efficient intracellular labeling method. To this end, NPCs derived from the neonatal subventricular zone were incubated with SPIONs (Feridex®) and then evaluated in vitro with regard to the labeling efficiency and biological functions. The results showed that, following 48 hours of incubation at 75 µg/ml, nearly all NPCs exhibited visible SPION intake. Evidence from light microscopy, electron microscopy, chemical analysis, and magnetic resonance imaging confirmed the effectiveness of the labeling. Additionally, biological assays showed that the labeled NPCs exhibited unaffected viability, oxidative stress, apoptosis and differentiation. In the demonstrated in vivo cellular MRI experiment, the hypointensities representing the SPION labeled NPCs remained observable throughout the entire tracking period. The findings indicate that simple SPION incubation without the addition of TAs is an efficient intracellular magnetic labeling method. This simple approach may be considered as an alternative approach to the mainstream labeling method that involves the use of TAs. PMID:23468856
Affinity Versus Label-Free Isolation of Circulating Tumor Cells: Who Wins?
Murlidhar, Vasudha; Rivera-Báez, Lianette; Nagrath, Sunitha
2016-09-01
The study of circulating tumor cells (CTCs) has been made possible by many technological advances in their isolation. Their isolation has seen many fronts, but each technology brings forth a new set of challenges to overcome. Microfluidics has been a key player in the capture of CTCs and their downstream analysis, with the aim of shedding light into their clinical application in cancer and metastasis. Researchers have taken diverging paths to isolate such cells from blood, ranging from affinity-based isolation targeting surface antigens expressed on CTCs, to label-free isolation taking advantage of the size differences between CTCs and other blood cells. For both major groups, many microfluidic technologies have reported high sensitivity and specificity for capturing CTCs. However, the question remains as to the superiority among these two isolation techniques, specifically to identify different CTC populations. This review highlights the key aspects of affinity and label-free microfluidic CTC technologies, and discusses which of these two would be the highest benefactor for the study of CTCs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sun, Yu-Qi; Dai, Chun-Mei; Zheng, Yan; Shi, Shu-Dan; Hu, Hai-Yang; Chen, Da-Wei
2017-11-01
Glycyrrhetinic acid (GA) is a natural active component from licorice, which is broadly used in traditional Chinese medicine. Lots of glycyrrhetinic acid receptors (GA-R) are proved to locate on the surface of liver cells. Many reports about the hepatocellular carcinoma (HCC) treatment were dependent on GA modified carriers. However, the reality of GA-R in HCC cells was not clear. In this paper, 18β-glycyrrhetinic acid (18β-GA) was labeled with fluorescence (FITC) by chemical synthesis. Together with the binding effect of fluorescence labeled glycyrrhetinic acid (FITC-GA), the competitive action of 18β-GA with GA-R was investigated in HCC cells. The results showed that in HepG2 cells, 18β-GA and FITC-GA presented similar cytotoxicity. The specific binding saturation of GA showed the dissociation constant (K d ) was 7.457±2.122pmol/L and the maximum binding counts (B max ) was 2.385±0.175pmol/2.5×10 6 cells, respectively. FITC-GA bound to cytomembrane specifically and 18β-GA competed to bind the sites significantly in HepG2 cells. Therefore, there is binding effect between fluorescence labeled GA and GA-R. The GA-R on HCC cells is confirmed as expected, which provides a useful reference of active target modified by GA and a novel approach for receptors and ligands study. Copyright © 2017 Elsevier Inc. All rights reserved.
Berninger, Markus T; Mohajerani, Pouyan; Wildgruber, Moritz; Beziere, Nicolas; Kimm, Melanie A; Ma, Xiaopeng; Haller, Bernhard; Fleming, Megan J; Vogt, Stephan; Anton, Martina; Imhoff, Andreas B; Ntziachristos, Vasilis; Meier, Reinhard; Henning, Tobias D
2017-06-01
The distribution of intramyocardially injected rabbit MSCs, labeled with the near-infrared dye 1,1'-dioctadecyl-3,3,3',3'-tetramethylindotricarbo-cyanine-iodide (DiR) using hybrid Fluorescence Molecular Tomography-X-ray Computed Tomography (FMT-XCT) and Multispectral Optoacoustic Tomography (MSOT) imaging technologies, was investigated. Viability and induction of apoptosis of DiR labeled MSCs were assessed by XTT- and Caspase-3/-7-testing in vitro . 2 × 10 6 , 2 × 10 5 and 2 × 10 4 MSCs labeled with 5 and 10 μg DiR/ml were injected into fresh frozen rabbit hearts. FMT-XCT, MSOT and fluorescence cryosection imaging were performed. Concentrations up to 10 μg DiR/ml did not cause apoptosis in vitro (p > 0.05). FMT and MSOT imaging of labeled MSCs led to a strong signal. The imaging modalities highlighted a difference in cell distribution and concentration correlated to the number of injected cells. Ex-vivo cryosectioning confirmed the molecular fluorescence signal. FMT and MSOT are sensitive imaging techniques offering high-anatomic resolution in terms of detection and distribution of intramyocardially injected stem cells in a rabbit model.
Sheikh, M Osman; Thieker, David; Chalmers, Gordon; Schafer, Christopher M; Ishihara, Mayumi; Azadi, Parastoo; Woods, Robert J; Glushka, John N; Bendiak, Brad; Prestegard, James H; West, Christopher M
2017-11-17
Skp1 is a conserved protein linking cullin-1 to F-box proteins in SCF ( S kp1/ C ullin-1/ F -box protein) E3 ubiquitin ligases, which modify protein substrates with polyubiquitin chains that typically target them for 26S proteasome-mediated degradation. In Dictyostelium (a social amoeba), Toxoplasma gondii (the agent for human toxoplasmosis), and other protists, Skp1 is regulated by a unique pentasaccharide attached to hydroxylated Pro-143 within its C-terminal F-box-binding domain. Prolyl hydroxylation of Skp1 contributes to O 2 -dependent Dictyostelium development, but full glycosylation at that position is required for optimal O 2 sensing. Previous studies have shown that the glycan promotes organization of the F-box-binding region in Skp1 and aids in Skp1's association with F-box proteins. Here, NMR and MS approaches were used to determine the glycan structure, and then a combination of NMR and molecular dynamics simulations were employed to characterize the impact of the glycan on the conformation and motions of the intrinsically flexible F-box-binding domain of Skp1. Molecular dynamics trajectories of glycosylated Skp1 whose calculated monosaccharide relaxation kinetics and rotational correlation times agreed with the NMR data indicated that the glycan interacts with the loop connecting two α-helices of the F-box-combining site. In these trajectories, the helices separated from one another to create a more accessible and dynamic F-box interface. These results offer an unprecedented view of how a glycan modification influences a disordered region of a full-length protein. The increased sampling of an open Skp1 conformation can explain how glycosylation enhances interactions with F-box proteins in cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Recyclable Cu(i)/melanin dots for cycloaddition, bioconjugation and cell labelling
Sun, Yao; Hong, Suhyun; Ma, Xiaowei; ...
2016-05-20
We successfully transferred melanin into a novel catalytic platform. Ligand-free, water-soluble, recyclable and biocompatible Cu(i)-loaded melanin dots [Cu(i)/M-dots] was easily prepared and demonstrate excellent properties for classic CuAAC, bioconjugation and cell labelling.
NASA Astrophysics Data System (ADS)
Mok, Aaron T. Y.; Lee, Kelvin C. M.; Wong, Kenneth K. Y.; Tsia, Kevin K.
2018-02-01
Biophysical properties of cells could complement and correlate biochemical markers to characterize a multitude of cellular states. Changes in cell size, dry mass and subcellular morphology, for instance, are relevant to cell-cycle progression which is prevalently evaluated by DNA-targeted fluorescence measurements. Quantitative-phase microscopy (QPM) is among the effective biophysical phenotyping tools that can quantify cell sizes and sub-cellular dry mass density distribution of single cells at high spatial resolution. However, limited camera frame rate and thus imaging throughput makes QPM incompatible with high-throughput flow cytometry - a gold standard in multiparametric cell-based assay. Here we present a high-throughput approach for label-free analysis of cell cycle based on quantitative-phase time-stretch imaging flow cytometry at a throughput of > 10,000 cells/s. Our time-stretch QPM system enables sub-cellular resolution even at high speed, allowing us to extract a multitude (at least 24) of single-cell biophysical phenotypes (from both amplitude and phase images). Those phenotypes can be combined to track cell-cycle progression based on a t-distributed stochastic neighbor embedding (t-SNE) algorithm. Using multivariate analysis of variance (MANOVA) discriminant analysis, cell-cycle phases can also be predicted label-free with high accuracy at >90% in G1 and G2 phase, and >80% in S phase. We anticipate that high throughput label-free cell cycle characterization could open new approaches for large-scale single-cell analysis, bringing new mechanistic insights into complex biological processes including diseases pathogenesis.
Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu
2012-03-09
In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms. Copyright © 2012 Elsevier Inc. All rights reserved.
Liu, Li; Tseng, Lanya; Ye, Qing; Wu, Yijen L; Bain, Daniel J; Ho, Chien
2016-05-18
Mesenchymal stem cells (MSCs) are among the major stem cells used for cell therapy and regenerative medicine. In-vivo cell-tracking by magnetic resonance imaging (MRI) is crucial for regenerative medicine, allowing verification that the transplanted cells reach the targeted sites. Cellular MRI combined with superparamagnetic iron-oxide (SPIO) contrast agents is an effective cell-tracking method. Here, we are reporting a new "bio-mimicry" method by making use of the "in-vivo environment" of MSCs to prepare native MSCs, so that (i) the phagocytic activity of cultured MSCs can be recovered and expanded MSCs can be ex-vivo labeled with Ferumoxytol, which is currently the only FDA approved SPIO nanoparticles for human use. Using our new method, 7-day cultured MSCs regain the capability to take up Ferumoxytol and exhibit an intracellular iron concentration of 2.50 ± 0.50 pg/MSC, comparable to that obtained by using Ferumoxytol-heparin-protamine nanocomplex; and (ii) cells can be re-sized to more native size, reducing from 32.0 ± 7.2 μm to 19.5 ± 5.2 μm. Our method can be very useful for expanding MSCs and labeling with Ferumoxytol, without the need for transfection agents and/or electroporation, allowing cell-tracking by MRI in both pre-clinical and clinical studies.
Liu, Li; Tseng, Lanya; Ye, Qing; Wu, Yijen L.; Bain, Daniel J.; Ho, Chien
2016-01-01
Mesenchymal stem cells (MSCs) are among the major stem cells used for cell therapy and regenerative medicine. In-vivo cell-tracking by magnetic resonance imaging (MRI) is crucial for regenerative medicine, allowing verification that the transplanted cells reach the targeted sites. Cellular MRI combined with superparamagnetic iron-oxide (SPIO) contrast agents is an effective cell-tracking method. Here, we are reporting a new “bio-mimicry” method by making use of the “in-vivo environment” of MSCs to prepare native MSCs, so that (i) the phagocytic activity of cultured MSCs can be recovered and expanded MSCs can be ex-vivo labeled with Ferumoxytol, which is currently the only FDA approved SPIO nanoparticles for human use. Using our new method, 7-day cultured MSCs regain the capability to take up Ferumoxytol and exhibit an intracellular iron concentration of 2.50 ± 0.50 pg/MSC, comparable to that obtained by using Ferumoxytol-heparin-protamine nanocomplex; and (ii) cells can be re-sized to more native size, reducing from 32.0 ± 7.2 μm to 19.5 ± 5.2 μm. Our method can be very useful for expanding MSCs and labeling with Ferumoxytol, without the need for transfection agents and/or electroporation, allowing cell-tracking by MRI in both pre-clinical and clinical studies. PMID:27188664
Bonfante-Fasolo, P; Vian, B; Perotto, S; Faccio, A; Knox, J P
1990-03-01
Two different types of contacts (or interfaces) exist between the plant host and the fungus during the vesicular-arbuscular mycorrhizal symbiosis, depending on whether the fungus is intercellular or intracellular. In the first case, the walls of the partners are in contact, while in the second case the fungal wall is separated from the host cytoplasm by the invaginated host plasmamembrane and by an interfacial material. In order to verify the origin of the interfacial material, affinity techniques which allow identification in situ of cell-wall components, were used. Cellobiohydrolase (CBH I) that binds to cellulose and a monoclonal antibody (JIM 5) that reacts with pectic components were tested on roots ofAllium porrum L. (leek) colonized byGlomus versiforme (Karst.) Berch. Both probes gave a labelling specific for the host cell wall, but each probe labelled over specific and distinct areas. The CBH I-colloidal gold complex heavily labelled the thick epidermal cell walls, whereas JIM 5 only labelled this area weakly. Labelling of the hypodermis was mostly on intercellular material after treatment with JIM 5 and only on the wall when CBH I was used. Suberin bands found on the radial walls were never labelled. Cortical cells were mostly labelled on the middle lamella with JIM 5 and on the wall with CBH I. Gold granules from the two probes were found in interfacial material both near the point where the fungus enters the cell and around the thin hyphae penetrating deep into the cell. The ultrastructural observations demonstrate that cellulose and pectic components have different but complementary distributions in the walls of root cells involved in the mycorrhizal symbiosis. These components show a similar distribution in the interfacial material laid down around the vesicular-arbuscular mycorrhizal fungus indicating that the interfacial material is of host origin.
Swaminathan Iyer, K; Gaikwad, R M; Woodworth, C D; Volkov, D O; Sokolov, Igor
2012-06-01
A significant change of surface features of malignant cervical epithelial cells compared to normal cells has been previously reported. Here, we are studying the question at which progressive stage leading to cervical cancer the surface alteration happens. A non-traditional method to identify malignant cervical epithelial cells in vitro, which is based on physical (in contrast to specific biochemical) labelling of cells with fluorescent silica micron-size beads, is used here to examine cells at progressive stages leading to cervical cancer which include normal epithelial cells, cells infected with human papillomavirus type-16 (HPV-16), cells immortalized by HPV-16, and carcinoma cells. The study shows a statistically significant (at p < 0.01) difference between both immortal and cancer cells and a group consisting of normal and infected. There is no significant difference between normal and infected cells. Immortal cells demonstrate the signal which is closer to cancer cells than to either normal or infected cells. This implies that the cell surface, surface cellular brush changes substantially when cells become immortal. Physical labeling of the cell surface represents a substantial departure from the traditional biochemical labeling methods. The results presented show the potential significance of physical properties of the cell surface for development of clinical methods for early detection of cervical cancer, even at the stage of immortalized, premalignant cells.
Iyer, K. Swaminathan; Gaikwad, R. M.; Woodworth, C. D.; Volkov, D. O.
2013-01-01
A significant change of surface features of malignant cervical epithelial cells compared to normal cells has been previously reported. Here, we are studying the question at which progressive stage leading to cervical cancer the surface alteration happens. A non-traditional method to identify malignant cervical epithelial cells in vitro, which is based on physical (in contrast to specific biochemical) labelling of cells with fluorescent silica micron-size beads, is used here to examine cells at progressive stages leading to cervical cancer which include normal epithelial cells, cells infected with human papillomavirus type-16 (HPV-16), cells immortalized by HPV-16, and carcinoma cells. The study shows a statistically significant (at p <0.01) difference between both immortal and cancer cells and a group consisting of normal and infected. There is no significant difference between normal and infected cells. Immortal cells demonstrate the signal which is closer to cancer cells than to either normal or infected cells. This implies that the cell surface, surface cellular brush changes substantially when cells become immortal. Physical labeling of the cell surface represents a substantial departure from the traditional biochemical labeling methods. The results presented show the potential significance of physical properties of the cell surface for development of clinical methods for early detection of cervical cancer, even at the stage of immortalized, pre-malignant cells. PMID:22351422
Label-free in vitro prostate cancer cell detection via photonic-crystal biosensor
NASA Astrophysics Data System (ADS)
DeLuna, Frank; Ding, XiaoFei; Sagredo, Ismael; Bustamante, Gilbert; Sun, Lu-Zhe; Ye, Jing Yong
2018-02-01
Prostate-specific antigen (PSA) biomarker assays are the current clinical method for mass screening of prostate cancer. However, high false-positive rates are often reported due to PSA's low specificity, leading to an urgent need for the development of a more specific detection system independent of PSA levels. In our previous research, we demonstrated the feasibility of using cellular refractive indices (RI) as a unique contrast parameter to accomplish label-free detection of prostate cancer cells via variance testing, but were unable to determine if a specific cell was cancerous or noncancerous. In this paper, we report the use of our Photonic-Crystal biosensor in a Total-Internal-Reflection (PC-TIR) configuration to construct a label-free imaging system, which allows for the detection of individual prostate cancer cells utilizing cellular RI as the only contrast parameter. Noncancerous prostate (BPH-1) cells and prostate cancer (PC-3) cells were mixed at varied ratios and measured concurrently. Additionally, we isolated and induced PC-3 cells to undergo epithelial-mesenchymal transition (EMT) by exposing these cells to soluble factors such as TGF-β1. The biophysical characteristics of the cellular RI were quantified extensively in comparison to non-induced PC-3 cells as well as BPH-1 cells. EMT is a crucial mechanism for the invasion and metastasis of epithelial tumors characterized by the loss of cell-cell adhesion and increased cell mobility. Our study shows promising clinical potential in utilizing the PC-TIR biosensor imaging system to not only detect prostate cancer cells, but also evaluate prostate cancer progression.
NASA Astrophysics Data System (ADS)
Hui, Yuen Yung; Su, Long-Jyun; Chen, Oliver Yenjyh; Chen, Yit-Tsong; Liu, Tzu-Ming; Chang, Huan-Cheng
2014-07-01
Nanodiamonds containing high density ensembles of negatively charged nitrogen-vacancy (NV-) centers are promising fluorescent biomarkers due to their excellent photostability and biocompatibility. The NV- centers in the particles have a fluorescence lifetime of up to 20 ns, which distinctly differs from those (<10 ns) of cell and tissue autofluorescence, making it possible to achieve background-free detection in vivo by time gating. Here, we demonstrate the feasibility of using fluorescent nanodiamonds (FNDs) as optical labels for wide-field time-gated fluorescence imaging and flow cytometric analysis of cancer cells with a nanosecond intensified charge-coupled device (ICCD) as the detector. The combined technique has allowed us to acquire fluorescence images of FND-labeled HeLa cells in whole blood covered with a chicken breast of ~0.1-mm thickness at the single cell level, and to detect individual FND-labeled HeLa cells in blood flowing through a microfluidic device at a frame rate of 23 Hz, as well as to locate and trace FND-labeled lung cancer cells in the blood vessels of a mouse ear. It opens a new window for real-time imaging and tracking of transplanted cells (such as stem cells) in vivo.
McGuire, V; Alexander, S
1996-06-14
The differentiated spores of Dictyostelium are surrounded by an extracellular matrix, the spore coat, which protects them from environmental factors allowing them to remain viable for extended periods of time. This presumably is a major evolutionary advantage. This unique extracellular matrix is composed of cellulose and glycoproteins. Previous work has shown that some of these spore coat glycoproteins exist as a preassembled multiprotein complex (the PsB multiprotein complex) which is stored in the prespore vesicles (Watson, N., McGuire, V., and Alexander, S (1994) J. Cell Sci. 107, 2567-2579). Later in development, the complex is synchronously secreted from the prespore vesicles and incorporated into the spore coat. We now have shown that the PsB complex has a specific in vitro cellulose binding activity. The analysis of mutants lacking individual subunits of the PsB complex revealed the relative order of assembly of the subunit proteins and demonstrated that the protein subunits must be assembled for cellulose binding activity. These results provide a biochemical explanation for the localization of this multiprotein complex in the spore coat.
Katayama, Takahiro; Yasukawa, Hiro
2008-10-01
It has been reported that Dictyostelium discoideum encodes four silent information regulator 2 (Sir2) proteins (Sir2A-D) showing sequence similarity to human homologues of Sir2 (SIRT1-3). Further screening in a database revealed that D. discoideum encodes an additional Sir2 homologue (Sir2E). The amino acid sequence of Sir2E is not similar to those of SIRTs but is similar to those of proteins encoded by Giardia lamblia, Cryptosporidium hominis and Cryptosporidium parvum. Fluorescence of Sir2E-green fluorescent protein fusion protein was detected in the D. discoideum nucleus, indicating that Sir2E is a nuclear localizing protein. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that D. discoideum expressed sir2E in amoebae in the growth phase and in prestalk cells in the developmental phase. D. discoideum overexpressing sir2E grew faster than the wild type. These results indicate that Sir2E plays important roles both in the growth phase and developmental phase of D. discoideum.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Raza, A.; Preisler, H.D.
A new technique using immunofluorescence and autoradiography is described, in which the DNA of cells in S phase are labeled with two different probes. This method makes it possible to study the relationship between DNA synthesis and the uptake and/or incorporation of chemotherapeutic agents into normal or neoplastic cells. An example is provided in which the incorporation of /sup 3/H-cytarabine into DNA is demonstrated to occur only in cells which were synthesizing DNA during exposure to /sup 3/H-cytarabine. Other radioactively labeled probes can be used as well.
