Heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylated variants of a single polypeptide chain.

PubMed

Murphy, P A; Cebula, T A; Windle, B E

1981-10-01

Rabbit endogenous pyrogens were of about the same molecular size, but showed considerable heterogeneity of their isoelectric points. We attempted to show that this heterogeneity was attributable to variable glycosylation of a single polypeptide chain. When peritoneal exudate cells were stimulated to make pyrogens in the presence of 2-deoxy-D-glucose, there was a relatively trivial suppression of pyrogen release, and analysis by isoelectric focusing showed parallel inhibition of secretion of all the forms of endogenous pyrogen. When cells were stimulated in the presence of 3H-labeled amino acids and 14C-labeled glucosamine or glucose, the purified pyrogens were labeled with 3H but not with 14C. Macrophage membrane preparations were made which contained glycosyl transferases and could transfer sugar residues from sugar nucleotides to deglycosylated fetuin. These macrophage membrane preparations did not transfer sugars to the pI 7.3 endogenous pyrogen. Treatment of endogenous pyrogens with neuraminidase or with periodate produced no evidence suggesting that the pyrogens were glycosylated. Last, endogenous pyrogens did not bind to any of four lectins with different carbohydrate specificities. This evidence suggests that the heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylation and must have some other cause.

Heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylated variants of a single polypeptide chain.

PubMed Central

Murphy, P A; Cebula, T A; Windle, B E

1981-01-01

Rabbit endogenous pyrogens were of about the same molecular size, but showed considerable heterogeneity of their isoelectric points. We attempted to show that this heterogeneity was attributable to variable glycosylation of a single polypeptide chain. When peritoneal exudate cells were stimulated to make pyrogens in the presence of 2-deoxy-D-glucose, there was a relatively trivial suppression of pyrogen release, and analysis by isoelectric focusing showed parallel inhibition of secretion of all the forms of endogenous pyrogen. When cells were stimulated in the presence of 3H-labeled amino acids and 14C-labeled glucosamine or glucose, the purified pyrogens were labeled with 3H but not with 14C. Macrophage membrane preparations were made which contained glycosyl transferases and could transfer sugar residues from sugar nucleotides to deglycosylated fetuin. These macrophage membrane preparations did not transfer sugars to the pI 7.3 endogenous pyrogen. Treatment of endogenous pyrogens with neuraminidase or with periodate produced no evidence suggesting that the pyrogens were glycosylated. Last, endogenous pyrogens did not bind to any of four lectins with different carbohydrate specificities. This evidence suggests that the heterogeneity of rabbit endogenous pyrogens is not attributable to glycosylation and must have some other cause. PMID:6271680

Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

PubMed

Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

2017-04-01

Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

Electrical detection and quantification of single and mixed DNA nucleotides in suspension

NASA Astrophysics Data System (ADS)

Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

2016-09-01

High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

3'-End labeling of nucleic acids by a polymerase ribozyme.

PubMed

Samanta, Biswajit; Horning, David P; Joyce, Gerald F

2018-06-13

A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

(3H)WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norman, A.B.; Battaglia, G.; Creese, I.

1985-12-01

In the presence of a 30 nM prazosin mask, (/sup 3/H)-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ((/sup 3/H)WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for (/sup 3/H) WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at (/sup 3/H)WB4101-binding sites in the presence of 30 nM prazosin and (/sup 3/H) lysergic acid diethylamide ((/sup 3/H)LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5more » mM MgSO4, the Bmax of (/sup 3/H)WB4101 is significantly lower than the Bmax of (/sup 3/H)LSD in various brain regions. WB4101 competition for (/sup 3/H) LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of (/sup 3/H)WB4101 binding derived from saturation experiments. This suggests that (/sup 3/H)WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by (/sup 3/H)LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for (/sup 3/H)WB4101 but compete for multiple (/sup 3/H)LSD 5-HT1 binding sites. These data indicate that (/sup 3/H)WB4101 selectively labels the 5-HT1A serotonin receptor, whereas (/sup 3/H) LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of (/sup 3/H)WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of (/sup 3/H)WB4101 binding.« less

Analysis of IAV Replication and Co-infection Dynamics by a Versatile RNA Viral Genome Labeling Method.

PubMed

Dou, Dan; Hernández-Neuta, Iván; Wang, Hao; Östbye, Henrik; Qian, Xiaoyan; Thiele, Swantje; Resa-Infante, Patricia; Kouassi, Nancy Mounogou; Sender, Vicky; Hentrich, Karina; Mellroth, Peter; Henriques-Normark, Birgitta; Gabriel, Gülsah; Nilsson, Mats; Daniels, Robert

2017-07-05

Genome delivery to the proper cellular compartment for transcription and replication is a primary goal of viruses. However, methods for analyzing viral genome localization and differentiating genomes with high identity are lacking, making it difficult to investigate entry-related processes and co-examine heterogeneous RNA viral populations. Here, we present an RNA labeling approach for single-cell analysis of RNA viral replication and co-infection dynamics in situ, which uses the versatility of padlock probes. We applied this method to identify influenza A virus (IAV) infections in cells and lung tissue with single-nucleotide specificity and to classify entry and replication stages by gene segment localization. Extending the classification strategy to co-infections of IAVs with single-nucleotide variations, we found that the dependence on intracellular trafficking places a time restriction on secondary co-infections necessary for genome reassortment. Altogether, these data demonstrate how RNA viral genome labeling can help dissect entry and co-infections. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.

PubMed

Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W

2016-01-01

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mankos, Marian; Persson, Henrik H. J.; N’Diaye, Alpha T.

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectronmore » and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. In conclusion, both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.« less

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy

DOE PAGES

Mankos, Marian; Persson, Henrik H. J.; N’Diaye, Alpha T.; ...

2016-05-05

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectronmore » and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. In conclusion, both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.« less

Photoinitiator Nucleotide for Quantifying Nucleic Acid Hybridization

PubMed Central

Johnson, Leah M.; Hansen, Ryan R.; Urban, Milan; Kuchta, Robert D.; Bowman, Christopher N.

2010-01-01

This first report of a photoinitiator-nucleotide conjugate demonstrates a novel approach for sensitive, rapid and visual detection of DNA hybridization events. This approach holds potential for various DNA labeling schemes and for applications benefiting from selective DNA-based polymerization initiators. Here, we demonstrate covalent, enzymatic incorporation of an eosin-photoinitiator 2′-deoxyuridine-5′-triphosphate (EITC-dUTP) conjugate into surface-immobilized DNA hybrids. Subsequent radical chain photoinitiation from these sites using an acrylamide/bis-acrylamide formulation yields a dynamic detection range between 500pM and 50nM of DNA target. Increasing EITC-nucleotide surface densities leads to an increase in surface-based polymer film heights until achieving a film height plateau of 280nm ±20nm at 610 ±70 EITC-nucleotides/μm2. Film heights of 10–20 nm were obtained from eosin surface densities of approximately 20 EITC-nucleotides/μm2 while below the detection limit of ~10 EITC-nucleotides/μm2, no detectable films were formed. This unique threshold behavior is utilized for instrument-free, visual quantification of target DNA concentration ranges. PMID:20337438

Synthesis of RNA oligomers on heterogeneous templates

NASA Technical Reports Server (NTRS)

Ertem, G.; Ferris, J. P.

1996-01-01

The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Nucleotide Dependent Switching in Rho GTPase: Conformational Heterogeneity and Competing Molecular Interactions

PubMed Central

Kumawat, Amit; Chakrabarty, Suman; Kulkarni, Kiran

2017-01-01

Ras superfamily of GTPases regulate myriad cellular processes through a conserved nucleotide (GTP/GDP) dependent switching mechanism. Unlike Ras family of GTPases, for the Rho GTPases, there is no clear evidence for the existence of “sub-states” such as state 1 & state 2 in the GTP bound form. To explore the nucleotide dependent conformational space of the Switch I loop and also to look for existence of state 1 like conformations in Rho GTPases, atomistic molecular dynamics and metadynamics simulations on RhoA were performed. These studies demonstrate that both the nucleotide-free state and the GDP bound “OFF” state have very similar conformations, whereas the GTP bound “ON” state has unique conformations with signatures of two intermediate states. The conformational free energy landscape for these systems suggests the presence of multiple intermediate states. Interestingly, the energetic penalty of exposing the non-polar residues in the GTP bound form is counter balanced by the favourable hydrogen bonded interactions between the γ-phosphate group of GTP with the highly conserved Tyr34 and Thr37 residues. These competing molecular interactions lead to a tuneable energy landscape of the Switch I conformation, which can undergo significant changes based on the local environment including changes upon binding to effectors. PMID:28374773

Nucleotide Dependent Switching in Rho GTPase: Conformational Heterogeneity and Competing Molecular Interactions

NASA Astrophysics Data System (ADS)

Kumawat, Amit; Chakrabarty, Suman; Kulkarni, Kiran

2017-04-01

Ras superfamily of GTPases regulate myriad cellular processes through a conserved nucleotide (GTP/GDP) dependent switching mechanism. Unlike Ras family of GTPases, for the Rho GTPases, there is no clear evidence for the existence of “sub-states” such as state 1 & state 2 in the GTP bound form. To explore the nucleotide dependent conformational space of the Switch I loop and also to look for existence of state 1 like conformations in Rho GTPases, atomistic molecular dynamics and metadynamics simulations on RhoA were performed. These studies demonstrate that both the nucleotide-free state and the GDP bound “OFF” state have very similar conformations, whereas the GTP bound “ON” state has unique conformations with signatures of two intermediate states. The conformational free energy landscape for these systems suggests the presence of multiple intermediate states. Interestingly, the energetic penalty of exposing the non-polar residues in the GTP bound form is counter balanced by the favourable hydrogen bonded interactions between the γ-phosphate group of GTP with the highly conserved Tyr34 and Thr37 residues. These competing molecular interactions lead to a tuneable energy landscape of the Switch I conformation, which can undergo significant changes based on the local environment including changes upon binding to effectors.

The guanine nucleotide exchange factor Ric-8A induces domain separation and Ras domain plasticity in Gαi1

PubMed Central

Van Eps, Ned; Thomas, Celestine J.; Hubbell, Wayne L.; Sprang, Stephen R.

2015-01-01

Heterotrimeric G proteins are activated by exchange of GDP for GTP at the G protein alpha subunit (Gα), most notably by G protein-coupled transmembrane receptors. Ric-8A is a soluble cytoplasmic protein essential for embryonic development that acts as both a guanine nucleotide exchange factor (GEF) and a chaperone for Gα subunits of the i, q, and 12/13 classes. Previous studies demonstrated that Ric-8A stabilizes a dynamically disordered state of nucleotide-free Gα as the catalytic intermediate for nucleotide exchange, but no information was obtained on the structures involved or the magnitude of the structural fluctuations. In the present study, site-directed spin labeling (SDSL) together with double electron-electron resonance (DEER) spectroscopy is used to provide global distance constraints that identify discrete members of a conformational ensemble in the Gαi1:Ric-8A complex and the magnitude of structural differences between them. In the complex, the helical and Ras-like nucleotide-binding domains of Gαi1 pivot apart to occupy multiple resolved states with displacements as large as 25 Å. The domain displacement appears to be distinct from that observed in Gαs upon binding of Gs to the β2 adrenergic receptor. Moreover, the Ras-like domain exhibits structural plasticity within and around the nucleotide-binding cavity, and the switch I and switch II regions, which are known to adopt different conformations in the GDP- and GTP-bound states of Gα, undergo structural rearrangements. Collectively, the data show that Ric-8A induces a conformationally heterogeneous state of Gαi and provide insight into the mechanism of action of a nonreceptor Gα GEF. PMID:25605908

Changes in mumps virus neurovirulence phenotype associated with quasispecies heterogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sauder, Christian J.; Vandenburgh, Kari M.; Iskow, Rebecca C.

2006-06-20

Mumps virus is a highly neurotropic virus with evidence of central nervous system invasion (CNS) in approximately half of all cases of infection. In countries where live attenuated mumps virus vaccines were introduced, the number of mumps cases declined dramatically; however, recently, the safety of some vaccine strains has been questioned. For example, one of the most widely used vaccines, the Urabe AM9 strain, was causally associated with meningitis, leading to the withdrawal of this product from the market in several countries. This highlights the need for a better understanding of the attenuation process and the identification of markers ofmore » attenuation. To this end, we further attenuated the Urabe AM9 strain by serial passage in cell culture and compared the complete nucleotide sequences of the parental and passaged viruses. Interestingly, despite a dramatic decrease in virus virulence (as assayed in rats), the only genomic changes were in the form of changes in the level of genetic heterogeneity at specific genome sites, i.e., either selection of one nucleotide variant at positions where the starting material exhibited nucleotide heterogeneity or the evolution of an additional nucleotide to create a heterogenic site. This finding suggests that changes in the level of genetic heterogeneity at specific genome sites can have profound neurovirulence phenotypic consequences and, therefore, caution should be exercised when evaluating genetic markers of virulence or attenuation based only on a consensus sequence.« less

Switch II Mutants Reveal Coupling between the Nucleotide- and Actin-Binding Regions in Myosin V

PubMed Central

Trivedi, Darshan V.; David, Charles; Jacobs, Donald J.; Yengo, Christopher M.

2012-01-01

Conserved active-site elements in myosins and other P-loop NTPases play critical roles in nucleotide binding and hydrolysis; however, the mechanisms of allosteric communication among these mechanoenzymes remain unresolved. In this work we introduced the E442A mutation, which abrogates a salt-bridge between switch I and switch II, and the G440A mutation, which abolishes a main-chain hydrogen bond associated with the interaction of switch II with the γ phosphate of ATP, into myosin V. We used fluorescence resonance energy transfer between mant-labeled nucleotides or IAEDANS-labeled actin and FlAsH-labeled myosin V to examine the conformation of the nucleotide- and actin-binding regions, respectively. We demonstrate that in the absence of actin, both the G440A and E442A mutants bind ATP with similar affinity and result in only minor alterations in the conformation of the nucleotide-binding pocket (NBP). In the presence of ADP and actin, both switch II mutants disrupt the formation of a closed NBP actomyosin.ADP state. The G440A mutant also prevents ATP-induced opening of the actin-binding cleft. Our results indicate that the switch II region is critical for stabilizing the closed NBP conformation in the presence of actin, and is essential for communication between the active site and actin-binding region. PMID:22713570

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Synthesis and Labeling of RNA In Vitro

PubMed Central

Huang, Chao; Yu, Yi-Tao

2013-01-01

This unit discusses several methods for generating large amounts of uniformly labeled, end-labeled, and site-specifically labeled RNAs in vitro. The methods involve a number of experimental procedures, including RNA transcription, 5′ dephosphorylation and rephosphorylation, 3′ terminal nucleotide addition (via ligation), site-specific RNase H cleavage directed by 2′-O-methyl RNA-DNA chimeras, and 2-piece splint ligation. The applications of these RNA radiolabeling approaches are also discussed. PMID:23547015

Database of amino acid-nucleotide contacts in contacts in DNA-homeodomain protein

NASA Astrophysics Data System (ADS)

Grokhlina, T. I.; Zrelov, P. V.; Ivanov, V. V.; Polozov, R. V.; Chirgadze, Yu. N.; Sivozhelezov, V. S.

2013-09-01

The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires an analysis of the physicochemical characteristics of these contacts and the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used to compare and classify the interfaces of the protein-DNA complexes.

A Method to Determine 18O Kinetic Isotope Effects in the Hydrolysis of Nucleotide Triphosphates

PubMed Central

Du, Xinlin; Ferguson, Kurt; Sprang, Stephen R.

2007-01-01

A method to determine 18O kinetic isotope effects (KIE) in the hydrolysis of GTP is described that is generally applicable to reactions involving other nucleotide triphosphates. Internal competition, wherein the substrate of the reaction is a mixture of 18O-labeled and unlabeled nucleotides, is employed and the change in relative abundance of the two species in the course of the reaction is used to calculate KIE. The nucleotide labeled with 18O at sites of mechanistic interest also contains 13C at all carbon positions, while the 16O-nucleotide is depleted of 13C. The relative abundance of the labeled and unlabeled substrates or products is reflected in the carbon isotope ratio (13C/12C) in GTP or GDP, which is determined by use of a liquid chromatography-coupled isotope ratio mass spectrometer (LC-coupled IRMS). The LC is coupled to the IRMS by an Isolink™ interface (ThermoFinnigan). Carbon isotope ratios can be determined with accuracy and precision greater than 0.04%, and are consistent over an order of magnitude in sample amount. KIE values for Ras/NF1333-catalyzed hydrolysis of [β18O3,13C]GTP were determined by change in the isotope ratio of GTP or GDP or the ratio of the isotope ratio of GDP to that of GTP. KIE values computed in the three ways agree within 0.1%, although the method using the ratio of isotope ratios of GDP and GTP gives superior precision (< 0.1%). A single KIE measurement can be conducted in 25 minutes with less than 5 μg nucleotide reaction product. PMID:17963711

Acid-soluble nucleotides of pinto bean leaves at different stages of development.

PubMed

Weinstein, L H; McCune, D C; Mancini, J F; van Leuken, P

1969-11-01

Acid-soluble nucleotides of unifoliate leaves of Pinto bean plants (Phaseolus vulgaris L.) were determined at young, mature, and senescent stages of development. At least 25 components could be distinguished on the basis of inorganic phosphorus determinations and 37 or more fractions on the basis of (32)P labeling, with adenosine di- and triphosphates accounting for 60% of the total moles of nucleotide. The total nucleotide P and inorganic P, on a fresh weight basis, decreased about 44% between each stage of leaf development, but decrements in the levels of individual nucleotides varied from this over-all pattern.Minor changes in the relative abundance of the individual nucleotides accompanied aging although the percentage of purine-containing nucleotides decreased with age. Total (32)P activity per leaf in the nucleotide pool increased about 3-fold between the young and mature leaves and decreased slightly as leaves became senescent. In general, the specific activities of the nucleotides increased with increased age and adenosine-, guanosine-, uridine-, and cytidine triphosphates and adenosine diphosphate accounted for approximately 90% of the total activity. The changes in the relative sizes and energy status of the nucleotide pools were not so obvious as the changes in other metabolites that have been reported to accompany aging in leaf tissue.

High-Yield Spin Labeling of Long RNAs for Electron Paramagnetic Resonance Spectroscopy.

PubMed

Kerzhner, Mark; Matsuoka, Hideto; Wuebben, Christine; Famulok, Michael; Schiemann, Olav

2018-05-10

Site-directed spin labeling is a powerful tool for investigating the conformation and dynamics of biomacromolecules such as RNA. Here we introduce a spin labeling strategy based on click chemistry in solution that, in combination with enzymatic ligation, allows highly efficient labeling of complex and long RNAs with short reaction times and suppressed RNA degradation. With this approach, a 34-nucleotide aptamer domain of the preQ1 riboswitch and an 81-nucleotide TPP riboswitch aptamer could be labeled with two labels in several positions. We then show that conformations of the preQ1 aptamer and its dynamics can be monitored in the absence and presence of Mg 2+ and a preQ1 ligand by continuous wave electron paramagnetic resonance spectroscopy at room temperature and pulsed electron-electron double resonance spectroscopy (PELDOR or DEER) in the frozen state.

Aptamer fluorescence anisotropy sensors for adenosine triphosphate by comprehensive screening tetramethylrhodamine labeled nucleotides.

PubMed

Zhao, Qiang; Lv, Qin; Wang, Hailin

2015-08-15

We previously reported a fluorescence anisotropy (FA) approach for small molecules using tetramethylrhodamine (TMR) labeled aptamer. It relies on target-binding induced change of intramolecular interaction between TMR and guanine (G) base. TMR-labeling sites are crucial for this approach. Only terminal ends and thymine (T) bases could be tested for TMR labeling in our previous work, possibly causing limitation in analysis of different targets with this FA strategy. Here, taking the analysis of adenosine triphosphate (ATP) as an example, we demonstrated a success of conjugating TMR on other bases of aptamer adenine (A) or cytosine (C) bases and an achievement of full mapping various labeling sites of aptamers. We successfully constructed aptamer fluorescence anisotropy (FA) sensors for adenosine triphosphate (ATP). We conjugated single TMR on adenine (A), cytosine (C), or thymine (T) bases or terminals of a 25-mer aptamer against ATP and tested FA responses of 14 TMR-labeled aptamer to ATP. The aptamers having TMR labeled on the 16th base C or 23rd base A were screened out and exhibited significant FA-decreasing or FA-increasing responses upon ATP, respectively. These two favorable TMR-labeled aptamers enabled direct FA sensing ATP with a detection limit of 1 µM and the analysis of ATP in diluted serum. The comprehensive screening various TMR labeling sites of aptamers facilitates the successful construction of FA sensors using TMR-labeled aptamers. It will expand application of TMR-G interaction based aptamer FA strategy to a variety of targets. Copyright © 2015 Elsevier B.V. All rights reserved.

RY-Coding and Non-Homogeneous Models Can Ameliorate the Maximum-Likelihood Inferences From Nucleotide Sequence Data with Parallel Compositional Heterogeneity.

PubMed

Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo

2012-01-01

In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.

Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

PubMed

Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

2016-05-01

Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

Spontaneous nucleotide exchange in low molecular weight GTPases by fluorescently labeled γ-phosphate-linked GTP analogs

PubMed Central

Korlach, Jonas; Baird, Daniel W.; Heikal, Ahmed A.; Gee, Kyle R.; Hoffman, Gregory R.; Webb, Watt W.

2004-01-01

Regulated guanosine nucleotide exchange and hydrolysis constitute the fundamental activities of low molecular weight GTPases. We show that three guanosine 5′-triphosphate analogs with BODIPY fluorophores coupled via the gamma phosphate bind to the GTPases Cdc42, Rac1, RhoA, and Ras and displace guanosine 5′-diphosphate with high intrinsic exchange rates in the presence of Mg2+ ions, thereby acting as synthetic, low molecular weight guanine nucleotide exchange factors. The accompanying large fluorescence enhancements (as high as 12-fold), caused by a reduction in guanine quenching of the environmentally sensitive BODIPY dye fluorescence on protein binding, allow for real-time monitoring of this spontaneous nucleotide exchange in the visible spectrum with high signal-to-noise ratios. Binding affinities increased with longer aliphatic linkers connecting the nucleotide and BODIPY fluorophore and were in the 10–100 nM range. Steady-state and time-resolved fluorescence spectroscopy showed an inverse relationship between linker length and fluorescence enhancement factors and differences in protein-bound fluorophore mobilities, providing optimization criteria for future applications of such compounds as efficient elicitors and reporters of nucleotide exchange. EDTA markedly enhanced nucleotide exchange, enabling rapid loading of GTPases with these probes. Differences in active site geometries, in the absence of Mg2+, caused qualitatively different reporting of the bound state by the different analogs. The BODIPY analogs also prevented the interaction of Cdc42 with p21 activated kinase. Together, these results validate the use of these analogs as valuable tools for studying GTPase functions and for developing potent synthetic nucleotide exchange factors for this important class of signaling molecules. PMID:14973186

A combination of SILAC and nucleotide acyl phosphate labelling reveals unexpected targets of the Rsk inhibitor BI-D1870.

