Sample records for labeled dna molecule

  1. End labeling procedures: an overview.

    PubMed

    Hilario, Elena

    2004-09-01

    There are two ways to label a DNA molecular; by the ends or all along the molecule. End labeling can be performed at the 3'- or 5'-end. Labeling at the 3' end is performed by filling 3'-end recessed ends with a mixture or labeled and unlabeled dNTPs using Klenow or T4 DNA polymerases. Both reactions are template dependent. Terminal deoxynucleotide transferase incorporates dNTPs at the 3' end of any kind of DNA molecule or RNA. Labels incorporated at the 3'-end of the DNA molecule prevent any further extension or ligation to any other molecule, but this can be overcome by labeling the 5'-end of the desired DNA molecule. 5'-end labeling is performed by enzymatic methods (T4 polynucleotide kinase exchange and forward reactions), by chemical modification of sensitized oligonucleotides with phosphoroamidite, or by combined methods. Probe cleanup is recommended when high background problems occur, but caution should be taken not to damage the attached probe with harsh chemicals or by light exposure.

  2. Fluorescence correlation spectroscopy analysis for accurate determination of proportion of doubly labeled DNA in fluorescent DNA pool for quantitative biochemical assays.

    PubMed

    Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert

    2014-01-15

    Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Photonic-plasmonic hybrid single-molecule nanosensor measures the effect of fluorescent labels on DNA-protein dynamics

    PubMed Central

    Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin

    2017-01-01

    Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341

  4. DNA-length-dependent quenching of fluorescently labeled iron oxide nanoparticles with gold, graphene oxide and MoS2 nanostructures.

    PubMed

    Balcioglu, Mustafa; Rana, Muhit; Robertson, Neil; Yigit, Mehmet V

    2014-08-13

    We controlled the fluorescence emission of a fluorescently labeled iron oxide nanoparticle using three different nanomaterials with ultraefficient quenching capabilities. The control over the fluorescence emission was investigated via spacing introduced by the surface-functionalized single-stranded DNA molecules. DNA molecules were conjugated on different templates, either on the surface of the fluorescently labeled iron oxide nanoparticles or gold and nanographene oxide. The efficiency of the quenching was determined and compared with various fluorescently labeled iron oxide nanoparticle and nanoquencher combinations using DNA molecules with three different lengths. We have found that the template for DNA conjugation plays significant role on quenching the fluorescence emission of the fluorescently labeled iron oxide nanoparticles. We have observed that the size of the DNA controls the quenching efficiency when conjugated only on the fluorescently labeled iron oxide nanoparticles by setting a spacer between the surfaces and resulting change in the hydrodynamic size. The quenching efficiency with 12mer, 23mer and 36mer oligonucleotides decreased to 56%, 54% and 53% with gold nanoparticles, 58%, 38% and 32% with nanographene oxide, 46%, 38% and 35% with MoS2, respectively. On the other hand, the presence, not the size, of the DNA molecules on the other surfaces quenched the fluorescence significantly with different degrees. To understand the effect of the mobility of the DNA molecules on the nanoparticle surface, DNA molecules were attached to the surface with two different approaches. Covalently immobilized oligonucleotides decreased the quenching efficiency of nanographene oxide and gold nanoparticles to ∼22% and ∼21%, respectively, whereas noncovalently adsorbed oligonucleotides decreased it to ∼25% and ∼55%, respectively. As a result, we have found that each nanoquencher has a powerful quenching capability against a fluorescent nanoparticle, which can be tuned with surface functionalized DNA molecules.

  5. A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

    PubMed

    Razvi, F; Gargiulo, G; Worcel, A

    1983-08-01

    Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

  6. Bioorthogonal Metabolic DNA Labelling using Vinyl Thioether-Modified Thymidine and o-Quinolinone Quinone Methide.

    PubMed

    Gubu, Amu; Li, Long; Ning, Yan; Zhang, Xiaoyun; Lee, Seonghyun; Feng, Mengke; Li, Qiang; Lei, Xiaoguang; Jo, Kyubong; Tang, Xinjing

    2018-04-17

    Bioorthogonal metabolic DNA labeling with fluorochromes is a powerful strategy to visualize DNA molecules and their functions. Here, we report the development of a new DNA metabolic labeling strategy enabled by the catalyst-free bioorthogonal ligation using vinyl thioether modified thymidine and o-quinolinone quinone methide. With the newly designed vinyl thioether-modified thymidine (VTdT), we added labeling tags on cellular DNA, which could further be linked to fluorochromes in cells. Therefore, we successfully visualized the DNA localization within cells as well as single DNA molecules without other staining reagents. In addition, we further characterized this bioorthogonal DNA metabolic labeling using DNase I digestion, MS characterization of VTdT as well as VTdT-oQQF conjugate in cell nuclei or mitochondria. This technique provides a powerful strategy to study DNA in cells, which paves the way to achieve future spatiotemporal deciphering of DNA synthesis and functions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

    NASA Astrophysics Data System (ADS)

    Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

    2009-03-01

    We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

  8. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  9. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  10. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  11. Single-molecule imaging at high fluorophore concentrations by local activation of dye

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.

    Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

  12. Single-molecule imaging at high fluorophore concentrations by local activation of dye

    DOE PAGES

    Geertsema, Hylkje J.; Mangel, Walter F.; Schulte, Aartje C.; ...

    2015-02-17

    Single-molecule fluorescence microscopy is a powerful approach to observe biomolecular interactions with high spatial and temporal resolution. Detecting fluorescent signals from individual, labeled proteins above high levels of background fluorescence remains challenging, however. For this reason, the concentrations of labeled proteins in in vitro assays are often kept low compared to their in vivo concentrations. Here, we present a new fluorescence imaging technique by which single fluorescent molecules can be observed in real time at high, physiologically relevant concentrations. The technique requires a protein and its macromolecular substrate to be labeled each with a different fluorophore. Then, making use ofmore » short-distance energy-transfer mechanisms, the fluorescence from only those proteins bound to their substrate are selectively activated. This approach is demonstrated by labeling a DNA substrate with an intercalating stain, exciting the stain, and using energy transfer from the stain to activate the fluorescence of only those labeled DNA-binding proteins bound to the DNA. Such an experimental design allowed us to observe the sequence-independent interaction of Cy5-labeled interferon-inducible protein 16 (IFI16) with DNA and the sliding via one-dimensional diffusion of Cy5-labeled adenovirus protease (pVIc-AVP) on DNA in the presence of a background of hundreds of nM Cy5 fluorophore.« less

  13. Control of microtubule trajectory within an electric field by altering surface charge density

    PubMed Central

    Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

    2015-01-01

    One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins. PMID:25567007

  14. Control of microtubule trajectory within an electric field by altering surface charge density.

    PubMed

    Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji

    2015-01-08

    One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins.

  15. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    NASA Astrophysics Data System (ADS)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels, creating molecular barcodes, which are efficiently read using fluorescence resonance energy transfer techniques for minimizing noise from unincorporated labels. As such, our integrative approach for the realization of genomic analysis through nanoconfinement, named nanocoding, was demonstrated through the barcoding and mapping of bacterial artificial chromosomal molecules, thereby providing the basis for a high-throughput platform competent for whole genome investigations.

  16. Current-voltage characteristics of double stranded versus single stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

    2004-03-01

    Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

  17. Single DNA molecule detection using nanopipettes and nanoparticles.

    PubMed

    Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D

    2005-02-01

    Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.

  18. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

    PubMed

    Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

    2009-12-24

    Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

  19. Four-color single-molecule fluorescence with noncovalent dye labeling to monitor dynamic multimolecular complexes.

    PubMed

    DeRocco, Vanessa; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A; Weninger, Keith

    2010-11-01

    To enable studies of conformational changes within multimolecular complexes, we present a simultaneous, four-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera-based, wide-field detection. We further demonstrate labeling histidine-tagged proteins noncovalently with Tris-nitrilotriacetic acid (Tris-NTA)-conjugated dyes to achieve single molecule detection. We combine these methods to colocalize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes.

  20. Four-color single molecule fluorescence with noncovalent dye labeling to monitor dynamic multimolecular complexes

    PubMed Central

    DeRocco, Vanessa C.; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A.; Weninger, Keith

    2010-01-01

    To allow studies of conformational changes within multi-molecular complexes, we present a simultaneous, 4-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera based, wide-field detection. We further demonstrate labeling histidine-tagged proteins non-covalently with tris-Nitrilotriacetic acid (tris-NTA) conjugated dyes to achieve single molecule detection. We combine these methods to co-localize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes. PMID:21091445

  1. Distribution of distances between DNA barcode labels in nanochannels close to the persistence length

    NASA Astrophysics Data System (ADS)

    Reinhart, Wesley F.; Reifenberger, Jeff G.; Gupta, Damini; Muralidhar, Abhiram; Sheats, Julian; Cao, Han; Dorfman, Kevin D.

    2015-02-01

    We obtained experimental extension data for barcoded E. coli genomic DNA molecules confined in nanochannels from 40 nm to 51 nm in width. The resulting data set consists of 1 627 779 measurements of the distance between fluorescent probes on 25 407 individual molecules. The probability density for the extension between labels is negatively skewed, and the magnitude of the skewness is relatively insensitive to the distance between labels. The two Odijk theories for DNA confinement bracket the mean extension and its variance, consistent with the scaling arguments underlying the theories. We also find that a harmonic approximation to the free energy, obtained directly from the probability density for the distance between barcode labels, leads to substantial quantitative error in the variance of the extension data. These results suggest that a theory for DNA confinement in such channels must account for the anharmonic nature of the free energy as a function of chain extension.

  2. Topological events in single molecules of E. coli DNA confined in nanochannels

    PubMed Central

    Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

    2015-01-01

    We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

  3. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    NASA Astrophysics Data System (ADS)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  4. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    PubMed Central

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-01-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

  5. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.

    1995-04-11

    A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.

  6. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.

    1995-01-01

    Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.

  7. Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

    NASA Astrophysics Data System (ADS)

    Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

    2007-02-01

    We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

  8. Electrochemiluminescent DNA sensor based on controlled Zn-mediated grafting of diazonium precursors.

    PubMed

    Torréns, Mabel; Ortiz, Mayreli; Bejarano-Nosas, Diego; O'Sullivan, Ciara K

    2015-07-01

    Controlled Zn-mediated grafting of a thin layer of a diazonium salt was used to functionalise a carbon electrode with ruthenium(II)-tris-bipyridine (Ru)-labelled DNA for use as a capture probe in an electrochemiluminescent genosensor. A secondary reporter probe was labelled with a ferrocene (Fc) molecule, and in the presence of the single-stranded DNA target a genocomplex formed, where the Fc-label effectively quenched the electrochemiluminescence of the signal emitted from the Ru-label. The spacing of the labels for maximum sensitivity and minimum detection limit was optimised, and the signal reproducibility and stability of the method was established.

  9. Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.

    PubMed

    Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki

    2016-11-29

    DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.

  10. The unusual and dynamic character of PX-DNA

    DOE PAGES

    Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...

    2015-07-15

    PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less

  11. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  12. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed

    Horn, T; Chang, C A; Urdea, M S

    1997-12-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

  13. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed Central

    Horn, T; Chang, C A; Urdea, M S

    1997-01-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

  14. Label-Enhanced Surface Plasmon Resonance: A New Concept for Improved Performance in Optical Biosensor Analysis

    PubMed Central

    Granqvist, Niko; Hanning, Anders; Eng, Lars; Tuppurainen, Jussi; Viitala, Tapani

    2013-01-01

    Surface plasmon resonance (SPR) is a well-established optical biosensor technology with many proven applications in the study of molecular interactions as well as in surface and material science. SPR is usually applied in the label-free mode which may be advantageous in cases where the presence of a label may potentially interfere with the studied interactions per se. However, the fundamental challenges of label-free SPR in terms of limited sensitivity and specificity are well known. Here we present a new concept called label-enhanced SPR, which is based on utilizing strongly absorbing dye molecules in combination with the evaluation of the full shape of the SPR curve, whereby the sensitivity as well as the specificity of SPR is significantly improved. The performance of the new label-enhanced SPR method was demonstrated by two simple model assays: a small molecule assay and a DNA hybridization assay. The small molecule assay was used to demonstrate the sensitivity enhancement of the method, and how competitive assays can be used for relative affinity determination. The DNA assay was used to demonstrate the selectivity of the assay, and the capabilities in eliminating noise from bulk liquid composition variations. PMID:24217357

  15. Determination of helix orientations in a flexible DNA by multi-frequency EPR spectroscopy.

    PubMed

    Grytz, C M; Kazemi, S; Marko, A; Cekan, P; Güntert, P; Sigurdsson, S Th; Prisner, T F

    2017-11-15

    Distance measurements are performed between a pair of spin labels attached to nucleic acids using Pulsed Electron-Electron Double Resonance (PELDOR, also called DEER) spectroscopy which is a complementary tool to other structure determination methods in structural biology. The rigid spin label Ç, when incorporated pairwise into two helical parts of a nucleic acid molecule, allows the determination of both the mutual orientation and the distance between those labels, since Ç moves rigidly with the helix to which it is attached. We have developed a two-step protocol to investigate the conformational flexibility of flexible nucleic acid molecules by multi-frequency PELDOR. In the first step, a library with a broad collection of conformers, which are in agreement with topological constraints, NMR restraints and distances derived from PELDOR, was created. In the second step, a weighted structural ensemble of these conformers was chosen, such that it fits the multi-frequency PELDOR time traces of all doubly Ç-labelled samples simultaneously. This ensemble reflects the global structure and the conformational flexibility of the two-way DNA junction. We demonstrate this approach on a flexible bent DNA molecule, consisting of two short helical parts with a five adenine bulge at the center. The kink and twist motions between both helical parts were quantitatively determined and showed high flexibility, in agreement with a Förster Resonance Energy Transfer (FRET) study on a similar bent DNA motif. The approach presented here should be useful to describe the relative orientation of helical motifs and the conformational flexibility of nucleic acid structures, both alone and in complexes with proteins and other molecules.

  16. Logic Gate Operation by DNA Translocation through Biological Nanopores.

    PubMed

    Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

    2016-01-01

    Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

  17. Logic Gate Operation by DNA Translocation through Biological Nanopores

    PubMed Central

    Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

    2016-01-01

    Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568

  18. Methods for immobilizing nucleic acids on a gel substrate

    DOEpatents

    Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

    1999-01-01

    A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

  19. Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

    PubMed

    Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

    2016-12-15

    A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Scanning confocal fluorescence microscopy for single molecule analysis of nucleotide excision repair complexes.

    PubMed

    Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C

    2002-11-01

    We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.

  1. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  2. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

    2013-01-01

    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  3. Electron Paramagnetic Resonance of a Single NV Nanodiamond Attached to an Individual Biomolecule

    NASA Astrophysics Data System (ADS)

    Teeling-Smith, Richelle M.; Jung, Young Woo; Scozzaro, Nicolas; Cardellino, Jeremy; Rampersaud, Isaac; North, Justin A.; Šimon, Marek; Bhallamudi, Vidya P.; Rampersaud, Arfaan; Johnston-Halperin, Ezekiel; Poirier, Michael G.; Hammel, P. Chris

    2016-05-01

    A key limitation of electron paramagnetic resonance (EPR), an established and powerful tool for studying atomic-scale biomolecular structure and dynamics is its poor sensitivity, samples containing in excess of 10^12 labeled biomolecules are required in typical experiments. In contrast, single molecule measurements provide improved insights into heterogeneous behaviors that can be masked by ensemble measurements and are often essential for illuminating the molecular mechanisms behind the function of a biomolecule. We report EPR measurements of a single labeled biomolecule that merge these two powerful techniques. We selectively label an individual double-stranded DNA molecule with a single nanodiamond containing nitrogen-vacancy (NV) centers, and optically detect the paramagnetic resonance of NV spins in the nanodiamond probe. Analysis of the spectrum reveals that the nanodiamond probe has complete rotational freedom and that the characteristic time scale for reorientation of the nanodiamond probe is slow compared to the transverse spin relaxation time. This demonstration of EPR spectroscopy of a single nanodiamond labeled DNA provides the foundation for the development of single molecule magnetic resonance studies of complex biomolecular systems.

  4. Single-Molecule Electrical Random Resequencing of DNA and RNA

    NASA Astrophysics Data System (ADS)

    Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

    2012-07-01

    Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

  5. Label-free detection of real-time DNA amplification using a nanofluidic diffraction grating

    NASA Astrophysics Data System (ADS)

    Yasui, Takao; Ogawa, Kensuke; Kaji, Noritada; Nilsson, Mats; Ajiri, Taiga; Tokeshi, Manabu; Horiike, Yasuhiro; Baba, Yoshinobu

    2016-08-01

    Quantitative DNA amplification using fluorescence labeling has played an important role in the recent, rapid progress of basic medical and molecular biological research. Here we report a label-free detection of real-time DNA amplification using a nanofluidic diffraction grating. Our detection system observed intensity changes during DNA amplification of diffracted light derived from the passage of a laser beam through nanochannels embedded in a microchannel. Numerical simulations revealed that the diffracted light intensity change in the nanofluidic diffraction grating was attributed to the change of refractive index. We showed the first case reported to date for label-free detection of real-time DNA amplification, such as specific DNA sequences from tubercle bacilli (TB) and human papillomavirus (HPV). Since our developed system allows quantification of the initial concentration of amplified DNA molecules ranging from 1 fM to 1 pM, we expect that it will offer a new strategy for developing fundamental techniques of medical applications.

  6. How to measure separations and angles between intra-molecular fluorescent markers

    NASA Astrophysics Data System (ADS)

    Flyvbjerg, Henrik; Mortensen, Kim I.; Sung, Jongmin; Spudich, James A.

    We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each color-separated microscope image in a time-lapse movie and using only simple means, we simultaneously determine both the relative (x,y)-separation of the fluorophores and their individual orientations in space with accuracy and precision. The positions and orientations of two domains of the same molecule are thus time-resolved. Using short double-stranded DNA molecules internally labelled with two fixed fluorophores, we demonstrate the accuracy and precision of our method using the known structure of double-stranded DNA as a benchmark, resolve 10-base-pair differences in fluorophore separations, and determine the unique 3D orientation of each DNA molecule, thereby establishing short, double-labelled DNA molecules as probes of 3D orientation of anything to which one can attach them firmly. This work was supported by a Lundbeck fellowship to K.I.M; a Stanford Bio-X fellowship to J.S. and Grants from the NIH (GM33289) to J.A.S. and the Human Frontier Science Program (GP0054/2009-C) to J.A.S. and H.F.

  7. Two-Way Gold Nanoparticle Label-Free Sensing of Specific Sequence and Small Molecule Targets Using Switchable Concatemers.

    PubMed

    Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao

    2017-05-19

    A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.

  8. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  9. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  10. Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

    PubMed Central

    Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

    2003-01-01

    Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

  11. DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale

    PubMed Central

    Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.

    2015-01-01

    Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731

  12. Visualization of DNA molecules in time during electrophoresis

    NASA Technical Reports Server (NTRS)

    Lubega, Seth

    1991-01-01

    For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

  13. Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

    PubMed

    Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

    2018-02-07

    Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

  14. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    PubMed

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  15. Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

    PubMed

    Schneider, G J; Geiduschek, E P

    1990-06-25

    The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

  16. First results on label-free detection of DNA and protein molecules using a novel integrated sensor technology based on gravimetric detection principles.

    PubMed

    Gabl, R; Feucht, H-D; Zeininger, H; Eckstein, G; Schreiter, M; Primig, R; Pitzer, D; Wersing, W

    2004-01-15

    A novel integrated bio-sensor technology based on thin-film bulk acoustic wave resonators on silicon is presented and the feasibility of detecting DNA and protein molecules proofed. The detection principle of these sensors is label-free and relies on a resonance frequency shift caused by mass loading of an acoustic resonator, a principle very well known from quartz crystal micro balances. Integrated ZnO bulk acoustic wave resonators with resonance frequencies around 2 GHz have been fabricated, employing an acoustic mirror for isolation from the silicon substrate. DNA oligos have been thiol-coupled to the gold electrode by on-wafer dispensing. In a further step, samples have either been hybridised or alternatively a protein has been coupled to the receptor. The measurement results show the new bio-sensor being capable of both, detecting proteins as well as the DNA hybridisation without using a label. Due to the substantially higher oscillation frequency, these sensors already show much higher sensitivity and resolution comparable to quartz crystal micro balances. The potential for these sensors and sensors arrays as well as technological challenges will be discussed in detail.

  17. 48-spot single-molecule FRET setup with periodic acceptor excitation

    NASA Astrophysics Data System (ADS)

    Ingargiola, Antonino; Segal, Maya; Gulinatti, Angelo; Rech, Ivan; Labanca, Ivan; Maccagnani, Piera; Ghioni, Massimo; Weiss, Shimon; Michalet, Xavier

    2018-03-01

    Single-molecule Förster resonance energy transfer (smFRET) allows measuring distances between donor and acceptor fluorophores on the 3-10 nm range. Solution-based smFRET allows measurement of binding-unbinding events or conformational changes of dye-labeled biomolecules without ensemble averaging and free from surface perturbations. When employing dual (or multi) laser excitation, smFRET allows resolving the number of fluorescent labels on each molecule, greatly enhancing the ability to study heterogeneous samples. A major drawback to solution-based smFRET is the low throughput, which renders repetitive measurements expensive and hinders the ability to study kinetic phenomena in real-time. Here we demonstrate a high-throughput smFRET system that multiplexes acquisition by using 48 excitation spots and two 48-pixel single-photon avalanche diode array detectors. The system employs two excitation lasers allowing separation of species with one or two active fluorophores. The performance of the system is demonstrated on a set of doubly labeled double-stranded DNA oligonucleotides with different distances between donor and acceptor dyes along the DNA duplex. We show that the acquisition time for accurate subpopulation identification is reduced from several minutes to seconds, opening the way to high-throughput screening applications and real-time kinetics studies of enzymatic reactions such as DNA transcription by bacterial RNA polymerase.

  18. Probing the size of proteins with glass nanopores

    NASA Astrophysics Data System (ADS)

    Steinbock, L. J.; Krishnan, S.; Bulushev, R. D.; Borgeaud, S.; Blokesch, M.; Feletti, L.; Radenovic, A.

    2014-11-01

    Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process.Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05001k

  19. Imaging and sizing of single DNA molecules on a mobile phone.

    PubMed

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2014-12-23

    DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

  20. High Sensitivity Detection of CdSe/ZnS Quantum Dot-Labeled DNA Based on N-type Porous Silicon Microcavities

    PubMed Central

    Lv, Changwu; Jia, Zhenhong; Lv, Jie; Zhang, Hongyan; Li, Yanyu

    2017-01-01

    N-type macroporous silicon microcavity structures were prepared using electrochemical etching in an HF solution in the absence of light and oxidants. The CdSe/ZnS water-soluble quantum dot-labeled DNA target molecules were detected by monitoring the microcavity reflectance spectrum, which was characterized by the reflectance spectrum defect state position shift resulting from changes to the structures’ refractive index. Quantum dots with a high refractive index and DNA coupling can improve the detection sensitivity by amplifying the optical response signals of the target DNA. The experimental results show that DNA combined with a quantum dot can improve the sensitivity of DNA detection by more than five times. PMID:28045442

  1. High Sensitivity Detection of CdSe/ZnS Quantum Dot-Labeled DNA Based on N-type Porous Silicon Microcavities.

    PubMed

    Lv, Changwu; Jia, Zhenhong; Lv, Jie; Zhang, Hongyan; Li, Yanyu

    2017-01-01

    N-type macroporous silicon microcavity structures were prepared using electrochemical etching in an HF solution in the absence of light and oxidants. The CdSe/ZnS water-soluble quantum dot-labeled DNA target molecules were detected by monitoring the microcavity reflectance spectrum, which was characterized by the reflectance spectrum defect state position shift resulting from changes to the structures' refractive index. Quantum dots with a high refractive index and DNA coupling can improve the detection sensitivity by amplifying the optical response signals of the target DNA. The experimental results show that DNA combined with a quantum dot can improve the sensitivity of DNA detection by more than five times.

  2. One-to-one quantum dot-labeled single long DNA probes.

    PubMed

    He, Shibin; Huang, Bi-Hai; Tan, Junjun; Luo, Qing-Ying; Lin, Yi; Li, Jun; Hu, Yong; Zhang, Lu; Yan, Shihan; Zhang, Qi; Pang, Dai-Wen; Li, Lijia

    2011-08-01

    Quantum dots (QDs) have been received most attention due to their unique properties. Constructing QDs conjugated with certain number of biomolecules is considered as one of the most important research goals in nanobiotechnology. In this study, we report polymerase chain reaction (PCR) amplification of primer oligonucleotides bound to QDs, termed as QD-based PCR. Characterization of QD-based PCR products by gel electrophoresis and atomic force microscopy showed that QD-labeled long DNA strands were synthesized and only a single long DNA strand was conjugated with a QD. The QD-based PCR products still kept fluorescence properties. Moreover, the one-to-one QD-labeled long DNA conjugates as probes could detect a single-copy gene on maize chromosomes by fluorescence in situ hybridization. Labeling a single QD to a single long DNA will make detection of small single-copy DNA fragments, quantitative detection and single molecule imaging come true by nanotechnology, and it will promote medical diagnosis and basic biological research as well as nano-material fabrication. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Label-free in-flow detection of single DNA molecules using glass nanopipettes.

    PubMed

    Gong, Xiuqing; Patil, Amol V; Ivanov, Aleksandar P; Kong, Qingyuan; Gibb, Thomas; Dogan, Fatma; deMello, Andrew J; Edel, Joshua B

    2014-01-07

    With the view of enhancing the functionality of label-free single molecule nanopore-based detection, we have designed and developed a highly robust, mechanically stable, integrated nanopipette-microfluidic device which combines the recognized advantages of microfluidic systems and the unique properties/advantages of nanopipettes. Unlike more typical planar solid-state nanopores, which have inherent geometrical constraints, nanopipettes can be easily positioned at any point within a microfluidic channel. This is highly advantageous, especially when taking into account fluid flow properties. We show that we are able to detect and discriminate between DNA molecules of varying lengths when motivated through a microfluidic channel, upon the application of appropriate voltage bias across the nanopipette. The effects of applied voltage and volumetric flow rates have been studied to ascertain translocation event frequency and capture rate. Additionally, by exploiting the advantages associated with microfluidic systems (such as flow control and concomitant control over analyte concentration/presence), we show that the technology offers a new opportunity for single molecule detection and recognition in microfluidic devices.

  4. Single-molecule visualization of fast polymerase turnover in the bacterial replisome

    PubMed Central

    Lewis, Jacob S; Spenkelink, Lisanne M; Jergic, Slobodan; Wood, Elizabeth A; Monachino, Enrico; Horan, Nicholas P; Duderstadt, Karl E; Cox, Michael M; Robinson, Andrew; Dixon, Nicholas E; van Oijen, Antoine M

    2017-01-01

    The Escherichia coli DNA replication machinery has been used as a road map to uncover design rules that enable DNA duplication with high efficiency and fidelity. Although the enzymatic activities of the replicative DNA Pol III are well understood, its dynamics within the replisome are not. Here, we test the accepted view that the Pol III holoenzyme remains stably associated within the replisome. We use in vitro single-molecule assays with fluorescently labeled polymerases to demonstrate that the Pol III* complex (holoenzyme lacking the β2 sliding clamp), is rapidly exchanged during processive DNA replication. Nevertheless, the replisome is highly resistant to dilution in the absence of Pol III* in solution. We further show similar exchange in live cells containing labeled clamp loader and polymerase. These observations suggest a concentration-dependent exchange mechanism providing a balance between stability and plasticity, facilitating replacement of replisomal components dependent on their availability in the environment. DOI: http://dx.doi.org/10.7554/eLife.23932.001 PMID:28432790

  5. The origin of in situ hybridization - A personal history.

    PubMed

    Gall, Joseph G

    2016-04-01

    In situ hybridization is the technique by which specific RNA or DNA molecules are detected in cytological preparations. Basically it involves formation of a hybrid molecule between an endogenous single-stranded RNA or DNA in the cell and a complementary single-stranded RNA or DNA probe. In its original form the probe was labeled with (3)H and the hybrid was detected by autoradiography. The first successful experiments in 1968 involved detection of the highly amplified ribosomal DNA in oocytes of the frog Xenopus, followed soon after by the reiterated "satellite DNA" in mouse and Drosophila chromosomes. Fluorescent probes were developed about ten years later. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. DNA motion capture reveals the mechanical properties of DNA at the mesoscale.

    PubMed

    Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J

    2015-05-19

    Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  7. Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

    NASA Astrophysics Data System (ADS)

    Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

    2017-05-01

    We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

  8. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    NASA Astrophysics Data System (ADS)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  9. Enzymatic production of single-molecule FISH and RNA capture probes.

    PubMed

    Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

    2017-10-01

    Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. DNA conformation on surfaces measured by fluorescence self-interference.

    PubMed

    Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R

    2006-02-21

    The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

  11. Label-free probing of genes by time-domain terahertz sensing.

    PubMed

    Haring Bolivar, P; Brucherseifer, M; Nagel, M; Kurz, H; Bosserhoff, A; Büttner, R

    2002-11-07

    A label-free sensing approach for the label-free characterization of genetic material with terahertz (THz) electromagnetic waves is presented. Time-resolved THz analysis of polynucleotides demonstrates a strong dependence of the complex refractive index of DNA molecules in the THz frequency range on their hybridization state. By monitoring THz signals one can thus infer the binding state (hybridized or denatured) of oligo- and polynucleotides, enabling the label-free determination the genetic composition of unknown DNA sequences. A broadband experimental proof-of-principle in a freespace analytic configuration, as well as a higher-sensitivity approach using integrated THz sensors reaching femtomol detection levels and demonstrating the capability to detect single-base mutations, are presented. The potential application for next generation high-throughput label-free genetic analytic systems is discussed.

  12. On-chip PMA labeling of foodborne pathogenic bacteria for viable qPCR and qLAMP detection

    USDA-ARS?s Scientific Manuscript database

    Propidium monoazide (PMA) is a membrane impermeable molecule that covalently bonds to double stranded DNA when exposed to light and inhibits the polymerase activity, thus enabling DNA amplification detection protocols that discriminate between viable and non-viable entities. Here, we present a micro...

  13. Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

    PubMed

    Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

    2007-03-01

    Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

  14. High-throughput single-molecule telomere characterization.

    PubMed

    McCaffrey, Jennifer; Young, Eleanor; Lassahn, Katy; Sibert, Justin; Pastor, Steven; Riethman, Harold; Xiao, Ming

    2017-11-01

    We have developed a novel method that enables global subtelomere and haplotype-resolved analysis of telomere lengths at the single-molecule level. An in vitro CRISPR/Cas9 RNA-directed nickase system directs the specific labeling of human (TTAGGG)n DNA tracts in genomes that have also been barcoded using a separate nickase enzyme that recognizes a 7-bp motif genome-wide. High-throughput imaging and analysis of large DNA single molecules from genomes labeled in this fashion using a nanochannel array system permits mapping through subtelomere repeat element (SRE) regions to unique chromosomal DNA while simultaneously measuring the (TTAGGG)n tract length at the end of each large telomere-terminal DNA segment. The methodology also permits subtelomere and haplotype-resolved analyses of SRE organization and variation, providing a window into the population dynamics and potential functions of these complex and structurally variant telomere-adjacent DNA regions. At its current stage of development, the assay can be used to identify and characterize telomere length distributions of 30-35 discrete telomeres simultaneously and accurately. The assay's utility is demonstrated using early versus late passage and senescent human diploid fibroblasts, documenting the anticipated telomere attrition on a global telomere-by-telomere basis as well as identifying subtelomere-specific biases for critically short telomeres. Similarly, we present the first global single-telomere-resolved analyses of two cancer cell lines. © 2017 McCaffrey et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    PubMed

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Sequential strand displacement beacon for detection of DNA coverage on functionalized gold nanoparticles.

    PubMed

    Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris

    2014-06-17

    Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.

  17. Single-Molecule Encoders for Tracking Motor Proteins on DNA

    NASA Astrophysics Data System (ADS)

    Lipman, Everett A.

    2012-02-01

    Devices such as inkjet printers and disk drives track position and velocity using optical encoders, which produce periodic signals precisely synchronized with linear or rotational motion. We have implemented this technique at the nanometer scale by labeling DNA with regularly spaced fluorescent dyes. The resulting molecular encoders can be used in several ways for high-resolution continuous tracking of individual motor proteins. These measurements do not require mechanical coupling to macroscopic instrumentation, are automatically calibrated by the underlying structure of DNA, and depend on signal periodicity rather than absolute level. I will describe the synthesis of single-molecule encoders, data from and modeling of experiments on a helicase and a DNA polymerase, and some ideas for future work.

  18. 3'-End labeling of nucleic acids by a polymerase ribozyme.

    PubMed

    Samanta, Biswajit; Horning, David P; Joyce, Gerald F

    2018-06-13

    A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

  19. Supercoiled circular DNA of an insect granulosis virus

    PubMed Central

    Tweeten, Kathleen A.; Bulla, Lee A.; Consigli, Richard A.

    1977-01-01

    The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of 3H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 × 106 by sedimentation in neutral sucrose and 78 × 106 by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 × 106. The buoyant density of the granulosis virus DNA was 1.703 g/cm3 and that of its insect host DNA was 1.697 g/cm3. Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively. Images PMID:198791

  20. Supercoiled circular DNA of an insect granulosis virus.

    PubMed

    Tweeten, K A; Bulla, L A; Consigli, R A

    1977-08-01

    The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.

  1. Combining crystallography and EPR: crystal and solution structures of the multidomain cochaperone DnaJ

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de; Brosi, Richard W. W.; Steinmetz, Andrea

    2013-08-01

    The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein,more » but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.« less

  2. Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haab, B.B.; Mathies, R.A.

    A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

  3. “Ultra-high resolution optical trap with single fluorophore sensitivity”

    PubMed Central

    Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R

    2013-01-01

    We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286

  4. Part-per-trillion level detection of estradiol by competitive fluorescence immunoassay using DNA/dye conjugate as antibody multiple labels.

    PubMed

    Zhu, Shengchao; Zhang, Qin; Guo, Liang-Hong

    2008-08-22

    Fluorescent organic dyes are currently the standard signal-generating labels used in microarray quantification. However, new labeling strategies are needed to meet the demand for high sensitivity in the detection of low-abundance proteins and small molecules. In this report, a long-chain DNA/dye conjugate was used to attach multiple fluorescence labels on antibodies to improve signal intensity and immunoassay sensitivity. Compared with the 30 base-pair (bp) oligonucleotide used in our previous work [Q. Zhang, L.-H. Guo, Bioconjugate Chem. 18 (2007) 1668-1672], conjugation of a 219 bp DNA in solution with a fluorescent DNA binder SYBR Green I resulted in more than sixfold increase in signal intensity, consistent with the increase in bp number. In a direct immunoassay for the detection of goat anti-mouse IgG in a mouse IgG-coated 96-well plate, the long DNA conjugate label also produced higher fluorescence than the short one, accompanied by about 15-fold improvement in the detection limit. To demonstrate its advantage in real applications, the DNA/dye conjugate was employed in the competitive immunoassay of 17beta-estradiol, a clinically and environmentally important analyte. The biotin-terminated DNA was attached to biotinylated anti-estradiol antibody through the biotin/streptavidin/biotin bridge after the immuno-reaction was completed, followed by conjugation with SYBR Green I. The limit of detection for 17beta-estradiol is 1.9 pg mL(-1), which is 200-fold lower than the assay using fluorescein-labeled antibodies. The new multiple labeling strategy uses readily available reagents, and is also compatible with current biochip platform. It has great potential in the sensitive detection of protein and antibody microarrays.

  5. Computer simulation of gene detection without PCR by single molecule detection

    NASA Astrophysics Data System (ADS)

    Davis, Lloyd M.; Williams, John G.; Lamb, Don T.

    1999-01-01

    Pioneer Hi-Bred is developing a low-cost method for rapid screening of DNA, for use in research on elite crop seed genetics. Unamplified genomic DNA with the requisite base sequence is simultaneously labeled by two different colored fluorescent probes, which hybridize near the selected gene. Dual-channel single molecule detection (SMD) within a flow cell, then provides a sensitive and specific assay for the gene. The technique has been demonstrated using frequency- doubled Nd:YAG laser excitation of two visible-wavelength dyes. A prototype instrument employing infrared fluorophores and laser diodes for excitation has been developed. Here, we report results from a Monte Carlo simulation of the new instrument, in which experimentally determined photophysical parameters for candidate infrared dyes are used for parametric studies of experimental operating conditions. Fluorophore photostability is found to be a key factor in determining the instrument sensitivity. Most infrared dyes have poor photostability, resulting in inefficient SMD. However, the normalized cross-correlation function of the photon signals from each of the two channels can still yield a discernable peak, provided that the concentration of dual- labeled molecules is sufficiently high. Further, for low concentrations, processing of the two photon streams with Gaussian -weighted sliding sum digital filters and selection of simultaneously occurring peaks can also provide a sensitive indicator of the presence of dual-labeled molecules, although accidental coincidences must be considered in the interpretation of results.

  6. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

    PubMed Central

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

    2011-01-01

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

  7. Beyond sequencing: optical mapping of DNA in the age of nanotechnology and nanoscopy.

    PubMed

    Levy-Sakin, Michal; Ebenstein, Yuval

    2013-08-01

    Next generation sequencing (NGS) is revolutionizing all fields of biological research but it fails to extract the full range of information associated with genetic material. Optical mapping of DNA grants access to genetic and epigenetic information on individual DNA molecules up to ∼1 Mbp in length. Fluorescent labeling of specific sequence motifs, epigenetic marks and other genomic information on individual DNA molecules generates a high content optical barcode along the DNA. By stretching the DNA to a linear configuration this barcode may be directly visualized by fluorescence microscopy. We discuss the advances of these methods in light of recent developments in nano-fabrication and super-resolution optical imaging (nanoscopy) and review the latest achievements of optical mapping in the context of genomic analysis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Single-molecule study of thymidine glycol and i-motif through the alpha-hemolysin ion channel

    NASA Astrophysics Data System (ADS)

    He, Lidong

    Nanopore-based devices have emerged as a single-molecule detection and analysis tool for a wide range of applications. Through electrophoretically driving DNA molecules across a nanosized pore, a lot of information can be received, including unfolding kinetics and DNA-protein interactions. This single-molecule method has the potential to sequence kilobase length DNA polymers without amplification or labeling, approaching "the third generation" genome sequencing for around $1000 within 24 hours. alpha-Hemolysin biological nanopores have the advantages of excellent stability, low-noise level, and precise site-directed mutagenesis for engineering this protein nanopore. The first work presented in this thesis established the current signal of the thymidine glycol lesion in DNA oligomers through an immobilization experiment. The thymidine glycol enantiomers were differentiated from each other by different current blockage levels. Also, the effect of bulky hydrophobic adducts to the current blockage was investigated. Secondly, the alpha-hemolysin nanopore was used to study the human telomere i-motif and RET oncogene i-motif at a single-molecule level. In Chapter 3, it was demonstrated that the alpha-hemolysin nanopore can differentiate an i-motif form and single-strand DNA form at different pH values based on the same sequence. In addition, it shows potential to differentiate the folding topologies generated from the same DNA sequence.

  9. Method for producing labeled single-stranded nucleic acid probes

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-10-19

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  10. Modulation-frequency encoded multi-color fluorescent DNA analysis in an optofluidic chip.

    PubMed

    Dongre, Chaitanya; van Weerd, Jasper; Besselink, Geert A J; Vazquez, Rebeca Martinez; Osellame, Roberto; Cerullo, Giulio; van Weeghel, Rob; van den Vlekkert, Hans H; Hoekstra, Hugo J W M; Pollnau, Markus

    2011-02-21

    We introduce a principle of parallel optical processing to an optofluidic lab-on-a-chip. During electrophoretic separation, the ultra-low limit of detection achieved with our set-up allows us to record fluorescence from covalently end-labeled DNA molecules. Different sets of exclusively color-labeled DNA fragments-otherwise rendered indistinguishable by spatio-temporal coincidence-are traced back to their origin by modulation-frequency-encoded multi-wavelength laser excitation, fluorescence detection with a single ultrasensitive, albeit color-blind photomultiplier, and Fourier analysis decoding. As a proof of principle, fragments obtained by multiplex ligation-dependent probe amplification from independent human genomic segments, associated with genetic predispositions to breast cancer and anemia, are simultaneously analyzed.

  11. Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays

    PubMed Central

    2011-01-01

    Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more fluorescent molecules per RNA fragment. PMID:21235785

  12. LABELLING OF NUCLEIC ACID WITH RADIOACTIVE ISOTOPES AND THEIR APPLICATION (in Yugoslavian)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Becarevic, A.; Hudnik-Plevnik, T.; Glisin, V.

    The DNA of the liver and spleen of rats was labeled with P/sup 32/. The specific activity obtained was high enough to be able to follow the fate of these acids after injection in irradiated and non-irradiated rats. The results show that, after injection in the rats, the labeled kids were degraded into small fragmnts, which were utilized as building blocks for the synthesis of the big molecules of the cells. (auth)

  13. Localization of DNA and RNA in eosinophil secretory granules.

    PubMed

    Behzad, Ali R; Walker, David C; Abraham, Thomas; McDonough, John; Mahmudi-Azer, Salahadin; Chu, Fanny; Shaheen, Furquan; Hogg, James C; Paré, Peter D

    2010-01-01

    Although the accepted paradigm is that the proteins stored in eosinophil crystalloid granules are translated from messenger RNA transcribed in the cell nucleus, recent ultrastructural evidence suggests that protein synthesis may also take place within eosinophilic granules. We used 2 different methods to detect the presence of DNA and RNA in eosinophil secretory granules. Using bromodeoxyuridine, a thymidine analogue, and bromouridine, a uracil analogue, we labeled the DNA and RNA in eosinophils in vivo in rabbits. Immunoelectron microscopy to localize these molecules was performed on ultrathin sections of blood and bone marrow eosinophils using monoclonal anti-bromodeoxyuridine antibody with IgG as a control. The immunogold grain density was measured in each subcellular compartment within the eosinophils and analyzed using image analysis software. A combination of DNA/CD63 immunofluorescence staining and a fluorescently labeled molecular probe that stains RNA was used to examine the presence of DNA and RNA in the secretory granules of human blood eosinophils. The mean density of bromodeoxyuridine-labeled DNA and bromouridine-labeled RNA immunogold grains in the secretory granules of blood and bone marrow eosinophils were significantly higher (p < 0.0005) than cytoplasmic or background staining. We also demonstrated the existence of DNA and RNA in the CD63-positive secretory granules of human peripheral blood eosinophils by means of immunofluorescent staining and a fluorescently labeled molecular probe. These results provide evidence that eosinophil granules are the site of DNA and RNA synthesis and suggest the potential for a new role(s) for eosinophil-secretory granules. Copyright 2009 S. Karger AG, Basel.

  14. Homogeneous electrochemical immunoassay of aflatoxin B1 in foodstuff using proximity-hybridization-induced omega-like DNA junctions and exonuclease III-triggered isothermal cycling signal amplification.

    PubMed

    Tang, Juan; Huang, Yapei; Liu, Huiqiong; Zhang, Cengceng; Tang, Dianping

    2016-12-01

    A new homogeneous electrochemical immunosensing platform was designed for sensitive detection of aflatoxin B 1 (AFB 1 ) in foodstuff. The system consisted of anti-AFB 1 antibody labeled DNA 1 (Ab-DNA 1 ), AFB 1 -bovine serum albumin (BSA)-conjugated DNA 2 (AFB 1 -DNA 2 ), and methylene blue functionalized hairpin DNA. Owing to a specific antigen-antibody reaction between anti-AFB 1 and AFB 1 -BSA, the immunocomplex formed assisted the proximity hybridization of DNA 1 with DNA 2 , thus resulting in the formation of an omega-like DNA junction. Thereafter, the junction opened the hairpin DNA to construct a new double-stranded DNA, which could be readily cleaved by exonuclease III to release the omega-like DNA junction and methylene blue. The dissociated DNA junction could repeatedly hybridize with residual hairpin DNA molecules with exonuclease III-based isothermal cycling amplification, thereby releasing numerous free methylene blue molecules into the detection solution. The as-produced free methylene blue molecules could be captured by a negatively charged indium tin oxide electrode, each of which could produce an electronic signal within the applied potentials. On introduction of target AFB 1 , the analyte competed with AFB 1 -DNA 2 for the conjugated anti-AFB 1 on the Ab-DNA 1 , subsequently decreasing the amount of omega-like DNA junctions formed, hence causing methylene blue labeled hairpin DNA to move far away from the electrode surface. Under optimal conditions the detectable electrochemical signal decreased with increasing amount of target AFB 1 in a dynamic working range of 0.01-30 ng mL -1 with a detection limit of 4.8 pg mL -1 . In addition, the precision and reproducibility of this system were acceptable. Finally, the method was further evaluated for analysis of naturally contaminated or AFB 1 -spiked peanut samples, giving results that matched well with those obtained with a commercial AFB 1 ELISA kit.

  15. Homology Between Burkitt Herpes Viral DNA and DNA in Continuous Lymphoblastoid Cells from Patients with Infectious Mononucleosis

    PubMed Central

    Kieff, Elliott; Levine, Judith

    1974-01-01

    At least 90% of the sequences of purified, in vitro labeled, DNA from Epstein-Barr virus (prepared from HR-1, Burkitt's lymphoblastoid cells) are homologous to the DNA of the herpes virus contained in cell lines derived from patients with infectious mononucleosis. The thermal stability of the homologous and heterologous hybrid DNA molecules could not be differentiated, indicating at least 97% matching of base pairs between DNA of Epstein-Barr virus and the herpes viral DNA contained in the lymphoblasts from patients with infectious mononucleosis. PMID:4360941

  16. Integrated planar terahertz resonators for femtomolar sensitivity label-free detection of DNA hybridization.

    PubMed

    Nagel, Michael; Bolivar, Peter Haring; Brucherseifer, Martin; Kurz, Heinrich; Bosserhoff, Anja; Büttner, Reinhard

    2002-04-01

    A promising label-free approach for the analysis of genetic material by means of detecting the hybridization of polynucleotides with electromagnetic waves at terahertz (THz) frequencies is presented. Using an integrated waveguide approach, incorporating resonant THz structures as sample carriers and transducers for the analysis of the DNA molecules, we achieve a sensitivity down to femtomolar levels. The approach is demonstrated with time-domain ultrafast techniques based on femtosecond laser pulses for generating and electro-optically detecting broadband THz signals, although the principle can certainly be transferred to other THz technologies.

  17. Agarose droplet microfluidics for highly parallel and efficient single molecule emulsion PCR.

    PubMed

    Leng, Xuefei; Zhang, Wenhua; Wang, Chunming; Cui, Liang; Yang, Chaoyong James

    2010-11-07

    An agarose droplet method was developed for highly parallel and efficient single molecule emulsion PCR. The method capitalizes on the unique thermoresponsive sol-gel switching property of agarose for highly efficient DNA amplification and amplicon trapping. Uniform agarose solution droplets generated via a microfluidic chip serve as robust and inert nanolitre PCR reactors for single copy DNA molecule amplification. After PCR, agarose droplets are gelated to form agarose beads, trapping all amplicons in each reactor to maintain the monoclonality of each droplet. This method does not require cocapsulation of primer labeled microbeads, allows high throughput generation of uniform droplets and enables high PCR efficiency, making it a promising platform for many single copy genetic studies.

  18. Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

    PubMed Central

    Ren, Xiaomei; El-Sagheer, Afaf H.; Brown, Tom

    2016-01-01

    A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

  19. Intracellular Delivery of a Planar DNA Origami Structure by the Transferrin-Receptor Internalization Pathway.

    PubMed

    Schaffert, David H; Okholm, Anders H; Sørensen, Rasmus S; Nielsen, Jesper S; Tørring, Thomas; Rosen, Christian B; Kodal, Anne Louise B; Mortensen, Michael R; Gothelf, Kurt V; Kjems, Jørgen

    2016-05-01

    DNA origami provides rapid access to easily functionalized, nanometer-sized structures making it an intriguing platform for the development of defined drug delivery and sensor systems. Low cellular uptake of DNA nanostructures is a major obstacle in the development of DNA-based delivery platforms. Herein, significant strong increase in cellular uptake in an established cancer cell line by modifying a planar DNA origami structure with the iron transport protein transferrin (Tf) is demonstrated. A variable number of Tf molecules are coupled to the origami structure using a DNA-directed, site-selective labeling technique to retain ligand functionality. A combination of confocal fluorescence microscopy and quantitative (qPCR) techniques shows up to 22-fold increased cytoplasmic uptake compared to unmodified structures and with an efficiency that correlates to the number of transferrin molecules on the origami surface. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. The influence of ionic strength on DNA diffusion in gel networks

    NASA Astrophysics Data System (ADS)

    Fu, Yuanxi; Jee, Ah-Young; Kim, Hyeong-Ju; Granick, Steve

    Cations are known to reduce the rigidity of the DNA molecules by screening the negative charge along the sugar phosphate backbone. This was established by optical tweezer pulling experiment of immobilized DNA strands. However, little is known regarding the influence of ions on the motion of DNA molecules as they thread through network meshes. We imaged in real time the Brownian diffusion of fluorescent labeled lambda-DNA in an agarose gel network in the presence of salt with monovalent or multivalent cations. Each movie was analyzed using home-written program to yield a trajectory of center of the mass and the accompanying history of the shape fluctuations. One preliminary finding is that ionic strength has a profound influence on the slope of the trace of mean square displacement (MSD) versus time. The influence of ionic strength on DNA diffusion in gel networks.