Fast-crawling cell types migrate to avoid the direction of periodic substratum stretching
Okimura, Chika; Ueda, Kazuki; Sakumura, Yuichi; Iwadate, Yoshiaki
2016-01-01
ABSTRACT To investigate the relationship between mechanical stimuli from substrata and related cell functions, one of the most useful techniques is the application of mechanical stimuli via periodic stretching of elastic substrata. In response to this stimulus, Dictyostelium discoideum cells migrate in a direction perpendicular to the stretching direction. The origins of directional migration, higher migration velocity in the direction perpendicular to the stretching direction or the higher probability of a switch of migration direction to perpendicular to the stretching direction, however, remain unknown. In this study, we applied periodic stretching stimuli to neutrophil-like differentiated HL-60 cells, which migrate perpendicular to the direction of stretch. Detailed analysis of the trajectories of HL-60 cells and Dictyostelium cells obtained in a previous study revealed that the higher probability of a switch of migration direction to that perpendicular to the direction of stretching was the main cause of such directional migration. This directional migration appears to be a strategy adopted by fast-crawling cells in which they do not migrate faster in the direction they want to go, but migrate to avoid a direction they do not want to go. PMID:26980079
Bilzer, Annika; Dölz, Heike; Reinhardt, Alexander; Schmith, Anika; Siol, Oliver; Winckler, Thomas
2011-01-01
Retrotransposable elements are molecular parasites that have invaded the genomes of virtually all organisms. Although retrotransposons encode essential proteins to mediate their amplification, they also require assistance by host cell-encoded machineries that perform functions such as DNA transcription and repair. The retrotransposon TRE5-A of the social amoeba Dictyostelium discoideum generates a notable amount of both sense and antisense RNAs, which are generated from element-internal promoters, located in the A module and the C module, respectively. We observed that TRE5-A retrotransposons depend on the C-module-binding factor (CbfA) to maintain high steady-state levels of TRE5-A transcripts and that CbfA supports the retrotransposition activity of TRE5-A elements. The carboxy-terminal domain of CbfA was found to be required and sufficient to mediate the accumulation of TRE5-A transcripts, but it did not support productive retrotransposition of TRE5-A. This result suggests different roles for CbfA protein domains in the regulation of TRE5-A retrotransposition frequency in D. discoideum cells. Although CbfA binds to the C module in vitro, the factor regulates neither C-module nor A-module promoter activity in vivo. We speculate that CbfA supports the amplification of TRE5-A retrotransposons by suppressing the expression of an as yet unidentified component of the cellular posttranscriptional gene silencing machinery.
EVIDENCE FROM THYMIDINE-3H-LABELED MERISTEMS OF VICIA FABA OF TWO CELL POPULATIONS
Webster, P. L.; Davidson, D.
1968-01-01
Treatments with tritiated thymidine (TdR-3H) have revealed the existence of two populations of mitotically active cells in meristems of lateral roots of Vicia faba. A rapidly dividing population, with a cycle time of 14 hr, constitutes about half the cells in the meristem. A second population of cells, with a cycle time in excess of 30 hr, is also present. Estimates of the relative size of this slowly dividing population are more difficult to make, but we calculate that this population includes 27–43% of meristem cells. The remaining fraction of the meristem is made up of cells that divide rarely or not at all. Since, at all times, both populations contribute to the mitotic index, the curve of the percentage of labeled mitoses that can be determined after a pulse label with TdR-3H differs from the curve expected of an ideal population in an important way: the peak value of the curve of the percentage of labeled mitoses is always less than 100%, usually between 75 and 80%. This heterogeneity within a meristem must be borne in mind in terms of the response of meristems to disruptive treatments, the mechanisms controlling mitotic cycle duration, and the spatial organization of a heterogeneous population in an organ that shows polarized growth. PMID:5677968
Evidence from thymidine-3H-labeled meristems of Vicia faba of two cell populations.
Webster, P L; Davidson, D
1968-11-01
Treatments with tritiated thymidine (TdR-(3)H) have revealed the existence of two populations of mitotically active cells in meristems of lateral roots of Vicia faba. A rapidly dividing population, with a cycle time of 14 hr, constitutes about half the cells in the meristem. A second population of cells, with a cycle time in excess of 30 hr, is also present. Estimates of the relative size of this slowly dividing population are more difficult to make, but we calculate that this population includes 27-43% of meristem cells. The remaining fraction of the meristem is made up of cells that divide rarely or not at all. Since, at all times, both populations contribute to the mitotic index, the curve of the percentage of labeled mitoses that can be determined after a pulse label with TdR-(3)H differs from the curve expected of an ideal population in an important way: the peak value of the curve of the percentage of labeled mitoses is always less than 100%, usually between 75 and 80%. This heterogeneity within a meristem must be borne in mind in terms of the response of meristems to disruptive treatments, the mechanisms controlling mitotic cycle duration, and the spatial organization of a heterogeneous population in an organ that shows polarized growth.
Mettler, Esther; Trenkler, Anja; Feilen, Peter J; Wiegand, Frederik; Fottner, Christian; Ehrhart, Friederike; Zimmermann, Heiko; Hwang, Yong Hwa; Lee, Dong Yun; Fischer, Stefan; Schreiber, Laura M; Weber, Matthias M
2013-01-01
Islet cell transplantation is a promising option for the restoration of normal glucose homeostasis in patients with type 1 diabetes. Because graft volume is a crucial issue in islet transplantations for patients with diabetes, we evaluated a new method for increasing functional tissue yield in xenogeneic grafts of encapsulated islets. Islets were labeled with three different superparamagnetic iron oxide nano particles (SPIONs; dextran-coated SPION, siloxane-coated SPION, and heparin-coated SPION). Magnetic separation was performed to separate encapsulated islets from the empty capsules, and cell viability and function were tested. Islets labeled with 1000 μg Fe/ml dextran-coated SPIONs experienced a 69.9% reduction in graft volume, with a 33.2% loss of islet-containing capsules. Islets labeled with 100 μg Fe/ml heparin-coated SPIONs showed a 46.4% reduction in graft volume, with a 4.5% loss of capsules containing islets. No purification could be achieved using siloxane-coated SPIONs due to its toxicity to the primary islets. SPION labeling of islets is useful for transplant purification during islet separation as well as in vivo imaging after transplantation. Furthermore, purification of encapsulated islets can also reduce the volume of the encapsulated islets without impairing their function by removing empty capsules. © 2013 John Wiley & Sons A/S.
Cheng, Ke; Li, Tao-Sheng; Malliaras, Konstantinos; Davis, Darryl; Zhang, Yiqiang; Marbán, Eduardo
2010-01-01
Rationale The success of cardiac stem cell therapies is limited by low cell retention, due at least in part to washout via coronary veins. Objective We sought to counter the efflux of transplanted cells by rendering them magnetically-responsive and imposing an external magnetic field on the heart during and immediately after injection. Methods and Results Cardiosphere-derived cells (CDCs) were labeled with superparamagnetic microspheres (SPMs). In vitro studies revealed that cell viability and function were minimally affected by SPM labeling. SPM-labeled rat CDCs were injected intramyocardially, with and without a superimposed magnet. With magnetic targeting, cells were visibly attracted towards the magnet and accumulated around the ischemic zone. In contrast, the majority of non-targeted cells washed out immediately after injection. Fluorescence imaging revealed more retention of transplanted cells in the heart, and less migration into other organs, in the magnetically-targeted group. Quantitative PCR confirmed that magnetic targeting enhanced cell retention (at 24 hours) and engraftment (at 3 weeks) in the recipient hearts by ∼3-fold compared to non-targeted cells. Morphometric analysis revealed maximal attenuation of LV remodeling, and echocardiography showed the greatest functional improvement, in the magnetic targeting group. Histologically, more engrafted cells were evident with magnetic targeting, but there was no incremental inflammation. Conclusion Magnetic targeting enhances cell retention, engraftment and functional benefit. This novel method to improve cell therapy outcomes offers the potential for rapid translation into clinical applications. PMID:20378859
Label-free imaging to study phenotypic behavioural traits of cells in complex co-cultures
NASA Astrophysics Data System (ADS)
Suman, Rakesh; Smith, Gabrielle; Hazel, Kathryn E. A.; Kasprowicz, Richard; Coles, Mark; O'Toole, Peter; Chawla, Sangeeta
2016-02-01
Time-lapse imaging is a fundamental tool for studying cellular behaviours, however studies of primary cells in complex co-culture environments often requires fluorescent labelling and significant light exposure that can perturb their natural function over time. Here, we describe ptychographic phase imaging that permits prolonged label-free time-lapse imaging of microglia in the presence of neurons and astrocytes, which better resembles in vivo microenvironments. We demonstrate the use of ptychography as an assay to study the phenotypic behaviour of microglial cells in primary neuronal co-cultures through the addition of cyclosporine A, a potent immune-modulator.
Diana, Valentina; Bossolasco, Patrizia; Moscatelli, Davide; Silani, Vincenzo; Cova, Lidia
2013-01-01
Multipotent stem cells (SCs) could substitute damaged cells and also rescue degeneration through the secretion of trophic factors able to activate the endogenous SC compartment. Therefore, fetal SCs, characterized by high proliferation rate and devoid of ethical concern, appear promising candidate, particularly for the treatment of neurodegenerative diseases. Super Paramagnetic Iron Oxide nanoparticles (SPIOn), routinely used for pre-clinical cell imaging and already approved for clinical practice, allow tracking of transplanted SCs and characterization of their fate within the host tissue, when combined with Magnetic Resonance Imaging (MRI). In this work we investigated how SPIOn could influence cell migration after internalization in two fetal SC populations: human amniotic fluid and chorial villi SCs were labeled with SPIOn and their motility was evaluated. We found that SPIOn loading significantly reduced SC movements without increasing production of Reactive Oxygen Species (ROS). Moreover, motility impairment was directly proportional to the amount of loaded SPIOn while a chemoattractant-induced recovery was obtained by increasing serum levels. Interestingly, the migration rate of SPIOn labeled cells was also significantly influenced by a degenerative surrounding. In conclusion, this work highlights how SPIOn labeling affects SC motility in vitro in a dose-dependent manner, shedding the light on an important parameter for the creation of clinical protocols. Establishment of an optimal SPIOn dose that enables both a good visualization of grafted cells by MRI and the physiological migration rate is a main step in order to maximize the effects of SC therapy in both animal models of neurodegeneration and clinical studies. PMID:24244310
USDA-ARS?s Scientific Manuscript database
Pig hepatocytes are an important investigational tool for optimizing hepatocyte transplantation schemes in both allogeneic and xenogeneic transplant scenarios. MRI can be used to serially monitor the transplanted cells, but only if the hepatocytes can be labeled with a magnetic particle. In this wo...
Jung, Goeh; Remmert, Kirsten; Wu, Xufeng; Volosky, Joanne M.; III, John A. Hammer
2001-01-01
Fusion proteins containing the Src homology (SH)3 domains of Dictyostelium myosin IB (myoB) and IC (myoC) bind a 116-kD protein (p116), plus nine other proteins identified as the seven member Arp2/3 complex, and the α and β subunits of capping protein. Immunoprecipitation reactions indicate that myoB and myoC form a complex with p116, Arp2/3, and capping protein in vivo, that the myosins bind to p116 through their SH3 domains, and that capping protein and the Arp2/3 complex in turn bind to p116. Cloning of p116 reveals a protein dominated by leucine-rich repeats and proline-rich sequences, and indicates that it is a homologue of Acan 125. Studies using p116 fusion proteins confirm the location of the myosin I SH3 domain binding site, implicate NH2-terminal sequences in binding capping protein, and show that a region containing a short sequence found in several G-actin binding proteins, as well as an acidic stretch, can activate Arp2/3-dependent actin nucleation. p116 localizes along with the Arp2/3 complex, myoB, and myoC in dynamic actin-rich cellular extensions, including the leading edge of cells undergoing chemotactic migration, and dorsal, cup-like, macropinocytic extensions. Cells lacking p116 exhibit a striking defect in the formation of these macropinocytic structures, a concomitant reduction in the rate of fluid phase pinocytosis, a significant decrease in the efficiency of chemotactic aggregation, and a decrease in cellular F-actin content. These results identify a complex that links key players in the nucleation and termination of actin filament assembly with a ubiquitous barbed end–directed motor, indicate that the protein responsible for the formation of this complex is physiologically important, and suggest that previously reported myosin I mutant phenotypes in Dictyostelium may be due, at least in part, to defects in the assembly state of actin. We propose that p116 and Acan 125, along with homologues identified in Caenorhabditis elegans
Kubohara, Yuzuru; Kikuchi, Haruhisa; Matsuo, Yusuke; Oshima, Yoshiteru; Homma, Yoshimi
2014-01-01
ABSTRACT Differentiation-inducing factor-3 (DIF-3), found in the cellular slime mold Dictyostelium discoideum, and its derivatives, such as butoxy-DIF-3 (Bu-DIF-3), are potent anti-tumor agents. To investigate the activity of DIF-like molecules in tumor cells, we recently synthesized a green fluorescent DIF-3 derivative, BODIPY-DIF-3G, and analyzed its bioactivity and cellular localization. In this study, we synthesized a red (orange) fluorescent DIF-3 derivative, BODIPY-DIF-3R, and compared the cellular localization and bioactivities of the two BODIPY-DIF-3s in HeLa human cervical cancer cells. Both fluorescent compounds penetrated the extracellular membrane within 0.5 h and localized mainly to the mitochondria. In formalin-fixed cells, the two BODIPY-DIF-3s also localized to the mitochondria, indicating that the BODIPY-DIF-3s were incorporated into mitochondria independently of the mitochondrial membrane potential. After treatment for 3 days, BODIPY-DIF-3G, but not BODIPY-DIF-3R, induced mitochondrial swelling and suppressed cell proliferation. Interestingly, the swollen mitochondria were stainable with BODIPY-DIF-3G but not with BODIPY-DIF-3R. When added to isolated mitochondria in vitro, BODIPY-DIF-3G increased dose-dependently the rate of O2 consumption, but BODIPY-DIF-3R did not. These results suggest that the bioactive BODIPY-DIF-3G suppresses cell proliferation, at least in part, by altering mitochondrial activity, whereas the non-bioactive BODIPY-DIF-3R localizes to the mitochondria but does not affect mitochondrial activity or cell proliferation. PMID:24682009
Xu, Yuechi; Brown, Kevin M.; Wang, Zhuo A.; van der Wel, Hanke; Teygong, Crystal; Zhang, Dongmei; Blader, Ira J.; West, Christopher M.
2012-01-01
In diverse types of organisms, cellular hypoxic responses are mediated by prolyl 4-hydroxylases that use O2 and α-ketoglutarate as substrates to hydroxylate conserved proline residues in target proteins. Whereas in metazoans these enzymes control the stability of the HIFα family of transcription factor subunits, the Dictyostelium enzyme (DdPhyA) contributes to O2 regulation of development by a divergent mechanism involving hydroxylation and subsequent glycosylation of DdSkp1, an adaptor subunit in E3SCF ubiquitin ligases. Sequences related to DdPhyA, DdSkp1, and the glycosyltransferases that cap Skp1 hydroxyproline occur also in the genomes of Toxoplasma and other protists, suggesting that this O2 sensing mechanism may be widespread. Here we show by disruption of the TgphyA locus that this enzyme is required for Skp1 glycosylation in Toxoplasma and that disrupted parasites grow slowly at physiological O2 levels. Conservation of cellular function was tested by expression of TgPhyA in DdphyA-null cells. Simple gene replacement did not rescue Skp1 glycosylation, whereas overexpression not only corrected Skp1 modification but also restored the O2 requirement to a level comparable to that of overexpressed DdPhyA. Bacterially expressed TgPhyA protein can prolyl hydroxylate both Toxoplasma and Dictyostelium Skp1s. Kinetic analyses showed that TgPhyA has similar properties to DdPhyA, including a superimposable dependence on the concentration of its co-substrate α-ketoglutarate. Remarkably, however, TgPhyA had a significantly higher apparent affinity for O2. The findings suggest that Skp1 hydroxylation by PhyA is a conserved process among protists and that this biochemical pathway may indirectly sense O2 by detecting the levels of O2-regulated metabolites such as α-ketoglutarate. PMID:22648409
Kawaharada, Ritsuko; Nakamura, Akio; Takahashi, Katsunori; Kikuchi, Haruhisa; Oshima, Yoshiteru; Kubohara, Yuzuru
2016-06-15
Differentiation-inducing factor 1 (DIF-1), originally discovered in the cellular slime mold Dictyostelium discoideum, and its derivatives possess pharmacological activities, such as the promotion of glucose uptake in non-transformed mammalian cells in vitro. Accordingly, DIFs are considered promising lead candidates for novel anti-diabetic drugs. The aim of this study was to assess the anti-diabetic and toxic effects of DIF-1 in mouse 3T3-L1 fibroblast cells in vitro and in diabetic rats in vivo. Main methods We investigated the in vitro effects of DIF-1 and DIF-1(3M), a derivative of DIF-1, on glucose metabolism in 3T3-L1 cells by using capillary electrophoresis time-of-flight mass spectrometry (CE-TOF-MS). We also examined the effects of DIF-1 on blood glucose levels in streptozotocin (STZ)-induced rats. CE-TOF-MS revealed that 20μM DIF-1 and 20μM DIF-1(3M) promoted glucose uptake and metabolism in 3T3-L1 cells. Oral administration of DIF-1 (30mg/kg) significantly lowered basal blood glucose levels in STZ-treated rats and promoted a decrease in blood glucose levels after oral glucose loading (2.5g/kg) in the rats. In addition, daily oral administration of DIF-1 (30mg/kg/day) for 1wk significantly lowered the blood glucose levels in STZ-treated rats but did not affect their body weight and caused only minor alterations in the levels of other blood analytes. These results indicate that DIF-1 may be a good lead compound for the development of anti-diabetic drugs. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhang, Lu; Zhao, Xin; Zhang, Zhenxi; Zhao, Hong; Chen, Wei; Yuan, Li
2016-07-01
A single living cell's light scattering pattern (LSP) in the horizontal plane, which has been denoted as the cell's "2D fingerprint," may provide a powerful label-free detection tool in clinical applications. We have recently studied the LSP in spatial scattering planes, denoted as the cell's "3D fingerprint," for mature and immature lymphocyte cells in human peripheral blood. The effects of membrane size, morphology, and the existence of the nucleus on the spatial LSP are discussed. In order to distinguish clinical label-free mature and immature lymphocytes, the special features of the spatial LSP are studied by statistical method in both the spatial and frequency domains. Spatial LSP provides rich information on the cell's morphology and contents, which can distinguish mature from immature lymphocyte cells and hence ultimately it may be a useful label-free technique for clinical leukemia diagnosis.
NASA Astrophysics Data System (ADS)
Kemper, Björn; Schnekenburger, Jürgen; Ketelhut, Steffi
2017-02-01
We investigated the capabilities of digital holographic microscopy (DHM) for label-free quantification of the response of living single cells to chemical stimuli in 3D assays. Fibro sarcoma cells were observed in a collagen matrix inside 3D chemotaxis chambers with a Mach-Zehnder interferometer-based DHM setup. From the obtained series of quantitative phase images, the migration trajectories of single cells were retrieved by automated cell tracking and subsequently analyzed for maximum migration distance and motility. Our results demonstrate DHM as a highly reliable and efficient tool for label-free quantification of chemotaxis in 2D and 3D environments.
Journet, Agnès; Klein, Gérard; Brugière, Sabine; Vandenbrouck, Yves; Chapel, Agnès; Kieffer, Sylvie; Bruley, Christophe; Masselon, Christophe; Aubry, Laurence
2012-01-01
The cellular slime mold Dictyostelium discoideum is a soil-living eukaryote, which feeds on microorganisms engulfed by phagocytosis. Axenic laboratory strains have been produced that are able to use liquid growth medium internalized by macropinocytosis as the source of food. To better define the macropinocytosis process, we established the inventory of proteins associated with this pathway using mass spectrometry-based proteomics. Using a magnetic purification procedure and high-performance LC-MS/MS proteome analysis, a list of 2108 non-redundant proteins was established, of which 24% featured membrane-spanning domains. Bioinformatics analyses indicated that the most abundant proteins were linked to signaling, vesicular trafficking and the cytoskeleton. The present repertoire validates our purification method and paves the way for a future proteomics approach to study the dynamics of macropinocytosis. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shibasaki, Shota; Shirokawa, Yuka; Shimada, Masakazu
2017-05-21
Biological studies of the evolution of cooperation are challenging because this process is vulnerable to cheating. Many mechanisms, including kin discrimination, spatial structure, or by-products of self-interested behaviors, can explain this evolution. Here we propose that the evolution of cooperation can be induced by other cooperation. To test this idea, we used a model organism Dictyostelium discoideum because it exhibits two cooperative dormant phases, the fruiting body and the macrocyst. In both phases, the same chemoattractant, cyclic AMP (cAMP), is used to collect cells. This common feature led us to hypothesize that the evolution of macrocyst formation would be induced by coexistence with fruiting bodies. Before forming a mathematical model, we confirmed that macrocysts coexisted with fruiting bodies, at least under laboratory conditions. Next, we analyzed our evolutionary game theory-based model to investigate whether coexistence with fruiting bodies would stabilize macrocyst formation. The model suggests that macrocyst formation represents an evolutionarily stable strategy and a global invader strategy under this coexistence, but is unstable if the model ignores the fruiting body formation. This result indicates that the evolution of macrocyst formation and maintenance is attributable to coexistence with fruiting bodies. Therefore, macrocyst evolution can be considered as an example of evolution of cooperation induced by other cooperation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Platt, James L.; Rogers, Benjamin J.; Rogers, Kelley C.; Harwood, Adrian J.; Kimmel, Alan R.