PubMed

Edgar, Alexander J; Trost, Matthias; Watts, Colin; Zaru, Rossana

2014-02-01

Protein kinase inhibitors frequently have interesting effects that cannot be fully ascribed to the intended target kinase(s) but identifying additional targets that might explain the effects is not straightforward. By comparing two different inhibitors of the Rsk (p90 ribosomal S6 kinase) kinases, we found that the increasingly used compound BI-D1870 had biological effects in murine DCs (dendritic cells) that could not be solely ascribed to Rsk or other documented targets. We assessed the ability of BI-D1870 and a second Rsk inhibitor, BIX 02565 to protect enzyme active sites from reaction with biotinylated nucleotide acyl phosphates. Using SILAC (stable isotope labelling by amino acids in cell culture)-labelled DC lysates as a source of enzyme targets, we identify several kinases that interact with BI-D1870 but not with BIX 02565. We confirmed that these kinases, including Slk, Lok and Mst1, are inhibited by BI-D1870 but to a much lesser extent by BIX 02565 and that phosphorylation of some of their substrates is blocked by BI-D1870 in living cells. Our results suggest that the BI-D1870 inhibitor should be used with caution. The SILAC-based methodology we used should be useful for further comparative unbiased profiling of the target spectrum of kinase inhibitors with interesting biological effects under conditions that closely mimic those found in cells. © 2014 The author(s).

One-step nucleotide-programmed growth of porous upconversion nanoparticles: application to cell labeling and drug delivery

NASA Astrophysics Data System (ADS)

Zhou, Li; Li, Zhenhua; Liu, Zhen; Yin, Meili; Ren, Jinsong; Qu, Xiaogang

2014-01-01

A simple and ``green'' strategy has been reported for the first time to fabricate upconversion nanoparticles (UCNPs) by utilizing nucleotides as bio-templates. The influence of the functionalities present on the nucleotide on the production of nanoparticles was investigated in detail. Through the effects of nucleotides, the obtained nanoparticles possessed a porous structure. The use of the as-prepared UCNPs for cell imaging, drug delivery and versatile therapy applications were demonstrated. In view of the bright up-conversion luminescence as well as the excellent biocompatibility, and the good colloidal stability of the as-prepared UCNPs, we envision that our synthesis protocol might advance both the fields of UCNPs and biomolecule-based nanotechnology for future studies.A simple and ``green'' strategy has been reported for the first time to fabricate upconversion nanoparticles (UCNPs) by utilizing nucleotides as bio-templates. The influence of the functionalities present on the nucleotide on the production of nanoparticles was investigated in detail. Through the effects of nucleotides, the obtained nanoparticles possessed a porous structure. The use of the as-prepared UCNPs for cell imaging, drug delivery and versatile therapy applications were demonstrated. In view of the bright up-conversion luminescence as well as the excellent biocompatibility, and the good colloidal stability of the as-prepared UCNPs, we envision that our synthesis protocol might advance both the fields of UCNPs and biomolecule-based nanotechnology for future studies. Electronic supplementary information (ESI) available: Supporting figures. See DOI: 10.1039/c3nr04255c

The A2 Adenosine Receptor: Guanine Nucleotide Modulation of Agonist Binding Is Enhanced by Proteolysis

PubMed Central

NANOFF, CHRISTIAN; JACOBSON, KENNETH A.; STILES, GARY L.

2012-01-01

SUMMARY Agonist binding to the A2 adenosine receptor (A2AR) and its regulation by guanine nucleotides was studied using the newly developed radioligand 125l-2-[4-(2-{2-[(4-ammnophenyl)methylcarbonylamino]ethylaminnocarbonyl}ethyl)phenyl]ethylamino-5′-N-ethylcarboxamidoadenosine (1251-PAPA-APEC) and its photoaffinity analog 125l-azido-PAPA-APEC. A single protein of Mr 45,000, displaying the appropriate A2AR pharmacology, is Iabeled in membranes from bovine striatum, PC12 cells, and frog erythrocytes. In DDT1 MF2 cells the labeled protein has a slightly lower molecular weight. Incorporation of 125l-azido-PAPA-APEC into membranes from rabbit striatum, however, reveals two specifically labeled peptides (Mr ~47,O00 and 38,000), both of which display A2AR pharmacology. Inhibition of protease activity leads to a decrease in the amount of the Mr 38,000 protein, with only the Mr 47,000 protein remaining. This suggests that the Mr 38,000 peptide is a proteolytic product of the Mr 47,000 A2AR protein. In membranes containing the intact undigested A2AR protein, guanine nucleotides induce a small to insignificant decrease in agonist binding, which is atypical of stimulatory Gs-coupled receptors. This minimal effect is observed in rabbit striatal membranes prepared in the presence of protease inhibitors, as well as in the other tissues studied. Binding to rabbit stnatal membranes that possess the partially digested receptor protein, however, reveals a 50% reduction in maximal specific agonist binding upon addition of guanine nucleotides. Inhibition of proteolysis in rabbit striatum, on the other hand, results in a diminished ability of guanine nucleotides to regulate agonist binding. Thus, the enhanced effectiveness of guanine nucleotides in rabbit striatal membranes is associated with the generation of the Mr 38,000 peptide fragment. Guanosine 5′-(β,γ-imido)triphosphate reduces photoaffinity labeling by 55% in the Mr 38,000 protein, whereas the labeling is decreased by

Label-free isolation and deposition of single bacterial cells from heterogeneous samples for clonal culturing

NASA Astrophysics Data System (ADS)

Riba, J.; Gleichmann, T.; Zimmermann, S.; Zengerle, R.; Koltay, P.

2016-09-01

The isolation and analysis of single prokaryotic cells down to 1 μm and less in size poses a special challenge and requires micro-engineered devices to handle volumes in the picoliter to nanoliter range. Here, an advanced Single-Cell Printer (SCP) was applied for automated and label-free isolation and deposition of bacterial cells encapsulated in 35 pl droplets by inkjet-like printing. To achieve this, dispenser chips to generate micro droplets have been fabricated with nozzles 20 μm in size. Further, the magnification of the optical system used for cell detection was increased. Redesign of the optical path allows for collision-free addressing of any flat substrate since no compartment protrudes below the nozzle of the dispenser chip anymore. The improved system allows for deterministic isolation of individual bacterial cells. A single-cell printing efficiency of 93% was obtained as shown by printing fluorescent labeled E. coli. A 96-well plate filled with growth medium is inoculated with single bacteria cells on average within about 8 min. Finally, individual bacterial cells from a heterogeneous sample of E. coli and E. faecalis were isolated for clonal culturing directly on agar plates in user-defined array geometry.

Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

PubMed Central

Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

2014-01-01

Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

ERIC Educational Resources Information Center

Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

2012-01-01

Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Site-specific labeling of RNA at internal ribose hydroxyl groups: terbium-assisted deoxyribozymes at work.

PubMed

Büttner, Lea; Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia

2014-06-04

A general and efficient single-step method was established for site-specific post-transcriptional labeling of RNA. Using Tb(3+) as accelerating cofactor for deoxyribozymes, various labeled guanosines were site-specifically attached to 2'-OH groups of internal adenosines in in vitro transcribed RNA. The DNA-catalyzed 2',5'-phosphodiester bond formation proceeded efficiently with fluorescent, spin-labeled, biotinylated, or cross-linker-modified guanosine triphosphates. The sequence context of the labeling site was systematically analyzed by mutating the nucleotides flanking the targeted adenosine. Labeling of adenosines in a purine-rich environment showed the fastest reactions and highest yields. Overall, practically useful yields >70% were obtained for 13 out of 16 possible nucleotide (nt) combinations. Using this approach, we demonstrate preparative labeling under mild conditions for up to ~160-nt-long RNAs, including spliceosomal U6 small nuclear RNA and a cyclic-di-AMP binding riboswitch RNA.

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Mosaic organization of DNA nucleotides

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

1994-01-01

Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

Heavy atom labeled nucleotides for measurement of kinetic isotope effects.

PubMed

Weissman, Benjamin P; Li, Nan-Sheng; York, Darrin; Harris, Michael; Piccirilli, Joseph A

2015-11-01

Experimental analysis of kinetic isotope effects represents an extremely powerful approach for gaining information about the transition state structure of complex reactions not available through other methodologies. The implementation of this approach to the study of nucleic acid chemistry requires the synthesis of nucleobases and nucleotides enriched for heavy isotopes at specific positions. In this review, we highlight current approaches to the synthesis of nucleic acids enriched site specifically for heavy oxygen and nitrogen and their application in heavy atom isotope effect studies. This article is part of a special issue titled: Enzyme Transition States from Theory and Experiment. Copyright © 2015 Elsevier B.V. All rights reserved.

Benzofurazane as a new redox label for electrochemical detection of DNA: towards multipotential redox coding of DNA bases.

PubMed

Balintová, Jana; Plucnara, Medard; Vidláková, Pavlína; Pohl, Radek; Havran, Luděk; Fojta, Miroslav; Hocek, Michal

2013-09-16

Benzofurazane has been attached to nucleosides and dNTPs, either directly or through an acetylene linker, as a new redox label for electrochemical analysis of nucleotide sequences. Primer extension incorporation of the benzofurazane-modified dNTPs by polymerases has been developed for the construction of labeled oligonucleotide probes. In combination with nitrophenyl and aminophenyl labels, we have successfully developed a three-potential coding of DNA bases and have explored the relevant electrochemical potentials. The combination of benzofurazane and nitrophenyl reducible labels has proved to be excellent for ratiometric analysis of nucleotide sequences and is suitable for bioanalytical applications. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electrochemical primer extension based on polyoxometalate electroactive labels for multiplexed detection of single nucleotide polymorphisms.

PubMed

Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K

2018-06-07

Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.

Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

PubMed

Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

2017-04-18

Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

Gold Nanoparticle Labels and Heterogeneous Immunoassays: The Case for the Inverted Substrate.

PubMed

Crawford, Alexis C; Young, Colin C; Porter, Marc D

2018-06-15

This paper examines how the difference in the spatial orientation of the capture substrate influences the analytical sensitivity and limits of detection for immunoassays that use gold nanoparticle labels (AuNPs) and rely on diffusion in quiet solution in the antigen capture and labeling steps. Ideally, the accumulation of both reactants should follow a dependence governed by the rate in which diffusion delivers reactants to the capture surface. In other words, the accumulation of reactants should increase with the square root of the incubation time, i.e., t1/2. The work herein shows, however, that this expectation is only obeyed when the capture substrate is oriented to direct the gravity-induced sedimentation of the AuNP labels away from the substrate. Using an assay for human IgG, the results show that circumventing the sedimentation of the gold nanoparticle labels by substrate inversion enables the dependence of the labeling step on diffusion, reduces nonspecific label adsorption, and improves the estimated detection limit by ~30×. High-density maps of the signal across the two types of substrates also demonstrate that inversion in the labeling step results in a more uniform distribution of AuNP labels across the surface, which translates to a greater measurement reproducibility. These results, which are supported by model simulations via the Mason-Weaver sedimentation-diffusion equation, and their potential implications when using other nanoparticle labels and related materials in diagnostic tests and other applications, are briefly discussed.

Responses of Adenine Nucleotides in Germinating Soybean Embryonic Axes to Exogenously Applied Adenine and Adenosine

PubMed Central

Anderson, James D.

1977-01-01

The ATP content of soybean (Glycine max [L.] Merr. cv. Kent) axes incubated for 3 hours in 1 mm solutions of adenine and adenosine increased over 100% and 75%, respectively, over axes incubated in water. The increase in ATP was primarily due to the conversion of these purines to nucleotides via the nucleotide salvage pathway. The ATP formed was in a metabolically active pool because label from adenine was incorporated into acid-insoluble material. Adenine also increased the levels of GTP, UTP, and CTP, but not to the extent of the ATP level. PMID:16660165

Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

PubMed

Winterhagen, Patrick; Wünsche, Jens-Norbert

2016-05-01

Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

HPLC-based quantification of bacterial housekeeping nucleotides and alarmone messengers ppGpp and pppGpp.

PubMed

Varik, Vallo; Oliveira, Sofia Raquel Alves; Hauryliuk, Vasili; Tenson, Tanel

2017-09-08

Here we describe an HPLC-based method to quantify bacterial housekeeping nucleotides and the signaling messengers ppGpp and pppGpp. We have replicated and tested several previously reported HPLC-based approaches and assembled a method that can process 50 samples in three days, thus making kinetically resolved experiments feasible. The method combines cell harvesting by rapid filtration, followed by acid extraction, freeze-drying with chromatographic separation. We use a combination of C18 IPRP-HPLC (GMP unresolved and co-migrating with IMP; GDP and GTP; AMP, ADP and ATP; CTP; UTP) and SAX-HPLC in isocratic mode (ppGpp and pppGpp) with UV detection. The approach is applicable to bacteria without the requirement of metabolic labelling with 32P-labelled radioactive precursors. We applied our method to quantify nucleotide pools in Escherichia coli BW25113 K12-strain both throughout the growth curve and during acute stringent response induced by mupirocin. While ppGpp and pppGpp levels vary drastically (40- and ≥8-fold, respectively) these changes are decoupled from the quotients of the housekeeping pool and guanosine and adenosine housekeeping nucleotides: NTP/NDP/NMP ratio remains stable at 6/1/0.3 during both normal batch culture growth and upon acute amino acid starvation.

A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

PubMed

López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

2012-06-01

The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

Organizational heterogeneity of vertebrate genomes.

PubMed

Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

2012-01-01

Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Purine Nucleotide Metabolism of Germinating Soybean Embryonic Axes

PubMed Central

Anderson, James D.

1979-01-01

Isolated soybean (Glycine max L. cv. Kent) embyronic axes metabolized [14C]glycine to ATP within the 1 hour of imbibition. Radioactivity was not detected in GTP until the 3rd hour. Throughout most of the first 24 hours of germination about 10 to 26 times as much label from [14C]glycine appears in ATP as GTP. About five times as much [14C]hypoxanthine and [14C]inosine was converted into GTP as into ATP in embryonic axes. Two independent pools of IMP appear to be used in purine nucleotide synthesis of soybean axes. PMID:16660656

A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

PubMed

Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

2014-11-24

Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

PubMed

Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

2015-09-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

PubMed Central

Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

2015-01-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

Phenolic amides are potent inhibitors of De Novo nucleotide biosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposuremore » leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [ 15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. Furthermore, the results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals.« less

Phenolic amides are potent inhibitors of De Novo nucleotide biosynthesis

DOE PAGES

Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; ...

2015-06-12

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposuremore » leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [ 15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. Furthermore, the results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals.« less

Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

NASA Astrophysics Data System (ADS)

Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

2014-03-01

DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Self-reference and random sampling approach for label-free identification of DNA composition using plasmonic nanomaterials.

PubMed

Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu

2018-05-09

The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.

Origin and analysis of microbial population heterogeneity in bioprocesses.

PubMed

Müller, Susann; Harms, Hauke; Bley, Thomas

2010-02-01

Heterogeneity of industrial production cultures is accepted to a certain degree; however, the underlying mechanisms are seldom perceived or included in the development of new bioprocess control strategies. Population heterogeneity and its basics, perceptible in the diverse proficiency of cells, begins with asymmetric birth and is found to recess during the life cycle. Since inefficient subpopulations have significant impact on the productivity of industrial cultures, cellular heterogeneity needs to be detected and quantified by using high speed detection tools like flow cytometry. Possible origins of population heterogeneity, sophisticated fluorescent techniques for detection of individual cell states, and cutting-edge Omics-technologies for extended information beyond the resolution of fluorescent labelling are highlighted.

Direct photoaffinity labeling of an allosteric site on subunit protein M1 of mouse ribonucleotide reductase by dTTP.

PubMed Central

Eriksson, S; Caras, I W; Martin, D W

1982-01-01

The protein M1 subunit of ribonucleotide reductase contains at least two allosteric nucleotide binding sites that control the capacity of the enzyme to reduce ribonucleotides to the deoxyribonucleotides required for DNA synthesis. Direct photoaffinity labeling of partially purified protein M1 from mouse T-lymphoma (S49) cells was observed after UV irradiation in the presence of dTTP at 0 degrees C. The relative molar incorporation of nucleotide per subunit was 4-8%. Competition experiments showed that the dTTP was bound to an allosteric domain genetically and kinetically defined as the substrate specificity site of the enzyme. An altered protein M1 isolated from a thymidine-resistant mutant cell line showed significantly decreased photoincorporation of dTTP, consistent with the fact that its CDP reductase activity is resistant to feedback inhibition by dTTP. Specific photolabeling of several other proteins with pyrimidine and purine nucleotides was also found, indicating the general usefulness of direct photoaffinity labeling in the study of enzymes involved in nucleotide and nucleic acid metabolism. Images PMID:7033963

Coupling between nucleotide excision repair and gene expression.

PubMed

Cambindo Botto, Adrián E; Muñoz, Juan C; Muñoz, Manuel J

2018-05-17

Gene expression and DNA repair are fundamental processes for life. During the last decade, accumulating experimental evidence point towards different modes of coupling between these processes. Here we discuss the molecular mechanisms by which RNAPII-dependent transcription affects repair by the Nucleotide Excision Repair system (NER) and how NER activity, through the generation of single stranded DNA intermediates and activation of the DNA damage response kinase ATR, drives gene expression in a genotoxic scenario. Since NER-dependent repair is compromised in Xeroderma Pigmentosum (XP) patients, and having in mind that these patients present a high degree of clinical heterogeneity, we speculate that some of the clinical features of XP patients can be explained by misregulation of gene expression.

Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

PubMed

Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

2013-10-01

Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

PubMed

Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

2011-06-15

A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

Profiling of Sugar Nucleotides.

PubMed

Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A

2017-01-01

Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.

Single-molecule studies highlight conformational heterogeneity in the early folding steps of a large ribozyme

PubMed Central

Xie, Zheng; Srividya, Narayanan; Sosnick, Tobin R.; Pan, Tao; Scherer, Norbert F.

2004-01-01

The equilibrium folding of the catalytic domain of Bacillus subtilis RNase P RNA is investigated by single-molecule fluorescence resonance energy transfer (FRET). Previous ensemble studies of this 255-nucleotide ribozyme described the equilibrium folding with two transitions, U-to-Ieq-to-N, and focused on the Ieq-to-N transition. The present study focuses on the U-to-Ieq transition. Comparative ensemble measurements of the ribozyme construct labeled with fluorescein at the 5′ end and Cy3 at the 3′ end show that modifications required for labeling do not interfere with folding and help to define the Mg2+ concentration range for the U-to-Ieq transition. Histogram analysis of the Mg2+-dependent single-molecule FRET efficiency reveals two previously undetermined folding intermediates. The single-molecule FRET trajectories exhibit non-two-state and nonergodic behaviors at intermediate Mg2+ concentrations on the time scale of seconds. The trajectories at intermediate Mg2+ concentrations are classified into five classes based on three FRET levels and their dynamics of interconversion within the measured time range. This heterogeneity, together with the observation of “nonsudden jump” FRET transitions, indicates that the early folding steps of this ribozyme involve a series of intermediates with different degrees of kinetic isolation and that folding occurs under kinetic control and involves many “local” conformational switches. A free energy contour is constructed to illustrate the complex folding surface. PMID:14704266

Genome-wide heterogeneity of nucleotide substitution model fit.

PubMed

Arbiza, Leonardo; Patricio, Mateus; Dopazo, Hernán; Posada, David

2011-01-01

At a genomic scale, the patterns that have shaped molecular evolution are believed to be largely heterogeneous. Consequently, comparative analyses should use appropriate probabilistic substitution models that capture the main features under which different genomic regions have evolved. While efforts have concentrated in the development and understanding of model selection techniques, no descriptions of overall relative substitution model fit at the genome level have been reported. Here, we provide a characterization of best-fit substitution models across three genomic data sets including coding regions from mammals, vertebrates, and Drosophila (24,000 alignments). According to the Akaike Information Criterion (AIC), 82 of 88 models considered were selected as best-fit models at least in one occasion, although with very different frequencies. Most parameter estimates also varied broadly among genes. Patterns found for vertebrates and Drosophila were quite similar and often more complex than those found in mammals. Phylogenetic trees derived from models in the 95% confidence interval set showed much less variance and were significantly closer to the tree estimated under the best-fit model than trees derived from models outside this interval. Although alternative criteria selected simpler models than the AIC, they suggested similar patterns. All together our results show that at a genomic scale, different gene alignments for the same set of taxa are best explained by a large variety of different substitution models and that model choice has implications on different parameter estimates including the inferred phylogenetic trees. After taking into account the differences related to sample size, our results suggest a noticeable diversity in the underlying evolutionary process. All together, we conclude that the use of model selection techniques is important to obtain consistent phylogenetic estimates from real data at a genomic scale.

Pointwise mutual information quantifies intratumor heterogeneity in tissue sections labeled with multiple fluorescent biomarkers

PubMed Central

Spagnolo, Daniel M.; Gyanchandani, Rekha; Al-Kofahi, Yousef; Stern, Andrew M.; Lezon, Timothy R.; Gough, Albert; Meyer, Dan E.; Ginty, Fiona; Sarachan, Brion; Fine, Jeffrey; Lee, Adrian V.; Taylor, D. Lansing; Chennubhotla, S. Chakra

2016-01-01

Background: Measures of spatial intratumor heterogeneity are potentially important diagnostic biomarkers for cancer progression, proliferation, and response to therapy. Spatial relationships among cells including cancer and stromal cells in the tumor microenvironment (TME) are key contributors to heterogeneity. Methods: We demonstrate how to quantify spatial heterogeneity from immunofluorescence pathology samples, using a set of 3 basic breast cancer biomarkers as a test case. We learn a set of dominant biomarker intensity patterns and map the spatial distribution of the biomarker patterns with a network. We then describe the pairwise association statistics for each pattern within the network using pointwise mutual information (PMI) and visually represent heterogeneity with a two-dimensional map. Results: We found a salient set of 8 biomarker patterns to describe cellular phenotypes from a tissue microarray cohort containing 4 different breast cancer subtypes. After computing PMI for each pair of biomarker patterns in each patient and tumor replicate, we visualize the interactions that contribute to the resulting association statistics. Then, we demonstrate the potential for using PMI as a diagnostic biomarker, by comparing PMI maps and heterogeneity scores from patients across the 4 different cancer subtypes. Estrogen receptor positive invasive lobular carcinoma patient, AL13-6, exhibited the highest heterogeneity score among those tested, while estrogen receptor negative invasive ductal carcinoma patient, AL13-14, exhibited the lowest heterogeneity score. Conclusions: This paper presents an approach for describing intratumor heterogeneity, in a quantitative fashion (via PMI), which departs from the purely qualitative approaches currently used in the clinic. PMI is generalizable to highly multiplexed/hyperplexed immunofluorescence images, as well as spatial data from complementary in situ methods including FISSEQ and CyTOF, sampling many different components

Pointwise mutual information quantifies intratumor heterogeneity in tissue sections labeled with multiple fluorescent biomarkers.