  1. Direct Correlation of DNA Binding and Single Protein Domain Motion via Dual Illumination Fluorescence Microscopy

    PubMed Central

    2015-01-01

    We report a dual illumination, single-molecule imaging strategy to dissect directly and in real-time the correlation between nanometer-scale domain motion of a DNA repair protein and its interaction with individual DNA substrates. The strategy was applied to XPD, an FeS cluster-containing DNA repair helicase. Conformational dynamics was assessed via FeS-mediated quenching of a fluorophore site-specifically incorporated into XPD. Simultaneously, binding of DNA molecules labeled with a spectrally distinct fluorophore was detected by colocalization of the DNA- and protein-derived signals. We show that XPD undergoes thermally driven conformational transitions that manifest in spatial separation of its two auxiliary domains. DNA binding does not strictly enforce a specific conformation. Interaction with a cognate DNA damage, however, stabilizes the compact conformation of XPD by increasing the weighted average lifetime of this state by 140% relative to an undamaged DNA. Our imaging strategy will be a valuable tool to study other FeS-containing nucleic acid processing enzymes. PMID:25204359

  2. Mechanisms of Surface-Mediated DNA Hybridization

    PubMed Central

    2015-01-01

    Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278

  3. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  4. Double nanohole optical tweezers visualize protein p53 suppressing unzipping of single DNA-hairpins

    PubMed Central

    Kotnala, Abhay; Gordon, Reuven

    2014-01-01

    Here we report on the use of double-nanohole (DNH) optical tweezers as a label-free and free-solution single-molecule probe for protein–DNA interactions. Using this approach, we demonstrate the unzipping of individual 10 base pair DNA-hairpins, and quantify how tumor suppressor p53 protein delays the unzipping. From the Arrhenius behavior, we find the energy barrier to unzipping introduced by p53 to be 2 × 10−20 J, whereas cys135ser mutant p53 does not show suppression of unzipping, which gives clues to its functional inability to suppress tumor growth. This transformative approach to single molecule analysis allows for ultra-sensitive detection and quantification of protein–DNA interactions to revolutionize the fight against genetic diseases. PMID:24940547

  5. DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.

    PubMed

    Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason

    2017-11-21

    Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.

  6. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  7. A novel label-free fluorescence strategy for methyltransferase activity assay based on dsDNA-templated copper nanoparticles coupled with an endonuclease-assisted signal transduction system.

    PubMed

    Lai, Q Q; Liu, M D; Gu, C C; Nie, H G; Xu, X J; Li, Z H; Yang, Z; Huang, S M

    2016-02-21

    Evaluating DNA methyltransferase (MTase) activity has received considerable attention due to its significance in the fields of early cancer clinical diagnostics and drug discovery. Herein, we proposed a novel label-free fluorescence method for MTase activity assay by coupling double-stranded DNA (dsDNA)-templated copper nanoparticles (CuNPs) with an endonuclease-assisted signal transduction system. In this strategy, dsDNA molecules were first methylated by DNA adenine methylation (Dam) MTase and then cleaved by the methylation-sensitive restriction endonuclease DpnI. The cleaved DNA fragments could not act as efficient templates for the formation of fluorescent CuNPs and thus no fluorescence signal was produced. Under optimized experimental conditions, the developed strategy exhibited a sensitive fluorescence response to Dam MTase activity. This strategy was also demonstrated to provide an excellent platform to the inhibitor screening for Dam MTase. These results demonstrated the great potential for the practical applications of the proposed strategy for Dam MTase activity assay.

  8. Superresolution intrinsic fluorescence imaging of chromatin utilizing native, unmodified nucleic acids for contrast

    PubMed Central

    Dong, Biqin; Almassalha, Luay M.; Stypula-Cyrus, Yolanda; Urban, Ben E.; Chandler, John E.; Nguyen, The-Quyen; Sun, Cheng; Zhang, Hao F.; Backman, Vadim

    2016-01-01

    Visualizing the nanoscale intracellular structures formed by nucleic acids, such as chromatin, in nonperturbed, structurally and dynamically complex cellular systems, will help expand our understanding of biological processes and open the next frontier for biological discovery. Traditional superresolution techniques to visualize subdiffractional macromolecular structures formed by nucleic acids require exogenous labels that may perturb cell function and change the very molecular processes they intend to study, especially at the extremely high label densities required for superresolution. However, despite tremendous interest and demonstrated need, label-free optical superresolution imaging of nucleotide topology under native nonperturbing conditions has never been possible. Here we investigate a photoswitching process of native nucleotides and present the demonstration of subdiffraction-resolution imaging of cellular structures using intrinsic contrast from unmodified DNA based on the principle of single-molecule photon localization microscopy (PLM). Using DNA-PLM, we achieved nanoscopic imaging of interphase nuclei and mitotic chromosomes, allowing a quantitative analysis of the DNA occupancy level and a subdiffractional analysis of the chromosomal organization. This study may pave a new way for label-free superresolution nanoscopic imaging of macromolecular structures with nucleotide topologies and could contribute to the development of new DNA-based contrast agents for superresolution imaging. PMID:27535934

  9. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology.

    PubMed

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H

    2011-11-27

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    PubMed

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  11. Detecting RNA/DNA hybridization using double-labeled donor probes with enhanced fluorescence resonance energy transfer signals.

    PubMed

    Okamura, Yukio; Watanabe, Yuichiro

    2006-01-01

    Fluorescence resonance energy transfer (FRET) occurs when two fluorophores are in close proximity, and the emission energy of a donor fluorophore is transferred to excite an acceptor fluorophore. Using such fluorescently labeled oligonucleotides as FRET probes, makes possible specific detection of RNA molecules even if similar sequences are present in the environment. A higher ratio of signal to background fluorescence is required for more sensitive probe detection. We found that double-labeled donor probes labeled with BODIPY dye resulted in a remarkable increase in fluorescence intensity compared to single-labeled donor probes used in conventional FRET. Application of this double-labeled donor system can improve a variety of FRET techniques.

  12. The colibactin warhead crosslinks DNA

    NASA Astrophysics Data System (ADS)

    Vizcaino, Maria I.; Crawford, Jason M.

    2015-05-01

    Members of the human microbiota are increasingly being correlated to human health and disease states, but the majority of the underlying microbial metabolites that regulate host-microbe interactions remain largely unexplored. Select strains of Escherichia coli present in the human colon have been linked to the initiation of inflammation-induced colorectal cancer through an unknown small-molecule-mediated process. The responsible non-ribosomal peptide-polyketide hybrid pathway encodes ‘colibactin’, which belongs to a largely uncharacterized family of small molecules. Genotoxic small molecules from this pathway that are capable of initiating cancer formation have remained elusive due to their high instability. Guided by metabolomic analyses, here we employ a combination of NMR spectroscopy and bioinformatics-guided isotopic labelling studies to characterize the colibactin warhead, an unprecedented substituted spirobicyclic structure. The warhead crosslinks duplex DNA in vitro, providing direct experimental evidence for colibactin's DNA-damaging activity. The data support unexpected models for both colibactin biosynthesis and its mode of action.

  13. Enhancing the Sensitivity of DNA Microarray Using Dye-Doped Silica Nanoparticles: Detection of Human Papilloma Virus

    NASA Astrophysics Data System (ADS)

    Enrichi, F.; Riccò, R.; Meneghello, A.; Pierobon, R.; Canton, G.; Cretaio, E.

    2010-10-01

    DNA microarray is a high-throughput technology used for detection and quantification of nucleic acid molecules and others of biological interest. The analysis is based on the specific hybridization between probe sequences deposited in array and a target ss-DNA amplified by PCR and functionalized by a fluorescent dye. Organic labels have well known disadvantages like photobleaching and low signal intensities, which put a limitation to the lower amount of DNA material that can be detected. Therefore for trace analysis the development of more efficient biomarkers is required. With this aim we present in this paper the synthesis and application of alternative hybrid nanosystems obtained by incorporating standard fluorescent molecules into monodisperse silica nanoparticles. Efficient application to the detection of Human Papilloma Virus is demonstrated. This virus is associated to the formation of cervical cancer, a leading cause of death by cancer for women worldwide. It is shown that the use of the novel biomarkers increases the optical signal of about one order of magnitude with respect to the free dyes or quantum dots in conventional instruments. This is due to the high number of molecules that can be accommodated into each nanoparticle, to the reduced photobleaching and to the improved environmental protection of the dyes when encapsulated in the silica matrix. The cheap and easy synthesis of these luminescent particles, the stability in water, the surface functionalizability and bio-compatibility make them very promising for present and future bio-labeling and bio-imaging applications.

  14. Droplet Microfluidics for Compartmentalized Cell Lysis and Extension of DNA from Single-Cells

    NASA Astrophysics Data System (ADS)

    Zimny, Philip; Juncker, David; Reisner, Walter

    Current single cell DNA analysis methods suffer from (i) bias introduced by the need for molecular amplification and (ii) limited ability to sequence repetitive elements, resulting in (iii) an inability to obtain information regarding long range genomic features. Recent efforts to circumvent these limitations rely on techniques for sensing single molecules of DNA extracted from single-cells. Here we demonstrate a droplet microfluidic approach for encapsulation and biochemical processing of single-cells inside alginate microparticles. In our approach, single-cells are first packaged inside the alginate microparticles followed by cell lysis, DNA purification, and labeling steps performed off-chip inside this microparticle system. The alginate microparticles are then introduced inside a micro/nanofluidic system where the alginate is broken down via a chelating buffer, releasing long DNA molecules which are then extended inside nanofluidic channels for analysis via standard mapping protocols.

  15. High-Throughput Block Optical DNA Sequence Identification.

    PubMed

    Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant

    2018-01-01

    Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Long-range barcode labeling-sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Feng; Zhang, Tao; Singh, Kanwar K.

    Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.

  17. Accelerator mass spectrometry in the biomedical sciences: applications in low-exposure biomedical and environmental dosimetry

    NASA Astrophysics Data System (ADS)

    Felton, J. S.; Turteltaub, K. W.; Vogel, J. S.; Balhorn, R.; Gledhill, B. L.; Southon, J. R.; Caffee, M. W.; Finkel, R. C.; Nelson, D. E.; Proctor, I. D.; Davis, J. C.

    1990-12-01

    We are utilizing accelerator mass spectrometry as a sensitive detector for tracking the disposition of radioisotopically labeled molecules in the biomedical sciences. These applications have shown the effectiveness of AMS as a tool to quantify biologically important molecules at extremely low levels. For example, AMS is being used to determine the amount of carcinogen covalently bound to animal DNA (DNA adduct) at levels relevent to human exposure. Detection sensitivities are 1 carcinogen molecule bound in 1011 to 1012 DNA bases, depending on the specific activity of the radiolabeled carcinogen. Studies have been undertaken in our laboratory utilizing heterocyclic amine food-borne carcinogens and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a potent environmental carcinogen, to study the metabolism of carcinogens at low doses. In addition, AMS is being used to detect the presence of rare proteins (mutant forms of protamine) in human sperm. Approximately l per 106 sperm analyzed contain the rare form of the protamine. Protamine isolated from this small number of cells is being analyzed by AMS, following 14C labeling. Thus, AMS can be used to verify the identity of an extremely small amount of biological material. Furthermore, an additional improvement of 2 orders of magnitude in the sensitivity of biomédical tracer studies is suggested by preliminary work with bacterial hosts depleted in radiocarbon. Other problems in the life sciences where detection sensitivity or sample sizes are limitations should also benefit from AMS. Studies are underway to measure the molecular targeting of cancer chemotherapeutics in human tissue and to pursue applications for receptor biology. We are also applying other candidate isotopes, such as 3H (double labeling with 14C) and 41Ca (bone absorption) to problems in biology. The detection of 36Cl and 26Al have applications for determination of human neutron exposure and understanding neurological toxicity, respectively. The results described here with 14C-labeled molecules coupled with new isotope applications clearly show AMS technology to be an important new tool for the biomedical sciences community.

  18. Capillary array scanner for time-resolved detection and identification of fluorescently labelled DNA fragments.

    PubMed

    Neumann, M; Herten, D P; Dietrich, A; Wolfrum, J; Sauer, M

    2000-02-25

    The first capillary array scanner for time-resolved fluorescence detection in parallel capillary electrophoresis based on semiconductor technology is described. The system consists essentially of a confocal fluorescence microscope and a x,y-microscope scanning stage. Fluorescence of the labelled probe molecules was excited using a short-pulse diode laser emitting at 640 nm with a repetition rate of 50 MHz. Using a single filter system the fluorescence decays of different labels were detected by an avalanche photodiode in combination with a PC plug-in card for time-correlated single-photon counting (TCSPC). The time-resolved fluorescence signals were analyzed and identified by a maximum likelihood estimator (MLE). The x,y-microscope scanning stage allows for discontinuous, bidirectional scanning of up to 16 capillaries in an array, resulting in longer fluorescence collection times per capillary compared to scanners working in a continuous mode. Synchronization of the alignment and measurement process were developed to allow for data acquisition without overhead. Detection limits in the subzeptomol range for different dye molecules separated in parallel capillaries have been achieved. In addition, we report on parallel time-resolved detection and separation of more than 400 bases of single base extension DNA fragments in capillary array electrophoresis. Using only semiconductor technology the presented technique represents a low-cost alternative for high throughput DNA sequencing in parallel capillaries.

  19. Polymer physics experiments with single DNA molecules

    NASA Astrophysics Data System (ADS)

    Smith, Douglas E.

    1999-11-01

    Bacteriophage DNA molecules were taken as a model flexible polymer chain for the experimental study of polymer dynamics at the single molecule level. Video fluorescence microscopy was used to directly observe the conformational dynamics of fluorescently labeled molecules, optical tweezers were used to manipulate individual molecules, and micro-fabricated flow cells were used to apply controlled hydrodynamic strain to molecules. These techniques constitute a powerful new experimental approach in the study of basic polymer physics questions. I have used these techniques to study the diffusion and relaxation of isolated and entangled polymer molecules and the hydrodynamic deformation of polymers in elongational and shear flows. These studies revealed a rich, and previously unobserved, ``molecular individualism'' in the dynamical behavior of single molecules. Individual measurements on ensembles of identical molecules allowed the average conformation to be determined as well as the underlying probability distributions for molecular conformation. Scaling laws, that predict the dependence of properties on chain length and concentration, were also tested. The basic assumptions of the reptation model were directly confirmed by visualizing the dynamics of entangled chains.

  20. Artificial plasmid labeled with 5-bromo-2'-deoxyuridine: a universal molecular system for strand break detection.

    PubMed

    Zylicz-Stachula, Agnieszka; Polska, Katarzyna; Skowron, Piotr; Rak, Janusz

    2014-07-07

    DNA strand breaks (SBs) are among the most cytotoxic forms of DNA damage, and their residual levels correlate directly with cell death. Hence, the type and amount of SBs is directly related to the efficacy of a given anticancer therapy. In this study, we describe a molecular tool that can differentiate between single (SSBs) and double (DSBs) strand breaks and also assess them quantitatively. Our method involves PCR amplification of a linear DNA fragment labeled with a sensitizing nucleotide, circularization of that fragment, and enzymatic introduction of supercoils to transform the circular relaxed form of the synthesized plasmid into a supercoiled one. After exposure of the molecule to a damaging factor, SSB and DSB levels can be easily assayed with gel electrophoresis. We applied this method to prepare an artificial plasmid labeled with 5-bromo-2'-deoxyuridine and to assay SBs photoinduced in the synthesized plasmid. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

    PubMed Central

    Nelson, P S; Kent, M; Muthini, S

    1992-01-01

    Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185

  2. Nanofabrication technique based on localized photocatalytic reactions using a TiO2-coated atomic force microscopy probe

    NASA Astrophysics Data System (ADS)

    Shibata, Takayuki; Iio, Naohiro; Furukawa, Hiromi; Nagai, Moeto

    2017-02-01

    We performed a fundamental study on the photocatalytic degradation of fluorescently labeled DNA molecules immobilized on titanium dioxide (TiO2) thin films under ultraviolet irradiation. The films were prepared by the electrochemical anodization of Ti thin films sputtered on silicon substrates. We also confirmed that the photocurrent arising from the photocatalytic oxidation of DNA molecules can be detected during this process. We then demonstrated an atomic force microscopy (AFM)-based nanofabrication technique by employing TiO2-coated AFM probes to penetrate living cell membranes under near-physiological conditions for minimally invasive intracellular delivery.

  3. Nanosecond to submillisecond dynamics in dye-labeled single-stranded DNA, as revealed by ensemble measurements and photon statistics at single-molecule level.

    PubMed

    Kaji, Takahiro; Ito, Syoji; Iwai, Shigenori; Miyasaka, Hiroshi

    2009-10-22

    Single-molecule and ensemble time-resolved fluorescence measurements were applied for the investigation of the conformational dynamics of single-stranded DNA, ssDNA, connected with a fluorescein dye by a C6 linker, where the motions both of DNA and the C6 linker affect the geometry of the system. From the ensemble measurement of the fluorescence quenching via photoinduced electron transfer with a guanine base in the DNA sequence, three main conformations were found in aqueous solution: a conformation unaffected by the guanine base in the excited state lifetime of fluorescein, a conformation in which the fluorescence is dynamically quenched in the excited-state lifetime, and a conformation leading to rapid quenching via nonfluorescent complex. The analysis by using the parameters acquired from the ensemble measurements for interphoton time distribution histograms and FCS autocorrelations by the single-molecule measurement revealed that interconversion in these three conformations took place with two characteristic time constants of several hundreds of nanoseconds and tens of microseconds. The advantage of the combination use of the ensemble measurements with the single-molecule detections for rather complex dynamic motions is discussed by integrating the experimental results with those obtained by molecular dynamics simulation.

  4. DNA concentration modulation on supported lipid bilayers switched by surface acoustic waves.

    PubMed

    Hennig, Martin; Wolff, Manuel; Neumann, Jürgen; Wixforth, Achim; Schneider, Matthias F; Rädler, Joachim O

    2011-12-20

    Spatially addressable arrays of molecules embedded in or anchored to supported lipid bilayers are important for on-chip screening and binding assays; however, methods to sort or accumulate components in a fluid membrane on demand are still limited. Here we apply in-plane surface acoustic shear waves (SAWs) to laterally accumulate double-stranded DNA segments electrostatically bound to a cationic supported lipid bilayer. The fluorescently labeled DNA segments are found to segregate into stripe patterns with a spatial frequency corresponding to the periodicity of the standing SAW wave (~10 μm). The DNA molecules are accumulated 10-fold in the regions of SAW antinodes. The superposition of two orthogonal sets of SAW sources creates checkerboard like arrays of DNA demonstrating the potential to generate arrayed fields dynamically. The pattern relaxation time of 0.58 s, which is independent of the segment length, indicates a sorting and relaxation mechanism dominated by lipid diffusion rather than DNA self-diffusion. © 2011 American Chemical Society

  5. DNA-based Nanoconstructs for the Detection of Ions and Biomolecules with Related Raman/SERS Signature Studies

    NASA Astrophysics Data System (ADS)

    Brenneman, Kimber L.

    The utilization of DNA aptamers and semiconductor quantum dots (QDs) for the detection of ions and biomolecules was investigated. In recent years, there have been many studies based on the use of DNA and RNA aptamers, which are single stranded oligonucleotides capable of binding to biomolecules, other molecules, and ions. In many of these cases, the conformational changes of these DNA and RNA aptamers are suitable to use fluorescence resonant energy transfer (FRET) or nanometal surface energy transfer (NSET) techniques to detect such analytes. Coupled with this growth in such uses of aptamers, there has been an expanded use of semiconductor quantum dots as brighter, longer-lasting alternatives to fluorescent dyes in labeling and detection techniques of interest in biomedicine and environmental monitoring. Thrombin binding aptamer (TBA) and a zinc aptamer were used to detect mercury, lead, zinc, and cadmium. These probes were tested in a liquid assay as well as on a filter paper coupon. Biomolecules were also studied and detected using surface-enhanced Raman spectroscopy (SERS), including DNA aptamers and C-reactive protein (CRP). Raman spectroscopy is a useful tool for sensor development, label-free detection, and has the potential for remote sensing. Raman spectra provide information on the vibrational modes or phonons, between and within molecules. Therefore, unique spectral fingerprints for single molecules can be obtained. SERS is accomplished through the use of substrates with nanometer scale geometries made of metals with many free electrons, such as silver, gold, or copper. In this research silver SERS substrates were used to study the SERS signature of biomolecules that typically produce very weak Raman signals.

  6. Mechanisms of inactivation of bacteriophage phiX174 and its DNA in aerosols by ozone and ozonized cyclohexene.

    PubMed Central

    de Mik, G.; de Groot, I.

    1977-01-01

    The mechanisms of inactivation of aerosolized bacteriophage phiX174 in atmospheres containing ozone, cyclohexene, or ozonized cyclohexene were studied by using 32P-labelled phage. The inactivation of the aerosolized phage in clear air or in air containing cyclohexene is due to damage of the protein coat since the deoxyribonucleic acid (DNA) extracted from the inactivated phage retains its biological activity. Inactivation of the phage in air containing ozonized cyclohexene is due both to protein and DNA damage. Sucrose gradient analysis shows that aerosolized inactivated phiX174 releases unbroken DNA. In contrast, the DNA from phage phiX174 inactivated by ozonized cyclohexene is broken. The inactivation of aerosolized phage phiX174-DNA was studied in the same atmospheres using 32P-labelled DNA. phiX174-DNA aerosolized in clear air or air containing cyclohexene at 75% r.h. is inactivated by a factor of 2 in 30 min. The inactivated DNA is broken. Ozone as well as ozonized cyclohexene inactivates KNA very fast causing breaks in the molecule. This is in contrast with the intact bacteriophage in which ozone does not produce breaks in the DNA. PMID:265342

  7. Emerging applications of label-free optical biosensors

    NASA Astrophysics Data System (ADS)

    Zanchetta, Giuliano; Lanfranco, Roberta; Giavazzi, Fabio; Bellini, Tommaso; Buscaglia, Marco

    2017-01-01

    Innovative technical solutions to realize optical biosensors with improved performance are continuously proposed. Progress in material fabrication enables developing novel substrates with enhanced optical responses. At the same time, the increased spectrum of available biomolecular tools, ranging from highly specific receptors to engineered bioconjugated polymers, facilitates the preparation of sensing surfaces with controlled functionality. What remains often unclear is to which extent this continuous innovation provides effective breakthroughs for specific applications. In this review, we address this challenging question for the class of label-free optical biosensors, which can provide a direct signal upon molecular binding without using secondary probes. Label-free biosensors have become a consolidated approach for the characterization and screening of molecular interactions in research laboratories. However, in the last decade, several examples of other applications with high potential impact have been proposed. We review the recent advances in label-free optical biosensing technology by focusing on the potential competitive advantage provided in selected emerging applications, grouped on the basis of the target type. In particular, direct and real-time detection allows the development of simpler, compact, and rapid analytical methods for different kinds of targets, from proteins to DNA and viruses. The lack of secondary interactions facilitates the binding of small-molecule targets and minimizes the perturbation in single-molecule detection. Moreover, the intrinsic versatility of label-free sensing makes it an ideal platform to be integrated with biomolecular machinery with innovative functionality, as in case of the molecular tools provided by DNA nanotechnology.

  8. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  9. Classic maximum entropy recovery of the average joint distribution of apparent FRET efficiency and fluorescence photons for single-molecule burst measurements.

    PubMed

    DeVore, Matthew S; Gull, Stephen F; Johnson, Carey K

    2012-04-05

    We describe a method for analysis of single-molecule Förster resonance energy transfer (FRET) burst measurements using classic maximum entropy. Classic maximum entropy determines the Bayesian inference for the joint probability describing the total fluorescence photons and the apparent FRET efficiency. The method was tested with simulated data and then with DNA labeled with fluorescent dyes. The most probable joint distribution can be marginalized to obtain both the overall distribution of fluorescence photons and the apparent FRET efficiency distribution. This method proves to be ideal for determining the distance distribution of FRET-labeled biomolecules, and it successfully predicts the shape of the recovered distributions.

  10. Detecting and identifying DNA via the THz backbone frequency using a metamaterial-based label-free biosensor

    NASA Astrophysics Data System (ADS)

    Mirzaei, Sahar; Green, Nicolas G.; Rotaru, Mihai; Pu, Suan Hui

    2017-02-01

    In genetic diagnostics, laboratory-based equipment generally uses analytical techniques requiring complicated and expensive fluorescent labelling of target DNA molecules. Intense research effort into, and commercial development of, Point-of-Care diagnostics and Personalized Healthcare are driving the development of simple, fast and cost-effective detection methods. One potential label-free DNA detection method uses Terahertz (THz) spectroscopy of the natural responses of DNA in metamaterial structures, which are engineered to have properties that are impossible to obtain in natural materials. This paper presents a study of the development of metamaterials based on asymmetric X-shaped resonator inclusions as a functional sensor for DNA. Gold X-shaped resonator structures with dimensions of 90/85 μm were demonstrated to produce trapped mode resonant frequency in the correct range for DNA detection. Realistic substrate materials in the form of 375 μm thick quartz were investigated, demonstrating that the non-transparent nature of the material resulted in the production of standing waves, affecting the system response, as well as requiring a reduction in scale of the resonator of 85%. As a result, the effect of introducing etched windows in the substrate material were investigated, demonstrating that increased window size significantly reduces the effect of the substrate on the system response. The device design showed a good selectivity when RNA samples were introduced to the model, demonstrating the potential for this design of device in the development of sensors capable of performing cheap and simple genetic analysis of DNA, giving label-free detection at high sensitivity.

  11. A universal DNA-based protein detection system.

    PubMed

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

    2013-09-25

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  12. A Universal DNA-Based Protein Detection System

    PubMed Central

    Tran, Thua N. N.; Cui, Jinhui; Hartman, Mark R.; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C.; Lis, John T.; Cui, Haixin; Luo, Dan

    2014-01-01

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability. PMID:23978265

  13. Quantitative analysis of small molecule-nucleic acid interactions with a biosensor surface and surface plasmon resonance detection.

    PubMed

    Liu, Yang; Wilson, W David

    2010-01-01

    Surface plasmon resonance (SPR) technology with biosensor surfaces has become a widely-used tool for the study of nucleic acid interactions without any labeling requirements. The method provides simultaneous kinetic and equilibrium characterization of the interactions of biomolecules as well as small molecule-biopolymer binding. SPR monitors molecular interactions in real time and provides significant advantages over optical or calorimetic methods for systems with strong binding coupled to small spectroscopic signals and/or reaction heats. A detailed and practical guide for nucleic acid interaction analysis using SPR-biosensor methods is presented. Details of the SPR technology and basic fundamentals are described with recommendations on the preparation of the SPR instrument, sensor chips, and samples, as well as extensive information on experimental design, quantitative and qualitative data analysis and presentation. A specific example of the interaction of a minor-groove-binding agent with DNA is evaluated by both kinetic and steady-state SPR methods to illustrate the technique. Since the molecules that bind cooperatively to specific DNA sequences are attractive for many applications, a cooperative small molecule-DNA interaction is also presented.

  14. Quantitative nanoscale imaging of orientational order in biological filaments by polarized superresolution microscopy

    PubMed Central

    Valades Cruz, Cesar Augusto; Shaban, Haitham Ahmed; Kress, Alla; Bertaux, Nicolas; Monneret, Serge; Mavrakis, Manos; Savatier, Julien; Brasselet, Sophie

    2016-01-01

    Essential cellular functions as diverse as genome maintenance and tissue morphogenesis rely on the dynamic organization of filamentous assemblies. For example, the precise structural organization of DNA filaments has profound consequences on all DNA-mediated processes including gene expression, whereas control over the precise spatial arrangement of cytoskeletal protein filaments is key for mechanical force generation driving animal tissue morphogenesis. Polarized fluorescence is currently used to extract structural organization of fluorescently labeled biological filaments by determining the orientation of fluorescent labels, however with a strong drawback: polarized fluorescence imaging is indeed spatially limited by optical diffraction, and is thus unable to discriminate between the intrinsic orientational mobility of the fluorophore labels and the real structural disorder of the labeled biomolecules. Here, we demonstrate that quantitative single-molecule polarized detection in biological filament assemblies allows not only to correct for the rotational flexibility of the label but also to image orientational order of filaments at the nanoscale using superresolution capabilities. The method is based on polarized direct stochastic optical reconstruction microscopy, using dedicated optical scheme and image analysis to determine both molecular localization and orientation with high precision. We apply this method to double-stranded DNA in vitro and microtubules and actin stress fibers in whole cells. PMID:26831082

  15. Single molecule actuation and detection on a lab-on-a-chip magnetoresistive platform

    NASA Astrophysics Data System (ADS)

    Chaves, R. C.; Bensimon, D.; Freitas, P. P.

    2011-03-01

    On-chip magnetic tweezers based on current loops were integrated with magnetoresistive sensors. Magnetic forces up to 1.0±0.3pN are produced to actuate on DNA anchored to the surface of a flow cell and labeled with micrometer-sized magnetic beads. The levitation of the beads stretches the immobilized DNA. The relative position of the magnetic beads is monitored using spin-valve sensors. A bead vertical displacement resolution of 60nm is derived for DNA molecular motor activity in a tweezer steady current regime.

  16. Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

    PubMed

    Zakian, V A; Brewer, B J; Fangman, W L

    1979-08-01

    Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA molecule is identical to that which controls the initiation of chromosomal DNA.

  17. Electrochemical sensing and biosensing platform based on chemically reduced graphene oxide.

    PubMed

    Zhou, Ming; Zhai, Yueming; Dong, Shaojun

    2009-07-15

    In this paper, the characterization and application of a chemically reduced graphene oxide modified glassy carbon (CR-GO/GC) electrode, a novel electrode system, for the preparation of electrochemical sensing and biosensing platform are proposed. Different kinds of important inorganic and organic electroactive compounds (i.e., probe molecule (potassium ferricyanide), free bases of DNA (guanine (G), adenine (A), thymine (T), and cytosine (C)), oxidase/dehydrogenase-related molecules (hydrogen peroxide (H2O2)/beta-nicotinamide adenine dinucleotide (NADH)), neurotransmitters (dopamine (DA)), and other biological molecules (ascorbic acid (AA), uric acid (UA), and acetaminophen (APAP)) were employed to study their electrochemical responses at the CR-GO/GC electrode, which shows more favorable electron transfer kinetics than graphite modified glassy carbon (graphite/GC) and glassy carbon (GC) electrodes. The greatly enhanced electrochemical reactivity of the four free bases of DNA at the CR-GO/GC electrode compared with that at graphite/GC and GC electrodes makes the CR-GO/GC electrode a better choice for the electrochemical biosensing of four DNA bases in both the single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) at physiological pH without a prehydrolysis step. This allows us to detect a single-nucleotide polymorphism (SNP) site for short oligomers with a particular sequence at the CR-GO/GC electrode without any hybridization or labeling processes in this work, suggesting the potential applications of CR-GO in the label-free electrochemical detection of DNA hybridization or DNA damage for further research. Based on the greatly enhanced electrochemical reactivity of H2O2 and NADH at the CR-GO/GC electrode, CR-GO/GC electrode-based bioelectrodes (in connection with glucose oxidase (GOD) and alcohol dehydrogenase (ADH)) show a better analytical performance for the detection of glucose and ethanol compared with graphite/GC- or GC-based bioelectrodes. By comparing the electrochemical performance of CR-GO with that of the conventional graphite and GC, we reveal that CR-GO with the nature of a single sheet showing favorable electrochemical activity should be a kind of more robust and advanced carbon electrode material which may hold great promise for electrochemical sensors and biosensors design.

  18. A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes

    PubMed Central

    Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom

    2017-01-01

    This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528

  19. Addressable configurations of DNA nanostructures for rewritable memory

    PubMed Central

    Levchenko, Oksana; Patel, Dhruv S.; MacIsaac, Molly

    2017-01-01

    Abstract DNA serves as nature's information storage molecule, and has been the primary focus of engineered systems for biological computing and data storage. Here we combine recent efforts in DNA self-assembly and toehold-mediated strand displacement to develop a rewritable multi-bit DNA memory system. The system operates by encoding information in distinct and reversible conformations of a DNA nanoswitch and decoding by gel electrophoresis. We demonstrate a 5-bit system capable of writing, erasing, and rewriting binary representations of alphanumeric symbols, as well as compatibility with ‘OR’ and ‘AND’ logic operations. Our strategy is simple to implement, requiring only a single mixing step at room temperature for each operation and standard gel electrophoresis to read the data. We envision such systems could find use in covert product labeling and barcoding, as well as secure messaging and authentication when combined with previously developed encryption strategies. Ultimately, this type of memory has exciting potential in biomedical sciences as data storage can be coupled to sensing of biological molecules. PMID:28977499

  20. Highly sensitive electrochemical detection of DNA hybridisation by coupling the chemical reduction of a redox label to the electrode reaction of a solution phase mediator.

    PubMed

    Ngoensawat, Umphan; Rijiravanich, Patsamon; Somasundrum, Mithran; Surareungchai, Werasak

    2014-11-21

    We have described a highly sensitive method for detecting DNA hybridisation using a redox-labeled stem loop probe. The redox labels were poly(styrene-co-acrylic) (PSA) spheres of 454 nm diameter, modified by methylene blue (MB) deposited alternatively with poly(sodium 4-styrene sulphonate) (PSS) in a layer-by-layer process. Each PSA sphere carried approx. 3.7 × 10(5) molecules of MB, as determined optically. DIG-tagged stem loop probes were immobilised on screen printed electrodes bearing anti-DIG antibodies. Binding with the target enabled straightening of the stem loop, which made attachment to the MB-coated PSA spheres possible. For measuring the current from the direct reduction of MB by differential pulse voltammetry, a 30 mer DNA target common to 70 strains of Escherichia coli was calibrated across the range 1.0 fM to 100 pM (gradient = 3.2 × 10(-8) A (log fM)(-1), r(2) = 0.95, n = 60), with an LOD of ∼58 fM. By using Fe(CN)6(3-/4-) as a solution phase mediator for the MB reduction, we were able to lower the LOD to ∼39 aM (gradient = 5.95 × 10(-8) A (log aM)(-1), r(2) = 0.96, n = 30), which corresponds to the detection of 0.76 ag (∼50 molecules) in the 2 μL analyte sample. We hypothesise that the lowering of the LOD was due to the fact that not all the MB labels were able to contact the electrode surface.

  1. Synthesis and biosynthesis of {sup 13}C-, {sup 15}N-labeled deoxynucleosides useful for biomolecular structural determinations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ashburn, D.A.; Garcia, K.; Hanners, J.L.

    Currently, there is a great emphasis on elucidating the structure, function, and dynamics of DNA. Much of the research involved in this study uses nuclear magnetic resonance (NMR) spectroscopy. Effective use of NMR spectroscopy for DNA molecules with mw > 10,000 requires stable isotope enrichment. We present strategies for site-specific isotopic labeling of the purine bases adenosine and guanosine and the biosynthesis of (U-{sup 13}C, {sup 15}N) DNA from methylotropic bacteria. With commercially available 6-chloropurine, an effective two-step route leads to 2{prime}-deoxy-(amino-{sup 15}N)adenosine (dA). The resulting d(amino-{sup 15}N)A is used in a series of reactions to synthesize 2{prime}-deoxy-(2-{sup 13}C,1,amino-{sup 15}N{submore » 2})guanosine or any combination thereof. An improved biosynthesis of labeled DNA has been accomplished using Methylobacterium extorquens AS1. Each liter of growth medium contains 4 g of methanol to yield 1 g of lyophilized cells. As much as 200 mg of RNA per liter of culture has been obtained. We are currently developing large-scale isolation protocols. General synthetic pathways to oligomeric DNA will be presented.« less

  2. A universal aptameric biosensor: Multiplexed detection of small analytes via aggregated perylene-based broad-spectrum quencher.

    PubMed

    Hu, Rong; Zhang, Xi; Xu, Qiang; Lu, Dan-Qing; Yang, Yun-Hui; Xu, Quan-Qing; Ruan, Qiong; Mo, Liu-Ting; Zhang, Xiao-Bing

    2017-06-15

    A universal aptameric system based on the taking advantage of double-stranded DNA/perylene diimide (dsDNA/PDI) as the signal probe was developed for multiplexed detection of small molecules. Aptamers are single-stranded DNA or RNA oligonucleotides which are selected in vitro by a process known as systematic evolution of ligands by exponential enrichment. In this work, we synthesized a new kind of PDI and reported this aggregated PDI could quench the double-stranded DNA (dsDNA)-labeled fluorophores with a high quenching efficiency. The quenching efficiencies on the fluorescence of FAM, TAMRA and Cy5 could reach to 98.3%±0.9%, 97.2%±0.6% and 98.1%±1.1%, respectively. This broad-spectrum quencher was then adopted to construct a multicolor biosensor via a label-free approach. A structure-switching-triggered enzymatic recycling amplification was employed for signal amplification. High quenching efficiency combined with autocatalytic target recycling amplification afforded the biosensor with high sensitivity towards small analytes. For other targets, changing the corresponding aptamer can achieve the goal. The quencher did not interfere with the catalytic activity of nuclease. The biosensor could be manipulated with similar sensitivity no matter in pre-addition or post-addition manner. Moreover, simultaneous and multiplexed analysis of several small molecules in homogeneous solution was achieved, demonstrating its potential application in the rapid screening of multiple biotargets. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Efficient methods for attaching non-radioactive labels to the 5' ends of synthetic oligodeoxyribonucleotides.

    PubMed Central

    Agrawal, S; Christodoulou, C; Gait, M J

    1986-01-01

    The syntheses are described of two types of linker molecule useful for the specific attachment of non-radioactive labels such as biotin and fluorophores to the 5' terminus of synthetic oligodeoxyribonucleotides. The linkers are designed such that they can be coupled to the oligonucleotide as a final step in solid-phase synthesis using commercial DNA synthesis machines. Increased sensitivity of biotin detection was possible using an anti-biotin hybridoma/peroxidase detection system. PMID:3748808

  4. Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

    2004-01-01

    There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

  5. Fluorescent Labeling of COS-7 Expressing SNAP-tag Fusion Proteins for Live Cell Imaging

    PubMed Central

    Provost, Christopher R.; Sun, Luo

    2010-01-01

    SNAP-tag and CLIP-tag protein labeling systems enable the specific, covalent attachment of molecules, including fluorescent dyes, to a protein of interest in live cells. These systems offer a broad selection of fluorescent substrates optimized for a range of imaging instrumentation. Once cloned and expressed, the tagged protein can be used with a variety of substrates for numerous downstream applications without having to clone again. There are two steps to using this system: cloning and expression of the protein of interest as a SNAP-tag fusion, and labeling of the fusion with the SNAP-tag substrate of choice. The SNAP-tag is a small protein based on human O6-alkylguanine-DNA-alkyltransferase (hAGT), a DNA repair protein. SNAP-tag labels are dyes conjugated to guanine or chloropyrimidine leaving groups via a benzyl linker. In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the SNAP-tag. CLIP-tag is a modified version of SNAP-tag, engineered to react with benzylcytosine rather than benzylguanine derivatives. When used in conjunction with SNAP-tag, CLIP-tag enables the orthogonal and complementary labeling of two proteins simultaneously in the same cells. PMID:20485262

  6. Label-Free Direct Electronic Detection of Biomolecules with Amorphous Silicon Nanostructures

    PubMed Central

    Lund, John; Mehta, Ranjana; Parviz, Babak A.

    2007-01-01

    We present the fabrication and characterization of a nano-scale sensor made of amorphous silicon for the label-free, electronic detection of three classes of biologically important molecules: ions, oligonucleotides, and proteins. The sensor structure has an active element which is a 50 nm wide amorphous silicon semicircle and has a total footprint of less than 4 μm2. We demonstrate the functionalization of the sensor with receptor molecules and the electronic detection of three targets: H+ ions, short single-stranded DNAs, and streptavidin. The sensor is able to reliably distinguish single base-pair mismatches in 12 base long strands of DNA and monitor the introduction and identification of straptavidin in real-time. The versatile sensor structure can be readily functionalized with a wide range of receptor molecules and is suitable for integration with high-speed electronic circuits as a post-process on an integrated circuit chip. PMID:17292148

  7. High-throughput, dual probe biological assays based on single molecule detection

    DOEpatents

    Hollars, Christopher W [Brentwood, CA; Huser, Thomas R [Livermore, CA; Lane, Stephen M [Oakland, CA; Balhorn, Rodney L [Livermore, CA; Bakajin, Olgica [San Leandro, CA; Darrow, Christopher [Pleasanton, CA; Satcher, Jr., Joe H.

    2006-07-11

    A method and apparatus with the sensitivity to detect and identify single target molecules through the localization of dual, fluorescently labeled probe molecules. This can be accomplished through specific attachment of the taget to a surface or in a two-dimensional (2D) flowing fluid sheet having approximate dimensions of 0.5 .mu.m.times.100 .mu.m.times.100 .mu.m. A device using these methods would have 10.sup.3 10.sup.4 greater throughput than previous one-dimensional (1D) micro-stream devices having 1 .mu.m.sup.3 interrogation volumes and would for the first time allow immuno- and DNA assays at ultra-low (femtomolar) concentrations to be performed in short time periods (.about.10 minutes). The use of novel labels (such as metal or semiconductor nanoparticles) may be incorporated to further extend the sensitivity possibly into the attomolar range.

  8. Classic Maximum Entropy Recovery of the Average Joint Distribution of Apparent FRET Efficiency and Fluorescence Photons for Single-molecule Burst Measurements

    PubMed Central

    DeVore, Matthew S.; Gull, Stephen F.; Johnson, Carey K.

    2012-01-01

    We describe a method for analysis of single-molecule Förster resonance energy transfer (FRET) burst measurements using classic maximum entropy. Classic maximum entropy determines the Bayesian inference for the joint probability describing the total fluorescence photons and the apparent FRET efficiency. The method was tested with simulated data and then with DNA labeled with fluorescent dyes. The most probable joint distribution can be marginalized to obtain both the overall distribution of fluorescence photons and the apparent FRET efficiency distribution. This method proves to be ideal for determining the distance distribution of FRET-labeled biomolecules, and it successfully predicts the shape of the recovered distributions. PMID:22338694

  9. Single-molecule studies of multi-protein machines

    NASA Astrophysics Data System (ADS)

    van Oijen, Antoine

    2010-03-01

    Advances in optical imaging and molecular manipulation techniques have made it possible to observe individual enzymes and record molecular movies that provide new insight into their dynamics and reaction mechanisms. In a biological context, most of these enzymes function in concert with other enzymes in multi-protein complexes, so an important future direction will be the utilization of single-molecule techniques to unravel the orchestration of large macromolecular assemblies. Our group is developing the single-molecule tools that will make it possible to study biochemical pathways of arbitrary complexity at the single-molecule level. I will discuss results of single-molecule experiments on the replisome, the molecular machinery that is responsible for replication of DNA. We stretch individual DNA molecules and use their elastic properties to obtain dynamic information on the proteins that unwind the double helix and copy its genetic information. Furthermore, we visualize fluorescently labeled components of the replisome and thus obtain information on stochiometry and exchange kinetics. This simultaneous observation of catalytic activity and composition allows us to gain deeper insight into the structure-function relationship of the replisome.

  10. Chemo-mechanical pushing of proteins along single-stranded DNA.

    PubMed

    Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M

    2016-05-31

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

  11. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  12. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  13. The Dynamics of Entangled DNA Networks using Single-Molecule Methods

    NASA Astrophysics Data System (ADS)

    Chapman, Cole David

    Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

  14. Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

    PubMed

    Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

    2012-04-25

    A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

  15. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    PubMed

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Controllable assembly and disassembly of nanoparticle systems via protein and DNA agents

    DOEpatents

    Lee, Soo-Kwan; Gang, Oleg; van der Lelie, Daniel

    2014-05-20

    The invention relates to the use of peptides, proteins, and other oligomers to provide a means by which normally quenched nanoparticle fluorescence may be recovered upon detection of a target molecule. Further, the inventive technology provides a structure and method to carry out detection of target molecules without the need to label the target molecules before detection. In another aspect, a method for forming arbitrarily shaped two- and three-dimensional protein-mediated nanoparticle structures and the resulting structures are described. Proteins mediating structure formation may themselves be functionalized with a variety of useful moieties, including catalytic functional groups.

  17. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    PubMed Central

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  18. In vitro assembly of semi-artificial molecular machine and its use for detection of DNA damage.

    PubMed

    Minchew, Candace L; Didenko, Vladimir V

    2012-01-11

    Naturally occurring bio-molecular machines work in every living cell and display a variety of designs. Yet the development of artificial molecular machines centers on devices capable of directional motion, i.e. molecular motors, and on their scaled-down mechanical parts (wheels, axels, pendants etc). This imitates the macro-machines, even though the physical properties essential for these devices, such as inertia and momentum conservation, are not usable in the nanoworld environments. Alternative designs, which do not follow the mechanical macromachines schemes and use mechanisms developed in the evolution of biological molecules, can take advantage of the specific conditions of the nanoworld. Besides, adapting actual biological molecules for the purposes of nano-design reduces potential dangers the nanotechnology products may pose. Here we demonstrate the assembly and application of one such bio-enabled construct, a semi-artificial molecular device which combines a naturally-occurring molecular machine with artificial components. From the enzymology point of view, our construct is a designer fluorescent enzyme-substrate complex put together to perform a specific useful function. This assembly is by definition a molecular machine, as it contains one. Yet, its integration with the engineered part - fluorescent dual hairpin - re-directs it to a new task of labeling DNA damage. Our construct assembles out of a 32-mer DNA and an enzyme vaccinia topoisomerase I (VACC TOPO). The machine then uses its own material to fabricate two fluorescently labeled detector units (Figure 1). One of the units (green fluorescence) carries VACC TOPO covalently attached to its 3'end and another unit (red fluorescence) is a free hairpin with a terminal 3'OH. The units are short-lived and quickly reassemble back into the original construct, which subsequently recleaves. In the absence of DNA breaks these two units continuously separate and religate in a cyclic manner. In tissue sections with DNA damage, the topoisomerase-carrying detector unit selectively attaches to blunt-ended DNA breaks with 5'OH (DNase II-type breaks), fluorescently labeling them. The second, enzyme-free hairpin formed after oligonucleotide cleavage, will ligate to a 5'PO(4) blunt-ended break (DNase I-type breaks), if T4 DNA ligase is present in the solution. When T4 DNA ligase is added to a tissue section or a solution containing DNA with 5'PO(4) blunt-ended breaks, the ligase reacts with 5'PO(4) DNA ends, forming semi-stable enzyme-DNA complexes. The blunt ended hairpins will interact with these complexes releasing ligase and covalently linking hairpins to DNA, thus labeling 5'PO(4) blunt-ended DNA breaks. This development exemplifies a new practical approach to the design of molecular machines and provides a useful sensor for detection of apoptosis and DNA damage in fixed cells and tissues. Copyright © 2012 Journal of Visualized Experiments

  19. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

    1998-12-22

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

  20. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

    1998-01-01

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

  1. Recent development of nano-materials used in DNA biosensors.

    PubMed

    Xu, Kai; Huang, Junran; Ye, Zunzhong; Ying, Yibin; Li, Yanbin

    2009-01-01

    As knowledge of the structure and function of nucleic acid molecules has increased, sequence-specific DNA detection has gained increased importance. DNA biosensors based on nucleic acid hybridization have been actively developed because of their specificity, speed, portability, and low cost. Recently, there has been considerable interest in using nano-materials for DNA biosensors. Because of their high surface-to-volume ratios and excellent biological compatibilities, nano-materials could be used to increase the amount of DNA immobilization; moreover, DNA bound to nano-materials can maintain its biological activity. Alternatively, signal amplification by labeling a targeted analyte with nano-materials has also been reported for DNA biosensors in many papers. This review summarizes the applications of various nano-materials for DNA biosensors during past five years. We found that nano-materials of small sizes were advantageous as substrates for DNA attachment or as labels for signal amplification; and use of two or more types of nano-materials in the biosensors could improve their overall quality and to overcome the deficiencies of the individual nano-components. Most current DNA biosensors require the use of polymerase chain reaction (PCR) in their protocols. However, further development of nano-materials with smaller size and/or with improved biological and chemical properties would substantially enhance the accuracy, selectivity and sensitivity of DNA biosensors. Thus, DNA biosensors without PCR amplification may become a reality in the foreseeable future.