2013-01-01
Control of chromatin structure is crucial for multicellular development and regulation of cell differentiation. The CHD (chromodomain-helicase-DNA binding) protein family is one of the major ATP-dependent, chromatin remodeling factors that regulate nucleosome positioning and access of transcription factors and RNA polymerase to the eukaryotic genome. There are three mammalian CHD subfamilies and their impaired functions are associated with several human diseases. Here, we identify three CHD orthologs (ChdA, ChdB and ChdC) in Dictyostelium discoideum. These CHDs are expressed throughout development, but with unique patterns. Null mutants lacking each CHD have distinct phenotypes that reflect their expression patterns and suggest functional specificity. Accordingly, using genome-wide (RNA-seq) transcriptome profiling for each null strain, we show that the different CHDs regulate distinct gene sets during both growth and development. ChdC is an apparent ortholog of the mammalian Class III CHD group that is associated with the human CHARGE syndrome, and GO analyses of aberrant gene expression in chdC nulls suggest defects in both cell-autonomous and non-autonomous signaling, which have been confirmed through analyses of chdC nulls developed in pure populations or with low levels of wild-type cells. This study provides novel insight into the broad function of CHDs in the regulation development and disease, through chromatin-mediated changes in directed gene expression. PMID:24301467
Patel, Chetan D; Agarwal, Snehlata; Seth, Sandeep; Mohanty, Sujata; Aggarwal, Himesh; Gupta, Namit
2014-01-01
Bone marrow stem cells having myogenic potential are promising candidates for various cell-based therapies for myocardial disease. We present here images showing homing of technetium-99m (Tc-99m) hexamethylpropyleneamine oxime (HMPAO) labeled stem cells in the infarcted myocardium from a pilot study conducted to radio-label part of the stem cells in patients enrolled in a stem cell clinical trial for recent myocardial infarction. PMID:25400375
An optimized method for measuring fatty acids and cholesterol in stable isotope-labeled cells
Argus, Joseph P.; Yu, Amy K.; Wang, Eric S.; Williams, Kevin J.; Bensinger, Steven J.
2017-01-01
Stable isotope labeling has become an important methodology for determining lipid metabolic parameters of normal and neoplastic cells. Conventional methods for fatty acid and cholesterol analysis have one or more issues that limit their utility for in vitro stable isotope-labeling studies. To address this, we developed a method optimized for measuring both fatty acids and cholesterol from small numbers of stable isotope-labeled cultured cells. We demonstrate quantitative derivatization and extraction of fatty acids from a wide range of lipid classes using this approach. Importantly, cholesterol is also recovered, albeit at a modestly lower yield, affording the opportunity to quantitate both cholesterol and fatty acids from the same sample. Although we find that background contamination can interfere with quantitation of certain fatty acids in low amounts of starting material, our data indicate that this optimized method can be used to accurately measure mass isotopomer distributions for cholesterol and many fatty acids isolated from small numbers of cultured cells. Application of this method will facilitate acquisition of lipid parameters required for quantifying flux and provide a better understanding of how lipid metabolism influences cellular function. PMID:27974366
2011-01-01
Background Stem cell therapy has emerged as a promising addition to traditional treatments for a number of diseases. However, harnessing the therapeutic potential of stem cells requires an understanding of their fate in vivo. Non-invasive cell tracking can provide knowledge about mechanisms responsible for functional improvement of host tissue. Superparamagnetic iron oxide nanoparticles (SPIONs) have been used to label and visualize various cell types with magnetic resonance imaging (MRI). In this study we performed experiments designed to investigate the biological properties, including proliferation, viability and differentiation capacity of mesenchymal cells (MSCs) labeled with clinically approved SPIONs. Results Rat and mouse MSCs were isolated, cultured, and incubated with dextran-covered SPIONs (ferumoxide) alone or with poly-L-lysine (PLL) or protamine chlorhydrate for 4 or 24 hrs. Labeling efficiency was evaluated by dextran immunocytochemistry and MRI. Cell proliferation and viability were evaluated in vitro with Ki67 immunocytochemistry and live/dead assays. Ferumoxide-labeled MSCs could be induced to differentiate to adipocytes, osteocytes and chondrocytes. We analyzed ferumoxide retention in MSCs with or without mitomycin C pretreatment. Approximately 95% MSCs were labeled when incubated with ferumoxide for 4 or 24 hrs in the presence of PLL or protamine, whereas labeling of MSCs incubated with ferumoxide alone was poor. Proliferative capacity was maintained in MSCs incubated with ferumoxide and PLL for 4 hrs, however, after 24 hrs it was reduced. MSCs incubated with ferumoxide and protamine were efficiently visualized by MRI; they maintained proliferation and viability for up to 7 days and remained competent to differentiate. After 21 days MSCs pretreated with mitomycin C still showed a large number of ferumoxide-labeled cells. Conclusions The efficient and long lasting uptake and retention of SPIONs by MSCs using a protocol employing ferumoxide and
Strahan, J. Alex; Walker, William H.; Montgomery, Taylor R.; Forger, Nancy G.
2016-01-01
Minocycline, an antibiotic of the tetracycline family, inhibits microglia in many paradigms, and is among the most commonly used tools for examining the role of microglia in physiological processes. Microglia may play an active role in triggering developmental neuronal cell death, although findings have been contradictory. To determine whether microglia influence developmental cell death, we treated perinatal mice with minocycline (45 mg/kg) and quantified effects on dying cells and microglial labeling using immunohistochemistry for activated caspase-3 (AC3) and ionized calcium-binding adapter molecule 1 (Iba1), respectively. Contrary to our expectations, minocycline treatment from embryonic day 18 to postnatal day (P)1 caused a >10-fold increase in cell death 8 h after the last injection in all brain regions examined, including the primary sensory cortex (S1), septum, hippocampus and hypothalamus. Iba1 labeling was also increased in most regions. Similar effects, although of smaller magnitude, were seen when treatment was delayed to P3-P5. Minocycline treatment from P3-P5 also decreased overall cell number in the septum at weaning, suggesting lasting effects of the neonatal exposure. When administered at lower doses (4.5 or 22.5 mg/kg), or at the same dose one week later (P10-P12), minocycline no longer increased microglial markers or cell death. Taken together, the most commonly used microglial “inhibitor” increases cell death and Iba1 labeling in the neonatal mouse brain. Minocycline is used clinically in infant and pediatric populations; caution is warrented when using minocycline in developing animals, or extrapolating the effects of this drug across ages. PMID:27706925
Stojanov, Katica; de Vries, Erik F J; Hoekstra, Dick; van Waarde, Aren; Dierckx, Rudi A J O; Zuhorn, Inge S
2012-02-01
The introduction of neural stem cells into the brain has promising therapeutic potential for the treatment of neurodegenerative diseases. To monitor the cellular replacement therapy, that is, to determine stem cell migration, survival, and differentiation, in vivo tracking methods are needed. Ideally, these tracking methods are noninvasive. Noninvasive tracking methods that have been successfully used for the visualization of blood-derived progenitor cells include magnetic resonance imaging and radionuclide imaging using single-photon emission computed tomography (SPECT) and positron emission tomography (PET). The SPECT tracer In-111-oxine is suitable for stem cell labeling, but for studies in small animals, the higher sensitivity and facile quantification that can be obtained with PET are preferred. Here the potential of 2'-[18F]fluoro-2'-deoxy-D-glucose ([18F]-FDG), a PET tracer, for tracking of neural stem cell (NSCs) trafficking toward an inflammation site was investigated. [18F]-FDG turns out to be a poor radiopharmaceutical to label NSCs owing to the low labeling efficiency and substantial release of radioactivity from these cells. Efflux of [18F]-FDG from NSCs can be effectively reduced by phloretin in vitro, but inhibition of tracer release is insufficient in vivo for accurate monitoring of stem cell trafficking.
NASA Astrophysics Data System (ADS)
Ashok, Praveen C.; Praveen, Bavishna B.; Campbell, Elaine C.; Dholakia, Kishan; Powis, Simon J.
2014-03-01
Leucocytes in the blood of mammals form a powerful protective system against a wide range of dangerous pathogens. There are several types of immune cells that has specific role in the whole immune system. The number and type of immune cells alter in the disease state and identifying the type of immune cell provides information about a person's state of health. There are several immune cell subsets that are essentially morphologically identical and require external labeling to enable discrimination. Here we demonstrate the feasibility of using Wavelength Modulated Raman Spectroscopy (WMRS) with suitable machine learning algorithms as a label-free method to distinguish between different closely lying immune cell subset. Principal Component Analysis (PCA) was performed on WMRS data from single cells, obtained using confocal Raman microscopy for feature reduction, followed by Support Vector Machine (SVM) for binary discrimination of various cell subset, which yielded an accuracy >85%. The method was successful in discriminating between untouched and unfixed purified populations of CD4+CD3+ and CD8+CD3+ T lymphocyte subsets, and CD56+CD3- natural killer cells with a high degree of specificity. It was also proved sensitive enough to identify unique Raman signatures that allow clear discrimination between dendritic cell subsets, comprising CD303+CD45+ plasmacytoid and CD1c+CD141+ myeloid dendritic cells. The results of this study clearly show that WMRS is highly sensitive and can distinguish between cell types that are morphologically identical.
Bush, J M; Ebert, D L; Cardelli, J A
1990-11-15
The importance of N-linked oligosaccharides and their associated modifications in the transport, sorting, and secretion of lysosomal acid phosphatase was investigated using three mutant Dictyostelium cell lines. These mutants synthesize altered N-linked oligosaccharides with the following properties: (i) in strain HL244 carbohydrate side chains lack mannose 6-sulfate residues, (ii) in strain M31 the side chains retain the two alpha-1,3-linked glucose residues resulting in less sulfate and methylphosphate modifications, and (iii) in strain HL243 the nonglucosylated branches are missing three of the outer mannose sugars and the oligosaccharides contain fewer sulfate and phosphate modifications. Lysosomal enzymes in both HL243 and HL244 are also missing a shared epitope termed common antigen-1 (CA-1), which consists in part of mannose 6-sulfate moieties. No increases were observed in the secretion of radiolabeled acid phosphatase or acid phosphatase activity during growth in any of the mutant cell lines, suggesting that the enzyme was correctly sorted to lysosomes. In support of this, Percoll gradient fractionations and indirect immunofluorescence microscopy indicated that acid phosphatase was transported to lysosomes in all cell lines. However, radiolabel pulse chase protocols indicated that newly synthesized acid phosphatase was transported out of the endoplasmic reticulum (ER) and into lysosomes at a two- to threefold slower rate in HL243 and at a sixfold slower rate in M31. The rate of transport of acid phosphatase from the ER to the Golgi was reduced only twofold in M31 as determined by digestion of newly synthesized enzyme with endoglycosidose H. This suggests that certain alterations in carbohydrate structure may only slightly affect transport of the enzyme from the ER to the Golgi but these alterations may greatly delay transport from the Golgi or post-Golgi compartments to lysosomes. Finally all three mutants secreted acid phosphatase at significantly lower
Bilzer, Annika; Dölz, Heike; Reinhardt, Alexander; Schmith, Anika; Siol, Oliver; Winckler, Thomas
2011-01-01
Retrotransposable elements are molecular parasites that have invaded the genomes of virtually all organisms. Although retrotransposons encode essential proteins to mediate their amplification, they also require assistance by host cell-encoded machineries that perform functions such as DNA transcription and repair. The retrotransposon TRE5-A of the social amoeba Dictyostelium discoideum generates a notable amount of both sense and antisense RNAs, which are generated from element-internal promoters, located in the A module and the C module, respectively. We observed that TRE5-A retrotransposons depend on the C-module-binding factor (CbfA) to maintain high steady-state levels of TRE5-A transcripts and that CbfA supports the retrotransposition activity of TRE5-A elements. The carboxy-terminal domain of CbfA was found to be required and sufficient to mediate the accumulation of TRE5-A transcripts, but it did not support productive retrotransposition of TRE5-A. This result suggests different roles for CbfA protein domains in the regulation of TRE5-A retrotransposition frequency in D. discoideum cells. Although CbfA binds to the C module in vitro, the factor regulates neither C-module nor A-module promoter activity in vivo. We speculate that CbfA supports the amplification of TRE5-A retrotransposons by suppressing the expression of an as yet unidentified component of the cellular posttranscriptional gene silencing machinery. PMID:21076008
Zhou, Shukui; Yin, Ting; Zou, Qingsong; Zhang, Kaile; Gao, Guo; Shapter, Joseph G; Huang, Peng; Fu, Qiang
2017-02-21
Cell sheet therapy has emerged as a potential therapeutic option for reparation and reconstruction of damaged tissues and organs. However, an effective means to assess the fate and distribution of transplanted cell sheets in a serial and noninvasive manner is still lacking. To investigate the feasibility of tracking Adipose derived stem cells (ADSCs) sheet in vivo using ultrasmall super-paramagnetic Fe 3 O 4 nanoparticles (USPIO), canine ADSCs were cultured and incubated with USPIO and 0.75 μg/ml Poly-L-Lysine (PLL) for 12 h. Labeling efficiency, cell viability, apoptotic cell rate were assessed to screen the optimum concentrations of USPIO for best labeling ADSCs. The results showed ADSCs were labeled by USPIO at an iron dose of 50 μg/ml for a 12 h incubation time, which can most efficiently mark cells and did not impair the cell survival, self-renewal, and proliferation capacity. USPIO-labeled ADSCs sheets can be easily and clearly detected in vivo and have persisted for at least 12 weeks. Our experiment confirmed USPIO was feasible for in vivo labeling of the ADSCs sheets with the optimal concentration of 50 μg Fe/ml and the tracing time is no less than 12 weeks.
3D imaging of cells in scaffolds: direct labelling for micro CT.
Shepherd, David V; Shepherd, Jennifer H; Best, Serena M; Cameron, Ruth E
2018-06-12
The development of in-vitro techniques to characterise the behaviour of cells in biomedical scaffolds is a rapidly developing field. However, until now it has not been possible to visualise, directly in 3D, the extent of cell migration using a desktop X-ray microCT. This paper describes a new technique based on cell labelling with a radio opacifier (barium sulphate), which permits cell tracking without the need for destructive sample preparation. The ability to track cells is highlighted via a comparison of cell migration through demonstrator lyophilised collagen scaffolds with contrasting pore size and interconnectivity. The results demonstrate the ease with which the technique can be used to characterise the effects of scaffold architecture on cell infiltration.
Jennings, M L; Anderson, M P
1987-02-05
A new method has been developed for the chemical modification and labeling of carboxyl groups in proteins. Carboxyl groups are activated with Woodward's reagent K (N-ethyl-5-phenylisoxazolium 3'-sulfonate), and the adducts are reduced with [3H]BH4. The method has been applied to the anion transport protein of the human red blood cell (band 3). Woodward's reagent K is a reasonably potent inhibitor of band 3-mediated anion transport; a 5-min exposure of intact cells to 2 mM reagent at pH 6.5 produces 80% inhibition of transport. The inhibition is a consequence of modification of residues that can be protected by 4,4'-dinitrostilbene-2,2'-disulfonate. Treatment of intact cells with Woodward's reagent K followed by B3H4 causes extensive labeling of band 3, with minimal labeling of intracellular proteins such as spectrin. Proteolytic digestion of the labeled protein reveals that both the 60- and the 35-kDa chymotryptic fragments are labeled and that the labeling of each is inhibitable by stilbenedisulfonate. If the reduction is performed at neutral pH the major labeled product is the primary alcohol corresponding to the original carboxylic acid. Liquid chromatography of acid hydrolysates of labeled affinity-purified band 3 shows that glutamate but not aspartate residues have been converted into the hydroxyl derivative. This is the first demonstration of the conversion of a glutamate carboxyl group to an alcohol in a protein. The labeling experiments reveal that there are two glutamate residues that are sufficiently close to the stilbenedisulfonate site for their labeling to be blocked by 4,4'-diisothiocyanodihydrostilbene-2,2'-disulfonate and 4,4'-dinitrostilbene-2,2'-disulfonate.
Tunable coating of gold nanostars: tailoring robust SERS labels for cell imaging
NASA Astrophysics Data System (ADS)
Bassi, B.; Taglietti, A.; Galinetto, P.; Marchesi, N.; Pascale, A.; Cabrini, E.; Pallavicini, P.; Dacarro, G.
2016-07-01
Surface modification of noble metal nanoparticles with mixed molecular monolayers is one of the most powerful tools in nanotechnology, and is used to impart and tune new complex surface properties. In imaging techniques based on surface enhanced Raman spectroscopy (SERS), precise and controllable surface modifications are needed to carefully design reproducible, robust and adjustable SERS nanoprobes. We report here the attainment of SERS labels based on gold nanostars (GNSs) coated with a mixed monolayer composed of a poly ethylene glycol (PEG) thiol (neutral or negatively charged) that ensure stability in biological environments, and of a signalling unit 7-Mercapto-4-methylcoumarin as a Raman reporter molecule. The composition of the coating mixture is precisely controlled using an original method, allowing the modulation of the SERS intensity and ensuring overall nanoprobe stability. The further addition of a positively charged layer of poly (allylamine hydrocloride) on the surface of negatively charged SERS labels does not change the SERS response, but it promotes the penetration of GNSs in SH-SY5Y neuroblastoma cells. As an example of an application of such an approach, we demonstrate here the internalization of these new labels by means of visualization of cell morphology obtained with SERS mapping.
Hebert, Colin G; Hart, Sean; Leski, Tomasz A; Terray, Alex; Lu, Qin
2017-10-03
Understanding the interaction between macrophage cells and Bacillus anthracis spores is of significant importance with respect to both anthrax disease progression, spore detection for biodefense, as well as understanding cell clearance in general. While most detection systems rely on specific molecules, such as nucleic acids or proteins and fluorescent labels to identify the target(s) of interest, label-free methods probe changes in intrinsic properties, such as size, refractive index, and morphology, for correlation with a particular biological event. Optical chromatography is a label free technique that uses the balance between optical and fluidic drag forces within a microfluidic channel to determine the optical force on cells or particles. Here we show an increase in the optical force experienced by RAW264.7 macrophage cells upon the uptake of both microparticles and B. anthracis Sterne 34F2 spores. In the case of spores, the exposure was detected in as little as 1 h without the use of antibodies or fluorescent labels of any kind. An increase in the optical force was also seen in macrophage cells treated with cytochalasin D, both with and without a subsequent exposure to spores, indicating that a portion of the increase in the optical force arises independent of phagocytosis. These results demonstrate the capability of optical chromatography to detect subtle biological differences in a rapid and sensitive manner and suggest future potential in a range of applications, including the detection of biological threat agents for biodefense and pathogens for the prevention of sepsis and other diseases.
Birch, Ditlev; Christensen, Malene Vinther; Staerk, Dan; Franzyk, Henrik; Nielsen, Hanne Mørck
2017-12-01
Cell-penetrating peptides constitute efficient delivery vectors, and studies of their uptake and mechanism of translocation typically involve fluorophore-labeled conjugates. In the present study, the influence of a number of specific fluorophores on the physico-chemical properties and uptake-related characteristics of penetratin were studied. An array of seven fluorophores belonging to distinct structural classes was examined, and the impact of fluorophore labeling on intracellular distribution and cytotoxicity was correlated to the physico-chemical properties of the conjugates. Exposure of several mammalian cell types to fluorophore-penetratin conjugates revealed a strong structure-dependent reduction in viability (1.5- to 20-fold lower IC 50 values as compared to those of non-labeled penetratin). Also, the degree of less severe effects on membrane integrity, as well as intracellular distribution patterns differed among the conjugates. Overall, neutral hydrophobic fluorophores or negatively charged fluorophores conferred less cytotoxicity as compared to the effect exerted by positively charged, hydrophobic fluorophores. The latter conjugates, however, exhibited less membrane association and more clearly defined intracellular distribution patterns. Thus, selection of the appropriate flurophore is critical. Copyright © 2017 Elsevier B.V. All rights reserved.
A non-genetic approach to labelling acute myeloid leukemia and bone marrow cells with quantum dots.
Zheng, Yanwen; Tan, Dongming; Chen, Zheng; Hu, Chenxi; Mao, Zhengwei J; Singleton, Timothy P; Zeng, Yan; Shao, Xuejun; Yin, Bin
2014-06-01
The difficulty in manipulation of leukemia cells has long hindered the dissection of leukemia pathogenesis. We have introduced a non-genetic approach of marking blood cells, using quantum dots. We compared quantum dots complexed with different vehicles, including a peptide Tat, cationic polymer Turbofect and liposome. Quantum dots-Tat showed the highest efficiency of marking hematopoietic cells among the three vehicles. Quantum dots-Tat could also label a panel of leukemia cell lines at varied efficiencies. More uniform intracellular distributions of quantum dots in mouse bone marrow and leukemia cells were obtained with quantum dots-Tat, compared with the granule-like formation obtained with quantum dots-liposome. Our results suggest that quantum dots have provided a photostable and non-genetic approach that labels normal and malignant hematopoietic cells, in a cell type-, vehicle-, and quantum dot concentration-dependent manner. We expect for potential applications of quantum dots as an easy and fast marking tool assisting investigations of various types of blood cells in the future.
Muralidhar, Gautam S; Channappayya, Sumohana S; Slater, John H; Blinka, Ellen M; Bovik, Alan C; Frey, Wolfgang; Markey, Mia K
2008-11-06
Automated analysis of fluorescence microscopy images of endothelial cells labeled for actin is important for quantifying changes in the actin cytoskeleton. The current manual approach is laborious and inefficient. The goal of our work is to develop automated image analysis methods, thereby increasing cell analysis throughput. In this study, we present preliminary results on comparing different algorithms for cell segmentation and image denoising.
Hao, Sijie; Nisic, Merisa; He, Hongzhang; Tai, Yu-Chong; Zheng, Si-Yang
2017-01-01
Analysis of rare circulating tumor cells enriched from metastatic cancer patients yields critical information on disease progression, therapy response, and the mechanism of cancer metastasis. Here we describe in detail a label-free enrichment process of circulating tumor cells based on its unique physical properties (size and deformability). Viable circulating tumor cells can be successfully enriched and analyzed, or easily released for further characterization due to the novel separable two-layer design.
Robson, Gillian E.; Williams, Keith L.
1979-01-01
The genetic basis of vegetative incompatibility in the cellular slime mold, Dictyostelium discoideum, is elucidated. Vegetatively compatible haploid strains from parasexual diploids at a frequency of between 10-6 and 10-5, whereas "escaped" diploids are formed between vegetatively incompatible strains at a frequency of ∼10-8. There is probably only a single vegetative incompatibility site, which appears to be located at, or closely linked to, the mating-type locus. The nature of the vegetative incompatibility is deduced from parasexual diploid formation between wild isolates and tester strains of each mating type, examination of the frequency of formation of "escaped" diploids formed between vegetatively incompatible strains, and examination of the mating type and vegetative incompatibility of haploid segregants obtained from "escaped" diploids. PMID:17248984
Classification of blood cells and tumor cells using label-free ultrasound and photoacoustics.