PubMed

Spagnolo, Daniel M; Gyanchandani, Rekha; Al-Kofahi, Yousef; Stern, Andrew M; Lezon, Timothy R; Gough, Albert; Meyer, Dan E; Ginty, Fiona; Sarachan, Brion; Fine, Jeffrey; Lee, Adrian V; Taylor, D Lansing; Chennubhotla, S Chakra

2016-01-01

Measures of spatial intratumor heterogeneity are potentially important diagnostic biomarkers for cancer progression, proliferation, and response to therapy. Spatial relationships among cells including cancer and stromal cells in the tumor microenvironment (TME) are key contributors to heterogeneity. We demonstrate how to quantify spatial heterogeneity from immunofluorescence pathology samples, using a set of 3 basic breast cancer biomarkers as a test case. We learn a set of dominant biomarker intensity patterns and map the spatial distribution of the biomarker patterns with a network. We then describe the pairwise association statistics for each pattern within the network using pointwise mutual information (PMI) and visually represent heterogeneity with a two-dimensional map. We found a salient set of 8 biomarker patterns to describe cellular phenotypes from a tissue microarray cohort containing 4 different breast cancer subtypes. After computing PMI for each pair of biomarker patterns in each patient and tumor replicate, we visualize the interactions that contribute to the resulting association statistics. Then, we demonstrate the potential for using PMI as a diagnostic biomarker, by comparing PMI maps and heterogeneity scores from patients across the 4 different cancer subtypes. Estrogen receptor positive invasive lobular carcinoma patient, AL13-6, exhibited the highest heterogeneity score among those tested, while estrogen receptor negative invasive ductal carcinoma patient, AL13-14, exhibited the lowest heterogeneity score. This paper presents an approach for describing intratumor heterogeneity, in a quantitative fashion (via PMI), which departs from the purely qualitative approaches currently used in the clinic. PMI is generalizable to highly multiplexed/hyperplexed immunofluorescence images, as well as spatial data from complementary in situ methods including FISSEQ and CyTOF, sampling many different components within the TME. We hypothesize that PMI will

NMR studies of two spliced leader RNAs using isotope labeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lapham, J.; Crothers, D.M.

1994-12-01

Spliced leader RNAs are a class of RNA molecules (<200 nts) involved in the trans splicing of messenger RNA found in trypanosomes, nematodes, and other lower eukaryotes. The spliced leader RNA from the trypanosome Leptomonas Collosoma exists in two alternate structural forms with similar thermal stabilities. The 54 nucleotides on the 5{prime} end of the SL molecule is structurally independent from the 3{prime} half of the RNA, and displays the two structural forms. Furthermore, the favored of the two structures was shown to contain anomalous nuclease sensitivity and thermal stability features, which suggests that there may be tertiary interactions betweenmore » the splice site and other nucleotides in the 5{prime} end. Multidimensional NMR studies are underway to elucidate the structural elements present in the SL RNAs that give rise to their physical properties. Two spliced leader sequences have been studied. The first, the 54 nucleotides on the 5{prime} end of the L. Collosoma sequence, was selected because of earlier studies in our laboratory. The second sequence is the 5{prime} end of the trypanosome Crithidia Fasciculata, which was chosen because of its greater sequence homology to other SL sequences. Given the complexity of the NMR spectra for RNA molecules of this size, we have incorporated {sup 15}N/{sup 13}C-labeled nucleotides into the RNA. One of the techniques we have developed to simplify the spectra of these RNA molecules is isotope labeling of specific regions of the RNA. This has been especially helpful in assigning the secondary structure of molecules that may be able to adopt multiple conformations. Using this technique one can examine a part of the molecule without spectral interference from the unlabeled portion. We hope this approach will promote an avenue for studying the structure of larger RNAs in their native surroundings.« less

Profiles of the biosynthesis and metabolism of pyridine nucleotides in potatoes (Solanum tuberosum L.).

PubMed

Katahira, Riko; Ashihara, Hiroshi

2009-12-01

As part of a research program on nucleotide metabolism in potato tubers (Solanum tuberosum L.), profiles of pyridine (nicotinamide) metabolism were examined based on the in situ metabolic fate of radio-labelled precursors and the in vitro activities of enzymes. In potato tubers, [(3)H]quinolinic acid, which is an intermediate of de novo pyridine nucleotide synthesis, and [(14)C]nicotinamide, a catabolite of NAD, were utilised for pyridine nucleotide synthesis. The in situ tracer experiments and in vitro enzyme assays suggest the operation of multiple pyridine nucleotide cycles. In addition to the previously proposed cycle consisting of seven metabolites, we found a new cycle that includes newly discovered nicotinamide riboside deaminase which is also functional in potato tubers. This cycle bypasses nicotinamide and nicotinic acid; it is NAD --> nicotinamide mononucleotide --> nicotinamide riboside --> nicotinic acid riboside --> nicotinic acid mononucleotide --> nicotinic acid adenine dinucleotide --> NAD. Degradation of the pyridine ring was extremely low in potato tubers. Nicotinic acid glucoside is formed from nicotinic acid in potato tubers. Comparative studies of [carboxyl-(14)C]nicotinic acid metabolism indicate that nicotinic acid is converted to nicotinic acid glucoside in all organs of potato plants. Trigonelline synthesis from [carboxyl-(14)C]nicotinic acid was also found. Conversion was greater in green parts of plants, such as leaves and stem, than in underground parts of potato plants. Nicotinic acid utilised for the biosynthesis of these conjugates seems to be derived not only from the pyridine nucleotide cycle, but also from the de novo synthesis of nicotinic acid mononucleotide.

The Heterogeneity in Retrieved Relations between the Personality Trait ‘Harm Avoidance’ and Gray Matter Volumes Due to Variations in the VBM and ROI Labeling Processing Settings

PubMed Central

Van Schuerbeek, Peter; Baeken, Chris; De Mey, Johan

2016-01-01

Concerns are raising about the large variability in reported correlations between gray matter morphology and affective personality traits as ‘Harm Avoidance’ (HA). A recent review study (Mincic 2015) stipulated that this variability could come from methodological differences between studies. In order to achieve more robust results by standardizing the data processing procedure, as a first step, we repeatedly analyzed data from healthy females while changing the processing settings (voxel-based morphology (VBM) or region-of-interest (ROI) labeling, smoothing filter width, nuisance parameters included in the regression model, brain atlas and multiple comparisons correction method). The heterogeneity in the obtained results clearly illustrate the dependency of the study outcome to the opted analysis settings. Based on our results and the existing literature, we recommended the use of VBM over ROI labeling for whole brain analyses with a small or intermediate smoothing filter (5-8mm) and a model variable selection step included in the processing procedure. Additionally, it is recommended that ROI labeling should only be used in combination with a clear hypothesis and that authors are encouraged to report their results uncorrected for multiple comparisons as supplementary material to aid review studies. PMID:27096608

Systematic Review and Meta-analysis of the Impact of Restaurant Menu Calorie Labeling

PubMed Central

Tobias, Deirdre K.; Cradock, Angie L.; Batchelder, Holly; Gortmaker, Steven L.

2015-01-01

We conducted a systematic review and meta-analysis evaluating the relationship between menu calorie labeling and calories ordered or purchased in the PubMed, Web of Science, PolicyFile, and PAIS International databases through October 2013. Among 19 studies, menu calorie labeling was associated with a −18.13 kilocalorie reduction ordered per meal with significant heterogeneity across studies (95% confidence interval = −33.56, −2.70; P = .021; I2 = 61.0%). However, among 6 controlled studies in restaurant settings, labeling was associated with a nonsignificant −7.63 kilocalorie reduction (95% confidence interval = −21.02, 5.76; P = .264; I2 = 9.8%). Although current evidence does not support a significant impact on calories ordered, menu calorie labeling is a relatively low-cost education strategy that may lead consumers to purchase slightly fewer calories. These findings are limited by significant heterogeneity among nonrestaurant studies and few studies conducted in restaurant settings. PMID:25790388

Isotope labeling for studying RNA by solid-state NMR spectroscopy.

PubMed

Marchanka, Alexander; Kreutz, Christoph; Carlomagno, Teresa

2018-04-12

Nucleic acids play key roles in most biological processes, either in isolation or in complex with proteins. Often they are difficult targets for structural studies, due to their dynamic behavior and high molecular weight. Solid-state nuclear magnetic resonance spectroscopy (ssNMR) provides a unique opportunity to study large biomolecules in a non-crystalline state at atomic resolution. Application of ssNMR to RNA, however, is still at an early stage of development and presents considerable challenges due to broad resonances and poor dispersion. Isotope labeling, either as nucleotide-specific, atom-specific or segmental labeling, can resolve resonance overlaps and reduce the line width, thus allowing ssNMR studies of RNA domains as part of large biomolecules or complexes. In this review we discuss the methods for RNA production and purification as well as numerous approaches for isotope labeling of RNA. Furthermore, we give a few examples that emphasize the instrumental role of isotope labeling and ssNMR for studying RNA as part of large ribonucleoprotein complexes.

Study of mitochondria D-loop gene to detect the heterogeneity of gemak in Turnicidae family

NASA Astrophysics Data System (ADS)

Setiati, N.; Partaya

2018-03-01

As a part of life biodiversity, birds in Turnicidae family should be preserved from the extinction and its type heterogeneity decline. One effort for giving the strategic base of plasma nutfah conservation is through genetic heterogeneity study. The aim of the research is to analyze D-loop gen from DNA mitochondria of gemak bird in Turnicidae family molecularly. From the result of the analysis, it may be known the genetic heterogeneity of gemak bird based on the sequence of D-loop gen. The collection of both types of gemak of Turnicidae family is still easy since we can find them in ricefield area after harvest particularly for Gemakloreng (Turnix sylvatica), it means while gemak tegalan (Turnixsusciator) is getting difficult to find. Based on the above DNA quantification standard, the blood sample of Gemak in this research is mostly grouped into pure blood (ranges from 1,63 – 1,90), and it deserves to be used for PCR analysis. The sequencing analysis has not detected the sequence of nucleotide completely. However, it indicates sequence polymorphism of base as the arranger of D-loop gen. D-loop gen may identify genetic heterogeneity of gemak bird of Turnicidae family, but it is necessary to perform further sequencing analysis with PCR-RFLP technique. This complete nucleotide sequence is obtained and easy to detect after being cut restriction enzyme.

Antinociceptive effect of purine nucleotides.

PubMed

Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

1996-10-01

The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

Behavior Based Social Dimensions Extraction for Multi-Label Classification

PubMed Central

Li, Le; Xu, Junyi; Xiao, Weidong; Ge, Bin

2016-01-01

Classification based on social dimensions is commonly used to handle the multi-label classification task in heterogeneous networks. However, traditional methods, which mostly rely on the community detection algorithms to extract the latent social dimensions, produce unsatisfactory performance when community detection algorithms fail. In this paper, we propose a novel behavior based social dimensions extraction method to improve the classification performance in multi-label heterogeneous networks. In our method, nodes’ behavior features, instead of community memberships, are used to extract social dimensions. By introducing Latent Dirichlet Allocation (LDA) to model the network generation process, nodes’ connection behaviors with different communities can be extracted accurately, which are applied as latent social dimensions for classification. Experiments on various public datasets reveal that the proposed method can obtain satisfactory classification results in comparison to other state-of-the-art methods on smaller social dimensions. PMID:27049849

The regulation of nucleotide metabolism of immune cells: papaverine induced nucleotide breakdown.

PubMed

Sheppard, H; Sass, S; Tsien, W H

1980-06-01

During a period of prelabeling of mouse thymus cells with any nucleoside at 4 degrees C, nucleoside phosphates accumulated, but no nucleic acid synthesis occurred. Elevating the temperature to 37 degrees C then led to incorporation into the respective nucleic acid reaching a maximum in 5--15 min. Papaverine inhibited this incorporation (IC50:50 muM) and caused an efflux of label into the medium as a nonphosphorylated product. The responses of the different nucleotide phosphate pools showed more dependency on the base then the sugar moeity. The effect of papaverine could not be altered or mimicked by deprivation of oxygen, glucose, or calcium. Mouse spleen cells responded like thymocytes to papaverine, but rat GH3 pituitary cell DNA syntesis was only transiently inhibited with no concomitant efflux of 3H into the medium. As expected, thymus cellular adenosine triphosphate (ATP), determined by the luciferin-luciferase reaction, decreased in the presence of papaverine; suprisingly, extracellular ATP fell as well. The results suggest that decreases in cellular ATP of mouse thymus cells leads to reductions of all nucleoside phosphates and the efflux of the resultant nucleosides. Papaverine may effect a decrease in the ATP levels by activating a phosphohydrolase rather than, or in addition to, the previously suggested inhibition of mitochondrial electron transport.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

FLUORESCENT IN SITU DETECTION OF ENCEPHALITOZOON HELLEM SPORES WITH A 6-CARBOXYFLUORESCEIN-LABELED RNA-TARGETED OLIGONUCLEOTIDE PROBE

EPA Science Inventory

A fluorescent in situ hybridization assay has been developed for the detection of the human-pathogenic microsporidian, Encephalitozoon hellem, in water samples using epifluorescence microscopy. The assay employs a 19-nucleotide species-specific 6-carboxyfluorescein-labeled oligo...

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Multi-Isotope Secondary Ion Mass Spectrometry Combining Heavy Water 2H with 15N Labeling As Complementary Tracers for Metabolic Heterogeneity at the Single-Cell Level

NASA Astrophysics Data System (ADS)

Kopf, S.; McGlynn, S.; Cowley, E.; Green, A.; Newman, D. K.; Orphan, V. J.

2014-12-01

Metabolic rates of microbial communities constitute a key physiological parameter for understanding the in situ growth constraints for life in any environment. Isotope labeling techniques provide a powerful approach for measuring such biological activity, due to the use of isotopically enriched substrate tracers whose incorporation into biological materials can be detected with high sensitivity by isotope-ratio mass spectrometry. Nano-meter scale secondary ion mass spectrometry (NanoSIMS) combined with stable isotope labeling provides a unique tool for studying the spatiometabolic activity of microbial populations at the single cell level in order to assess both community structure and population diversity. However, assessing the distribution and range of microbial activity in complex environmental systems with slow-growing organisms, diverse carbon and nitrogen sources, or heterotrophic subpopulations poses a tremendous technical challenge because the introduction of isotopically labeled substrates frequently changes the nutrient availability and can inflate or bias measures of activity. Here, we present the use of hydrogen isotope labeling with deuterated water as an important new addition to the isotopic toolkit and apply it for the determination of single cell microbial activities by NanoSIMS imaging. This tool provides a labeling technique that minimally alters any aquatic chemical environment, can be administered with strong labels even in minimal addition (natural background is very low), is an equally universal substrate for all forms of life even in complex, carbon and nitrogen saturated systems, and can be combined with other isotopic tracers. The combination of heavy water labeling with the most commonly used NanoSIMS tracer, 15N, is technically challenging but opens up a powerful new set of multi-tracer experiments for the study of microbial activity in complex communities. We present the first truly simultaneous single cell triple isotope system

Probing the nucleotide binding domain of the osmoregulator EnvZ using fluorescent nucleotide derivatives.

PubMed

Plesniak, Leigh; Horiuchi, Yuki; Sem, Daniel; Meinenger, David; Stiles, Linda; Shaffer, Jennifer; Jennings, Patricia A; Adams, Joseph A

2002-11-26

EnvZ is a histidine protein kinase important for osmoregulation in bacteria. While structural data are available for this enzyme, the nucleotide binding pocket is not well characterized. The ATP binding domain (EnvZB) was expressed, and its ability to bind nucleotide derivatives was assessed using equilbrium and stopped-flow fluorescence spectroscopy. The fluorescence emission of the trinitrophenyl derivatives, TNP-ATP and TNP-ADP, increase upon binding to EnvZB. The fluorescence enhancements were quantitatively abolished in the presence of excess ADP, indicating that the fluorescent probes occupy the nucleotide binding pocket. Both TNP-ATP and TNP-ADP bind to EnvZB with high affinity (K(d) = 2-3 microM). The TNP moiety attached to the ribose ring does not impede access of the fluorescent nucleotide into the binding pocket. The association rate constant for TNP-ADP is 7 microM(-1) s(-1), a value consistent with those for natural nucleotides and the eucaryotic protein kinases. Using competition experiments, it was found that ATP and ADP bind 30- and 150-fold more poorly, respectively, than the corresponding TNP-derivatized forms. Surprisingly, the physiological metal Mg(2+) is not required for ADP binding and only enhances ATP affinity by 3-fold. Although portions of the nucleotide pocket are disordered, the recombinant enzyme is highly stable, unfolding only at temperatures in excess of 70 degrees C. The unusually high affinity of the TNP derivatives compared to the natural nucleotides suggests that hydrophobic substitutions on the ribose ring enforce an altered binding mode that may be exploited for drug design strategies.

Relative similarity within purine nucleotide and ligand structures operating on nitric oxide synthetase, guanylyl cyclase and potassium (K ATP, BK Ca) channels.

PubMed

Williams, W Robert

2011-01-01

Purine nucleotides play a central role in signal transduction events initiated at the cell membrane. The NO-cGMP-cGK pathway, in particular, mediates events involving NOS and some classes of K(+) ion channel. The aim of this study is to investigate relative molecular similarity within the ligands binding to NOS, K(ATP), BK(Ca) channels and regulatory nucleotides. Minimum energy conformers of the ligand structures were superimposed and fitted to L-arginine and the nucleotides of adenine and guanine using a computational program. Distinctive patterns were evident in the fitting of NOS isoform antagonists to L-arginine. K(ATP) channel openers and antagonists superimposed on the glycosidic linkage and imidazole ring of the purine nucleotides, and guanidinium and ribose groups of GTP in the case of glibenclamide. The fits of BK(Ca) channel openers and antagonists to cGMP were characterized by the linear dimensions of their structures; distances between terminal oxy groups in respect of dexamethasone and aldosterone. The findings provide structural evidence for the functional interaction between K(+) channel openers/antagonists and the regulatory nucleotides. Use of the purine nucleotide template systematizes the considerable heterogeneity evident within the structures of ligands operating on K(+) ion channels. © 2010 The Author. JPP © 2010 Royal Pharmaceutical Society.

Robust Statistical Fusion of Image Labels

PubMed Central

Landman, Bennett A.; Asman, Andrew J.; Scoggins, Andrew G.; Bogovic, John A.; Xing, Fangxu; Prince, Jerry L.

2011-01-01

Image labeling and parcellation (i.e. assigning structure to a collection of voxels) are critical tasks for the assessment of volumetric and morphometric features in medical imaging data. The process of image labeling is inherently error prone as images are corrupted by noise and artifacts. Even expert interpretations are subject to subjectivity and the precision of the individual raters. Hence, all labels must be considered imperfect with some degree of inherent variability. One may seek multiple independent assessments to both reduce this variability and quantify the degree of uncertainty. Existing techniques have exploited maximum a posteriori statistics to combine data from multiple raters and simultaneously estimate rater reliabilities. Although quite successful, wide-scale application has been hampered by unstable estimation with practical datasets, for example, with label sets with small or thin objects to be labeled or with partial or limited datasets. As well, these approaches have required each rater to generate a complete dataset, which is often impossible given both human foibles and the typical turnover rate of raters in a research or clinical environment. Herein, we propose a robust approach to improve estimation performance with small anatomical structures, allow for missing data, account for repeated label sets, and utilize training/catch trial data. With this approach, numerous raters can label small, overlapping portions of a large dataset, and rater heterogeneity can be robustly controlled while simultaneously estimating a single, reliable label set and characterizing uncertainty. The proposed approach enables many individuals to collaborate in the construction of large datasets for labeling tasks (e.g., human parallel processing) and reduces the otherwise detrimental impact of rater unavailability. PMID:22010145

Single-cell mRNA sequencing identifies subclonal heterogeneity in anti-cancer drug responses of lung adenocarcinoma cells.

PubMed

Kim, Kyu-Tae; Lee, Hye Won; Lee, Hae-Ock; Kim, Sang Cheol; Seo, Yun Jee; Chung, Woosung; Eum, Hye Hyeon; Nam, Do-Hyun; Kim, Junhyong; Joo, Kyeung Min; Park, Woong-Yang

2015-06-19

Intra-tumoral genetic and functional heterogeneity correlates with cancer clinical prognoses. However, the mechanisms by which intra-tumoral heterogeneity impacts therapeutic outcome remain poorly understood. RNA sequencing (RNA-seq) of single tumor cells can provide comprehensive information about gene expression and single-nucleotide variations in individual tumor cells, which may allow for the translation of heterogeneous tumor cell functional responses into customized anti-cancer treatments. We isolated 34 patient-derived xenograft (PDX) tumor cells from a lung adenocarcinoma patient tumor xenograft. Individual tumor cells were subjected to single cell RNA-seq for gene expression profiling and expressed mutation profiling. Fifty tumor-specific single-nucleotide variations, including KRAS(G12D), were observed to be heterogeneous in individual PDX cells. Semi-supervised clustering, based on KRAS(G12D) mutant expression and a risk score representing expression of 69 lung adenocarcinoma-prognostic genes, classified PDX cells into four groups. PDX cells that survived in vitro anti-cancer drug treatment displayed transcriptome signatures consistent with the group characterized by KRAS(G12D) and low risk score. Single-cell RNA-seq on viable PDX cells identified a candidate tumor cell subgroup associated with anti-cancer drug resistance. Thus, single-cell RNA-seq is a powerful approach for identifying unique tumor cell-specific gene expression profiles which could facilitate the development of optimized clinical anti-cancer strategies.

[Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

PubMed

Wu, Lei; He, Yao; Zhang, Di

2015-11-01

To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

Internucleotide correlations and nucleotide periodicity in Drosophila mtDNA: new evidence for panselective evolution.

PubMed

Valenzuela, Carlos Y

2010-01-01

Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA), the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9) was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.

Learning from Data with Heterogeneous Noise using SGD

PubMed Central

Song, Shuang; Chaudhuri, Kamalika; Sarwate, Anand D.

2015-01-01

We consider learning from data of variable quality that may be obtained from different heterogeneous sources. Addressing learning from heterogenous data in its full generality is a challenging problem. In this paper, we adopt instead a model in which data is observed through heterogeneous noise, where the noise level reflects the quality of the data source. We study how to use stochastic gradient algorithms to learn in this model. Our study is motivated by two concrete examples where this problem arises naturally: learning with local differential privacy based on data from multiple sources with different privacy requirements, and learning from data with labels of variable quality. The main contribution of this paper is to identify how heterogeneous noise impacts performance. We show that given two datasets with heterogeneous noise, the order in which to use them in standard SGD depends on the learning rate. We propose a method for changing the learning rate as a function of the heterogeneity, and prove new regret bounds for our method in two cases of interest. Experiments on real data show that our method performs better than using a single learning rate and using only the less noisy of the two datasets when the noise level is low to moderate. PMID:26705435

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

PubMed

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

A method for the 32P labeling of peptides or peptide nucleic acid oligomers

NASA Technical Reports Server (NTRS)

Kozlov, I. A.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1998-01-01

A novel approach to the radioactive labeling of peptides and PNA oligomers is described. It is based on the conjugation of a deoxynucleoside 3'-phosphate with the terminal amine of the substrate, followed by phosphorylation of the 5'-hydroxyl group of the nucleotide using T4 polynucleotide kinase and [gamma-32P]ATP.