  2. Recent Development of Nano-Materials Used in DNA Biosensors

    PubMed Central

    Xu, Kai; Huang, Junran; Ye, Zunzhong; Ying, Yibin; Li, Yanbin

    2009-01-01

    As knowledge of the structure and function of nucleic acid molecules has increased, sequence-specific DNA detection has gained increased importance. DNA biosensors based on nucleic acid hybridization have been actively developed because of their specificity, speed, portability, and low cost. Recently, there has been considerable interest in using nano-materials for DNA biosensors. Because of their high surface-to-volume ratios and excellent biological compatibilities, nano-materials could be used to increase the amount of DNA immobilization; moreover, DNA bound to nano-materials can maintain its biological activity. Alternatively, signal amplification by labeling a targeted analyte with nano-materials has also been reported for DNA biosensors in many papers. This review summarizes the applications of various nano-materials for DNA biosensors during past five years. We found that nano-materials of small sizes were advantageous as substrates for DNA attachment or as labels for signal amplification; and use of two or more types of nano-materials in the biosensors could improve their overall quality and to overcome the deficiencies of the individual nano-components. Most current DNA biosensors require the use of polymerase chain reaction (PCR) in their protocols. However, further development of nano-materials with smaller size and/or with improved biological and chemical properties would substantially enhance the accuracy, selectivity and sensitivity of DNA biosensors. Thus, DNA biosensors without PCR amplification may become a reality in the foreseeable future. PMID:22346713

  3. Nanopore arrays in a silicon membrane for parallel single-molecule detection: DNA translocation

    NASA Astrophysics Data System (ADS)

    Zhang, Miao; Schmidt, Torsten; Jemt, Anders; Sahlén, Pelin; Sychugov, Ilya; Lundeberg, Joakim; Linnros, Jan

    2015-08-01

    Optical nanopore sensing offers great potential in single-molecule detection, genotyping, or DNA sequencing for high-throughput applications. However, one of the bottle-necks for fluorophore-based biomolecule sensing is the lack of an optically optimized membrane with a large array of nanopores, which has large pore-to-pore distance, small variation in pore size and low background photoluminescence (PL). Here, we demonstrate parallel detection of single-fluorophore-labeled DNA strands (450 bps) translocating through an array of silicon nanopores that fulfills the above-mentioned requirements for optical sensing. The nanopore array was fabricated using electron beam lithography and anisotropic etching followed by electrochemical etching resulting in pore diameters down to ∼7 nm. The DNA translocation measurements were performed in a conventional wide-field microscope tailored for effective background PL control. The individual nanopore diameter was found to have a substantial effect on the translocation velocity, where smaller openings slow the translocation enough for the event to be clearly detectable in the fluorescence. Our results demonstrate that a uniform silicon nanopore array combined with wide-field optical detection is a promising alternative with which to realize massively-parallel single-molecule detection.

  4. Non-Gaussian Distribution of DNA Barcode Extension In Nanochannels Using High-throughput Imaging

    NASA Astrophysics Data System (ADS)

    Sheats, Julian; Reinhart, Wesley; Reifenberger, Jeff; Gupta, Damini; Muralidhar, Abhiram; Cao, Han; Dorfman, Kevin

    2015-03-01

    We present experimental data for the extension of internal segments of highly confined DNA using a high-­throughput experimental setup. Barcode­-labeled E. coli genomic DNA molecules were imaged at a high areal density in square nanochannels with sizes ranging from 40 nm to 51 nm in width. Over 25,000 molecules were used to obtain more than 1,000,000 measurements for genomic distances between 2,500 bp and 100,000 bp. The distribution of extensions has positive excess kurtosis and is skew­ left due to weak backfolding in the channel. As a result, the two Odijk theories for the chain extension and variance bracket the experimental data. We compared to predictions of a harmonic approximation for the confinement free energy and show that it produces a substantial error in the variance. These results suggest an inherent error associated with any statistical analysis of barcoded DNA that relies on harmonic models for chain extension. Present address: Department of Chemical and Biological Engineering, Princeton University.

  5. Transportin mediates nuclear entry of DNA in vertebrate systems.

    PubMed

    Lachish-Zalait, Aurelie; Lau, Corine K; Fichtman, Boris; Zimmerman, Ella; Harel, Amnon; Gaylord, Michelle R; Forbes, Douglass J; Elbaum, Michael

    2009-10-01

    Delivery of DNA to the cell nucleus is an essential step in many types of viral infection, transfection, gene transfer by the plant pathogen Agrobacterium tumefaciens and in strategies for gene therapy. Thus, the mechanism by which DNA crosses the nuclear pore complex (NPC) is of great interest. Using nuclei reconstituted in vitro in Xenopus egg extracts, we previously studied DNA passage through the nuclear pores using a single-molecule approach based on optical tweezers. Fluorescently labeled DNA molecules were also seen to accumulate within nuclei. Here we find that this import of DNA relies on a soluble protein receptor of the importin family. To identify this receptor, we used different pathway-specific cargoes in competition studies as well as pathway-specific dominant negative inhibitors derived from the nucleoporin Nup153. We found that inhibition of the receptor transportin suppresses DNA import. In contrast, inhibition of importin beta has little effect on the nuclear accumulation of DNA. The dependence on transportin was fully confirmed in assays using permeabilized HeLa cells and a mammalian cell extract. We conclude that the nuclear import of DNA observed in these different vertebrate systems is largely mediated by the receptor transportin. We further report that histones, a known cargo of transportin, can act as an adaptor for the binding of transportin to DNA.

  6. Metabolic activation and nucleic acid binding of acetaminophen and related arylamine substrates by the respiratory burst of human granulocytes.

    PubMed

    Corbett, M D; Corbett, B R; Hannothiaux, M H; Quintana, S J

    1989-01-01

    Following stimulation with phorbol myristate acetate, human granulocytes were found to incorporate acetaminophen, p-phenetidine, p-aminophenol, and p-chloroaniline into cellular DNA and RNA. Phenacetin was not incorporated into nucleic acid or metabolized by such activated granulocytes. None of the substrates gave nucleic acid binding if the granulocyte cultures were not induced to undergo the respiratory burst. Additional studies on the binding of acetaminophen to DNA and RNA were made by use of both ring-14C-labeled and carbonyl-14C-labeled forms of this substrate. The finding that equivalent amounts of these two labeled acetaminophen substrates were bound to cellular DNA demonstrated that the intact acetaminophen molecule was incorporated into DNA. On the other hand, the finding that excess ring-14C-labeled acetaminophen was incorporated into cellular RNA implies partial hydrolysis of the acetaminophen substrate prior to RNA binding. Evidence was presented which strongly indicates that the nucleic acid binding of the substrates was covalent in nature. The inability of the respiratory burst to result in the binding of phenacetin to nucleic acid suggests that arylamides are not normally activated or metabolized by activated granulocytes. Acetaminophen is an exception to the recalcitrance of arylamides to such bioactivation processes because it also possesses the phenolic functional group, which, like the arylamine group, is oxidized by certain reactive oxygen species. Myeloperoxidase appears to be much more important in the binding of acetaminophen to DNA than it is in the DNA binding of arylamines in general. The role of the respiratory burst in causing the bioactivation of certain arylamines, which are not normally genotoxic via the more usual microsomal activation pathways, was extended to include certain amide substrates such as acetaminophen.

  7. Comparing the Properties of Electrochemical-Based DNA Sensors Employing Different Redox Tags

    PubMed Central

    Kang, Di; Zuo, Xiaolei; Yang, Renqiang; Xia, Fan; Plaxco, Kevin W.; White, Ryan J.

    2009-01-01

    Many electrochemical biosensor approaches developed in recent years utilize redox labeled (most commonly methylene blue or ferrocene) oligonucleotide probes site-specifically attached to an interrogating electrode. Sensors in this class have been reported employing a range of probe architectures, including single- and double-stranded DNA, more complex DNA structures, DNA and RNA aptamers and, most recently, DNA-small molecule chimeras. Signaling in this class of sensors is generally predicated on binding-induced changes in the efficiency with which the covalently attached redox label transfers electrons with the interrogating electrode. Here we have investigated how the properties of the redox tag affect the performance of such sensors. Specifically, we compare the differences in signaling and stability of electrochemical DNA sensors (E-DNA sensors) fabricated using either ferrocene or methylene blue as the signaling redox moiety. We find that while both tags support efficient E-DNA signaling, ferrocene produces slightly improved signal gain and target affinity. These small advantages, however, come at a potentially significant price: the ferrocene-based sensors are far less stable than their methylene blue counterparts, particularly with regards to stability to long-term storage, repeated electrochemical interrogations, repeated sensing/regeneration iterations, and employment in complex sample matrices such as blood serum. PMID:19810694

  8. Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation.

    PubMed

    Zhang, Hui; Guo, Peixuan

    2014-05-15

    Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

    PubMed

    Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2015-02-15

    Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Detecting single DNA molecule interactions with optical microcavities (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Vollmer, Frank

    2015-09-01

    Detecting molecules and their interactions lies at the heart of all biosensor devices, which have important applications in health, environmental monitoring and biomedicine. Achieving biosensing capability at the single molecule level is, moreover, a particularly important goal since single molecule biosensors would not only operate at the ultimate detection limit by resolving individual molecular interactions, but they could also monitor biomolecular properties which are otherwise obscured in ensemble measurements. For example, a single molecule biosensor could resolve the fleeting interaction kinetics between a molecule and its receptor, with immediate applications in clinical diagnostics. We have now developed a label-free biosensing platform that is capable of monitoring single DNA molecules and their interaction kinetics[1], hence achieving an unprecedented sensitivity in the optical domain, Figure 1. We resolve the specific contacts between complementary oligonucleotides, thereby detecting DNA strands with less than 2.4 kDa molecular weight. Furthermore we can discern strands with single nucleotide mismatches by monitoring their interaction kinetics. Our device utilizes small glass microspheres as optical transducers[1,2, 3], which are capable of increasing the number of interactions between a light beam and analyte molecules. A prism is used to couple the light beam into the microsphere. Ourr biosensing approach resolves the specific interaction kinetics between single DNA fragments. The optical transducer is assembled in a simple three-step protocol, and consists of a gold nanorod attached to a glass microsphere, where the surface of the nanorod is further modified with oligonucleotide receptors. The interaction kinetics of an oligonucleotide receptor with DNA fragments in the surrounding aqueous solution is monitored at the single molecule level[1]. The light remains confined inside the sphere where it is guided by total internal reflections along a circular optical path, similar to an acoustic wave guided along the wall of St. Paul's Cathedral. These so called whispering gallery modes (WGM) propagate with little loss, so that even a whisper can be heard on the other side of the gallery. In the optical case, the light beam can travel many thousand times around the inside of the microsphere before being scattered or absorbed, thereby making numerous interactions with an analyte molecule, bound to microsphere from surrounding sample solution. The most part of the light intensity, however, remains inside the microsphere, just below the reflecting glass surface, resulting in a relatively weak interaction between the light and the bound molecule. To enhance this interaction further, we attach tiny 42 nm x 12 nm gold nanorods to the glass surface. When passing a nanorod, the lightwave induces oscillations of conduction electrons, resulting in so called plasmon resonance. These nanorod plasmons greatly enhance the light intensity on the nanorod, so that the interaction of the light with a molecule attached to the nanorod is also enhanced[4-6]. This enhanced interaction results in an increase in sensitivity by more than a factor of one thousand, putting our experiments of single DNA molecule detection within reach. For the specific detection of nucleic acids, we attach single-stranded DNA to the nanorod and immerse our device in a liquid solution. When a matching, i.e. complementary DNA fragment binds from solution to the "bait" on the nanorod, the enhanced interaction with the light results in an observable shift of the WGM wavelength. Since light propagates in a WGM only for a very precise resonance wavelength or frequency, this shift can be detected with great accuracy[3]. On our current biosensor platform, we detect wavelength shifts with an accuracy of less than one femtometer, resulting in an extremely high sensitivity for biosensing, which we leverage for the specific detection of single 8 mer oligonucleotides as well as the detection of less than 1 kDa intercalating small molecules[1]. [1] M. D. Baaske, M. R. Foreman, and F. Vollmer, "Single molecule nucleic acid interactions monitored on a label-free microcavity biosensing platform," Nature Nanotechnology, vol. 9, pp. 933-939, 2014. [2] Y. Wu, D. Y. Zhang, P. Yin, and F. Vollmer, "Ultraspecific and Highly Sensitive Nucleic Acid Detection by Integrating a DNA Catalytic Network with a Label-Free Microcavity," Small, vol. 10, pp. 2067-2076, 2014. [3] M. R. Foreman, W.-L. Jin, and F. Vollmer, "Optimizing Detection Limits in Whispering Gallery Mode Biosensing," Optics Express, vol. 22, pp. 5491-5511, 2014. [4] M. A. Santiago-Cordoba, S. V. Boriskina, F. Vollmer, and M. C. Demirel, "Nanoparticle-based protein detection by optical shift of a resonant microcavity," Applied Physics Letters, vol. 99, Aug 2011. [5] M. R. Foreman and F. Vollmer, "Theory of resonance shifts of whispering gallery modes by arbitrary plasmonic nanoparticles," New Journal of Physics, vol. 15, p. 083006, Aug 2013. [6] M. R. Foreman and F. Vollmer "Level repulsion in hybrid photonic-plasmonic microresonators for enhanced biodetection" Phys. Rev. A 88, 023831 (2013).

  11. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    PubMed Central

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  12. Tying Knots in DNA with Holographic Optical Tweezers

    NASA Astrophysics Data System (ADS)

    Miles, Mervyn; Foster, David; Seddon, Annela; Phillips, David; Carberry, David; Padgett, Miles; Dennis, Mark

    It has been demonstrated that holographic optical tweezers can be used to tie a trefoil knot in double-stranded DNA. We have developed an advanced holographic optical tweezers system with several types of intuitive control interfaces. It has been used in a range of research projects including the characterization and assembly of structures. Here the process of tying increasingly complex knots with holographic tweezers will be described. The DNA is of the order of 50 μ m in length and is fluorescently labeled, in order that it can be visualized in the optical microscope of the tweezers system. With a knot was tied, the effect of increasing the persistence length of the DNA by partial methylation of the DNA molecule was investigated. Leverhulme Trust.

  13. Addressable configurations of DNA nanostructures for rewritable memory.

    PubMed

    Chandrasekaran, Arun Richard; Levchenko, Oksana; Patel, Dhruv S; MacIsaac, Molly; Halvorsen, Ken

    2017-11-02

    DNA serves as nature's information storage molecule, and has been the primary focus of engineered systems for biological computing and data storage. Here we combine recent efforts in DNA self-assembly and toehold-mediated strand displacement to develop a rewritable multi-bit DNA memory system. The system operates by encoding information in distinct and reversible conformations of a DNA nanoswitch and decoding by gel electrophoresis. We demonstrate a 5-bit system capable of writing, erasing, and rewriting binary representations of alphanumeric symbols, as well as compatibility with 'OR' and 'AND' logic operations. Our strategy is simple to implement, requiring only a single mixing step at room temperature for each operation and standard gel electrophoresis to read the data. We envision such systems could find use in covert product labeling and barcoding, as well as secure messaging and authentication when combined with previously developed encryption strategies. Ultimately, this type of memory has exciting potential in biomedical sciences as data storage can be coupled to sensing of biological molecules. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Detection of HIV-1 by digoxigenin-labelled PCR and microtitre plate solution hybridisation assay and prevention of PCR carry-over by uracil-N-glycosylase.

    PubMed

    King, J A; Ball, J K

    1993-09-01

    An extremely sensitive and convenient microtiter plate solution hybridisation assay for the detection of HIV-1 PCR products was developed. The PCR product is labelled by direct incorporation of digoxigenin-dUTP and after denaturation is captured by a microtitre plate coated with a streptavidin-linked biotinylated probe. The PCR/probe hybrids are reacted with an alkaline phosphate conjugated anti-digoxigenin antibody and detected using an alkaline phosphatase enzyme amplification system. The use of uracil-N-glycosylase and dUTP instead of dTTP in the PCR is used to effectively control carry-over from previous PCR products. The assay can detect single HIV-1 DNA molecules in a background DNA of 0.75 microgram.

  15. Chemo-mechanical pushing of proteins along single-stranded DNA

    PubMed Central

    Sokoloski, Joshua E.; Kozlov, Alexander G.; Galletto, Roberto; Lohman, Timothy M.

    2016-01-01

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3′-Cy3–labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5′ to 3′ ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5′ to 3′) pushing of the SSB toward the 3′ ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3′ to 5′) direction, are observed with EcRep and EcUvrD (both 3′ to 5′ ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA. PMID:27185951

  16. Nonlinear microrheology and molecular imaging to map microscale deformations of entangled DNA networks

    NASA Astrophysics Data System (ADS)

    Wu, Tsai-Chin; Anderson, Rae

    We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.

  17. A silicon carbide nanowire field effect transistor for DNA detection

    NASA Astrophysics Data System (ADS)

    Fradetal, L.; Bano, E.; Attolini, G.; Rossi, F.; Stambouli, V.

    2016-06-01

    This work reports on the label-free electrical detection of DNA molecules for the first time, using silicon carbide (SiC) as a novel material for the realization of nanowire field effect transistors (NWFETs). SiC is a promising semiconductor for this application due to its specific characteristics such as chemical inertness and biocompatibility. Non-intentionally n-doped SiC NWs are first grown using a bottom-up vapor-liquid-solid (VLS) mechanism, leading to the NWs exhibiting needle-shaped morphology, with a length of approximately 2 μm and a diameter ranging from 25 to 60 nm. Then, the SiC NWFETs are fabricated and functionalized with DNA molecule probes via covalent coupling using an amino-terminated organosilane. The drain current versus drain voltage (I d-V d) characteristics obtained after the DNA grafting and hybridization are reported from the comparative and simultaneous measurements carried out on the SiC NWFETs, used either as sensors or references. As a representative result, the current of the sensor is lowered by 22% after probe DNA grafting and by 7% after target DNA hybridization, while the current of the reference does not vary by more than ±0.6%. The current decrease confirms the field effect induced by the negative charges of the DNA molecules. Moreover, the selectivity, reproducibility, reversibility and stability of the studied devices are emphasized by de-hybridization, non-complementary hybridization and re-hybridization experiments. This first proof of concept opens the way for future developments using SiC-NW-based sensors.

  18. Fluorescence quenching by TEMPO: a sub-30 A single-molecule ruler.

    PubMed

    Zhu, Peizhi; Clamme, Jean-Pierre; Deniz, Ashok A

    2005-11-01

    A series of DNA molecules labeled with 5-carboxytetramethylrhodamine (5-TAMRA) and the small nitroxide radical TEMPO were synthesized and tested to investigate whether the intramolecular quenching efficiency can be used to measure short intramolecular distances in small ensemble and single-molecule experiments. In combination with distance calculations using molecular mechanics modeling, the experimental results from steady-state ensemble fluorescence and fluorescence correlation spectroscopy measurements both show an exponential decrease in the quenching rate constant with the dye-quencher distance in the 10-30 A range. The results demonstrate that TEMPO-5-TAMRA fluorescence quenching is a promising method to measure short distance changes within single biomolecules.

  19. Label-free and high-sensitive detection for genetic point mutation based on hyperspectral interferometry

    NASA Astrophysics Data System (ADS)

    Fu, Rongxin; Li, Qi; Zhang, Junqi; Wang, Ruliang; Lin, Xue; Xue, Ning; Su, Ya; Jiang, Kai; Huang, Guoliang

    2016-10-01

    Label free point mutation detection is particularly momentous in the area of biomedical research and clinical diagnosis since gene mutations naturally occur and bring about highly fatal diseases. In this paper, a label free and high sensitive approach is proposed for point mutation detection based on hyperspectral interferometry. A hybridization strategy is designed to discriminate a single-base substitution with sequence-specific DNA ligase. Double-strand structures will take place only if added oligonucleotides are perfectly paired to the probe sequence. The proposed approach takes full use of the inherent conformation of double-strand DNA molecules on the substrate and a spectrum analysis method is established to point out the sub-nanoscale thickness variation, which benefits to high sensitive mutation detection. The limit of detection reach 4pg/mm2 according to the experimental result. A lung cancer gene point mutation was demonstrated, proving the high selectivity and multiplex analysis capability of the proposed biosensor.

  20. Luminescent Quantum Dots as Ultrasensitive Biological Labels

    NASA Astrophysics Data System (ADS)

    Nie, Shuming

    2000-03-01

    Highly luminescent semiconductor quantum dots have been covalently coupled to biological molecules for use in ultrasensitive biological detection. This new class of luminescent labels is considerably brighter and more resistant againt photobleaching in comparison with organic dyes. Quantum dots labeled with the protein transferrin undergo receptor-mediated endocytosis (RME) in cultured HeLa cells, and those dots that were conjugated to immunomolecules recognize specific antibodies or antigens. In addition, we show that DNA functionalized quantum dots can be used to target specific genes by hybridization. We expect that quantum dot bioconjugates will have a broad range of biological applications, such as ligand-receptor interactions, real-time monitoring of molecular trafficking inside living cells, multicolor fluorescence in-situ hybridization (FISH), high-sensitivity detection in miniaturized devices (e.g., DNA chips), and fluorescent tagging of combinatorial chemical libraries. A potential clinical application is the use of quantum dots for ultrasensitive viral RNA detection, in which as low as 100 copies of hepatitis C and HIV viruses per ml blood should be detected.

  1. Ultrasensitive Visual Detection of HIV DNA Biomarkers via a Multi-amplification Nanoplatform.

    PubMed

    Long, Yuyin; Zhou, Cuisong; Wang, Congmin; Cai, Honglian; Yin, Cuiyun; Yang, Qiufang; Xiao, Dan

    2016-04-01

    Methodologies to detect disease biomarkers at ultralow concentrations can potentially improve the standard of living. A facile and label-free multi-amplification strategy is proposed for the ultrasensitive visual detection of HIV DNA biomarkers in real physiological media. This multi-amplification strategy not only exhibits a signficantly low detection limit down to 4.8 pM but also provides a label-free, cost-effective and facile technique for visualizing a few molecules of nucleic acid analyte with the naked eye. Importantly, the biosensor is capable of discriminating single-based mismatch lower than 5.0 nM in human serum samples. Moreover, the visual sensing platform exhibits excellent specificity, acceptable reusability and a long-term stability. All these advantages could be attributed to the nanofibrous sensing platform that 1) has a high surface-area-to-volume provided by electrospun nanofibrous membrane, and 2) combines glucose oxidase (GOx) biocatalysis, DNAzyme-catalyzed colorimetric reaction and catalytic hairpin assembly (CHA) recycling amplification together. This multi-amplification nanoplatform promises label-free and visual single-based mismatch DNA monitoring with high sensitivity and specificity, suggesting wide applications that range from virus detection to genetic disease diagnosis.

  2. Nanopore sensing of individual transcription factors bound to DNA

    PubMed Central

    Squires, Allison; Atas, Evrim; Meller, Amit

    2015-01-01

    Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes. PMID:26109509

  3. Nanopore sensing of individual transcription factors bound to DNA

    NASA Astrophysics Data System (ADS)

    Squires, Allison; Atas, Evrim; Meller, Amit

    2015-06-01

    Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes.

  4. A small-molecule-linked DNA-graphene oxide-based fluorescence-sensing system for detection of biotin.

    PubMed

    Zhang, Hao; Li, Yan; Su, Xingguang

    2013-11-15

    In this paper, we establish a novel fluorescence-sensing system for the detection of biotin based on the interaction between DNA and graphene oxide and on protection of the terminal of the biotinylated single-stranded DNA fluorescent probe by streptavidin. In this system, streptavidin binds to the biotinylated DNA, which protects the DNA from hydrolysis by exonuclease I. The streptavidin-DNA conjugate is then adsorbed to the graphene oxide resulting in the fluorescence being quenched. Upon the addition of free biotin, it competes with the labeled biotin for the binding sites of streptavidin and then the exonuclease I digests the unbound DNA probe from the 3' to the 5' terminal, releasing the fluorophore from the DNA. Because of the weak affinity between the fluorophore and graphene oxide, the fluorescence is recovered. Under optimal conditions, the fluorescence intensity is proportional to the concentration of biotin in the concentration range of 0.5-20nmol/L. The detection limit for biotin is 0.44nmol/L. The proposed fluorescence-sensing system was applied to the determination of biotin in some real samples with satisfactory reproducibility and accuracy. This work could provide a common platform for detecting small biomolecules based on protein-small molecule ligand binding. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Osmylated DNA, a novel concept for sequencing DNA using nanopores

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia

    2015-03-01

    Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

  6. Quantitative Detection of Small Molecule/DNA Complexes Employing a Force-Based and Label-Free DNA-Microarray

    PubMed Central

    Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.

    2009-01-01

    Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688

  7. Ordered Self-Assembled Monolayers of Peptide Nucleic Acids with DNA Recognition Capability

    NASA Astrophysics Data System (ADS)

    Briones, C.; Mateo-Marti, E.; Gómez-Navarro, C.; Parro, V.; Román, E.; Martín-Gago, J. A.

    2004-11-01

    We report on the formation of ordered self-assembled monolayers (SAMs) of single-stranded peptide nucleic acids (ssPNA). In spite of their remarkable length (7nm) thiolated PNAs assemble standing up on gold surfaces similarly to the SAMs of short alkanethiols. SAMs of ssPNA recognize complementary nucleic acids, acting as specific biosensors that discriminate even a point mutation in target ssDNA. These results are obtained by surface characterization techniques that avoid labeling of the target molecule: x-ray photoemission, x-ray absorption and atomic force microscopy.

  8. Development of a miRNA surface-enhanced Raman scattering assay using benchtop and handheld Raman systems

    NASA Astrophysics Data System (ADS)

    Schechinger, Monika; Marks, Haley; Locke, Andrea; Choudhury, Mahua; Cote, Gerard

    2018-01-01

    DNA-functionalized nanoparticles, when paired with surface-enhanced Raman spectroscopy (SERS), can rapidly detect microRNA. However, widespread use of this approach is hindered by drawbacks associated with large and expensive benchtop Raman microscopes. MicroRNA-17 (miRNA-17) has emerged as a potential epigenetic indicator of preeclampsia, a condition that occurs during pregnancy. Biomarker detection using an SERS point-of-care device could enable prompt diagnosis and prevention as early as the first trimester. Recently, strides have been made in developing portable Raman systems for field applications. An SERS assay for miRNA-17 was assessed and translated from traditional benchtop Raman microscopes to a handheld system. Three different photoactive molecules were compared as potential Raman reporter molecules: a chromophore, malachite green isothiocyanate (MGITC), a fluorophore, tetramethylrhodamine isothiocyanate, and a polarizable small molecule 5,5-dithio-bis-(2-nitrobenzoic acid) (DTNB). For the benchtop Raman microscope, the DTNB-labeled assay yielded the greatest sensitivity under 532-nm laser excitation, but the MGITC-labeled assay prevailed at 785 nm. Conversely, DTNB was preferable for the miniaturized 785-nm Raman system. This comparison showed significant SERS enhancement variation in response to 1-nM miRNA-17, implying that the sensitivity of the assay may be more heavily dependent on the excitation wavelength, instrumentation, and Raman reporter chosen than on the plasmonic coupling from DNA/miRNA-mediated nanoparticle assemblies.

  9. Organophosphonate-based PNA-functionalization of silicon nanowires for label-free DNA detection.

    PubMed

    Cattani-Scholz, Anna; Pedone, Daniel; Dubey, Manish; Neppl, Stefan; Nickel, Bert; Feulner, Peter; Schwartz, Jeffrey; Abstreiter, Gerhard; Tornow, Marc

    2008-08-01

    We investigated hydroxyalkylphosphonate monolayers as a novel platform for the biofunctionalization of silicon-based field effect sensor devices. This included a detailed study of the thin film properties of organophosphonate films on Si substrates using several surface analysis techniques, including AFM, ellipsometry, contact angle, X-ray photoelectron spectroscopy (XPS), X-ray reflectivity, and current-voltage characteristics in electrolyte solution. Our results indicate the formation of a dense monolayer on the native silicon oxide that has excellent passivation properties. The monolayer was biofunctionalized with 12 mer peptide nucleic acid (PNA) receptor molecules in a two-step procedure using the heterobifunctional linker, 3-maleimidopropionic-acid-N-hydroxysuccinimidester. Successful surface modification with the probe PNA was verified by XPS and contact angle measurements, and hybridization with DNA was determined by fluorescence measurements. Finally, the PNA functionalization protocol was translated to 2 microm long, 100 nm wide Si nanowire field effect devices, which were successfully used for label-free DNA/PNA hybridization detection.

  10. Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin

    PubMed Central

    Ball, David A.; Mehta, Gunjan D.; Salomon-Kent, Ronit; Mazza, Davide; Morisaki, Tatsuya; Mueller, Florian; McNally, James G.; Karpova, Tatiana S.

    2016-01-01

    In vivo single molecule tracking has recently developed into a powerful technique for measuring and understanding the transient interactions of transcription factors (TF) with their chromatin response elements. However, this method still lacks a solid foundation for distinguishing between specific and non-specific interactions. To address this issue, we took advantage of the power of molecular genetics of yeast. Yeast TF Ace1p has only five specific sites in the genome and thus serves as a benchmark to distinguish specific from non-specific binding. Here, we show that the estimated residence time of the short-residence molecules is essentially the same for Hht1p, Ace1p and Hsf1p, equaling 0.12–0.32 s. These three DNA-binding proteins are very different in their structure, function and intracellular concentration. This suggests that (i) short-residence molecules are bound to DNA non-specifically, and (ii) that non-specific binding shares common characteristics between vastly different DNA-bound proteins and thus may have a common underlying mechanism. We develop new and robust procedure for evaluation of adverse effects of labeling, and new quantitative analysis procedures that significantly improve residence time measurements by accounting for fluorophore blinking. Our results provide a framework for the reliable performance and analysis of single molecule TF experiments in yeast. PMID:27566148

  11. Phase sensitive spectral domain interferometry for label free biomolecular interaction analysis and biosensing applications

    NASA Astrophysics Data System (ADS)

    Chirvi, Sajal

    Biomolecular interaction analysis (BIA) plays vital role in wide variety of fields, which include biomedical research, pharmaceutical industry, medical diagnostics, and biotechnology industry. Study and quantification of interactions between natural biomolecules (proteins, enzymes, DNA) and artificially synthesized molecules (drugs) is routinely done using various labeled and label-free BIA techniques. Labeled BIA (Chemiluminescence, Fluorescence, Radioactive) techniques suffer from steric hindrance of labels on interaction site, difficulty of attaching labels to molecules, higher cost and time of assay development. Label free techniques with real time detection capabilities have demonstrated advantages over traditional labeled techniques. The gold standard for label free BIA is surface Plasmon resonance (SPR) that detects and quantifies the changes in refractive index of the ligand-analyte complex molecule with high sensitivity. Although SPR is a highly sensitive BIA technique, it requires custom-made sensor chips and is not well suited for highly multiplexed BIA required in high throughput applications. Moreover implementation of SPR on various biosensing platforms is limited. In this research work spectral domain phase sensitive interferometry (SD-PSI) has been developed for label-free BIA and biosensing applications to address limitations of SPR and other label free techniques. One distinct advantage of SD-PSI compared to other label-free techniques is that it does not require use of custom fabricated biosensor substrates. Laboratory grade, off-the-shelf glass or plastic substrates of suitable thickness with proper surface functionalization are used as biosensor chips. SD-PSI is tested on four separate BIA and biosensing platforms, which include multi-well plate, flow cell, fiber probe with integrated optics and fiber tip biosensor. Sensitivity of 33 ng/ml for anti-IgG is achieved using multi-well platform. Principle of coherence multiplexing for multi-channel label-free biosensing applications is introduced. Simultaneous interrogation of multiple biosensors is achievable with a single spectral domain phase sensitive interferometer by coding the individual sensograms in coherence-multiplexed channels. Experimental results demonstrating multiplexed quantitative biomolecular interaction analysis of antibodies binding to antigen coated functionalized biosensor chip surfaces on different platforms are presented.

  12. Label-free liquid crystal biosensor based on specific oligonucleotide probes for heavy metal ions.

    PubMed

    Yang, Shengyuan; Wu, Chao; Tan, Hui; Wu, Yan; Liao, Shuzhen; Wu, Zhaoyang; Shen, Guoli; Yu, Ruqin

    2013-01-02

    In this study, to enhance the capability of metal ions disturbing the orientation of liquid crystals (LCs), we designed a new label-free LC biosensor for the highly selective and sensitive detection of heavy metal ions. This strategy makes use of the target-induced DNA conformational change to enhance the disruption of target molecules for the orientation of LC leading to an amplified optical signal. The Hg(2+) ion, which possesses a unique property to bind specifically to two DNA thymine (T) bases, is used as a model heavy metal ion. In the presence of Hg(2+), the specific oligonucleotide probes form a conformational reorganization of the oligonucleotide probes from hairpin structure to duplex-like complexes. The duplex-like complexes are then bound on the triethoxysilylbutyraldehyde/N,N-dimethyl-N-octadecyl (3-aminopropyl) trimethoxysilyl chloride (TEA/DMOAP)-coated substrate modified with capture probes, which can greatly distort the orientational profile of LC, making the optical image of LC cell birefringent as a result. The optical signal of LC sensor has a visible change at the Hg(2+) concentration of low to 0.1 nM, showing good detection sensitivity. The cost-effective LC sensing method can translate the concentration signal of heavy metal ions in solution into the presence of DNA duplexes and is expected to be a sensitive detection platform for heavy metal ions and other small molecule monitors.

  13. Microbeads display of proteins using emulsion PCR and cell-free protein synthesis.

    PubMed

    Gan, Rui; Yamanaka, Yumiko; Kojima, Takaaki; Nakano, Hideo

    2008-01-01

    We developed a method for coupling protein to its coding DNA on magnetic microbeads using emulsion PCR and cell-free protein synthesis in emulsion. A PCR mixture containing streptavidin-coated microbeads was compartmentalized by water-in-oil (w/o) emulsion with estimated 0.5 template molecules per droplet. The template molecules were amplified and immobilized on beads via bead-linked reverse primers and biotinylated forward primers. After amplification, the templates were sequentially labeled with streptavidin and biotinylated anti-glutathione S-transferase (GST) antibody. The pool of beads was then subjected to cell-free protein synthesis compartmentalized in another w/o emulsion, in which templates were coupled to their coding proteins. We mixed two types of DNA templates of Histidine6 tag (His6)-fused and FLAG tag-fused GST in a ratio of 1:1,000 (His6: FLAG) for use as a model DNA library. After incubation with fluorescein isothiocyanate (FITC)-labeled anti-His6 (C-term) antibody, the beads with the His6 gene were enriched 917-fold in a single-round screening by using flow cytometry. A library with a theoretical diversity of 10(6) was constructed by randomizing the middle four residues of the His6 tag. After a two-round screening, the randomized sequences were substantially converged to peptide-encoding sequences recognized by the anti-His6 antibody.

  14. Conformational transitions in DNA polymerase I revealed by single-molecule FRET

    PubMed Central

    Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.

    2010-01-01

    The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740

  15. Microarray slide hybridization using fluorescently labeled cDNA.

    PubMed

    Ares, Manuel

    2014-01-01

    Microarray hybridization is used to determine the amount and genomic origins of RNA molecules in an experimental sample. Unlabeled probe sequences for each gene or gene region are printed in an array on the surface of a slide, and fluorescently labeled cDNA derived from the RNA target is hybridized to it. This protocol describes a blocking and hybridization protocol for microarray slides. The blocking step is particular to the chemistry of "CodeLink" slides, but it serves to remind us that almost every kind of microarray has a treatment step that occurs after printing but before hybridization. We recommend making sure of the precise treatment necessary for the particular chemistry used in the slides to be hybridized because the attachment chemistries differ significantly. Hybridization is similar to northern or Southern blots, but on a much smaller scale.

  16. Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.

    PubMed

    Cui, Chenghua; Shu, Wei; Li, Peining

    2016-01-01

    Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.

  17. Effect of Concentration on the Formation of Molecular Hybrids from T4 DNA

    PubMed Central

    Kozinski, Andrzej W.; Beer, Michael

    1962-01-01

    When the thymine of T4 DNA is replaced by 5-BU the melting temperature of T4 DNA is increased from about 83° to about 93°C. Heating and slow cooling of T4 DNA at concentrations of about 30 μg/ml leads to aggregates which consist of several polynucleotide chains which appear in the electron microscope as a branched structure. The aggregates have regions which are true hybrids. When the concentration of T4 DNA is lowered to less than 1 μg/ml the products of hybridization are not aggregates but have the morphology of native DNA molecules and the density labels are distributed as expected from the fusing of two chains of approximately equal length. ImagesFigure 6Figure 7Figure 8 PMID:14459098

  18. Progressing single biomolecule force spectroscopy measurements for the screening of DNA binding agents

    NASA Astrophysics Data System (ADS)

    Zhang, Wenke; Barbagallo, Romina; Madden, Claire; Roberts, Clive J.; Woolford, Alison; Allen, Stephanie

    2005-10-01

    Recent studies have indicated that the force-extension properties of single molecules of double stranded (ds) DNA are sensitive to the presence of small molecule DNA binding agents, and also to their mode of binding. These observations raise the possibility of using this approach as a highly sensitive tool for the screening of such agents. However, particularly for studies employing the atomic force microscope (AFM), several non-trivial barriers hinder the progress of this approach to the non-specialist arena and hence also the full realization of this possibility. In this paper, we therefore address a series of key reproducibility and metrological issues associated with this type of measurement. Specifically, we present an improved immobilization method that covalently anchors one end (5' end) of a dual labelled (5'-thiol, 3'-biotin) p53 DNA molecule onto a gold substrate via gold-thiol chemistry, whilst the biotinylated 3' end is available for 'pick-up' using a streptavidin modified AFM tip. We also show that co-surface immobilization of DNA with 6-mercapto-1-hexanol (MCH) can also lead to a further increase the measured contour length. We demonstrate the impact of these improved protocols through the observation of the cooperative transition plateau in a DNA fragment of approximately 118 bp, a significantly smaller fragment than previously investigated. The results of a comparative study of the effects of a model minor groove binder (Hoechst 33258) and an intercalating drug (proflavine), alone, as a mixture and under different buffer conditions, are also presented.

  19. Redefining Molecular Amphipathicity in Reversing the "Coffee-Ring Effect": Implications for Single Base Mutation Detection.

    PubMed

    Huang, Chi; Wang, Jie; Lv, Xiaobo; Liu, Liu; Liang, Ling; Hu, Wei; Luo, Changliang; Wang, Fubing; Yuan, Quan

    2018-05-21

    The "coffee ring effect" is a natural phenomenon where sessile drops leave ring-shaped structures on solid surfaces upon drying. It drives non-uniform deposition of suspended compounds on substrates, which adversely affects many processes, including surface-assisted biosensing and molecular self-assembly. In this study, we describe how the coffee ring effect can be eliminated by controlling the amphipathicity of the suspended compounds, for example DNA modified with hydrophobic dye. Specifically, nuclease digestion of the hydrophilic DNA end converts the dye-labeled molecule into an amphipathic molecule (one with comparably weighted hydrophobic and hydrophilic ends) and reverses the coffee ring effect and results in uniform disc-shaped feature deposition of the dye. The amphipathic product decreases the surface tension of the sessile drops and induces Marangoni flow, which drives the uniform distribution of the amphipathic dye-labeled product in the drops. As proof-of-concept, this strategy was used in a novel enzymatic amplification method for biosensing to eliminate the coffee ring effect on a nitrocellulose membrane and increase assay reliability and sensitivity. Importantly, the reported strategy for eliminating the coffee ring effect can be extended to other sessile drop systems for potentially improving assay reliability, and sensitivity.

  20. Horizontal Magnetic Tweezers for Micromanipulation of Single DNA-Protein Complexes

    NASA Astrophysics Data System (ADS)

    McAndrew, C.; Sarkar, A.; Mehl, P.

    2011-03-01

    We report on the development of a new magnetic force transducer or ``tweezer'' that can apply pico-Newton forces on single DNA molecules in the focus plane. Since the changes in DNA's end-to-end extension are coplanar with the pulling force, there is no need to continually refocus. The DNA constructs (λ -DNA end labeled with a 3 μ m polystyrene bead and a 2.8 μ m paramagnetic sphere) and appropriate buffer are introduced to a custom built 400 μ L to 650 μ L closed cell. This closed cell isolates our sample and produces low-noise force and extension measurements. This chamber rests on a stage fixed to a three axis micromanipulator. Entering the flat chamber are two micropipettes, a 2.5 μ m id pipette for aspirating the polystyrene bead and a 20 μ m id pipette for injecting proteins of interest. The suction and the injection pipettes are rigidly mounted to a hydraulic, three-axis micromanipulator. DNA-bead constructs, once introduced to the chamber, can be located by moving the stage over the objective. We have shown that we can easily and reputably find, capture, and manipulate single molecules of DNA within a force range of 0.1pN to 100pN.

  1. Genomic Mapping of Human DNA provides Evidence of Difference in Stretch between AT and GC rich regions

    NASA Astrophysics Data System (ADS)

    Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han

    Human DNA is a not a polymer consisting of a uniform distribution of all 4 nucleic acids, but rather contains regions of high AT and high GC content. When confined, these regions could have different stretch due to the extra hydrogen bond present in the GC basepair. To measure this potential difference, human genomic DNA was nicked with NtBspQI, labeled with a cy3 like fluorophore at the nick site, stained with YOYO, loaded into a device containing an array of nanochannels, and imaged. Over 473,000 individual molecules of DNA, corresponding to roughly 30x coverage of a human genome, were collected and aligned to the human reference. Based on the known AT/GC content between aligned pairs of labels, the stretch was measured for regions of similar size but different AT/GC content. We found that regions of high GC content were consistently more stretched than regions of high AT content between pairs of labels varying in size between 2.5 kbp and 500 kbp. We measured that for every 1% increase in GC content there was roughly a 0.06% increase in stretch. While this effect is small, it is important to take into account differences in stretch between AT and GC rich regions to improve the sensitivity of detection of structural variations from genomic variations. NIH Grant: R01-HG006851.

  2. Developing Single-Molecule TPM Experiments for Direct Observation of Successful RecA-Mediated Strand Exchange Reaction

    PubMed Central

    Fan, Hsiu-Fang; Cox, Michael M.; Li, Hung-Wen

    2011-01-01

    RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5′-to-3′ fashion, using a synapse segment with a wide and continuous size distribution. PMID:21765895

  3. DNA hybridization activity of single-stranded DNA-conjugated gold nanoparticles used as probes for DNA detection

    NASA Astrophysics Data System (ADS)

    Kira, Atsushi; Matsuo, Kosuke; Nakajima, Shin-ichiro

    2016-02-01

    Colloidal nanoparticles (NPs) have potential applications in bio-sensing technologies as labels or signal enhancers. In order to meet demands for a development of biomolecular assays by a quantitative understanding of single-molecule, it is necessary to regulate accuracy of the NPs probes modified with biomolecules to optimize the characteristics of NPs. However, to our knowledge, there is little information about the structural effect of conjugated biomolecules to the NPs. In this study, we investigated the contribution of a density of single-stranded DNA (ssDNA) conjugating gold NP to hybridization activity. Hybridization activity decreased in accordance with increases in the density of attached ssDNAs, likely due to electrostatic repulsion generated by negatively charged phosphate groups in the ssDNA backbone. These results highlight the importance of controlling the density of ssDNAs attached to the surface of NPs used as DNA detection probes.

  4. Analyzing the dynamics of DNA replication in Mammalian cells using DNA combing.

    PubMed

    Bialic, Marta; Coulon, Vincent; Drac, Marjorie; Gostan, Thierry; Schwob, Etienne

    2015-01-01

    How cells duplicate their chromosomes is a key determinant of cell identity and genome stability. DNA replication can initiate from more than 100,000 sites distributed along mammalian chromosomes, yet a given cell uses only a subset of these origins due to inefficient origin activation and regulation by developmental or environmental cues. An impractical consequence of cell-to-cell variations in origin firing is that population-based techniques do not accurately describe how chromosomes are replicated in single cells. DNA combing is a biophysical DNA fiber stretching method which permits visualization of ongoing DNA synthesis along Mb-sized single-DNA molecules purified from cells that were previously pulse-labeled with thymidine analogues. This allows quantitative measurements of several salient features of chromosome replication dynamics, such as fork velocity, fork asymmetry, inter-origin distances, and global instant fork density. In this chapter we describe how to obtain this information from asynchronous cultures of mammalian cells.

  5. Nanoengineered Plasmonic Hybrid Systems for Bio-nanotechnology

    NASA Astrophysics Data System (ADS)

    Leong, Kirsty

    Plasmonic hybrid systems are fabricated using a combination of lithography and layer-by-layer directed self-assembly approaches to serve as highly sensitive nanosensing devices. This layer-by-layer directed self-assembly approach is utilized as a hybrid methodology to control the organization of quantum dots (QDs), nanoparticles, and biomolecules onto inorganic nanostructures with site-specific attachment and functionality. Here, surface plasmon-enhanced nanoarrays are fabricated where the photoluminescence of quantum dots and conjugated polymer nanoarrays are studied. This study was performed by tuning the localized surface plasmon resonance and the distance between the emitter and the metal surface using genetically engineered polypeptides as binding agents and biotin-streptavidin binding as linker molecules. In addition, these nanoarrays were also chemically modified to support the immobilization and label-free detection of DNA using surface enhanced Raman scattering. The surface of the nanoarrays was chemically modified using an acridine containing molecule which can act as an intercalating agent for DNA. The self-assembled monolayer (SAM) showed the ability to immobilize and intercalate DNA onto the surface. This SAM system using surface enhanced Raman scattering (SERS) serves as a highly sensitive methodology for the immobilization and label-free detection of DNA applicable into a wide range of bio-diagnostic platforms. Other micropatterned arrays were also fabricated using a combination of soft lithography and surface engineering. Selective single cell patterning and adhesion was achieved through chemical modifications and surface engineering of poly(dimethylsiloxane) surface. The surface of each microwell was functionally engineered with a SAM which contained an aldehyde terminated fused-ring aromatic thiolated molecule. Cells were found to be attracted and adherent to the chemically modified microwells. By combining soft lithography and surface engineering, a simple methodology produced single cell arrays on biocompatible substrates. Thus the design of plasmonic devices relies heavily on the nature of the plasmonic interactions between nanoparticles in the devices which can potentially be fabricated into lab-on-a-chip devices for multiplex sensing capabilities.

  6. Fluorescence Quenching by TEMPO: A Sub-30 Å Single-Molecule Ruler

    PubMed Central

    Zhu, Peizhi; Clamme, Jean-Pierre; Deniz, Ashok A.

    2005-01-01

    A series of DNA molecules labeled with 5-carboxytetramethylrhodamine (5-TAMRA) and the small nitroxide radical TEMPO were synthesized and tested to investigate whether the intramolecular quenching efficiency can be used to measure short intramolecular distances in small ensemble and single-molecule experiments. In combination with distance calculations using molecular mechanics modeling, the experimental results from steady-state ensemble fluorescence and fluorescence correlation spectroscopy measurements both show an exponential decrease in the quenching rate constant with the dye-quencher distance in the 10–30 Å range. The results demonstrate that TEMPO-5-TAMRA fluorescence quenching is a promising method to measure short distance changes within single biomolecules. PMID:16199509

  7. Genome-Wide Structural Variation Detection by Genome Mapping on Nanochannel Arrays.

    PubMed

    Mak, Angel C Y; Lai, Yvonne Y Y; Lam, Ernest T; Kwok, Tsz-Piu; Leung, Alden K Y; Poon, Annie; Mostovoy, Yulia; Hastie, Alex R; Stedman, William; Anantharaman, Thomas; Andrews, Warren; Zhou, Xiang; Pang, Andy W C; Dai, Heng; Chu, Catherine; Lin, Chin; Wu, Jacob J K; Li, Catherine M L; Li, Jing-Woei; Yim, Aldrin K Y; Chan, Saki; Sibert, Justin; Džakula, Željko; Cao, Han; Yiu, Siu-Ming; Chan, Ting-Fung; Yip, Kevin Y; Xiao, Ming; Kwok, Pui-Yan

    2016-01-01

    Comprehensive whole-genome structural variation detection is challenging with current approaches. With diploid cells as DNA source and the presence of numerous repetitive elements, short-read DNA sequencing cannot be used to detect structural variation efficiently. In this report, we show that genome mapping with long, fluorescently labeled DNA molecules imaged on nanochannel arrays can be used for whole-genome structural variation detection without sequencing. While whole-genome haplotyping is not achieved, local phasing (across >150-kb regions) is routine, as molecules from the parental chromosomes are examined separately. In one experiment, we generated genome maps from a trio from the 1000 Genomes Project, compared the maps against that derived from the reference human genome, and identified structural variations that are >5 kb in size. We find that these individuals have many more structural variants than those published, including some with the potential of disrupting gene function or regulation. Copyright © 2016 by the Genetics Society of America.