Strohm, Eric M; Kolios, Michael C
2015-08-01
A label-free method that can identify cells in a blood sample using high frequency photoacoustic and ultrasound signals is demonstrated. When the wavelength of the ultrasound or photoacoustic wave is similar to the size of a single cell (frequencies of 100-500 MHz), unique periodic features occur within the ultrasound and photoacoustic power spectrum that depend on the cell size, structure, and morphology. These spectral features can be used to identify different cell types present in blood, such as red blood cells (RBCs), white blood cells (WBCs), and circulating tumor cells. Circulating melanoma cells are ideal for photoacoustic detection due to their endogenous optical absorption properties. Using a 532 nm pulsed laser and a 375 MHz transducer, the ultrasound and photoacoustic signals from RBCs, WBCs, and melanoma cells were individually measured in an acoustic microscope to examine how the signals change between cell types. A photoacoustic and ultrasound signal was detected from RBCs and melanoma cells; only an ultrasound signal was detected from WBCs. The different cell types were distinctly separated using the ultrasound and photoacoustic signal amplitude and power spectral periodicity. The size of each cell was also estimated from the spectral periodicity. For the first time, sound waves generated using pulse-echo ultrasound and photoacoustics have been used to identify and size single cells, with applications toward counting and identifying cells, including circulating melanoma cells. © 2015 International Society for Advancement of Cytometry.
Vandenplas, Sam; Willems, Maxime; Witten, P Eckhard; Hansen, Tom; Fjelldal, Per Gunnar; Huysseune, Ann
2016-01-01
The Atlantic salmon (Salmo salar) and African bichir (Polypterus senegalus) are both actinopterygian fish species that continuously replace their teeth without the involvement of a successional dental lamina. Instead, they share the presence of a middle dental epithelium: an epithelial tier enclosed by inner and outer dental epithelium. It has been hypothesized that this tier could functionally substitute for a successional dental lamina and might be a potential niche to house epithelial stem cells involved in tooth cycling. Therefore, in this study we performed a BrdU pulse chase experiment on both species to (1) determine the localization and extent of proliferating cells in the dental epithelial layers, (2) describe cell dynamics and (3) investigate if label-retaining cells are present, suggestive for the putative presence of stem cells. Cells proliferate in the middle dental epithelium, outer dental epithelium and cervical loop at the lingual side of the dental organ to form a new tooth germ. Using long chase times, both in S. salar (eight weeks) and P. senegalus (eight weeks and twelve weeks), we could not reveal the presence of label-retaining cells in the dental organ. Immunostaining of P. senegalus dental organs for the transcription factor Sox2, often used as a stem cell marker, labelled cells in the zone of outer dental epithelium which grades into the oral epithelium (ODE transition zone) and the inner dental epithelium of a successor only. The location of Sox2 distribution does not provide evidence for epithelial stem cells in the dental organ and, more specifically, in the middle dental epithelium. Comparison of S. salar and P. senegalus reveals shared traits in tooth cycling and thus advances our understanding of the developmental mechanism that ensures lifelong replacement.
Vandenplas, Sam; Willems, Maxime; Witten, P. Eckhard; Hansen, Tom; Fjelldal, Per Gunnar; Huysseune, Ann
2016-01-01
The Atlantic salmon (Salmo salar) and African bichir (Polypterus senegalus) are both actinopterygian fish species that continuously replace their teeth without the involvement of a successional dental lamina. Instead, they share the presence of a middle dental epithelium: an epithelial tier enclosed by inner and outer dental epithelium. It has been hypothesized that this tier could functionally substitute for a successional dental lamina and might be a potential niche to house epithelial stem cells involved in tooth cycling. Therefore, in this study we performed a BrdU pulse chase experiment on both species to (1) determine the localization and extent of proliferating cells in the dental epithelial layers, (2) describe cell dynamics and (3) investigate if label-retaining cells are present, suggestive for the putative presence of stem cells. Cells proliferate in the middle dental epithelium, outer dental epithelium and cervical loop at the lingual side of the dental organ to form a new tooth germ. Using long chase times, both in S. salar (eight weeks) and P. senegalus (eight weeks and twelve weeks), we could not reveal the presence of label-retaining cells in the dental organ. Immunostaining of P. senegalus dental organs for the transcription factor Sox2, often used as a stem cell marker, labelled cells in the zone of outer dental epithelium which grades into the oral epithelium (ODE transition zone) and the inner dental epithelium of a successor only. The location of Sox2 distribution does not provide evidence for epithelial stem cells in the dental organ and, more specifically, in the middle dental epithelium. Comparison of S. salar and P. senegalus reveals shared traits in tooth cycling and thus advances our understanding of the developmental mechanism that ensures lifelong replacement. PMID:27049953
Glycogen synthase kinase-3 enhances nuclear export of a Dictyostelium STAT protein
Ginger, Rebecca S.; Dalton, Emma C.; Ryves, W.Jonathan; Fukuzawa, Masashi; Williams, Jeffrey G.; Harwood, Adrian J.
2000-01-01
Extracellular cAMP stimulates the rapid tyrosine phosphorylation and nuclear translocation of the Dictyostelium STAT protein Dd-STATa. Here we show that it also induces serine phosphorylation by GskA, a homologue of glycogen synthase kinase-3 (GSK-3). Tyrosine phosphorylation occurs within 10 s of stimulation, whereas serine phosphorylation takes 5 min, matching the kinetics observed for the cAMP regulation of GskA. Phosphorylation by GskA enhances nuclear export of Dd-STATa. The phosphorylated region, however, is not itself a nuclear export signal and we identify a region elsewhere in the protein that mediates nuclear export. These results suggest a biphasic regulation of Dd-STATa, in which extracellular cAMP initially directs nuclear import and then, via GskA, promotes its subsequent export. It also raises the possibility of an analogous regulation of STAT nuclear export in higher eukaryotes. PMID:11032815
Strahan, J Alex; Walker, William H; Montgomery, Taylor R; Forger, Nancy G
2017-06-01
Minocycline, an antibiotic of the tetracycline family, inhibits microglia in many paradigms and is among the most commonly used tools for examining the role of microglia in physiological processes. Microglia may play an active role in triggering developmental neuronal cell death, although findings have been contradictory. To determine whether microglia influence developmental cell death, we treated perinatal mice with minocycline (45 mg/kg) and quantified effects on dying cells and microglial labeling using immunohistochemistry for activated caspase-3 (AC3) and ionized calcium-binding adapter molecule 1 (Iba1), respectively. Contrary to our expectations, minocycline treatment from embryonic day 18 to postnatal day (P)1 caused a > tenfold increase in cell death 8 h after the last injection in all brain regions examined, including the primary sensory cortex, septum, hippocampus and hypothalamus. Iba1 labeling was also increased in most regions. Similar effects, although of smaller magnitude, were seen when treatment was delayed to P3-P5. Minocycline treatment from P3 to P5 also decreased overall cell number in the septum at weaning, suggesting lasting effects of the neonatal exposure. When administered at lower doses (4.5 or 22.5 mg/kg), or at the same dose 1 week later (P10-P12), minocycline no longer increased microglial markers or cell death. Taken together, the most commonly used microglial "inhibitor" increases cell death and Iba1 labeling in the neonatal mouse brain. Minocycline is used clinically in infant and pediatric populations; caution is warrented when using minocycline in developing animals, or extrapolating the effects of this drug across ages. © 2016 Wiley Periodicals, Inc. Develop Neurobiol 77: 753-766, 2017. © 2016 Wiley Periodicals, Inc.
Megger, Dominik A; Pott, Leona L; Rosowski, Kristin; Zülch, Birgit; Tautges, Stephanie; Bracht, Thilo; Sitek, Barbara
2017-01-01
Tandem mass tags (TMT) are usually introduced at the levels of isolated proteins or peptides. Here, for the first time, we report the labeling of whole cells and a critical evaluation of its performance in comparison to conventional labeling approaches. The obtained results indicated that TMT protein labeling using intact cells is generally possible, if it is coupled to a subsequent enrichment using anti-TMT antibody. The quantitative results were similar to those obtained after labeling of isolated proteins and both were found to be slightly complementary to peptide labeling. Furthermore, when using NHS-based TMT, no specificity towards cell surface proteins was observed in the case of cell labeling. In summary, the conducted study revealed first evidence for the general possibility of TMT cell labeling and highlighted limitations of NHS-based labeling reagents. Future studies should therefore focus on the synthesis and investigation of membrane impermeable TMTs to increase specificity towards cell surface proteins.
Mi, Yuanyuan; Sun, Chuanyu; Wei, Bingbing; Sun, Feiyu; Guo, Yijun; Hu, Qingfeng; Ding, Weihong; Zhu, Lijie; Xia, Guowei
2018-01-01
Label-free quantitative proteomics has broad applications in the identification of differentially expressed proteins. Here, we applied this method to identify differentially expressed proteins (such as coatomer subunit beta 2 [COPB2]) and evaluated the functions and molecular mechanisms of these proteins in prostate cancer (PCA) cell proliferation. Proteins extracted from surgically resected PCA tissues and adjacent tissues of 3 patients were analyzed by label-free quantitative proteomics. The target protein was confirmed by bioinformatics and GEO dataset analyses. To investigate the role of the target protein in PCA, we used lentivirus-mediated small-interfering RNA (siRNA) to knockdown protein expression in the prostate carcinoma cell line, CWR22RV1 cells and assessed gene and protein expression by reverse transcription quantitative polymerase chain reaction and western blotting. CCK8 and colony formation assays were conducted to evaluate cell proliferation. Cell cycle distributions and apoptosis were assayed by flow cytometry. We selected the differentiation-related protein COPB2 as our target protein based on the results of label-free quantitative proteomics. High expression of COPB2 was found in PCA tissue and was related to poor overall survival based on a public dataset. Cell proliferation was significantly inhibited in COPB2-knockdown CWR22RV1 cells, as demonstrated by CCK8 and colony formation assays. Additionally, the apoptosis rate and percentage of cells in the G 1 phase were increased in COPB2-knockdown cells compared with those in control cells. CDK2, CDK4, and cyclin D1 were downregulated, whereas p21 Waf1/Cip1 and p27 Kip1 were upregulated, affecting the cell cycle signaling pathway. COPB2 significantly promoted CWR22RV1 cell proliferation through the cell cycle signaling pathway. Thus, silencing of COPB2 may have therapeutic applications in PCA. Copyright © 2017 Elsevier Inc. All rights reserved.
[Visualization and Functional Regulation of Live Cell Proteins Based on Labeling Probe Design].
Mizukami, Shin; Kikuchi, Kazuya
2016-01-01
There are several approaches to understanding the physiological roles of biomolecules: (1) by observing the localization or activities of biomolecules (based on microscopic imaging experiments with fluorescent proteins or fluorescent probes) and (2) by investigating the cellular response via activation or suppression of functions of the target molecule (by using inhibitors, antagonists, siRNAs, etc.). In this context, protein-labeling technology serves as a powerful tool that can be used in various experiments, such as for fluorescence imaging of target proteins. Recently, we developed a protein-labeling technology that uses a mutant β-lactamase (a bacterial hydrolase) as the tag protein. In this protein-labeling technology, also referred to as the BL-tag technology, various β-lactam compounds were used as specific ligands that were covalently labeled to the tag. One major advantage of this labeling technology is that various functions can be carried out by suitably designing both the functional moieties such as the fluorophore and the β-lactam ligand structure. In this review, we briefly introduce the BL-tag technology and describe our future outlook for this technology, such as in fluorescence imaging of biomolecules and functional regulation of cellular proteins in living cells.
NASA Astrophysics Data System (ADS)
McReynolds, Naomi; Cooke, Fiona G. M.; Chen, Mingzhou; Powis, Simon J.; Dholakia, Kishan
2017-02-01
Moving towards label-free techniques for cell identification is essential for many clinical and research applications. Raman spectroscopy and digital holographic microscopy (DHM) are both label-free, non-destructive optical techniques capable of providing complimentary information. We demonstrate a multi-modal system which may simultaneously take Raman spectra and DHM images to provide both a molecular and a morphological description of our sample. In this study we use Raman spectroscopy and DHM to discriminate between three immune cell populations CD4+ T cells, B cells, and monocytes, which together comprise key functional immune cell subsets in immune responses to invading pathogens. Various parameters that may be used to describe the phase images are also examined such as pixel value histograms or texture analysis. Using our system it is possible to consider each technique individually or in combination. Principal component analysis is used on the data set to discriminate between cell types and leave-one-out cross-validation is used to estimate the efficiency of our method. Raman spectroscopy provides specific chemical information but requires relatively long acquisition times, combining this with a faster modality such as DHM could help achieve faster throughput rates. The combination of these two complimentary optical techniques provides a wealth of information for cell characterisation which is a step towards achieving label free technology for the identification of human immune cells.
Roeder, Emilie; Henrionnet, Christel; Goebel, Jean Christophe; Gambier, Nicolas; Beuf, Olivier; Grenier, Denis; Chen, Bailiang; Vuissoz, Pierre-André; Gillet, Pierre; Pinzano, Astrid
2014-01-01
The aim of this work was the development of successful cell therapy techniques for cartilage engineering. This will depend on the ability to monitor non-invasively transplanted cells, especially mesenchymal stem cells (MSCs) that are promising candidates to regenerate damaged tissues. MSCs were labeled with superparamagnetic iron oxide particles (SPIO). We examined the effects of long-term labeling, possible toxicological consequences and the possible influence of progressive concentrations of SPIO on chondrogenic differentiation capacity. No influence of various SPIO concentrations was noted on human bone marrow MSC viability or proliferation. We demonstrated long-term (4 weeks) in vitro retention of SPIO by human bone marrow MSCs seeded in collagenic sponges under TGF-β1 chondrogenic conditions, detectable by Magnetic Resonance Imaging (MRI) and histology. Chondrogenic differentiation was demonstrated by molecular and histological analysis of labeled and unlabeled cells. Chondrogenic gene expression (COL2A2, ACAN, SOX9, COL10, COMP) was significantly altered in a dose-dependent manner in labeled cells, as were GAG and type II collagen staining. As expected, SPIO induced a dramatic decrease of MRI T2 values of sponges at 7T and 3T, even at low concentrations. This study clearly demonstrates (1) long-term in vitro MSC traceability using SPIO and MRI and (2) a deleterious dose-dependence of SPIO on TGF-β1 driven chondrogenesis in collagen sponges. Low concentrations (12.5-25 µg Fe/mL) seem the best compromise to optimize both chondrogenesis and MRI labeling.
Bentzen, Amalie Kai; Marquard, Andrea Marion; Lyngaa, Rikke; Saini, Sunil Kumar; Ramskov, Sofie; Donia, Marco; Such, Lina; Furness, Andrew J S; McGranahan, Nicholas; Rosenthal, Rachel; Straten, Per Thor; Szallasi, Zoltan; Svane, Inge Marie; Swanton, Charles; Quezada, Sergio A; Jakobsen, Søren Nyboe; Eklund, Aron Charles; Hadrup, Sine Reker
2016-10-01
Identification of the peptides recognized by individual T cells is important for understanding and treating immune-related diseases. Current cytometry-based approaches are limited to the simultaneous screening of 10-100 distinct T-cell specificities in one sample. Here we use peptide-major histocompatibility complex (MHC) multimers labeled with individual DNA barcodes to screen >1,000 peptide specificities in a single sample, and detect low-frequency CD8 T cells specific for virus- or cancer-restricted antigens. When analyzing T-cell recognition of shared melanoma antigens before and after adoptive cell therapy in melanoma patients, we observe a greater number of melanoma-specific T-cell populations compared with cytometry-based approaches. Furthermore, we detect neoepitope-specific T cells in tumor-infiltrating lymphocytes and peripheral blood from patients with non-small cell lung cancer. Barcode-labeled pMHC multimers enable the combination of functional T-cell analysis with large-scale epitope recognition profiling for the characterization of T-cell recognition in various diseases, including in small clinical samples.
Probing GFP-actin diffusion in living cells using fluorescence correlation spectroscopy.
Engelke, Hanna; Heinrich, Doris; Rädler, Joachim O
2010-12-22
The cytoskeleton of eukaryotic cells is continuously remodeled by polymerization and depolymerization of actin. Consequently, the relative content of polymerized filamentous actin (F-actin) and monomeric globular actin (G-actin) is subject to temporal and spatial fluctuations. Since fluorescence correlation spectroscopy (FCS) can measure the diffusion of fluorescently labeled actin it seems likely that FCS allows us to determine the dynamics and hence indirectly the structural properties of the cytoskeleton components with high spatial resolution. To this end we investigate the FCS signal of GFP-actin in living Dictyostelium discoideum cells and explore the inherent spatial and temporal signatures of the actin cytoskeleton. Using the free green fluorescent protein (GFP) as a reference, we find that actin diffusion inside cells is dominated by G-actin and slower than diffusion in diluted cell extract. The FCS signal in the dense cortical F-actin network near the cell membrane is probed using the cytoskeleton protein LIM and is found to be slower than cytosolic G-actin diffusion. Furthermore, we show that polymerization of the cytoskeleton induced by Jasplakinolide leads to a substantial decrease of G-actin diffusion. Pronounced fluctuations in the distribution of the FCS correlation curves can be induced by latrunculin, which is known to induce actin waves. Our work suggests that the FCS signal of GFP-actin in combination with scanning or spatial correlation techniques yield valuable information about the local dynamics and concomitant cytoskeletal properties.
Whitney, T J; Gardner, D G; Mott, M L; Brandon, M
2010-03-09
The unusual life cycle of Dictyostelium discoideum, in which an extra-cellular stressor such as starvation induces the development of a multicellular fruiting body consisting of stalk cells and spores from a culture of identical amoebae, provides an excellent model for investigating the molecular control of differentiation and the transition from single- to multi-cellular life, a key transition in development. We utilized serial analysis of gene expression (SAGE), a molecular method that is unbiased by dependence on previously identified genes, to obtain a transcriptome from a high-density culture of amoebae, in order to examine the transition to multi-cellular development. The SAGE method provides relative expression levels, which allows us to rank order the expressed genes. We found that a large number of ribosomal proteins were expressed at high levels, while various components of the proteosome were expressed at low levels. The only identifiable transmembrane signaling system components expressed in amoebae are related to quorum sensing, and their expression levels were relatively low. The most highly expressed gene in the amoeba transcriptome, dutA untranslated RNA, is a molecule with unknown function that may serve as an inhibitor of translation. These results suggest that high-density amoebae have not initiated development, and they also suggest a mechanism by which the transition into the development program is controlled.
Label-free ferrohydrodynamic cell separation of circulating tumor cells.
Zhao, Wujun; Cheng, Rui; Jenkins, Brittany D; Zhu, Taotao; Okonkwo, Nneoma E; Jones, Courtney E; Davis, Melissa B; Kavuri, Sravan K; Hao, Zhonglin; Schroeder, Carsten; Mao, Leidong
2017-09-12
Circulating tumor cells (CTCs) have significant implications in both basic cancer research and clinical applications. To address the limited availability of viable CTCs for fundamental and clinical investigations, effective separation of extremely rare CTCs from blood is critical. Ferrohydrodynamic cell separation (FCS), a label-free method that conducted cell sorting based on cell size difference in biocompatible ferrofluids, has thus far not been able to enrich low-concentration CTCs from cancer patients' blood because of technical challenges associated with processing clinical samples. In this study, we demonstrated the development of a laminar-flow microfluidic FCS device that was capable of enriching rare CTCs from patients' blood in a biocompatible manner with a high throughput (6 mL h -1 ) and a high rate of recovery (92.9%). Systematic optimization of the FCS devices through a validated analytical model was performed to determine optimal magnetic field and its gradient, ferrofluid properties, and cell throughput that could process clinically relevant amount of blood. We first validated the capability of the FCS devices by successfully separating low-concentration (∼100 cells per mL) cancer cells using six cultured cell lines from undiluted white blood cells (WBCs), with an average 92.9% cancer cell recovery rate and an average 11.7% purity of separated cancer cells, at a throughput of 6 mL per hour. Specifically, at ∼100 cancer cells per mL spike ratio, the recovery rates of cancer cells were 92.3 ± 3.6% (H1299 lung cancer), 88.3 ± 5.5% (A549 lung cancer), 93.7 ± 5.5% (H3122 lung cancer), 95.3 ± 6.0% (PC-3 prostate cancer), 94.7 ± 4.0% (MCF-7 breast cancer), and 93.0 ± 5.3% (HCC1806 breast cancer), and the corresponding purities of separated cancer cells were 11.1 ± 1.2% (H1299 lung cancer), 10.1 ± 1.7% (A549 lung cancer), 12.1 ± 2.1% (H3122 lung cancer), 12.8 ± 1.6% (PC-3 prostate cancer), 11.9 ± 1.8% (MCF-7 breast cancer), and 12.2 ± 1
Kobayashi, Kazuko; Sasaki, Takanori; Takenaka, Fumiaki; Yakushiji, Hiromasa; Fujii, Yoshihiro; Kishi, Yoshiro; Kita, Shoichi; Shen, Lianhua; Kumon, Hiromi; Matsuura, Eiji
2015-01-01
Mesothelin (MSLN) is a 40-kDa cell differentiation-associated glycoprotein appearing with carcinogenesis and is highly expressed in many human cancers, including the majority of pancreatic adenocarcinomas, ovarian cancers, and mesotheliomas, while its expression in normal tissue is limited to mesothelial cells lining the pleura, pericardium, and peritoneum. Clone 11-25 is a murine hybridoma secreting monoclonal antibody (mAb) against human MSLN. In this study, we applied the 11-25 mAb to in vivo imaging to detect MSLN-expressing tumors. In in vitro and ex vivo immunochemical studies, we demonstrated specificity of 11-25 mAb to membranous MSLN expressed on several pancreatic cancer cells. We showed the accumulation of Alexa Fluor 750-labeled 11-25 mAb in MSLN-expressing tumor xenografts in athymic nude mice. Then, 11-25 mAb was labeled with 64Cu via a chelating agent DOTA and was used in both in vitro cell binding assay and in vivo positron emission tomography (PET) imaging in the tumor-bearing mice. We confirmed that 64Cu-labeled 11-25 mAb highly accumulated in MSLN-expressing tumors as compared to MSLN-negative ones. The 64Cu-labeled 11-25 mAb is potentially useful as a PET probe capable of being used for wide range of tumors, rather than 18F-FDG that occasionally provides nonspecific accumulation into the inflammatory lesions. PMID:25883990
Nelson, G N; Roh, J D; Mirensky, T L; Wang, Y; Yi, T; Tellides, G; Pober, J S; Shkarin, P; Shapiro, E M; Saltzman, W M; Papademetris, X; Fahmy, T M; Breuer, C K
2008-11-01
This pilot study examines noninvasive MR monitoring of tissue-engineered vascular grafts (TEVGs) in vivo using cells labeled with iron oxide nanoparticles. Human aortic smooth muscle cells (hASMCs) were labeled with ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles. The labeled hASMCs, along with human aortic endothelial cells, were incorporated into eight TEVGs and were then surgically implanted as aortic interposition grafts in a C.B-17 SCID/bg mouse host. USPIO-labeled hASMCs persisted in the grafts throughout a 3 wk observation period and allowed noninvasive MR imaging of the human TEVGs for real-time, serial monitoring of hASMC retention. This study demonstrates the feasibility of applying noninvasive imaging techniques for evaluation of in vivo TEVG performance.