The heterogeneous levels of linkage disequilibrium in white spruce genes and comparative analysis with other conifers.

PubMed

Pavy, N; Namroud, M-C; Gagnon, F; Isabel, N; Bousquet, J

2012-03-01

In plants, knowledge about linkage disequilibrium (LD) is relevant for the design of efficient single-nucleotide polymorphism arrays in relation to their use in population and association genomics studies. Previous studies of conifer genes have shown LD to decay rapidly within gene limits, but exceptions have been reported. To evaluate the extent of heterogeneity of LD among conifer genes and its potential causes, we examined LD in 105 genes of white spruce (Picea glauca) by sequencing a panel of 48 haploid megagametophytes from natural populations and further compared it with LD in other conifer species. The average pairwise r(2) value was 0.19 (s.d.=0.19), and LD dropped quickly with a half-decay being reached at a distance of 65 nucleotides between sites. However, LD was significantly heterogeneous among genes. A first group of 29 genes had stronger LD (mean r(2)=0.28), and a second group of 38 genes had weaker LD (mean r(2)=0.12). While a strong relationship was found with the recombination rate, there was no obvious relationship between LD and functional classification. The level of nucleotide diversity, which was highly heterogeneous across genes, was also not significantly correlated with LD. A search for selection signatures highlighted significant deviations from the standard neutral model, which could be mostly attributed to recent demographic changes. Little evidence was seen for hitchhiking and clear relationships with LD. When compared among conifer species, on average, levels of LD were similar in genes from white spruce, Norway spruce and Scots pine, whereas loblolly pine and Douglas fir genes exhibited a significantly higher LD.

Evidence for label-retaining tumour-initiating cells in human glioblastoma

PubMed Central

Deleyrolle, Loic P.; Harding, Angus; Cato, Kathleen; Siebzehnrubl, Florian A.; Rahman, Maryam; Azari, Hassan; Olson, Sarah; Gabrielli, Brian; Osborne, Geoffrey; Vescovi, Angelo

2011-01-01

Individual tumour cells display diverse functional behaviours in terms of proliferation rate, cell–cell interactions, metastatic potential and sensitivity to therapy. Moreover, sequencing studies have demonstrated surprising levels of genetic diversity between individual patient tumours of the same type. Tumour heterogeneity presents a significant therapeutic challenge as diverse cell types within a tumour can respond differently to therapies, and inter-patient heterogeneity may prevent the development of general treatments for cancer. One strategy that may help overcome tumour heterogeneity is the identification of tumour sub-populations that drive specific disease pathologies for the development of therapies targeting these clinically relevant sub-populations. Here, we have identified a dye-retaining brain tumour population that displays all the hallmarks of a tumour-initiating sub-population. Using a limiting dilution transplantation assay in immunocompromised mice, label-retaining brain tumour cells display elevated tumour-initiation properties relative to the bulk population. Importantly, tumours generated from these label-retaining cells exhibit all the pathological features of the primary disease. Together, these findings confirm dye-retaining brain tumour cells exhibit tumour-initiation ability and are therefore viable targets for the development of therapeutics targeting this sub-population. PMID:21515906

Three-step preparation and purification of phosphorus-33-labeled creatine phosphate of high specific activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Savabi, F.; Geiger, P.J.; Bessman, S.P.

1984-03-01

Rabbit heart mitochondria were used as a source of enzymes for the synthesis of phosphorus-labeled creatine phosphate. This method is based on the coupled reaction between mitochondrial oxidative phosphorylation and mitochondrial-bound creatine kinase. It is possible to convert more than 90% of the inorganic phosphate (P/sub i/) to creatine phosphate. The method used only small amounts of adenine nucleotides which led to a product with only slight nucleotide contamination. This could be removed by activated charcoal extraction. For further purification, a method for the removal of residual P/sub i/ is described. 20 references.

Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence*

PubMed Central

Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L.; Embrey, Kevin J.; Golovanov, Alexander P.

2016-01-01

The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly 15N-labeled Ras as well as [13C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. PMID:26565026

Intracellular nucleotide and nucleotide sugar contents of cultured CHO cells determined by a fast, sensitive, and high-resolution ion-pair RP-HPLC.

PubMed

Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L

2006-01-15

Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.

Evidence for the absence of the terminal adenine nucleotide at the amino acid-acceptor end of transfer ribonucleic acid in non-lactating bovine mammary gland and its inhibitory effect on the aminoacylation of rat liver transfer ribonucleic acid

PubMed Central

Herrington, M. D.; Hawtrey, A. O.

1970-01-01

1. tRNA isolated from non-lactating bovine mammary gland competitively inhibits the formation of aminoacyl-tRNA in the rat liver system. 2. Non-lactating bovine mammary gland tRNA and twice-pyrophosphorolysed rat liver tRNA are unable to accept amino acids in a reaction catalysed by aminoacyl-tRNA synthetases from either rat liver or bovine mammary gland. Deacylated rat liver tRNA can however be aminoacylated in the presence of either enzyme. 3. Bovine mammary gland tRNA lacks the terminal adenine nucleotide at the 3′-terminus amino acid acceptor end, which can be replaced by incubation in the presence of rat liver nucleotide-incorporating enzyme, ATP and CTP. 4. The enzymically modified bovine tRNA (tRNApCpCpA) can bind labelled amino acids to form aminoacyl-tRNA, which can then transfer its labelled amino acids to growing polypeptide chains on ribosomes. 5. Molecules of rat liver tRNA or bovine mammary gland tRNA that lack the terminal adenine nucleotide or the terminal cytosine and adenine nucleotides inhibit the aminoacylation of normal rat liver tRNA to varying degrees. tRNA molecules lacking the terminal −pCpCpA nucleotide sequence exhibit the major inhibitory effect. 6. The enzyme fraction from bovine mammary gland corresponding to that containing the nucleotide-incorporating enzyme in rat liver is unable to catalyse the incorporation of cytosine and adenine nucleotides in pyrophosphorolysed rat liver tRNA and deacylated bovine tRNA. This fraction also markedly inhibits the action of the rat liver nucleotide-incorporating enzyme. PMID:5435687

Genetic heterogeneity of L-Zagreb mumps virus vaccine strain.

PubMed

Kosutic-Gulija, Tanja; Forcic, Dubravko; Santak, Maja; Ramljak, Ana; Mateljak-Lukacevic, Sanja; Mazuran, Renata

2008-07-10

The most often used mumps vaccine strains Jeryl Lynn (JL), RIT4385, Urabe-AM9, L-Zagreb and L-3 differ in immunogenicity and reactogenicity. Previous analyses showed that JL, Urabe-AM9 and L-3 are genetically heterogeneous. We identified the heterogeneity of L-Zagreb throughout the entire genome. Two major variants were defined: variant A being identical to the consensus sequence of viral seeds and vaccine(s) and variant B which differs from variant A in three nucleotide positions. The difference between viral variants in L-Zagreb strain is insufficient for distinct viral strains to be defined. We demonstrated that proportion of variants in L-Zagreb viral population depends on cell substrate used for viral replication in vitro and in vivo. L-Zagreb strain should be considered as a single strain composed of at least two variant viral genomes.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

PubMed

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions

PubMed Central

Nishizawa, Manami; Nishizawa, Kazuhisa

2000-01-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

PubMed

Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

NASA Astrophysics Data System (ADS)

Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Nucleotide-dependent conformational states of actin

PubMed Central

Pfaendtner, Jim; Branduardi, Davide; Parrinello, Michele; Pollard, Thomas D.; Voth, Gregory A.

2009-01-01

The influence of the state of the bound nucleotide (ATP, ADP-Pi, or ADP) on the conformational free-energy landscape of actin is investigated. Nucleotide-dependent folding of the DNase-I binding (DB) loop in monomeric actin and the actin trimer is carried out using all-atom molecular dynamics (MD) calculations accelerated with a multiscale implementation of the metadynamics algorithm. Additionally, an investigation of the opening and closing of the actin nucleotide binding cleft is performed. Nucleotide-dependent free-energy profiles for all of these conformational changes are calculated within the framework of metadynamics. We find that in ADP-bound monomer, the folded and unfolded states of the DB loop have similar relative free-energy. This result helps explain the experimental difficulty in obtaining an ordered crystal structure for this region of monomeric actin. However, we find that in the ADP-bound actin trimer, the folded DB loop is stable and in a free-energy minimum. It is also demonstrated that the nucleotide binding cleft favors a closed conformation for the bound nucleotide in the ATP and ADP-Pi states, whereas the ADP state favors an open confirmation, both in the monomer and trimer. These results suggest a mechanism of allosteric interactions between the nucleotide binding cleft and the DB loop. This behavior is confirmed by an additional simulation that shows the folding free-energy as a function of the nucleotide cleft width, which demonstrates that the barrier for folding changes significantly depending on the value of the cleft width. PMID:19620726

FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

PubMed

Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

2017-09-01

The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

A methodology for comprehensive breast cancer Ki67 labeling index with intra-tumor heterogeneity appraisal based on hexagonal tiling of digital image analysis data.

PubMed

Plancoulaine, Benoit; Laurinaviciene, Aida; Herlin, Paulette; Besusparis, Justinas; Meskauskas, Raimundas; Baltrusaityte, Indra; Iqbal, Yasir; Laurinavicius, Arvydas

2015-10-19

Digital image analysis (DIA) enables higher accuracy, reproducibility, and capacity to enumerate cell populations by immunohistochemistry; however, the most unique benefits may be obtained by evaluating the spatial distribution and intra-tissue variance of markers. The proliferative activity of breast cancer tissue, estimated by the Ki67 labeling index (Ki67 LI), is a prognostic and predictive biomarker requiring robust measurement methodologies. We performed DIA on whole-slide images (WSI) of 302 surgically removed Ki67-stained breast cancer specimens; the tumour classifier algorithm was used to automatically detect tumour tissue but was not trained to distinguish between invasive and non-invasive carcinoma cells. The WSI DIA-generated data were subsampled by hexagonal tiling (HexT). Distribution and texture parameters were compared to conventional WSI DIA and pathology report data. Factor analysis of the data set, including total numbers of tumor cells, the Ki67 LI and Ki67 distribution, and texture indicators, extracted 4 factors, identified as entropy, proliferation, bimodality, and cellularity. The factor scores were further utilized in cluster analysis, outlining subcategories of heterogeneous tumors with predominant entropy, bimodality, or both at different levels of proliferative activity. The methodology also allowed the visualization of Ki67 LI heterogeneity in tumors and the automated detection and quantitative evaluation of Ki67 hotspots, based on the upper quintile of the HexT data, conceptualized as the "Pareto hotspot". We conclude that systematic subsampling of DIA-generated data into HexT enables comprehensive Ki67 LI analysis that reflects aspects of intra-tumor heterogeneity and may serve as a methodology to improve digital immunohistochemistry in general.

DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

PubMed

Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

2017-05-23

A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

Genetic heterogeneity of L-Zagreb mumps virus vaccine strain

PubMed Central

Kosutic-Gulija, Tanja; Forcic, Dubravko; Šantak, Maja; Ramljak, Ana; Mateljak-Lukacevic, Sanja; Mazuran, Renata

2008-01-01

Background The most often used mumps vaccine strains Jeryl Lynn (JL), RIT4385, Urabe-AM9, L-Zagreb and L-3 differ in immunogenicity and reactogenicity. Previous analyses showed that JL, Urabe-AM9 and L-3 are genetically heterogeneous. Results We identified the heterogeneity of L-Zagreb throughout the entire genome. Two major variants were defined: variant A being identical to the consensus sequence of viral seeds and vaccine(s) and variant B which differs from variant A in three nucleotide positions. The difference between viral variants in L-Zagreb strain is insufficient for distinct viral strains to be defined. We demonstrated that proportion of variants in L-Zagreb viral population depends on cell substrate used for viral replication in vitro and in vivo. Conclusion L-Zagreb strain should be considered as a single strain composed of at least two variant viral genomes. PMID:18616793

Harvesting geographic features from heterogeneous raster maps

NASA Astrophysics Data System (ADS)

Chiang, Yao-Yi

2010-11-01

Raster maps offer a great deal of geospatial information and are easily accessible compared to other geospatial data. However, harvesting geographic features locked in heterogeneous raster maps to obtain the geospatial information is challenging. This is because of the varying image quality of raster maps (e.g., scanned maps with poor image quality and computer-generated maps with good image quality), the overlapping geographic features in maps, and the typical lack of metadata (e.g., map geocoordinates, map source, and original vector data). Previous work on map processing is typically limited to a specific type of map and often relies on intensive manual work. In contrast, this thesis investigates a general approach that does not rely on any prior knowledge and requires minimal user effort to process heterogeneous raster maps. This approach includes automatic and supervised techniques to process raster maps for separating individual layers of geographic features from the maps and recognizing geographic features in the separated layers (i.e., detecting road intersections, generating and vectorizing road geometry, and recognizing text labels). The automatic technique eliminates user intervention by exploiting common map properties of how road lines and text labels are drawn in raster maps. For example, the road lines are elongated linear objects and the characters are small connected-objects. The supervised technique utilizes labels of road and text areas to handle complex raster maps, or maps with poor image quality, and can process a variety of raster maps with minimal user input. The results show that the general approach can handle raster maps with varying map complexity, color usage, and image quality. By matching extracted road intersections to another geospatial dataset, we can identify the geocoordinates of a raster map and further align the raster map, separated feature layers from the map, and recognized features from the layers with the geospatial

Biocompatible mannosylated endosomal-escape nanoparticles enhance selective delivery of short nucleotide sequences to tumor associated macrophages

NASA Astrophysics Data System (ADS)

Ortega, Ryan A.; Barham, Whitney J.; Kumar, Bharat; Tikhomirov, Oleg; McFadden, Ian D.; Yull, Fiona E.; Giorgio, Todd D.

2014-12-01

Tumor associated macrophages (TAMs) can modify the tumor microenvironment to create a pro-tumor niche. Manipulation of the TAM phenotype is a novel, potential therapeutic approach to engage anti-cancer immunity. siRNA is a molecular tool for knockdown of specific mRNAs that is tunable in both strength and duration. The use of siRNA to reprogram TAMs to adopt an immunogenic, anti-tumor phenotype is an attractive alternative to ablation of this cell population. One current difficulty with this approach is that TAMs are difficult to specifically target and transfect. We report here successful utilization of novel mannosylated polymer nanoparticles (MnNP) that are capable of escaping the endosomal compartment to deliver siRNA to TAMs in vitro and in vivo. Transfection with MnNP-siRNA complexes did not significantly decrease TAM cell membrane integrity in culture, nor did it create adverse kidney or liver function in mice, even at repeated doses of 5 mg kg-1. Furthermore, MnNP effectively delivers labeled nucleotides to TAMs in mice with primary mammary tumors. We also confirmed TAM targeting in the solid tumors disseminated throughout the peritoneum of ovarian tumor bearing mice following injection of fluorescently labeled MnNP-nucleotide complexes into the peritoneum. Finally, we show enhanced uptake of MnNP in lung metastasis associated macrophages compared to untargeted particles when using an intubation delivery method. In summary, we have shown that MnNP specifically and effectively deliver siRNA to TAMs in vivo.

Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors

NASA Astrophysics Data System (ADS)

Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian

2006-01-01

We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor

Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence.

PubMed

Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L; Embrey, Kevin J; Golovanov, Alexander P

2016-01-22

The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly (15)N-labeled Ras as well as [(13)C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Heterogeneity of D2 dopamine receptors in different brain regions.

PubMed Central

Leonard, M N; Macey, C A; Strange, P G

1987-01-01

The binding of [3H]spiperone has been examined in membranes derived from different regions of bovine brain. In caudate nucleus, nucleus accumbens, olfactory tubercle and putamen binding is to D2 dopamine and 5HT2 serotonin receptors, whereas in cingulate cortex only serotonin 5HT2 receptor binding can be detected. D2 dopamine receptors were examined in detail in caudate nucleus, olfactory tubercle and putamen using [3H]spiperone binding in the presence of 0.3 microM-mianserin (to block 5HT2 serotonin receptors). No evidence for heterogeneity among D2 dopamine receptors either between brain regions or within a brain region was found from the displacements of [3H]spiperone binding by a range of antagonists, including dibenzazepines and substituted benzamides. Regulation of agonist binding by guanine nucleotides did, however, differ between regions. In caudate nucleus a population of agonist binding sites appeared resistant to guanine nucleotide regulation, whereas this was not the case in olfactory tubercle and putamen. PMID:2963621

DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

PubMed

Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

2013-07-15

Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

PubMed Central

Fasullo, Michael; Endres, Lauren

2015-01-01

Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP) produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases. PMID:25923076

Evolving nucleotide binding surfaces

NASA Technical Reports Server (NTRS)

Kieber-Emmons, T.; Rein, R.

1981-01-01

An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

In situ end labeling of fragmented DNA in induced ovarian atresia.

PubMed

D'Herde, K; De Pestel, G; Roels, F

1994-01-01

Apoptosis is studied in a model of induced follicular atresia in the ovary of Japanese quail (Coturnix coturnix japonica) by in situ end labeling of DNA fragments in granulosa cells using two different techniques (incorporation of labeled nucleotides by DNA polymerase I or terminal deoxynucleotidyl transferase). The most remarkable observation related to apoptosis in this model is the predominant cytoplasmic localization of labeled DNA fragments, while DNA fragmentation appears to be absent from compacted chromatin masses of apoptotic nuclei and apoptotic nuclear fragments. Unstained apoptotic bodies are present adjacent to stained ones, so that their detection rate on hematoxylin + eosin stained sections is better than on the in situ end-labeled sections. This suggests that DNA fragmentation is a late even or not obligatory in apoptotic granulosa cell death. In contrast to similar studies on atretic granulosa in mammalian models, the process of apoptosis is asynchronous in the granulosal epithelium, with a majority of nuclei with normal chromatin configuration remaining negative for DNA fragmentation. Finally it is shown that the techniques used are not specific for apoptosis, as DNA fragmentation in necrotic granulosa cells is detected as well.

Advances in targeting cyclic nucleotide phosphodiesterases

PubMed Central

Maurice, Donald H.; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C.

2014-01-01

Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants. PMID:24687066

Structural basis of reverse nucleotide polymerization

PubMed Central

Nakamura, Akiyoshi; Nemoto, Taiki; Heinemann, Ilka U.; Yamashita, Keitaro; Sonoda, Tomoyo; Komoda, Keisuke; Tanaka, Isao; Söll, Dieter; Yao, Min

2013-01-01

Nucleotide polymerization proceeds in the forward (5′-3′) direction. This tenet of the central dogma of molecular biology is found in diverse processes including transcription, reverse transcription, DNA replication, and even in lagging strand synthesis where reverse polymerization (3′-5′) would present a “simpler” solution. Interestingly, reverse (3′-5′) nucleotide addition is catalyzed by the tRNA maturation enzyme tRNAHis guanylyltransferase, a structural homolog of canonical forward polymerases. We present a Candida albicans tRNAHis guanylyltransferase-tRNAHis complex structure that reveals the structural basis of reverse polymerization. The directionality of nucleotide polymerization is determined by the orientation of approach of the nucleotide substrate. The tRNA substrate enters the enzyme’s active site from the opposite direction (180° flip) compared with similar nucleotide substrates of canonical 5′-3′ polymerases, and the finger domains are on opposing sides of the core palm domain. Structural, biochemical, and phylogenetic data indicate that reverse polymerization appeared early in evolution and resembles a mirror image of the forward process. PMID:24324136

Base pair mismatch recognition using plasmon resonant particle labels.

PubMed

Oldenburg, Steven J; Genick, Christine C; Clark, Keith A; Schultz, David A

2002-10-01

We demonstrate the use of silver plasmon resonant particles (PRPs), as reporter labels, in a microarray-based DNA hybridization assay in which we screen for a known polymorphic site in the breast cancer gene BRCA1. PRPs (40-100 nm in diameter) image as diffraction-limited points of colored light in a standard microscope equipped with dark-field illumination, and can be individually identified and discriminated against background scatter. Rather than overall intensity, the number of PRPs counted in a CCD image by a software algorithm serves as the signal in these assays. In a typical PRP hybridization assay, we achieve a detection sensitivity that is approximately 60 x greater than that achieved by using fluorescent labels. We conclude that single particle counting is robust, generally applicable to a wide variety of assay platforms, and can be integrated into low-cost and quantitative detection systems for single nucleotide polymorphism analysis.

Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.

1990-06-01

High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubatedmore » under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.« less

Heterogeneous patterns of oligodendroglial differentiation in the forebrain of the opossum Didelphis marsupialis.

PubMed

Barradas, P C; Gomes, S S; Cavalcante, L A

1998-01-01

The differentiation of oligodendrocytes in the forebrain of the opossum (Didelphis marsupialis) has been studied by the immunohistochemical identification of 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) and by the autoradiographic detection of the uptake of 3H-thymidine. CNPase is expressed early in oligodendroglia somata and fibre sheaths (myelin) in the forebrain and its persistence in the cell bodies is regionally heterogeneous, being ephemeral in cells within the optic pathway, supraoptic decussation, and posterior commissure, of intermediate duration in the mamillo-thalamic fascicle, and stria medullaris, and long-lasting in other diencephalic and in telencephalic tracts. In the cerebral cortex, most CNPase+ cells have small somata and multiple processes (types I and II). CNPase-expressing oligodendrocytes are also regionally heterogeneous in terms of proliferative capability, which could not be detected in forebrain tracts or diencephalon, but has appeared in a small proportion of cells in the neocortical white matter and in the fimbria. Our findings provide additional evidence in favour of the heterogeneity of oligodendrocytes.

Nucleotide Binding by Lhs1p Is Essential for Its Nucleotide Exchange Activity and for Function in Vivo*

PubMed Central

de Keyzer, Jeanine; Steel, Gregor J.; Hale, Sarah J.; Humphries, Daniel; Stirling, Colin J.