  8. Non-radioactive detection of trinucleotide repeat size variability.

    PubMed

    Tomé, Stéphanie; Nicole, Annie; Gomes-Pereira, Mario; Gourdon, Genevieve

    2014-03-06

    Many human diseases are associated with the abnormal expansion of unstable trinucleotide repeat sequences. The mechanisms of trinucleotide repeat size mutation have not been fully dissected, and their understanding must be grounded on the detailed analysis of repeat size distributions in human tissues and animal models. Small-pool PCR (SP-PCR) is a robust, highly sensitive and efficient PCR-based approach to assess the levels of repeat size variation, providing both quantitative and qualitative data. The method relies on the amplification of a very low number of DNA molecules, through sucessive dilution of a stock genomic DNA solution. Radioactive Southern blot hybridization is sensitive enough to detect SP-PCR products derived from single template molecules, separated by agarose gel electrophoresis and transferred onto DNA membranes. We describe a variation of the detection method that uses digoxigenin-labelled locked nucleic acid probes. This protocol keeps the sensitivity of the original method, while eliminating the health risks associated with the manipulation of radiolabelled probes, and the burden associated with their regulation, manipulation and waste disposal.

  9. Quantitative single-molecule imaging by confocal laser scanning microscopy.

    PubMed

    Vukojevic, Vladana; Heidkamp, Marcus; Ming, Yu; Johansson, Björn; Terenius, Lars; Rigler, Rudolf

    2008-11-25

    A new approach to quantitative single-molecule imaging by confocal laser scanning microscopy (CLSM) is presented. It relies on fluorescence intensity distribution to analyze the molecular occurrence statistics captured by digital imaging and enables direct determination of the number of fluorescent molecules and their diffusion rates without resorting to temporal or spatial autocorrelation analyses. Digital images of fluorescent molecules were recorded by using fast scanning and avalanche photodiode detectors. In this way the signal-to-background ratio was significantly improved, enabling direct quantitative imaging by CLSM. The potential of the proposed approach is demonstrated by using standard solutions of fluorescent dyes, fluorescently labeled DNA molecules, quantum dots, and the Enhanced Green Fluorescent Protein in solution and in live cells. The method was verified by using fluorescence correlation spectroscopy. The relevance for biological applications, in particular, for live cell imaging, is discussed.

  10. Uptake of DNA by cancer cells without a transfection reagent.

    PubMed

    Kong, Yanping; Zhang, Xianbo; Zhao, Yongliang; Xue, Yanfang; Zhang, Ye

    2017-01-21

    Cancer cells exhibit elevated levels of glucose uptake and may obtain pre-formed, diet-derived fatty acids from the bloodstream to boost their rapid growth; they may also use nucleic acid from their microenvironment. The study of processing nucleic acid by cancer cells will help improve the understanding of the metabolism of cancer. DNA is commonly packaged into a viral or lipid particle to be transferred into cells; this process is called transfection in laboratory. Cancer cells are known for having gene mutations and the evolving ability of endocytosis. Their uptake of DNAs might be different from normal cells; they may take in DNAs directly from the environment. In this report, we studied the uptake of DNAs in cancer cells without a transfection reagent. A group of DNA fragments were prepared with PCR and labeled with isotope phosphorous-32 to test their uptake by Huh 7 (liver cancer) and THLE3 (normal liver cells) after incubation overnight by counting radioactivity of the cells' genomic DNA. Multiple cell lines including breast cancer and lung cancer were tested with the same method. DNA molecules were also labeled with fluorescence to test the location in the cells using a kit of "label it fluorescence in situ hybridization (FISH)" from Mirus (USA). The data demonstrated that hepatocellular carcinoma cells possess the ability to take in large DNA fragments directly without a transfection reagent whereas normal liver cells cannot. Huh7 and MDA-MB231 cells displayed a significantly higher Rhodamine density in the cytoplasmic phagosomes and this suggests that the mechanism of uptake of large DNA by cancer cells is likely endocytosis. The efficacy of uptake is related to the DNA's size. Some cell lines of lung cancer and breast cancer also showed similar uptake of DNA. In the present study, we have revealed the evidence that some cancer cells, but not nontumorigenic cells, can take DNA fragments directly from the environment without the aid of the transfecting reagent.

  11. A CMOS enhanced solid-state nanopore based single molecule detection platform.

    PubMed

    Chen, Chinhsuan; Yemenicioglu, Sukru; Uddin, Ashfaque; Corgliano, Ellie; Theogarajan, Luke

    2013-01-01

    Solid-state nanopores have emerged as a single molecule label-free electronic detection platform. Existing transimpedance stages used to measure ionic current nanopores suffer from dynamic range limitations resulting from steady-state baseline currents. We propose a digitally-assisted baseline cancellation CMOS platform that circumvents this issue. Since baseline cancellation is a form of auto-zeroing, the 1/f noise of the system is also reduced. Our proposed design can tolerate a steady state baseline current of 10µA and has a usable bandwidth of 750kHz. Quantitative DNA translocation experiments on 5kbp DNA was performed using a 5nm silicon nitride pore using both the CMOS platform and a commercial system. Comparison of event-count histograms show that the CMOS platform clearly outperforms the commercial system, allowing for unambiguous interpretation of the data.

  12. Investigations of nanoscale variations in spin and charge transport in manganites and organic semiconductors using spin polarized scanning tunneling spectroscopy

    NASA Astrophysics Data System (ADS)

    Hughes, Cameron Richard

    Analysis of DNA structure and behavior, up to and including full sequencing of a genome's bases, and of biological processes such as replication, transcription and translation, is essential for an understanding of genetic variation, heritable diseases and the effects of environmental factors. Recently, single-molecule techniques have been developed to study DNA properties in unprecedented detail. For a number of these techniques, controlled adsorption of linearly stretched DNA molecules on surfaces is necessary. In experiments where hybridization of adsorbed molecules to labeled probes is used to determine DNA structure, single-stranded DNA is needed. Conventionally, for long DNA's (up to Mbp), double-stranded DNA is deposited on a surface and denatured in-situ. While successful, this method has several disadvantages. This thesis reports efforts to directly adsorb long single-stranded DNA's out of solution as an alternative strategy. It consists of three parts: (1) Establishment of a simple method using Acridine Orange (AO) staining dye to determine whether DNA's are ss or ds on the surface. The method allows for the assessment of the degree of renaturation during deposition. Incubation of surface-adsorbed DNA in solutions of AO dye in the concentration range of 10--15uM were found to be effective for discriminating between ss DNA and ds DNA based on differences in the fluorescence emission spectra. (2) Deposition of ss DNA produced by heat denaturation on polymer-coated surfaces. Lambda DNA (48502bp) was adsorbed by drop evaporation or dipping/extraction of surface out of a buffered solution. The efficiency of deposition was optimized with respect to DNA concentration, buffer type and pH. (3) Separation of complementary single strands of Lambda, mono-cut digest and HindIII digest by gel electrophoresis. Using agarose gels in concentrations ranging from 0.4% to 1.4% (weight/volume), electric fields in the range 1--4V/cm in 1x Tris-Acetate-EDTA (TAE) buffer, good strand separation could be obtained. Both DC and pulsed electric fields were used and compared. Following separation, sense and anti-sense strands of lambda DNA were extracted from gels and deposited separately onto surfaces, and length distributions of the isolated molecules were measured by fluorescence microscopy.

  13. Synthesis and Characterization of DNase 1-Stabilized Gold Nanoclusters

    DTIC Science & Technology

    2014-10-01

    Acknowledgments The authors would like to thank Victor Rodriguez Santiago for the X-ray photoelectron spectroscopy. We also acknowledge the support of the...a Materials Research Science and Engineering Center Shared Experimental Facility. The authors would also like to thank Michael Sellers and Joshua...Postdoctoral Associateship. vi INTENTIONALLY LEFT BLANK. 1 1. Introduction The labeling of biological molecules like protein or DNA has been a large

  14. Highly Sensitive Detection of Target Biomolecules on Cell Surface Using Gold Nanoparticle Conjugated with Aptamer Probe

    NASA Astrophysics Data System (ADS)

    Kim, Hyonchol; Terazono, Hideyuki; Hayashi, Masahito; Takei, Hiroyuki; Yasuda, Kenji

    2012-06-01

    A method of gold nanoparticle (Au NP) labeling with backscattered electron (BE) imaging of field emission scanning electron microscopy (FE-SEM) was applied for specific detection of target biomolecules on a cell surface. A single-stranded DNA aptamer, which specifically binds to the target molecule on a human acute lymphoblastic leukemia cell, was conjugated with a 20 nm Au NP and used as a probe to label its target molecule on the cell. The Au NP probe was incubated with the cell, and the interaction was confirmed using BE imaging of FE-SEM through direct counting of the number of Au NPs attached on the target cell surface. Specific Au NP-aptamer probes were observed on a single cell surface and their spatial distributions including submicron-order localizations were also clearly visualized, whereas the nonspecific aptamer probes were not observed on it. The aptamer probe can be potentially dislodged from the cell surface with treatment of nucleases, indicating that Au NP-conjugated aptamer probes can be used as sensitive and reversible probes to label target biomolecules on cells.

  15. SPRi-based biosensing platforms for detection of specific DNA sequences using thiolate and dithiocarbamate assemblies

    NASA Astrophysics Data System (ADS)

    Drozd, Marcin; Pietrzak, Mariusz D.; Malinowska, Elżbieta

    2018-05-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0,66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 ·1012 molecules • cm-2 (with the calculated area occupied by single nanoparticle label of 132.7 nm2), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  16. SPRi-Based Biosensing Platforms for Detection of Specific DNA Sequences Using Thiolate and Dithiocarbamate Assemblies.

    PubMed

    Drozd, Marcin; Pietrzak, Mariusz D; Malinowska, Elżbieta

    2018-01-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0.66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 · 10 12 molecules · cm -2 (with the calculated area occupied by single nanoparticle label of ~132.7 nm 2 ), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  17. Dissection of molecular assembly dynamics by tracking orientation and position of single molecules in live cells

    PubMed Central

    McQuilken, Molly; La Riviere, Patrick J.; Occhipinti, Patricia; Verma, Amitabh; Oldenbourg, Rudolf; Gladfelter, Amy S.; Tani, Tomomi

    2016-01-01

    Regulation of order, such as orientation and conformation, drives the function of most molecular assemblies in living cells but remains difficult to measure accurately through space and time. We built an instantaneous fluorescence polarization microscope, which simultaneously images position and orientation of fluorophores in living cells with single-molecule sensitivity and a time resolution of 100 ms. We developed image acquisition and analysis methods to track single particles that interact with higher-order assemblies of molecules. We tracked the fluctuations in position and orientation of molecules from the level of an ensemble of fluorophores down to single fluorophores. We tested our system in vitro using fluorescently labeled DNA and F-actin, in which the ensemble orientation of polarized fluorescence is known. We then tracked the orientation of sparsely labeled F-actin network at the leading edge of migrating human keratinocytes, revealing the anisotropic distribution of actin filaments relative to the local retrograde flow of the F-actin network. Additionally, we analyzed the position and orientation of septin-GFP molecules incorporated in septin bundles in growing hyphae of a filamentous fungus. Our data indicate that septin-GFP molecules undergo positional fluctuations within ∼350 nm of the binding site and angular fluctuations within ∼30° of the central orientation of the bundle. By reporting position and orientation of molecules while they form dynamic higher-order structures, our approach can provide insights into how micrometer-scale ordered assemblies emerge from nanoscale molecules in living cells. PMID:27679846

  18. Label-free CMOS bio sensor with on-chip noise reduction scheme for real-time quantitative monitoring of biomolecules.

    PubMed

    Seong-Jin Kim; Euisik Yoon

    2012-06-01

    We present a label-free CMOS field-effect transistor sensing array to detect the surface potential change affected by the negative charge in DNA molecules for real-time monitoring and quantification. The proposed CMOS bio sensor includes a new sensing pixel architecture implemented with correlated double sampling for reducing offset fixed pattern noise and 1/f noise of the sensing devices. We incorporated non-surface binding detection which allows real-time continuous monitoring of DNA concentrations without immobilizing them on the sensing surface. Various concentrations of 19-bp oligonucleotides solution can be discriminated using the prototype device fabricated in 1- μm double-poly double-metal standard CMOS process. The detection limit was measured as 1.1 ng/μl with a dynamic range of 40 dB and the transient response time was measured less than 20 seconds.

  19. Development of a miRNA surface-enhanced Raman scattering assay using benchtop and handheld Raman systems.

    PubMed

    Schechinger, Monika; Marks, Haley; Locke, Andrea; Choudhury, Mahua; Cote, Gerard

    2018-01-01

    DNA-functionalized nanoparticles, when paired with surface-enhanced Raman spectroscopy (SERS), can rapidly detect microRNA. However, widespread use of this approach is hindered by drawbacks associated with large and expensive benchtop Raman microscopes. MicroRNA-17 (miRNA-17) has emerged as a potential epigenetic indicator of preeclampsia, a condition that occurs during pregnancy. Biomarker detection using an SERS point-of-care device could enable prompt diagnosis and prevention as early as the first trimester. Recently, strides have been made in developing portable Raman systems for field applications. An SERS assay for miRNA-17 was assessed and translated from traditional benchtop Raman microscopes to a handheld system. Three different photoactive molecules were compared as potential Raman reporter molecules: a chromophore, malachite green isothiocyanate (MGITC), a fluorophore, tetramethylrhodamine isothiocyanate, and a polarizable small molecule 5,5-dithio-bis-(2-nitrobenzoic acid) (DTNB). For the benchtop Raman microscope, the DTNB-labeled assay yielded the greatest sensitivity under 532-nm laser excitation, but the MGITC-labeled assay prevailed at 785 nm. Conversely, DTNB was preferable for the miniaturized 785-nm Raman system. This comparison showed significant SERS enhancement variation in response to 1-nM miRNA-17, implying that the sensitivity of the assay may be more heavily dependent on the excitation wavelength, instrumentation, and Raman reporter chosen than on the plasmonic coupling from DNA/miRNA-mediated nanoparticle assemblies. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

  20. Förster resonance energy transfer and protein-induced fluorescence enhancement as synergetic multi-scale molecular rulers

    NASA Astrophysics Data System (ADS)

    Ploetz, Evelyn; Lerner, Eitan; Husada, Florence; Roelfs, Martin; Chung, Sangyoon; Hohlbein, Johannes; Weiss, Shimon; Cordes, Thorben

    2016-09-01

    Advanced microscopy methods allow obtaining information on (dynamic) conformational changes in biomolecules via measuring a single molecular distance in the structure. It is, however, extremely challenging to capture the full depth of a three-dimensional biochemical state, binding-related structural changes or conformational cross-talk in multi-protein complexes using one-dimensional assays. In this paper we address this fundamental problem by extending the standard molecular ruler based on Förster resonance energy transfer (FRET) into a two-dimensional assay via its combination with protein-induced fluorescence enhancement (PIFE). We show that donor brightness (via PIFE) and energy transfer efficiency (via FRET) can simultaneously report on e.g., the conformational state of double stranded DNA (dsDNA) following its interaction with unlabelled proteins (BamHI, EcoRV, and T7 DNA polymerase gp5/trx). The PIFE-FRET assay uses established labelling protocols and single molecule fluorescence detection schemes (alternating-laser excitation, ALEX). Besides quantitative studies of PIFE and FRET ruler characteristics, we outline possible applications of ALEX-based PIFE-FRET for single-molecule studies with diffusing and immobilized molecules. Finally, we study transcription initiation and scrunching of E. coli RNA-polymerase with PIFE-FRET and provide direct evidence for the physical presence and vicinity of the polymerase that causes structural changes and scrunching of the transcriptional DNA bubble.

  1. Förster resonance energy transfer and protein-induced fluorescence enhancement as synergetic multi-scale molecular rulers

    PubMed Central

    Ploetz, Evelyn; Lerner, Eitan; Husada, Florence; Roelfs, Martin; Chung, SangYoon; Hohlbein, Johannes; Weiss, Shimon; Cordes, Thorben

    2016-01-01

    Advanced microscopy methods allow obtaining information on (dynamic) conformational changes in biomolecules via measuring a single molecular distance in the structure. It is, however, extremely challenging to capture the full depth of a three-dimensional biochemical state, binding-related structural changes or conformational cross-talk in multi-protein complexes using one-dimensional assays. In this paper we address this fundamental problem by extending the standard molecular ruler based on Förster resonance energy transfer (FRET) into a two-dimensional assay via its combination with protein-induced fluorescence enhancement (PIFE). We show that donor brightness (via PIFE) and energy transfer efficiency (via FRET) can simultaneously report on e.g., the conformational state of double stranded DNA (dsDNA) following its interaction with unlabelled proteins (BamHI, EcoRV, and T7 DNA polymerase gp5/trx). The PIFE-FRET assay uses established labelling protocols and single molecule fluorescence detection schemes (alternating-laser excitation, ALEX). Besides quantitative studies of PIFE and FRET ruler characteristics, we outline possible applications of ALEX-based PIFE-FRET for single-molecule studies with diffusing and immobilized molecules. Finally, we study transcription initiation and scrunching of E. coli RNA-polymerase with PIFE-FRET and provide direct evidence for the physical presence and vicinity of the polymerase that causes structural changes and scrunching of the transcriptional DNA bubble. PMID:27641327

  2. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  3. Measuring DNA Replication in Hypoxic Conditions.

    PubMed

    Foskolou, Iosifina P; Biasoli, Deborah; Olcina, Monica M; Hammond, Ester M

    2016-01-01

    It is imperative that dividing cells maintain replication fork integrity in order to prevent DNA damage and cell death. The investigation of DNA replication is of high importance as alterations in this process can lead to genomic instability, a known causative factor of tumor development. A simple, sensitive, and informative technique which enables the study of DNA replication, is the DNA fiber assay, an adaptation of which is described in this chapter. The DNA fiber method is a powerful tool, which allows the quantitative and qualitative analysis of DNA replication at the single molecule level. The sequential pulse labeling of live cells with two thymidine analogues and the subsequent detection with specific antibodies and fluorescence imaging allows direct examination of sites of DNA synthesis. In this chapter, we describe how this assay can be performed in conditions of low oxygen levels (hypoxia)-a physiologically relevant stress that occurs in most solid tumors. Moreover, we suggest ways on how to overcome the technical problems that arise while using the hypoxic chambers.

  4. Nanobiodevices for Biomolecule Analysis and Imaging

    NASA Astrophysics Data System (ADS)

    Yasui, Takao; Kaji, Noritada; Baba, Yoshinobu

    2013-06-01

    Nanobiodevices have been developed to analyze biomolecules and cells for biomedical applications. In this review, we discuss several nanobiodevices used for disease-diagnostic devices, molecular imaging devices, regenerative medicine, and drug-delivery systems and describe the numerous advantages of nanobiodevices, especially in biological, medical, and clinical applications. This review also outlines the fabrication technologies for nanostructures and nanomaterials, including top-down nanofabrication and bottom-up molecular self-assembly approaches. We describe nanopillar arrays and nanowall arrays for the ultrafast separation of DNA or protein molecules and nanoball materials for the fast separation of a wide range of DNA molecules, and we present examples of applications of functionalized carbon nanotubes to obtain information about subcellular localization on the basis of mobility differences between free fluorophores and fluorophore-labeled carbon nanotubes. Finally, we discuss applications of newly synthesized quantum dots to the screening of small interfering RNA, highly sensitive detection of disease-related proteins, and development of cancer therapeutics and diagnostics.

  5. DNA-assisted oligomerization of pore-forming toxin monomers into precisely-controlled protein channels

    PubMed Central

    Knechtel, Johann

    2017-01-01

    Abstract We have developed a novel approach for creating membrane-spanning protein-based pores. The construction principle is based on using well-defined, circular DNA nanostructures to arrange a precise number of pore-forming protein toxin monomers. We can thereby obtain, for the first time, protein pores with specifically set diameters. We demonstrate this principle by constructing artificial alpha-hemolysin (αHL) pores. The DNA/αHL hybrid nanopores composed of twelve, twenty or twenty-six monomers show stable insertions into lipid bilayers during electrical recordings, along with steady, pore size-dependent current levels. Our approach successfully advances the applicability of nanopores, in particular towards label-free studies of single molecules in large nanoscaled biological structures. PMID:29088457

  6. Massively parallel haplotyping on microscopic beads for the high-throughput phase analysis of single molecules.

    PubMed

    Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene

    2012-01-01

    In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.

  7. Molecular DNA-based detection of ionising radiation in meat.

    PubMed

    Şakalar, Ergün

    2017-05-01

    Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  8. Magnetic Beads-Based Sensor with Tailored Sensitivity for Rapid and Single-Step Amperometric Determination of miRNAs.

    PubMed

    Vargas, Eva; Torrente-Rodríguez, Rebeca M; Ruiz-Valdepeñas Montiel, Víctor; Povedano, Eloy; Pedrero, María; Montoya, Juan J; Campuzano, Susana; Pingarrón, José M

    2017-11-09

    This work describes a sensitive amperometric magneto-biosensor for single-step and rapid determination of microRNAs (miRNAs). The developed strategy involves the use of direct hybridization of the target miRNA (miRNA-21) with a specific biotinylated DNA probe immobilized on streptavidin-modified magnetic beads (MBs), and labeling of the resulting heteroduplexes with a specific DNA-RNA antibody and the bacterial protein A (ProtA) conjugated with an horseradish peroxidase (HRP) homopolymer (Poly-HRP40) as an enzymatic label for signal amplification. Amperometric detection is performed upon magnetic capture of the modified MBs onto the working electrode surface of disposable screen-printed carbon electrodes (SPCEs) using the H₂O₂/hydroquinone (HQ) system. The magnitude of the cathodic signal obtained at -0.20 V (vs. the Ag pseudo-reference electrode) demonstrated linear dependence with the concentration of the synthetic target miRNA over the 1.0 to 100 pM range. The method provided a detection limit (LOD) of 10 attomoles (in a 25 μL sample) without any target miRNA amplification in just 30 min (once the DNA capture probe-MBs were prepared). This approach shows improved sensitivity compared with that of biosensors constructed with the same anti-DNA-RNA Ab as capture instead of a detector antibody and further labeling with a Strep-HRP conjugate instead of the Poly-HRP40 homopolymer. The developed strategy involves a single step working protocol, as well as the possibility to tailor the sensitivity by enlarging the length of the DNA/miRNA heteroduplexes using additional probes and/or performing the labelling with ProtA conjugated with homopolymers prepared with different numbers of HRP molecules. The practical usefulness was demonstrated by determination of the endogenous levels of the mature target miRNA in 250 ng raw total RNA (RNA t ) extracted from human mammary epithelial normal (MCF-10A) and cancer (MCF-7) cells and tumor tissues.

  9. Hyperthermal (1-100 eV) nitrogen ion scattering damage to D-ribose and 2-deoxy-D-ribose films.

    PubMed

    Deng, Zongwu; Bald, Ilko; Illenberger, Eugen; Huels, Michael A

    2007-10-14

    Highly charged heavy ion traversal of a biological medium can produce energetic secondary fragment ions. These fragment ions can in turn cause collisional and reactive scattering damage to DNA. Here we report hyperthermal (1-100 eV) scattering of one such fragment ion (N(+)) from biologically relevant sugar molecules D-ribose and 2-deoxy-D-ribose condensed on polycrystalline Pt substrate. The results indicate that N(+) ion scattering at kinetic energies down to 10 eV induces effective decomposition of both sugar molecules and leads to the desorption of abundant cation and anion fragments. Use of isotope-labeled molecules (5-(13)C D-ribose and 1-D D-ribose) partly reveals some site specificity of the fragment origin. Several scattering reactions are also observed. Both ionic and neutral nitrogen atoms abstract carbon from the molecules to form CN(-) anion at energies down to approximately 5 eV. N(+) ions also abstract hydrogen from hydroxyl groups of the molecules to form NH(-) and NH(2) (-) anions. A fraction of OO(-) fragments abstract hydrogen to form OH(-). The formation of H(3)O(+) ions also involves hydrogen abstraction as well as intramolecular proton transfer. These findings suggest a variety of severe damaging pathways to DNA molecules which occur on the picosecond time scale following heavy ion irradiation of a cell, and prior to the late diffusion-limited homogeneous chemical processes.

  10. Proximity-dependent isothermal cycle amplification for small-molecule detection based on surface enhanced Raman scattering.

    PubMed

    Li, Ying; Zeng, Yan; Mao, Yaning; Lei, Chengcun; Zhang, Shusheng

    2014-01-15

    A novel proximity-dependent isothermal cycle amplification (PDICA) strategy has been proposed and successfully used for the determination of cocaine coupled with surface enhanced Raman scattering (SERS). For enhancing the SERS signal, Raman dye molecules modified bio-barcode DNA and gold nanoparticles (AuNPs) are used to prepare the Raman probes. Magnetic beads (MBs) are used as the carrier of amplification template and signal output products for circumventing the problem of high background induced by excess bio-barcode DNA. In the presence of target molecules, two label-free proximity probes can hybridize with each other and subsequently opens the hairpin connector-probe to perform the PDICA reaction including the target recycling amplification and strand-displacement amplification. As a result, abundant AuNPs Raman probes can be anchored on the surface of MBs and a low detection limit of 0.1 nM for cocaine is obtained. This assay also exhibits an excellent selectivity and has been successfully performed in human serum, which confirms the reliability and practicality of this protocol. © 2013 Elsevier B.V. All rights reserved.

  11. A label-free, fluorescence based assay for microarray

    NASA Astrophysics Data System (ADS)

    Niu, Sanjun

    DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same intensity of excitation light. The fluorescence contrast is used to quantify the amount of probe-target hybridization. A mathematical model that considers multiple reflections and scattering is developed to explain the mechanism of the fluorescence contrast which depends on the thickness of the PS film. Scattering is the dominant factor that contributes to the contrast. The potential of this assay to detect single nucleotide polymorphism is also tested.

  12. Simple methods for the 3' biotinylation of RNA.

    PubMed

    Moritz, Bodo; Wahle, Elmar

    2014-03-01

    Biotinylation of RNA allows its tight coupling to streptavidin and is thus useful for many types of experiments, e.g., pull-downs. Here we describe three simple techniques for biotinylating the 3' ends of RNA molecules generated by chemical or enzymatic synthesis. First, extension with either the Schizosaccharomyces pombe noncanonical poly(A) polymerase Cid1 or Escherichia coli poly(A) polymerase and N6-biotin-ATP is simple, efficient, and generally applicable independently of the 3'-end sequences of the RNA molecule to be labeled. However, depending on the enzyme and the reaction conditions, several or many biotinylated nucleotides are incorporated. Second, conditions are reported under which splint-dependent ligation by T4 DNA ligase can be used to join biotinylated and, presumably, other chemically modified DNA oligonucleotides to RNA 3' ends even if these are heterogeneous as is typical for products of enzymatic synthesis. Third, we describe the use of 29 DNA polymerase for a template-directed fill-in reaction that uses biotin-dUTP and, thanks to the enzyme's proofreading activity, can cope with more extended 3' heterogeneities.

  13. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

    PubMed Central

    Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

    2012-01-01

    RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

  14. Preparation of water soluble L-arginine capped CdSe/ZnS QDs and their interaction with synthetic DNA: Picosecond-resolved FRET study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giri, Anupam; Goswami, Nirmal; Lemmens, Peter

    2012-08-15

    Graphical abstract: Förster resonance energy transfer (FRET) studies on the interaction of water soluble arginine-capped CdSe/ZnS QDs with ethidium bromide (EB) labeled synthetic dodecamer DNA. Highlights: ► We have solubilized CdSe/ZnS QD in water replacing their TOPO ligand by L-arginine. ► We have studied arginine@QD–DNA interaction using FRET technique. ► Arginine@QDs act as energy donor and ethidium bromide-DNA acts as energy acceptor. ► We have applied a kinetic model to understand the kinetics of energy transfer. ► Circular dichroism studies revealed negligible perturbation in the DNA B-form in the arg@QD-DNA complex. -- Abstract: We have exchanged TOPO (trioctylphosphine oxide) ligandmore » of CdSe/ZnS core/shell quantum dots (QDs) with an amino acid L-arginine (Arg) at the toluene/water interface and eventually rendered the QDs from toluene to aqueous phase. We have studied the interaction of the water soluble Arg-capped QDs (energy donor) with ethidium (EB) labeled synthetic dodecamer DNA (energy acceptor) using picoseconds resolved Förster resonance energy transfer (FRET) technique. Furthermore, we have applied a model developed by M. Tachiya to understand the kinetics of energy transfer and the distribution of acceptor (EB-DNA) molecules around the donor QDs. Circular dichroism (CD) studies revealed a negligible perturbation in the native B-form structure of the DNA upon interaction with Arg-capped QDs. The melting and the rehybridization pathways of the DNA attached to the QDs have been monitored by the CD which reveals hydrogen bonding is the associative mechanism for interaction between Arg-capped QDs and DNA.« less

  15. Super-resolution binding activated localization microscopy through reversible change of DNA conformation.

    PubMed

    Szczurek, Aleksander; Birk, Udo; Knecht, Hans; Dobrucki, Jurek; Mai, Sabine; Cremer, Christoph

    2018-01-01

    Methods of super-resolving light microscopy (SRM) have found an exponentially growing range of applications in cell biology, including nuclear structure analyses. Recent developments have proven that Single Molecule Localization Microscopy (SMLM), a type of SRM, is particularly useful for enhanced spatial analysis of the cell nucleus due to its highest resolving capability combined with very specific fluorescent labeling. In this commentary we offer a brief review of the latest methodological development in the field of SMLM of chromatin designated DNA Structure Fluctuation Assisted Binding Activated Localization Microscopy (abbreviated as fBALM) as well as its potential future applications in biology and medicine.

  16. Super-resolution binding activated localization microscopy through reversible change of DNA conformation

    PubMed Central

    Knecht, Hans; Dobrucki, Jurek; Mai, Sabine

    2018-01-01

    ABSTRACT Methods of super-resolving light microscopy (SRM) have found an exponentially growing range of applications in cell biology, including nuclear structure analyses. Recent developments have proven that Single Molecule Localization Microscopy (SMLM), a type of SRM, is particularly useful for enhanced spatial analysis of the cell nucleus due to its highest resolving capability combined with very specific fluorescent labeling. In this commentary we offer a brief review of the latest methodological development in the field of SMLM of chromatin designated DNA Structure Fluctuation Assisted Binding Activated Localization Microscopy (abbreviated as fBALM) as well as its potential future applications in biology and medicine. PMID:29297245

  17. Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin.

    PubMed

    Ball, David A; Mehta, Gunjan D; Salomon-Kent, Ronit; Mazza, Davide; Morisaki, Tatsuya; Mueller, Florian; McNally, James G; Karpova, Tatiana S

    2016-12-01

    In vivo single molecule tracking has recently developed into a powerful technique for measuring and understanding the transient interactions of transcription factors (TF) with their chromatin response elements. However, this method still lacks a solid foundation for distinguishing between specific and non-specific interactions. To address this issue, we took advantage of the power of molecular genetics of yeast. Yeast TF Ace1p has only five specific sites in the genome and thus serves as a benchmark to distinguish specific from non-specific binding. Here, we show that the estimated residence time of the short-residence molecules is essentially the same for Hht1p, Ace1p and Hsf1p, equaling 0.12-0.32 s. These three DNA-binding proteins are very different in their structure, function and intracellular concentration. This suggests that (i) short-residence molecules are bound to DNA non-specifically, and (ii) that non-specific binding shares common characteristics between vastly different DNA-bound proteins and thus may have a common underlying mechanism. We develop new and robust procedure for evaluation of adverse effects of labeling, and new quantitative analysis procedures that significantly improve residence time measurements by accounting for fluorophore blinking. Our results provide a framework for the reliable performance and analysis of single molecule TF experiments in yeast. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  18. DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

    PubMed

    Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

    2006-12-15

    We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

  19. SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

    Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

  20. DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

    PubMed

    Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun

    2016-09-15

    We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Plasmonic nanoparticles-decorated diatomite biosilica: extending the horizon of on-chip chromatography and label-free biosensing.

    PubMed

    Kong, Xianming; Li, Erwen; Squire, Kenny; Liu, Ye; Wu, Bo; Cheng, Li-Jing; Wang, Alan X

    2017-11-01

    Diatomite consists of fossilized remains of ancient diatoms and is a type of naturally abundant photonic crystal biosilica with multiple unique physical and chemical functionalities. In this paper, we explored the fluidic properties of diatomite as the matrix for on-chip chromatography and, simultaneously, the photonic crystal effects to enhance the plasmonic resonances of metallic nanoparticles for surface-enhanced Raman scattering (SERS) biosensing. The plasmonic nanoparticle-decorated diatomite biosilica provides a lab-on-a-chip capability to separate and detect small molecules from mixture samples with ultra-high detection sensitivity down to 1 ppm. We demonstrate the significant potential for biomedical applications by screening toxins in real biofluid, achieving simultaneous label-free biosensing of phenethylamine and miR21cDNA in human plasma with unprecedented sensitivity and specificity. To the best of our knowledge, this is the first time demonstration to detect target molecules from real biofluids by on-chip chromatography-SERS techniques. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Intranucleus Single-Molecule Imaging in Living Cells.

    PubMed

    Shao, Shipeng; Xue, Boxin; Sun, Yujie

    2018-06-01

    Many critical processes occurring in mammalian cells are stochastic and can be directly observed at the single-molecule level within their physiological environment, which would otherwise be obscured in an ensemble measurement. There are various fundamental processes in the nucleus, such as transcription, replication, and DNA repair, the study of which can greatly benefit from intranuclear single-molecule imaging. However, the number of such studies is relatively small mainly because of lack of proper labeling and imaging methods. In the past decade, tremendous efforts have been devoted to developing tools for intranuclear imaging. Here, we mainly describe the recent methodological developments of single-molecule imaging and their emerging applications in the live nucleus. We also discuss the remaining issues and provide a perspective on future developments and applications of this field. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  3. Can nanotechnology help advance glaciological research?

    NASA Astrophysics Data System (ADS)

    Dahlke, H. E.; McNew, C.; Wang, C.; McLaughlin, S.; Kocis, T. N.

    2017-12-01

    In a rapidly changing cryosphere, identifying sources, pathways, and residence times of snow and glacier meltwater is critical to developing improved understanding of watershed-stream connections and hydrological/glaciological melt models. Traditionally, glaciologists have used a variety of tracers, including chloride, microparticles, and dyes, to identify the structure and morphology of subglacial drainage systems. However, minimum detection limits, tracer expense, and the ability of watersheds to retain a memory of past tracer inputs have restricted both the scale of tracer application and the repeated or simultaneous use of most known tracers, thus limiting our ability to study complex glacial systems. These shortcomings in hydrologic tracers can be overcome by utilizing a tracer that allows for the unique identification between spatial and temporal inputs while maintaining identical transport characteristics. Here, we present the use of DNA-labeled nanoparticles, developed for nano-medicine and drug delivery, as environmental tracers. The DNA-labeled particle tracers consist of short DNA strands encapsulated within biodegradable polymer microspheres, which allow for repeatable production of numerous uniquely labelled tracers of pre-determined size and physical transport properties. Each batch of tracers are independently quantifiable; even a single DNA molecule can be detected with cost-effective quantitative polymerase chain reaction (qPCR). We have tested our tracer technology in complex systems such as valley glaciers in Sweden and Alaska and in both laboratory and field studies of channel flow, overland flow, and flow in porous media; these proof-of-concept studies indicate that nanotechnology allows for powerful characterization, description, and, ultimately, prediction of flow pathways in glacial systems and the environment.

  4. Surface-enhanced localized surface plasmon resonance biosensing of avian influenza DNA hybridization using subwavelength metallic nanoarrays

    NASA Astrophysics Data System (ADS)

    Kim, Shin Ae; Byun, Kyung Min; Kim, Kyujung; Jang, Sung Min; Ma, Kyungjae; Oh, Youngjin; Kim, Donghyun; Kim, Sung Guk; Shuler, Michael L.; Kim, Sung June

    2010-09-01

    We demonstrated enhanced localized surface plasmon resonance (SPR) biosensing based on subwavelength gold nanoarrays built on a thin gold film. Arrays of nanogratings (1D) and nanoholes (2D) with a period of 200 nm were fabricated by electron-beam lithography and used for the detection of avian influenza DNA hybridization. Experimental results showed that both nanoarrays provided significant sensitivity improvement and, especially, 1D nanogratings exhibited higher SPR signal amplification compared with 2D nanohole arrays. The sensitivity enhancement is associated with changes in surface-limited reaction area and strong interactions between bound molecules and localized plasmon fields. Our approach is expected to improve both the sensitivity and sensing resolution and can be applicable to label-free detection of DNA without amplification by polymerase chain reaction.

  5. Space pruning monotonic search for the non-unique probe selection problem.

    PubMed

    Pappalardo, Elisa; Ozkok, Beyza Ahlatcioglu; Pardalos, Panos M

    2014-01-01

    Identification of targets, generally viruses or bacteria, in a biological sample is a relevant problem in medicine. Biologists can use hybridisation experiments to determine whether a specific DNA fragment, that represents the virus, is presented in a DNA solution. A probe is a segment of DNA or RNA, labelled with a radioactive isotope, dye or enzyme, used to find a specific target sequence on a DNA molecule by hybridisation. Selecting unique probes through hybridisation experiments is a difficult task, especially when targets have a high degree of similarity, for instance in a case of closely related viruses. After preliminary experiments, performed by a canonical Monte Carlo method with Heuristic Reduction (MCHR), a new combinatorial optimisation approach, the Space Pruning Monotonic Search (SPMS) method, is introduced. The experiments show that SPMS provides high quality solutions and outperforms the current state-of-the-art algorithms.

  6. In vitro replication of poliovirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lubinski, J.M.

    1986-01-01

    Poliovirus is a member of the Picornaviridae whose genome is a single stranded RNA molecule of positive polarity surrounded by a proteinaceous capsid. Replication of poliovirus occurs via negative strand intermediates in infected cells using a virally encoded RNA-dependent RNA polymerase and host cell proteins. The authors have exploited the fact that complete cDNA copies of the viral genome when transfected onto susceptible cells generate virus. Utilizing the bacteriophage SP6 DNA dependent RNA polymerase system to synthesize negative strands in vitro and using these in an in vitro reaction the authors have generated full length infectious plus strands. Mutagenesis ofmore » the 5' and 3' ends of the negative and positive strands demonstrated that replication could occur either de novo or be extensions of the templates from their 3' ends or from nicks occurring during replication. The appearance of dimeric RNA molecules generated in these reactions was not dependent upon the same protein required for de novo initiation. Full length dimeric RNA molecules using a 5' /sup 32/P end-labelled oligo uridylic acid primer and positive strand template were demonstrated in vitro containing only the 35,000 Mr host protein and the viral RNA-dependent RNA polymerase. A model for generating positive strands without protein priming by cleavage of dimeric RNA molecules was proposed.« less

  7. Effects of molecular size and chemical factor on plasma gene transfection

    NASA Astrophysics Data System (ADS)

    Ikeda, Yoshihisa; Motomura, Hideki; Kido, Yugo; Satoh, Susumu; Jinno, Masafumi

    2016-07-01

    In order to clarify the mechanism of plasma gene transfection, the relationship between transfection efficiency and transferred molecular size was investigated. Molecules with low molecular mass (less than 50 kDa; dye or dye-labeled oligonucleotide) and high molecular mass (more than 1 MDa; plasmid DNA or fragment of plasmid DNA) were transferred to L-929 cells. It was found that the transfection efficiency decreases with increasing in transferred molecular size and also depends on the tertiary structure of transferred molecules. Moreover, it was suggested the transfection mechanism is different between the molecules with low (less than 50 kDa) and high molecular mass (higher than 1 MDa). For the amount of gene transfection after plasma irradiation, which is comparable to that during plasma irradiation, it is shown that H2O2 molecules are the main contributor. The transfection efficiency decreased to 0.40 ± 0.22 upon scavenging the H2O2 generated by plasma irradiation using the catalase. On the other hand, when the H2O2 solution is dropped into the cell suspension without plasma irradiation, the transfection efficiency is almost 0%. In these results, it is also suggested that there is a synergetic effect of H2O2 with electrical factors or other reactive species generated by plasma irradiation.

  8. Two-color, 30 second microwave-accelerated Metal-Enhanced Fluorescence DNA assays: a new Rapid Catch and Signal (RCS) technology.

    PubMed

    Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D

    2011-03-07

    For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Preparation and high-resolution microscopy of gold cluster labeled nucleic acid conjugates and nanodevices

    PubMed Central

    Powell, Richard D.; Hainfeld, James F.

    2013-01-01

    Nanogold and undecagold are covalently linked gold cluster labels which enable the identification and localization of biological components with molecular precision and resolution. They can be prepared with different reactivities, which means they can be conjugated to a wide variety of molecules, including nucleic acids, at specific, unique sites. The location of these sites can be synthetically programmed in order to preserve the binding affinity of the conjugate and impart novel characteristics and useful functionality. Methods for the conjugation of undecagold and Nanogold to DNA and RNA are discussed, and applications of labeled conjugates to the high-resolution microscopic identification of binding sites and characterization of biological macromolecular assemblies are described. In addition to providing insights into their molecular structure and function, high-resolution microscopic methods also show how Nanogold and undecagold conjugates can be synthetically assembled, or self-assemble, into supramolecular materials to which the gold cluster labels impart useful functionality. PMID:20869258

  10. Double-labeled donor probe can enhance the signal of fluorescence resonance energy transfer (FRET) in detection of nucleic acid hybridization

    PubMed Central

    Okamura, Yukio; Kondo, Satoshi; Sase, Ichiro; Suga, Takayuki; Mise, Kazuyuki; Furusawa, Iwao; Kawakami, Shigeki; Watanabe, Yuichiro

    2000-01-01

    A set of fluorescently-labeled DNA probes that hybridize with the target RNA and produce fluorescence resonance energy transfer (FRET) signals can be utilized for the detection of specific RNA. We have developed probe sets to detect and discriminate single-strand RNA molecules of plant viral genome, and sought a method to improve the FRET signals to handle in vivo applications. Consequently, we found that a double-labeled donor probe labeled with Bodipy dye yielded a remarkable increase in fluorescence intensity compared to a single-labeled donor probe used in an ordinary FRET. This double-labeled donor system can be easily applied to improve various FRET probes since the dependence upon sequence and label position in enhancement is not as strict. Furthermore this method could be applied to other nucleic acid substances, such as oligo RNA and phosphorothioate oligonucleotides (S-oligos) to enhance FRET signal. Although the double-labeled donor probes labeled with a variety of fluorophores had unexpected properties (strange UV-visible absorption spectra, decrease of intensity and decay of donor fluorescence) compared with single-labeled ones, they had no relation to FRET enhancement. This signal amplification mechanism cannot be explained simply based on our current results and knowledge of FRET. Yet it is possible to utilize this double-labeled donor system in various applications of FRET as a simple signal-enhancement method. PMID:11121494

  11. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    PubMed

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  12. Localization Microscopy Analyses of MRE11 Clusters in 3D-Conserved Cell Nuclei of Different Cell Lines.

    PubMed

    Eryilmaz, Marion; Schmitt, Eberhard; Krufczik, Matthias; Theda, Franziska; Lee, Jin-Ho; Cremer, Christoph; Bestvater, Felix; Schaufler, Wladimir; Hausmann, Michael; Hildenbrand, Georg

    2018-01-22

    In radiation biophysics, it is a subject of nowadays research to investigate DNA strand break repair in detail after damage induction by ionizing radiation. It is a subject of debate as to what makes up the cell's decision to use a certain repair pathway and how the repair machinery recruited in repair foci is spatially and temporarily organized. Single-molecule localization microscopy (SMLM) allows super-resolution analysis by precise localization of single fluorescent molecule tags, resulting in nuclear structure analysis with a spatial resolution in the 10 nm regime. Here, we used SMLM to study MRE11 foci. MRE11 is one of three proteins involved in the MRN-complex (MRE11-RAD50-NBS1 complex), a prominent DNA strand resection and broken end bridging component involved in homologous recombination repair (HRR) and alternative non-homologous end joining (a-NHEJ). We analyzed the spatial arrangements of antibody-labelled MRE11 proteins in the nuclei of a breast cancer and a skin fibroblast cell line along a time-course of repair (up to 48 h) after irradiation with a dose of 2 Gy. Different kinetics for cluster formation and relaxation were determined. Changes in the internal nano-scaled structure of the clusters were quantified and compared between the two cell types. The results indicate a cell type-dependent DNA damage response concerning MRE11 recruitment and cluster formation. The MRE11 data were compared to H2AX phosphorylation detected by γH2AX molecule distribution. These data suggested modulations of MRE11 signal frequencies that were not directly correlated to DNA damage induction. The application of SMLM in radiation biophysics offers new possibilities to investigate spatial foci organization after DNA damaging and during subsequent repair.

  13. Localization Microscopy Analyses of MRE11 Clusters in 3D-Conserved Cell Nuclei of Different Cell Lines

    PubMed Central

    Eryilmaz, Marion; Schmitt, Eberhard; Krufczik, Matthias; Theda, Franziska; Lee, Jin-Ho; Cremer, Christoph; Bestvater, Felix; Schaufler, Wladimir; Hildenbrand, Georg

    2018-01-01

    In radiation biophysics, it is a subject of nowadays research to investigate DNA strand break repair in detail after damage induction by ionizing radiation. It is a subject of debate as to what makes up the cell’s decision to use a certain repair pathway and how the repair machinery recruited in repair foci is spatially and temporarily organized. Single-molecule localization microscopy (SMLM) allows super-resolution analysis by precise localization of single fluorescent molecule tags, resulting in nuclear structure analysis with a spatial resolution in the 10 nm regime. Here, we used SMLM to study MRE11 foci. MRE11 is one of three proteins involved in the MRN-complex (MRE11-RAD50-NBS1 complex), a prominent DNA strand resection and broken end bridging component involved in homologous recombination repair (HRR) and alternative non-homologous end joining (a-NHEJ). We analyzed the spatial arrangements of antibody-labelled MRE11 proteins in the nuclei of a breast cancer and a skin fibroblast cell line along a time-course of repair (up to 48 h) after irradiation with a dose of 2 Gy. Different kinetics for cluster formation and relaxation were determined. Changes in the internal nano-scaled structure of the clusters were quantified and compared between the two cell types. The results indicate a cell type-dependent DNA damage response concerning MRE11 recruitment and cluster formation. The MRE11 data were compared to H2AX phosphorylation detected by γH2AX molecule distribution. These data suggested modulations of MRE11 signal frequencies that were not directly correlated to DNA damage induction. The application of SMLM in radiation biophysics offers new possibilities to investigate spatial foci organization after DNA damaging and during subsequent repair. PMID:29361783

  14. Suppression of dexamethasone-stimulated DNA synthesis in an oncogene construct containing rat cell line by a DNA site-oriented ligand of poly-ADP-ribose polymerase: 6-amino-1,2-benzopyrone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kirsten, E.; Bauer, P.I.; Kun, E.