A new metabolic cell wall labeling method reveals peptidoglycan in Chlamydia trachomatis
Liechti, G.; Kuru, E.; Hall, E.; Kalinda, A.; Brun, Y. V.; VanNieuwenhze, M.; Maurelli, A. T.
2014-01-01
Peptidoglycan (PG), an essential structure in the cell walls of the vast majority of bacteria, is critical for division and maintaining cell shape and hydrostatic pressure1. Bacteria comprising the Chlamydiales were thought to be one of the few exceptions. Chlamydia encodes genes for PG biosynthesis2–7 and exhibits susceptibility to "anti-PG" antibiotics8,9, yet attempts to detect PG in any chlamydial species have proven unsuccessful (the ‘chlamydial anomaly’10). We employed a novel approach to metabolically label chlamydial PG using D-amino acid dipeptide probes and click chemistry. Replicating Chlamydia trachomatis was labeled with the probes throughout its biphasic, developmental life cycle, and differential probe incorporation experiments conducted in the presence of ampicillin is consistent with the presence of chlamydial PG modifying enzymes. These findings culminate 50 years of speculation and debate concerning the chlamydial anomaly and are the strongest evidence to date that chlamydial species possess functional PG. PMID:24336210
Gold nanoparticle-cell labeling methodology for tracking stem cells within the brain
NASA Astrophysics Data System (ADS)
Betzer, Oshra; Meir, Rinat; Motiei, Menachem; Yadid, Gal; Popovtzer, Rachela
2017-02-01
Cell therapy provides a promising approach for diseases and injuries that conventional therapies cannot cure effectively. Mesenchymal stem cells (MSCs) can be used as effective targeted therapy, as they exhibit homing capabilities to sites of injury and inflammation, exert anti-inflammatory effects, and can differentiate in order to regenerate damaged tissue. Despite the potential efficacy of cell therapy, applying cell-based therapy in clinical practice is very challenging; there is a need to uncover the mystery regarding the fate of the transplanted cells. Therefore, in this study, we developed a method for longitudinal and quantitative in vivo cell tracking, based on the superior visualization abilities of classical X-ray computed tomography (CT), and combined with gold nanoparticles as labeling agents. We applied this technique for non-invasive imaging of MSCs transplanted in a rat model for depression, a highly prevalent and disabling neuropsychiatric disorder lacking effective treatment. Our results, which demonstrate that cell migration could be detected as early as 24 hours and up to one month post-transplantation, revealed that MSCs specifically navigated and homed to distinct depression related brain regions. This research further reveals that cell therapy is a beneficial approach for treating neuropsychiatric disorders; Behavioral manifestations of core symptoms of depressive behavior, were significantly attenuated following treatment. We expect This CT-based technique to lead to a significant enhancement in cellular therapy both for basic research and clinical applications of brain pathologies.
Thimm, Benjamin W; Hofmann, Sandra; Schneider, Philipp; Carretta, Roberto; Müller, Ralph
2012-03-01
Computed tomography (CT) represents a truly three-dimensional (3D) imaging technique that can provide high-resolution images on the cellular level. Thus, one approach to detect single cells is X-ray absorption-based CT, where cells are labeled with a dense, opaque material providing the required contrast for CT imaging. Within the present work, a novel cell-labeling method has been developed showing the feasibility of labeling fixed cells with iron oxide (FeO) particles for subsequent CT imaging and quantitative morphometry. A biotin-streptavidin detection system was exploited to bind FeO particles to its target endothelial cells. The binding of the particles was predominantly close to the cell centers on 2D surfaces as shown by light microscopy, scanning electron microscopy, and CT. When cells were cultured on porous, 3D polyurethane surfaces, significantly more FeO particles were detected compared with surfaces without cells and FeO particle labeling using CT. Here, we report on the implementation and evaluation of a novel cell detection method based on high-resolution CT. This system has potential in cell tracking for 3D in vitro imaging in the future.
Kessels, M M; Qualmann, B; Thole, H H; Sierralta, W D
1998-01-01
Ultrastructural localization studies of estradiol receptor in hormone-deprived and hormone-stimulated MCF7 cells were done using F(ab') fragments of three different antibodies (#402, 13H2, HT277) covalently linked to nanogold. These ultra-small, non-charged immunoreagents, combined with a size-enlargement by silver enhancement, localized estradiol receptor in both nuclear and cytoplasmic areas of non-stimulated target cells; stimulation with the steroid induced a predominantly nuclear labelling. In the cytoplasm of resting cells, tagging was often observed at or in the proximity of stress fibers. In the nucleus a large proportion of receptor was found inside the nucleolus, specially with the reagent derived from antibody 13H2. We postulate that different accessibilities of receptor epitopes account for the different labelling densities observed at cytoskeletal elements and the nucleoli.
Label-free evanescent microscopy for membrane nano-tomography in living cells.
Bon, Pierre; Barroca, Thomas; Lévèque-Fort, Sandrine; Fort, Emmanuel
2014-11-01
We show that through-the-objective evanescent microscopy (epi-EM) is a powerful technique to image membranes in living cells. Readily implementable on a standard inverted microscope, this technique enables full-field and real-time tracking of membrane processes without labeling and thus signal fading. In addition, we demonstrate that the membrane/interface distance can be retrieved with 10 nm precision using a multilayer Fresnel model. We apply this nano-axial tomography of living cell membranes to retrieve quantitative information on membrane invagination dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Skopalik, Josef; Polakova, Katerina; Havrdova, Marketa; Justan, Ivan; Magro, Massimiliano; Milde, David; Knopfova, Lucia; Smarda, Jan; Polakova, Helena; Gabrielova, Eva; Vianello, Fabio; Michalek, Jaroslav; Zboril, Radek
2014-01-01
Cell therapies have emerged as a promising approach in medicine. The basis of each therapy is the injection of 1-100×10(6) cells with regenerative potential into some part of the body. Mesenchymal stromal cells (MSCs) are the most used cell type in the cell therapy nowadays, but no gold standard for the labeling of the MSCs for magnetic resonance imaging (MRI) is available yet. This work evaluates our newly synthesized uncoated superparamagnetic maghemite nanoparticles (surface-active maghemite nanoparticles - SAMNs) as an MRI contrast intracellular probe usable in a clinical 1.5 T MRI system. MSCs from rat and human donors were isolated, and then incubated at different concentrations (10-200 μg/mL) of SAMN maghemite nanoparticles for 48 hours. Viability, proliferation, and nanoparticle uptake efficiency were tested (using fluorescence microscopy, xCELLigence analysis, atomic absorption spectroscopy, and advanced microscopy techniques). Migration capacity, cluster of differentiation markers, effect of nanoparticles on long-term viability, contrast properties in MRI, and cocultivation of labeled cells with myocytes were also studied. SAMNs do not affect MSC viability if the concentration does not exceed 100 μg ferumoxide/mL, and this concentration does not alter their cell phenotype and long-term proliferation profile. After 48 hours of incubation, MSCs labeled with SAMNs show more than double the amount of iron per cell compared to Resovist-labeled cells, which correlates well with the better contrast properties of the SAMN cell sample in T2-weighted MRI. SAMN-labeled MSCs display strong adherence and excellent elasticity in a beating myocyte culture for a minimum of 7 days. Detailed in vitro tests and phantom tests on ex vivo tissue show that the new SAMNs are efficient MRI contrast agent probes with exclusive intracellular uptake and high biological safety.
Synthesis of strongly fluorescent molybdenum disulfide nanosheets for cell-targeted labeling.
Wang, Nan; Wei, Fang; Qi, Yuhang; Li, Hongxiang; Lu, Xin; Zhao, Guoqiang; Xu, Qun
2014-11-26
MoS2 nanosheets with polydispersity of the lateral dimensions from natural mineral molybdenite have been prepared in the emulsions microenvironment built by the water/surfactant/CO2 system. The size, thickness, and atomic structure are characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM), and laser-scattering particle size analysis. Meanwhile, by the analysis of photoluminescence spectroscopy and microscope, the MoS2 nanosheets with smaller lateral dimensions exhibit extraordinary photoluminescence properties different from those with relatively larger lateral dimensions. The discovery of the excitation dependent photoluminescence for MoS2 nanosheets makes them potentially of interests for the applications in optoelectronics and biology. Moreover, we demonstrate that the fabricated MoS2 nanosheets can be a nontoxic fluorescent label for cell-targeted labeling application.
Xiao, Kunyi; Liu, Juan; Chen, Hui; Zhang, Song; Kong, Jilie
2017-05-15
A label-free and high-efficient graphene oxide (GO)-based aptasensor was developed for the detection of low quantity cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and dye-labeled linker DNAs stably coexisted in solution, and the fluorescence was quenched by the GO-based FÖrster resonance energy transfer (FRET) process. In the presence of target cells, the specific binding of HAPs with the target cells triggered a conformational alternation, which resulted in linker DNA complementary pairing and cleavage by nicking endonuclease-strand scission cycles. Consequently, more cleaved fragments of linker DNAs with more the terminal labeled dyes could show the enhanced fluorescence because these cleaved DNA fragments hardly combine with GOs and prevent the FRET process. Fluorescence analysis demonstrated that this GO-based aptasensor exhibited selective and sensitive response to the presence of target CCRF-CEM cells in the concentration range from 50 to 10 5 cells. The detection limit of this method was 25 cells, which was approximately 20 times lower than the detection limit of normal fluorescence aptasensors without amplification. With high sensitivity and specificity, it provided a simple and cost-effective approach for early cancer diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Teston, Eliott; Maldiney, Thomas; Marangon, Iris; Volatron, Jeanne; Lalatonne, Yoann; Motte, Laurence; Boisson-Vidal, Catherine; Autret, Gwennhael; Clément, Olivier; Scherman, Daniel; Gazeau, Florence; Richard, Cyrille
2018-04-01
Once injected into a living organism, cells diffuse or migrate around the initial injection point and become impossible to be visualized and tracked in vivo. The present work concerns the development of a new technique for therapeutic cell labeling and subsequent in vivo visualization and magnetic retention. It is hypothesized and subsequently demonstrated that nanohybrids made of persistent luminescence nanoparticles and ultrasmall superparamagnetic iron oxide nanoparticles incorporated into a silica matrix can be used as an effective nanoplatform to label therapeutic cells in a nontoxic way in order to dynamically track them in real-time in vitro and in living mice. As a proof-of-concept, it is shown that once injected, these labeled cells can be visualized and attracted in vivo using a magnet. This first step suggests that these nanohybrids represent efficient multifunctional nanoprobes for further imaging guided cell therapies development. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Marcoleta, Andrés E.; Varas, Macarena A.; Ortiz-Severín, Javiera; Vásquez, Leonardo; Berríos-Pastén, Camilo; Sabag, Andrea V.; Chávez, Francisco P.; Allende, Miguel L.; Santiviago, Carlos A.; Monasterio, Octavio; Lagos, Rosalba
2018-01-01
Multiresistant and invasive hypervirulent Klebsiella pneumoniae strains have become one of the most urgent bacterial pathogen threats. Recent analyses revealed a high genomic plasticity of this species, harboring a variety of mobile genetic elements associated with virulent strains, encoding proteins of unknown function whose possible role in pathogenesis have not been addressed. K. pneumoniae virulence has been studied mainly in animal models such as mice and pigs, however, practical, financial, ethical and methodological issues limit the use of mammal hosts. Consequently, the development of simple and cost-effective experimental approaches with alternative host models is needed. In this work we described the use of both, the social amoeba and professional phagocyte Dictyostelium discoideum and the fish Danio rerio (zebrafish) as surrogate host models to study K. pneumoniae virulence. We compared three K. pneumoniae clinical isolates evaluating their resistance to phagocytosis, intracellular survival, lethality, intestinal colonization, and innate immune cells recruitment. Optical transparency of both host models permitted studying the infective process in vivo, following the Klebsiella-host interactions through live-cell imaging. We demonstrated that K. pneumoniae RYC492, but not the multiresistant strains 700603 and BAA-1705, is virulent to both host models and elicits a strong immune response. Moreover, this strain showed a high resistance to phagocytosis by D. discoideum, an increased ability to form biofilms and a more prominent and irregular capsule. Besides, the strain 700603 showed the unique ability to replicate inside amoeba cells. Genomic comparison of the K. pneumoniae strains showed that the RYC492 strain has a higher overall content of virulence factors although no specific genes could be linked to its phagocytosis resistance, nor to the intracellular survival observed for the 700603 strain. Our results indicate that both zebrafish and D. discoideum
A recombinant fungal lectin for labeling truncated glycans on human cancer cells.
Audfray, Aymeric; Beldjoudi, Mona; Breiman, Adrien; Hurbin, Amandine; Boos, Irene; Unverzagt, Carlo; Bouras, Mourad; Lantuejoul, Sylvie; Coll, Jean-Luc; Varrot, Annabelle; Le Pendu, Jacques; Busser, Benoit; Imberty, Anne
2015-01-01
Cell surface glycoconjugates present alterations of their structures in chronic diseases and distinct oligosaccharide epitopes have been associated with cancer. Among them, truncated glycans present terminal non-reducing β-N-acetylglucosamine (GlcNAc) residues that are rare on healthy tissues. Lectins from unconventional sources such as fungi or algi provide novel markers that bind specifically to such epitopes, but their availability may be challenging. A GlcNAc-binding lectin from the fruiting body of the fungus Psathyrella velutina (PVL) has been produced in good yield in bacterial culture. A strong specificity for terminal GlcNAc residues was evidenced by glycan array. Affinity values obtained by microcalorimetry and surface plasmon resonance demonstrated a micromolar affinity for GlcNAcβ1-3Gal epitopes and for biantennary N-glycans with GlcNAcβ1-2Man capped branches. Crystal structure of PVL complexed with GlcNAcβ1-3Gal established the structural basis of the specificity. Labeling of several types of cancer cells and use of inhibitors of glycan metabolism indicated that rPVL binds to terminal GlcNAc but also to sialic acid (Neu5Ac). Analysis of glycosyltransferase expression confirmed the higher amount of GlcNAc present on cancer cells. rPVL binding is specific to cancer tissue and weak or no labeling is observed for healthy ones, except for stomach glands that present unique αGlcNAc-presenting mucins. In lung, breast and colon carcinomas, a clear delineation could be observed between cancer regions and surrounding healthy tissues. PVL is therefore a useful tool for labeling agalacto-glycans in cancer or other diseases.
A Recombinant Fungal Lectin for Labeling Truncated Glycans on Human Cancer Cells
Hurbin, Amandine; Boos, Irene; Unverzagt, Carlo; Bouras, Mourad; Lantuejoul, Sylvie; Coll, Jean-Luc; Varrot, Annabelle; Le Pendu, Jacques; Busser, Benoit; Imberty, Anne
2015-01-01
Cell surface glycoconjugates present alterations of their structures in chronic diseases and distinct oligosaccharide epitopes have been associated with cancer. Among them, truncated glycans present terminal non-reducing β-N-acetylglucosamine (GlcNAc) residues that are rare on healthy tissues. Lectins from unconventional sources such as fungi or algi provide novel markers that bind specifically to such epitopes, but their availability may be challenging. A GlcNAc-binding lectin from the fruiting body of the fungus Psathyrella velutina (PVL) has been produced in good yield in bacterial culture. A strong specificity for terminal GlcNAc residues was evidenced by glycan array. Affinity values obtained by microcalorimetry and surface plasmon resonance demonstrated a micromolar affinity for GlcNAcβ1-3Gal epitopes and for biantennary N-glycans with GlcNAcβ1-2Man capped branches. Crystal structure of PVL complexed with GlcNAcβ1-3Gal established the structural basis of the specificity. Labeling of several types of cancer cells and use of inhibitors of glycan metabolism indicated that rPVL binds to terminal GlcNAc but also to sialic acid (Neu5Ac). Analysis of glycosyltransferase expression confirmed the higher amount of GlcNAc present on cancer cells. rPVL binding is specific to cancer tissue and weak or no labeling is observed for healthy ones, except for stomach glands that present unique αGlcNAc-presenting mucins. In lung, breast and colon carcinomas, a clear delineation could be observed between cancer regions and surrounding healthy tissues. PVL is therefore a useful tool for labeling agalacto-glycans in cancer or other diseases. PMID:26042789
Runck, Laura A; Kramer, Megan; Ciraolo, Georgianne; Lewis, Alfor G
2010-01-01
In certain regions of the body, transition zones exist where stratified squamous epithelia directly abut against other types of epithelia. Certain transition zones are especially prone to tumorigenesis an example being the anorectal junction, although the reason for this is not known. One possibility is that the abrupt transition of the simple columnar epithelium of the colon to the stratified squamous epithelium of the proximal portion of the anal canal may contain a unique stem cell niche. We investigated whether the anorectal region contained cells with stem cell properties relative to the adjacent epithelium. We utilized a tetracycline-regulatable histone H2B-GFP transgenic mice model, previously used to identify hair follicle stem cells, to fluorescently label slow-cycling anal epithelial cells (e.g., prospective stem cells) in combination with a panel of putative stem cell markers. We identified a population of long-term GFP label-retaining cells concentrated at the junction between the anal canal and the rectum. These cells are BrdU-retaining cells and expressed the stem cell marker CD34. Moreover, tracking the fate of the anal label-retaining cells in vivo revealed that the slow-cycling cells only gave rise to progeny of the anal epithelium. In conclusion, we identified a unique population of cells at the anorectal junction which can be separated from the other basal anal epithelial cells based upon the expression of the stem cell marker CD34 and integrin α6, and thus represent a putative anal stem cell population. PMID:20647777
Lee, Myung Gwon; Shin, Joong Ho; Bae, Chae Yun; Choi, Sungyoung; Park, Je-Kyun
2013-07-02
We report a contraction-expansion array (CEA) microchannel device that performs label-free high-throughput separation of cancer cells from whole blood at low Reynolds number (Re). The CEA microfluidic device utilizes hydrodynamic field effect for cancer cell separation, two kinds of inertial effects: (1) inertial lift force and (2) Dean flow, which results in label-free size-based separation with high throughput. To avoid cell damages potentially caused by high shear stress in conventional inertial separation techniques, the CEA microfluidic device isolates the cells with low operational Re, maintaining high-throughput separation, using nondiluted whole blood samples (hematocrit ~45%). We characterized inertial particle migration and investigated the migration of blood cells and various cancer cells (MCF-7, SK-BR-3, and HCC70) in the CEA microchannel. The separation of cancer cells from whole blood was demonstrated with a cancer cell recovery rate of 99.1%, a blood cell rejection ratio of 88.9%, and a throughput of 1.1 × 10(8) cells/min. In addition, the blood cell rejection ratio was further improved to 97.3% by a two-step filtration process with two devices connected in series.
Chronology of Islet Differentiation Revealed By Temporal Cell Labeling
Miyatsuka, Takeshi; Li, Zhongmei; German, Michael S.