2009-01-01

Protein translocation and folding in the endoplasmic reticulum of Saccharomyces cerevisiae involves two distinct Hsp70 chaperones, Lhs1p and Kar2p. Both proteins have the characteristic domain structure of the Hsp70 family consisting of a conserved N-terminal nucleotide binding domain and a C-terminal substrate binding domain. Kar2p is a canonical Hsp70 whose substrate binding activity is regulated by cochaperones that promote either ATP hydrolysis or nucleotide exchange. Lhs1p is a member of the Grp170/Lhs1p subfamily of Hsp70s and was previously shown to function as a nucleotide exchange factor (NEF) for Kar2p. Here we show that in addition to this NEF activity, Lhs1p can function as a holdase that prevents protein aggregation in vitro. Analysis of the nucleotide requirement of these functions demonstrates that nucleotide binding to Lhs1p stimulates the interaction with Kar2p and is essential for NEF activity. In contrast, Lhs1p holdase activity is nucleotide-independent and unaffected by mutations that interfere with ATP binding and NEF activity. In vivo, these mutants show severe protein translocation defects and are unable to support growth despite the presence of a second Kar2p-specific NEF, Sil1p. Thus, Lhs1p-dependent nucleotide exchange activity is vital for ER protein biogenesis in vivo. PMID:19759005

Nucleotide and Nucleotide Sugar Analysis by Liquid Chromatography-Electrospray Ionization-Mass Spectrometry on Surface-Conditioned Porous Graphitic Carbon

PubMed Central

2010-01-01

We examined the analysis of nucleotides and nucleotide sugars by chromatography on porous graphitic carbon with mass spectrometric detection, a method that evades contamination of the MS instrument with ion pairing reagent. At first, adenosine triphosphate (ATP) and other triphosphate nucleotides exhibited very poor chromatographic behavior on new columns and could hardly be eluted from columns previously cleaned with trifluoroacetic acid. Satisfactory performance of both new and older columns could, however, be achieved by treatment with reducing agent and, unexpectedly, hydrochloric acid. Over 40 nucleotides could be detected in cell extracts including many isobaric compounds such as ATP, deoxyguanosine diphosphate (dGTP), and phospho-adenosine-5′-phosphosulfate or 3′,5′-cyclic adenosine 5'-monophosphate (AMP) and its much more abundant isomer 2′,3′-cylic AMP. A fast sample preparation procedure based on solid-phase extraction on carbon allowed detection of very short-lived analytes such as cytidine 5'-monophosphate (CMP)-2-keto-deoxy-octulosonic acid. In animal cells and plant tissues, about 35 nucleotide sugars were detected, among them rarely considered metabolites such as uridine 5'-diphosphate (UDP)-l-arabinopyranose, UDP-l-arabinofuranose, guanosine 5'-diphosphate (GDP)-l-galactofuranose, UDP-l-rhamnose, and adenosine diphosphate (ADP)-sugars. Surprisingly, UDP-arabinopyranose was also found in Chinese hamster ovary (CHO) cells. Due to the unique structural selectivity of graphitic carbon, the method described herein distinguishes more nucleotides and nucleotide sugars than previously reported approaches. PMID:21043458

Combination nucleoside/nucleotide reverse transcriptase inhibitors for treatment of HIV infection.

PubMed

Akanbi, Maxwell O; Scarsi, Kimberly K; Scarci, Kimberly; Taiwo, Babafemi; Murphy, Robert L

2012-01-01

The combination of two nucleoside/nucleotide reverse transcriptase inhibitors (N(t)RTIs) and a third agent from another antiretroviral class is currently recommended for initial antiretroviral therapy. In general, N(t)RTIs remain relevant in subsequent regimens. There are currently six nucleoside reverse transcriptase inhibitors and one nucleotide reverse transcriptase inhibitor drug entities available, and several formulations that include two or more N(t)RTIs in a fixed-dose combination. These entities have heterogeneous pharmacological and clinical properties. Accordingly, toxicity, pill burden, dosing frequency, potential drug-drug interaction, preexisting antiretroviral drug resistance and comorbid conditions should be considered when constructing a regimen. This approach is critical in order to optimize virologic efficacy and clinical outcomes. This article reviews N(t)RTI combinations used in the treatment of HIV-infected adults. The pharmacological properties of each N(t)RTI, and the clinical trials that have influenced treatment guidelines are discussed. It is likely that N(t)RTIs will continue to dominate the global landscape of HIV treatment and prevention, despite emerging interest in N(t)RTI-free combination therapy. Clinical domains where only few alternatives to N(t)RTIs exist include treatment of HIV/HBV coinfection and HIV-2. There is a need for novel N(t)RTIs with enhanced safety and resistance profiles compared with current N(t)RTIs.

Calorie Labeling in Chain Restaurants and Body Weight: Evidence from New York.

PubMed

Restrepo, Brandon J

2017-10-01

This study analyzes the impact of local mandatory calorie labeling laws implemented by New York jurisdictions on body weight. The analysis indicates that on average the point-of-purchase provision of calorie information on chain restaurant menus reduced body mass index (BMI) by 1.5% and lowered the risk of obesity by 12%. Quantile regression results indicate that calorie labeling has similar impacts across the BMI distribution. An analysis of heterogeneity suggests that calorie labeling has a larger impact on the body weight of lower income individuals, especially lower income minorities. The estimated impacts of calorie labeling on physical activity, smoking, and the consumption of alcoholic beverages, fruits, and vegetables are small in magnitude, which suggests that other margins of adjustment drive the body-weight impacts estimated here. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Probing the metabolic network in bloodstream-form Trypanosoma brucei using untargeted metabolomics with stable isotope labelled glucose.

PubMed

Creek, Darren J; Mazet, Muriel; Achcar, Fiona; Anderson, Jana; Kim, Dong-Hyun; Kamour, Ruwida; Morand, Pauline; Millerioux, Yoann; Biran, Marc; Kerkhoven, Eduard J; Chokkathukalam, Achuthanunni; Weidt, Stefan K; Burgess, Karl E V; Breitling, Rainer; Watson, David G; Bringaud, Frédéric; Barrett, Michael P

2015-03-01

Metabolomics coupled with heavy-atom isotope-labelled glucose has been used to probe the metabolic pathways active in cultured bloodstream form trypomastigotes of Trypanosoma brucei, a parasite responsible for human African trypanosomiasis. Glucose enters many branches of metabolism beyond glycolysis, which has been widely held to be the sole route of glucose metabolism. Whilst pyruvate is the major end-product of glucose catabolism, its transamination product, alanine, is also produced in significant quantities. The oxidative branch of the pentose phosphate pathway is operative, although the non-oxidative branch is not. Ribose 5-phosphate generated through this pathway distributes widely into nucleotide synthesis and other branches of metabolism. Acetate, derived from glucose, is found associated with a range of acetylated amino acids and, to a lesser extent, fatty acids; while labelled glycerol is found in many glycerophospholipids. Glucose also enters inositol and several sugar nucleotides that serve as precursors to macromolecule biosynthesis. Although a Krebs cycle is not operative, malate, fumarate and succinate, primarily labelled in three carbons, were present, indicating an origin from phosphoenolpyruvate via oxaloacetate. Interestingly, the enzyme responsible for conversion of phosphoenolpyruvate to oxaloacetate, phosphoenolpyruvate carboxykinase, was shown to be essential to the bloodstream form trypanosomes, as demonstrated by the lethal phenotype induced by RNAi-mediated downregulation of its expression. In addition, glucose derivatives enter pyrimidine biosynthesis via oxaloacetate as a precursor to aspartate and orotate.

Intratumour Heterogeneity: Evolution through Space and Time

PubMed Central

Swanton, Charles

2013-01-01

Recent technological advances have permitted higher resolution and more rapid analysis of individual cancer genomes at the single nucleotide level. Such advances have demonstrated bewildering inter-tumour heterogeneity with limited somatic alterations shared between tumours of the same histopathological subtype. Exacerbating such complexity, increasing evidence of intratumour genetic heterogeneity (ITH) is emerging, both within individual tumour biopsies and spatially separated between biopsies of the same tumour. Sequential analysis of tumours has also revealed evidence that ITH temporally evolves during the disease course. ITH has implications for predictive or prognostic biomarker strategies, where the tumour subclone that may ultimately influence therapeutic outcome may evade detection due to its absence or presence at low frequency at diagnosis or due to its regional separation from the tumour biopsy site. In this review the implications of “trunk and branch” tumour evolution for drug discovery approaches and emerging evidence that low frequency somatic events may drive tumour growth through paracrine signalling fostering a tumour ecological niche, are discussed. The concept of an “actionable mutation” is considered within a model of clonal dominance and heterogeneous tumour cell dependencies. Evidence that cancer therapeutics may augment ITH and the need to track the tumour subclonal architecture through treatment are defined as key research areas. Finally, if combination therapeutic approaches to limit the consequences of ITH prove challenging, identification of drivers or suppressors of ITH may provide attractive therapeutic targets to limit tumour evolutionary rates and adaptation. PMID:23002210

Technological advances in site-directed spin labeling of proteins.

PubMed

Hubbell, Wayne L; López, Carlos J; Altenbach, Christian; Yang, Zhongyu

2013-10-01

Molecular flexibility over a wide time range is of central importance to the function of many proteins, both soluble and membrane. Revealing the modes of flexibility, their amplitudes, and time scales under physiological conditions is the challenge for spectroscopic methods, one of which is site-directed spin labeling EPR (SDSL-EPR). Here we provide an overview of some recent technological advances in SDSL-EPR related to investigation of structure, structural heterogeneity, and dynamics of proteins. These include new classes of spin labels, advances in measurement of long range distances and distance distributions, methods for identifying backbone and conformational fluctuations, and new strategies for determining the kinetics of protein motion. Copyright © 2013 Elsevier Ltd. All rights reserved.

Single Upconversion Nanoparticle-Bacterium Cotrapping for Single-Bacterium Labeling and Analysis.

PubMed

Xin, Hongbao; Li, Yuchao; Xu, Dekang; Zhang, Yueli; Chen, Chia-Hung; Li, Baojun

2017-04-01

Detecting and analyzing pathogenic bacteria in an effective and reliable manner is crucial for the diagnosis of acute bacterial infection and initial antibiotic therapy. However, the precise labeling and analysis of bacteria at the single-bacterium level are a technical challenge but very important to reveal important details about the heterogeneity of cells and responds to environment. This study demonstrates an optical strategy for single-bacterium labeling and analysis by the cotrapping of single upconversion nanoparticles (UCNPs) and bacteria together. A single UCNP with an average size of ≈120 nm is first optically trapped. Both ends of a single bacterium are then trapped and labeled with single UCNPs emitting green light. The labeled bacterium can be flexibly moved to designated locations for further analysis. Signals from bacteria of different sizes are detected in real time for single-bacterium analysis. This cotrapping method provides a new approach for single-pathogenic-bacterium labeling, detection, and real-time analysis at the single-particle and single-bacterium level. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants.

PubMed

Ellison, Brenna; Lusk, Jayson L; Davis, David

2013-02-08

Recent legislation has required calorie labels on restaurant menus as a means of improving Americans' health. Despite the growing research in this area, no consensus has been reached on the effectiveness of menu labels. This suggests the possibility of heterogeneity in responses to caloric labels across people with different attitudes and demographics. The purpose of this study was to explore the potential relationships between caloric intake and diners' socio-economic characteristics and attitudes in a restaurant field experiment that systematically varied the caloric information printed on the menus. We conducted a field experiment in a full service restaurant where patrons were randomly assigned to one of three menu treatments which varied the amount of caloric information printed on the menus (none, numeric, or symbolic calorie label). At the conclusion of their meals, diners were asked to complete a brief survey regarding their socio-economic characteristics, attitudes, and meal selections. Using regression analysis, we estimated the number of entrée and extra calories ordered by diners as a function of demographic and attitudinal variables. Additionally, irrespective of the menu treatment to which a subject was assigned, our study identified which types of people are likely to be low-, medium-, and high-calorie diners. Results showed that calorie labels have the greatest impact on those who are least health conscious. Additionally, using a symbolic calorie label can further reduce the caloric intake of even the most health conscious patrons. Finally, calorie labels were more likely to influence the selection of the main entrée as opposed to supplemental items such as drinks and desserts. If numeric calorie labels are implemented (as currently proposed), they are most likely to influence consumers who are less health conscious - probably one of the key targets of this legislation. Unfortunately, numeric labels did little for those consumers who were already

Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

PubMed Central

2013-01-01

Background Recent legislation has required calorie labels on restaurant menus as a means of improving Americans’ health. Despite the growing research in this area, no consensus has been reached on the effectiveness of menu labels. This suggests the possibility of heterogeneity in responses to caloric labels across people with different attitudes and demographics. The purpose of this study was to explore the potential relationships between caloric intake and diners’ socio-economic characteristics and attitudes in a restaurant field experiment that systematically varied the caloric information printed on the menus. Methods We conducted a field experiment in a full service restaurant where patrons were randomly assigned to one of three menu treatments which varied the amount of caloric information printed on the menus (none, numeric, or symbolic calorie label). At the conclusion of their meals, diners were asked to complete a brief survey regarding their socio-economic characteristics, attitudes, and meal selections. Using regression analysis, we estimated the number of entrée and extra calories ordered by diners as a function of demographic and attitudinal variables. Additionally, irrespective of the menu treatment to which a subject was assigned, our study identified which types of people are likely to be low-, medium-, and high-calorie diners. Results Results showed that calorie labels have the greatest impact on those who are least health conscious. Additionally, using a symbolic calorie label can further reduce the caloric intake of even the most health conscious patrons. Finally, calorie labels were more likely to influence the selection of the main entrée as opposed to supplemental items such as drinks and desserts. Conclusions If numeric calorie labels are implemented (as currently proposed), they are most likely to influence consumers who are less health conscious – probably one of the key targets of this legislation. Unfortunately, numeric labels did

Identification of a nucleotide in 5′ untranslated region contributing to virus replication and virulence of Coxsackievirus A16

PubMed Central

Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang

2016-01-01

Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5′ untranslated region (5′UTR), have not been investigated until now. Here, a series of nucleotides present in 5′UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5′UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5′UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5′UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5′UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413

A Practical Approach to Tumor Heterogeneity in Clinical Research and Diagnostics.

PubMed

Stanta, Giorgio; Bonin, Serena

2018-01-01

This Pathobiology issue tries to better define the complex phenomenon of intratumor heterogeneity (ITH), mostly from a practical point of view. This topic has been chosen because ITH is a central issue in tumor development and has to be investigated directly in patient tissue and immediately applied in the treatment of the presenting patient. Different types of ITH should be considered: clonal genetic and epigenetic evolution, morphological heterogeneity, and tumor sampling, heterogeneity resulting from microenvironmental autocrine and paracrine interaction, and stochastic plasticity related to different functional cell efficiencies. For a higher level of reproducibility in clinical research and diagnostics, it is necessary to establish standardized analytical methods, including microdissection. In situ techniques can be pivotal to explore tumor microenvironment and can be improved with associated digital analysis. Liquid biopsies for plasma DNA analysis are at present the best method to study recurrent tumors with treatment adaptation, and widespread clinical use could be beneficial. The different types of tumor genomic instabilities could have pragmatic applications to rank ITH for clinical applications: treatment approaches differ in patients with a high nucleotide mutation rate and patients with high copy number alterations. © 2017 S. Karger AG, Basel.

Heterogeneity mapping of protein expression in tumors using quantitative immunofluorescence.

PubMed

Faratian, Dana; Christiansen, Jason; Gustavson, Mark; Jones, Christine; Scott, Christopher; Um, InHwa; Harrison, David J

2011-10-25

-quantitative and subject to intra- and inter-observer bias, more sensitive and quantitative methodologies are required in order to accurately map and quantify tissue heterogeneity in situ. We have developed and applied an experimental and statistical methodology in order to systematically quantify the heterogeneity of protein expression in whole tissue sections of tumors, based on the Automated QUantitative Analysis (AQUA) system(6). Tissue sections are labeled with specific antibodies directed against cytokeratins and targets of interest, coupled to fluorophore-labeled secondary antibodies. Slides are imaged using a whole-slide fluorescence scanner. Images are subdivided into hundreds to thousands of tiles, and each tile is then assigned an AQUA score which is a measure of protein concentration within the epithelial (tumor) component of the tissue. Heatmaps are generated to represent tissue expression of the proteins and a heterogeneity score assigned, using a statistical measure of heterogeneity originally used in ecology, based on the Simpson's biodiversity index(7). To date there have been no attempts to systematically map and quantify this variability in tandem with protein expression, in histological preparations. Here, we illustrate the first use of the method applied to ER and HER2 biomarker expression in ovarian cancer. Using this method paves the way for analyzing heterogeneity as an independent variable in studies of biomarker expression in translational studies, in order to establish the significance of heterogeneity in prognosis and prediction of responses to therapy.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Assessing metabolic heterogeneity in genetically homogeneous populations of bacteria using SIMS

NASA Astrophysics Data System (ADS)

McClelland, H. L. O.; Fike, D. A.; Jones, C.; Bradley, A. S.

2016-12-01

Biogeochemical cycles of elements are catalyzed by microbes, and can be assessed using a wide array of geochemical techniques. As the spatial resolution of these analytical techniques improves over time, it has become apparent that spatial heterogeneity of geochemical processes may impose noise on a range of geochemical signals. This spatial heterogeneity may reflect population structure, as well as metabolic heterogeneity among cells. New analytical approaches are required to understand, at the cellular level, differences in biogeochemical cycling of elements. We are developing such approaches by applying secondary-ion mass spectrometry (SIMS) techniques to populations of model organisms. In this work we report initial results from the analysis of genetically homogeneous cultures of Methylobacterium extorquens PA1, a facultative methylotrophic Alphaproteobacterium that has been extensively studied growing on both single carbon (e.g., methanol) and multi-carbon (e.g., succinate) substrates. PA1 cultures acclimated to succinate exhibited a more pronounced lag when grown on methanol compared with populations acclimated to methanol. However neither acclimation condition results in a pronounced lag during growth on succinate. When grown on a mixture of methanol and succinate, Methylobacterium co-utilize these substrates on a population level. We investigated the degree to which this apparent coutilisation is representative of individual cells, or whether it is a superposition of distinct metabolically specialized subpopulations. To explore this metabolic heterogeneity, we have grown populations of PA1 in liquid media containing a mixture of both methanol and succinate with one or the other substrate labelled with 13C. SIMS analysis of the isotopic composition of each cell allows us to infer the substrate, or mix of substrates, used for anabolic processes in each cell, along with cell-specfic growth rates via the exponential dilution of a 15N label.

A homogeneous quenching resonance energy transfer assay for the kinetic analysis of the GTPase nucleotide exchange reaction.

PubMed

Kopra, Kari; Ligabue, Alessio; Wang, Qi; Syrjänpää, Markku; Blaževitš, Olga; Veltel, Stefan; van Adrichem, Arjan J; Hänninen, Pekka; Abankwa, Daniel; Härmä, Harri

2014-07-01

A quenching resonance energy transfer (QRET) assay for small GTPase nucleotide exchange kinetic monitoring is demonstrated using nanomolar protein concentrations. Small GTPases are central signaling proteins in all eukaryotic cells acting as a "molecular switches" that are active in the GTP-state and inactive in the GDP-state. GTP-loading is highly regulated by guanine nucleotide exchange factors (GEFs). In several diseases, most prominently cancer, this process in misregulated. The kinetics of the nucleotide exchange reaction reports on the enzymatic activity of the GEF reaction system and is, therefore, of special interest. We determined the nucleotide exchange kinetics using europium-labeled GTP (Eu-GTP) in the QRET assay for small GTPases. After GEF catalyzed GTP-loading of a GTPase, a high time-resolved luminescence signal was found to be associated with GTPase bound Eu-GTP, whereas the non-bound Eu-GTP fraction was quenched by soluble quencher. The association kinetics of the Eu-GTP was measured after GEF addition, whereas the dissociation kinetics could be determined after addition of unlabeled GTP. The resulting association and dissociation rates were in agreement with previously published values for H-Ras(Wt), H-Ras(Q61G), and K-Ras(Wt), respectively. The broader applicability of the QRET assay for small GTPases was demonstrated by determining the kinetics of the Ect2 catalyzed RhoA(Wt) GTP-loading. The QRET assay allows the use of nanomolar protein concentrations, as more than 3-fold signal-to-background ratio was achieved with 50 nM GTPase and GEF proteins. Thus, small GTPase exchange kinetics can be efficiently determined in a HTS compatible 384-well plate format.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Category labels versus feature labels: category labels polarize inferential predictions.

PubMed

Yamauchi, Takashi; Yu, Na-Yung

2008-04-01

What makes category labels different from feature labels in predictive inference? This study suggests that category labels tend to make inductive reasoning polarized and homogeneous. In two experiments, participants were shown two schematic pictures of insects side by side and predicted the value of a hidden feature of one insect on the basis of the other insect. Arbitrary verbal labels were shown above the two pictures, and the meanings of the labels were manipulated in the instructions. In one condition, the labels represented the category membership of the insects, and in the other conditions, the same labels represented attributes of the insects. When the labels represented category membership, participants' responses became substantially polarized and homogeneous, indicating that the mere reference to category membership can modify reasoning processes.

Structural Basis for Nucleotide Exchange in Heterotrimeric G Proteins

PubMed Central

Dror, Ron O.; Mildorf, Thomas J.; Hilger, Daniel; Manglik, Aashish; Borhani, David W.; Arlow, Daniel H.; Philippsen, Ansgar; Villanueva, Nicolas; Yang, Zhongyu; Lerch, Michael T.; Hubbell, Wayne L.; Kobilka, Brian K.; Sunahara, Roger K.; Shaw, David E.

2016-01-01

G protein–coupled receptors (GPCRs) relay diverse extracellular signals into cells by catalyzing nucleotide release from heterotrimeric G proteins, but the mechanism underlying this quintessential molecular signaling event has remained unclear. Here we use atomic-level simulations to elucidate the nucleotide-release mechanism. We find that the G protein α subunit Ras and helical domains—previously observed to separate widely upon receptor binding to expose the nucleotide-binding site—separate spontaneously and frequently even in the absence of a receptor. Domain separation is necessary but not sufficient for rapid nucleotide release. Rather, receptors catalyze nucleotide release by favoring an internal structural rearrangement of the Ras domain that weakens its nucleotide affinity. We use double electron-electron resonance spectroscopy and protein engineering to confirm predictions of our computationally determined mechanism. PMID:26089515

Photoaffinity labeling of the TF1-ATPase from the thermophilic bacterium PS3 with 3'-O-(4-benzoyl)benzoyl ADP.

PubMed

Bar-Zvi, D; Yoshida, M; Shavit, N

1985-05-31

3'-O-(4-Benzoyl)benzoyl ADP (BzADP) was used as a photoaffinity label for covalent binding of adenine nucleotide analogs to the nucleotide binding site(s) of the thermophilic bacterium PS3 ATPase (TF1). As with the CF1-ATPase (Bar-Zvi, D. and Shavit, N. (1984) Biochim. Biophys. Acta 765, 340-356) noncovalently bound BzADP is a reversible inhibitor of the TF1-ATPase. BzADP changes the kinetics of ATP hydrolysis from noncooperative to cooperative in the same way as ADP does, but, in contrast to the effect on the CF1-ATPase, it has no effect on the Vmax. In the absence of Mg2+ 1 mol BzADP binds noncovalently to TF1, while with Mg2+ 3 mol are bound. Photoactivation of BzADP results in the covalent binding of the analog to the nucleotide binding site(s) on TF1 and correlates with the inactivation of the ATPase. Complete inactivation of the TF1-ATPase occurs after covalent binding of 2 mol BzADP/mol TF1. Photoinactivation of TF1 by BzADP is prevented if excess of either ADP or ATP is present during irradiation. Analysis by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate of the Bz[3H]ADP-labeled TF1-ATPase shows that all the radioactivity is incorporated into the beta subunit.