    1991-03-01

    The cellular inhibitory effects of 6-amino-1,2-benzopyrone (6-ABP), a DNA site-specific ligand of adenosine diphosphoribosyl transferase (ADPRT), were determined in a dexamethasone-sensitive EJ-ras gene construct containing cell line (14C cells). Dexamethansone in vitro transforms these cells to a tumorigenic phenotype and also stimulates cell replication. AT a nontoxic concentration 6-ABP treatment of intact cells for 4 days inhibits the dexamethasone-stimulated increment of cellular DNA content, depresses replicative DNA synthesis as assayed by thymidine incorporation to the level of cells that were not exposed to dexamethasone, and in permeabilized cells reduces the dexamethasone-stimulated increase of deoxyribonucleotide incorporation into DNA to the levelmore » of untreated cells. In situ pulse labeling of cells pretreated with 6-ABP indicated an inhibition of DNA synthesis at a stage prior to the formation of the 10-kb intermediate species. Neither dexamethasone nor the drug influenced the cellular quantity of ADPRT molecules, tested immunochemically.« less

  15. Histone Hl-DNA interaction. Influence of phosphorylation on the interaction of histone Hl with linear fragmented DNA.

    PubMed Central

    Glotov, B O; Nikolaev, L G; Kurochkin, S N; Severin, E S

    1977-01-01

    By measuring the fluorescence polarization of fluorescent histone H1 derivatives complexed with DNA, binding of the histone to DNA was studied as a function of ionic strength in the solution prior to and after the H1 phosphorylation on Ser-37 residue. Fluorescent labels were covalently linked either specifically to Tyr-72 residues or unspecifically to lysine residues in the H1 polypeptide chain. The values of the corresponding rotational relaxation times showed that at low ionic strength all the segments of the H1 molecule were immobilized on binding to DNA. The gradual increasing NaC1 concentration in the solution of H1-DNA complex was accompanied at first by additional retardation of the histone mobility in the complex, and then by progressive release of histone H1 from from the complex which was completed at 0.5-0.6 M NaC1 irrespective of phosphorylation. tat the same time the phosphorylation of histone H1 led to removal of the central and, presumably, N-terminal regions of H1 from DNA. PMID:194228

  16. Direct observation of single flexible polymers using single stranded DNA†

    PubMed Central

    Brockman, Christopher; Kim, Sun Ju

    2012-01-01

    Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981

  17. Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.

    PubMed

    Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng

    2015-10-07

    To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.

  18. Design of label-free, homogeneous biosensing platform based on plasmonic coupling and surface-enhanced Raman scattering using unmodified gold nanoparticles.

    PubMed

    Yi, Zi; Li, Xiao-Yan; Liu, Feng-Juan; Jin, Pei-Yan; Chu, Xia; Yu, Ru-Qin

    2013-05-15

    Surface-enhanced Raman scattering (SERS) has emerged as a promising spectroscopic technique for biosensing. However, to design a SERS-based biosensor, almost all currently used methods involve the time-consuming and complicated modification of the metallic nanoparticles with the Raman active dye and biorecognition element, which restricts their widespread applications. Herein, we report a label-free, homogeneous and easy-to-operate biosensing platform for the rapid, simple and sensitive SERS detection by using the unmodified gold nanoparticles (Au NPs). This strategy utilizes the difference in adsorption property of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) on citrate-coated Au NPs. In the presence of dsDNA, the aggregation of Au NPs takes place after adding salt solution because the dsDNA cannot adsorb on the Au NPs to protect them from salt-induced aggregation. Such aggregation gives rise to the plasmonic coupling of adjacent metallic NPs and turns on the enhancement of the Raman scattering, displaying a strong SERS signal. In contrast, the ssDNA can adsorb on the Au NPs surface through strong electrostatic attraction and protect them from salt-induced aggregation, showing a weak SERS signal. This approach is not only straightforward and simple in design but also rapid and convenient in operation. The feasibility and universality of the design have been demonstrated successfully by the detection of DNA and Hg(2+), and the assay possesses the superior signal-to-background ratio as high as ∼30 and excellent selectivity. The method can be extended to detect various analytes, such as other metal ions, proteins and small molecules by using the oligonucleotides that can selectively bind the analytes. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

    NASA Astrophysics Data System (ADS)

    Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

    2013-10-01

    Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

  20. Devices, systems, and methods for detecting nucleic acids using sedimentation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory J.

    Embodiments of the present invention are directed toward devices, systems, and method for conducting nucleic acid purification and quantification using sedimentation. In one example, a method includes generating complexes which bind to a plurality of beads in a fluid sample, individual ones of the complexes comprising a nucleic acid molecule such as DNA or RNA and a labeling agent. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a density lower than a density of the beads and higher than a density of the fluid sample, and wherein the transportingmore » occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.« less

  1. Tales told by tails: watching DNA driven through a random medium

    NASA Astrophysics Data System (ADS)

    Guan, Juan; Wang, Bo; Bae, Sung Chul; Granick, Steve

    2013-03-01

    DNA ligation is used to label separately the ends and centers of monodisperse DNA 16 μm in contour length, and 2-color fluorescence microscopy is used to follow with nm resolution how chains migrate through agarose networks driven by electric fields, at both whole chain and segment level. We observe that the leading segment is always a physical chain end which stretches and pulls out slack in the still-quiescent remainder of the chain until the other end is taken up. Heads and tails behave strikingly differently: the leading end of migrating chains migrates more smoothly, whereas motion of the trailing end shows intermittent pauses and jerky recoil. None of the mechanisms imagined classically for this situation - chain reptation, hooking or entropic trapping, appears to fully describe these data obtained from single-molecule visualization.

  2. High-Throughput Identification of Combinatorial Ligands for DNA Delivery in Cell Culture

    NASA Astrophysics Data System (ADS)

    Svahn, Mathias G.; Rabe, Kersten S.; Barger, Geoffrey; EL-Andaloussi, Samir; Simonson, Oscar E.; Didier, Boturyn; Olivier, Renaudet; Dumy, Pascal; Brandén, Lars J.; Niemeyer, Christof M.; Smith, C. I. Edvard

    2008-10-01

    Finding the optimal combinations of ligands for tissue-specific delivery is tedious even if only a few well-established compounds are tested. The cargo affects the receptor-ligand interaction, especially when it is charged like DNA. The ligand should therefore be evaluated together with its cargo. Several viruses have been shown to interact with more than one receptor, for efficient internalization. We here present a DNA oligonucleotide-based method for inexpensive and rapid screening of biotin labeled ligands for combinatorial effects on cellular binding and uptake. The oligonucleotide complex was designed as a 44 bp double-stranded DNA oligonucleotide with one central streptavidin molecule and a second streptavidin at the terminus. The use of a highly advanced robotic platform ensured stringent processing and execution of the experiments. The oligonucleotides were fluorescently labeled and used for detection and analysis of cell-bound, internalized and intra-cellular compartmentalized constructs by an automated line-scanning confocal microscope, IN Cell Analyzer 3000. All possible combinations of 22 ligands were explored in sets of 2 and tested on 6 different human cell lines in triplicates. In total, 10 000 transfections were performed on the automation platform. Cell-specific combinations of ligands were identified and their relative position on the scaffold oligonucleotide was found to be of importance. The ligands were found to be cargo dependent, carbohydrates were more potent for DNA delivery whereas cell penetrating peptides were more potent for delivery of less charged particles.

  3. Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs.

    PubMed

    Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M

    2017-06-01

    The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange events and exploring cellular heterogeneity. Strand-seq is a single-cell sequencing technology that resolves the individual homologs within a cell by restricting sequence analysis to the DNA template strands used during DNA replication. This protocol, which takes up to 4 d to complete, relies on the directionality of DNA, in which each single strand of a DNA molecule is distinguished based on its 5'-3' orientation. Culturing cells in a thymidine analog for one round of cell division labels nascent DNA strands, allowing for their selective removal during genomic library construction. To preserve directionality of template strands, genomic preamplification is bypassed and labeled nascent strands are nicked and not amplified during library preparation. Each single-cell library is multiplexed for pooling and sequencing, and the resulting sequence data are aligned, mapping to either the minus or plus strand of the reference genome, to assign template strand states for each chromosome in the cell. The major adaptations to conventional single-cell sequencing protocols include harvesting of daughter cells after a single round of BrdU incorporation, bypassing of whole-genome amplification, and removal of the BrdU + strand during Strand-seq library preparation. By sequencing just template strands, the structure and identity of each homolog are preserved.

  4. [Application of DNA labeling technology in forensic botany].

    PubMed

    Znang, Xian; Li, Jing-Lin; Zhang, Xiang-Yu

    2008-12-01

    Forensic botany is a study of judicial plant evidence. Recently, researches on DNA labeling technology have been a mainstream of forensic botany. The article systematically reviews various types of DNA labeling techniques in forensic botany with enumerated practical cases, as well as the potential forensic application of each individual technique. The advantages of the DNA labeling technology over traditional morphological taxonomic methods are also summarized.

  5. Sequence-specific sepsis-related DNA capture and fluorescent labeling in monoliths prepared by single-step photopolymerization in microfluidic devices.

    PubMed

    Knob, Radim; Hanson, Robert L; Tateoka, Olivia B; Wood, Ryan L; Guerrero-Arguero, Israel; Robison, Richard A; Pitt, William G; Woolley, Adam T

    2018-05-21

    Fast determination of antibiotic resistance is crucial in selecting appropriate treatment for sepsis patients, but current methods based on culture are time consuming. We are developing a microfluidic platform with a monolithic column modified with oligonucleotides designed for sequence-specific capture of target DNA related to the Klebsiella pneumoniae carbapenemase (KPC) gene. We developed a novel single-step monolith fabrication method with an acrydite-modified capture oligonucleotide in the polymerization mixture, enabling fast monolith preparation in a microfluidic channel using UV photopolymerization. These prepared columns had a threefold higher capacity compared to monoliths prepared in a multistep process involving Schiff-base DNA attachment. Conditions for denaturing, capture and fluorescence labeling using hybridization probes were optimized with synthetic 90-mer oligonucleotides. These procedures were applied for extraction of a PCR amplicon from the KPC antibiotic resistance gene in bacterial lysate obtained from a blood sample spiked with E. coli. The results showed similar eluted peak areas for KPC amplicon extracted from either hybridization buffer or bacterial lysate. Selective extraction of the KPC DNA was verified by real time PCR on eluted fractions. These results show great promise for application in an integrated microfluidic diagnostic system that combines upstream blood sample preparation and downstream single-molecule counting detection. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Surface Coverage and Structure of Mixed DNA/Alkylthiol Monolayers on Gold: Characterization by XPS, NEXAFS, and Fluorescence Intensity Measurements

    PubMed Central

    Lee, Chi-Ying; Gong, Ping; Harbers, Gregory M.; Grainger, David W.; Castner, David G.; Gamble, Lara J.

    2006-01-01

    Self-assembly of thiol-terminated single-stranded DNA (HS-ssDNA) on gold has served as an important model system for DNA immobilization at surfaces. Here, we report a detailed study of the surface composition and structure of mixed self-assembled DNA monolayers containing a short alkylthiol surface diluent [11-mercapto-1-undecanol (MCU)] on gold supports. These mixed DNA monolayers were studied with X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine structure spectroscopy (NEXAFS), and fluorescence intensity measurements. XPS results on sequentially adsorbed DNA/MCU monolayers on gold indicated that adsorbed MCU molecules first incorporate into the HS-ssDNA monolayer and, upon longer MCU exposures, displace adsorbed HS-ssDNA molecules from the surface. Thus, HS-ssDNA surface coverage steadily decreased with MCU exposure time. Polarization-dependent NEXAFS and fluorescence results both show changes in signals consistent with changes in DNA orientation after only 30 min of MCU exposure. NEXAFS polarization dependence (followed by monitoring the N 1s → π* transition) of the mixed DNA monolayers indicated that the DNA nucleotide base ring structures are oriented more parallel to the gold surface compared to DNA bases in pure HS-ssDNA monolayers. This indicates that HS-ssDNA oligomers reorient toward a more-upright position upon MCU incorporation. Fluorescence intensity results using end-labeled DNA probes on gold show little observable fluorescence on pure HS-ssDNA monolayers, likely due to substrate quenching effects between the fluorophore and the gold. MCU diluent incorporation into HS-ssDNA monolayers initially increases DNA fluorescence signal by densifying the chemisorbed monolayer, prompting an upright orientation of the DNA, and moving the terminal fluorophore away from the substrate. Immobilized DNA probe density and DNA target hybridization in these mixed DNA monolayers, as well as effects of MCU diluent on DNA hybridization in complex milieu (i.e., serum) were characterized by surface plasmon resonance (SPR) and 32P-radiometric assays and reported in a related study PMID:16689533

  7. NMR of enzymatically synthesized uniformly 13C15N-labeled DNA oligonucleotides.

    PubMed Central

    Zimmer, D P; Crothers, D M

    1995-01-01

    A procedure for the enzymatic synthesis of uniformly 13C15N-labeled DNA oligonucleotides in milligram quantities for NMR studies is described. Deoxynucleotides obtained from microorganisms grown on 13C and 15N nutrient sources are enzymatically phosphorylated to dNTPs, and the dNTPs are incorporated into oligonucleotides using a 3'-5' exonuclease-deficient mutant of Klenow fragment of DNA polymerase I and an oligonucleotide template primer designed for efficient separation of labeled product DNA from unlabeled template. The labeling strategy has been used to uniformly label one or the other oligonucleotide strand in the DNA duplex dGGCAAAACGG.dCCGTTTTGCC in order to facilitate assignment and structure determination by NMR. Application of 15N and 13C heteronuclear NMR experiments to isotopically labeled DNA is presented. Images Fig. 2 Fig. 3 Fig. 4 PMID:7724521

  8. Study on performance of magnetic fluorescent nanoparticles as gene carrier and location in pig kidney cells

    NASA Astrophysics Data System (ADS)

    Wang, Yan; Cui, Haixin; Sun, Changjiao; Du, Wei; Cui, Jinhui; Zhao, Xiang

    2013-03-01

    We evaluated the performance of green fluorescent magnetic Fe3O4 nanoparticles (NPs) as gene carrier and location in pig kidney cells. When the mass ratio of NPs to green fluorescent protein plasmid DNA reached 1:16 or above, DNA molecules can be combined completely with NPs, which indicates that the NPs have good ability to bind negative DNA. Atomic force microscopy (AFM) experiments were carried out to investigate the binding mechanism between NPs and DNA. AFM images show that individual DNA strands come off of larger pieces of netlike agglomerations and several spherical nanoparticles are attached to each individual DNA strand and interact with each other. The pig kidney cells were labelled with membrane-specific red fluorescent dye 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate and nucleus-specific blue fluorescent dye 4',6-diamidino-2-phenylindole dihydrochloride. We found that green fluorescent nanoparticles can past the cell membrane and spread throughout the interior of the cell. The NPs seem to locate more frequently in the cytoplasm than in the nucleus.

  9. Improved stability and electrophoretic properties of preformed fluorescent cationic dye-DNA complexes in a taps-tetrapentylammonium buffer in agarose slab gels.

    PubMed

    Zeng, Z; Clark, S M; Mathies, R A; Glazer, A N

    1997-10-01

    High-resolution capillary electrophoresis sizing of preformed complexes of bis-intercalating fluorescent dyes with double-stranded DNA has been demonstrated using hydroxyethylcellulose and 3-[tris-(hydroxymethyl) methylamino]-1-propanesulfonic acid-tetrapentylammonium (Taps-NPe+4) buffers (S. M. Clark and R. A. Mathies, Anal. Chem. 69, 1355-1363, 1997). Such capillary electrophoresis separations were unattainable in conventional buffers containing other cations such as Tris+, Na+, and NH+4. We report here the behavior of preformed double-stranded DNA-dye complexes on agarose slab gel electrophoresis in 40 mM Taps-NPe+4, 1 mM H2EDTA, pH 8.2. Upon electrophoresis in this buffer (a) complexes formed at DNA base pairs:dye ratios ranging from 100:1 to 5:1 show the same mobility; (b) the half-lives of DNA-dye complexes with monointercalators are two- to threefold longer than those in commonly used Tris buffers; (c) there is little dye transfer between labeled and unlabeled DNA molecules; and (d) precise two-color sizing of preformed restriction fragment-dye complexes with fluorescent bisintercalators is achieved.

  10. A nonenzymatic DNA nanomachine for biomolecular detection by target recycling of hairpin DNA cascade amplification.

    PubMed

    Zheng, Jiao; Li, Ningxing; Li, Chunrong; Wang, Xinxin; Liu, Yucheng; Mao, Guobin; Ji, Xinghu; He, Zhike

    2018-06-01

    Synthetic enzyme-free DNA nanomachine performs quasi-mechanical movements in response to external intervention, suggesting the promise of constructing sensitive and specific biosensors. Herein, a smart DNA nanomachine biosensor for biomolecule (such as nucleic acid, thrombin and adenosine) detection is developed by target-assisted enzyme-free hairpin DNA cascade amplifier. The whole DNA nanomachine system is constructed on gold nanoparticle which decorated with hundreds of locked hairpin substrate strands serving as DNA tracks, and the DNA nanomachine could be activated by target molecule toehold-mediated exchange on gold nanoparticle surface, resulted in the fluorescence recovery of fluorophore. The process is repeated so that each copy of the target can open multiplex fluorophore-labeled hairpin substrate strands, resulted in amplification of the fluorescence signal. Compared with the conventional biosensors of catalytic hairpin assembly (CHA) without substrate in solution, the DNA nanomachine could generate 2-3 orders of magnitude higher fluorescence signal. Furthermore, the DNA nanomachine could be used for nucleic acid, thrombin and adenosine highly sensitive specific detection based on isothermal, and homogeneous hairpin DNA cascade signal amplification in both buffer and a complicated biomatrix, and this kind of DNA nanomachine could be efficiently applied in the field of biomedical analysis. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.

    2002-02-01

    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

  12. Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

    PubMed Central

    Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

    2015-01-01

    Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

  13. Single cell and single molecule techniques for the analysis of the epigenome

    NASA Astrophysics Data System (ADS)

    Wallin, Christopher Benjamin

    Epigenetic regulation is a critical biological process for the health and development of a cell. Epigenetic regulation is facilitated by covalent modifications to the underlying DNA and chromatin proteins. A fundamental understanding of these epigenetic modifications and their associated interactions at the molecular scale is necessary to explain phenomena including cellular identity, stem cell plasticity, and neoplastic transformation. It is widely known that abnormal epigenetic profiles have been linked to many diseases, most notably cancer. While the field of epigenetics has progressed rapidly with conventional techniques, significant advances remain to be made with respect to combinatoric analysis of epigenetic marks and single cell epigenetics. Therefore, in this dissertation, I will discuss our development of devices and methodologies to address these pertinent issues. First, we designed a preparatory polydimethylsiloxane (PDMS) microdevice for the extraction, purification, and stretching of human chromosomal DNA and chromatin from small cell populations down to a single cell. The valveless device captures cells by size exclusion within the micropillars, entraps the DNA or chromatin in the micropillars after cell lysis, purifies away the cellular debris, and fluorescently labels the DNA and/or chromatin all within a single reaction chamber. With the device, we achieve nearly 100% extraction efficiency of the DNA. The device is also used for in-channel immunostaining of chromatin followed by downstream single molecule chromatin analysis in nanochannels (SCAN). Second, using multi-color, time-correlated single molecule measurements in nanochannels, simultaneous coincidence detection of 2 epigenetic marks is demonstrated. Coincidence detection of 3 epigenetic marks is also established using a pulsed interleaved excitation scheme. With these two promising results, genome-wide quantification of epigenetic marks was pursued. Unfortunately, quantitative SCAN never materialized. Reasons for this, including poor signal to background, are explained in detail. Third, development of mobility-SCAN, an analytical technique for measuring and analyzing single molecules based on their fluorescent signature and their electrophoretic mobility in nanochannels is described. We use the technique to differentiate biomolecules from complex mixtures and derive parameters such as diffusion coefficients and effective charges. Finally, the device is used to detect binding interactions of various complexes similar to affinity capillary electrophoresis, but on a single molecule level. Fourth, we conclude by briefly discussing SCAN-sort, a technique to sort individual chromatin molecules based on their fluorescent emissions for further downstream analysis such as DNA sequencing. We demonstrate a 2-fold enrichment of chromatin from sorting and discuss possible system modifications for better performance in the future.

  14. Programmable oligonucleotide probes design and applications for in situ and in vivo RNA imaging in cells

    NASA Astrophysics Data System (ADS)

    Cheglakov, Zoya

    Unequal spreading of mRNA is a frequent experience observed in varied cell lines. The study of cellular processes dynamics and precise localization of mRNAs offers a vital toolbox to target specific proteins in precise cytoplasmic areas and provides a convenient instrument to uncover their mechanisms and functions. Latest methodological innovations have allowed imaging of a single mRNA molecule in situ and in vivo. Today, Fluorescent In Situ Hybridization (FISH) methods allow the studying of mRNA expression and offer a vital toolbox for accurate biological models. Studies enable analysis of the dynamics of an individual mRNA, have uncovered the multiplex RNA transport systems. With all current approaches, a single mRNA tracking in the mammalian cells is still challenging. This thesis describes mRNA detection methods based on programmable fluorophore-labeled DNA structures complimentary to native targets providing an accurate mRNA imaging in mammalian cells. First method represents beta-actin (ACTB) transcripts in situ detection in human cells, the technique strategy is based on programmable DNA probes, amplified by rolling circle amplification (RCA). The method reports precise localization of molecule of interest with an accuracy of a single-cell. Visualization and localization of specific endogenous mRNA molecules in real-time in vivo has the promising to innovate cellular biology studies, medical analysis and to provide a vital toolbox in drugs invention area. Second method described in this thesis represents miR-21 miRNA detection within a single live-cell resolution. The method using fluorophore-labeled short synthetic DNAs probes forming a stem-loop shape and generating Fluorescent Resonance Energy Transfer (FRET) as a result of target-probes hybridization. Catalytic nucleic acid (DNAzymes) probes are cooperative tool for precise detection of different mRNA targets. With assistance of a complementary fluorophore-quencher labeled substrate, the DNAzymes provide a beneficial strategy for simultaneous tracking readily accomplished by multicolor imaging with diverse fluorescent tags. The third method in this thesis will demonstrate the advantage of DNAzymes probes amplification, and offers potential strategy to monitor miRNAs in mammalian live cells.

  15. Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Stasiak, Andrzej

    2016-09-01

    Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

  16. Hyperthermal (1-100 eV) nitrogen ion scattering damage to D-ribose and 2-deoxy-D-ribose films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Deng Zongwu; Bald, Ilko; Illenberger, Eugen

    2007-10-14

    Highly charged heavy ion traversal of a biological medium can produce energetic secondary fragment ions. These fragment ions can in turn cause collisional and reactive scattering damage to DNA. Here we report hyperthermal (1-100 eV) scattering of one such fragment ion (N{sup +}) from biologically relevant sugar molecules D-ribose and 2-deoxy-D-ribose condensed on polycrystalline Pt substrate. The results indicate that N{sup +} ion scattering at kinetic energies down to 10 eV induces effective decomposition of both sugar molecules and leads to the desorption of abundant cation and anion fragments. Use of isotope-labeled molecules (5-{sup 13}C D-ribose and 1-D D-ribose) partlymore » reveals some site specificity of the fragment origin. Several scattering reactions are also observed. Both ionic and neutral nitrogen atoms abstract carbon from the molecules to form CN{sup -} anion at energies down to {approx}5 eV. N{sup +} ions also abstract hydrogen from hydroxyl groups of the molecules to form NH{sup -} and NH{sub 2}{sup -} anions. A fraction of O/O{sup -} fragments abstract hydrogen to form OH{sup -}. The formation of H{sub 3}O{sup +} ions also involves hydrogen abstraction as well as intramolecular proton transfer. These findings suggest a variety of severe damaging pathways to DNA molecules which occur on the picosecond time scale following heavy ion irradiation of a cell, and prior to the late diffusion-limited homogeneous chemical processes.« less

  17. A dielectrophoresis-impedance method for protein detection and analysis

    NASA Astrophysics Data System (ADS)

    Mohamad, Ahmad Sabry; Hamzah, Roszymah; Hoettges, Kai F.; Hughes, Michael Pycraft

    2017-01-01

    Dielectrophoresis (DEP) has increasingly been used for the assessment of the electrical properties of molecular scale objects including proteins, DNA, nanotubes and nanowires. However, whilst techniques have been developed for the electrical characterisation of frequency-dependent DEP response, biomolecular study is usually limited to observation using fluorescent markers, limiting its applicability as a characterisation tool. In this paper we present a label-free, impedance-based method of characterisation applied to the determination of the electrical properties of colloidal protein molecules, specifically Bovine Serum Albumin (BSA). By monitoring the impedance between electrodes as proteins collect, it is shown to be possible to observe multi-dispersion behaviour. A DEP dispersion exhibited at 400 kHz is attributable to the orientational dispersion of the molecule, whilst a second, higher-frequency dispersion is attributed to a Maxwell-Wagner type dispersion; changes in behaviour with medium conductivity suggest that this is strongly influenced by the electrical double layer surrounding the molecule.

  18. Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes

    NASA Astrophysics Data System (ADS)

    Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

    2015-12-01

    Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation. Electronic supplementary information (ESI) available: I. Sequences of DIS25, DIS25-2a and DIS25-3a. II. Structural formula of poly(l-lysine)-graft-dextran (PLL-g-Dex). 1H-NMR spectra of PLL-g-Dex in D2O. III. Gel electrophoretic analysis of dimerization of DIS25 with various N/P ratios. IV. The effect of polyelectrolyte on the fluorescence polarity of TAMRA-labeled duplex. V. UV absorption/Tm profiles of DIS25. VI. Arrhenius plots for spontaneous dissociation of the DIS25 dimer and PLL-g-Dex-assisted dimerization of DIS25.VII. Switching between double stem-loop DIS42 and extended multiplex drived by PLL-g-Dex and PVS. See DOI: 10.1039/c5nr05193b

  19. quenched-smFISH: Counting small RNA in Pathogenic Bacteria

    NASA Astrophysics Data System (ADS)

    Shepherd, Douglas; Li, Nan; Micheva-Viteva, Sofiya; Munsky, Brian; Hong-Geller, Elizabeth; Werner, James

    2014-03-01

    Here, we present a modification to single-molecule fluorescence in situ hybridization, quenched smFISH (q-smFISH), that enables quantitative detection and analysis of small RNA (sRNA) expressed in bacteria. We show that short nucleic acid targets can be detected when the background of unbound singly dye-labeled DNA oligomers is reduced through hybridization with a set of complementary DNA oligomers labeled with a fluorescence quencher. Exploiting an automated, multi-color wide-field microscope and GPU-accelerated data analysis package, we analyzed the statistics of sRNA expression in thousands of individual Yersinia pseudotuberculosis and Yersinia pestis bacteria before and during a simulated infection. Before infection, we find only a small fraction of either bacteria express the small RNAs YSR35 or YSP8. The copy numbers of these RNA are increased during simulated infection, suggesting a role in pathogenesis. The ability to directly quantify expression level changes of sRNA in single cells as a function of external stimuli provides key information on the role of sRNA in bacterial regulatory networks.

  20. Interpretation of sucrose gradient sedimentation pattern of deoxyribonucleic acid fragments resulting from random breaks.

    PubMed

    Litwin, S; Shahn, E; Kozinski, A W

    1969-07-01

    Mass distribution in a sucrose gradient of deoxyribonucleic acid (DNA) fragments arising as a result of random breaks is predicted by analytical means from which computer evaluations are plotted. The analytical results are compared with the results of verifying experiments: (i) a Monte Carlo computer experiment in which simulated molecules of DNA were individuals of unit length subjected to random "breaks" applied by a random number generator, and (ii) an in vitro experiment in which molecules of T4 DNA, highly labeled with (32)P, were stored in liquid nitrogen for variable periods of time during which a precisely known number of (32)P atoms decayed, causing single-stranded breaks. The distribution of sizes of the resulting fragments was measured in an alkaline sucrose gradient. The profiles obtained in this fashion were compared with the mathematical predictions. Both experiments agree with the analytical approach and thus permit the use of the graphs obtained from the latter as a means of determining the average number of random breaks in DNA from distributions obtained experimentally in a sucrose gradient. An example of the application of this procedure to a previously unresolved problem is provided in the case of DNA from ultraviolet-irradiated phage which undergoes a dose-dependent intracellular breakdown. The relationship between the number of lethal hits and the number of single-stranded breaks was not previously established. A comparison of the calculated number of nicks per strand of DNA with the known dose in phage-lethal hits reveals a relationship closely approximating one lethal hit to one single-stranded break.

  1. Detection and size analysis of proteins with switchable DNA layers.

    PubMed

    Rant, Ulrich; Pringsheim, Erika; Kaiser, Wolfgang; Arinaga, Kenji; Knezevic, Jelena; Tornow, Marc; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2009-04-01

    We introduce a chip-compatible scheme for the label-free detection of proteins in real-time that is based on the electrically driven conformation switching of DNA oligonucleotides on metal surfaces. The switching behavior is a sensitive indicator for the specific recognition of IgG antibodies and antibody fragments, which can be detected in quantities of less than 10(-18) mol on the sensor surface. Moreover, we show how the dynamics of the induced molecular motion can be monitored by measuring the high-frequency switching response. When proteins bind to the layer, the increase in hydrodynamic drag slows the switching dynamics, which allows us to determine the size of the captured proteins. We demonstrate the identification of different antibody fragments by means of their kinetic fingerprint. The switchDNA method represents a generic approach to simultaneously detect and size target molecules using a single analytical platform.

  2. CYTOPLASMIC DNA SYNTHESIS IN AMOEBA PROTEUS

    PubMed Central

    Rabinovitch, M.; Plaut, W.

    1962-01-01

    The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 µ particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H3-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles. PMID:13972870

  3. Modulation of the Pyrococcus abyssi NucS Endonuclease Activity by Replication Clamp at Functional and Structural Levels*

    PubMed Central

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P.; Khun, Joelle; Vos, Marten H.; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-01-01

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5′ and 3′ flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction. PMID:22431731

  4. Modulation of the Pyrococcus abyssi NucS endonuclease activity by replication clamp at functional and structural levels.

    PubMed

    Creze, Christophe; Ligabue, Alessio; Laurent, Sébastien; Lestini, Roxane; Laptenok, Sergey P; Khun, Joelle; Vos, Marten H; Czjzek, Mirjam; Myllykallio, Hannu; Flament, Didier

    2012-05-04

    Pyrococcus abyssi NucS is the founding member of a new family of structure-specific DNA endonucleases that interact with the replication clamp proliferating cell nuclear antigen (PCNA). Using a combination of small angle x-ray scattering and surface plasmon resonance analyses, we demonstrate the formation of a stable complex in solution, in which one molecule of the PabNucS homodimer binds to the outside surface of the PabPCNA homotrimer. Using fluorescent labels, PCNA is shown to increase the binding affinity of NucS toward single-strand/double-strand junctions on 5' and 3' flaps, as well as to modulate the cleavage specificity on the branched DNA structures. Our results indicate that the presence of a single major contact between the PabNucS and PabPCNA proteins, together with the complex-induced DNA bending, facilitate conformational flexibility required for specific cleavage at the single-strand/double-strand DNA junction.

  5. GENETICS OF HUMAN CELL LINES

    PubMed Central

    Djordjevic, B.; Szybalski, Waclaw

    1960-01-01

    The human cell line D98S can be cultivated indefinitely in the presence of up to 3 x 10–5 M 5-bromodeoxyuridine (BUDR), without loss of cell viability. During this time, BUDR is incorporated into both strands of the DNA molecules, replacing up to 45 per cent of the thymidine and thereby rendering the cells highly sensitive to UV light and to x-rays. Cells grown for a limited period of time in the presence of 5-iododeoxyuridine (IUDR) become UV-sensitized, while prolonged cultivation with IUDR results in the loss of cell viability. The properties of the BUDR label permitted the demonstration that: (a) human DNA replicates in a "semiconservative" manner; (b) the degree of radiosensitization of BUDR-treated cells depends on whether the DNA has been substituted in one strand only ("unifilarly") or in both strands ("bifilarly"); (c) functional human DNA is produced during partial inhibition of protein synthesis. The potential applicability of this new rational principle of radiosensitization to the radiotherapy of neoplastic diseases is discussed. PMID:13723177

  6. Cytoplasmic DNA synthesis in Amoeba proteus. I. On the particulate nature of the DNA-containing elements.

    PubMed

    RABINOVITCH, M; PLAUT, W

    1962-12-01

    The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 micro particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H(3)-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles.

  7. Pushing the limits for amplifying BrdU-labeled DNA encoding 16S rRNA: DNA polymerase as the determining factor.

    PubMed

    Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A

    2010-12-01

    Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Optofluidic lasers with a single molecular layer of gain

    PubMed Central

    Chen, Qiushu; Ritt, Michael; Sivaramakrishnan, Sivaraj; Sun, Yuze; Fan, Xudong

    2014-01-01

    We achieve optofluidic lasers with a single molecular layer of gain, in which green fluorescent protein, dye-labeled bovine serum albumin, and dye-labeled DNA are respectively used as the gain medium and attached to the surface of a ring resonator via surface immobilization biochemical methods. It is estimated that the surface density of the gain molecules is on the order of 1012/cm2, sufficient for lasing under pulsed optical excitation. It is further shown that the optofluidic laser can be tuned by energy transfer mechanisms through biomolecular interactions. This work not only opens a door to novel photonic devices that can be controlled at the level of a single molecular layer, but also provides a promising sensing platform to analyze biochemical processes at the solid-liquid interface. PMID:25312306

  9. Stability of DNA Origami Nanoarrays in Cell Lysate

    PubMed Central

    Mei, Qian; Wei, Xixi; Su, Fengyu; Liu, Yan; Youngbull, Cody; Johnson, Roger; Lindsay, Stuart; Yan, Hao; Meldrum, Deirdre

    2012-01-01

    Scaffolded DNA origami, a method to create self-assembled nanostructures with spatially addressable features, has recently been used to develop water-soluble molecular chips for label-free RNA detection, platforms for deterministic protein positioning, and single molecule reaction observatories. These applications highlight the possibility of exploiting the unique properties and biocompatibility of DNA nanostructures in live, cellular systems. Herein, we assembled several DNA origami nanostructures of differing shape, size and probes, and investigated their interaction with lysate obtained from various normal and cancerous cell lines. We separated and analyzed the origami–lysate mixtures using agarose gel electrophoresis and recovered the DNA structures for functional assay and subsequent microscopic examination. Our results demonstrate that DNA origami nanostructures are stable in cell lysate and can be easily separated from lysate mixtures, in contrast to natural, single- and double-stranded DNA. Atomic force microscope (AFM) and transmission electron microscope (TEM) images show that the DNA origami structures are fully intact after separation from cell lysates and hybridize to their targets, verifying the superior structural integrity and functionality of self-assembled DNA origami nanostructures relative to conventional oligonucleotides. The stability and functionality of DNA origami structures in cell lysate validate their use for biological applications, for example, as programmable molecular rafts or disease detection platforms. PMID:21366226

  10. Graphene-palladium nanowires based electrochemical sensor using ZnFe2O4-graphene quantum dots as an effective peroxidase mimic.

    PubMed

    Liu, Weiyan; Yang, Hongmei; Ma, Chao; Ding, Ya-nan; Ge, Shenguang; Yu, Jinghua; Yan, Mei

    2014-12-10

    We proposed an electrochemical DNA sensor by using peroxidase-like magnetic ZnFe2O4-graphene quantum dots (ZnFe2O4/GQDs) nanohybrid as a mimic enzymatic label. Aminated graphene and Pd nanowires were successively modified on glassy carbon electrode, which improved the electronic transfer rate as well as increased the amount of immobilized capture ssDNA (S1). The nanohybrid ZnFe2O4/GQDs was prepared by assembling the GQDs on the surface of ZnFe2O4 through a photo-Fenton reaction, which was not only used as a mimic enzyme but also as a carrier to label complementary ssDNA (S3). By synergistically integrating highly catalytically activity of nano-sized GQDs and ZnFe2O4, the nanohybrid possessed highly-efficient peroxidase-like catalytic activity which could produce a large current toward the reduction of H2O2 for signal amplification. Thionine was used as an excellent electron mediator. Compared with traditional enzyme labels, the mimic enzyme ZnFe2O4/GQDs exhibited many advantages such as environment friendly and better stability. Under the optimal conditions, the approach provided a wide linear range from 10(-16) to 5×10(-9) M and low detection limit of 6.2×10(-17) M. The remarkable high catalytic capability could allow the nanohybrid to replace conventional peroxidase-based assay systems. The new, robust and convenient assay systems can be widely utilized for the identification of other target molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Innovations in biomedical nanoengineering: nanowell array biosensor.

    PubMed

    Seo, YoungTae; Jeong, Sunil; Lee, JuKyung; Choi, Hak Soo; Kim, Jonghan; Lee, HeaYeon

    2018-01-01

    Nanostructured biosensors have pioneered biomedical engineering by providing highly sensitive analyses of biomolecules. The nanowell array (NWA)-based biosensing platform is particularly innovative, where the small size of NWs within the array permits extremely profound sensing of a small quantity of biomolecules. Undoubtedly, the NWA geometry of a gently-sloped vertical wall is critical for selective docking of specific proteins without capillary resistances, and nanoprocessing has contributed to the fabrication of NWA electrodes on gold substrate such as molding process, e-beam lithography, and krypton-fluoride (KrF) stepper semiconductor method. The Lee group at the Mara Nanotech has established this NW-based biosensing technology during the past two decades by engineering highly sensitive electrochemical sensors and providing a broad range of detection methods from large molecules (e.g., cells or proteins) to small molecules (e.g., DNA and RNA). Nanosized gold dots in the NWA enhance the detection of electrochemical biosensing to the range of zeptomoles in precision against the complementary target DNA molecules. In this review, we discuss recent innovations in biomedical nanoengineering with a specific focus on novel NWA-based biosensors. We also describe our continuous efforts in achieving a label-free detection without non-specific binding while maintaining the activity and stability of immobilized biomolecules. This research can lay the foundation of a new platform for biomedical nanoengineering systems.

  12. Innovations in biomedical nanoengineering: nanowell array biosensor

    NASA Astrophysics Data System (ADS)

    Seo, YoungTae; Jeong, Sunil; Lee, JuKyung; Choi, Hak Soo; Kim, Jonghan; Lee, HeaYeon

    2018-04-01

    Nanostructured biosensors have pioneered biomedical engineering by providing highly sensitive analyses of biomolecules. The nanowell array (NWA)-based biosensing platform is particularly innovative, where the small size of NWs within the array permits extremely profound sensing of a small quantity of biomolecules. Undoubtedly, the NWA geometry of a gently-sloped vertical wall is critical for selective docking of specific proteins without capillary resistances, and nanoprocessing has contributed to the fabrication of NWA electrodes on gold substrate such as molding process, e-beam lithography, and krypton-fluoride (KrF) stepper semiconductor method. The Lee group at the Mara Nanotech has established this NW-based biosensing technology during the past two decades by engineering highly sensitive electrochemical sensors and providing a broad range of detection methods from large molecules (e.g., cells or proteins) to small molecules (e.g., DNA and RNA). Nanosized gold dots in the NWA enhance the detection of electrochemical biosensing to the range of zeptomoles in precision against the complementary target DNA molecules. In this review, we discuss recent innovations in biomedical nanoengineering with a specific focus on novel NWA-based biosensors. We also describe our continuous efforts in achieving a label-free detection without non-specific binding while maintaining the activity and stability of immobilized biomolecules. This research can lay the foundation of a new platform for biomedical nanoengineering systems.

  13. Binding-induced DNA walker for signal amplification in highly selective electrochemical detection of protein.

    PubMed

    Ji, Yuhang; Zhang, Lei; Zhu, Longyi; Lei, Jianping; Wu, Jie; Ju, Huangxian

    2017-10-15

    A binding-induced DNA walker-assisted signal amplification was developed for highly selective electrochemical detection of protein. Firstly, the track of DNA walker was constructed by self-assembly of the high density ferrocene (Fc)-labeled anchor DNA and aptamer 1 on the gold electrode surface. Sequentially, a long swing-arm chain containing aptamer 2 and walking strand DNA was introduced onto gold electrode through aptamers-target specific recognition, and thus initiated walker strand sequences to hybridize with anchor DNA. Then, the DNA walker was activated by the stepwise cleavage of the hybridized anchor DNA by nicking endonuclease to release multiple Fc molecules for signal amplification. Taking thrombin as the model target, the Fc-generated electrochemical signal decreased linearly with logarithm value of thrombin concentration ranging from 10pM to 100nM with a detection limit of 2.5pM under the optimal conditions. By integrating the specific recognition of aptamers to target with the enzymatic cleavage of nicking endonuclease, the aptasensor showed the high selectivity. The binding-induced DNA walker provides a promising strategy for signal amplification in electrochemical biosensor, and has the extensive applications in sensitive and selective detection of the various targets. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Indium tin oxide with zwitterionic interfacial design for biosensing applications in complex matrices

    NASA Astrophysics Data System (ADS)

    Darwish, Nadia T.; Alias, Yatimah; Khor, Sook Mei

    2015-01-01

    Biosensing interfaces consisting of linker molecules (COOH or NH2) and charged, antifouling moieties ((sbnd SO3- and N+(Me)3) for biosensing applications were prepared for the first time by the in situ deposition of mixtures of aryl diazonium cations on indium tin oxide (ITO) electrodes. A linker molecule is required for the attachment of biorecognition molecules (e.g., antibodies, enzymes, DNA chains, and aptamers) close to the transducer surface. The attached molecules improve the biosensing sensitivity and also provide a short response time for analyte detection. Thus, the incorporation of a linker and antifouling molecules is an important interfacial design for both affinity and enzymatic biosensors. The reductive adsorption behavior and electrochemical measurement were studied for (1) an individual compound and (2) a mixture of antifouling zwitterionic molecules together with linker molecules [combination 1: 4-sulfophenyl (SP), 4-trimethylammoniophenyl (TMAP), and 1,4-phenylenediamine (PPD); combination 2: 4-sulfophenyl (SP), 4-trimethylammoniophenyl (TMAP), and 4-aminobenzoic acid (PABA)] of aryl diazonium cations grafted onto an ITO electrode. The mixture ratios of SP:TMAP:PPD and SP:TMAP:PABA that provided the greatest resistance to non-specific protein adsorptions of bovine serum albumin labeled with fluorescein isothiocyanate (BSA-FITC) and cytochrome c labeled with rhodamine B isothiocyanate (RBITC-Cyt c) were determined by confocal laser scanning microscopy (CLSM). For the surface antifouling study, we used 2-[2-(2-methoxyethoxy) ethoxy]acetic acid (OEG) as a standard control because of its prominent antifouling properties. Surface compositions of combinations 1 and 2 were characterized using X-ray photoelectron spectroscopy (XPS). Field-emission scanning electron microscopy (FE-SEM) was used to characterize the morphology of the grafted films to confirm the even distribution between linker and antifouling molecules grafted onto the ITO surfaces. Combination 1 (SP:TMAP:PPD) with a ratio of 0.5:1.5:0.37 exhibited the best antifouling capability with respect to resisting the nonspecific adsorption of proteins.

  15. Concentration methods for high-resolution THz spectroscopy of nucleic-acid biomolecules and crystals

    NASA Astrophysics Data System (ADS)

    Brown, E. R.; Zhang, W.; Mendoza, E. A.; Kuznetsova, Y.; Brueck, S. R. J.; Rahman, M.; Norton, M. L.

    2012-03-01

    Biomolecules can exhibit low-lying vibrational modes in the THz region which are detectable in transmission given a strong molecular dipole moment and optical depth, and a spectrometer of adequate sensitivity. The nucleic acids are particularly interesting because of applications such as label-free gene assay, bio-agent detection, etc. However for nucleic acids, sample preparation and THz coupling are of paramount importance because of the strong absorption by liquid water and the small concentration of molecules present in physiological solutions. Concentration methods become necessary to make the THz vibrational modes detectable, either by concentrating the nucleic-acid sample itself in a small volume but large area, or by concentrating the THz radiation down to the volume of the sample. This paper summarizes one type of the first method: nanofluidic channel arrays for biological nucleic acids; and two types of the second method: (1) a circular-waveguide pinhole, and (2) a circular-waveguide, conical-horn coupling structure, both for DNA crystals. The first method has been demonstrated on a very short artificial nucleic acid [small-interfering (si) RNA (17-to-25 bp)] and a much longer, biological molecule [Lambda-phage DNA (48.5 kbp)]. The second method has been demonstrated on small (~100 micron) single crystals of DNA grown by the sitting-drop method.

  16. Carbon Nanotube Nanoelectrode Array as an Electronic Chip for Ultrasensitive Label-free DNA Detection

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

    2003-01-01

    A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6 and ferrocene derivatives. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. BRCA1 related oligonucleotide probes with 18 bp are selectively functionalized at the open ends of the nanotube array and specifically hybridized with oligonucleotide targets incorporated with a polyG tag. The guanine groups are employed as the signal moieties in the electrochemical measurements. R(bpy)(sup 2+, sub 3) mediator is used to further amplify the guanine oxidation signal. The hybridization of sub-attomoles of DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the R(bpy)(sup 2+, sub 3) amplification mechanism. This technique was employed for direct electrochemical detection of label-free PCR amplicon from a healthy donor through specific hybridization with the BRCA1 probe. The detection limit is estimated to be less than 1000 DNA molecules since abundant guanine bases in the PCR amplicon provides a large signal. This system provides a general platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparation, and low-cost operation.

  17. Click-electron microscopy for imaging metabolically tagged non-protein biomolecules

    PubMed Central

    Ngo, John T.; Adams, Stephen R.; Deerinck, Thomas J.; Boassa, Daniela; Rodriguez-Rivera, Frances; Palida, Sakina F.; Bertozzi, Carolyn R.; Ellisman, Mark H.; Tsien, Roger Y.

    2016-01-01

    Electron microscopy (EM) has long been the main technique to image cell structures with nanometer resolution, but has lagged behind light microscopy in the crucial ability to make specific molecules stand out. Here we introduce “Click-EM,” a labeling technique for correlative light microscopy and EM imaging of non-protein biomolecules. In this approach, metabolic labeling substrates containing bioorthogonal functional groups are provided to cells for incorporation into biopolymers by endogenous biosynthetic machinery. The unique chemical functionality of these analogs is exploited for selective attachment of singlet oxygen-generating fluorescent dyes via bioorthogonal “click chemistry” ligations. Illumination of dye-labeled structures generates singlet oxygen to locally catalyze the polymerization of diaminobenzidine into an osmiophilic reaction product that is readily imaged by EM. We describe the application of Click-EM in imaging metabolically tagged DNA, RNA, and lipids in cultured cells and neurons, and highlight its use in tracking peptidoglycan synthesis in the Gram-positive bacterium Listeria monocytogenes. PMID:27110681

  18. Monitoring Single-Molecule Protein Dynamics with a Carbon Nanotube Transistor

    NASA Astrophysics Data System (ADS)

    Collins, Philip G.

    2014-03-01

    Nanoscale electronic devices like field-effect transistors have long promised to provide sensitive, label-free detection of biomolecules. Single-walled carbon nanotubes press this concept further by not just detecting molecules but also monitoring their dynamics in real time. Recent measurements have demonstrated this premise by monitoring the single-molecule processivity of three different enzymes: lysozyme, protein Kinase A, and the Klenow fragment of DNA polymerase I. With all three enzymes, single molecules tethered to nanotube transistors were electronically monitored for 10 or more minutes, allowing us to directly observe a range of activity including rare transitions to chemically inactive and hyperactive conformations. The high bandwidth of the nanotube transistors further allow every individual chemical event to be clearly resolved, providing excellent statistics from tens of thousands of turnovers by a single enzyme. Initial success with three different enzymes indicates the generality and attractiveness of the nanotube devices as a new tool to complement other single-molecule techniques. Research on transduction mechanisms provides the design rules necessary to further generalize this architecture and apply it to other proteins. The purposeful incorporation of just one amino acid is sufficient to fabricate effective, single molecule sensors from a wide range of enzymes or proteins.

  19. Evaluation of genotoxicity testing of FDA approved large molecule therapeutics.

    PubMed

    Sawant, Satin G; Fielden, Mark R; Black, Kurt A

    2014-10-01

    Large molecule therapeutics (MW>1000daltons) are not expected to enter the cell and thus have reduced potential to interact directly with DNA or related physiological processes. Genotoxicity studies are therefore not relevant and typically not required for large molecule therapeutic candidates. Regulatory guidance supports this approach; however there are examples of marketed large molecule therapeutics where sponsors have conducted genotoxicity studies. A retrospective analysis was performed on genotoxicity studies of United States FDA approved large molecule therapeutics since 1998 identified through the Drugs@FDA website. This information was used to provide a data-driven rationale for genotoxicity evaluations of large molecule therapeutics. Fifty-three of the 99 therapeutics identified were tested for genotoxic potential. None of the therapeutics tested showed a positive outcome in any study except the peptide glucagon (GlucaGen®) showing equivocal in vitro results, as stated in the product labeling. Scientific rationale and data from this review indicate that testing of a majority of large molecule modalities do not add value to risk assessment and support current regulatory guidance. Similarly, the data do not support testing of peptides containing only natural amino acids. Peptides containing non-natural amino acids and small molecules in conjugated products may need to be tested. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. A polarized view on DNA under tension

    NASA Astrophysics Data System (ADS)

    van Mameren, Joost; Vermeulen, Karen; Wuite, Gijs J. L.; Peterman, Erwin J. G.