2009-01-01
OBJECTIVE Neurogenin 3 plays a pivotal role in pancreatic endocrine differentiation. Whereas mouse models expressing reporters such as eGFP or LacZ under the control of the Neurog3 gene enable us to label cells in the pancreatic endocrine lineage, the long half-life of most reporter proteins makes it difficult to distinguish cells actively expressing neurogenin 3 from differentiated cells that have stopped transcribing the gene. RESEARCH DESIGN AND METHODS In order to separate the transient neurogenin 3 –expressing endocrine progenitor cells from the differentiating endocrine cells, we developed a mouse model (Ngn3-Timer) in which DsRed-E5, a fluorescent protein that shifts its emission spectrum from green to red over time, was expressed transgenically from the NEUROG3 locus. RESULTS In the Ngn3-Timer embryos, green-dominant cells could be readily detected by microscopy or flow cytometry and distinguished from green/red double-positive cells. When fluorescent cells were sorted into three different populations by a fluorescence-activated cell sorter, placed in culture, and then reanalyzed by flow cytometry, green-dominant cells converted to green/red double-positive cells within 6 h. The sorted cell populations were then used to determine the temporal patterns of expression for 145 transcriptional regulators in the developing pancreas. CONCLUSIONS The precise temporal resolution of this model defines the narrow window of neurogenin 3 expression in islet progenitor cells and permits sequential analyses of sorted cells as well as the testing of gene regulatory models for the differentiation of pancreatic islet cells. PMID:19478145
NASA Astrophysics Data System (ADS)
Lugongolo, Masixole Yvonne; Ombinda-Lemboumba, Saturnin; Noto, Luyanda Lunga; Maaza, Malik; Mthunzi-Kufa, Patience
2018-02-01
The human immunodeficiency virus-1 (HIV-1) is currently detected using conventional qualitative and quantitative tests to determine the presence or absence of HIV in blood samples. However, the approach of these tests detects the presence of either viral antibodies or viral RNA that require labelling which may be costly, sophisticated and time consuming. A label-free approach of detecting the presence of HIV is therefore desirable. Of note optical tweezers can be coupled with other technologies including spectroscopy, which also investigates light-matter interactions. For example, coupling of optical tweezers with luminescence spectroscopy techniques has emerged as a powerful tool in biology for micro-manipulation, detection and analysis of individual cells. Integration of optical techniques has enabled studying biological particles in a label-free manner, whilst detecting functional groups and other essential molecules within mixed populations of cells. In the current study, an optical trapping system coupled to luminescence spectroscopy was utilised to detect the presence of HIV infection in TZM-bl cells in vitro. This was performed by infecting TZM-bl cells with the ZM53 HIV-1 pseudovirus, and incubating them for 48 hours prior analysis. The differences between infected and uninfected cells were thereafter displayed as shown by the spectrographs obtained. Combination of these two techniques has a potential in the field of infectious disease diagnostics.
Mobile Application for Pesticide Label Matching
The label matching application will give inspectors the ability to instantly compare pesticide product labels against state and federal label databases via their cell phone, tablet or other mobile device.
Freeze, H H; Koza-Taylor, P; Saunders, A; Cardelli, J A
1989-11-15
We have examined the relationship of N-linked oligosaccharide structures to the proper targeting and proteolytic processing of two lysosomal enzymes, alpha-mannosidase and beta-glucosidase, in the slime mold Dictyostelium discoideum. Two different mutant strains, HL241 and HL243, each synthesize the same nonglucosylated, truncated, lipid-linked oligosaccharide precursor, Man6GlcNAc2. [3H]Mannose-labeled N-linked oligosaccharides were studied following their release from immunoprecipitated alpha-mannosidase and beta-glucosidase by digestion with peptide:N-glycosidase F. The oligosaccharides from both mutants resembled each other, but they were smaller and contained fewer anionic groups than those from the wild-type. The oligosaccharides from the mutants strains were reduced in sulfate and Man-6-P content, and all Man-6-P was in the form of acid-stable phosphodiesters. Pulse-chase radiolabeling experiments using [35S] methionine indicated that the precursor forms of both enzymes were smaller than wild-type, and that this difference was due solely to differences in N-linked oligosaccharides. The precursor forms of the enzymes were not over-secreted, but appeared to be proteolytically processed into mature forms at approximately 50% the rate of wild-type. This is mainly due to their prolonged retention in the rough endoplasmic reticulum, but, ultimately, both enzymes were properly targeted to lysosomes. These studies indicate that a reduction in the amount of sulfation, phosphorylation or size of the N-linked oligosaccharides in these mutants is not critical for the proteolytic processing and targeting of the lysosomal enzymes, but that these changes may influence their rate of exit from the rough endoplasmic reticulum.
Park, Seong-Jun; Kwak, Min-Kyu; Kang, Sa-Ouk
2017-05-01
Polyamines protect protein glycation in cells against the advanced glycation end product precursor methylglyoxal, which is inevitably produced during glycolysis, and the enzymes that detoxify this α-ketoaldehyde have been widely studied. Nonetheless, nonenzymatic methylglyoxal-scavenging molecules have not been sufficiently studied either in vitro or in vivo. Here, we hypothesized reciprocal regulation between polyamines and methylglyoxal modeled in Dictyostelium grown in a high-glucose medium. We based our hypothesis on the reaction between putrescine and methylglyoxal in putrescine-deficient (odc - ) or putrescine-overexpressing (odc oe ) cells. In these strains, growth and cell cycle were found to be dependent on cellular methylglyoxal and putrescine contents. The odc - cells showed growth defects and underwent G1 phase cell cycle arrest, which was efficiently reversed by exogenous putrescine. Cellular methylglyoxal, reactive oxygen species (ROS), and glutathione levels were remarkably changed in odc oe cells and odc̄ cells. These results revealed that putrescine may act as an intracellular scavenger of methylglyoxal and ROS. Herein, we observed interactions of putrescine and methylglyoxal via formation of a Schiff base complex, by UV-vis spectroscopy, and confirmed this adduct by liquid chromatography with mass spectrometry via electrospray ionization. Schiff bases were isolated, analyzed, and predicted to have molecular masses ranging from 124 to 130. We showed that cellular putrescine-methylglyoxal Schiff bases were downregulated in proportion to the levels of endogenous or exogenous putrescine and glutathione in the odc mutants. The putrescine-methylglyoxal Schiff base affected endogenous metabolite levels. This is the first report showing that cellular methylglyoxal functions as a signaling molecule through reciprocal interactions with polyamines by forming Schiff bases. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Riba, J.; Gleichmann, T.; Zimmermann, S.; Zengerle, R.; Koltay, P.
2016-09-01
The isolation and analysis of single prokaryotic cells down to 1 μm and less in size poses a special challenge and requires micro-engineered devices to handle volumes in the picoliter to nanoliter range. Here, an advanced Single-Cell Printer (SCP) was applied for automated and label-free isolation and deposition of bacterial cells encapsulated in 35 pl droplets by inkjet-like printing. To achieve this, dispenser chips to generate micro droplets have been fabricated with nozzles 20 μm in size. Further, the magnification of the optical system used for cell detection was increased. Redesign of the optical path allows for collision-free addressing of any flat substrate since no compartment protrudes below the nozzle of the dispenser chip anymore. The improved system allows for deterministic isolation of individual bacterial cells. A single-cell printing efficiency of 93% was obtained as shown by printing fluorescent labeled E. coli. A 96-well plate filled with growth medium is inoculated with single bacteria cells on average within about 8 min. Finally, individual bacterial cells from a heterogeneous sample of E. coli and E. faecalis were isolated for clonal culturing directly on agar plates in user-defined array geometry.
Enhanced detection of fluorescence quenching in labeled cells
Crissman, H.A.; Steinkamp, J.A.
1987-11-30
A method is provided for quantifying BrdU labeled DNA in cells. The BrdU is substituted onto the DNA and the DNA is stained with a first fluorochrome having a fluorescence which is quenchable by BrdU. The first fluorochrome is preferably a thymidine base halogen analogue, such as a Hoechst fluorochrome. The DNA is then stained with a second fluorochrome having a fluorescence which is substantially uneffected by BrdU. The second fluorochrome may be selected from the group consisting of mithramycin, chromomycin A3, olivomycin, propidium iodide and ethidium bromine. The fluorescence from the first and second fluorochromes is then measured to obtain first and second output signals, respectively. The first output signal is subtracted from the second output signal to obtain a difference signal which is functionally related to the quantity of BrdU incorporated into DNA. The technique is particularly useful for quantifying the synthesis of DNA during the S-phase of the cell cycle. 2 figs.
Enhanced detection of fluorescence quenching in labeled cells
Crissman, Harry A.; Steinkamp, John A.
1992-01-01
A method is provided for quantifying BrdU labeled DNA in cells. The BrdU is incorporated into the DNA and the DNA is stained with a first fluorochrome having a fluorescence which is quenchable by BrdU. The first fluorochrome is preferably a thymidine base halogen analogue, such as a Hoechst fluorochrome. The DNA is then stained with a second fluorochrome having a fluorescence that is substantially uneffected by BrdU. The second fluorochrome may be selected from the group consisting of mithramycin, chromomycin A3, olivomycin, propidium iodide and ethidium bromine. The fluorescence from the first and second fluorochromes is then measured to obtain first and second output signals, respectively. The first output signal is substracted from the second output signal to obtain a difference signal which is functionally related to the quantity of BrdU incorporated into DNA. The technique is particularly useful for quantifying the synthesis of DNA during the S-phase of the cell cycle.
Xu, Ruqiang; El-Hage, Nazira; Dever, Seth M
2015-11-01
HIV penetrates the central nervous system (CNS), and although it is clear that microglia and to a lesser extent astrocytes are infected, whether certain other cell types such as neurons are infected remains unclear. Here, we confirmed the finding that RNAs of both cellular and viral origins are present in native HIV-1 particles and exploited this phenomenon to directly examine HIV-1 infectivity of CNS cell types. Using in vitro transcribed mRNAs that were labeled with a fluorescent dye, we showed that these fluorescent mRNAs were packaged into HIV-1 particles by directly examining infected cells using fluorescence microscopy. Cells in culture infected with these labeled virions showed the fluorescent signals of mRNA labels by a distinct pattern of punctate, focal signals within the cells which was used to demonstrate that the CXCR4-tropic NL4-3 strain was able to enter microglia and to a lesser extent astrocytes, but not neurons. The strategy used in the present study may represent a novel approach of simplicity, robustness and reliability for versatile applications in HIV studies, such as the determination of infectivity across a broad range of cell types and within sub-populations of an individual cell type by direct visualization of viral entry into cells. Copyright © 2015 Elsevier B.V. All rights reserved.
Label-free high-throughput imaging flow cytometry
NASA Astrophysics Data System (ADS)
Mahjoubfar, A.; Chen, C.; Niazi, K. R.; Rabizadeh, S.; Jalali, B.
2014-03-01
Flow cytometry is an optical method for studying cells based on their individual physical and chemical characteristics. It is widely used in clinical diagnosis, medical research, and biotechnology for analysis of blood cells and other cells in suspension. Conventional flow cytometers aim a laser beam at a stream of cells and measure the elastic scattering of light at forward and side angles. They also perform single-point measurements of fluorescent emissions from labeled cells. However, many reagents used in cell labeling reduce cellular viability or change the behavior of the target cells through the activation of undesired cellular processes or inhibition of normal cellular activity. Therefore, labeled cells are not completely representative of their unaltered form nor are they fully reliable for downstream studies. To remove the requirement of cell labeling in flow cytometry, while still meeting the classification sensitivity and specificity goals, measurement of additional biophysical parameters is essential. Here, we introduce an interferometric imaging flow cytometer based on the world's fastest continuous-time camera. Our system simultaneously measures cellular size, scattering, and protein concentration as supplementary biophysical parameters for label-free cell classification. It exploits the wide bandwidth of ultrafast laser pulses to perform blur-free quantitative phase and intensity imaging at flow speeds as high as 10 meters per second and achieves nanometer-scale optical path length resolution for precise measurements of cellular protein concentration.
Autophagy contributes to degradation of Hirano bodies
Kim, Dong-Hwan; Davis, Richard C.; Furukawa, Ruth; Fechheimer, Marcus
2009-01-01
Hirano bodies are actin-rich inclusions reported most frequently in the hippocampus in association with a variety of conditions including neurodegenerative diseases and aging. We have developed a model system for formation of Hirano bodies in Dictyostelium and cultured mammalian cells to permit detailed studies of the dynamics of these structures in living cells. Model Hirano bodies are frequently observed in membrane-enclosed vesicles in mammalian cells consistent with a role of autophagy in the degradation of these structures. Clearance of Hirano bodies by an exocytotic process is supported by images from electron microscopy showing extracellular release of Hirano bodies, and observation of Hirano bodies in the culture medium of Dictyostelium and mammalian cells. An autophagosome marker protein Atg8-GFP was colocalized with model Hirano bodies in wild-type Dictyostelium cells, but not in atg5- or atg1-1 autophagy mutant strains. Induction of model Hirano bodies in Dictyostelium with a high-level expression of 34 kDa ΔEF1 from the inducible discoidin promoter resulted in larger Hirano bodies and a cessation of cell doubling. The degradation of model Hirano bodies still occurred rapidly in autophagy mutant (atg5-) Dictyostelium, suggesting that other mechanisms such as the ubiquitin-mediated proteasome pathway could contribute to the degradation of Hirano bodies. Chemical inhibition of the proteasome pathway with lactacystin significantly decreased the turnover of Hirano bodies in Dictyostelium, providing direct evidence that autophagy and the proteasome can both contribute to degradation of Hirano bodies. Short-term treatment of mammalian cells with either lactacystin or 3-methyl adenine results in higher levels of Hirano bodies and a lower level of viable cells in the cultures, supporting the conclusion that both autophagy and the proteasome contribute to degradation of Hirano bodies. PMID:18989098
High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells.
Lin, Eric; Rivera-Báez, Lianette; Fouladdel, Shamileh; Yoon, Hyeun Joong; Guthrie, Stephanie; Wieger, Jacob; Deol, Yadwinder; Keller, Evan; Sahai, Vaibhav; Simeone, Diane M; Burness, Monika L; Azizi, Ebrahim; Wicha, Max S; Nagrath, Sunitha
2017-09-27
We present "Labyrinth," a label-free microfluidic device to isolate circulating tumor cells (CTCs) using the combination of long loops and sharp corners to focus both CTCs and white blood cells (WBCs) at a high throughput of 2.5 mL/min. The high yield (>90%) and purity (600 WBCs/mL) of Labyrinth enabled us to profile gene expression in CTCs. As proof of principle, we used previously established cancer stem cell gene signatures to profile single cells isolated from the blood of breast cancer patients. We observed heterogeneous subpopulations of CTCs expressing genes for stem cells, epithelial cells, mesenchymal cells, and cells transitioning between epithelial and mesenchymal. Labyrinth offers a cell-surface marker-independent single-cell isolation platform to study heterogeneous CTC subpopulations. Copyright © 2017 Elsevier Inc. All rights reserved.
Muhamadali, Howbeer; Chisanga, Malama; Subaihi, Abdu; Goodacre, Royston
2015-04-21
There is no doubt that the contribution of microbially mediated bioprocesses toward maintenance of life on earth is vital. However, understanding these microbes in situ is currently a bottleneck, as most methods require culturing these microorganisms to suitable biomass levels so that their phenotype can be measured. The development of new culture-independent strategies such as stable isotope probing (SIP) coupled with molecular biology has been a breakthrough toward linking gene to function, while circumventing in vitro culturing. In this study, for the first time we have combined Raman spectroscopy and Fourier transform infrared (FT-IR) spectroscopy, as metabolic fingerprinting approaches, with SIP to demonstrate the quantitative labeling and differentiation of Escherichia coli cells. E. coli cells were grown in minimal medium with fixed final concentrations of carbon and nitrogen supply, but with different ratios and combinations of (13)C/(12)C glucose and (15)N/(14)N ammonium chloride, as the sole carbon and nitrogen sources, respectively. The cells were collected at stationary phase and examined by Raman and FT-IR spectroscopies. The multivariate analysis investigation of FT-IR and Raman data illustrated unique clustering patterns resulting from specific spectral shifts upon the incorporation of different isotopes, which were directly correlated with the ratio of the isotopically labeled content of the medium. Multivariate analysis results of single-cell Raman spectra followed the same trend, exhibiting a separation between E. coli cells labeled with different isotopes and multiple isotope levels of C and N.
Magneto-impedance based detection of magnetically labeled cancer cells and bio-proteins
NASA Astrophysics Data System (ADS)
Devkota, J.; Howell, M.; Mohapatra, S.; Nhung, T. H.; Mukherjee, P.; Srikanth, H.; Phan, M. H.
2015-03-01
A magnetic biosensor with enhanced sensitivity and immobilized magnetic markers is essential for a reliable analysis of the presence of a biological entity in a fluid. Based on conventional approaches, however, it is quite challenging to create such a sensor. We report on a novel magnetic biosensor using the magneto-impedance (MI) effect of a Co-based amorphous ribbon with a microhole-patterned surface that fulfils these requirements. The sensor probe was fabricated by patterning four microholes, each of diameter 2 μm and depth 2 μm, on the ribbon surface using FIB lithography. The magnetically labeled Luis Lung Carcinoma (LLC) cancer cells and Bovine serum albumin (BSA) proteins were drop-casted on the ribbon surface, and MI was measured over 0.1 - 10 MHz frequency range. As the analytes were trapped into the microholes, their physical motion was minimized and interaction among the magnetic fields was strengthened, thus yielding a more reliable and sensitive detection of the biological entities. The presence of magnetically labeled LLC cells (8.25x105 cells/ml, 10 μl) and BSA proteins (2x1011 particles/ml, 10 μl) were found to result in a ~ 2% change in MI with respect to the reference signal.
Tatlybaeva, Elena B; Nikiyan, Hike N; Vasilchenko, Alexey S; Deryabin, Dmitri G
2013-01-01
The labelling of functional molecules on the surface of bacterial cells is one way to recognize the bacteria. In this work, we have developed a method for the selective labelling of protein A on the cell surfaces of Staphylococcus aureus by using nanosized immunogold conjugates as cell-surface markers for atomic force microscopy (AFM). The use of 30-nm size Au nanoparticles conjugated with immunoglobulin G (IgG) allowed the visualization, localization and distribution of protein A-IgG complexes on the surface of S. aureus. The selectivity of the labelling method was confirmed in mixtures of S. aureus with Bacillus licheniformis cells, which differed by size and shape and had no IgG receptors on the surface. A preferential binding of the IgG-Au conjugates to S. aureus was obtained. Thus, this novel approach allows the identification of protein A and other IgG receptor-bearing bacteria, which is useful for AFM indication of pathogenic microorganisms in poly-component associations.
Tatlybaeva, Elena B; Vasilchenko, Alexey S; Deryabin, Dmitri G
2013-01-01
Summary The labelling of functional molecules on the surface of bacterial cells is one way to recognize the bacteria. In this work, we have developed a method for the selective labelling of protein A on the cell surfaces of Staphylococcus aureus by using nanosized immunogold conjugates as cell-surface markers for atomic force microscopy (AFM). The use of 30-nm size Au nanoparticles conjugated with immunoglobulin G (IgG) allowed the visualization, localization and distribution of protein A–IgG complexes on the surface of S. aureus. The selectivity of the labelling method was confirmed in mixtures of S. aureus with Bacillus licheniformis cells, which differed by size and shape and had no IgG receptors on the surface. A preferential binding of the IgG–Au conjugates to S. aureus was obtained. Thus, this novel approach allows the identification of protein A and other IgG receptor-bearing bacteria, which is useful for AFM indication of pathogenic microorganisms in poly-component associations. PMID:24367742
Aoshima, Ryota; Hiraoka, Rieko; Shimada, Nao; Kawata, Takefumi
2006-01-01
A Dd-STATa-null mutant, which is defective in expression of a Dictyostelium homologue of the metazoan STAT (signal transducers and activators of transcription) proteins, fails to culminate and this phenotype correlates with the loss of expression of various prestalk (pst) genes. An EST clone, SSK395, encodes a close homologue of the adducin amino-terminal head domain and harbors a putative actin-binding domain. We fused promoter fragments of the cognate gene, ahhA (adducin head homologue A), to a lacZ reporter and determined their expression pattern. The proximal promoter region is necessary for the expression of ahhA at an early (pre-aggregative) stage of development and this expression is Dd-STATa independent. The distal promoter region is necessary for expression at later stages of development in pstA cells, of the slug and in upper cup and pstAB cells during culmination. The distal region is partly Dd-STATa-dependent. The ahhA-null mutant develops almost normally until culmination, but it forms slanting culminants that tend to collapse on to the substratum. The mutant also occasionally forms fruiting bodies with swollen papillae and with constrictions in the prestalk region. The AhhA protein localizes to the stalk tube entrance and also to the upper cup cells and in cells at or near to the constricted region where an F-actin ring is localized. These findings suggest that Dd-STATa regulates culmination and may be necessary for straight downward elongation of the stalk, via the putative actin-binding protein AhhA.
Jeong, Hee-Jin; Abhiraman, Gita C.; Story, Craig M.
2017-01-01
Sortase A, a calcium-dependent transpeptidase derived from Staphylococcus aureus, is used in a broad range of applications, such as the conjugation of fluorescent dyes and other moieties to proteins or to the surface of eukaryotic cells. In vivo and cell-based applications of sortase have been somewhat limited by the large range of calcium concentrations, as well as by the often transient nature of protein-protein interactions in living systems. In order to use sortase A for cell labeling applications, we generated a new sortase A variant by combining multiple mutations to yield an enzyme that was both calcium-independent and highly active. This variant has enhanced activity for both N- and C-terminal labeling, as well as for cell surface modification under physiological conditions. PMID:29200433
Node-pore sensing enables label-free surface-marker profiling of single cells.
Balakrishnan, Karthik R; Whang, Jeremy C; Hwang, Richard; Hack, James H; Godley, Lucy A; Sohn, Lydia L
2015-03-03
Flow cytometry is a ubiquitous, multiparametric method for characterizing cellular populations. However, this method can grow increasingly complex with the number of proteins that need to be screened simultaneously: spectral emission overlap of fluorophores and the subsequent need for compensation, lengthy sample preparation, and multiple control tests that need to be performed separately must all be considered. These factors lead to increased costs, and consequently, flow cytometry is performed in core facilities with a dedicated technician operating the instrument. Here, we describe a low-cost, label-free microfluidic method that can determine the phenotypic profiles of single cells. Our method employs Node-Pore Sensing to measure the transit times of cells as they interact with a series of different antibodies, each corresponding to a specific cell-surface antigen, that have been functionalized in a single microfluidic channel. We demonstrate the capabilities of our method not only by screening two acute promyelocytic leukemia human cells lines (NB4 and AP-1060) for myeloid antigens, CD13, CD14, CD15, and CD33, simultaneously, but also by distinguishing a mixture of cells of similar size—AP-1060 and NALM-1—based on surface markers CD13 and HLA-DR. Furthermore, we show that our method can screen complex subpopulations in clinical samples: we successfully identified the blast population in primary human bone marrow samples from patients with acute myeloid leukemia and screened these cells for CD13, CD34, and HLA-DR. We show that our label-free method is an affordable, highly sensitive, and user-friendly technology that has the potential to transform cellular screening at the benchside.