Applications of adenine nucleotide measurements in oceanography

NASA Technical Reports Server (NTRS)

Holm-Hansen, O.; Hodson, R.; Azam, F.

1975-01-01

The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

The multispecific thyroid hormone transporter OATP1C1 mediates cell-specific sulforhodamine 101-labeling of hippocampal astrocytes.

PubMed

Schnell, Christian; Shahmoradi, Ali; Wichert, Sven P; Mayerl, Steffen; Hagos, Yohannes; Heuer, Heike; Rossner, Moritz J; Hülsmann, Swen

2015-01-01

Sulforhodamine 101 (SR101) is widely used for astrocyte identification, though the labeling mechanism remains unknown and the efficacy of labeling in different brain regions is heterogeneous. By combining region-specific isolation of astrocytes followed by transcriptome analysis, two-photon excitation microscopy, and mouse genetics, we identified the thyroid hormone transporter OATP1C1 as the SR101-uptake transporter in hippocampus and cortex.

An algorithm for optimal fusion of atlases with different labeling protocols

PubMed Central

Iglesias, Juan Eugenio; Sabuncu, Mert Rory; Aganj, Iman; Bhatt, Priyanka; Casillas, Christen; Salat, David; Boxer, Adam; Fischl, Bruce; Van Leemput, Koen

2014-01-01

In this paper we present a novel label fusion algorithm suited for scenarios in which different manual delineation protocols with potentially disparate structures have been used to annotate the training scans (hereafter referred to as “atlases”). Such scenarios arise when atlases have missing structures, when they have been labeled with different levels of detail, or when they have been taken from different heterogeneous databases. The proposed algorithm can be used to automatically label a novel scan with any of the protocols from the training data. Further, it enables us to generate new labels that are not present in any delineation protocol by defining intersections on the underling labels. We first use probabilistic models of label fusion to generalize three popular label fusion techniques to the multi-protocol setting: majority voting, semi-locally weighted voting and STAPLE. Then, we identify some shortcomings of the generalized methods, namely the inability to produce meaningful posterior probabilities for the different labels (majority voting, semi-locally weighted voting) and to exploit the similarities between the atlases (all three methods). Finally, we propose a novel generative label fusion model that can overcome these drawbacks. We use the proposed method to combine four brain MRI datasets labeled with different protocols (with a total of 102 unique labeled structures) to produce segmentations of 148 brain regions. Using cross-validation, we show that the proposed algorithm outperforms the generalizations of majority voting, semi-locally weighted voting and STAPLE (mean Dice score 83%, vs. 77%, 80% and 79%, respectively). We also evaluated the proposed algorithm in an aging study, successfully reproducing some well-known results in cortical and subcortical structures. PMID:25463466

Seasonal changes of nucleotides in mussel (Mytilus galloprovincialis) mantle tissue.

PubMed

Blanco, S L; Suárez, M P; San Juan, F

2006-03-01

Seasonal variations of nucleotides in Mytilus galloprovincialis mantle tissue were analyzed. Separation and quantification was achieved by reversed-phase high-performance liquid chromatography. Total nucleotides show a pronounced seasonal variation with maximum and minimum values in autumn and spring, respectively. Adenine nucleotides accounted for the major part in spring and summer, guanosine and cytidine nucleotides in winter; uridine nucleotides were relatively constant throughout the year. Their inverse variation suggests inter-conversion among them and the maintenance of the potential cell energy in winter by other triphosphate nucleotides different from ATP. These results reflect environmental and nutritional conditions, and also the reserves and gametogenic cycles taking place in M. galloprovincialis mantle tissue.

New perspectives in cyclic nucleotide-mediated functions in the CNS: the emerging role of cyclic nucleotide-gated (CNG) channels.

PubMed

Podda, Maria Vittoria; Grassi, Claudio

2014-07-01

Cyclic nucleotides play fundamental roles in the central nervous system (CNS) under both physiological and pathological conditions. The impact of cAMP and cGMP signaling on neuronal and glial cell functions has been thoroughly characterized. Most of their effects have been related to cyclic nucleotide-dependent protein kinase activity. However, cyclic nucleotide-gated (CNG) channels, first described as key mediators of sensory transduction in retinal and olfactory receptors, have been receiving increasing attention as possible targets of cyclic nucleotides in the CNS. In the last 15 years, consistent evidence has emerged for their expression in neurons and astrocytes of the rodent brain. Far less is known, however, about the functional role of CNG channels in these cells, although several of their features, such as Ca(2+) permeability and prolonged activation in the presence of cyclic nucleotides, make them ideal candidates for mediators of physiological functions in the CNS. Here, we review literature suggesting the involvement of CNG channels in a number of CNS cellular functions (e.g., regulation of membrane potential, neuronal excitability, and neurotransmitter release) as well as in more complex phenomena, like brain plasticity, adult neurogenesis, and pain sensitivity. The emerging picture is that functional and dysfunctional cyclic nucleotide signaling in the CNS has to be reconsidered including CNG channels among possible targets. However, concerted efforts and multidisciplinary approaches are still needed to get more in-depth knowledge in this field.

Structure of a eukaryotic cyclic nucleotide-gated channel

PubMed Central

Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

2018-01-01

Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Scanning confocal fluorescence microscopy for single molecule analysis of nucleotide excision repair complexes.

PubMed

Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C

2002-11-01

We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.

New dye-labeled terminators for improved DNA sequencing patterns.

PubMed Central

Rosenblum, B B; Lee, L G; Spurgeon, S L; Khan, S H; Menchen, S M; Heiner, C R; Chen, S M

1997-01-01

We have used two new dye sets for automated dye-labeled terminator DNA sequencing. One set consists of four, 4,7-dichlororhodamine dyes (d-rhodamines). The second set consists of energy-transfer dyes that use the 5-carboxy-d-rhodamine dyes as acceptor dyes and the 5- or 6-carboxy isomers of 4'-aminomethylfluorescein as the donor dye. Both dye sets utilize a new linker between the dye and the nucleotide, and both provide more even peak heights in terminator sequencing than the dye-terminators consisting of unsubstituted rhodamine dyes. The unsubstituted rhodamine terminators produced electropherograms in which weak G peaks are observed after A peaks and occasionally C peaks. The number of weak G peaks has been reduced or eliminated with the new dye terminators. The general improvement in peak evenness improves accuracy for the automated base-calling software. The improved signal-to-noise ratio of the energy-transfer dye-labeled terminators combined with more even peak heights results in successful sequencing of high molecular weight DNA templates such as bacterial artificial chromosome DNA. PMID:9358158

Functional analysis of regulatory single-nucleotide polymorphisms.

PubMed

Pampín, Sandra; Rodríguez-Rey, José C

2007-04-01

The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

Evolution of functional nucleic acids in the presence of nonheritable backbone heterogeneity.

PubMed

Trevino, Simon G; Zhang, Na; Elenko, Mark P; Lupták, Andrej; Szostak, Jack W

2011-08-16

Multiple lines of evidence support the hypothesis that the early evolution of life was dominated by RNA, which can both transfer information from generation to generation through replication directed by base-pairing, and carry out biochemical activities by folding into functional structures. To understand how life emerged from prebiotic chemistry we must therefore explain the steps that led to the emergence of the RNA world, and in particular, the synthesis of RNA. The generation of pools of highly pure ribonucleotides on the early Earth seems unlikely, but the presence of alternative nucleotides would support the assembly of nucleic acid polymers containing nonheritable backbone heterogeneity. We suggest that homogeneous monomers might not have been necessary if populations of heterogeneous nucleic acid molecules could evolve reproducible function. For such evolution to be possible, function would have to be maintained despite the repeated scrambling of backbone chemistry from generation to generation. We have tested this possibility in a simplified model system, by using a T7 RNA polymerase variant capable of transcribing nucleic acids that contain an approximately 11 mixture of deoxy- and ribonucleotides. We readily isolated nucleotide-binding aptamers by utilizing an in vitro selection process that shuffles the order of deoxy- and ribonucleotides in each round. We describe two such RNA/DNA mosaic nucleic acid aptamers that specifically bind ATP and GTP, respectively. We conclude that nonheritable variations in nucleic acid backbone structure may not have posed an insurmountable barrier to the emergence of functionality in early nucleic acids.

Replication labeling patterns and chromosome territories typical of mammalian nuclei are conserved in the early metazoan Hydra.

PubMed

Alexandrova, Olga; Solovei, Irina; Cremer, Thomas; David, Charles N

2003-12-01

To investigate the evolutionary conservation of higher order nuclear architecture previously described for mammalian cells we have analyzed the nuclear architecture of the simple polyp Hydra. These diploblastic organisms have large nuclei (8-10 microm) containing about 3x10(9) bp of DNA organized in 15 chromosome pairs. They belong to the earliest metazoan phylum and are separated from mammals by at least 600 million years. Single and double pulse labeling with halogenated nucleotides (bromodeoxyuridine, iododeoxyuridine and chlorodeoxyuridine) revealed striking similarities to the known sequence of replication labeling patterns in mammalian nuclei. These patterns reflect a persistent nuclear arrangement of early, mid-, and late replicating chromatin foci that could be identified during all stages of interphase over at least 5-10 cell generations. Segregation of labeled chromatids led after several cell divisions to nuclei with single or a few labeled chromosome territories. In such nuclei distinct clusters of labeled chromatin foci were separated by extended nuclear areas with non-labeled chromatin, which is typical of a territorial arrangement of interphase chromosomes. Our results indicate the conservation of fundamental features of higher order chromatin arrangements throughout the evolution of metazoan animals and suggest the existence of conserved mechanism(s) controlling this architecture.

Regulation of Ion Channels by Pyridine Nucleotides

PubMed Central

Kilfoil, Peter J.; Tipparaju, Srinivas M.; Barski, Oleg A.; Bhatnagar, Aruni

2014-01-01

Recent research suggests that in addition to their role as soluble electron carriers, pyridine nucleotides [NAD(P)(H)] also regulate ion transport mechanisms. This mode of regulation seems to have been conserved through evolution. Several bacterial ion–transporting proteins or their auxiliary subunits possess nucleotide-binding domains. In eukaryotes, the Kv1 and Kv4 channels interact with pyridine nucleotide–binding β-subunits that belong to the aldo-keto reductase superfamily. Binding of NADP+ to Kvβ removes N-type inactivation of Kv currents, whereas NADPH stabilizes channel inactivation. Pyridine nucleotides also regulate Slo channels by interacting with their cytosolic regulator of potassium conductance domains that show high sequence homology to the bacterial TrkA family of K+ transporters. These nucleotides also have been shown to modify the activity of the plasma membrane KATP channels, the cystic fibrosis transmembrane conductance regulator, the transient receptor potential M2 channel, and the intracellular ryanodine receptor calcium release channels. In addition, pyridine nucleotides also modulate the voltage-gated sodium channel by supporting the activity of its ancillary subunit—the glycerol-3-phosphate dehydrogenase-like protein. Moreover, the NADP+ metabolite, NAADP+, regulates intracellular calcium homeostasis via the 2-pore channel, ryanodine receptor, or transient receptor potential M2 channels. Regulation of ion channels by pyridine nucleotides may be required for integrating cell ion transport to energetics and for sensing oxygen levels or metabolite availability. This mechanism also may be an important component of hypoxic pulmonary vasoconstriction, memory, and circadian rhythms, and disruption of this regulatory axis may be linked to dysregulation of calcium homeostasis and cardiac arrhythmias. PMID:23410881

Large-scale replication and heterogeneity in Parkinson disease genetic loci

PubMed Central

Ioannidis, John P.A.; Aasly, Jan O.; Annesi, Grazia; Brice, Alexis; Van Broeckhoven, Christine; Bertram, Lars; Bozi, Maria; Crosiers, David; Clarke, Carl; Facheris, Maurizio; Farrer, Matthew; Garraux, Gaetan; Gispert, Suzana; Auburger, Georg; Vilariño-Güell, Carles; Hadjigeorgiou, Georgios M.; Hicks, Andrew A.; Hattori, Nobutaka; Jeon, Beom; Lesage, Suzanne; Lill, Christina M.; Lin, Juei-Jueng; Lynch, Timothy; Lichtner, Peter; Lang, Anthony E.; Mok, Vincent; Jasinska-Myga, Barbara; Mellick, George D.; Morrison, Karen E.; Opala, Grzegorz; Pramstaller, Peter P.; Pichler, Irene; Park, Sung Sup; Quattrone, Aldo; Rogaeva, Ekaterina; Ross, Owen A.; Stefanis, Leonidas; Stockton, Joanne D.; Satake, Wataru; Silburn, Peter A.; Theuns, Jessie; Tan, Eng-King; Toda, Tatsushi; Tomiyama, Hiroyuki; Uitti, Ryan J.; Wirdefeldt, Karin; Wszolek, Zbigniew; Xiromerisiou, Georgia; Yueh, Kuo-Chu; Zhao, Yi; Gasser, Thomas; Maraganore, Demetrius; Krüger, Rejko

2012-01-01

Objective: Eleven genetic loci have reached genome-wide significance in a recent meta-analysis of genome-wide association studies in Parkinson disease (PD) based on populations of Caucasian descent. The extent to which these genetic effects are consistent across different populations is unknown. Methods: Investigators from the Genetic Epidemiology of Parkinson's Disease Consortium were invited to participate in the study. A total of 11 SNPs were genotyped in 8,750 cases and 8,955 controls. Fixed as well as random effects models were used to provide the summary risk estimates for these variants. We evaluated between-study heterogeneity and heterogeneity between populations of different ancestry. Results: In the overall analysis, single nucleotide polymorphisms (SNPs) in 9 loci showed significant associations with protective per-allele odds ratios of 0.78–0.87 (LAMP3, BST1, and MAPT) and susceptibility per-allele odds ratios of 1.14–1.43 (STK39, GAK, SNCA, LRRK2, SYT11, and HIP1R). For 5 of the 9 replicated SNPs there was nominally significant between-site heterogeneity in the effect sizes (I2 estimates ranged from 39% to 48%). Subgroup analysis by ethnicity showed significantly stronger effects for the BST1 (rs11724635) in Asian vs Caucasian populations and similar effects for SNCA, LRRK2, LAMP3, HIP1R, and STK39 in Asian and Caucasian populations, while MAPT rs2942168 and SYT11 rs34372695 were monomorphic in the Asian population, highlighting the role of population-specific heterogeneity in PD. Conclusion: Our study allows insight to understand the distribution of newly identified genetic factors contributing to PD and shows that large-scale evaluation in diverse populations is important to understand the role of population-specific heterogeneity. Neurology® 2012;79:659–667 PMID:22786590

Large-scale replication and heterogeneity in Parkinson disease genetic loci.

PubMed

Sharma, Manu; Ioannidis, John P A; Aasly, Jan O; Annesi, Grazia; Brice, Alexis; Van Broeckhoven, Christine; Bertram, Lars; Bozi, Maria; Crosiers, David; Clarke, Carl; Facheris, Maurizio; Farrer, Matthew; Garraux, Gaetan; Gispert, Suzana; Auburger, Georg; Vilariño-Güell, Carles; Hadjigeorgiou, Georgios M; Hicks, Andrew A; Hattori, Nobutaka; Jeon, Beom; Lesage, Suzanne; Lill, Christina M; Lin, Juei-Jueng; Lynch, Timothy; Lichtner, Peter; Lang, Anthony E; Mok, Vincent; Jasinska-Myga, Barbara; Mellick, George D; Morrison, Karen E; Opala, Grzegorz; Pramstaller, Peter P; Pichler, Irene; Park, Sung Sup; Quattrone, Aldo; Rogaeva, Ekaterina; Ross, Owen A; Stefanis, Leonidas; Stockton, Joanne D; Satake, Wataru; Silburn, Peter A; Theuns, Jessie; Tan, Eng-King; Toda, Tatsushi; Tomiyama, Hiroyuki; Uitti, Ryan J; Wirdefeldt, Karin; Wszolek, Zbigniew; Xiromerisiou, Georgia; Yueh, Kuo-Chu; Zhao, Yi; Gasser, Thomas; Maraganore, Demetrius; Krüger, Rejko

2012-08-14

Eleven genetic loci have reached genome-wide significance in a recent meta-analysis of genome-wide association studies in Parkinson disease (PD) based on populations of Caucasian descent. The extent to which these genetic effects are consistent across different populations is unknown. Investigators from the Genetic Epidemiology of Parkinson's Disease Consortium were invited to participate in the study. A total of 11 SNPs were genotyped in 8,750 cases and 8,955 controls. Fixed as well as random effects models were used to provide the summary risk estimates for these variants. We evaluated between-study heterogeneity and heterogeneity between populations of different ancestry. In the overall analysis, single nucleotide polymorphisms (SNPs) in 9 loci showed significant associations with protective per-allele odds ratios of 0.78-0.87 (LAMP3, BST1, and MAPT) and susceptibility per-allele odds ratios of 1.14-1.43 (STK39, GAK, SNCA, LRRK2, SYT11, and HIP1R). For 5 of the 9 replicated SNPs there was nominally significant between-site heterogeneity in the effect sizes (I(2) estimates ranged from 39% to 48%). Subgroup analysis by ethnicity showed significantly stronger effects for the BST1 (rs11724635) in Asian vs Caucasian populations and similar effects for SNCA, LRRK2, LAMP3, HIP1R, and STK39 in Asian and Caucasian populations, while MAPT rs2942168 and SYT11 rs34372695 were monomorphic in the Asian population, highlighting the role of population-specific heterogeneity in PD. Our study allows insight to understand the distribution of newly identified genetic factors contributing to PD and shows that large-scale evaluation in diverse populations is important to understand the role of population-specific heterogeneity.

Deep Learning in Label-free Cell Classification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia

Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individualmore » cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. In conclusion, this system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells.« less

Deep Learning in Label-free Cell Classification

PubMed Central

Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia; Blaby, Ian K.; Huang, Allen; Niazi, Kayvan Reza; Jalali, Bahram

2016-01-01

Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individual cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. This system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells. PMID:26975219

Deep Learning in Label-free Cell Classification

DOE PAGES

Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia; ...

2016-03-15

Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individualmore » cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. In conclusion, this system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells.« less

Deep Learning in Label-free Cell Classification

NASA Astrophysics Data System (ADS)

Chen, Claire Lifan; Mahjoubfar, Ata; Tai, Li-Chia; Blaby, Ian K.; Huang, Allen; Niazi, Kayvan Reza; Jalali, Bahram

2016-03-01

Label-free cell analysis is essential to personalized genomics, cancer diagnostics, and drug development as it avoids adverse effects of staining reagents on cellular viability and cell signaling. However, currently available label-free cell assays mostly rely only on a single feature and lack sufficient differentiation. Also, the sample size analyzed by these assays is limited due to their low throughput. Here, we integrate feature extraction and deep learning with high-throughput quantitative imaging enabled by photonic time stretch, achieving record high accuracy in label-free cell classification. Our system captures quantitative optical phase and intensity images and extracts multiple biophysical features of individual cells. These biophysical measurements form a hyperdimensional feature space in which supervised learning is performed for cell classification. We compare various learning algorithms including artificial neural network, support vector machine, logistic regression, and a novel deep learning pipeline, which adopts global optimization of receiver operating characteristics. As a validation of the enhanced sensitivity and specificity of our system, we show classification of white blood T-cells against colon cancer cells, as well as lipid accumulating algal strains for biofuel production. This system opens up a new path to data-driven phenotypic diagnosis and better understanding of the heterogeneous gene expressions in cells.

Supplementing glycosylation: A review of applying nucleotide-sugar precursors to growth medium to affect therapeutic recombinant protein glycoform distributions.

PubMed

Blondeel, Eric J M; Aucoin, Marc G

2018-06-15

Glycosylation is a critical quality attribute (CQA) of many therapeutic proteins, particularly monoclonal antibodies (mAbs), and is a major consideration in the approval of biosimilar biologics due to its effects to therapeutic efficacy. Glycosylation generates a distribution of glycoforms, resulting in glycoproteins with inherent molecule-to-molecule heterogeneity, capable of activating (or failing to activate) different effector functions of the immune system. Glycoforms can be affected by the supplementation of nucleotide-sugar precursors, and related components, to culture growth medium, affecting the metabolism of glycosylation. These supplementations has been demonstrated to increase nucleotide-sugar intracellular pools, and impact glycoform distributions, but with varied results. These variations can be attributed to five key factors: Differences between cell platforms (enzyme/transporter expression levels); differences between recombinant proteins produced (glycan-site accessibility); the fermentation and sampling timeline (glucose availability and exoglycosidase accumulation); glutamine levels (affecting ammonia levels, which impact Golgi pH, as well as UDP-GlcNAc pools); and finally, a lack of standardized metrics for observing shifts in glycoform distributions (glycosylation indices) across different experiments. The purpose of this review is to provide detail and clarity on the state of the art of supplementation strategies for nucleotide-sugar precursors for affecting glycosylation in cell culture processes, and to apply glycosylation indices for standardized comparisons across the field. Copyright © 2018. Published by Elsevier Inc.

Semi-automated quantification and neuroanatomical mapping of heterogeneous cell populations.

PubMed

Mendez, Oscar A; Potter, Colin J; Valdez, Michael; Bello, Thomas; Trouard, Theodore P; Koshy, Anita A

2018-07-15

Our group studies the interactions between cells of the brain and the neurotropic parasite Toxoplasma gondii. Using an in vivo system that allows us to permanently mark and identify brain cells injected with Toxoplasma protein, we have identified that Toxoplasma-injected neurons (TINs) are heterogeneously distributed throughout the brain. Unfortunately, standard methods to quantify and map heterogeneous cell populations onto a reference brain atlas are time consuming and prone to user bias. We developed a novel MATLAB-based semi-automated quantification and mapping program to allow the rapid and consistent mapping of heterogeneously distributed cells on to the Allen Institute Mouse Brain Atlas. The system uses two-threshold background subtraction to identify and quantify cells of interest. We demonstrate that we reliably quantify and neuroanatomically localize TINs with low intra- or inter-observer variability. In a follow up experiment, we show that specific regions of the mouse brain are enriched with TINs. The procedure we use takes advantage of simple immunohistochemistry labeling techniques, use of a standard microscope with a motorized stage, and low cost computing that can be readily obtained at a research institute. To our knowledge there is no other program that uses such readily available techniques and equipment for mapping heterogeneous populations of cells across the whole mouse brain. The quantification method described here allows reliable visualization, quantification, and mapping of heterogeneous cell populations in immunolabeled sections across whole mouse brains. Copyright © 2018 Elsevier B.V. All rights reserved.

Cyclic nucleotide content of tobacco BY-2 cells.