    2018-03-01

    In the past decades, sensitive fluorescence microscopy techniques have contributed significantly to our understanding of the dynamics of DNA. The specific labeling of DNA using intercalating dyes has allowed for quantitative measurement of the thermal fluctuations the polymers undergo. On the other hand, recent advances in single-molecule manipulation techniques have unraveled the mechanical and elastic properties of this intricate polymer. Here, we have combined these two approaches to study the conformational dynamics of DNA under a wide range of tensions. Using polarized fluorescence microscopy in conjunction with optical-tweezers-based manipulation of YOYO-intercalated DNA, we controllably align the YOYO dyes using DNA tension, enabling us to disentangle the rapid dynamics of the dyes from that of the DNA itself. With unprecedented control of the DNA alignment, we resolve an inconsistency in reports about the tilted orientation of intercalated dyes. We find that intercalated dyes are on average oriented perpendicular to the long axis of the DNA, yet undergo fast dynamics on the time scale of absorption and fluorescence emission. In the overstretching transition of double-stranded DNA, we do not observe changes in orientation or orientational dynamics of the dyes. Only beyond the overstretching transition, a considerable depolarization is observed, presumably caused by an average tilting of the DNA base pairs. Our combined approach thus contributes to the elucidation of unique features of the molecular dynamics of DNA.

  1. Small molecule inhibitors of ERCC1-XPF protein-protein interaction synergize alkylating agents in cancer cells.

    PubMed

    Jordheim, Lars Petter; Barakat, Khaled H; Heinrich-Balard, Laurence; Matera, Eva-Laure; Cros-Perrial, Emeline; Bouledrak, Karima; El Sabeh, Rana; Perez-Pineiro, Rolando; Wishart, David S; Cohen, Richard; Tuszynski, Jack; Dumontet, Charles

    2013-07-01

    The benefit of cancer chemotherapy based on alkylating agents is limited because of the action of DNA repair enzymes, which mitigate the damage induced by these agents. The interaction between the proteins ERCC1 and XPF involves two major components of the nucleotide excision repair pathway. Here, novel inhibitors of this interaction were identified by virtual screening based on available structures with use of the National Cancer Institute diversity set and a panel of DrugBank small molecules. Subsequently, experimental validation of the in silico screening was undertaken. Top hits were evaluated on A549 and HCT116 cancer cells. In particular, the compound labeled NSC 130813 [4-[(6-chloro-2-methoxy-9-acridinyl)amino]-2-[(4-methyl-1-piperazinyl)methyl

  2. Development of one novel multiple-target plasmid for duplex quantitative PCR analysis of roundup ready soybean.

    PubMed

    Zhang, Haibo; Yang, Litao; Guo, Jinchao; Li, Xiang; Jiang, Lingxi; Zhang, Dabing

    2008-07-23

    To enforce the labeling regulations of genetically modified organisms (GMOs), the application of reference molecules as calibrators is becoming essential for practical quantification of GMOs. However, the reported reference molecules with tandem marker multiple targets have been proved not suitable for duplex PCR analysis. In this study, we developed one unique plasmid molecule based on one pMD-18T vector with three exogenous target DNA fragments of Roundup Ready soybean GTS 40-3-2 (RRS), that is, CaMV35S, NOS, and RRS event fragments, plus one fragment of soybean endogenous Lectin gene. This Lectin gene fragment was separated from the three exogenous target DNA fragments of RRS by inserting one 2.6 kb DNA fragment with no relatedness to RRS detection targets in this resultant plasmid. Then, we proved that this design allows the quantification of RRS using the three duplex real-time PCR assays targeting CaMV35S, NOS, and RRS events employing this reference molecule as the calibrator. In these duplex PCR assays, the limits of detection (LOD) and quantification (LOQ) were 10 and 50 copies, respectively. For the quantitative analysis of practical RRS samples, the results of accuracy and precision were similar to those of simplex PCR assays, for instance, the quantitative results were at the 1% level, the mean bias of the simplex and duplex PCR were 4.0% and 4.6%, respectively, and the statistic analysis ( t-test) showed that the quantitative data from duplex and simplex PCR had no significant discrepancy for each soybean sample. Obviously, duplex PCR analysis has the advantages of saving the costs of PCR reaction and reducing the experimental errors in simplex PCR testing. The strategy reported in the present study will be helpful for the development of new reference molecules suitable for duplex PCR quantitative assays of GMOs.

  3. The effect of column purification on cDNA indirect labelling for microarrays

    PubMed Central

    Molas, M Lia; Kiss, John Z

    2007-01-01

    Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522

  4. The effect of column purification on cDNA indirect labelling for microarrays.

    PubMed

    Molas, M Lia; Kiss, John Z

    2007-06-27

    The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.

  5. In situ end labeling of fragmented DNA in induced ovarian atresia.

    PubMed

    D'Herde, K; De Pestel, G; Roels, F

    1994-01-01

    Apoptosis is studied in a model of induced follicular atresia in the ovary of Japanese quail (Coturnix coturnix japonica) by in situ end labeling of DNA fragments in granulosa cells using two different techniques (incorporation of labeled nucleotides by DNA polymerase I or terminal deoxynucleotidyl transferase). The most remarkable observation related to apoptosis in this model is the predominant cytoplasmic localization of labeled DNA fragments, while DNA fragmentation appears to be absent from compacted chromatin masses of apoptotic nuclei and apoptotic nuclear fragments. Unstained apoptotic bodies are present adjacent to stained ones, so that their detection rate on hematoxylin + eosin stained sections is better than on the in situ end-labeled sections. This suggests that DNA fragmentation is a late even or not obligatory in apoptotic granulosa cell death. In contrast to similar studies on atretic granulosa in mammalian models, the process of apoptosis is asynchronous in the granulosal epithelium, with a majority of nuclei with normal chromatin configuration remaining negative for DNA fragmentation. Finally it is shown that the techniques used are not specific for apoptosis, as DNA fragmentation in necrotic granulosa cells is detected as well.

  6. Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors

    NASA Astrophysics Data System (ADS)

    Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian

    2006-01-01

    We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor

  7. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

    2016-04-01

    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  8. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  9. Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

    NASA Astrophysics Data System (ADS)

    Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

    2013-05-01

    Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

  10. DNA-Templated Introduction of an Aldehyde Handle in Proteins.

    PubMed

    Kodal, Anne Louise B; Rosen, Christian B; Mortensen, Michael R; Tørring, Thomas; Gothelf, Kurt V

    2016-07-15

    Many medical and biotechnological applications rely on protein labeling, but a key challenge is the production of homogeneous and site-specific conjugates. This can rarely be achieved by simple residue-specific random labeling, but generally requires genetic engineering. Using site-selective DNA-templated reductive amination, we created DNA-protein conjugates with control over labeling stoichiometry and without genetic engineering. A guiding DNA strand with a metal-binding functionality facilitates site-selectivity by directing the coupling of a second reactive DNA strand in the vicinity of a protein metal-binding site. We demonstrate DNA-templated reductive amination for His6 -tagged proteins and metal-binding proteins, including IgG1 antibodies. We also used a cleavable linker between the DNA and the protein to remove the DNA and introduce a single aldehyde on the protein. This functions as a handle for further modifications with desired labels. In addition to directing the aldehyde positioning, the DNA provides a straightforward route for purification between reaction steps. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. In vivo study on alkylation site in DNA by the bifunctional dianhydrogalactitol.

    PubMed

    Institoris, E

    1981-05-01

    In vivo alkylation of Yoshida sarcoma cell DNA by 3H-labelled 1,2:5,6-dianhydrogalactitol (DAG) yielded N-7 monogalactitylguanines and 1,6-di-(guanin-7-yl)-galactitol, similar to the alkylated products obtained by in vitro reaction of DNA with dianhydrogalactitol in neutral solution. The ratio between monoalkylguanines and diguaninyl product was 2-2.5, slightly increasing with doses. Persistence of alkylated products in DNA was followed in function of time. There was no significant loss of either monoalkylated bases or diguaninyl derivative during the observation period i.e. 7-24 h after treatment. In contrast, the physical measurements of the amount of renaturable DNA showed a rapid opening of cross-links in the same period. Taking the presence of diguaninyl moiety as an indicator of cross-links in DNA, these two latter findings show an apparent contradiction which could be reconciled however by the mechanism proposed by Reid and Walker (Biochim. Biophys. Acta, 179 (1969) 179) for the removal of cross-linkage induced by HN2. Accordingly, one arm of the cross-links is removed, probably enzymically, leaving the DNA non-renaturable, while the other arm of cross-link is still covalently attached to the DNA molecule rendering possible the detection of diguaninyl moiety in DNA at some later time. This concept for the removal of cross-links from DNA seems to be supported by our results too.

  12. Visualizing long-term single-molecule dynamics in vivo by stochastic protein labeling.

    PubMed

    Liu, Hui; Dong, Peng; Ioannou, Maria S; Li, Li; Shea, Jamien; Pasolli, H Amalia; Grimm, Jonathan B; Rivlin, Patricia K; Lavis, Luke D; Koyama, Minoru; Liu, Zhe

    2018-01-09

    Our ability to unambiguously image and track individual molecules in live cells is limited by packing of multiple copies of labeled molecules within the resolution limit. Here we devise a universal genetic strategy to precisely control copy number of fluorescently labeled molecules in a cell. This system has a dynamic range of ∼10,000-fold, enabling sparse labeling of proteins expressed at different abundance levels. Combined with photostable labels, this system extends the duration of automated single-molecule tracking by two orders of magnitude. We demonstrate long-term imaging of synaptic vesicle dynamics in cultured neurons as well as in intact zebrafish. We found axon initial segment utilizes a "waterfall" mechanism gating synaptic vesicle transport polarity by promoting anterograde transport processivity. Long-time observation also reveals that transcription factor hops between clustered binding sites in spatially restricted subnuclear regions, suggesting that topological structures in the nucleus shape local gene activities by a sequestering mechanism. This strategy thus greatly expands the spatiotemporal length scales of live-cell single-molecule measurements, enabling new experiments to quantitatively understand complex control of molecular dynamics in vivo.

  13. Deformation of DNA molecules by hydrodynamic focusing

    NASA Astrophysics Data System (ADS)

    Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming

    2003-12-01

    The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.

  14. Aptamer Recognition of Multiplexed Small-Molecule-Functionalized Substrates.

    PubMed

    Nakatsuka, Nako; Cao, Huan H; Deshayes, Stephanie; Melkonian, Arin Lucy; Kasko, Andrea M; Weiss, Paul S; Andrews, Anne M

    2018-05-31

    Aptamers are chemically synthesized oligonucleotides or peptides with molecular recognition capabilities. We investigated recognition of substrate-tethered small-molecule targets, using neurotransmitters as examples, and fluorescently labeled DNA aptamers. Substrate regions patterned via microfluidic channels with dopamine or L-tryptophan were selectively recognized by previously identified dopamine or L-tryptophan aptamers, respectively. The on-substrate dissociation constant determined for the dopamine aptamer was comparable to, though slightly greater than the previously determined solution dissociation constant. Using pre-functionalized neurotransmitter-conjugated oligo(ethylene glycol) alkanethiols and microfluidics patterning, we produced multiplexed substrates to capture and to sort aptamers. Substrates patterned with L-DOPA, L-DOPS, and L-5-HTP enabled comparison of the selectivity of the dopamine aptamer for different targets via simultaneous determination of in situ binding constants. Thus, beyond our previous demonstrations of recognition by protein binding partners (i.e., antibodies and G-protein-coupled receptors), strategically optimized small-molecule-functionalized substrates show selective recognition of nucleic acid binding partners. These substrates are useful for side-by-side target comparisons, and future identification and characterization of novel aptamers targeting neurotransmitters or other important small-molecules.

  15. DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

    NASA Astrophysics Data System (ADS)

    Golubovic, Leonardo

    2005-03-01

    We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

  16. DNA Hybridization: Nonradioactive Labeling Now Available for the Laboratory.

    ERIC Educational Resources Information Center

    Freeman, Lenore Gardner

    1984-01-01

    The advantages of DNA hybridization procedures for classroom and clinical use can now be realized by the recent development of nonradioactive DNA labeling/detection procedures. These methods (which are described) can replace the use of isotopes in standard DNA hybridization procedures. (JN)

  17. Growth of the parvovirus minute virus of mice MVMp3 in EL4 lymphocytes is restricted after cell entry and before viral DNA amplification: cell-specific differences in virus uncoating in vitro.

    PubMed

    Previsani, N; Fontana, S; Hirt, B; Beard, P

    1997-10-01

    Two murine parvoviruses with genomic sequences differing only in 33 nucleotides (8 amino acids) in the region coding for the capsid proteins show different host cell specificities: MVMi grows in EL4 T lymphocytes and MVMp3 grows in A9 fibroblasts. In this study we compared the courses of infections with these two viruses in EL4 cells in order to investigate at which step(s) the infection process of MVMp3 is interrupted. The two viruses bound equally well to EL4 cells, and similar amounts of MVMi and MVMp3 input virion DNA appeared in the nuclear fractions of EL4 cells 1 h after infection. However, double-stranded replicative-form (RF) DNA of the two viruses appeared at different times, at 10 h postinfection with MVMi and at 24 h postinfection with MVMp3. The amount of MVMp3 RF DNA detected at 24 h was very small because it was produced only in a tiny subset of the population of EL4 cells that proved to be permissive for MVMp3. Replication of double-stranded viral DNA in EL4 cells was measured after transfection of purified RF DNA, cloned viral DNA, and cloned viral DNA with a mutation preventing synthesis of the capsid proteins. In each of these cases, DNA replication was comparable for MVMi and MVMp3. Production of virus particles also appeared to be similar after transfection of the two types of RF DNA into EL4 cells. Conversion of incoming 32P-labeled single-stranded MVM DNA to 32P-labeled double-stranded RF DNA was detected only after RF DNA amplification, indicating that few molecules serve as templates for viral DNA amplification. We showed that extracts of EL4 cells contain a factor which can destabilize MVMi virions but not MVMp3 by testing the sensitivity of viral DNA to DNase and by CsCl gradient analyses of viral particles. We therefore conclude that the MVMp3 life cycle is arrested after the transport of virions to the nucleus and prior to the replication of RF DNA, most likely at the stage of viral decapsidation.

  18. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    PubMed

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. A universal label-free fluorescent aptasensor based on Ru complex and quantum dots for adenosine, dopamine and 17β-estradiol detection.

    PubMed

    Huang, Hailiang; Shi, Shuo; Gao, Xing; Gao, Ruru; Zhu, Ying; Wu, Xuewen; Zang, Ruimin; Yao, Tianming

    2016-05-15

    Based on specific aptamer binding properties, a strategy for adenosine, dopamine and 17β-estradiol detection was realised by employing Ru complex and quantum dots (QDs) as fluorescence probes. Ru complex, which could quench the fluorescence of QDs, preferred to bind with aptamer DNA and resulted in the fluorescence rise of QDs. When the aptamer DNA was incubated with the target first, it could not bind with Ru complex and the fluorescence of QDs was quenched. Under the optimal condition, the fluorescence intensity was linearly proportional to the concentration of adenosine, dopamine and 17β-estradiol with a limit of detection (LOD) of 101 nM, 19 nM and 37 nM, respectively. The experiments in fetal bovine serum were also carried out with good results. This universal method was rapid, label-free, low-cost, easy-operating and highly repeatable for the detection of adenosine, dopamine and 17β-estradiol. Qualitative detection by naked eyes was also available without complex instruments. It could also be extended to detect various analytes, such as metal ions, proteins and small molecules by using appropriate aptamers. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Chemiluminescent labels released from long spacer arm-functionalized magnetic particles: a novel strategy for ultrasensitive and highly selective detection of pathogen infections.

    PubMed

    Yang, Haowen; Liang, Wenbiao; He, Nongyue; Deng, Yan; Li, Zhiyang

    2015-01-14

    Previously, the unique advantages provided by chemiluminescence (CL) and magnetic particles (MPs) have resulted in the development of many useful nucleic acid detection methods. CL is highly sensitive, but when applied to MPs, its intensity is limited by the inner filter-like effect arising from excess dark MPs. Herein, we describe a modified strategy whereby CL labels are released from MPs to eliminate this negative effect. This approach relies on (1) the magnetic capture of target molecules on long spacer arm-functionalized magnetic particles (LSA-MPs), (2) the conjugation of streptavidin-alkaline phosphatase (SA-AP) to biotinylated amplicons of target pathogens, (3) the release of CL labels (specifically, AP tags), and (4) the detection of the released labels. CL labels were released from LSA-MPs through LSA ultrasonication or DNA enzymolysis, which proved to be the superior method. In contrast to conventional MPs, LSA-MPs exhibited significantly improved CL detection, because of the introduction of LSA, which was made of water-soluble carboxymethylated β-1,3-glucan. Detection of hepatitis B virus with this technique revealed a low detection limit of 50 fM, high selectivity, and excellent reproducibility. Thus, this approach may hold great potential for early stage clinical diagnosis of infectious diseases.

  1. Autonomous assembly of ordered metastable DNA nanoarchitecture and in situ visualizing of intracellular microRNAs.

    PubMed

    Xu, Jianguo; Wu, Zai-Sheng; Wang, Zhenmeng; Le, Jingqing; Zheng, Tingting; Jia, Lee

    2017-03-01

    Facile assembly of intelligent DNA nanoobjects with the ability to exert in situ visualization of intracellular microRNAs (miRNAs) has long been concerned in the fields of DNA nanotechnology and basic medical study. Here, we present a driving primer (DP)-triggered polymerization-mediated metastable assembly (PMA) strategy to prepare a well-ordered metastable DNA nanoarchitecture composed of only two hairpin probes (HAPs), which has never been explored by assembly methods. Its structural features and functions are characterized by atomic force microscope (AFM) and gel electrophoresis. Even if with a metastable molecular structure, this nanoarchitecture is relatively stable at physiological temperature. The assembly strategy can be expanded to execute microRNA-21 (miRNA-21) in situ imaging inside cancer cells by labelling one of the HAPs with fluorophore and quencher. Compared with the conventional fluorescence probe-based in situ hybridization (FISH) technique, confocal images revealed that the proposed DNA nanoassembly can not only achieve greatly enhanced imaging effect within cancer cells, but also reflect the miRNA-21 expression level sensitively. We believe that the easily constructed DNA nanoarchitecture and in situ profiling strategy are significant progresses in DNA assembly and molecule imaging in cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Adaptation of the TdT assay for semi-quantitative flow cytometric detection of DNA strand breaks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bromidge, T.J.; Howe, D.J.; Johnson, S.A.

    The enzyme Terminal Deoxynucleotidyl Transferase (TdT) is a DNA polymerase which can be used to label DNA strand breaks by the incorporation of a labelled nucleotide followed by a fluorescent detection step. The amount of label incorporated can then be assessed by flow cytometry. The mechanism of action of TdT, however, will allow the addition of varying numbers of nucleotides to the free 3{prime} termini produced by DNA strand breaks. The substitution of Digoxigenin (DIG){trademark} labelled dideoxynucleotides for labelled deoxy-nucleotides in the TdT assay will limit the addition of label to a DNA break to a single nucleotide, thus ensuringmore » a direct relationship between an increase in DNA strand breaks and an increase in fluorescence. We have used this adaptation of the TdT assay to evaluate DNA damage incurred in lymphocytes, from patients with Chronic Lymphocytic Leukemia (CLL), on exposure to UV irradiation and apoptosis-inducing drugs, fludarabine and 2-Chloro-2{prime}-deoxyadenosine (2-CdA). This technique may give a good indication of the susceptibility of CLL patients to apoptosis inducing drugs, and hence an indication of the likely response to these therapies. 7 refs., 2 figs., 2 tabs.« less

  3. Methods of DNA methylation detection

    NASA Technical Reports Server (NTRS)

    Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

    2010-01-01

    The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

  4. A mathematical model for DNA

    NASA Astrophysics Data System (ADS)

    Sepehri, Alireza

    Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.

  5. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.

    1995-01-01

    A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

  6. DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

    PubMed

    Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

    2013-02-18

    A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

  7. Spike-In Normalization of ChIP Data Using DNA-DIG-Antibody Complex.

    PubMed

    Eberle, Andrea B

    2018-01-01

    Chromatin immunoprecipitation (ChIP) is a widely used method to determine the occupancy of specific proteins within the genome, helping to unravel the function and activity of specific genomic regions. In ChIP experiments, normalization of the obtained data by a suitable internal reference is crucial. However, particularly when comparing differently treated samples, such a reference is difficult to identify. Here, a simple method to improve the accuracy and reliability of ChIP experiments by the help of an external reference is described. An artificial molecule, composed of a well-defined digoxigenin (DIG) labeled DNA fragment in complex with an anti-DIG antibody, is synthesized and added to each chromatin sample before immunoprecipitation. During the ChIP procedure, the DNA-DIG-antibody complex undergoes the same treatments as the chromatin and is therefore purified and quantified together with the chromatin of interest. This external reference compensates for variability during the ChIP routine and improves the similarity between replicates, thereby emphasizing the biological differences between samples.

  8. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  9. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    PubMed

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  10. Molecularly Imprinted Polymers with DNA Aptamer Fragments as Macromonomers.

    PubMed

    Zhang, Zijie; Liu, Juewen

    2016-03-01

    Molecularly imprinted polymers (MIPs) are produced in the presence of a template molecule. After removing the template, the cavity can selectively rebind the template. MIPs are attractive functional materials with a low cost and high stability, but traditional MIPs often suffer from low binding affinity. This study employs DNA aptamer fragments as macromonomers to improve MIPs. The DNA aptamer for adenosine was first split into two halves, fluorescently labeled, and copolymerized into MIPs. With a fluorescence quenching assay, the importance of imprinting was confirmed. Further studies were carried out using isothermal titration calorimetry (ITC). Compared to the mixture of the free aptamer fragments, their MIPs doubled the binding affinity. Each free aptamer fragment alone cannot bind adenosine, whereas MIPs containing each fragment are effective binders. We further shortened one of the aptamer fragments, and the DNA length was pushed to as short as six nucleotides, yielding MIPs with a dissociation constant of 27 μM adenosine. This study provides a new method for preparing functional MIP materials by combining high-affinity biopolymer fragments with low-cost synthetic monomers, allowing higher binding affinity and providing a method for signaling binding based on DNA chemistry.

  11. Assessing Telomere Length Using Surface Enhanced Raman Scattering

    NASA Astrophysics Data System (ADS)

    Zong, Shenfei; Wang, Zhuyuan; Chen, Hui; Cui, Yiping

    2014-11-01

    Telomere length can provide valuable insight into telomeres and telomerase related diseases, including cancer. Here, we present a brand-new optical telomere length measurement protocol using surface enhanced Raman scattering (SERS). In this protocol, two single strand DNA are used as SERS probes. They are labeled with two different Raman molecules and can specifically hybridize with telomeres and centromere, respectively. First, genome DNA is extracted from cells. Then the telomere and centromere SERS probes are added into the genome DNA. After hybridization with genome DNA, excess SERS probes are removed by magnetic capturing nanoparticles. Finally, the genome DNA with SERS probes attached is dropped onto a SERS substrate and subjected to SERS measurement. Longer telomeres result in more attached telomere probes, thus a stronger SERS signal. Consequently, SERS signal can be used as an indicator of telomere length. Centromere is used as the inner control. By calibrating the SERS intensity of telomere probe with that of the centromere probe, SERS based telomere measurement is realized. This protocol does not require polymerase chain reaction (PCR) or electrophoresis procedures, which greatly simplifies the detection process. We anticipate that this easy-operation and cost-effective protocol is a fine alternative for the assessment of telomere length.

  12. Interactions and Localization of Escherichia coli Error-Prone DNA Polymerase IV after DNA Damage.

    PubMed

    Mallik, Sarita; Popodi, Ellen M; Hanson, Andrew J; Foster, Patricia L

    2015-09-01

    Escherichia coli's DNA polymerase IV (Pol IV/DinB), a member of the Y family of error-prone polymerases, is induced during the SOS response to DNA damage and is responsible for translesion bypass and adaptive (stress-induced) mutation. In this study, the localization of Pol IV after DNA damage was followed using fluorescent fusions. After exposure of E. coli to DNA-damaging agents, fluorescently tagged Pol IV localized to the nucleoid as foci. Stepwise photobleaching indicated ∼60% of the foci consisted of three Pol IV molecules, while ∼40% consisted of six Pol IV molecules. Fluorescently tagged Rep, a replication accessory DNA helicase, was recruited to the Pol IV foci after DNA damage, suggesting that the in vitro interaction between Rep and Pol IV reported previously also occurs in vivo. Fluorescently tagged RecA also formed foci after DNA damage, and Pol IV localized to them. To investigate if Pol IV localizes to double-strand breaks (DSBs), an I-SceI endonuclease-mediated DSB was introduced close to a fluorescently labeled LacO array on the chromosome. After DSB induction, Pol IV localized to the DSB site in ∼70% of SOS-induced cells. RecA also formed foci at the DSB sites, and Pol IV localized to the RecA foci. These results suggest that Pol IV interacts with RecA in vivo and is recruited to sites of DSBs to aid in the restoration of DNA replication. DNA polymerase IV (Pol IV/DinB) is an error-prone DNA polymerase capable of bypassing DNA lesions and aiding in the restart of stalled replication forks. In this work, we demonstrate in vivo localization of fluorescently tagged Pol IV to the nucleoid after DNA damage and to DNA double-strand breaks. We show colocalization of Pol IV with two proteins: Rep DNA helicase, which participates in replication, and RecA, which catalyzes recombinational repair of stalled replication forks. Time course experiments suggest that Pol IV recruits Rep and that RecA recruits Pol IV. These findings provide in vivo evidence that Pol IV aids in maintaining genomic stability not only by bypassing DNA lesions but also by participating in the restoration of stalled replication forks. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Nucleic Acid Nanostructures: Bottom-Up Control of Geometry on the Nanoscale

    PubMed Central

    Seeman, Nadrian C.; Lukeman, Philip S.

    2012-01-01

    DNA may seem an unlikely molecule from which to build nanostructures, but this is not correct. The specificity of interaction that enables DNA to function so successfully as genetic material also enables its use as a smart molecule for construction on the nanoscale. The key to using DNA for this purpose is the design of stable branched molecules, which expand its ability to interact specifically with other nucleic acid molecules. The same interactions used by genetic engineers can be used to make cohesive interactions with other DNA molecules that lead to a variety of new species. Branched DNA molecules are easy to design, and the can assume a variety of structural motifs. These can be used for purposes both of specific construction, such as polyhedra, and for the assembly of topological targets. A variety of two-dimensional periodic arrays with specific patterns have been made. DNA nanomechanical devices have been built with a series of different triggers, small molecules, nucleic acid molecules and proteins. Recently, progress has been made in self-replication of DNA nano-constructs, and in the scaffolding of other species into DNA arrangements. PMID:25152542

  14. Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

    PubMed

    Chen, Xiang

    2013-09-01

    A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

  15. DNA attachment to support structures

    DOEpatents

    Balhorn, Rodney L.; Barry, Christopher H.

    2002-01-01

    Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

  16. Application of 5-bromo-2'deoxyuridine as a label for in situ hybridization in chromosome microdissection and painting, and 3' OH DNA end labeling for apoptosis.

    PubMed

    Mühlmann-Díaz, M C; Dullea, R G; Bedford, J S

    1996-07-01

    We have utilized 5-bromo-2'deoxyuridine (BrdU) substituted DNA as a probe for a number of applications including, principally, for chromosome painting by fluorescence in situ hybridization (FISH) but also for DNA end-labeling to detect apoptotic cell death and for filter hybridization. Br-dUTP was used as a substitute for biotin or digoxigenin-dUTP in probe labeling techniques, such as random priming, nick translation, end-labeling or PCR. An especially useful application is that it may be incorporated into probe DNA while cells or plasmids in bacteria are growing in the presence of BrdU. This can be particularly advantageous when large quantities of probe are needed, since the cost per mole of digoxigenin-dUTP or biotin-dUTP is nearly 1000 times that of Br-dUTP. Also, if probe is prepared by growth in BrdU, the difference in cost to prepare equal quantities of labeled DNA is more than 10,000 times greater for biotin-dUTP.

  17. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  18. The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

    PubMed

    Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

    2011-01-25

    DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

  19. Target-regulated proximity hybridization with three-way DNA junction for in situ enhanced electronic detection of marine biotoxin based on isothermal cycling signal amplification strategy.

    PubMed

    Liu, Bingqian; Chen, Jinfeng; Wei, Qiaohua; Zhang, Bing; Zhang, Lan; Tang, Dianping

    2015-07-15

    A new signal amplification strategy based on target-regulated DNA proximity hybridization (TRPH) reaction accompanying formation of three-way DNA junction was designed for electronic detection of Microcystin-LR (MC-LR used in this case), coupling with junction-induced isothermal cycling signal amplification. Initially, a sandwiched-type immunoreaction was carried out in a low-cost PCR tube between anti-MC-LR mAb1 antibody-labeled DNA1 (mAb1-DNA1) and anti-MC-LR mAb2-labeled DNA2 (mAb2-DNA2) in the presence of target to form a three-way DNA junction. Then, the junction could undergo an unbiased strand displacement reaction on an h-like DNA nanostructure-modified electrode (labeled with methylene blue redox tag on the short DNA strand), thereby resulting in the dissociation of methylene blue-labeled signal DNA from the electrode. The newly formed double-stranded DNA could be cleaved again by exonuclease III, and the released three-way DNA junction retriggered the strand-displacement reaction with h-like DNA nanostructures for junction recycling. During the strand-displacement reaction, numerous methylene blue-labeled DNA strands were far away from the electrode, thus decreasing the detectable electrochemical signal within the applied potentials. Under optimal conditions, the TRPH-based immunosensing system exhibited good electrochemical responses for detecting target MC-LR at a concentration as low as 1.0ngkg(-1) (1.0ppt). Additionally, the precision, reproducibility, specificity and method accuracy were also investigated with acceptable results. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Attachment of second harmonic-active moiety to molecules for detection of molecules at interfaces

    DOEpatents

    Salafsky, Joshua S.; Eisenthal, Kenneth B.

    2005-10-11

    This invention provides methods of detecting molecules at an interface, which comprise labeling the molecules with a second harmonic-active moiety and detecting the labeled molecules at the interface using a surface selective technique. The invention also provides methods for detecting a molecule in a medium and for determining the orientation of a molecular species within a planar surface using a second harmonic-active moiety and a surface selective technique.

  1. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  2. Solvent-modified ultrafast decay dynamics in conjugated polymer/dye labeled single stranded DNA

    NASA Astrophysics Data System (ADS)

    Kim, Inhong; Kang, Mijeong; Woo, Han Young; Oh, Jin-Woo; Kyhm, Kwangseuk

    2015-07-01

    We have investigated that organic solvent (DMSO, dimethyl sulfoxide) modifies energy transfer efficiency between conjugated polymers (donors) and fluorescein-labeled single stranded DNAs (acceptors). In a mixture of buffer and organic solvent, fluorescence of the acceptors is significantly enhanced compared to that of pure water solution. This result can be attributed to change of the donor-acceptor environment such as decreased hydrophobicity of polymers, screening effect of organic solvent molecules, resulting in an enhanced energy transfer efficiency. Time-resolved fluorescence decay of the donors and the acceptors was modelled by considering the competition between the energy harvesting Foerster resonance energy transfer and the energy-wasting quenching. This enables to quantity that the Foerster distance (R0 = 43.3 Å) and resonance energy transfer efficiency (EFRET = 58.7 %) of pure buffer solution become R0 = 38.6 Å and EFRET = 48.0 % when 80% DMSO/buffer mixture is added.

  3. Real-Time Label-Free Direct Electronic Monitoring of Topoisomerase Enzyme Binding Kinetics on Graphene.

    PubMed

    Zuccaro, Laura; Tesauro, Cinzia; Kurkina, Tetiana; Fiorani, Paola; Yu, Hak Ki; Knudsen, Birgitta R; Kern, Klaus; Desideri, Alessandro; Balasubramanian, Kannan

    2015-11-24

    Monolayer graphene field-effect sensors operating in liquid have been widely deployed for detecting a range of analyte species often under equilibrium conditions. Here we report on the real-time detection of the binding kinetics of the essential human enzyme, topoisomerase I interacting with substrate molecules (DNA probes) that are immobilized electrochemically on to monolayer graphene strips. By monitoring the field-effect characteristics of the graphene biosensor in real-time during the enzyme-substrate interactions, we are able to decipher the surface binding constant for the cleavage reaction step of topoisomerase I activity in a label-free manner. Moreover, an appropriate design of the capture probes allows us to distinctly follow the cleavage step of topoisomerase I functioning in real-time down to picomolar concentrations. The presented results are promising for future rapid screening of drugs that are being evaluated for regulating enzyme activity.

  4. Label-free DNA imaging in vivo with stimulated Raman scattering microscopy

    PubMed Central

    Lu, Fa-Ke; Basu, Srinjan; Igras, Vivien; Hoang, Mai P.; Ji, Minbiao; Fu, Dan; Holtom, Gary R.; Neel, Victor A.; Freudiger, Christian W.; Fisher, David E.; Xie, X. Sunney

    2015-01-01

    Label-free DNA imaging is highly desirable in biology and medicine to perform live imaging without affecting cell function and to obtain instant histological tissue examination during surgical procedures. Here we show a label-free DNA imaging method with stimulated Raman scattering (SRS) microscopy for visualization of the cell nuclei in live animals and intact fresh human tissues with subcellular resolution. Relying on the distinct Raman spectral features of the carbon-hydrogen bonds in DNA, the distribution of DNA is retrieved from the strong background of proteins and lipids by linear decomposition of SRS images at three optimally selected Raman shifts. Based on changes on DNA condensation in the nucleus, we were able to capture chromosome dynamics during cell division both in vitro and in vivo. We tracked mouse skin cell proliferation, induced by drug treatment, through in vivo counting of the mitotic rate. Furthermore, we demonstrated a label-free histology method for human skin cancer diagnosis that provides comparable results to other conventional tissue staining methods such as H&E. Our approach exhibits higher sensitivity than SRS imaging of DNA in the fingerprint spectral region. Compared with spontaneous Raman imaging of DNA, our approach is three orders of magnitude faster, allowing both chromatin dynamic studies and label-free optical histology in real time. PMID:26324899

  5. Physicochemical and biological properties of self-assembled antisense/poly(amidoamine) dendrimer nanoparticles: the effect of dendrimer generation and charge ratio

    PubMed Central

    Nomani, Alireza; Haririan, Ismaeil; Rahimnia, Ramin; Fouladdel, Shamileh; Gazori, Tarane; Dinarvand, Rassoul; Omidi, Yadollah; Azizi, Ebrahim

    2010-01-01

    To gain a deeper understanding of the physicochemical phenomenon of self-assembled nanoparticles of different generations and ratios of poly (amidoamine) dendrimer (PAMAM) dendrimer and a short-stranded DNA (antisense oligonucleotide), multiple methods were used to characterize these nanoparticles including photon correlation spectroscopy (PCS); zeta potential measurement; and atomic force microscopy (AFM). PCS and AFM results revealed that, in contrast to larger molecules of DNA, smaller molecules produce more heterodisperse and large nanoparticles when they are condensed with a cationic dendrimer. AFM images also showed that such nanoparticles were spherical. The stability of the antisense content of the nanoparticles was investigated over different charge ratios using polyacrylamide gel electrophoresis. It was clear from such analyses that much more than charge neutrality point was required to obtain stable nanoparticles. For cell uptake, self-assembled nanoparticles were prepared with PAMAM G5 and 5’-FITC labeled antisense and the uptake experiment was carried out in T47D cell culture. This investigation also shows that the cytotoxicity of the nanoparticles was dependent upon the generation and charge ratio of the PAMAM dendrimer, and the antisense concentration had no significant effect on the cytotoxicity. PMID:20517481

  6. In situ amplified electrochemical aptasensing for sensitive detection of adenosine triphosphate by coupling target-induced hybridization chain reaction with the assembly of silver nanotags.

    PubMed

    Zhou, Qian; Lin, Youxiu; Lin, Yuping; Wei, Qiaohua; Chen, Guonan; Tang, Dianping

    2016-01-01

    Biomolecular immobilization and construction of the sensing platform are usually crucial for the successful development of a high-efficiency detection system. Herein we report on a novel and label-free signal-amplified aptasensing for sensitive electrochemical detection of small molecules (adenosine triphosphate, ATP, used in this case) by coupling with target-induced hybridization chain reaction (HCR) and the assembly of electroactive silver nanotags. The system mainly consisted of two alternating hairpin probes, a partial-pairing trigger-aptamer duplex DNA and a capture probe immobilized on the electrode. Upon target ATP introduction, the analyte attacked the aptamer and released the trigger DNA, which was captured by capture DNA immobilized on the electrode to form a newly partial-pairing double-stranded DNA. Thereafter, the exposed domain at trigger DNA could be utilized as the initator strand to open the hairpin probes in sequence, and propagated a chain reaction of hybridization events between two alternating hairpins to form a long nicked double-helix. The electrochemical signal derived from the assembled silver nanotags on the nicked double-helix. Under optimal conditions, the electrochemical aptasensor could exhibit a high sensitivity and a low detection limit, and allowed the detection of ATP at a concentration as low as 0.03 pM. Our design showed a high selectivity for target ATP against its analogs because of the high-specificity ATP-aptamer reaction, and its applicable for monitoring ATP in the spiking serum samples. Improtantly, the distinct advantages of the developed aptasensor make it hold a great potential for the development of simple and robust sensing strategies for the detection of other small molecules by controlling the apatmer sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Ligation-rolling circle amplification combined with γ-cyclodextrin mediated stemless molecular beacon for sensitive and specific genotyping of single-nucleotide polymorphism.

    PubMed

    Zou, Zhen; Qing, Zhihe; He, Xiaoxiao; Wang, Kemin; He, Dinggeng; Shi, Hui; Yang, Xue; Qing, Taiping; Yang, Xiaoxiao

    2014-07-01

    A novel approach for highly sensitive and selective genotyping of single-nucleotide polymorphism (SNP) has been developed based on ligation-rolling circle amplification (L-RCA) and stemless molecular beacon. In this approach, two tailored DNA probes were involved. The stemless molecular beacon, formed through the inclusion interactions of γ-cyclodextrin (γ-CD) and bis-pyrene labeled DNA fragment, was served as signal probe. In the absence of mutant target, the two pyrene molecules were bound in the γ-CD cavity to form an excimer and showed a strong fluorescence at 475 nm. It was here named γ-CD-P-MB. The padlock DNA probe was designed as recognition probe. Upon the recognition of a point mutation DNA targets, the padlock probe was ligated to generate a circular template. An RCA amplification was then initiated using the circular template in the presence of Phi29 polymerase and dNTPs. The L-RCA products, containing repetitive sequence units, subsequently hybridized with the γ-CD-P-MB. This made pyrene molecules away from γ-CD cavity and caused a decrease of excimer fluorescence. As a proof-of-concept, SNP typing of β-thalassemia gene at position -28 was investigated using this approach. The detection limit of mutated target was determined to be 40 fM. In addition, DNA ligase offered high fidelity in distinguishing the mismatched bases at the ligation site, resulting in positive detection of mutant target even when the ratio of the wildtype to the mutant is 999:1. Given these attractive characteristics, the developed approach might provide a great genotyping platform for pathogenic diagnosis and genetic analysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Evidence for the Involvement of Membranous Bodies in the Processes Leading to Genetic Transformation in Bacillus subtilis

    PubMed Central

    Wolstenholme, David R.; Vermeulen, Cornelius A.; Venema, Gerhardus

    1966-01-01

    Wolstenholme, David R. (Max-Planck-Institut für Biologie, Tübingen, Germany), Cornelius A. Vermeulen, and Gerhardus Venema. Evidence for the involvement of membranous bodies in the processes leading to genetic transformation in Bacillus subtilis. J. Bacteriol. 92:1111–1121. 1966.—Data obtained from electron microscopic autoradiographs of profiles of cells of a Bacillus subtilis population exposed to H3-thymidine-labeled donor deoxyribonucleic acid (DNA) during the phase of maximal competence indicated that molecules originating from absorbed DNA are closely associated with membranous bodies, particularly with those situated in the cytoplasm, but that most if not all of the radioactive molecules are outside the bodies. It is suggested that membranous bodies produce enzymes essential to the eventual incorporation of transforming DNA into the bacterial genome, or to the breakdown and utilization or expulsion of absorbed DNA not incorporated as transformant (or to both processes). During the phase of maximal competence, the total number of membranous bodies seen in profiles increased continuously to as much as 2.3 times the numbers found during earlier stages of culture. This increase was not accounted for by a decrease in bacterial cell volume, but resulted from an actual increase in total volume of membranous bodies. The number of membranous bodies visibly connecting plasma membrane and nuclear region increased during maximal competence to as much as 30 times the numbers found in earlier stages. As both increases were found in the absence of donor DNA and only began after maximal competence was attained, it seemed most probable that they were an expression of a physiological state influenced by the continuing deficiency of nutrients in the growth medium during this phase of culture. Images PMID:4959042

  9. DNA-psoralen interaction: a single molecule experiment.

    PubMed

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  10. DNA of a Human Hepatitis B Virus Candidate

    PubMed Central

    Robinson, William S.; Clayton, David A.; Greenman, Richard L.

    1974-01-01

    Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328

  11. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    ERIC Educational Resources Information Center

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  12. A small-molecule acts as a 'roadblock' on DNA, hampering its fundamental processes.

    PubMed

    Kumar, Amit

    2017-11-01

    DNA replication, RNA and protein synthesis are the most fundamental housekeeping processes involved in an organism's growth. Failure or dysregulation of these pathways are often deleterious to life. Therefore, selective inhibition of such processes can be crucial for the inhibition of the growth of any cell, including cancer cells, pathogenic bacteria or other deadly microbes. In the present study, a Zn 2+ complex is shown to act as a roadblock of DNA. The Zn 2+ complex inhibited DNA taq polymerase activity under the in vitro conditions of polymerase chain reaction (PCR). Under in vivo conditions, it readily crosses the cell wall of gram-negative bacteria (Escherichia coli), leading to the reduction of RNA levels as well as protein content. Growth of pathogenic bacteria (e.g., Staphylococcus aureus and Pseudomonas aeruginosa) was also significantly retarded. The Zn 2+ complex binds to the grooves of the DNA without inducing conformational changes or exhibiting chemical nuclease activity. To the best current knowledge, this is first coordination complex exhibiting a 'roadblock' property under both in vitro and in vivo conditions (show at all three levels - DNA, RNA and protein). The label-free approach used in this study may offer an alternative route towards fighting pathogenic bacteria or cancer cells by hampering fundamental cellular processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lishanski, A.; Ostrander, E.A.; Rine, J.

    1994-03-29

    An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less

  14. Cloned plasmid DNA fragments as calibrators for controlling GMOs: different real-time duplex quantitative PCR methods.

    PubMed

    Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc

    2004-03-01

    Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.

  15. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  16. Novel ratiometric surface-enhanced raman spectroscopy aptasensor for sensitive and reproducible sensing of Hg2.

    PubMed

    Wu, Yan; Jiang, Tingting; Wu, Zhaoyang; Yu, Ruqin

    2018-01-15

    It is important to precisely monitor mercury (II) ions (Hg 2+ ) for environment protection and human health monitoring. Although many strategies have been developed in the past decades, there still remains a challenge for developing an ultrasensitive, simple and reliable approach to detect Hg 2+ . Herein, we report a ratiometric surface-enhanced Raman scattering (SERS) aptasensor by employing aptamer-modified Au@Ag core-shell nanoparticles (Au@Ag NPs) as highly functional sensing probes, allowing for ultrasensitive detection of Hg 2+ . In principle, the thiolated 5'-Cy3 labeled aptamer probe (Cy3-aptamer) is firstly immobilized on the SERS substrate surface and then hybridizes with the 5'-Rox labeled complementary DNA (cDNA) to form a rigid double-stranded DNA (dsDNA), in which the Cy3 and Rox Raman labels are used to produce the ratiometric Raman signals. In the presence of Hg 2+ , the aptamer DNA turns into the thymine (T)-Hg 2+ -T mediated hairpin structure, leading to the dissociation of dsDNA. As a result, the Rox labels are away from the Au@Ag NP SERS substrate while Cy3 labels are close to it. Therefore, the intensity of SERS signal from Cy3 labels increases while that from Rox labels decreases. The ratio between the Raman intensities of Cy3 labels and Rox labels is linear with Hg 2+ concentrations in the range from 0.001 to 1.0nM, and the limit of detection is estimated to be 0.4pM. The proposed strategy provides a new rapid, simple and reliable approach for sensitive detection of Hg 2+ and may create a universal methodology for developing analogous aptasensors for a wide range of other analytes determination. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

    PubMed

    Schneider, Uffe Vest

    2012-01-01

    This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

  18. Versatile microfluidic total internal reflection (TIR)-based devices: application to microbeads velocity measurement and single molecule detection with upright and inverted microscope.

    PubMed

    Le, Nam Cao Hoai; Yokokawa, Ryuji; Dao, Dzung Viet; Nguyen, Thien Duy; Wells, John C; Sugiyama, Susumu

    2009-01-21

    A poly(dimethylsiloxane) (PDMS) chip for Total Internal Reflection (TIR)-based imaging and detection has been developed using Si bulk micromachining and PDMS casting. In this paper, we report the applications of the chip on both inverted and upright fluorescent microscopes and confirm that two types of sample delivery platforms, PDMS microchannel and glass microchannel, can be easily integrated depending on the magnification of an objective lens needed to visualize a sample. Although any device configuration can be achievable, here we performed two experiments to demonstrate the versatility of the microfluidic TIR-based devices. The first experiment was velocity measurement of Nile red microbeads with nominal diameter of 500 nm in a pressure-driven flow. The time-sequenced fluorescent images of microbeads, illuminated by an evanescent field, were cross-correlated by a Particle Image Velocimetry (PIV) program to obtain near-wall velocity field of the microbeads at various flow rates from 500 nl/min to 3000 nl/min. We then evaluated the capabilities of the device for Single Molecule Detection (SMD) of fluorescently labeled DNA molecules from 30 bp to 48.5 kbp and confirm that DNA molecules as short as 1105 bp were detectable. Our versatile, integrated device could provide low-cost and fast accessibility to Total Internal Reflection Fluorescent Microscopy (TIRFM) on both conventional upright and inverted microscopes. It could also be a useful component in a Micro-Total Analysis System (micro-TAS) to analyze nanoparticles or biomolecules near-wall transport or motion.

  19. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    PubMed

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  20. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    PubMed Central

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  1. Incorporation of Deoxyribonucleic Acid Precursors by T4 Deoxyribonucleic Acid-Protein Complexes Retained on Glass Fiber Filters

    PubMed Central

    Miller, Robert C.; Kozinski, Andrzej W.

    1970-01-01

    Bacteriophage T4 deoxyribonucleic acid (DNA)-protein complexes were retained preferentially on glass fiber filters. DNA polymerase activity in the complex was detected through the incorporation of 3H-labeled DNA precursors. The primer-product DNA hybridized with both phage and Escherichia coli DNA. Density labeling experiments showed that about 30% of incorporated 3H-deoxyadenosine triphosphate was found in DNA which hybridized with phage DNA; this DNA was found to be covalently attached to the primer DNA. PMID:5497903

  2. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    PubMed

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Differential nuclear staining assay for high-throughput screening to identify cytotoxic compounds.