Veeranarayanan, Srivani; Poulose, Aby Cheruvathoor; Mohamed, Sheikh; Aravind, Athulya; Nagaoka, Yutaka; Yoshida, Yasuhiko; Maekawa, Toru; Kumar, D Sakthi
2012-03-01
The use of fluorescent nanomaterials has gained great importance in the field of medical imaging. Many traditional imaging technologies have been reported utilizing dyes in the past. These methods face drawbacks due to non-specific accumulation and photobleaching of dyes. We studied the uptake and internalization of two different sized (30 nm and 100 nm) FITC labeled silica nanoparticles in Human umbilical vein endothelial cell line. These nanomaterials show high biocompatability and are highly photostable inside live cells for increased period of time in comparison to the dye alone. To our knowledge, we report for the first time the use of 30 nm fluorescent silica nanoparticles as efficient endothelial tags along with the well studied 100 nm particles. We also have emphasized the good photostability of these materials in live cells.
Mishra, Sushanta Kumar; Khushu, Subash; Gangenahalli, Gurudutta
2018-03-22
The use of iron oxide nanoparticles for different biomedical applications, hold immense promise to develop negative tissue contrast in magnetic resonance imaging (MRI). Previously, we have optimized the labelling of mesenchymal stem cells (MSCs) with iron oxide nanoparticles complexed to different transfection agents like poly-l-lysine (IO-PLL) and protamine sulfate (Fe-Pro) on the basis of relaxation behaviour and its biological expressions. However, there is a distinct need to investigate the biocompatibility and biosafety concerns coupled with its cytotoxicity and genotoxicity. This study was prepared to evaluate the viability of cells, generation of ROS, changes in actin cytoskeleton, investigation of cell death, level of GSH and TAC, activities of SOD and GPx, and stability of DNA in MSCs after labelling. Results demonstrated a marginal alteration in toxicological parameters like ROS generation, cell length, actin cytoskeleton, total apoptosis and DNA damage was detected after stem cell labelling. Insignificant depletion of GSH and SOD level, and increase in GPx and TAC level in MSCs were measured after labelling with IO-PLL and Fe-Pro complexes, which later on recovered and normalized to its baseline. This MSCs labelling could provide a reference guideline for toxicological analysis and relaxometry based in vivo MRI detection. Copyright © 2018. Published by Elsevier Ltd.
Positive contrast of SPIO-labeled cells by off-resonant reconstruction of 3D radial half-echo bSSFP.
Diwoky, Clemens; Liebmann, Daniel; Neumayer, Bernhard; Reinisch, Andreas; Knoll, Florian; Strunk, Dirk; Stollberger, Rudolf
2015-01-01
This article describes a new acquisition and reconstruction concept for positive contrast imaging of cells labeled with superparamagnetic iron oxides (SPIOs). Overcoming the limitations of a negative contrast representation as gained with gradient echo and fully balanced steady state (bSSFP), the proposed method delivers a spatially localized contrast with high cellular sensitivity not accomplished by other positive contrast methods. Employing a 3D radial bSSFP pulse sequence with half-echo sampling, positive cellular contrast is gained by adding artificial global frequency offsets to each half-echo before image reconstruction. The new contrast regime is highlighted with numerical intravoxel simulations including the point-spread function for 3D half-echo acquisitions. Furthermore, the new method is validated on the basis of in vitro cell phantom measurements on a clinical MRI platform, where the measured contrast-to-noise ratio (CNR) of the new approach exceeds even the negative contrast of bSSFP. Finally, an in vivo proof of principle study based on a mouse model with a clear depiction of labeled cells within a subcutaneous cell islet containing a cell density as low as 7 cells/mm(3) is presented. The resultant isotropic images show robustness to motion and a high CNR, in addition to an enhanced specificity due to the positive contrast of SPIO-labeled cells. Copyright © 2014 John Wiley & Sons, Ltd.
Detecting molecules and cells labeled with magnetic particles using an atomic magnetometer
NASA Astrophysics Data System (ADS)
Yu, Dindi; Ruangchaithaweesuk, Songtham; Yao, Li; Xu, Shoujun
2012-09-01
The detection of magnetically labeled molecules and cells involves three essential parameters: sensitivity, spatial resolution, and molecular specificity. We report on the use of atomic magnetometry and its derivative techniques to achieve high performance in terms of all these parameters. With a sensitivity of 80 fT/√Hz for dc magnetic fields, we show that 7,000 streptavidin-conjugated magnetic microparticles magnetized by a permanent magnet produce a magnetic field of 650 pT; this result predicts that a single such particle can be detected during one second of signal averaging. Spatial information is obtained using a scanning magnetic imaging scheme. The spatial resolution is 20 μm with a detection distance of more than 1 cm; this distance is much longer than that in previous reports. The molecular specificity is achieved using force-induced remnant magnetization spectroscopy, which currently uses an atomic magnetometer for detection. As an example, we perform measurement of magnetically labeled human CD4+ T cells, whose count in the blood is the diagnostic criterion for human immunodeficiency virus infection. Magnetic particles that are specifically bound to the cells are resolved from nonspecifically bound particles and quantitatively correlate with the number of cells. The magnetic particles have an overall size of 2.8 μm, with a magnetic core in nanometer regime. The combination of our techniques is predicted to be useful in molecular and cellular imaging.
Mizukami, Shin; Hori, Yuichiro; Kikuchi, Kazuya
2014-01-21
The use of genetic engineering techniques allows researchers to combine functional proteins with fluorescent proteins (FPs) to produce fusion proteins that can be visualized in living cells, tissues, and animals. However, several limitations of FPs, such as slow maturation kinetics or issues with photostability under laser illumination, have led researchers to examine new technologies beyond FP-based imaging. Recently, new protein-labeling technologies using protein/peptide tags and tag-specific probes have attracted increasing attention. Although several protein-labeling systems are com mercially available, researchers continue to work on addressing some of the limitations of this technology. To reduce the level of background fluorescence from unlabeled probes, researchers have pursued fluorogenic labeling, in which the labeling probes do not fluoresce until the target proteins are labeled. In this Account, we review two different fluorogenic protein-labeling systems that we have recently developed. First we give a brief history of protein labeling technologies and describe the challenges involved in protein labeling. In the second section, we discuss a fluorogenic labeling system based on a noncatalytic mutant of β-lactamase, which forms specific covalent bonds with β-lactam antibiotics such as ampicillin or cephalosporin. Based on fluorescence (or Förster) resonance energy transfer and other physicochemical principles, we have developed several types of fluorogenic labeling probes. To extend the utility of this labeling system, we took advantage of a hydrophobic β-lactam prodrug structure to achieve intracellular protein labeling. We also describe a small protein tag, photoactive yellow protein (PYP)-tag, and its probes. By utilizing a quenching mechanism based on close intramolecular contact, we incorporated a turn-on switch into the probes for fluorogenic protein labeling. One of these probes allowed us to rapidly image a protein while avoiding washout. In
IDAWG: Metabolic incorporation of stable isotope labels for quantitative glycomics of cultured cells
Orlando, Ron; Lim, Jae-Min; Atwood, James A.; Angel, Peggi M.; Fang, Meng; Aoki, Kazuhiro; Alvarez-Manilla, Gerardo; Moremen, Kelley W.; York, William S.; Tiemeyer, Michael; Pierce, Michael; Dalton, Stephen; Wells, Lance
2012-01-01
Robust quantification is an essential component of comparative –omic strategies. In this regard, glycomics lags behind proteomics. Although various isotope-tagging and direct quantification methods have recently enhanced comparative glycan analysis, a cell culture labeling strategy, that could provide for glycomics the advantages that SILAC provides for proteomics, has not been described. Here we report the development of IDAWG, Isotopic Detection of Aminosugars With Glutamine, for the incorporation of differential mass tags into the glycans of cultured cells. In this method, culture media containing amide-15N-Gln is used to metabolically label cellular aminosugars with heavy nitrogen. Because the amide side chain of Gln is the sole source of nitrogen for the biosynthesis of GlcNAc, GalNAc, and sialic acid, we demonstrate that culturing mouse embryonic stems cells for 72 hours in the presence of amide-15N-Gln media results in nearly complete incorporation of 15N into N-linked and O-linked glycans. The isotopically heavy monosaccharide residues provide additional information for interpreting glycan fragmentation and also allow quantification in both full MS and MS/MS modes. Thus, IDAWG is a simple to implement, yet powerful quantitative tool for the glycomics toolbox. PMID:19449840
Lamanna, Giuseppe; Garofalo, Antonio; Popa, Gabriela; Wilhelm, Claire; Bégin-Colin, Sylvie; Felder-Flesch, Delphine; Bianco, Alberto; Gazeau, Florence; Ménard-Moyon, Cécilia
2013-05-21
Coating of carbon nanotubes (CNTs) with magnetic nanoparticles (NPs) imparts novel magnetic, optical, and thermal properties with potential applications in the biomedical domain. Multi-walled CNTs have been decorated with iron oxide superparamagnetic NPs. Two different approaches have been investigated based on ligand exchange or "click chemistry". The presence of the NPs on the nanotube surface allows conferring magnetic properties to CNTs. We have evaluated the potential of the NP/CNT hybrids as a contrast agent for magnetic resonance imaging (MRI) and their interactions with cells. The capacity of the hybrids to magnetically monitor and manipulate cells has also been investigated. The NP/CNTs can be manipulated by a remote magnetic field with enhanced contrast in MRI. They are internalized into tumor cells without showing cytotoxicity. The labeled cells can be magnetically manipulated as they display magnetic mobility and are detected at a single cell level through high resolution MRI.
Su, Zi-Fen; He, Jiang; Rusckowski, Mary; Hnatowich, Donald J
2003-02-01
The level of alpha(V)beta(3) integrins on endothelial cells is elevated in angiogenesis. The high binding specificity to alpha(V)beta(3) integrins of peptides containing Arg-Gly-Asp (RGD) residues suggests that the radiolabeled RGD peptides may be useful as tumor specific imaging agents. In this research, cyclised peptides containing Arg-Gly-Asp (RGD) and Arg-Gly-Glu (RGE, as control) residues were conjugated with HYNIC and labeled with (99m)Tc. The goal was to evaluate the influence of co-ligand, either tricine or ethylenediamine-N,N'-diacetic acid (EDDA) on protein and integrin binding and on cellular uptake in culture. The n-octanol/water partition coefficient, binding to bovine serum albumin (BSA) and human umbilical vein endothelial (HUVE) cells, and cell lysate distributions of the radiolabeled peptides were evaluated. The co-ligands had a significant effect on the labeling efficiency of the HYNIC conjugates and on certain properties of the (99m)Tc complexes. The labeling efficiency with tricine was 10 fold higher and BSA binding was over 8 fold greater compared to EDDA. Both RGD labels showed higher (6 to 28 fold) binding to HUVE cells than that of the RGE labels, indicating binding specificity. After cell-lysis, only a small percentage of the total RGD label that accumulated in the cells was found bound to cellular proteins (9% of RGD/tricine and 5% of RGD/EDDA), implying that over 90% of the radiolabeled peptides were internalized for both radiolabeled RGDs. The number of the RGD molecules bound to proteins was estimated to be approximately three per cell, suggesting that only a small number of alpha(V)beta(3) integrin proteins are expressed on the cells. Apart from the differences in radiolabeling, the only important effect of substituting EDDA for tricine as co-ligand on the HYNIC-peptides was the lower degree of serum protein binding. In spite of the lower serum protein binding potential, in vivo tumor accumulation of the RGD/EDDA may not be improved
Dynamic analysis of CO₂ labeling and cell respiration using membrane-inlet mass spectrometry.
Yang, Tae Hoon
2014-01-01
Here, we introduce a mass spectrometry-based analytical method and relevant technical details for dynamic cell respiration and CO2 labeling analysis. Such measurements can be utilized as additional information and constraints for model-based (13)C metabolic flux analysis. Dissolved dynamics of oxygen consumption and CO2 mass isotopomer evolution from (13)C-labeled tracer substrates through different cellular processes can be precisely measured on-line using a miniaturized reactor system equipped with a membrane-inlet mass spectrometer. The corresponding specific rates of physiologically relevant gases and CO2 mass isotopomers can be quantified within a short-term range based on the liquid-phase dynamics of dissolved fermentation gases.
A Continuum Model of Actin Waves in Dictyostelium discoideum
Khamviwath, Varunyu; Hu, Jifeng; Othmer, Hans G.
2013-01-01
Actin waves are complex dynamical patterns of the dendritic network of filamentous actin in eukaryotes. We developed a model of actin waves in PTEN-deficient Dictyostelium discoideum by deriving an approximation of the dynamics of discrete actin filaments and combining it with a signaling pathway that controls filament branching. This signaling pathway, together with the actin network, contains a positive feedback loop that drives the actin waves. Our model predicts the structure, composition, and dynamics of waves that are consistent with existing experimental evidence, as well as the biochemical dependence on various protein partners. Simulation suggests that actin waves are initiated when local actin network activity, caused by an independent process, exceeds a certain threshold. Moreover, diffusion of proteins that form a positive feedback loop with the actin network alone is sufficient for propagation of actin waves at the observed speed of . Decay of the wave back can be caused by scarcity of network components, and the shape of actin waves is highly dependent on the filament disassembly rate. The model allows retraction of actin waves and captures formation of new wave fronts in broken waves. Our results demonstrate that a delicate balance between a positive feedback, filament disassembly, and local availability of network components is essential for the complex dynamics of actin waves. PMID:23741312
Tsao, D D; Wang, S G; Lynn, B D; Nagy, J I
2017-06-01
Gap junctions between cells in the pineal gland have been described ultrastructurally, but their connexin constituents have not been fully characterized. We used immunofluorescence in combination with markers of pineal cells to document the cellular localization of connexin43 (Cx43). Immunofluorescence labelling of Cx43 with several different antibodies was widely distributed throughout the pineal, whereas another connexin examined, connexin26, was not found in pineal but only in surrounding leptomeninges. Labelling apparently associated with plasma membranes was visualized either as fine Cx43-puncta (1-2 μm) or as unusually large pools of Cx43 ranging up to 4-7 μm in diameter or length. These puncta and pools were highly concentrated in perivascular spaces, where they were associated with numerous cells devoid of labelling for markers of pinealocytes (e.g. tryptophan hydroxylase and serotonin), and where they were minimally associated with blood vessels and lacked association with resident macrophages. Astrocytes labelled for glial fibrillary acidic protein were largely restricted to the anterior pole of the pineal gland, where they displayed only fine and sparse Cx43-puncta along their processes. Labelling for Cx43 was localized largely though not exclusively to the somata and long processes of a subpopulation of perivascular interstitial cells that were immunopositive for calbindin-D28K. These cells were often located among dense bundles or termination areas of sympathetic fibres labelled for tyrosine hydroxylase or serotonin. The results indicate that interstitial cells form abundant gap junctions composed of Cx43, and suggest that gap junction-mediated intracellular communication by these cells supports the activities of pinealocytes. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
The National Cancer Institute seek parties interested in in-licensing and/or collaborative research to develop and commercialize cell labeling, cell tracking, cell trafficking, cell-based therapy, and PET imaging for cancer.
Tomographic sensing and localization of fluorescently labeled circulating cells in mice in vivo
NASA Astrophysics Data System (ADS)
Zettergren, Eric; Swamy, Tushar; Runnels, Judith; Lin, Charles P.; Niedre, Mark
2012-07-01
Sensing and enumeration of specific types of circulating cells in small animals is an important problem in many areas of biomedical research. Microscopy-based fluorescence in vivo flow cytometry methods have been developed previously, but these are typically limited to sampling of very small blood volumes, so that very rare circulating cells may escape detection. Recently, we described the development of a ‘diffuse fluorescence flow cytometer’ (DFFC) that allows sampling of much larger blood vessels and therefore circulating blood volumes in the hindlimb, forelimb or tail of a mouse. In this work, we extend this concept by developing and validating a method to tomographically localize circulating fluorescently labeled cells in the cross section of a tissue simulating optical flow phantom and mouse limb. This was achieved using two modulated light sources and an array of six fiber-coupled detectors that allowed rapid, high-sensitivity acquisition of full tomographic data sets at 10 Hz. These were reconstructed into two-dimensional cross-sectional images using Monte Carlo models of light propagation and the randomized algebraic reconstruction technique. We were able to obtain continuous images of moving cells in the sample cross section with 0.5 mm accuracy or better. We first demonstrated this concept in limb-mimicking optical flow photons with up to four flow channels, and then in the tails of mice with fluorescently labeled multiple myeloma cells. This approach increases the overall diagnostic utility of our DFFC instrument.
GFP Labeling and Hepatic Differentiation Potential of Human Placenta-Derived Mesenchymal Stem Cells.
Yu, Jiong; Su, Xiaoru; Zhu, Chengxing; Pan, Qiaoling; Yang, Jinfeng; Ma, Jing; Shen, Leyao; Cao, Hongcui; Li, Lanjuan
2015-01-01
Stem cell-based therapy in liver diseases has received increasing interest over the past decade, but direct evidence of the homing and implantation of transplanted cells is conflicting. Reliable labeling and tracking techniques are essential but lacking. The purpose of this study was to establish human placenta-derived mesenchymal stem cells (hPMSCs) expressing green fluorescent protein (GFP) and to assay their hepatic functional differentiation in vitro. The GFP gene was transduced into hPMSCs using a lentivirus to establish GFP(+) hPMSCs. GFP(+) hPMSCs were analyzed for their phenotypic profile, viability and adipogenic, osteogenic and hepatic differentiation. The derived GFP(+) hepatocyte-like cells were evaluated for their metabolic, synthetic and secretory functions, respectively. GFP(+) hPMSCs expressed high levels of HLA I, CD13, CD105, CD73, CD90, CD44 and CD29, but were negative for HLA II, CD45, CD31, CD34, CD133, CD271 and CD79. They possessed adipogenic, osteogenic and hepatic differentiation potential. Hepatocyte-like cells derived from GFP(+) hPMSCs showed typical hepatic phenotypes. GFP gene transduction has no adverse influences on the cellular or biochemical properties of hPMSCs or markers. GFP gene transduction using lentiviral vectors is a reliable labeling and tracking method. GFP(+) hPMSCs can therefore serve as a tool to investigate the mechanisms of MSC-based therapy, including hepatic disease therapy. © 2015 S. Karger AG, Basel.
The two Dictyostelium discoideum autophagy 8 proteins have distinct autophagic functions.
Meßling, Susanne; Matthias, Jan; Xiong, Qiuhong; Fischer, Sarah; Eichinger, Ludwig
2017-06-01
Autophagy is a highly conserved cellular degradation pathway which is crucial for various cellular processes. The autophagic process is subdivided in the initiation, autophagosome maturation and lysosomal degradation phases and involves more than forty core and accessory autophagy-related (ATG) proteins. Autophagy 8 (ATG8, in mammals LC3) is a well-established marker of autophagy and is linked to the autophagic membrane from initiation until fusion with the lysosome. We generated single and double knock-out mutants of the two Dictyostelium paralogues, ATG8a and ATG8b, as well as strains that expressed RFP-ATG8a and/or GFP-ATG8b, RFP-ATG8b, RFP-GFP-ATG8a or RFP-GFP-ATG8b in different knock-out mutants. The ATG8b¯ mutant displayed only subtle phenotypic changes in comparison to AX2 wild-type cells. In contrast, deletion of ATG8a resulted in a complex phenotype with delayed development, reduced growth, phagocytosis and cell viability, an increase in ubiquitinylated proteins and a concomitant decrease in proteasomal activity. The phenotype of the ATG8a¯/b¯ strain was, except for cell viability, in all aforementioned aspects more severe, showing that both proteins function in parallel during most analysed cellular processes. Immunofluorescence analysis of knock-out strains expressing either RFP-GFP-ATG8a or RFP-GFP-ATG8b suggests a crucial function for ATG8b in autophagosome-lysosome fusion. Quantitative analysis of strains expressing RFP-ATG8a, RFP-ATG8b, or RFP-ATG8a and GFP-ATG8b revealed that ATG8b generally localised to small and large vesicles, whereas ATG8a preferentially co-localised with ATG8b on large vesicles, indicating that ATG8b associated with nascent autophagosomes before ATG8a, which is supported by previous results (Matthias et al., 2016). Deconvoluted confocal fluorescence images showed that ATG8b localised around ATG8a and was presumably mainly present on the outer membrane of the autophagosome while ATG8a appears to be mainly associated with the
Zebrabow: multispectral cell labeling for cell tracing and lineage analysis in zebrafish
Pan, Y. Albert; Freundlich, Tom; Weissman, Tamily A.; Schoppik, David; Wang, X. Cindy; Zimmerman, Steve; Ciruna, Brian; Sanes, Joshua R.; Lichtman, Jeff W.; Schier, Alexander F.