PubMed

Richards, Helen; Das, Swadipa; Smith, Christopher J; Pereira, Louisa; Geisbrecht, Alan; Devitt, Nicola J; Games, David E; van Geyschem, Jan; Gareth Brenton, A; Newton, Russell P

2002-11-01

The cyclic nucleotide content of cultured tobacco bright yellow-2 (BY-2) cells was determined, after freeze-killing, perchlorate extraction and sequential chromatography, by radioimmunoassay. The identities of the putative cyclic nucleotides, adenosine 3',5'-cyclic monophosphate (cyclic AMP), guanosine 3',5'-cyclic monophosphate (cyclic GMP) and cytidine 3',5'-cyclic monophosphate (cyclic CMP) were unambiguously confirmed by tandem mass spectrometry. The potential of BY-2 cell cultures as a model system for future investigations of cyclic nucleotide function in higher plants is discussed.

Nucleotide binding properties of bovine brain uncoating ATPase.

PubMed

Gao, B; Emoto, Y; Greene, L; Eisenberg, E

1993-04-25

Many functions of the 70-kDa heat-shock proteins (hsp70s) appear to be regulated by bound nucleotide. In this study we examined the nucleotide binding properties of purified bovine brain uncoating ATPase, one of the constitutively expressed members of the hsp70 family. We found that uncoating ATPase purified by ATP-agarose column chromatography retained one ADP molecule bound per enzyme molecule which could not be removed by extensive dialysis. Since this bound ADP exchanged rapidly with free ADP or ATP, the inability to remove the bound nucleotide was not due to slow dissociation but rather to strong binding of the nucleotide to the uncoating ATPase. In confirmation of this view, equilibrium dialysis experiments suggested that the dissociation constants for both ADP and ATP were less than 0.1 microM. Schmid et al. (Schmid, S. L., Braell, W. A., and Rothman, J. E. (1985) J. Biol. Chem 260, 10057-10062) suggested that the uncoating ATPase had two sites for bound nucleotide, one specific for ATP and one binding both ATP and ATP analogues but not ADP. In contrast, we found that enzyme with bound ADP did not bind further adenosine 5'-(beta,gamma-imino)triphosphate or dATP, nor did more than one ATP molecule bind per enzyme even in 200 microM free ATP. These results strongly suggest that the enzyme has only one binding site for nucleotide. During steady-state ATP hydrolysis, 85% of the bound nucleotide at this site was determined to be ATP and 15% ADP; this is consistent with the rate of ADP release determined in the exchange experiments noted above, where ADP release was found to be six times faster than the overall rate of ATP hydrolysis.

GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

PubMed

Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

2010-11-19

Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Bacterial nucleotide-based second messengers.

PubMed

Pesavento, Christina; Hengge, Regine

2009-04-01

In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain.

PubMed

Ahn, Jinhi; Beharry, Seelochan; Molday, Laurie L; Molday, Robert S

2003-10-10

ABCR, also known as ABCA4, is a member of the superfamily of ATP binding cassette transporters that is believed to transport retinal or retinylidene-phosphatidylethanolamine across photoreceptor disk membranes. Mutations in the ABCR gene are responsible for Stargardt macular dystrophy and related retinal dystrophies that cause severe loss in vision. ABCR consists of two tandemly arranged halves each containing a membrane spanning segment followed by a large extracellular/lumen domain, a multi-spanning membrane domain, and a nucleotide binding domain (NBD). To define the role of each NBD, we examined the nucleotide binding and ATPase activities of the N and C halves of ABCR individually and co-expressed in COS-1 cells and derived from trypsin-cleaved ABCR in disk membranes. When disk membranes or membranes from co-transfected cells were photoaffinity labeled with 8-azido-ATP and 8-azido-ADP, only the NBD2 in the C-half bound and trapped the nucleotide. Co-expressed half-molecules displayed basal and retinal-stimulated ATPase activity similar to full-length ABCR. The individually expressed N-half displayed weak 8-azido-ATP labeling and low basal ATPase activity that was not stimulated by retinal, whereas the C-half did not bind ATP and exhibited little if any ATPase activity. Purified ABCR contained one tightly bound ADP, presumably in NBD1. Our results indicate that only NBD2 of ABCR binds and hydrolyzes ATP in the presence or absence of retinal. NBD1, containing a bound ADP, associates with NBD2 to play a crucial, non-catalytic role in ABCR function.

Identification of protein-interacting nucleotides in a RNA sequence using composition profile of tri-nucleotides.

PubMed

Panwar, Bharat; Raghava, Gajendra P S

2015-04-01

The RNA-protein interactions play a diverse role in the cells, thus identification of RNA-protein interface is essential for the biologist to understand their function. In the past, several methods have been developed for predicting RNA interacting residues in proteins, but limited efforts have been made for the identification of protein-interacting nucleotides in RNAs. In order to discriminate protein-interacting and non-interacting nucleotides, we used various classifiers (NaiveBayes, NaiveBayesMultinomial, BayesNet, ComplementNaiveBayes, MultilayerPerceptron, J48, SMO, RandomForest, SMO and SVM(light)) for prediction model development using various features and achieved highest 83.92% sensitivity, 84.82 specificity, 84.62% accuracy and 0.62 Matthew's correlation coefficient by SVM(light) based models. We observed that certain tri-nucleotides like ACA, ACC, AGA, CAC, CCA, GAG, UGA, and UUU preferred in protein-interaction. All the models have been developed using a non-redundant dataset and are evaluated using five-fold cross validation technique. A web-server called RNApin has been developed for the scientific community (http://crdd.osdd.net/raghava/rnapin/). Copyright © 2015 Elsevier Inc. All rights reserved.

EVIDENCE FROM THYMIDINE-3H-LABELED MERISTEMS OF VICIA FABA OF TWO CELL POPULATIONS

PubMed Central

Webster, P. L.; Davidson, D.

1968-01-01

Treatments with tritiated thymidine (TdR-3H) have revealed the existence of two populations of mitotically active cells in meristems of lateral roots of Vicia faba. A rapidly dividing population, with a cycle time of 14 hr, constitutes about half the cells in the meristem. A second population of cells, with a cycle time in excess of 30 hr, is also present. Estimates of the relative size of this slowly dividing population are more difficult to make, but we calculate that this population includes 27–43% of meristem cells. The remaining fraction of the meristem is made up of cells that divide rarely or not at all. Since, at all times, both populations contribute to the mitotic index, the curve of the percentage of labeled mitoses that can be determined after a pulse label with TdR-3H differs from the curve expected of an ideal population in an important way: the peak value of the curve of the percentage of labeled mitoses is always less than 100%, usually between 75 and 80%. This heterogeneity within a meristem must be borne in mind in terms of the response of meristems to disruptive treatments, the mechanisms controlling mitotic cycle duration, and the spatial organization of a heterogeneous population in an organ that shows polarized growth. PMID:5677968

Evidence from thymidine-3H-labeled meristems of Vicia faba of two cell populations.

PubMed

Webster, P L; Davidson, D

1968-11-01

Treatments with tritiated thymidine (TdR-(3)H) have revealed the existence of two populations of mitotically active cells in meristems of lateral roots of Vicia faba. A rapidly dividing population, with a cycle time of 14 hr, constitutes about half the cells in the meristem. A second population of cells, with a cycle time in excess of 30 hr, is also present. Estimates of the relative size of this slowly dividing population are more difficult to make, but we calculate that this population includes 27-43% of meristem cells. The remaining fraction of the meristem is made up of cells that divide rarely or not at all. Since, at all times, both populations contribute to the mitotic index, the curve of the percentage of labeled mitoses that can be determined after a pulse label with TdR-(3)H differs from the curve expected of an ideal population in an important way: the peak value of the curve of the percentage of labeled mitoses is always less than 100%, usually between 75 and 80%. This heterogeneity within a meristem must be borne in mind in terms of the response of meristems to disruptive treatments, the mechanisms controlling mitotic cycle duration, and the spatial organization of a heterogeneous population in an organ that shows polarized growth.

Regional differences in endothelial cell cytoskeleton, junctional proteins and phosphorylated tyrosine labeling in the porcine vortex vein system.

PubMed

Tan, Priscilla Ern Zhi; Yu, Paula K; Yang, Hongfang; Cringle, Stephen J; Yu, Dao-Yi

2018-07-01

We previously demonstrated endothelial phenotype heterogeneity in the vortex vein system. This study is to further determine whether regional differences are present in the cytoskeleton, junctional proteins and phosphorylated tyrosine labeling within the system. The vortex vein system of twenty porcine eyes was perfused with labels for f-actin, claudin-5, VE-Cadherin, phosphorylated tyrosine and nucleic acid. The endothelial cells of eight different regions (choroidal veins, pre-ampulla, anterior ampulla, mid-ampulla, posterior ampulla, post-ampulla, intra-scleral canal and the extra-ocular vortex vein) were studied using confocal microscopy. There were regional differences in the endothelial cell structures. Cytoskeleton labeling was relatively even in intensity throughout Regions 1 to 6. Overall VE-Cadherin had a non-uniform distribution and thicker width endothelial cell border staining than claudin-5. Progressing downstream there was an increased variation in thickness of VE-cadherin labeling. There was an overlap in phosphorylated tyrosine and VE-Cadherin labeling in the post-ampulla, intra-scleral canal and extra-ocular vortex vein. Intramural cells were observed that were immune-positive for VE-Cadherin and phosphorylated tyrosine. There were significant differences in the number of intramural cells in different regions. Significant regional differences with endothelial cell labeling of cytoskeleton, junction proteins, and phosphorylated tyrosine were found within the vortex vein system. These findings support existing data on endothelial cell phenotype heterogeneity, and may aid in the knowledge of venous pathologies by understanding regions of vulnerability to endothelial damage within the vortex vein system. It could be valuable to further investigate and characterize the VE-cadherin and phosphotyrosine immune-positive intramural cells. Copyright © 2018. Published by Elsevier Ltd.

Genome-wide detection of intervals of genetic heterogeneity associated with complex traits

PubMed Central

Llinares-López, Felipe; Grimm, Dominik G.; Bodenham, Dean A.; Gieraths, Udo; Sugiyama, Mahito; Rowan, Beth; Borgwardt, Karsten

2015-01-01

Motivation: Genetic heterogeneity, the fact that several sequence variants give rise to the same phenotype, is a phenomenon that is of the utmost interest in the analysis of complex phenotypes. Current approaches for finding regions in the genome that exhibit genetic heterogeneity suffer from at least one of two shortcomings: (i) they require the definition of an exact interval in the genome that is to be tested for genetic heterogeneity, potentially missing intervals of high relevance, or (ii) they suffer from an enormous multiple hypothesis testing problem due to the large number of potential candidate intervals being tested, which results in either many false positives or a lack of power to detect true intervals. Results: Here, we present an approach that overcomes both problems: it allows one to automatically find all contiguous sequences of single nucleotide polymorphisms in the genome that are jointly associated with the phenotype. It also solves both the inherent computational efficiency problem and the statistical problem of multiple hypothesis testing, which are both caused by the huge number of candidate intervals. We demonstrate on Arabidopsis thaliana genome-wide association study data that our approach can discover regions that exhibit genetic heterogeneity and would be missed by single-locus mapping. Conclusions: Our novel approach can contribute to the genome-wide discovery of intervals that are involved in the genetic heterogeneity underlying complex phenotypes. Availability and implementation: The code can be obtained at: http://www.bsse.ethz.ch/mlcb/research/bioinformatics-and-computational-biology/sis.html. Contact: felipe.llinares@bsse.ethz.ch Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26072488

Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.

PubMed

Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki

2010-07-01

Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.

Site-Specific Antibody Labeling by Covalent Photoconjugation of Z Domains Functionalized for Alkyne-Azide Cycloaddition Reactions.

PubMed

Perols, Anna; Arcos Famme, Melina; Eriksson Karlström, Amelie

2015-11-01

Antibodies are extensively used in research, diagnostics, and therapy, and for many applications the antibodies need to be labeled. Labeling is typically performed by using amine-reactive probes that target surface-exposed lysine residues, resulting in heterogeneously labeled antibodies. An alternative labeling strategy is based on the immunoglobulin G (IgG)-binding protein domain Z, which binds to the Fc region of IgG. Introducing the photoactivable amino acid benzoylphenylalanine (BPA) into the Z domain makes it possible for a covalent bond to be be formed between the Z domain and the antibody on UV irradiation, to produce a site-specifically labeled product. Z32 BPA was synthesized by solid-phase peptide synthesis and further functionalized to give alkyne-Z32 BPA and azide-Z32 BPA for Cu(I) -catalyzed cycloaddition, as well as DBCO-Z32 BPA for Cu-free strain-promoted cycloaddition. The Z32 BPA variants were conjugated to the human IgG1 antibody trastuzumab and site-specifically labeled with biotin or fluorescein. The fluorescently labeled trastuzumab showed specific staining of the membranes of HER2-expressing cells in immunofluorescence microscopy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cyclic nucleotide binding proteins in the Arabidopsis thaliana and Oryza sativa genomes

PubMed Central

Bridges, Dave; Fraser, Marie E; Moorhead, Greg BG

2005-01-01

Background Cyclic nucleotides are ubiquitous intracellular messengers. Until recently, the roles of cyclic nucleotides in plant cells have proven difficult to uncover. With an understanding of the protein domains which can bind cyclic nucleotides (CNB and GAF domains) we scanned the completed genomes of the higher plants Arabidopsis thaliana (mustard weed) and Oryza sativa (rice) for the effectors of these signalling molecules. Results Our analysis found that several ion channels and a class of thioesterases constitute the possible cyclic nucleotide binding proteins in plants. Contrary to some reports, we found no biochemical or bioinformatic evidence for a plant cyclic nucleotide regulated protein kinase, suggesting that cyclic nucleotide functions in plants have evolved differently than in mammals. Conclusion This paper provides a molecular framework for the discussion of cyclic nucleotide function in plants, and resolves a longstanding debate about the presence of a cyclic nucleotide dependent kinase in plants. PMID:15644130

Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

PubMed

Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

2017-12-14

A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single nucleotide polymorphism detection in aldehyde dehydrogenase 2 (ALDH2) gene using bacterial magnetic particles based on dissociation curve analysis.

PubMed

Maruyama, Kohei; Takeyama, Haruko; Nemoto, Etsuo; Tanaka, Tsuyoshi; Yoda, Kiyoshi; Matsunaga, Tadashi

2004-09-20

Single nucleotide polymorphism (SNP) detection for aldehyde dehydrogenase 2 (ALDH2) gene based on DNA thermal dissociation curve analysis was successfully demonstrated using an automated system with bacterial magnetic particles (BMPs) by developing a new method for avoiding light scattering caused by nanometer-size particles when using commercially available fluorescent dyes such as FITC, Cy3, and Cy5 as labeling chromophores. Biotin-labeled PCR products in ALDH2, two allele-specific probes (Cy3-labeled detection probe for ALDH2*1 and Cy5-labeled detection probe for ALDH2*2), streptavidin-immobilized BMPs (SA-BMPs) were simultaneously mixed. The mixture was denatured at 70 degrees C for 3 min, cooled slowly to 25 degrees C, and incubated for 10 min, allowing the DNA duplex to form between Cy3- or Cy5-labeled detection probes and biotin-labeled PCR products on SA-BMPs. Then duplex DNA-BMP complex was heated to 58 degrees C, a temperature determined by dissociation curve analysis and a dissociated single-base mismatched detection probe was removed at the same temperature under precise control. Furthermore, fluorescence signal from the detection probe was liberated into the supernatant from completely matched duplex DNA-BMP complex by heating to 80 degrees C and measured. In the homozygote target DNA (ALDH2*1/*1 and ALDH2*2/*2), the fluorescence signals from single-base mismatched were decreased to background level, indicating that mismatched hybridization was efficiently removed by the washing process. In the heterozygote target DNA (ALDH2*1/*2), each fluorescence signals was at a similar level. Therefore, three genotypes of SNP in ALDH2 gene were detected using the automated detection system with BMPs. Copyright 2004 Wiley Periodicals, Inc.

Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

PubMed

Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

2014-12-01

Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

NASA Astrophysics Data System (ADS)

Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

2015-01-01

Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

Application of a coarse-grained model for DNA to homo- and heterogeneous melting equilibria

NASA Astrophysics Data System (ADS)

Tito, Nicholas B.; Stubbs, John M.

2010-01-01

Configurational-bias Monte Carlo simulations were carried out on deoxyribonucleic acid (DNA) decamers using a coarse-grained molecular model. The effects of single mutations on the melting transition were investigated as were heterogeneous systems with immobilization of one strand on a surface, both with and without a spacer. The destabilizing effect of an internal mutation is attributed to a lack of cooperativity, which acts through a hydrogen bonding nucleotide's restriction of the conformational freedom of neighboring bases. A surface-oligomer spacer is necessary for duplex stability with the destabilizing effect of the surface coinciding with the volume it excludes.

Heterogeneity of the calcium-induced permeability transition in isolated non-synaptic brain mitochondria.

PubMed

Kristián, Tibor; Weatherby, Tina M; Bates, Timothy E; Fiskum, Gary

2002-12-01

Calcium overload of neural cell mitochondria plays a key role in excitotoxic and ischemic brain injury. This study tested the hypothesis that brain mitochondria consist of subpopulations with differential sensitivity to calcium-induced inner membrane permeability transition, and that this sensitivity is greatly reduced by physiological levels of adenine nucleotides. Isolated non-synaptosomal rat brain mitochondria were incubated in a potassium-based medium in the absence or presence of ATP or ADP. Measurements were made of medium and intramitochondrial free calcium, light scattering, mitochondrial ultrastructure, and the elemental composition of electron-opaque deposits within mitochondria treated with calcium. In the absence of adenine nucleotides, calcium induced a partial decrease in light scattering, accompanied by three distinct ultrastructural morphologies, including large-amplitude swelling, matrix vacuolization and a normal appearance. In the presence of ATP or ADP the mitochondrial calcium uptake capacity was greatly enhanced and calcium induced an increase rather than a decrease in mitochondrial light scattering. Approximately 10% of the mitochondria appeared damaged and the rest contained electron-dense precipitates that contained calcium, as determined by electron-energy loss spectroscopy. These results indicate that brain mitochondria are heterogeneous in their response to calcium. In the absence of adenine nucleotides, approximately 20% of the mitochondrial population exhibit morphological alterations consistent with activation of the permeability transition, but less than 10% exhibit evidence of osmotic swelling and membrane disruption in the presence of ATP or ADP.

Collegial Activity Learning between Heterogeneous Sensors.

PubMed

Feuz, Kyle D; Cook, Diane J

2017-11-01

Activity recognition algorithms have matured and become more ubiquitous in recent years. However, these algorithms are typically customized for a particular sensor platform. In this paper we introduce PECO, a Personalized activity ECOsystem, that transfers learned activity information seamlessly between sensor platforms in real time so that any available sensor can continue to track activities without requiring its own extensive labeled training data. We introduce a multi-view transfer learning algorithm that facilitates this information handoff between sensor platforms and provide theoretical performance bounds for the algorithm. In addition, we empirically evaluate PECO using datasets that utilize heterogeneous sensor platforms to perform activity recognition. These results indicate that not only can activity recognition algorithms transfer important information to new sensor platforms, but any number of platforms can work together as colleagues to boost performance.

Multiple immunofluorescence labelling of formalin-fixed paraffin-embedded (FFPE) tissue

PubMed Central

Robertson, David; Savage, Kay; Reis-Filho, Jorge S; Isacke, Clare M

2008-01-01

Background Investigating the expression of candidate genes in tissue samples usually involves either immunohistochemical labelling of formalin-fixed paraffin-embedded (FFPE) sections or immunofluorescence labelling of cryosections. Although both of these methods provide essential data, both have important limitations as research tools. Consequently, there is a demand in the research community to be able to perform routine, high quality immunofluorescence labelling of FFPE tissues. Results We present here a robust optimised method for high resolution immunofluorescence labelling of FFPE tissues, which involves the combination of antigen retrieval, indirect immunofluorescence and confocal laser scanning microscopy. We demonstrate the utility of this method with examples of immunofluorescence labelling of human kidney, human breast and a tissue microarray of invasive human breast cancers. Finally, we demonstrate that stained slides can be stored in the short term at 4°C or in the longer term at -20°C prior to images being collected. This approach has the potential to unlock a large in vivo database for immunofluorescence investigations and has the major advantages over immunohistochemistry in that it provides higher resolution imaging of antigen localization and the ability to label multiple antigens simultaneously. Conclusion This method provides a link between the cell biology and pathology communities. For the cell biologist, it will enable them to utilise the vast archive of pathology specimens to advance their in vitro data into in vivo samples, in particular archival material and tissue microarrays. For the pathologist, it will enable them to utilise multiple antibodies on a single section to characterise particular cell populations or to test multiple biomarkers in limited samples and define with greater accuracy cellular heterogeneity in tissue samples. PMID:18366689

Systems heterogeneity: An integrative way to understand cancer heterogeneity.

PubMed

Wang, Diane Catherine; Wang, Xiangdong

2017-04-01

The concept of systems heterogeneity was firstly coined and explained in the Special Issue, as a new alternative to understand the importance and complexity of heterogeneity in cancer. Systems heterogeneity can offer a full image of heterogeneity at multi-dimensional functions and multi-omics by integrating gene or protein expression, epigenetics, sequencing, phosphorylation, transcription, pathway, or interaction. The Special Issue starts with the roles of epigenetics in the initiation and development of cancer heterogeneity through the interaction between permanent genetic mutations and dynamic epigenetic alterations. Cell heterogeneity was defined as the difference in biological function and phenotypes between cells in the same organ/tissue or in different organs, as well as various challenges, as exampled in telocytes. The single cell heterogeneity has the value of identifying diagnostic biomarkers and therapeutic targets and clinical potential of single cell systems heterogeneity in clinical oncology. A number of signaling pathways and factors contribute to the development of systems heterogeneity. Proteomic heterogeneity can change the strategy and thinking of drug discovery and development by understanding the interactions between proteins or proteins with drugs in order to optimize drug efficacy and safety. The association of cancer heterogeneity with cancer cell evolution and metastasis was also overviewed as a new alternative for diagnostic biomarkers and therapeutic targets in clinical application. Copyright © 2016 Elsevier Ltd. All rights reserved.

A fast boosting-based screening method for large-scale association study in complex traits with genetic heterogeneity.

PubMed

Wang, Lu-Yong; Fasulo, D

2006-01-01

Genome-wide association study for complex diseases will generate massive amount of single nucleotide polymorphisms (SNPs) data. Univariate statistical test (i.e. Fisher exact test) was used to single out non-associated SNPs. However, the disease-susceptible SNPs may have little marginal effects in population and are unlikely to retain after the univariate tests. Also, model-based methods are impractical for large-scale dataset. Moreover, genetic heterogeneity makes the traditional methods harder to identify the genetic causes of diseases. A more recent random forest method provides a more robust method for screening the SNPs in thousands scale. However, for more large-scale data, i.e., Affymetrix Human Mapping 100K GeneChip data, a faster screening method is required to screening SNPs in whole-genome large scale association analysis with genetic heterogeneity. We propose a boosting-based method for rapid screening in large-scale analysis of complex traits in the presence of genetic heterogeneity. It provides a relatively fast and fairly good tool for screening and limiting the candidate SNPs for further more complex computational modeling task.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Role of a GAG Hinge in the Nucleotide-induced Conformational Change Governing Nucleotide Specificity by T7 DNA Polymerase*

PubMed Central

Jin, Zhinan; Johnson, Kenneth A.