    PubMed

    Lema, Carolina; Varela-Ramirez, Armando; Aguilera, Renato J

    As large quantities of novel synthetic molecules continue to be generated there is a challenge to identify therapeutic agents with cytotoxic activity. Here we introduce a Differential Nuclear Staining (DNS) assay adapted to live-cell imaging for high throughput screening (HTS) that utilizes two fluorescent DNA intercalators, Hoechst 33342 and Propidium iodide (PI). Since Hoechst can readily cross cell membranes to stain DNA of living and dead cells, it was used to label the total number of cells. In contrast, PI only enters cells with compromised plasma membranes, thus selectively labeling dead cells. The DNS assay was successfully validated by utilizing well known cytotoxic agents with fast or slow cytotoxic activities. The assay was found to be suitable for HTS with Z' factors ranging from 0.86 to 0.60 for 96 and 384-well formats, respectively. Furthermore, besides plate-to-plate reproducibility, assay quality performance was evaluated by determining ratios of signal-to-noise and signal-to-background, as well as coefficient of variation, which resulted in adequate values and validated the assay for HTS initiatives. As proof of concept, eighty structurally diverse compounds from a small molecule library were screened in a 96-well plate format using the DNS assay. Using this DNS assay, six hits with cytotoxic properties were identified and all of them were also successfully identified by using the commercially available MTS assay (CellTiter 96® Cell Proliferation Assay). In addition, the DNS and a flow cytometry assay were used to validate the activity of the cytotoxic compounds. The DNS assay was also used to generate dose-response curves and to obtain CC 50 values. The results indicate that the DNS assay is reliable and robust and suitable for primary and secondary screens of compounds with potential cytotoxic activity.

  4. Differential nuclear staining assay for high-throughput screening to identify cytotoxic compounds

    PubMed Central

    LEMA, Carolina; VARELA-RAMIREZ, Armando; AGUILERA, Renato J.

    2016-01-01

    As large quantities of novel synthetic molecules continue to be generated there is a challenge to identify therapeutic agents with cytotoxic activity. Here we introduce a Differential Nuclear Staining (DNS) assay adapted to live-cell imaging for high throughput screening (HTS) that utilizes two fluorescent DNA intercalators, Hoechst 33342 and Propidium iodide (PI). Since Hoechst can readily cross cell membranes to stain DNA of living and dead cells, it was used to label the total number of cells. In contrast, PI only enters cells with compromised plasma membranes, thus selectively labeling dead cells. The DNS assay was successfully validated by utilizing well known cytotoxic agents with fast or slow cytotoxic activities. The assay was found to be suitable for HTS with Z′ factors ranging from 0.86 to 0.60 for 96 and 384-well formats, respectively. Furthermore, besides plate-to-plate reproducibility, assay quality performance was evaluated by determining ratios of signal-to-noise and signal-to-background, as well as coefficient of variation, which resulted in adequate values and validated the assay for HTS initiatives. As proof of concept, eighty structurally diverse compounds from a small molecule library were screened in a 96-well plate format using the DNS assay. Using this DNS assay, six hits with cytotoxic properties were identified and all of them were also successfully identified by using the commercially available MTS assay (CellTiter 96® Cell Proliferation Assay). In addition, the DNS and a flow cytometry assay were used to validate the activity of the cytotoxic compounds. The DNS assay was also used to generate dose-response curves and to obtain CC50 values. The results indicate that the DNS assay is reliable and robust and suitable for primary and secondary screens of compounds with potential cytotoxic activity. PMID:27042697

  5. Label-enhanced surface plasmon resonance applied to label-free interaction analysis of small molecules and fragments.

    PubMed

    Eng, Lars; Nygren-Babol, Linnéa; Hanning, Anders

    2016-10-01

    Surface plasmon resonance (SPR) is a well-established method for studying interactions between small molecules and biomolecules. In particular, SPR is being increasingly applied within fragment-based drug discovery; however, within this application area, the limited sensitivity of SPR may constitute a problem. This problem can be circumvented by the use of label-enhanced SPR that shows a 100-fold higher sensitivity as compared with conventional SPR. Truly label-free interaction data for small molecules can be obtained by applying label-enhanced SPR in a surface competition assay format. The enhanced sensitivity is accompanied by an increased specificity and inertness toward disturbances (e.g., bulk refractive index disturbances). Label-enhanced SPR can be used for fragment screening in a competitive assay format; the competitive format has the added advantage of confirming the specificity of the molecular interaction. In addition, label-enhanced SPR extends the accessible kinetic regime of SPR to the analysis of very fast fragment binding kinetics. In this article, we demonstrate the working principles and benchmark the performance of label-enhanced SPR in a model system-the interaction between carbonic anhydrase II and a number of small-molecule sulfonamide-based inhibitors. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Visualization of yeast chromosomal DNA

    NASA Technical Reports Server (NTRS)

    Lubega, Seth

    1990-01-01

    The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.

  7. Transformation of Escherichia coli with large DNA molecules by electroporation.

    PubMed Central

    Sheng, Y; Mancino, V; Birren, B

    1995-01-01

    We have examined bacterial electroporation with a specific interest in the transformation of large DNA, i.e. molecules > 100 kb. We have used DNA from bacterial artificial chromosomes (BACs) ranging from 7 to 240 kb, as well as BAC ligation mixes containing a range o different sized molecules. The efficiency of electroporation with large DNA is strongly dependent on the strain of Escherichia coli used; strains which offer comparable efficiencies for 7 kb molecules differ in their uptake of 240 kb DNA by as much as 30-fold. Even with a host strain that transforms relatively well with large DNA, transformation efficiency drops dramatically with increasing size of the DNA. Molecules of 240 kb transform approximately 30-fold less well, on a molar basis, than molecules of 80 kb. Maximum transformation of large DNA occurs with different voltage gradients and with different time constants than are optimal for smaller DNA. This provides the opportunity to increase the yield of transformants which have taken up large DNA relative to the number incorporating smaller molecules. We have demonstrated that conditions may be selected which increase the average size of BAC clones generated by electroporation and compare the overall efficiency of each of the conditions tested. Images PMID:7596828

  8. DNA-labeled clay: A sensitive new method for tracing particle transport

    USGS Publications Warehouse

    Mahler, B.J.; Winkler, M.; Bennett, P.; Hillis, D.M.

    1998-01-01

    The behavior of mobile colloids and sediment in most natural environments remains poorly understood, in part because characteristics of existing sediment tracers limit their wide-spread use. Here we describe the development of a new approach that uses a DNA-labeled montmorillonite clay as a highly sensitive and selective sediment tracer that can potentially characterize sediment and colloid transport in a wide variety of environments, including marine, wetland, ground-water, and atmospheric systems. Characteristics of DNA in natural systems render it unsuitable as an aqueous tracer but admirably suited as a label for tracing particulates. The DNA-labeled-clay approach, using techniques developed from molecular biology, has extremely low detection limits, very specific detection, and a virtually infinite number of tracer signatures. Furthermore, DNA-labeled clay has the same physical characteristics as the particles it is designed to trace, it is environmentally benign, and it can be relatively inexpensively produced and detected. Our initial results show that short (500 base pair) strands of synthetically produced DNA reversibly adsorb to both Na-montmorillonite and powdered silica surfaces via a magnesium bridge. The DNA-montmorillonite surface complexes are stable in calcium-bicarbonate spring waters for periods of up to 18 days and only slowly desorb to the aqueous phase, whereas the silica surface complex is stable only in distilled water. Both materials readily release the adsorbed DNA in dilute EDTA solutions for amplification by the polymerase chain reaction (PCR) and quantification. The stability of the DNA-labeled clay complex suggests that this material would be appropriate for use as an extremely sensitive sediment tracer for flow periods of as long as 2 weeks, and possibly longer.

  9. The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

    NASA Astrophysics Data System (ADS)

    Sharipov, T. I.; Bakhtizin, R. Z.

    2017-10-01

    An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

  10. The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

    PubMed Central

    Eoff, Robert L.; Raney, Kevin D.

    2010-01-01

    Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

  11. Synthesis of Bipartite Tetracysteine PNA Probes for DNA In Situ Fluorescent Labeling.

    PubMed

    Fang, Ge-Min; Seitz, Oliver

    2017-12-24

    "Label-free" fluorescent probes that avoid additional steps or building blocks for conjugation of fluorescent dyes with oligonucleotides can significantly reduce the time and cost of parallel bioanalysis of a large number of nucleic acid samples. A method for the synthesis of "label-free" bicysteine-modified PNA probes using solid-phase synthesis and procedures for sequence-specific DNA in situ fluorescent labeling is described here. The concept is based on the adjacent alignment of two bicysteine-modified peptide nucleic acids on a DNA target to form a structurally optimized bipartite tetracysteine motif, which induces a sequence-specific fluorogenic reaction with commercially available biarsenic dyes, even in complex media such as cell lysate. This unit will help researchers to quickly synthesize bipartite tetracysteine PNA probes and carry out low-cost DNA in situ fluorescent labeling experiments. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  12. Label-free DNA imaging in vivo with stimulated Raman scattering microscopy

    DOE PAGES

    Lu, Fa-Ke; Basu, Srinjan; Igras, Vivien; ...

    2015-08-31

    Label-free DNA imaging is highly desirable in biology and medicine to perform live imaging without affecting cell function and to obtain instant histological tissue examination during surgical procedures. Here we show a label-free DNA imaging method with stimulated Raman scattering (SRS) microscopy for visualization of the cell nuclei in live animals and intact fresh human tissues with subcellular resolution. Relying on the distinct Raman spectral features of the carbon-hydrogen bonds in DNA, the distribution of DNA is retrieved from the strong background of proteins and lipids by linear decomposition of SRS images at three optimally selected Raman shifts. Based onmore » changes on DNA condensation in the nucleus, we were able to capture chromosome dynamics during cell division both in vitro and in vivo. We tracked mouse skin cell proliferation, induced by drug treatment, through in vivo counting of the mitotic rate. Moreover, we demonstrated a label-free histology method for human skin cancer diagnosis that provides comparable results to other conventional tissue staining methods such as H&E. In conclusion, our approach exhibits higher sensitivity than SRS imaging of DNA in the fingerprint spectral region. Compared with spontaneous Raman imaging of DNA, our approach is three orders of magnitude faster, allowing both chromatin dynamic studies and label-free optical histology in real time.« less

  13. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    PubMed Central

    2011-01-01

    Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

  14. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

    PubMed

    Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

    2011-08-24

    Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.

  15. Torsional mechanics of DNA are regulated by small-molecule intercalation.

    PubMed

    Celedon, Alfredo; Wirtz, Denis; Sun, Sean

    2010-12-23

    Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

  16. Single Cell Mass Cytometry for Analysis of Immune System Functional States

    PubMed Central

    Bjornson, Zach B.; Nolan, Garry P.; Fantl, Wendy J.

    2013-01-01

    Single cell mass cytometry facilitates high-dimensional, quantitative analysis of the effects of bioactive molecules on cell populations at single-cell resolution. Datasets are generated with antibody panels (upwards of 40) in which each antibody is conjugated to a polymer chelated with a stable metal isotope, usually in the Lanthanide series of the periodic table. Isotope labelled antibodies recognize surface markers to delineate cell types and intracellular signaling molecules to provide a measure of the network state—and thereby demarcating multiple cell state functions such as apoptosis, DNA damage and cell cycle. By measuring all these parameters simultaneously, the signaling state of an individual cell can be measured at its network state. This review will cover the basics of mass cytometry as well as outline steps already taken to allow it to stand aside traditional fluorescence based cytometry in the immunologist’s analytical arsenal in their study of immune states during infection. PMID:23999316

  17. Multispot single-molecule FRET: High-throughput analysis of freely diffusing molecules

    PubMed Central

    Panzeri, Francesco

    2017-01-01

    We describe an 8-spot confocal setup for high-throughput smFRET assays and illustrate its performance with two characteristic experiments. First, measurements on a series of freely diffusing doubly-labeled dsDNA samples allow us to demonstrate that data acquired in multiple spots in parallel can be properly corrected and result in measured sample characteristics consistent with those obtained with a standard single-spot setup. We then take advantage of the higher throughput provided by parallel acquisition to address an outstanding question about the kinetics of the initial steps of bacterial RNA transcription. Our real-time kinetic analysis of promoter escape by bacterial RNA polymerase confirms results obtained by a more indirect route, shedding additional light on the initial steps of transcription. Finally, we discuss the advantages of our multispot setup, while pointing potential limitations of the current single laser excitation design, as well as analysis challenges and their solutions. PMID:28419142

  18. Selective Chemical Labeling of Proteins with Small Fluorescent Molecules Based on Metal-Chelation Methodology

    PubMed Central

    Soh, Nobuaki

    2008-01-01

    Site-specific chemical labeling utilizing small fluorescent molecules is a powerful and attractive technique for in vivo and in vitro analysis of cellular proteins, which can circumvent some problems in genetic encoding labeling by large fluorescent proteins. In particular, affinity labeling based on metal-chelation, advantageous due to the high selectivity/simplicity and the small tag-size, is promising, as well as enzymatic covalent labeling, thereby a variety of novel methods have been studied in recent years. This review describes the advances in chemical labeling of proteins, especially highlighting the metal-chelation methodology. PMID:27879749

  19. Labeling milk along its production chain with DNA encapsulated in silica.

    PubMed

    Bloch, Madeleine S; Paunescu, Daniela; Stoessel, Philipp R; Mora, Carlos A; Stark, Wendelin J; Grass, Robert N

    2014-10-29

    The capability of tracing a food product along its production chain is important to ensure food safety and product authenticity. For this purpose and as an application example, recently developed Silica Particles with Encapsulated DNA (SPED) were added to milk at concentrations ranging from 0.1 to 100 ppb (μg per kg milk). Thereby the milk, as well as the milk-derived products yoghurt and cheese, could be uniquely labeled with a DNA tag. Procedures for the extraction of the DNA tags from the food matrixes were elaborated and allowed identification and quantification of previously marked products by quantitative polymerase chain reaction (qPCR) with detection limits below 1 ppb of added particles. The applicability of synthetic as well as naturally occurring DNA sequences was shown. The usage of approved food additives as DNA carrier (silica = E551) and the low cost of the technology (<0.1 USD per ton of milk labeled with 10 ppb of SPED) display the technical applicability of this food labeling technology.

  20. Self-reference and random sampling approach for label-free identification of DNA composition using plasmonic nanomaterials.

    PubMed

    Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu

    2018-05-09

    The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.

  1. Cytological evidence for DNA chain elongation after UV irradiation in the S phase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Minka, D.F.; Nath, J.

    1981-04-01

    Human cells irradiated with UV light synthesize lower molecular weight DNA than unirradiated cells. This reduction in molecular weight is greater in xeroderma pigmentosum (XP) cells than in normal cells. The molecular weight of DNA is further reduced by the addition of caffeine to XP cells. By several hours after irradiation, DNA fragments are barely detectable. Cells from excision-proficient and excision-deficient XP patients were studied autoradiographically to produce cytological evidence of DNA chain elongation. Replicate cultures with and without caffeine were synchronized and irradiated with UV light during the S phase. Caffeine was removed in G2, and the cells weremore » labeled with /sup 3/H-thymidine. Results showed significantly increased labeling during G2 of excision-deficient XP cells. Labeling was dependent on the time of irradiation and presence of caffeine. The XP variant cells had no increase in labeling for any irradiation time.« less

  2. A cationic conjugated polymer and graphene oxide: Application to amplified fluorescence detection of sinapine.

    PubMed

    Zhang, Zhen; Xiang, Xia; Shi, Jianbin; Huang, Fenghong; Xia, Xiaoyang; Zheng, Mingming; Han, Ling; Tang, Hu

    2018-10-05

    An amplified fluorescence strategy is described for the detection of sinapine (SP) by using a cationic conjugated polymer (PFP) and graphene oxide (GO). It is observed that the fluorescein (FAM)-labeled single-stranded DNA (FAM-DNA) is absorbed on the surface of GO if SP is absent. This causes that fluorescence resonance energy transfer (FRET) from PFP to FAM is inefficient when adding PFP into FAM-DNA/GO complex. If SP is added to FAM-DNA/GO complex, FAM-DNA is desorbed from GO surface due to the competitive binding of SP and FAM-DNA toward GO. In this case, FAM-DNA is close to PFP in the presence of PFP through strong electrostatic interaction, leading to the occurrence of efficient FRET. Based on the above phenomenon, we demonstrate a method to amplify fluorescence signal of traditional GO-based SP assay by introducing PFP. In comparison to the use of single GO, the combination of PFP with GO-based strategy displays high turn-on ratio and enhanced sensitivity with a limit of detection as low as 7.3 ng mL -1 for SP detection. Satisfactory results in practical samples are also obtained by the recovery experiments, demonstrating the potential application of cationic conjugated polymer in plant-derived small molecule. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. TRF1 and TRF2 use different mechanisms to find telomeric DNA but share a novel mechanism to search for protein partners at telomeres.

    PubMed

    Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong

    2014-02-01

    Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.

  4. DNA stable-isotope probing (DNA-SIP).

    PubMed

    Dunford, Eric A; Neufeld, Josh D

    2010-08-02

    DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

  5. DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching

    NASA Astrophysics Data System (ADS)

    Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.

    2007-02-01

    We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).

  6. Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Ito, Takashi

    2008-01-01

    This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

  7. A comparison of DNA fragmentation methods - Applications for the biochip technology.

    PubMed

    Sapojnikova, Nelly; Asatiani, Nino; Kartvelishvili, Tamar; Asanishvili, Lali; Zinkevich, Vitaly; Bogdarina, Irina; Mitchell, Julian; Al-Humam, Abdulmohsen

    2017-08-20

    The efficiency of hybridization signal detection in a biochip is affected by the method used for test DNA preparation, such as fragmentation, amplification and fluorescent labelling. DNA fragmentation is the commonest methods used and it is recognised as a critical step in biochip analysis. Currently methods used for DNA fragmentation are based either on sonication or on the enzymatic digestion. In this study, we compared the effect of different types of enzymatic DNA fragmentations, using DNase I to generate ssDNA breaks, NEBNext dsDNA fragmentase and SaqAI restrictase, on DNA labelling. DNA from different Desulfovibrio species was used as a substrate for these enzymes. Of the methods used, DNA fragmented by NEBNext dsDNA Fragmentase digestion was subsequently labelled with the greatest efficiency. As a result of this, the use of this enzyme to fragment target DNA increases the sensitivity of biochip-based detection significantly, and this is an important consideration when determining the presence of targeted DNA in ecological and medical samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Optical detection of two-color-fluorophore barcode for nanopore DNA sensing

    NASA Astrophysics Data System (ADS)

    Zhang, M.; Sychugov, I.; Schmidt, T.; Linnros, J.

    2015-06-01

    A simple schematic on parallel optical detection of two-fluorophore barcode for single-molecule nanopore sensing is presented. The chosen two fluorophores, ATTO-532 and DY-521-XL, emitting in well-separated spectrum range can be excited at the same wavelength. A beam splitter was employed to separate signals from the two fluorophores and guide them to the same CCD camera. Based on a conventional microscope, sources of background in the nanopore sensing system, including membranes, compounds in buffer solution, and a detection cell was characterized. By photoluminescence excitation measurements, it turned out that silicon membrane has a negligible photoluminescence under the examined excitation from 440 nm to 560 nm, in comparison with a silicon nitrite membrane. Further, background signals from the detection cell were suppressed. Brownian motion of 450 bps DNA labelled with single ATTO-532 or DY-521-XL was successfully recorded by our optical system.

  9. Near-Infrared Ag2S Quantum Dots-Based DNA Logic Gate Platform for miRNA Diagnostics.

    PubMed

    Miao, Peng; Tang, Yuguo; Wang, Bidou; Meng, Fanyu

    2016-08-02

    Dysregulation of miRNA expression is correlated with the development and progression of many diseases. These miRNAs are regarded as promising biomarkers. However, it is challenging to measure these low abundant molecules without employing time-consuming radioactive labeling or complex amplification strategies. Here, we present a DNA logic gate platform for miRNA diagnostics with fluorescence outputs from near-infrared (NIR) Ag2S quantum dots (QDs). Carefully designed toehold exchange-mediated strand displacements with different miRNA inputs occur on a solid-state interface, which control QDs release from solid-state interface to solution, responding to multiplex information on initial miRNAs. Excellent fluorescence emission properties of NIR Ag2S QDs certify the great prospect for amplification-free and sensitive miRNA assay. We demonstrate the potential of this platform by achieving femtomolar level miRNA analysis and the versatility of a series of logic circuits computation.

  10. Bisecting Microfluidic Channels with Metallic Nanowires Fabricated by Nanoskiving.

    PubMed

    Kalkman, Gerard A; Zhang, Yanxi; Monachino, Enrico; Mathwig, Klaus; Kamminga, Machteld E; Pourhossein, Parisa; Oomen, Pieter E; Stratmann, Sarah A; Zhao, Zhiyuan; van Oijen, Antoine M; Verpoorte, Elisabeth; Chiechi, Ryan C

    2016-02-23

    This paper describes the fabrication of millimeter-long gold nanowires that bisect the center of microfluidic channels. We fabricated the nanowires by nanoskiving and then suspended them over a trench in a glass structure. The channel was sealed by bonding it to a complementary poly(dimethylsiloxane) structure. The resulting structures place the nanowires in the region of highest flow, as opposed to the walls, where it approaches zero, and expose their entire surface area to fluid. We demonstrate active functionality, by constructing a hot-wire anemometer to measure flow through determining the change in resistance of the nanowire as a function of heat dissipation at low voltage (<5 V). Further, passive functionality is demonstrated by visualizing individual, fluorescently labeled DNA molecules attached to the wires. We measure rates of flow and show that, compared to surface-bound DNA strands, elongation saturates at lower rates of flow and background fluorescence from nonspecific binding is reduced.

  11. Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

    PubMed

    Rosa, A M M; Prazeres, D M F; Paulo, P M R

    2017-06-28

    Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

  12. Double labeling of human leukemic cells using /sup 3/H-cytarabine and monoclonal antibody against bromodeoxyuridine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raza, A.; Preisler, H.D.

    A new technique using immunofluorescence and autoradiography is described, in which the DNA of cells in S phase are labeled with two different probes. This method makes it possible to study the relationship between DNA synthesis and the uptake and/or incorporation of chemotherapeutic agents into normal or neoplastic cells. An example is provided in which the incorporation of /sup 3/H-cytarabine into DNA is demonstrated to occur only in cells which were synthesizing DNA during exposure to /sup 3/H-cytarabine. Other radioactively labeled probes can be used as well.

  13. Benzofurazane as a new redox label for electrochemical detection of DNA: towards multipotential redox coding of DNA bases.

    PubMed

    Balintová, Jana; Plucnara, Medard; Vidláková, Pavlína; Pohl, Radek; Havran, Luděk; Fojta, Miroslav; Hocek, Michal

    2013-09-16

    Benzofurazane has been attached to nucleosides and dNTPs, either directly or through an acetylene linker, as a new redox label for electrochemical analysis of nucleotide sequences. Primer extension incorporation of the benzofurazane-modified dNTPs by polymerases has been developed for the construction of labeled oligonucleotide probes. In combination with nitrophenyl and aminophenyl labels, we have successfully developed a three-potential coding of DNA bases and have explored the relevant electrochemical potentials. The combination of benzofurazane and nitrophenyl reducible labels has proved to be excellent for ratiometric analysis of nucleotide sequences and is suitable for bioanalytical applications. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Portable SERS sensor for malachite green and other small dye molecules

    NASA Astrophysics Data System (ADS)

    Qiu, Suyan; Zhao, Fusheng; Li, Jingting; Shih, Wei-Chuan

    2017-02-01

    Sensitive detection of specific chemicals on site can be extremely powerful in many fields. Owing to its molecular fingerprinting capability, surface-enhanced Raman scattering has been one of the technological contenders. In this paper, we describe the novel use of DNA topological nanostructure on nanoporous gold nanoparticle (NPG-NP) array chip for chemical sensing. NPG-NP features large surface area and high-density plasmonic field enhancement known as "hotspots". Hence, NPG-NP array chip has found many applications in nanoplasmonic sensor development. This technique can provide novel label-free molecular sensing capability and enables high sensitivity and specificity detection using a portable Raman spectrometer.

  15. Laser-induced fluorescence microscopic system using an optical parametric oscillator for tunable detection in microchip analysis.

    PubMed

    Kumemura, Momoko; Odake, Tamao; Korenaga, Takashi

    2005-06-01

    A laser-induced fluorescence microscopic system based on optical parametric oscillation has been constructed as a tunable detector for microchip analysis. The detection limit of sulforhodamine B (Ex. 520 nm, Em. 570 nm) was 0.2 mumol, which was approximately eight orders of magnitude better than with a conventional fluorophotometer. The system was applied to the determination of fluorescence-labeled DNA (Ex. 494 nm, Em. 519 nm) in a microchannel and the detection limit reached a single molecule. These results showed the feasibility of this system as a highly sensitive and tunable fluorescence detector for microchip analysis.

  16. Resonant cavity enhanced multi-analyte sensing

    NASA Astrophysics Data System (ADS)

    Bergstein, David Alan

    Biological research and medicine increasingly depend on interrogating binding interactions among small segments of DNA, RNA, protein, and bio-specific small molecules. Microarray technology, which senses the affinity for target molecules in solution for a multiplicity of capturing agents fixed to a surface, has been used in biological research for gene expression profiling and in medicine for molecular biomarker detection. Label-free affinity sensing is preferable as it avoids fluorescent labeling of the target molecules, reducing test cost and variability. The Resonant Cavity Imaging Biosensor (RCIB) is a label-free optical inference based technique introduced that scales readily to high throughput and employs an optical resonant cavity to enhance sensitivity by a factor of 100 or more. Near-infrared light centered at 1512.5 nm couples resonantly through a cavity constructed from Si/SiO2 Bragg reflectors, one of which serves as the binding surface. As the wavelength is swept 5 nm, an Indium-Gallium-Arsenide digital camera monitors cavity transmittance at each pixel with resolution 128 x 128. A wavelength shift in the local resonant response of the optical cavity indicates binding. Positioning the sensing surface with respect to the standing wave pattern of the electric field within the cavity, one can control the sensitivity of the measurement to the presence of bound molecules thereby enhancing or suppressing sensitivity where appropriate. Transmitted intensity at thousands of pixel locations are recorded simultaneously in a 10 s, 5 nm scan. An initial proof-of-principle setup was constructed. A sample was fabricated with 25, 100 mum wide square regions, each with a different density of 1 mum square depressions etched 12 nm into the S1O 2 surface. The average depth of each etched region was found with 0.05 nm RMS precision when the sample remains loaded in the setup and 0.3 nm RMS precision when the sample is removed and replaced. Selective binding of the protein avidin to biotin conjugated bovine serum albumin was demonstrated with 50 pg/mm2 sensitivity. Analysis and discussion of these results provides a path toward improved performance.

  17. Selection of an optimal cysteine-containing peptide-based chelator for labeling of affibody molecules with (188)Re.

    PubMed

    Altai, Mohamed; Honarvar, Hadis; Wållberg, Helena; Strand, Joanna; Varasteh, Zohreh; Rosestedt, Maria; Orlova, Anna; Dunås, Finn; Sandström, Mattias; Löfblom, John; Tolmachev, Vladimir; Ståhl, Stefan

    2014-11-24

    Affibody molecules constitute a class of small (7 kDa) scaffold proteins that can be engineered to have excellent tumor targeting properties. High reabsorption in kidneys complicates development of affibody molecules for radionuclide therapy. In this study, we evaluated the influence of the composition of cysteine-containing C-terminal peptide-based chelators on the biodistribution and renal retention of (188)Re-labeled anti-HER2 affibody molecules. Biodistribution of affibody molecules containing GGXC or GXGC peptide chelators (where X is G, S, E or K) was compared with biodistribution of a parental affibody molecule ZHER2:2395 having a KVDC peptide chelator. All constructs retained low picomolar affinity to HER2-expressing cells after labeling. The biodistribution of all (188)Re-labeled affibody molecules was in general comparable, with the main observed difference found in the uptake and retention of radioactivity in excretory organs. The (188)Re-ZHER2:V2 affibody molecule with a GGGC chelator provided the lowest uptake in all organs and tissues. The renal retention of (188)Re-ZHER2:V2 (3.1 ± 0.5 %ID/g at 4 h after injection) was 55-fold lower than retention of the parental (188)Re-ZHER2:2395 (172 ± 32 %ID/g). We show that engineering of cysteine-containing peptide-based chelators can be used for significant improvement of biodistribution of (188)Re-labeled scaffold proteins, particularly reduction of their uptake in excretory organs. Copyright © 2014 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

  18. Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

    PubMed Central

    Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

    1982-01-01

    Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

  19. Group specific internal standard technology (GSIST) for simultaneous identification and quantification of small molecules

    DOEpatents

    Adamec, Jiri; Yang, Wen-Chu; Regnier, Fred E

    2014-01-14

    Reagents and methods are provided that permit simultaneous analysis of multiple diverse small molecule analytes present in a complex mixture. Samples are labeled with chemically identical but isotopically distince forms of the labeling reagent, and analyzed using mass spectrometry. A single reagent simultaneously derivatizes multiple small molecule analytes having different reactive functional groups.

  20. Interactions of the EcoRV restriction endonuclease with fluorescent oligodeoxynucleotides.

    PubMed

    Erskine, S G; Halford, S E

    1995-05-19

    A self-complementary dodecadeoxyribonucleotide that contains the recognition sequence for the R.EcoRV ENase was synthesised with a primary amino group at its 5' terminus. The 5' amino function was labeled with the fluorescent dye 5-[dimethylamino] napthalene-1-sulfonyl chloride. The labeled oligodeoxyribonucleotide in its duplex form was shown to be a suitable substrate for kinetic studies on the ENase and that no significant dye-DNA or dye-protein interactions occurred. Finally, the binding of R.EcoRV to the labeled DNA was followed by detecting the fluorescence resonance energy transfer between the tryptophans of the protein and the fluorescent labels of the DNA.

  1. An electrochemiluminescent DNA sensor based on nano-gold enhancement and ferrocene quenching.

    PubMed

    Yao, Wu; Wang, Lun; Wang, Haiyan; Zhang, Xiaolei; Li, Ling; Zhang, Na; Pan, Le; Xing, Nannan

    2013-02-15

    An electrochemiluminescent DNA (ECL-DNA) sensor based on nano-gold signal enhancement (i.e. gold nanoparticles, GNP) and ferrocene signal quenching was investigated. The Au electrode was first modified with GNPs through electrodeposition method, followed by subsequent immobilization of single-stranded probe DNA labeled with ruthenium complex. The resulting sensor produced a higher ECL signal due to its higher density of self-assembled probe DNAs on the surface. Upon the hybridization of probe DNA with complementary target DNA labeled with ferrocene, ECL intensity decreased significantly due to spatial separation of ECL label from the electrode surface. As a result, the ECL signal was simultaneously quenched by ferrocene. The effects of both nano-gold electrodeposition time and ferrocene on the performance of ECL-DNA sensor were studied in detail and possible reasons for these effects were suggested as well. The reported ECL-DNA sensor showed great sensitivity and may provide an alternative approach for DNA detection in diagnostics and gene analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Ultrashort laser pulse cell manipulation using nano- and micro- materials

    NASA Astrophysics Data System (ADS)

    Schomaker, Markus; Killian, Doreen; Willenbrock, Saskia; Diebold, Eric; Mazur, Eric; Bintig, Willem; Ngezahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo; Junghanß, Christian; Lubatschowski, Holger; Heisterkamp, Alexander

    2010-08-01

    The delivery of extra cellular molecules into cells is essential for cell manipulation. For this purpose genetic materials (DNA/RNA) or proteins have to overcome the impermeable cell membrane. To increase the delivery efficiency and cell viability of common methods different nano- and micro material based approaches were applied. To manipulate the cells, the membrane is in contact with the biocompatible material. Due to a field enhancement of the laser light at the material and the resulting effect the cell membrane gets perforated and extracellular molecules can diffuse into the cytoplasm. Membrane impermeable dyes, fluorescent labelled siRNA, as well as plasmid vectors encoded for GFP expression were used as an indicator for successful perforation or transfection, respectively. Dependent on the used material, perforation efficiencies over 90 % with a cell viability of about 80 % can be achieved. Additionally, we observed similar efficiencies for siRNA transfection. Due to the larger molecule size and the essential transport of the DNA into the nucleus cells are more difficult to transfect with GFP plasmid vectors. Proof of principle experiments show promising and adequate efficiencies by applying micro materials for plasmid vector transfection. For all methods a weakly focused fs laser beam is used to enable a high manipulation throughput for adherent and suspension cells. Furthermore, with these alternative optical manipulation methods it is possible to perforate the membrane of sensitive cell types such as primary and stem cells with a high viability.

  3. Oxidation of p53 through DNA Charge Transport Involves a Network of Disulfides within the DNA-Binding Domain

    PubMed Central

    2016-01-01

    Transcription factor p53 plays a critical role in the cellular response to stress stimuli. We have seen that p53 dissociates selectively from various promoter sites as a result of oxidation at long-range through DNA-mediated charge transport (CT). Here, we examine this chemical oxidation and determine the residues in p53 that are essential for oxidative dissociation, focusing on the network of cysteine residues adjacent to the DNA-binding site. Of the eight mutants studied, only the C275S mutation shows decreased affinity for the Gadd45 promoter site. However, both mutations C275S and C277S result in substantial attenuation of oxidative dissociation, with C275S causing the most severe attenuation. Differential thiol labeling was used to determine the oxidation states of cysteine residues within p53 after DNA-mediated oxidation. Reduced cysteines were iodoacetamide-labeled, whereas oxidized cysteines participating in disulfide bonds were 13C2D2-iodoacetamide-labeled. Intensities of respective iodoacetamide-modified peptide fragments were analyzed by mass spectrometry. A distinct shift in peptide labeling toward 13C2D2-iodoacetamide-labeled cysteines is observed in oxidized samples, confirming that chemical oxidation of p53 occurs at long range. All observable cysteine residues trend toward the heavy label under conditions of DNA CT, indicating the formation of multiple disulfide bonds among the cysteine network. On the basis of these data, it is proposed that disulfide formation involving C275 is critical for inducing oxidative dissociation of p53 from DNA. PMID:25584637

  4. Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

    PubMed

    Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

    2014-03-12

    The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

  5. Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

    NASA Astrophysics Data System (ADS)

    Kowalczykowski, Stephen

    2013-03-01

    We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

  6. [Stimulation of DNA molecules association with amphiphilic derivatives of 1,3-diazaadamantane containing hydrophobic side chanins].

    PubMed

    Mamaeva, O K; Gabrielian, A G; Arutiunian, G L; Bocharova, T N; Smirnova, E A; Volodin, A A; Shchelkina, A K; Kaliuzhnyĭ, D N

    2014-01-01

    Earlier, a new class of compounds--amphiphilic derivatives of 1,3-diazaadamantanes, capable of facilitating the strand exchange in the system of short oligonucleotides was revealed. Longer hydrophobic side chains of 1,3-diazaadamantanes promoted stronger acceleration of the reaction. In this study, interaction with DNA of two 1,3-diazaadamantane derivatives containing different side chains was investigated by use of optical methods. Concentration of the investigated 1,3-diazaadamantans micelles formation were determined by the means of monitoring fluorescence intensity enhancement of 1-anilinonaphtalene-8-sulphonate probe; as well as the ranges of concentrations where the compounds/water mixtures existed as true solutions. 1,3-diazaadamantanes affinity to DNA was determined with Fluorescent Intercalator Displacement (FID) approach. Significant increase in hydrodynamic volume of short DNA hairpins in the complexes with 1,3-diazaadamantanes was revealed by estimation of the fluorescence polarization of ethidium bromide probe bound to the hairpins. Intermolecular association of DNA hairpins upon binding with 1,3-diazaadamantans was confirmed by Förster resonance energy transfer in system of an equimolar mixture of fluorescently labeled with Cy-3 and Cy-5 hairpins. In this study, the number of positive charges at 1,3-diazaadamantane derivatives containing side chains of different lengths was demonstrated to affect their affinity to DNA, whereas longer length of the hydrophobic side chains ensured more efficient interaction between the DNA duplexes that may facilitate, in particular, DNA strand exchange.

  7. Sensitive and specific miRNA detection method using SplintR Ligase

    PubMed Central

    Jin, Jingmin; Vaud, Sophie; Zhelkovsky, Alexander M.; Posfai, Janos; McReynolds, Larry A.

    2016-01-01

    We describe a simple, specific and sensitive microRNA (miRNA) detection method that utilizes Chlorella virus DNA ligase (SplintR® Ligase). This two-step method involves ligation of adjacent DNA oligonucleotides hybridized to a miRNA followed by real-time quantitative PCR (qPCR). SplintR Ligase is 100X faster than either T4 DNA Ligase or T4 RNA Ligase 2 for RNA splinted DNA ligation. Only a 4–6 bp overlap between a DNA probe and miRNA was required for efficient ligation by SplintR Ligase. This property allows more flexibility in designing miRNA-specific ligation probes than methods that use reverse transcriptase for cDNA synthesis of miRNA. The qPCR SplintR ligation assay is sensitive; it can detect a few thousand molecules of miR-122. For miR-122 detection the SplintR qPCR assay, using a FAM labeled double quenched DNA probe, was at least 40× more sensitive than the TaqMan assay. The SplintR method, when coupled with NextGen sequencing, allowed multiplex detection of miRNAs from brain, kidney, testis and liver. The SplintR qPCR assay is specific; individual let-7 miRNAs that differ by one nucleotide are detected. The rapid kinetics and ability to ligate DNA probes hybridized to RNA with short complementary sequences makes SplintR Ligase a useful enzyme for miRNA detection. PMID:27154271

  8. Nanogold-functionalized DNAzyme concatamers with redox-active intercalators for quadruple signal amplification of electrochemical immunoassay.

    PubMed

    Zhou, Jun; Lai, Wenqiang; Zhuang, Junyang; Tang, Juan; Tang, Dianping

    2013-04-10

    A novel and in situ amplified immunoassay strategy with quadruple signal amplification was designed for highly efficient electrochemical detection of low-abundance proteins (carcinoembryonic antigen, CEA, as a model) by using nanogold-functionalized DNAzyme concatamers with redox-active intercalators. To construct such an in situ amplification system, streptavidin-labeled gold nanoparticles (AuNP-SA) were initially used for the labelling of initiator strands (S0) and detection antibody (mAb2) with a large ratio (mAb2-AuNP-S0), and then two auxiliary DNA strands S1 and S2 were designed for in situ propagation of DNAzyme concatamers with the hemin/G-quadruplex format. The quadruple signal amplification was implemented by using the avidin-biotin chemistry, nanogold labels, DNA concatamers, and DNAzymes. In the presence of target CEA, the sandwiched immunocomplex was formed between the immobilized primary antibodies on the electrode and the conjugated detection antibodies on the mAb2-AuNP-S0. The carried S0 initiator strands could progress a chain reaction of hybridization events between alternating S1/S2 DNA strands to form a nicked double-helix. Upon addition of hemin, the hemin-binding aptamers could be bound to form the hemin/G-quadruplex-based DNAzymes. The formed double-helix DNA polymers could cause the intercalation of numerous electroactive methylene blue molecules. During the electrochemical measurement, the formed DNAzymes could catalyze the reduction of H2O2 in the solution to amplify the electrochemical signal of the intercalated methylene blue. Under optimal conditions, the electrochemical immunoassay exhibited a wide dynamic range of 1.0 fg mL(-1) to 20 ng mL(-1) toward CEA standards with a low detection limit of 0.5 fg mL(-1). Intra-assay and inter-assay coefficients of variation (CV) were less than 8.5% and 11.5%, respectively. No significant differences at the 0.05 significance level were encountered in the analysis of 14 clinical serum specimens between the developed immunoassay and commercialized electrochemiluminescent (ECL) method for detection of CEA.

  9. Observing DNA in live cells.

    PubMed

    Weiss, Lucien E; Naor, Tal; Shechtman, Yoav

    2018-06-19

    The structural organization and dynamics of DNA are known to be of paramount importance in countless cellular processes, but capturing these events poses a unique challenge. Fluorescence microscopy is well suited for these live-cell investigations, but requires attaching fluorescent labels to the species under investigation. Over the past several decades, a suite of techniques have been developed for labeling and imaging DNA, each with various advantages and drawbacks. Here, we provide an overview of the labeling and imaging tools currently available for visualizing DNA in live cells, and discuss their suitability for various applications. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  10. Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

    PubMed

    Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

    2011-02-09

    Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

  11. Tagmentation on Microbeads: Restore Long-Range DNA Sequence Information Using Next Generation Sequencing with Library Prepared by Surface-Immobilized Transposomes.

    PubMed

    Chen, He; Yao, Jiacheng; Fu, Yusi; Pang, Yuhong; Wang, Jianbin; Huang, Yanyi

    2018-04-11

    The next generation sequencing (NGS) technologies have been rapidly evolved and applied to various research fields, but they often suffer from losing long-range information due to short library size and read length. Here, we develop a simple, cost-efficient, and versatile NGS library preparation method, called tagmentation on microbeads (TOM). This method is capable of recovering long-range information through tagmentation mediated by microbead-immobilized transposomes. Using transposomes with DNA barcodes to identically label adjacent sequences during tagmentation, we can restore inter-read connection of each fragment from original DNA molecule by fragment-barcode linkage after sequencing. In our proof-of-principle experiment, more than 4.5% of the reads are linked with their adjacent reads, and the longest linkage is over 1112 bp. We demonstrate TOM with eight barcodes, but the number of barcodes can be scaled up by an ultrahigh complexity construction. We also show this method has low amplification bias and effectively fits the applications to identify copy number variations.

  12. DNA Sequencing by Capillary Electrophoresis

    PubMed Central

    Karger, Barry L.; Guttman, Andras

    2009-01-01

    Sequencing of human and other genomes has been at the center of interest in the biomedical field over the past several decades and is now leading toward an era of personalized medicine. During this time, DNA sequencing methods have evolved from the labor intensive slab gel electrophoresis, through automated multicapillary electrophoresis systems using fluorophore labeling with multispectral imaging, to the “next generation” technologies of cyclic array, hybridization based, nanopore and single molecule sequencing. Deciphering the genetic blueprint and follow-up confirmatory sequencing of Homo sapiens and other genomes was only possible by the advent of modern sequencing technologies that was a result of step by step advances with a contribution of academics, medical personnel and instrument companies. While next generation sequencing is moving ahead at break-neck speed, the multicapillary electrophoretic systems played an essential role in the sequencing of the Human Genome, the foundation of the field of genomics. In this prospective, we wish to overview the role of capillary electrophoresis in DNA sequencing based in part of several of our articles in this journal. PMID:19517496

  13. Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

    PubMed

    Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

    2016-05-01

    The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.

  14. Fine tuning of nanopipettes using atomic layer deposition for single molecule sensing.

    PubMed

    Sze, Jasmine Y Y; Kumar, Shailabh; Ivanov, Aleksandar P; Oh, Sang-Hyun; Edel, Joshua B

    2015-07-21

    Nanopipettes are an attractive single-molecule tool for identification and characterisation of nucleic acids and proteins in solutions. They enable label-free analysis and reveal individual molecular properties, which are generally masked by ensemble averaging. Having control over the pore dimensions is vital to ensure that the dimensions of the molecules being probed match those of the pore for optimization of the signal to noise. Although nanopipettes are simple and easy to fabricate, challenges exist, especially when compared to more conventional solid-state analogues. For example, a sub-20 nm pore diameter can be difficult to fabricate and the batch-to-batch reproducibility is often poor. To improve on this limitation, atomic layer deposition (ALD) is used to deposit ultrathin layers of alumina (Al2O3) on the surface of the quartz nanopipettes enabling sub-nm tuning of the pore dimensions. Here, Al2O3 with a thickness of 8, 14 and 17 nm was deposited onto pipettes with a starting pore diameter of 75 ± 5 nm whilst a second batch had 5 and 8 nm Al2O3 deposited with a starting pore diameter of 25 ± 3 nm respectively. This highly conformal process coats both the inner and outer surfaces of pipettes and resulted in the fabrication of pore diameters as low as 7.5 nm. We show that Al2O3 modified pores do not interfere with the sensing ability of the nanopipettes and can be used for high signal-to-noise DNA detection. ALD provides a quick and efficient (batch processing) for fine-tuning nanopipettes for a broad range of applications including the detection of small biomolecules like RNA, aptamers and DNA-protein interactions at the single molecule level.

  15. Fluorescence resonance energy transfer between green fluorescent protein and doxorubicin enabled by DNA nanotechnology.

    PubMed

    Heger, Zbynek; Kominkova, Marketa; Cernei, Natalia; Krejcova, Ludmila; Kopel, Pavel; Zitka, Ondrej; Adam, Vojtech; Kizek, Rene

    2014-12-01

    DNA nanotechnology is a rapidly growing research area, where DNA may be used for wide range of applications such as construction of nanodevices serving for large scale of diverse purposes. Likewise a panel of various purified fluorescent proteins is investigated for their ability to emit their typical fluorescence spectra under influence of particular excitation. Hence these proteins may form ideal donor molecules for assembly of fluorescence resonance emission transfer (FRET) constructions. To extend the application possibilities of fluorescent proteins, while using DNA nanotechnology, we developed nanoconstruction comprising green fluorescent protein (GFP) bound onto surface of surface active nanomaghemite and functionalized with gold nanoparticles. We took advantage of natural affinity between gold and thiol moieties, which were modified to bind DNA fragment. Finally we enclosed doxorubicin into fullerene cages. Doxorubicin intercalated in DNA fragment bound on the particles and thus we were able to connect these parts together. Because GFP behaved as a donor and doxorubicin as an acceptor using excitation wavelength for GFP (395 nm) in emission wavelength of doxorubicin (590 nm) FRET was observed. This nanoconstruction may serve as a double-labeled transporter of doxorubicin guided by force of external magnetic force owing to the presence of nanomaghemite. Further nanomaghemite offers the possibility of using this technology for thermotherapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  17. DNA-Based Single-Molecule Electronics: From Concept to Function.

    PubMed

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  18. DNA-Based Single-Molecule Electronics: From Concept to Function

    PubMed Central

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  19. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

  20. An evolution based biosensor receptor DNA sequence generation algorithm.

    PubMed

    Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

    2010-01-01

    A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

  1. Digital Microarrays: Single-Molecule Readout with Interferometric Detection of Plasmonic Nanorod Labels.

    PubMed

    Sevenler, Derin; Daaboul, George G; Ekiz Kanik, Fulya; Ünlü, Neşe Lortlar; Ünlü, M Selim

    2018-05-21

    DNA and protein microarrays are a high-throughput technology that allow the simultaneous quantification of tens of thousands of different biomolecular species. The mediocre sensitivity and limited dynamic range of traditional fluorescence microarrays compared to other detection techniques have been the technology's Achilles' heel and prevented their adoption for many biomedical and clinical diagnostic applications. Previous work to enhance the sensitivity of microarray readout to the single-molecule ("digital") regime have either required signal amplifying chemistry or sacrificed throughput, nixing the platform's primary advantages. Here, we report the development of a digital microarray which extends both the sensitivity and dynamic range of microarrays by about 3 orders of magnitude. This technique uses functionalized gold nanorods as single-molecule labels and an interferometric scanner which can rapidly enumerate individual nanorods by imaging them with a 10× objective lens. This approach does not require any chemical signal enhancement such as silver deposition and scans arrays with a throughput similar to commercial fluorescence scanners. By combining single-nanoparticle enumeration and ensemble measurements of spots when the particles are very dense, this system achieves a dynamic range of about 6 orders of magnitude directly from a single scan. As a proof-of-concept digital protein microarray assay, we demonstrated detection of hepatitis B virus surface antigen in buffer with a limit of detection of 3.2 pg/mL. More broadly, the technique's simplicity and high-throughput nature make digital microarrays a flexible platform technology with a wide range of potential applications in biomedical research and clinical diagnostics.

  2. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    PubMed

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  3. Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

    PubMed

    Ares, Manuel

    2014-10-01

    This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

  4. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

    PubMed

    Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

    2015-11-15

    Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A bioanalytical microsystem for protein and DNA sensing based on a monolithic silicon optoelectronic transducer

    NASA Astrophysics Data System (ADS)

    Misiakos, K.; Petrou, P. S.; Kakabakos, S. E.; Ruf, H. H.; Ehrentreich-Förster, E.; Bier, F. F.

    2005-01-01

    A bioanalytical microsystem that is based on a monolithic silicon optical transducer and a microfluidic module and it is appropriate for real-time sensing of either DNA or protein analytes is presented. The optical transducer monolithically integrates silicon avalanche diodes as light sources, silicon nitride optical fibers and detectors and efficiently intercouples these optical elements through a self-alignment technique. After hydrophilization and silanization of the transducer surface, the biomolecular probes are immobilized through physical adsorption. Detection is performed through reaction of the immobilized biomolecules with gold nanoparticle labeled counterpart molecules. The binding of these molecules within the evanescent field at the surface of the optical fiber cause attenuated total reflection of the waveguided modes and reduction of the detector photocurrent. Using the developed microsystem, determination of single nucleotide polymorphism (SNP) in the gene of the human phenol sulfotransferase SULT1A1 was achieved. Full-matching hybrid resulted in 4-5 times higher signals compared to the mismatched hybrid after hybridization and dissociation processes. The protein sensing abilities of the developed microsystem were also investigated through a non-competitive assay for the determination of the MB isoform of creatine kinase enzyme (CK-MB) that is a widely used cardiac marker.