2013-01-01
Advances in imaging and cell-labeling techniques have greatly enhanced our understanding of developmental and neurobiological processes. Among vertebrates, zebrafish is uniquely suited for in vivo imaging owing to its small size and optical translucency. However, distinguishing and following cells over extended time periods remains difficult. Previous studies have demonstrated that Cre recombinase-mediated recombination can lead to combinatorial expression of spectrally distinct fluorescent proteins (RFP, YFP and CFP) in neighboring cells, creating a ‘Brainbow’ of colors. The random combination of fluorescent proteins provides a way to distinguish adjacent cells, visualize cellular interactions and perform lineage analyses. Here, we describe Zebrabow (Zebrafish Brainbow) tools for in vivo multicolor imaging in zebrafish. First, we show that the broadly expressed ubi:Zebrabow line provides diverse color profiles that can be optimized by modulating Cre activity. Second, we find that colors are inherited equally among daughter cells and remain stable throughout embryonic and larval stages. Third, we show that UAS:Zebrabow lines can be used in combination with Gal4 to generate broad or tissue-specific expression patterns and facilitate tracing of axonal processes. Fourth, we demonstrate that Zebrabow can be used for long-term lineage analysis. Using the cornea as a model system, we provide evidence that embryonic corneal epithelial clones are replaced by large, wedge-shaped clones formed by centripetal expansion of cells from the peripheral cornea. The Zebrabow tool set presented here provides a resource for next-generation color-based anatomical and lineage analyses in zebrafish. PMID:23757414
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeng, Yining; Yarbrough, John M.; Mittal, Ashutosh
Plant hemicellulose (largely xylan) is an excellent feedstock for renewable energy production and second only to cellulose in abundance. Beyond a source of fermentable sugars, xylan constitutes a critical polymer in the plant cell wall, where its precise role in wall assembly, maturation, and deconstruction remains primarily hypothetical. Effective detection of xylan, particularly by in situ imaging of xylan in the presence of other biopolymers, would provide critical information for tackling the challenges of understanding the assembly and enhancing the liberation of xylan from plant materials. Raman-based imaging techniques, especially the highly sensitive stimulated Raman scattering (SRS) microscopy, have provenmore » to be valuable tools for label-free imaging. However, due to the complex nature of plant materials, especially those same chemical groups shared between xylan and cellulose, the utility of specific Raman vibrational modes that are unique to xylan have been debated. Here, we report a novel approach based on combining spectroscopic analysis and chemical/enzymatic xylan removal from corn stover cell walls, to make progress in meeting this analytical challenge. We have identified several Raman peaks associated with xylan content in cell walls for label-free in situ imaging xylan in plant cell wall. We demonstrated that xylan can be resolved from cellulose and lignin in situ using enzymatic digestion and label-free SRS microscopy in both 2D and 3D. As a result, we believe that this novel approach can be used to map xylan in plant cell walls and that this ability will enhance our understanding of the role played by xylan in cell wall biosynthesis and deconstruction.« less
Zeng, Yining; Yarbrough, John M.; Mittal, Ashutosh; ...
2016-11-22
Plant hemicellulose (largely xylan) is an excellent feedstock for renewable energy production and second only to cellulose in abundance. Beyond a source of fermentable sugars, xylan constitutes a critical polymer in the plant cell wall, where its precise role in wall assembly, maturation, and deconstruction remains primarily hypothetical. Effective detection of xylan, particularly by in situ imaging of xylan in the presence of other biopolymers, would provide critical information for tackling the challenges of understanding the assembly and enhancing the liberation of xylan from plant materials. Raman-based imaging techniques, especially the highly sensitive stimulated Raman scattering (SRS) microscopy, have provenmore » to be valuable tools for label-free imaging. However, due to the complex nature of plant materials, especially those same chemical groups shared between xylan and cellulose, the utility of specific Raman vibrational modes that are unique to xylan have been debated. Here, we report a novel approach based on combining spectroscopic analysis and chemical/enzymatic xylan removal from corn stover cell walls, to make progress in meeting this analytical challenge. We have identified several Raman peaks associated with xylan content in cell walls for label-free in situ imaging xylan in plant cell wall. We demonstrated that xylan can be resolved from cellulose and lignin in situ using enzymatic digestion and label-free SRS microscopy in both 2D and 3D. As a result, we believe that this novel approach can be used to map xylan in plant cell walls and that this ability will enhance our understanding of the role played by xylan in cell wall biosynthesis and deconstruction.« less
NASA Astrophysics Data System (ADS)
Gholami, A.; Steinbock, O.; Zykov, V.; Bodenschatz, E.
2015-01-01
We report experiments on flow-driven waves in a microfluidic channel containing the signaling slime mold Dictyostelium discoideum. The observed cyclic adenosine monophosphate (cAMP) wave trains developed spontaneously in the presence of flow and propagated with the velocity proportional to the imposed flow velocity. The period of the wave trains was independent of the flow velocity. Perturbations of flow-driven waves via external periodic pulses of the signaling agent cAMP induced 1 ∶1 , 2 ∶1 , 3 ∶1 , and 1 ∶2 frequency responses, reminiscent of Arnold tongues in forced oscillatory systems. We expect our observations to be generic to active media governed by reaction-diffusion-advection dynamics, where spatially bound autocatalytic processes occur under flow conditions.
Temperature-induced labelling of Fluo-3 AM selectively yields brighter nucleus in adherent cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meng, Guixian; Pan, Leiting, E-mail: plt@nankai.edu.cn; Li, Cunbo
2014-01-17
Highlights: •We detailedly examine temperature effects of Fluo-3 AM labelling in adherent cells. •4 °C Loading and 20 °C de-esterification of Fluo-3 AM yields brighter nuclei. •Brighter nuclei labelling by Fluo-3 AM also depends on cell adhesion quality. •A qualitative model of the brighter nucleus is proposed. -- Abstract: Fluo-3 is widely used to study cell calcium. Two traditional approaches: (1) direct injection and (2) Fluo-3 acetoxymethyl ester (AM) loading, often bring conflicting results in cytoplasmic calcium ([Ca{sup 2+}]{sub c}) and nuclear calcium ([Ca{sup 2+}]{sub n}) imaging. AM loading usually yields a darker nucleus than in cytoplasm, while direct injectionmore » always induces a brighter nucleus which is more responsive to [Ca{sup 2+}]{sub n} detection. In this work, we detailedly investigated the effects of loading and de-esterification temperatures on the fluorescence intensity of Fluo-3 in response to [Ca{sup 2+}]{sub n} and [Ca{sup 2+}]{sub c} in adherent cells, including osteoblast, HeLa and BV2 cells. Interestingly, it showed that fluorescence intensity of nucleus in osteoblast cells was about two times larger than that of cytoplasm when cells were loaded with Fluo-3 AM at 4 °C and allowed a subsequent step for de-esterification at 20 °C. Brighter nuclei were also acquired in HeLa and BV2 cells using the same experimental condition. Furthermore, loading time and adhesion quality of cells had effect on fluorescence intensity. Taken together, cold loading and room temperature de-esterification treatment of Fluo-3 AM selectively yielded brighter nucleus in adherent cells.« less
Label free cell tracking in 3D tissue engineering constructs with high resolution imaging
NASA Astrophysics Data System (ADS)
Smith, W. A.; Lam, K.-P.; Dempsey, K. P.; Mazzocchi-Jones, D.; Richardson, J. B.; Yang, Y.
2014-02-01
Within the field of tissue engineering there is an emphasis on studying 3-D live tissue structures. Consequently, to investigate and identify cellular activities and phenotypes in a 3-D environment for all in vitro experiments, including shape, migration/proliferation and axon projection, it is necessary to adopt an optical imaging system that enables monitoring 3-D cellular activities and morphology through the thickness of the construct for an extended culture period without cell labeling. This paper describes a new 3-D tracking algorithm developed for Cell-IQ®, an automated cell imaging platform, which has been equipped with an environmental chamber optimized to enable capturing time-lapse sequences of live cell images over a long-term period without cell labeling. As an integral part of the algorithm, a novel auto-focusing procedure was developed for phase contrast microscopy equipped with 20x and 40x objectives, to provide a more accurate estimation of cell growth/trajectories by allowing 3-D voxels to be computed at high spatiotemporal resolution and cell density. A pilot study was carried out in a phantom system consisting of horizontally aligned nanofiber layers (with precise spacing between them), to mimic features well exemplified in cellular activities of neuronal growth in a 3-D environment. This was followed by detailed investigations concerning axonal projections and dendritic circuitry formation in a 3-D tissue engineering construct. Preliminary work on primary animal neuronal cells in response to chemoattractant and topographic cue within the scaffolds has produced encouraging results.
Kihara, Kumiko; Mori, Kotaro; Suzuki, Shingo; Ono, Naoaki; Furusawa, Chikara; Yomo, Tetsuya
2009-05-01
Escherichia coli and the cellular slime mold Dictyostelium discoideum form stable viscous symbiotic colonies in the laboratory. To examine changes in E. coli gene expression during establishment of this symbiotic relationship, cells of symbiotic co-cultures and monocultures at various time points were subjected to microarrays analysis. Genes changed significantly over time compared to the initial gene expression level were determined as characteristics of GO function categories. The categories that appeared significantly at the same sampling time points between the two cultures were also identified. Up-regulation of genes from several GO categories associated with polysaccharide synthesis, cell wall degradation, and iron acquisition as well as down-regulation of genes from GO categories associated with biosynthesis through starvation response were observed in co-cultures, indicating exchange of molecules between the two organisms. Up-regulation of genes from several GO categories associated with anaerobic respiration and flagella biosynthesis were also observed, indicating that the environment inside symbiotic colonies was similar to that in developed biofilms. Up-regulation of genes associated with energy-generating systems indicated that E. coli prolonged survival within the symbiotic colony. Thus, E. coli showed not only molecule exchange but also altered expression of various genes in symbiosis with D. discoideum.
Label-free detection of liver cancer cells by aptamer-based microcantilever biosensor.
Chen, Xuejuan; Pan, Yangang; Liu, Huiqing; Bai, Xiaojing; Wang, Nan; Zhang, Bailin
2016-05-15
Liver cancer is one of the most common and highly malignant cancers in the world. There are no effective therapeutic options if an early liver cancer diagnosis is not achieved. In this work, detection of HepG2 cells by label-free microcantilever array aptasensor was developed. The sensing microcantilevers were functionalized by HepG2 cells-specific aptamers. Meanwhile, to eliminate the interferences induced by the environment, the reference microcantilevers were modified with 6-mercapto-1-hexanol self-assembled monolayers. The aptasensor exhibits high specificity over not only human liver normal cells, but also other cancer cells of breast, bladder, and cervix tumors. The linear relation ranges from 1×10(3) to 1×10(5)cells/mL, with a detection limit of 300 cells/mL (S/N=3). Our work provides a simple method for detection of liver cancer cells with advantages in terms of simplicity and stability. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report inmore » the interest of brevity.« less
Photoaffinity labeling of regulatory subunits of protein kinase A in cardiac cell fractions of rats
NASA Technical Reports Server (NTRS)
Mednieks, M. I.; Popova, I.; Grindeland, R. E.
1992-01-01
Photoaffinity labeling in heart tissue of rats flown on Cosmos 2044 was used to measure the regulatory (R) subunits of adenosine monophosphate-dependent protein kinase. A significant decrease of RII subunits in the particulate cell fraction extract (S2; P less than 0.05 in all cases) was observed when extracts of tissue samples from vivarium controls were compared with those from flight animals. Photoaffinity labeling of the soluble fraction (S1) was observed to be unaffected by spaceflight or any of the simulation conditions. Proteins of the S2 fraction constitute a minor (less than 10 percent) component of the total, whereas the S1 fraction contained most of the cell proteins. Changes in a relatively minor aspect of adenosine monophosphate-mediated reactions are considered to be representative of a metabolic effect.
Preparation of Labeled Aflatoxins with High Specific Activities
Hsieh, D. P. H.; Mateles, R. I.
1971-01-01
Resting cells of Aspergillus parasiticus ATCC 15517 were used to prepare highly labeled aflatoxins from labeled acetate. High synthetic activity in growing cells was evidenced only during 40 to 70 hr of incubation. Glucose was required for high incorporation efficiency, whereas the concentration of the labeled acetate determined the specific activity of the product. When labeled acetate was continuously added to maintain a concentration near but not exceeding 10 mm, in a culture containing 30 g of glucose per liter, 2% of its labels could be recovered in the purified aflatoxins which have a specific activity more than three times that of the labeled acetate. PMID:4329435
NASA Astrophysics Data System (ADS)
Hilger, Ingrid; Kießling, Andreas; Romanus, Erik; Hiergeist, Robert; Hergt, Rudolf; Andrä, Wilfried; Roskos, Martin; Linss, Werner; Weber, Peter; Weitschies, Werner; Kaiser, Werner A.
2004-08-01
The minimally invasive elimination of tumours using heating as a therapeutic agent is an emerging technology in medical applications. Particularly, the intratumoural application of magnetic nanoparticles as potential heating sources when exposed to an alternating magnetic field has been demonstrated. The present work deals with the estimation of the basic relationships when the magnetic material has access and binds to structures on cell membranes of target cells at the tumour region, particularly as a consequence of administration through tumour supplying vessels. Therefore, using mouse endothelial cells in culture, the binding of dextran coated magnetic nanoparticles (mean hydrodynamic particle diameter 65 nm) was modelled using the periodate method. The efficacy of cell labelling was demonstrated by magnetorelaxometry (MRX)—a selective method for the detection of only those magnetic nanoparticles that were immobilized—as well as by electron microscopy and iron staining. The amount of iron immobilized on cells was found to be 153 ± 56 µg Fe per 1 × 107 cells as determined by atomic absorption spectrometry. Moreover, after exposure of those 1 × 107 labelled cells to an alternating magnetic field (frequency 410 kHz, amplitude 11 kA m-1) for 5 min, temperature increases of 2 °C were achieved. The consequences of particle immobilization are reflected by the results of the measurements related to the specific heating power (SHP) of the magnetic material. Basically, the heating potential is explained by the superposition of Brown and Neél relaxation while for immobilized nanoparticles the Brown contribution is absent. In the long term the data could open the door to targeted magnetic heating after further optimization of the heating potential of magnetic material as well as after functionalization with biomolecules which recognize specific structures on the surface of cells at the target region.
Automated Microfluidic Instrument for Label-Free and High-Throughput Cell Separation.
Zhang, Xinjie; Zhu, Zhixian; Xiang, Nan; Long, Feifei; Ni, Zhonghua
2018-03-20
Microfluidic technologies for cell separation were reported frequently in recent years. However, a compact microfluidic instrument enabling thoroughly automated cell separation is still rarely reported until today due to the difficult hybrid between the macrosized fluidic control system and the microsized microfluidic device. In this work, we propose a novel and automated microfluidic instrument to realize size-based separation of cancer cells in a label-free and high-throughput manner. Briefly, the instrument is equipped with a fully integrated microfluidic device and a set of robust fluid-driven and control units, and the instrument functions of precise fluid infusion and high-throughput cell separation are guaranteed by a flow regulatory chip and two cell separation chips which are the key components of the microfluidic device. With optimized control programs, the instrument is successfully applied to automatically sort human breast adenocarcinoma cell line MCF-7 from 5 mL of diluted human blood with a high recovery ratio of ∼85% within a rapid processing time of ∼23 min. We envision that our microfluidic instrument will be potentially useful in many biomedical applications, especially cell separation, enrichment, and concentration for the purpose of cell culture and analysis.
Mallett, Christiane L; McFadden, Catherine; Chen, Yuhua; Foster, Paula J
2012-07-01
A novel cell line of cytotoxic natural killer (NK) cells, KHYG-1, was examined in vivo for immunotherapy against prostate cancer. The feasibility of using magnetic resonance imaging (MRI) tracking to monitor the fate of injected NK cells following intravenous (i.v.), intraperitoneal (i.p.) and subcutaneous (s.c.) administration was assessed. PC-3M human prostate cancer cells were injected s.c. into the flank of nude mice (day 0). KHYG-1 NK cells were labeled with an iron oxide contrast agent and injected s.c., i.v. or i.p. on day 8. Mice were imaged by MRI on days 7, 9 and 12. Tumor sections were examined with fluorescence microscopy and immunohistologic staining for NK cells. NK cells were detected in the tumors by histology after all three administration routes. NK cells and fluorescence from the iron label were co-localized. Signal loss was seen in the areas around the tumors and between the tumor lobes in the s.c. group. We are the first to label this cell line of NK cells with an iron oxide contrast agent. Accumulation of NK cells was visualized by MRI after s.c. injection but not after i.v. and i.p. injection.
DIGE compatible labelling of surface proteins on vital cells in vitro and in vivo.
Mayrhofer, Corina; Krieger, Sigurd; Allmaier, Günter; Kerjaschki, Dontscho
2006-01-01
Efficient methods for profiling of the cell surface proteome are desirable to get a deeper insight in basic biological processes, to localise proteins and to uncover proteins differentially expressed in diseases. Here we present a strategy to target cell surface exposed proteins via fluorescence labelling using CyDye DIGE fluors. This method has been applied to human cell lines in vitro as well as to a complex biological system in vivo. It allows detection of fluorophore-tagged cell surface proteins and visualisation of the accessible proteome within a single 2-D gel, simplifying subsequent UV MALDI-MS analysis.
Kit for the selective labeling of red blood cells in whole blood with .sup.9 TC
Srivastava, Suresh C.; Babich, John W.; Straub, Rita; Richards, Powell
1992-01-01
Disclosed herein are a method and kit for the preparation of .sup.99m Tc labeled red blood cells using whole blood in a closed sterile system containing stannous tin in a form such that it will enter the red blood cells and be available therein for reduction of technetium.
Label-Free Imaging and Biochemical Characterization of Bovine Sperm Cells
Ferrara, Maria Antonietta; Di Caprio, Giuseppe; Managò, Stefano; De Angelis, Annalisa; Sirleto, Luigi; Coppola, Giuseppe; De Luca, Anna Chiara
2015-01-01
A full label-free morphological and biochemical characterization is desirable to select spermatozoa during preparation for artificial insemination. In order to study these fundamental parameters, we take advantage of two attractive techniques: digital holography (DH) and Raman spectroscopy (RS). DH presents new opportunities for studying morphological aspect of cells and tissues non-invasively, quantitatively and without the need for staining or tagging, while RS is a very specific technique allowing the biochemical analysis of cellular components with a spatial resolution in the sub-micrometer range. In this paper, morphological and biochemical bovine sperm cell alterations were studied using these techniques. In addition, a complementary DH and RS study was performed to identify X- and Y-chromosome-bearing sperm cells. We demonstrate that the two techniques together are a powerful and highly efficient tool elucidating some important criterions for sperm morphological selection and sex-identification, overcoming many of the limitations associated with existing protocols. PMID:25836358
Cardelli, J A; Bush, J M; Ebert, D; Freeze, H H
1990-05-25
Although previous studies have indicated that N-linked oligosaccharides on lysosomal enzymes in Dictyostelium discoideum are extensively phosphorylated and sulfated, the role of these modifications in the sorting and function of these enzymes remains to be determined. We have used radiolabel pulse-chase, subcellular fractionation, and immunofluorescence microscopy to analyze the transport, processing, secretion, and sorting of two lysosomal enzymes in a mutant, HL244, which is almost completely defective in sulfation. [3H]Mannose-labeled N-linked oligosaccharides were released from immunoprecipitated alpha-mannosidase and beta-glucosidase of HL244 by digestion with peptide: N-glycosidase. The size, Man9-10GlcNAc2, and processing of the neutral species were similar to that found in the wild type, but the anionic oligosaccharides were less charged than those from the wild-type enzymes. All of the negative charges on the oligosaccharides for HL244 were due to the presence of 1, 2, or 3 phosphodiesters and not to sulfate esters. The rate of proteolytic processing of precursor forms of alpha-mannosidase and beta-glucosidase to mature forms in HL244 was identical to wild type. The precursor polypeptides in the mutant and the wild type were membrane associated until being processed to mature forms; therefore, sulfated sugars are not essential for this association. Furthermore, the rate of transport of alpha-mannosidase and beta-glucosidase from the endoplasmic reticulum to the Golgi complex was normal in the mutant as determined by the rate at which the newly synthesized proteins became resistant to the enzyme, endo-beta-N-acetylglucosaminidase H. There was no increase in the percentage of newly synthesized mutant precursors which escaped sorting and were secreted, and the intracellularly retained lysosomal enzymes were properly localized to lysosomes as determined by fractionation of cell organelles on Percoll gradients and immunofluorescence microscopy. However, the
Saito, T; Ochiai, H
1999-10-01
cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.
Dudhia, Jayesh; Becerra, Patricia; Valdés, Miguel A.; Neves, Francisco; Hartman, Neil G.; Smith, Roger K.W.
2015-01-01
Recent advances in the application of bone marrow mesenchymal stem cells (BMMSC) for the treatment of tendon and ligament injuries in the horse suggest improved outcome measures in both experimental and clinical studies. Although the BMMSC are implanted into the tendon lesion in large numbers (usually 10 - 20 million cells), only a relatively small number survive (<10%) although these can persist for up to 5 months after implantation. This appears to be a common observation in other species where BMMSC have been implanted into other tissues and it is important to understand when this loss occurs, how many survive the initial implantation process and whether the cells are cleared into other organs. Tracking the fate of the cells can be achieved by radiolabeling the BMMSC prior to implantation which allows non-invasive in vivo imaging of cell location and quantification of cell numbers. This protocol describes a cell labeling procedure that uses Technetium-99m (Tc-99m), and tracking of these cells following implantation into injured flexor tendons in horses. Tc-99m is a short-lived (t1/2 of 6.01 hr) isotope that emits gamma rays and can be internalized by cells in the presence of the lipophilic compound hexamethylpropyleneamine oxime (HMPAO). These properties make it ideal for use in nuclear medicine clinics for the diagnosis of many different diseases. The fate of the labeled cells can be followed in the short term (up to 36 hr) by gamma scintigraphy to quantify both the number of cells retained in the lesion and distribution of the cells into lungs, thyroid and other organs. This technique is adapted from the labeling of blood leukocytes and could be utilized to image implanted BMMSC in other organs. PMID:26709915
Kit for the selective labeling of red blood cells in whole blood with [sup 99]Tc
Srivastava, S.C.; Babich, J.W.; Straub, R.; Richards, P.
1992-05-26
Disclosed herein are a method and kit for the preparation of [sup 99m]Tc labeled red blood cells using whole blood in a closed sterile system containing stannous tin in a form such that it will enter the red blood cells and be available therein for reduction of technetium. No Drawings