  6. Development of analytical method for ultrasensitive detection of salbutamol utilizing DNA labeled-immunoprobe.

    PubMed

    Lei, Yajing; Li, Xiaoyi; Akash, Muhammad Sajid Hamid; Zhou, Lifang; Tang, Xiaojing; Shi, Weixing; Liu, Zhiming; Chen, Shuqing

    2015-03-25

    Salbutamol (SAL) is known as quick-acting β-2 receptor agonist and its use in humans for pulmonary diseases and/or in animal feed is limited because of associated potential hazardous effects on health. Several techniques are available for the detection of SAL, but are expensive and time consuming. Here for the first time, a novel pre-assembled DNA immunoprobe-based immuno-PCR assay was developed to investigate the levels of SAL in human urine samples and compared the proposed immuno-PCR assay for the detection of SAL with that of direct competitive ELISA. Under the optimized conditions, the assay showed a linear range over seven orders of magnitude, whereas the limit of detection of SAL in buffer was found to be 21 fg/mL. Current immuno-PCR assay exhibited a 300-fold better detection limit for SAL as compared to one achieved with direct competitive ELISA using the same antibody. In conclusion, it has been found that the developed method is highly sensitive and simple method that can significantly enhance the detection sensitivity for small molecules. Moreover it can be modified and used for detecting other small molecules and/or chemicals that exist in the environment and are responsible for the environmental pollution. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Consistent assignment of the vibrations of symmetric and asymmetric para-disubstituted benzene molecules

    NASA Astrophysics Data System (ADS)

    Andrejeva, Anna; Gardner, Adrian M.; Tuttle, William D.; Wright, Timothy G.

    2016-03-01

    We give a description of the phenyl-ring-localized vibrational modes of the ground states of the para-disubstituted benzene molecules including both symmetric and asymmetric cases. In line with others, we quickly conclude that the use of Wilson mode labels is misleading and ambiguous; we conclude the same regarding the related ones of Varsányi. Instead we label the modes consistently based upon the Mulliken (Herzberg) method for the modes of para-difluorobenzene (pDFB). Since we wish the labelling scheme to cover both symmetrically- and asymmetrically-substituted molecules, we apply the Mulliken labelling under C2v symmetry. By studying the variation of the vibrational wavenumbers with mass of the substituent, we are able to identify the corresponding modes across a wide range of molecules and hence provide consistent assignments. Particularly interesting are pairs of vibrations that evolve from in- and out-of-phase motions in pDFB to more localized modes in asymmetric molecules. We consider the para isomers of the following: the symmetric dihalobenzenes, xylene, hydroquinone, the asymmetric dihalobenzenes, halotoluenes, halophenols and cresol.

  8. Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

    NASA Astrophysics Data System (ADS)

    Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

    2016-07-01

    The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

  9. Microchannel DNA Sequencing by End-Labelled Free Solution Electrophoresis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barron, A.

    2005-09-29

    The further development of End-Labeled Free-Solution Electrophoresis will greatly simplify DNA separation and sequencing on microfluidic devices. The development and optimization of drag-tags is critical to the success of this research.

  10. Nanopore detection of DNA molecules in crowded neutral polymer solutions

    NASA Astrophysics Data System (ADS)

    Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven

    Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.

  11. Single molecule techniques in DNA repair: A primer

    PubMed Central

    Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.

    2016-01-01

    A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596

  12. Optical Microfibre Based Photonic Components and Their Applications in Label-Free Biosensing

    PubMed Central

    Wang, Pengfei; Bo, Lin; Semenova, Yuliya; Farrell, Gerald; Brambilla, Gilberto

    2015-01-01

    Optical microfibre photonic components offer a variety of enabling properties, including large evanescent fields, flexibility, configurability, high confinement, robustness and compactness. These unique features have been exploited in a range of applications such as telecommunication, sensing, optical manipulation and high Q resonators. Optical microfibre biosensors, as a class of fibre optic biosensors which rely on small geometries to expose the evanescent field to interact with samples, have been widely investigated. Due to their unique properties, such as fast response, functionalization, strong confinement, configurability, flexibility, compact size, low cost, robustness, ease of miniaturization, large evanescent field and label-free operation, optical microfibres based biosensors seem a promising alternative to traditional immunological methods for biomolecule measurements. Unlabeled DNA and protein targets can be detected by monitoring the changes of various optical transduction mechanisms, such as refractive index, absorption and surface plasmon resonance, since a target molecule is capable of binding to an immobilized optical microfibre. In this review, we critically summarize accomplishments of past optical microfibre label-free biosensors, identify areas for future research and provide a detailed account of the studies conducted to date for biomolecules detection using optical microfibres. PMID:26287252

  13. An exonuclease I-based label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection with a wide concentration range.

    PubMed

    Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng

    2015-01-15

    A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.

  14. Optical Microfibre Based Photonic Components and Their Applications in Label-Free Biosensing.

    PubMed

    Wang, Pengfei; Bo, Lin; Semenova, Yuliya; Farrell, Gerald; Brambilla, Gilberto

    2015-07-22

    Optical microfibre photonic components offer a variety of enabling properties, including large evanescent fields, flexibility, configurability, high confinement, robustness and compactness. These unique features have been exploited in a range of applications such as telecommunication, sensing, optical manipulation and high Q resonators. Optical microfibre biosensors, as a class of fibre optic biosensors which rely on small geometries to expose the evanescent field to interact with samples, have been widely investigated. Due to their unique properties, such as fast response, functionalization, strong confinement, configurability, flexibility, compact size, low cost, robustness, ease of miniaturization, large evanescent field and label-free operation, optical microfibres based biosensors seem a promising alternative to traditional immunological methods for biomolecule measurements. Unlabeled DNA and protein targets can be detected by monitoring the changes of various optical transduction mechanisms, such as refractive index, absorption and surface plasmon resonance, since a target molecule is capable of binding to an immobilized optical microfibre. In this review, we critically summarize accomplishments of past optical microfibre label-free biosensors, identify areas for future research and provide a detailed account of the studies conducted to date for biomolecules detection using optical microfibres.

  15. Fluorescence Microscopy of Nanochannel-Confined DNA.

    PubMed

    Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

    2018-01-01

    Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

  16. M-DNA: a self-assembling molecular wire for nanoelectronics and biosensing.

    PubMed

    Wettig, Shawn D; Li, Chen-Zhong; Long, Yi-Tao; Kraatz, Heinz-Bernhard; Lee, Jeremy S

    2003-01-01

    M-DNA is a complex between divalent metal ions such as Zn2+ and duplex DNA which forms at pH 8.5. Unlike B-DNA, M-DNA does not bind ethidium so that M-DNA formation can be monitored conveniently by an ethidium fluorescence assay. M-DNA was shown to be a better conductor than B-DNA by fluorometric measurements of electron transport in donor-acceptor labelled duplexes; by direct conductivity measurements of M-DNA bound between gold electrodes and by cyclic voltammetric studies on ferrocene labelled duplexes attached to gold microelectrodes. As is the case with B-DNA, M-DNA can self-assemble into a variety of structures and is anticipated to find widespread use in nanoelectronics and biosensing.

  17. Genetics Home Reference: mitochondrial neurogastrointestinal encephalopathy disease

    MedlinePlus

    ... modification) is used as a building block of DNA . Thymidine phosphorylase breaks down thymidine into smaller molecules, ... molecule is damaging to a particular kind of DNA known as mitochondrial DNA or mtDNA. Mitochondria are ...

  18. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  19. DNA recombination activity in soybean mitochondria.

    PubMed

    Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L

    2006-02-17

    Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.

  20. The ultrastructure of subgingival dental plaque, revealed by high-resolution field emission scanning electron microscopy.

    PubMed

    Holliday, Richard; Preshaw, Philip M; Bowen, Leon; Jakubovics, Nicholas S

    2015-01-01

    To explore the ultrastructure of subgingival dental plaque using high-resolution field emission scanning electron microscopy (FE-SEM) and to investigate whether extracellular DNA (eDNA) could be visualised in ex vivo samples. Ten patients were recruited who fulfilled the inclusion criteria (teeth requiring extraction with radiographic horizontal bone loss of over 50% and grade II/III mobility). In total, 12 teeth were extracted using a minimally traumatic technique. Roots were sectioned using a dental air turbine handpiece, under water cooling to produce 21 samples. Standard fixation and dehydration protocols were followed. For some samples, gold-labelled anti-DNA antibodies were applied before visualising biofilms by FE-SEM. High-resolution FE-SEMs of subgingival biofilm were obtained in 90% of the samples. The sectioning technique left dental plaque biofilms undisturbed. Copious amounts of extracellular material were observed in the plaque, which may have been eDNA as they had a similar appearance to labelled eDNA from in vitro studies. There was also evidence of membrane vesicles and open-ended tubular structures. Efforts to label eDNA with immune-gold antibodies were unsuccessful and eDNA was not clearly labelled. High-resolution FE-SEM images were obtained of undisturbed subgingival ex vivo dental plaque biofilms. Important structural features were observed including extracellular polymeric material, vesicles and unusual open tubule structures that may be remnants of lysed cells. The application of an eDNA immune-gold-labelling technique, previously used successfully in in vitro samples, did not clearly identify eDNA in ex vivo samples. Further studies are needed to characterise the molecular composition of the observed extracellular matrix material.

  1. The ultrastructure of subgingival dental plaque, revealed by high-resolution field emission scanning electron microscopy

    PubMed Central

    Holliday, Richard; Preshaw, Philip M; Bowen, Leon; Jakubovics, Nicholas S

    2015-01-01

    Objectives/Aims: To explore the ultrastructure of subgingival dental plaque using high-resolution field emission scanning electron microscopy (FE-SEM) and to investigate whether extracellular DNA (eDNA) could be visualised in ex vivo samples. Materials and Methods: Ten patients were recruited who fulfilled the inclusion criteria (teeth requiring extraction with radiographic horizontal bone loss of over 50% and grade II/III mobility). In total, 12 teeth were extracted using a minimally traumatic technique. Roots were sectioned using a dental air turbine handpiece, under water cooling to produce 21 samples. Standard fixation and dehydration protocols were followed. For some samples, gold-labelled anti-DNA antibodies were applied before visualising biofilms by FE-SEM. Results: High-resolution FE-SEMs of subgingival biofilm were obtained in 90% of the samples. The sectioning technique left dental plaque biofilms undisturbed. Copious amounts of extracellular material were observed in the plaque, which may have been eDNA as they had a similar appearance to labelled eDNA from in vitro studies. There was also evidence of membrane vesicles and open-ended tubular structures. Efforts to label eDNA with immune-gold antibodies were unsuccessful and eDNA was not clearly labelled. Conclusions: High-resolution FE-SEM images were obtained of undisturbed subgingival ex vivo dental plaque biofilms. Important structural features were observed including extracellular polymeric material, vesicles and unusual open tubule structures that may be remnants of lysed cells. The application of an eDNA immune-gold-labelling technique, previously used successfully in in vitro samples, did not clearly identify eDNA in ex vivo samples. Further studies are needed to characterise the molecular composition of the observed extracellular matrix material. PMID:29607057

  2. An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.

    PubMed

    Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat

    2018-03-01

    A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.

  3. Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

    PubMed

    Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

    2015-01-15

    This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Recombinant DNA encoding a desulfurization biocatalyst

    DOEpatents

    Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

    1994-01-01

    This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

  5. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  6. Flow cytometric measurement of total DNA and incorporated halodeoxyuridine

    DOEpatents

    Dolbeare, F.A.; Gray, J.W.

    1983-10-18

    A method for the simultaneous flow cylometric measurement of total cellular DNA content and of the uptake of DNA precursors as a measure of DNA synthesis during various phases of the cell cycle in normal and malignant cells in vitro and in vivo is described. The method comprises reacting cells with labelled halodeoxyuridine (HdU), partially denaturing cellular DNA, adding to the reaction medium monoclonal antibodies (mabs) reactive with HdU, reacting the bound mabs with a second labelled antibody, incubating the mixture with a DNA stain, and measuring simultaneously the intensity of the DNA stain as a measure of the total cellular DNA and the HdU incorporated as a measure of DNA synthesis. (ACR)

  7. Functional helicoidal model of DNA molecule with elastic nonlinearity

    NASA Astrophysics Data System (ADS)

    Tseytlin, Y. M.

    2013-06-01

    We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

  8. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, Huamin; Smith, Lloyd M.

    1997-01-01

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

  9. Characterization of radiation damage to DNA by reaction with borohydride.

    PubMed Central

    Schellenberg, K A; Shaeffer, J; Nichols, R K; Gates, D

    1981-01-01

    Irradiation of aqueous solutions of native calf thymus DNA with x-rays produced functional groups that reacted with sodium borohydride. The DNA was labeled with tritium from NaB3H4 to the extent of 2.0 x 10(-10) atom/dalton/rad. The presence of cysteamine or other radical scavengers, or saturation of the solution with nitrogen during irradiation decreased the labeling. After mild acid hydrolysis, the major tritium-containing moiety was identical with 2,3-dihydroxy-2-methylpropanoic acid in all chromatographic systems tested. The suggested mechanism of labeling involved reduction by borohydride of the potential aldehyde at carbon 6 of thymine glycol residues present in the irradiated DNA. PMID:7279674

  10. Spot Surface Labeling of Magnetic Microbeads and Application in Biological Force Measurements

    NASA Astrophysics Data System (ADS)

    Estes, Ashley; O'Brien, E. Tim; Hill, David; Superfine, Richard

    2006-11-01

    Biological force measurements on single molecules and macromolecular structures often use microbeads for the application of force. These techniques are often complicated by multiple attachments and nonspecific binding. In one set of experiments, we are applying a magnetic force microscope that allows us to pull on magnetic beads attached to ciliated human bronchial epithelial cells. These experiments provide a means to measure the stall force of cilia and understand how cilia propel fluids. However, because we are using beads with diameters of one and 2.8 microns, and the diameter of human airway cilia is approximately 200 nm, we cannot be assured that the bead is bound to a single cilium. To address this, we have developed a sputter coating technique to block the biotin binding capability of the streptavidin labeled bead over its entire surface except for a small spot. These beads may also have applications in other biological experiments such as DNA force experiments in which binding of a single target to an individual bead is critical.

  11. Linearisation of λDNA molecules by instantaneous variation of the trapping electrode voltage inside a micro-channel

    NASA Astrophysics Data System (ADS)

    Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki

    2015-04-01

    Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kitchin, Kirk T.; Wallace, Kathleen

    A large amount of evidence suggests that arsenicals act via oxidative stress in causing cancer in humans and experimental animals. It is possible that arsenicals could bind in situ close to nuclear DNA followed by Haber-Weiss type oxidative DNA damage. Therefore, we tested this hypothesis by using radioactive {sup 73}As labeled arsenite and vacuum filtration methodology to determine the binding affinity and capacity of {sup 73}As arsenite to calf thymus DNA and Type 2A unfractionated histones, histone H3, H4 and horse spleen ferritin. Arsenicals are known to release redox active Fe from ferritin. At concentrations up to about 1 mM,more » neither DNA nor any of the three proteins studied, Type II-A histones, histone H3, H4 or ferritin, bound radioactive arsenite in a specific manner. Therefore, it appears highly unlikely that initial in situ binding of trivalent arsenicals, followed by in situ oxidative DNA damage, can account for arsenic's carcinogenicity. This experimental evidence (lack of arsenite binding to DNA, histone Type II-A and histone H3, H4) does not rule out other possible oxidative stress modes of action for arsenic such as (a) diffusion of longer lived oxidative stress molecules, such as H{sub 2}O{sub 2} into the nucleus and ensuing oxidative damage, (b) redox chemistry by unbound arsenicals in the nucleus, or (c) arsenical-induced perturbations in Fe, Cu or other metals which are already known to oxidize DNA in vitro and in vivo.« less

  13. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    PubMed

    Zhu, Jie; Feng, Xiaolu; Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  14. Identifying DNA methylation in a nanochannel

    NASA Astrophysics Data System (ADS)

    Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu

    2016-01-01

    DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.

  15. Recombinant DNA encoding a desulfurization biocatalyst

    DOEpatents

    Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

    1994-10-18

    This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

  16. Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

    NASA Astrophysics Data System (ADS)

    Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

    2003-11-01

    Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

  17. Parallel Arrays of Geometric Nanowells for Assembling Curtains of DNA with Controlled Lateral Dispersion

    PubMed Central

    Visnapuu, Mari-Liis; Fazio, Teresa; Wind, Shalom; Greene, Eric C.

    2009-01-01

    The analysis of individual molecules is evolving into an important tool for biological research, and presents conceptually new ways of approaching experimental design strategies. However, more robust methods are required if these technologies are to be made broadly available to the biological research community. To help achieve this goal we have combined nanofabrication techniques with single-molecule optical microscopy for assembling and visualizing curtains comprised of thousands of individual DNA molecules organized at engineered diffusion barriers on a lipid bilayer-coated surface. Here we present an important extension of this technology that implements geometric barrier patterns comprised of thousands of nanoscale wells that can be loaded with single molecules of DNA. We show that these geometric nanowells can be used to precisely control the lateral distribution of the individual DNA molecules within curtains assembled along the edges of the engineered barrier patterns. The individual molecules making up the DNA curtain can be separated from one another by a user-defined distance dictated by the dimensions of the nanowells. We demonstrate the broader utility of these patterned DNA curtains in a novel, real time restriction assay that we refer to as dynamic optical restriction mapping, which can be used to rapidly identify entire sets of cleavage sites within a large DNA molecule. PMID:18788761

  18. Escherichia coli cell-free protein synthesis and isotope labeling of mammalian proteins.

    PubMed

    Terada, Takaho; Yokoyama, Shigeyuki

    2015-01-01

    This chapter describes the cell-free protein synthesis method, using an Escherichia coli cell extract. This is a cost-effective method for milligram-scale protein production and is particularly useful for the production of mammalian proteins, protein complexes, and membrane proteins that are difficult to synthesize by recombinant expression methods, using E. coli and eukaryotic cells. By adjusting the conditions of the cell-free method, zinc-binding proteins, disulfide-bonded proteins, ligand-bound proteins, etc., may also be produced. Stable isotope labeling of proteins can be accomplished by the cell-free method, simply by using stable isotope-labeled amino acid(s) in the cell-free reaction. Moreover, the cell-free protein synthesis method facilitates the avoidance of stable isotope scrambling and dilution over the recombinant expression methods and is therefore advantageous for amino acid-selective stable isotope labeling. Site-specific stable isotope labeling is also possible with a tRNA molecule specific to the UAG codon. By the cell-free protein synthesis method, coupled transcription-translation is performed from a plasmid vector or a PCR-amplified DNA fragment encoding the protein. A milligram quantity of protein can be produced with a milliliter-scale reaction solution in the dialysis mode. More than a thousand solution structures have been determined by NMR spectroscopy for uniformly labeled samples of human and mouse functional domain proteins, produced by the cell-free method. Here, we describe the practical aspects of mammalian protein production by the cell-free method for NMR spectroscopy. © 2015 Elsevier Inc. All rights reserved.

  19. Superresolution microscopy with transient binding.

    PubMed

    Molle, Julia; Raab, Mario; Holzmeister, Susanne; Schmitt-Monreal, Daniel; Grohmann, Dina; He, Zhike; Tinnefeld, Philip

    2016-06-01

    For single-molecule localization based superresolution, the concentration of fluorescent labels has to be thinned out. This is commonly achieved by photophysically or photochemically deactivating subsets of molecules. Alternatively, apparent switching of molecules can be achieved by transient binding of fluorescent labels. Here, a diffusing dye yields bright fluorescent spots when binding to the structure of interest. As the binding interaction is weak, the labeling is reversible and the dye ligand construct diffuses back into solution. This approach of achieving superresolution by transient binding (STB) is reviewed in this manuscript. Different realizations of STB are discussed and compared to other localization-based superresolution modalities. We propose the development of labeling strategies that will make STB a highly versatile tool for superresolution microscopy at highest resolution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. DNA-labeled micro- and nanoparticles: a new approach to study contaminant transport in the subsurface

    NASA Astrophysics Data System (ADS)

    McNew, C.; Wang, C.; Kocis, T. N.; Murphy, N. P.; Dahlke, H. E.

    2017-12-01

    Though our understanding of contaminant behavior in the subsurface has improved, our ability to measure and predict complex contaminant transport pathways at hillslope to watershed scales is still lacking. By utilizing bio-molecular nanotechnology developed for nano-medicines and drug delivery, we are able to produce DNA-labeled micro- and nanoparticles for use in a myriad of environmental systems. Control of the fabrication procedure allows us to produce particles of custom size, charge, and surface functionality to mimic the transport properties of the particulate contaminant or colloid of interest. The use of custom sequenced DNA allows for the fabrication of an enormous number of unique particle labels (approximately 1.61 x 1060 unique sequences) and the ability to discern between varied spatial and temporal applications, or the transport effect of varied particle size, charge, or surface properties. To date, this technology has been utilized to study contaminant transport from lab to field scales, including surface and open channel flow applications, transport in porous media, soil retention, and even subglacial flow pathways. Here, we present the technology for production and detection of the DNA-labeled particles along with the results from a current hillslope study at the Sierra Foothills Research and Extension Center (SFREC). This field study utilizes spatial and temporal variations in DNA-labeled particle applications to identify subsurface pollutant transport pathways through the four distinct soil horizons present at the SFREC site. Results from this and previous studies highlight the tremendous potential of the DNA-labeled particle technology for studying contaminant transport through the subsurface.

  1. DNA-magnetic bead detection using disposable cards and the anisotropic magnetoresistive sensor

    NASA Astrophysics Data System (ADS)

    Hien, L. T.; Quynh, L. K.; Huyen, V. T.; Tu, B. D.; Hien, N. T.; Phuong, D. M.; Nhung, P. H.; Giang, D. T. H.; Duc, N. H.

    2016-12-01

    A disposable card incorporating specific DNA probes targeting the 16 S rRNA gene of Streptococcus suis was developed for magnetically labeled target DNA detection. A single-stranded target DNA was hybridized with the DNA probe on the SPA/APTES/PDMS/Si as-prepared card, which was subsequently magnetically labeled with superparamagnetic beads for detection using an anisotropic magnetoresistive (AMR) sensor. An almost linear response between the output signal of the AMR sensor and amount of single-stranded target DNA varied from 4.5 to 18 pmol was identified. From the sensor output signal response towards the mass of magnetic beads which were directly immobilized on the disposable card surface, the limit of detection was estimated about 312 ng ferrites, which corresponds to 3.8 μemu. In comparison with DNA detection by conventional biosensor based on magnetic bead labeling, disposable cards are featured with higher efficiency and performances, ease of use and less running cost with respects to consumables for biosensor in biomedical analysis systems operating with immobilized bioreceptor.

  2. Agarose gel electrophoresis for the separation of DNA fragments.

    PubMed

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.

  3. Fluorescein isothiocyanate-labeled human plasma fibronectin in extracellular matrix remodeling.

    PubMed

    Hoffmann, Celine; Leroy-Dudal, Johanne; Patel, Salima; Gallet, Olivier; Pauthe, Emmanuel

    2008-01-01

    Fluorescein isothiocyanate (FITC) is a well-known probe for labeling biologically relevant proteins. However, the impact of the labeling procedure on protein structure and biological activities remains unclear. In this work, FITC-labeled human plasma fibronectin (Fn) was developed to gain insight into the dynamic relationship between cells and Fn. The similarities and differences concerning the structure and function between Fn-FITC and standard Fn were evaluated using biochemical as well as cellular approaches. By varying the FITC/Fn ratio, we demonstrated that overlabeling (>10 FITC molecules/Fn molecule) induces probe fluorescence quenching, protein aggregation, and cell growth modifications. A correct balance between reliable fluorescence for detection and no significant modifications to structure and biological function compared with standard Fn was obtained with a final ratio of 3 FITC molecules per Fn molecule (Fn-FITC3). Fn-FITC3, similar to standard Fn, is correctly recruited into the cell matrix network. Also, Fn-FITC3 is proposed to be a powerful molecular tool to investigate Fn organization and cellular behavior concomitantly.

  4. Drug-DNA interactions at single molecule level: A view with optical tweezers

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan

    Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

  5. Increasing the Analytical Sensitivity by Oligonucleotides Modified with Para- and Ortho-Twisted Intercalating Nucleic Acids – TINA

    PubMed Central

    Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm

    2011-01-01

    The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Fa-Ke; Basu, Srinjan; Igras, Vivien

    Label-free DNA imaging is highly desirable in biology and medicine to perform live imaging without affecting cell function and to obtain instant histological tissue examination during surgical procedures. Here we show a label-free DNA imaging method with stimulated Raman scattering (SRS) microscopy for visualization of the cell nuclei in live animals and intact fresh human tissues with subcellular resolution. Relying on the distinct Raman spectral features of the carbon-hydrogen bonds in DNA, the distribution of DNA is retrieved from the strong background of proteins and lipids by linear decomposition of SRS images at three optimally selected Raman shifts. Based onmore » changes on DNA condensation in the nucleus, we were able to capture chromosome dynamics during cell division both in vitro and in vivo. We tracked mouse skin cell proliferation, induced by drug treatment, through in vivo counting of the mitotic rate. Moreover, we demonstrated a label-free histology method for human skin cancer diagnosis that provides comparable results to other conventional tissue staining methods such as H&E. In conclusion, our approach exhibits higher sensitivity than SRS imaging of DNA in the fingerprint spectral region. Compared with spontaneous Raman imaging of DNA, our approach is three orders of magnitude faster, allowing both chromatin dynamic studies and label-free optical histology in real time.« less

  7. Mitochondrial DNA Depletion in Respiratory Chain-Deficient Parkinson Disease Neurons.

    PubMed

    Grünewald, Anne; Rygiel, Karolina A; Hepplewhite, Philippa D; Morris, Christopher M; Picard, Martin; Turnbull, Doug M

    2016-03-01

    To determine the extent of respiratory chain abnormalities and investigate the contribution of mtDNA to the loss of respiratory chain complexes (CI-IV) in the substantia nigra (SN) of idiopathic Parkinson disease (IPD) patients at the single-neuron level. Multiple-label immunofluorescence was applied to postmortem sections of 10 IPD patients and 10 controls to quantify the abundance of CI-IV subunits (NDUFB8 or NDUFA13, SDHA, UQCRC2, and COXI) and mitochondrial transcription factors (TFAM and TFB2M) relative to mitochondrial mass (porin and GRP75) in dopaminergic neurons. To assess the involvement of mtDNA in respiratory chain deficiency in IPD, SN neurons, isolated with laser-capture microdissection, were assayed for mtDNA deletions, copy number, and presence of transcription/replication-associated 7S DNA employing a triplex real-time polymerase chain reaction (PCR) assay. Whereas mitochondrial mass was unchanged in single SN neurons from IPD patients, we observed a significant reduction in the abundances of CI and II subunits. At the single-cell level, CI and II deficiencies were correlated in patients. The CI deficiency concomitantly occurred with low abundances of the mtDNA transcription factors TFAM and TFB2M, which also initiate transcription-primed mtDNA replication. Consistent with this, real-time PCR analysis revealed fewer transcription/replication-associated mtDNA molecules and an overall reduction in mtDNA copy number in patients. This effect was more pronounced in single IPD neurons with severe CI deficiency. Respiratory chain dysfunction in IPD neurons not only involves CI, but also extends to CII. These deficiencies are possibly a consequence of the interplay between nDNA and mtDNA-encoded factors mechanistically connected via TFAM. © 2016 The Authors. Annals of Neurology published by Wiley Periodicals, Inc. on behalf of American Neurological Association.

  8. A label-free amplified fluorescence DNA detection based on isothermal circular strand-displacement polymerization reaction and graphene oxide.

    PubMed

    Li, Zhen; Zhu, Wenping; Zhang, Jinwen; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-07-07

    A label-free fluorescent DNA biosensor has been presented based on isothermal circular strand-displacement polymerization reaction (ICSDPR) combined with graphene oxide (GO) binding. The proposed method is simple and cost-effective with a low detection limit of 4 pM, which compares favorably with other GO-based homogenous DNA detection methods.

  9. Defining multiple, distinct, and shared spatiotemporal patterns of DNA replication and endoreduplication from 3D image analysis of developing maize (Zea mays L.) root tip nuclei.

    PubMed

    Bass, Hank W; Hoffman, Gregg G; Lee, Tae-Jin; Wear, Emily E; Joseph, Stacey R; Allen, George C; Hanley-Bowdoin, Linda; Thompson, William F

    2015-11-01

    Spatiotemporal patterns of DNA replication have been described for yeast and many types of cultured animal cells, frequently after cell cycle arrest to aid in synchronization. However, patterns of DNA replication in nuclei from plants or naturally developing organs remain largely uncharacterized. Here we report findings from 3D quantitative analysis of DNA replication and endoreduplication in nuclei from pulse-labeled developing maize root tips. In both early and middle S phase nuclei, flow-sorted on the basis of DNA content, replicative labeling was widely distributed across euchromatic regions of the nucleoplasm. We did not observe the perinuclear or perinucleolar replicative labeling patterns characteristic of middle S phase in mammals. Instead, the early versus middle S phase patterns in maize could be distinguished cytologically by correlating two quantitative, continuous variables, replicative labeling and DAPI staining. Early S nuclei exhibited widely distributed euchromatic labeling preferentially localized to regions with weak DAPI signals. Middle S nuclei also exhibited widely distributed euchromatic labeling, but the label was preferentially localized to regions with strong DAPI signals. Highly condensed heterochromatin, including knobs, replicated during late S phase as previously reported. Similar spatiotemporal replication patterns were observed for both mitotic and endocycling maize nuclei. These results revealed that maize euchromatin exists as an intermingled mixture of two components distinguished by their condensation state and replication timing. These different patterns might reflect a previously described genome organization pattern, with "gene islands" mostly replicating during early S phase followed by most of the intergenic repetitive regions replicating during middle S phase.

  10. Detecting the Length of Double-stranded DNA with Solid State Nanopores

    NASA Astrophysics Data System (ADS)

    Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene

    2003-03-01

    We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).

  11. Problem-based test: replication of mitochondrial DNA during the cell cycle.

    PubMed

    Sétáló, György

    2013-01-01

    Terms to be familiar with before you start to solve the test: cell cycle, generation time, S-phase, cell culture synchronization, isotopic pulse-chase labeling, density labeling, equilibrium density-gradient centrifugation, buoyant density, rate-zonal centrifugation, nucleoside, nucleotide, kinase enzymes, polymerization of nucleic acids, re-replication block, cell fractionation, Svedberg (sedimentation constant = [ S]), nuclear DNA, mitochondrial DNA, heavy and light mitochondrial DNA chains, heteroplasmy, mitochondrial diseases Copyright © 2013 Wiley Periodicals, Inc.

  12. Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

    NASA Astrophysics Data System (ADS)

    Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

    2008-06-01

    Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

  13. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  14. Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging

    PubMed Central

    2009-01-01

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980

  15. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    PubMed

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  16. Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

    PubMed

    Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

    2017-09-01

    Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

  17. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    PubMed

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    NASA Astrophysics Data System (ADS)

    Buyukdagli, Sahin

    2017-02-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

  19. DNA replication after mutagenic treatment in Hordeum vulgare.

    PubMed

    Kwasniewska, Jolanta; Kus, Arita; Swoboda, Monika; Braszewska-Zalewska, Agnieszka

    2016-12-01

    The temporal and spatial properties of DNA replication in plants related to DNA damage and mutagenesis is poorly understood. Experiments were carried out to explore the relationships between DNA replication, chromatin structure and DNA damage in nuclei from barley root tips. We quantitavely analysed the topological organisation of replication foci using pulse EdU labelling during the S phase and its relationship with the DNA damage induced by mutagenic treatment with maleic hydrazide (MH), nitroso-N-methyl-urea (MNU) and gamma ray. Treatment with mutagens did not change the characteristic S-phase patterns in the nuclei; however, the frequencies of the S-phase-labelled cells after treatment differed from those observed in the control cells. The analyses of DNA replication in barley nuclei were extended to the micronuclei induced by mutagens. Replication in the chromatin of the micronuclei was rare. The results of simultanous TUNEL reaction to identify cells with DNA strand breaks and the labelling of the S-phase cells with EdU revealed the possibility of DNA replication occurring in damaged nuclei. For the first time, the intensity of EdU fluorescence to study the rate of DNA replication was analysed. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. DNA combing on low-pressure oxygen plasma modified polysilsesquioxane substrates for single-molecule studies

    PubMed Central

    Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu

    2014-01-01

    Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

    PubMed

    Paul, Philip; Apgar, Josh

    2005-04-01

    Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

  3. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  4. Disentangling DNA molecules

    NASA Astrophysics Data System (ADS)

    Vologodskii, Alexander

    2016-09-01

    The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

  5. Capillary electrophoretic separation-based approach to determine the labeling kinetics of oligodeoxynucleotides

    PubMed Central

    Kanavarioti, Anastassia; Greenman, Kevin L.; Hamalainen, Mark; Jain, Aakriti; Johns, Adam M.; Melville, Chris R.; Kemmish, Kent; Andregg, William

    2014-01-01

    With the recent advances in electron microscopy (EM), computation, and nanofabrication, the original idea of reading DNA sequence directly from an image can now be tested. One approach is to develop heavy atom labels that can provide the contrast required for EM imaging. While evaluating tentative labels for the respective nucleobases in synthetic oligodeoxynucleotides (oligos), we developed a streamlined capillary electrophoresis (CE) protocol to assess the label stability, reactivity, and selectivity. We report our protocol using osmium tetroxide 2,2′-bipyridine (Osbipy) as a thymidine (T) specific label. The observed rates show that the labeling process is kinetically independent of both the oligo length, and the base composition. The conditions, i.e. temperature, optimal Osbipy concentration, and molar ratio of reagents, to promote 100% conversion of the starting oligo to labeled product were established. Hence the optimized conditions developed with the oligos could be leveraged to allow osmylation of effectively all Ts in single-stranded (ss) DNA, while achieving minimal mislabeling. In addition, the approach and methods employed here may be adapted to the evaluation of other prospective contrasting agents/labels to facilitate next-generation DNA sequencing by EM. PMID:23147698

  6. A novel electrochemiluminescence strategy for ultrasensitive DNA assay using luminol functionalized gold nanoparticles multi-labeling and amplification of gold nanoparticles and biotin-streptavidin system.

    PubMed

    Chai, Ying; Tian, Dayong; Wang, Wei; Cui, Hua

    2010-10-28

    Luminol functionalized gold nanoparticles were used as labels for electrochemiluminescence signal amplification and an ultrasensitive, highly selective, convenient, low cost DNA detection strategy was developed.

  7. Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

    NASA Astrophysics Data System (ADS)

    Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

    2006-09-01

    In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

  8. Using DNA-labelled nano- and microparticles to track particle transport in the environment

    NASA Astrophysics Data System (ADS)

    McNew, Coy; Wang, Chaozi; Dahlke, Helen; Lyon, Steve; Walter, Todd

    2017-04-01

    By utilizing bio-molecular nanotechnology developed for nano-medicines and drug delivery, we are able to produce DNA-labelled nano- and microparticle tracers for use in a myriad of environmental systems. The use of custom sequenced DNA allows for the fabrication of an enormous number of uniquely labelled tracers with identical transport properties (approximately 1.61 x 1060 unique sequences), each independently quantifiable, that can be applied simultaneously in any hydrologic system. By controlling the fabrication procedure to produce particles of custom size and charge, we are able to tag each size-charge combination uniquely in order to directly probe the effect of these variables on the transport properties of the particles. Here we present our methods for fabrication, extraction, and analysis of the DNA nano- and microparticle tracers, along with results from several successful applications of the tracers, including transport and retention analysis at the lab, continuum, and field scales. To date, our DNA-labelled nano- and microparticle tracers have proved useful in surface and subsurface water applications, soil retention, and even subglacial flow pathways. The range of potential applications continue to prove nearly limitless.

  9. Photoactivatable protein labeling by singlet oxygen mediated reactions.

    PubMed

    To, Tsz-Leung; Medzihradszky, Katalin F; Burlingame, Alma L; DeGrado, William F; Jo, Hyunil; Shu, Xiaokun

    2016-07-15

    Protein-protein interactions regulate many biological processes. Identification of interacting proteins is thus an important step toward molecular understanding of cell signaling. The aim of this study was to investigate the use of photo-generated singlet oxygen and a small molecule for proximity labeling of interacting proteins in cellular environment. The protein of interest (POI) was fused with a small singlet oxygen photosensitizer (miniSOG), which generates singlet oxygen ((1)O2) upon irradiation. The locally generated singlet oxygen then activated a biotin-conjugated thiol molecule to form a covalent bond with the proteins nearby. The labeled proteins can then be separated and subsequently identified by mass spectrometry. To demonstrate the applicability of this labeling technology, we fused the miniSOG to Skp2, an F-box protein of the SCF ubiquitin ligase, and expressed the fusion protein in mammalian cells and identified that the surface cysteine of its interacting partner Skp1 was labeled by the biotin-thiol molecule. This photoactivatable protein labeling method may find important applications including identification of weak and transient protein-protein interactions in the native cellular context, as well as spatial and temporal control of protein labeling. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. An aggregated perylene-based broad-spectrum, efficient and label-free quencher for multiplexed fluorescent bioassays.

    PubMed

    Liu, Tao; Hu, Rong; Lv, Yi-Fan; Wu, Yuan; Liang, Hao; Huan, Shuang-Yan; Zhang, Xiao-Bing; Tan, Weihong; Yu, Ru-Qin

    2014-08-15

    Fluorescent sensing systems based on the quenching of fluorophores have found wide applications in bioassays. An efficient quencher will endow the sensing system a high sensitivity. The frequently used quenchers are based on organic molecules or nanomaterials, which usually need tedious synthesizing and modifying steps, and exhibit different quenching efficiencies to different fluorophores. In this work, we for the first time report that aggregated perylene derivative can serve as a broad-spectrum and label-free quencher that is able to efficiently quench a variety of fluorophores, such as green, red and far red dyes labeled on DNA. By choosing nucleases as model biomolecules, such a broad-spectrum quencher was then employed to construct a multiplexed bioassay platform through a label-free manner. Due to the high quenching efficiency of the aggregated perylene, the proposed platform could detect nuclease with high sensitivity, with a detection limit of 0.03U/mL for EcoRV, and 0.05U/mL for EcoRI. The perylene quencher does not affect the activity of nuclease, which makes it possible to design post-addition type bioassay platform. Moreover, the proposed platform allows simultaneous and multicolor analysis of nucleases in homogeneous solution, demonstrating its value of potential application in rapid screening of multiple bio-targets. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Fab fragment labeled with ICG-derivative for detecting digestive tract cancer.

    PubMed

    Yano, Hiromi; Muguruma, Naoki; Ito, Susumu; Aoyagi, Eriko; Kimura, Tetsuo; Imoto, Yoshitaka; Cao, Jianxin; Inoue, Shohei; Sano, Shigeki; Nagao, Yoshimitsu; Kido, Hiroshi

    2006-09-01

    In previous studies, we generated infrared ray fluorescence-labeled monoclonal antibodies and developed an infrared ray fluorescence endoscope capable of detecting the monoclonal antibodies to establish a novel diagnostic technique for gastrointestinal cancer. Although the whole IgG molecule has commonly been used for preparation of labeled antibodies, labeled IgG displays insufficient sensitivity and specificity, probably resulting from non-specific binding of the Fc fragment to target cells or interference between fluorochromes on the identical labeled antibody, which might be caused by molecular structure. In this in vitro study, we characterized an Fc-free fluorescence-labeled Fab fragment, which was expected to yield more specific binding to target cells than the whole IgG molecule. An anti-mucin antibody and ICG-ATT, an ICG derivative, were used as the labeled antibody and labeling compound, respectively. Paraffin sections of excised gastric cancer tissues were subjected to staining. The labeled whole IgG molecule (ICG-ATT-labeled IgG) and the labeled Fab fragment (ICG-ATT-labeled Fab) were prepared according to a previous report, and the fluorescence properties, antibody activities, and features of fluorescence microscope images obtained from paraffin sections were compared. Both ICG-ATT-labeled Fab and ICG-ATT-labeled IgG were excited by a near infrared ray of 766nm, and maximum emission occurred at 804nm. Antibody activities of ICG-ATT-labeled Fab were shown to be similar to those of unlabeled anti-MUC1 antibody. The fluorescence intensity obtained from paraffin sections of excised gastric cancer tissues revealed a tendency to be greater with ICG-ATT-labeled Fab than with ICG-ATT-labeled IgG. The infrared ray fluorescence-labeled Fab fragment was likely to be more specific than the conventionally labeled antibodies. Fragmentation of antibodies is considered to contribute to improved sensitivity and specificity of labeled antibodies for detection of micro gastrointestinal cancers.

  12. Winding single-molecule double-stranded DNA on a nanometer-sized reel

    PubMed Central

    You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

    2012-01-01

    A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

  13. C2-streptavidin mediates the delivery of biotin-conjugated tumor suppressor protein p53 into tumor cells.

    PubMed

    Fahrer, Jörg; Schweitzer, Brigitte; Fiedler, Katja; Langer, Torben; Gierschik, Peter; Barth, Holger

    2013-04-17

    We have previously generated a recombinant C2-streptavidin fusion protein for the delivery of biotin-labeled molecules of low molecular weight into the cytosol of mammalian cells. A nontoxic moiety of Clostridium botulinum C2 toxin mediates the cellular uptake, whereas the streptavidin unit serves as a binding platform for biotin-labeled cargo molecules. In the present study, we used the C2-streptavidin transporter to introduce biotin-conjugated p53 protein into various mammalian cell lines. The p53 tumor suppressor protein is inactivated in many human cancers by multiple mechanisms and therefore the restoration of its activity in tumor cells is of great therapeutic interest. Recombinant p53 was expressed in insect cells and biotin-labeled. Biotin-p53 retained its specific high-affinity DNA-binding as revealed by gel-shift analysis. Successful conjugation of biotin-p53 to the C2-streptavidin transporter was monitored by an overlay blot technique and confirmed by real-time surface plasmon resonance, providing a KD-value in the low nM range. C2-streptavidin significantly enhanced the uptake of biotin-p53 into African Green Monkey (Vero) epithelial cells as shown by flow cytometry. Using cell fractionation, the cytosolic translocation of biotin-p53 was detected in Vero cells as well as in HeLa cervix carcinoma cells. In line with this finding, confocal microscopy displayed cytoplasmic staining of biotin-p53 in HeLa and HL60 leukemia cells. Internalized biotin-p53 partially colocalized with early endosomes, as confirmed by confocal microscopy. In conclusion, our results demonstrate the successful conjugation of biotin-p53 to C2-streptavidin and its subsequent receptor-mediated endocytosis into different human tumor cell lines.

  14. DNA intermediates and telomere addition during genome reorganization in Euplotes crassus.

    PubMed

    Roth, M; Prescott, D M

    1985-06-01

    Three gene-sized molecules cloned intact from macronuclear DNA served as hybridization probes to study excision of these molecules from chromosomes and their processing during macronuclear development in the hypotrich Euplotes crassus. These molecules occur in integrated forms within polytene chromosomal DNA during macronuclear developmental. After transection of the polytene chromosomes, the three molecules occur in intermediate forms. One of the three molecules first appeared in a large intermediate that was subsequently replaced by a second intermediate, approximately 140 bp larger than the final molecule. The other two macronuclear molecules were detected only in intermediates approximately 140 bp larger than the mature form. These penultimate intermediates are larger by virtue of oversized telomeres, which are pared to yield the mature gene-sized molecules.

  15. S phase entry causes homocysteine-induced death while ataxia telangiectasia and Rad3 related protein functions anti-apoptotically to protect neurons.

    PubMed

    Ye, Weizhen; Blain, Stacy W

    2010-08-01

    A major phenotype seen in neurodegenerative disorders is the selective loss of neurons due to apoptotic death and evidence suggests that inappropriate re-activation of cell cycle proteins in post-mitotic neurons may be responsible. To investigate whether reactivation of the G1 cell cycle proteins and S phase entry was linked with apoptosis, we examined homocysteine-induced neuronal cell death in a rat cortical neuron tissue culture system. Hyperhomocysteinaemia is a physiological risk factor for a variety of neurodegenerative diseases, including Alzheimer's disease. We found that in response to homocysteine treatment, cyclin D1, and cyclin-dependent kinases 4 and 2 translocated to the nucleus, and p27 levels decreased. Both cyclin-dependent kinases 4 and 2 regained catalytic activity, the G1 gatekeeper retinoblastoma protein was phosphorylated and DNA synthesis was detected, suggesting transit into S phase. Double-labelling immunofluorescence showed a 95% co-localization of anti-bromodeoxyuridine labelling with apoptotic markers, demonstrating that those cells that entered S phase eventually died. Neurons could be protected from homocysteine-induced death by methods that inhibited G1 phase progression, including down-regulation of cyclin D1 expression, inhibition of cyclin-dependent kinases 4 or 2 activity by small molecule inhibitors, or use of the c-Abl kinase inhibitor, Gleevec, which blocked cyclin D and cyclin-dependent kinase 4 nuclear translocation. However, blocking cell cycle progression post G1, using DNA replication inhibitors, did not prevent apoptosis, suggesting that death was not preventable post the G1-S phase checkpoint. While homocysteine treatment caused DNA damage and activated the DNA damage response, its mechanism of action was distinct from that of more traditional DNA damaging agents, such as camptothecin, as it was p53-independent. Likewise, inhibition of the DNA damage sensors, ataxia-telangiectasia mutant and ataxia telangiectasia and Rad3 related proteins, did not rescue apoptosis and in fact exacerbated death, suggesting that the DNA damage response might normally function neuroprotectively to block S phase-dependent apoptosis induction. As cell cycle events appear to be maintained in vivo in affected neurons for weeks to years before apoptosis is observed, activation of the DNA damage response might be able to hold cell cycle-induced death in check.

  16. High-throughput DNA separation in nanofilter arrays.

    PubMed

    Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong

    2014-08-01

    We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Detection and differentiation of coxiella burnetii in biological fluids

    DOEpatents

    Frazier, Marvin E.; Mallavia, Louis P.; Samuel, James E.; Baca, Oswald G.

    1990-01-01

    Methods for detecting the presence of Coxiella burenetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

  18. Detection and differentiation of coxiella burnetii in biological fluids

    DOEpatents

    Frazier, Marvin E.; Mallavia, Louis P.; Baca, Oswald G.; Samuel, James E.

    1989-01-01

    Methods for detecting the presence of Coxiella burnetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

  19. Mitochondrial DNA Depletion in Respiratory Chain–Deficient Parkinson Disease Neurons

    PubMed Central

    Rygiel, Karolina A.; Hepplewhite, Philippa D.; Morris, Christopher M.; Picard, Martin; Turnbull, Doug M.

    2016-01-01

    Objective To determine the extent of respiratory chain abnormalities and investigate the contribution of mtDNA to the loss of respiratory chain complexes (CI–IV) in the substantia nigra (SN) of idiopathic Parkinson disease (IPD) patients at the single‐neuron level. Methods Multiple‐label immunofluorescence was applied to postmortem sections of 10 IPD patients and 10 controls to quantify the abundance of CI–IV subunits (NDUFB8 or NDUFA13, SDHA, UQCRC2, and COXI) and mitochondrial transcription factors (TFAM and TFB2M) relative to mitochondrial mass (porin and GRP75) in dopaminergic neurons. To assess the involvement of mtDNA in respiratory chain deficiency in IPD, SN neurons, isolated with laser‐capture microdissection, were assayed for mtDNA deletions, copy number, and presence of transcription/replication‐associated 7S DNA employing a triplex real‐time polymerase chain reaction (PCR) assay. Results Whereas mitochondrial mass was unchanged in single SN neurons from IPD patients, we observed a significant reduction in the abundances of CI and II subunits. At the single‐cell level, CI and II deficiencies were correlated in patients. The CI deficiency concomitantly occurred with low abundances of the mtDNA transcription factors TFAM and TFB2M, which also initiate transcription‐primed mtDNA replication. Consistent with this, real‐time PCR analysis revealed fewer transcription/replication‐associated mtDNA molecules and an overall reduction in mtDNA copy number in patients. This effect was more pronounced in single IPD neurons with severe CI deficiency. Interpretation Respiratory chain dysfunction in IPD neurons not only involves CI, but also extends to CII. These deficiencies are possibly a consequence of the interplay between nDNA and mtDNA‐encoded factors mechanistically connected via TFAM. ANN NEUROL 2016;79:366–378 PMID:26605748

  20. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    EPA Science Inventory

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

Top