2011-01-01

A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284

Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

DOE PAGES

Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; ...

2014-11-17

Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities,more » nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.« less

C4'/H4' selective, non-uniformly sampled 4D HC(P)CH experiment for sequential assignments of (13)C-labeled RNAs.

PubMed

Saxena, Saurabh; Stanek, Jan; Cevec, Mirko; Plavec, Janez; Koźmiński, Wiktor

2014-11-01

A through bond, C4'/H4' selective, "out and stay" type 4D HC(P)CH experiment is introduced which provides sequential connectivity via H4'(i)-C4'(i)-C4'(i-1)-H4'(i-1) correlations. The (31)P dimension (used in the conventional 3D HCP experiment) is replaced with evolution of better dispersed C4' dimension. The experiment fully utilizes (13)C-labeling of RNA by inclusion of two C4' evolution periods. An additional evolution of H4' is included to further enhance peak resolution. Band selective (13)C inversion pulses are used to achieve selectivity and prevent signal dephasing due to the of C4'-C3' and C4'-C5' homonuclear couplings. For reasonable resolution, non-uniform sampling is employed in all indirect dimensions. To reduce sensitivity losses, multiple quantum coherences are preserved during shared-time evolution and coherence transfer delays. In the experiment the intra-nucleotide peaks are suppressed whereas inter-nucleotide peaks are enhanced to reduce the ambiguities. The performance of the experiment is verified on a fully (13)C, (15)N-labeled 34-nt hairpin RNA comprising typical structure elements.

Flow-aggregated traffic-driven label mapping in label-switching networks

NASA Astrophysics Data System (ADS)

Nagami, Kenichi; Katsube, Yasuhiro; Esaki, Hiroshi; Nakamura, Osamu

1998-12-01

Label switching technology enables high performance, flexible, layer-3 packet forwarding based on the fixed length label information mapped to the layer-3 packet stream. A Label Switching Router (LSR) forwards layer-3 packets based on their label information mapped to the layer-3 address information as well as their layer-3 address information. This paper evaluates the required number of labels under traffic-driven label mapping policy using the real backbone traffic traces. The evaluation shows that the label mapping policy requires a large number of labels. In order to reduce the required number of labels, we propose a label mapping policy which is a traffic-driven label mapping for the traffic toward the same destination network. The evaluation shows that the proposed label mapping policy requires only about one tenth as many labels compared with the traffic-driven label mapping for the host-pair packet stream,and the topology-driven label mapping for the destination network packet stream.

Nutrition Label Viewing during a Food-Selection Task: Front-of-Package Labels vs Nutrition Facts Labels.

PubMed

Graham, Dan J; Heidrick, Charles; Hodgin, Katie

2015-10-01

Earlier research has identified consumer characteristics associated with viewing Nutrition Facts labels; however, little is known about those who view front-of-package nutrition labels. Front-of-package nutrition labels might appeal to more consumers than do Nutrition Facts labels, but it might be necessary to provide consumers with information about how to locate and use these labels. This study quantifies Nutrition Facts and front-of-package nutrition label viewing among American adult consumers. Attention to nutrition information was measured during a food-selection task. One hundred and twenty-three parents (mean age=38 years, mean body mass index [calculated as kg/m(2)]=28) and one of their children (aged 6 to 9 years) selected six foods from a university laboratory-turned-grocery aisle. Participants were randomized to conditions in which front-of-package nutrition labels were present or absent, and signage explaining front-of-package nutrition labels was present or absent. Adults' visual attention to Nutrition Facts labels and front-of-package nutrition labels was objectively measured via eye-tracking glasses. To examine whether there were significant differences in the percentages of participants who viewed Nutrition Facts labels vs front-of-package nutrition labels, McNemar's tests were conducted across all participants, as well as within various sociodemographic categories. To determine whether hypothesized factors, such as health literacy and education, had stronger relationships with front-of-package nutrition label vs Nutrition Facts label viewing, linear regression assessed the magnitude of relationships between theoretically and empirically derived factors and each type of label viewing. Overall, front-of-package nutrition labels were more likely to be viewed than Nutrition Facts labels; however, for all subgroups, higher rates of front-of-package nutrition label viewership occurred only when signage was present drawing attention to the presence and

Co-Labeling for Multi-View Weakly Labeled Learning.

PubMed

Xu, Xinxing; Li, Wen; Xu, Dong; Tsang, Ivor W

2016-06-01

It is often expensive and time consuming to collect labeled training samples in many real-world applications. To reduce human effort on annotating training samples, many machine learning techniques (e.g., semi-supervised learning (SSL), multi-instance learning (MIL), etc.) have been studied to exploit weakly labeled training samples. Meanwhile, when the training data is represented with multiple types of features, many multi-view learning methods have shown that classifiers trained on different views can help each other to better utilize the unlabeled training samples for the SSL task. In this paper, we study a new learning problem called multi-view weakly labeled learning, in which we aim to develop a unified approach to learn robust classifiers by effectively utilizing different types of weakly labeled multi-view data from a broad range of tasks including SSL, MIL and relative outlier detection (ROD). We propose an effective approach called co-labeling to solve the multi-view weakly labeled learning problem. Specifically, we model the learning problem on each view as a weakly labeled learning problem, which aims to learn an optimal classifier from a set of pseudo-label vectors generated by using the classifiers trained from other views. Unlike traditional co-training approaches using a single pseudo-label vector for training each classifier, our co-labeling approach explores different strategies to utilize the predictions from different views, biases and iterations for generating the pseudo-label vectors, making our approach more robust for real-world applications. Moreover, to further improve the weakly labeled learning on each view, we also exploit the inherent group structure in the pseudo-label vectors generated from different strategies, which leads to a new multi-layer multiple kernel learning problem. Promising results for text-based image retrieval on the NUS-WIDE dataset as well as news classification and text categorization on several real-world multi

The pyrimidine nucleotide carrier PNC1 and mitochondrial trafficking of thymidine phosphates in cultured human cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam

2012-10-15

In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cellsmore » proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [{sup 3}H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1{sup -} cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1{sup +} cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: Black-Right-Pointing-Pointer Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. Black-Right-Pointing-Pointer siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1{sup -} cells. Black-Right-Pointing-Pointer PNC1 overexpression accumulates dTTP in mitochondria of TK1{sup +} cells. Black-Right-Pointing-Pointer PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. Black-Right-Pointing-Pointer PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.« less

Understanding nucleotide-regulated FtsZ filament dynamics and the monomer assembly switch with large-scale atomistic simulations.

PubMed

Ramírez-Aportela, Erney; López-Blanco, José Ramón; Andreu, José Manuel; Chacón, Pablo

2014-11-04

Bacterial cytoskeletal protein FtsZ assembles in a head-to-tail manner, forming dynamic filaments that are essential for cell division. Here, we study their dynamics using unbiased atomistic molecular simulations from representative filament crystal structures. In agreement with experimental data, we find different filament curvatures that are supported by a nucleotide-regulated hinge motion between consecutive FtsZ monomers. Whereas GTP-FtsZ filaments bend and twist in a preferred orientation, thereby burying the nucleotide, the differently curved GDP-FtsZ filaments exhibit a heterogeneous distribution of open and closed interfaces between monomers. We identify a coordinated Mg(2+) ion as the key structural element in closing the nucleotide site and stabilizing GTP filaments, whereas the loss of the contacts with loop T7 from the next monomer in GDP filaments leads to open interfaces that are more prone to depolymerization. We monitored the FtsZ monomer assembly switch, which involves opening/closing of the cleft between the C-terminal domain and the H7 helix, and observed the relaxation of isolated and filament minus-end monomers into the closed-cleft inactive conformation. This result validates the proposed switch between the low-affinity monomeric closed-cleft conformation and the active open-cleft FtsZ conformation within filaments. Finally, we observed how the antibiotic PC190723 suppresses the disassembly switch and allosterically induces closure of the intermonomer interfaces, thus stabilizing the filament. Our studies provide detailed structural and dynamic insights into modulation of both the intrinsic curvature of the FtsZ filaments and the molecular switch coupled to the high-affinity end-wise association of FtsZ monomers.

New Method for Producing Significant Amounts of RNA Labeled at Specific Sites | Center for Cancer Research

Cancer.gov

Among biomacromolecules, RNA is the most versatile, and it plays indispensable roles in almost all aspects of biology. For example, in addition to serving as mRNAs coding for proteins, RNAs regulate gene expression, such as controlling where, when, and how efficiently a gene gets expressed, participate in RNA processing, encode the genetic information of some viruses, serve as scaffolds, and even possess enzymatic activity. To study these RNAs and their biological functions and to make use of those RNA activities for biomedical applications, researchers first need to make various types of RNA. For structural biologists incorporating modified or labeled nucleotides at specific sites in RNA molecules of interest is critical to gain structural insight into RNA functions. However, placing labeled or modified residue(s) in desired positions in a large RNA has not been possible until now.

The heterogeneity of regional specific ventilation is unchanged following heavy exercise in athletes

PubMed Central

Tedjasaputra, Vince; Sá, Rui Carlos; Arai, Tatsuya J.; Holverda, Sebastiaan; Theilmann, Rebecca J.; Chen, William T.; Wagner, Peter D.; Davis, Christopher K.; Kim Prisk, G.

2013-01-01

Heavy exercise increases ventilation-perfusion mismatch and decreases pulmonary gas exchange efficiency. Previous work using magnetic resonance imaging (MRI) arterial spin labeling in athletes has shown that, after 45 min of heavy exercise, the spatial heterogeneity of pulmonary blood flow was increased in recovery. We hypothesized that the heterogeneity of regional specific ventilation (SV, the local tidal volume over functional residual capacity ratio) would also be increased following sustained exercise, consistent with the previously documented changes in blood flow heterogeneity. Trained subjects (n = 6, maximal O2 consumption = 61 ± 7 ml·kg−1·min−1) cycled 45 min at their individually determined ventilatory threshold. Oxygen-enhanced MRI was used to quantify SV in a sagittal slice of the right lung in supine posture pre- (preexercise) and 15- and 60-min postexercise. Arterial spin labeling was used to measure pulmonary blood flow in the same slice bracketing the SV measures. Heterogeneity of SV and blood flow were quantified by relative dispersion (RD = SD/mean). The alveolar-arterial oxygen difference was increased during exercise, 23.3 ± 5.3 Torr, compared with rest, 6.3 ± 3.7 Torr, indicating a gas exchange impairment during exercise. No significant change in RD of SV was seen after exercise: preexercise 0.78 ± 0.15, 15 min postexercise 0.81 ± 0.13, 60 min postexercise 0.78 ± 0.08 (P = 0.5). The RD of blood flow increased significantly postexercise: preexercise 1.00 ± 0.12, 15 min postexercise 1.15 ± 0.10, 45 min postexercise 1.10 ± 0.10, 60 min postexercise 1.19 ± 0.11, 90 min postexercise 1.11 ± 0.12 (P < 0.005). The lack of a significant change in RD of SV postexercise, despite an increase in the RD of blood flow, suggests that airways may be less susceptible to the effects of exercise than blood vessels. PMID:23640585

High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

PubMed Central

Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

2006-01-01

Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

Pyrophosphorolytic dismutation of oligodeoxy-nucleotides by terminal deoxynucleotidyltransferase.

PubMed Central

Anderson, R S; Bollum, F J; Beattie, K L

1999-01-01

Terminal transferase (TdT), when incubated with a purified(32)P-5"-end-labeled oligonucleotide of defined length in the presence of Co(2+), Mn(2+)or Mg(2+)and 2-mercaptoethanol in cacodylate or HEPES buffer, pH 7.2, exhibits the ability to remove a 3"-nucleotide from one oligonucleotide and add it to the 3"-end of another. When analyzed by urea-PAGE, this activity is observed as a disproportionation of the starting oligonucleotide into a ladder of shorter and longer oligonucleotides distributed around the starting material. Optimal metal ion concentration is 1-2 mM. All three metal ions support this activity with Co(2+)> Mn(2+) congruent with Mg(2+). Oligonucleotides p(dT) and p(dA) are more efficient substrates than p(dG) and p(dC) because the latter may form secondary structures. The dismutase activity is significant even in the presence of dNTP concentrations comparable to those that exist in the nucleus during the G(1)phase of the cell cycle. Using BetaScope image analysis the rate of pyrophosphorolytic dismutase activity was found to be only moderately slower than the poly-merization activity. These results may help explain the GC-richness of immunoglobulin gene segment joins (N regions) and the loss of bases that occur during gene rearrangements in pre-B and pre-T cells. PMID:10454617

Reducing nontemplated 3' nucleotide addition to polynucleotide transcripts

DOEpatents

Kao, C. Cheng

2000-01-01

Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.

Profile of nucleosides and nucleotides in donkey's milk.

PubMed

Vincenzetti, Silvia; Pucciarelli, Stefania; Nucci, Chiara; Polzonetti, Valeria; Cammertoni, Natalina; Polidori, Paolo

2014-01-01

Nucleotides play a crucial role to cellular functions; they can be obtained from the diet or through the nucleotide salvage pathway, however, in particular situations (occurring mainly in newborns) the metabolic demand of nucleotides exceeds the capacity of their synthesis. These molecules, are receiving attention from a nutraceutical point of view because of their potential direct role in regulating metabolism and infant body condition. Donkey's milk may be considered a good replacer for cow's milk in feeding children with severe Ig-E mediated cow's milk protein allergy, due to its high similarity with human milk. In this study, the presence of cytidine, uridine, CMP, UMP, guanosine, and adenosine, involved in numerous biochemical and physiological activities, were detected for the first time through a RP-HPLC method.

Compositions and methods for detecting single nucleotide polymorphisms

DOEpatents

Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

2016-11-22

Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

KBG syndrome involving a single-nucleotide duplication in ANKRD11

PubMed Central

Kleyner, Robert; Malcolmson, Janet; Tegay, David; Ward, Kenneth; Maughan, Annette; Maughan, Glenn; Nelson, Lesa; Wang, Kai; Robison, Reid; Lyon, Gholson J.

2016-01-01

KBG syndrome is a rare autosomal dominant genetic condition characterized by neurological involvement and distinct facial, hand, and skeletal features. More than 70 cases have been reported; however, it is likely that KBG syndrome is underdiagnosed because of lack of comprehensive characterization of the heterogeneous phenotypic features. We describe the clinical manifestations in a male currently 13 years of age, who exhibited symptoms including epilepsy, severe developmental delay, distinct facial features, and hand anomalies, without a positive genetic diagnosis. Subsequent exome sequencing identified a novel de novo heterozygous single base pair duplication (c.6015dupA) in ANKRD11, which was validated by Sanger sequencing. This single-nucleotide duplication is predicted to lead to a premature stop codon and loss of function in ANKRD11, thereby implicating it as contributing to the proband's symptoms and yielding a molecular diagnosis of KBG syndrome. Before molecular diagnosis, this syndrome was not recognized in the proband, as several key features of the disorder were mild and were not recognized by clinicians, further supporting the concept of variable expressivity in many disorders. Although a diagnosis of cerebral folate deficiency has also been given, its significance for the proband's condition remains uncertain. PMID:27900361

Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.

PubMed

El Houmami, Nawal; Seligmann, Hervé

2017-01-01

We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.

Cytokinin nucleotides contents in sexual buds of Douglas-fir

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imbault, N.; Doumas, P.; Bonnet-Masimbert, N.

1989-04-01

Cytokinin nucleotides were extracted from male and female buds of Pseudotsuga menxiesii by 10 % perchloric acid. They were prepurified on cation exchanger columns (CBA, Amersham) and then separated by two HPLC systems. The first one (Partisil 10 SAX, 10{mu}m, Wathman) separates the mono-, di- and tri-phosphates groups which were collected. The second one (Ultraspher, 5 {mu}m, Beckman) separates the cytokinin nucleotides inside each group. After separation, cytokinin nucleotides were assayed by radioimmunoassay with anti ribosyl zeatin (RZ) and anti isopentenyladenosine (iPA) antibodies. The analysis showed in the monophosphate (mono-P) group one immunoreactant peak in RZ fraction which co-chromatographied withmore » RZ-5{prime}-mono-P and two peaks in the iPA fraction. One of them co-chromatographied with iPA-5{prime}-mono-P. In the diphosphate group, there were three peaks which reacted with anti RZ antibodies and one with anti iPA antibodies. The nucleotides obtained after the first HPLC system, were hydrolysed by a 5{prime}-nucleotidase showed compounds co-chromatographing with RZ and iPA. We did not observe any qualitative differences between the male and female buds. This is the first evidence of cytokinin nucleotides in tissue from woody plants.« less

The accessibility of etheno-nucleotides to collisional quenchers and the nucleotide cleft in G- and F-actin.

PubMed Central

Root, D. D.; Reisler, E.

1992-01-01

Recent publication of the atomic structure of G-actin (Kabsch, W., Mannherz, H. G., Suck, D., Pai, E. F., & Holmes, K. C., 1990, Nature 347, 37-44) raises questions about how the conformation of actin changes upon its polymerization. In this work, the effects of various quenchers of etheno-nucleotides bound to G- and F-actin were examined in order to assess polymerization-related changes in the nucleotide phosphate site. The Mg(2+)-induced polymerization of actin quenched the fluorescence of the etheno-nucleotides by approximately 20% simultaneously with the increase in light scattering by actin. A conformational change at the nucleotide binding site was also indicated by greater accessibility of F-actin than G-actin to positively, negatively, and neutrally charged collisional quenchers. The difference in accessibility between G- and F-actin was greatest for I-, indicating that the environment of the etheno group is more positively charged in the polymerized form of actin. Based on calculations of the change in electric potential of the environment of the etheno group, specific polymerization-related movements of charged residues in the atomic structure of G-actin are suggested. The binding of S-1 to epsilon-ATP-G-actin increased the accessibility of the etheno group to I- even over that in Mg(2+)-polymerized actin. The quenching of the etheno group by nitromethane was, however, unaffected by the binding of S-1 to actin. Thus, the binding of S-1 induces conformational changes in the cleft region of actin that are different from those caused by Mg2+ polymerization of actin.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1304380

Nucleotide excision repair by dual incisions in plants.

PubMed

Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz

2016-04-26

Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct.

VarDetect: a nucleotide sequence variation exploratory tool

PubMed Central

Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

2008-01-01

Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

DNA Nucleotides Detection via capacitance properties of Graphene

NASA Astrophysics Data System (ADS)

Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

2016-05-01

In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

Label-free logic modules and two-layer cascade based on stem-loop probes containing a G-quadruplex domain.

PubMed

Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun

2014-09-01

A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

PubMed Central

Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver

2017-01-01

Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes. PMID:28341698

Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats.

PubMed

Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver

2017-05-05

Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade + reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2 FEN1 Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe , but contributes to DNA repeat stability in MMR-independent processes. Copyright © 2017 Villahermosa et al.

Label Review Training: Module 1: Label Basics, Page 21

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. Learn about types of labels.

Label Review Training: Module 1: Label Basics, Page 20

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. This section focuses on supplemental labeling.

Label Review Training: Module 1: Label Basics, Page 22

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. Learn about what labels require review.

Label Review Training: Module 1: Label Basics, Page 19

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. This section covers supplemental distributor labeling.

Interrogating Surface Functional Group Heterogeneity of Activated Thermoplastics Using Super-Resolution Fluorescence Microscopy.

PubMed

ONeil, Colleen E; Jackson, Joshua M; Shim, Sang-Hee; Soper, Steven A

2016-04-05

We present a novel approach for characterizing surfaces utilizing super-resolution fluorescence microscopy with subdiffraction limit spatial resolution. Thermoplastic surfaces were activated by UV/O3 or O2 plasma treatment under various conditions to generate pendant surface-confined carboxylic acids (-COOH). These surface functional groups were then labeled with a photoswitchable dye and interrogated using single-molecule, localization-based, super-resolution fluorescence microscopy to elucidate the surface heterogeneity of these functional groups across the activated surface. Data indicated nonuniform distributions of these functional groups for both COC and PMMA thermoplastics with the degree of heterogeneity being dose dependent. In addition, COC demonstrated relative higher surface density of functional groups compared to PMMA for both UV/O3 and O2 plasma treatment. The spatial distribution of -COOH groups secured from super-resolution imaging were used to simulate nonuniform patterns of electroosmotic flow in thermoplastic nanochannels. Simulations were compared to single-particle tracking of fluorescent nanoparticles within thermoplastic nanoslits to demonstrate the effects of surface functional group heterogeneity on the electrokinetic transport process.

Label Review Training: Module 1: Label Basics, Page 18

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. This section discusses the types of labels.

Label Review Training: Module 1: Label Basics, Page 26

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. Learn about mandatory and advisory label statements.

Label Review Training: Module 1: Label Basics, Page 15

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. Learn about the consequences of improper labeling.

Label Review Training: Module 1: Label Basics, Page 14

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. Learn about positive effects from proper labeling.

Label Review Training: Module 1: Label Basics, Page 24

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. This page is about which labels require review.

Label Review Training: Module 1: Label Basics, Page 17

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. See an overview of the importance of labels.

Label Review Training: Module 1: Label Basics, Page 27

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. See examples of mandatory and advisory label statements.

Heterogeneity within compulsive buyers: a Q-sort study.

PubMed

Thornhill, Kate; Kellett, Stephen; Davies, Jason

2012-06-01

This study investigated how compulsive buyers make sense of their excessive shopping behaviour to explore possible sources of heterogeneity between compulsive buyers. Twenty female participants met 'caseness' for compulsive buying (CB) on the CB Scale (CBS), prior to completing a Q-sort specifically related to their experiences of shopping. Participants provided details of occupation, income, and debt levels and completed two psychometric scales: the Hospital Anxiety and Depression Scale (HADS) and Yale Brown Obsessive Compulsive Scale-Shopping Version (YBOCS-SV). Principle component analysis (PCA) identified two groups within the compulsive buyers (labelled positive reinforcement and emotional distress) that explained 44% of the study variance. Ten women defined the positive reinforcement factor and tended to identify with pleasurable aspects of buying. Six women characterized the emotional distress factor and endorsed varied financial, emotional, and interpersonal difficulties associated with their CB. The emotional distress group carried significantly greater current debt levels and had significantly more severe CB. The study illustrates that compulsive buyers can relate to their 'symptoms' in dissimilar ways. The clinical implications of such heterogeneity are discussed, methodological shortcomings identified, and areas for future research indicated. ©2011 The British Psychological Society.

Label Review Training: Module 1: Label Basics, Page 23

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. Lists types of labels that do not require review.

Updating Our View of Organelle Genome Nucleotide Landscape

PubMed Central

Smith, David Roy

2012-01-01

Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299

Distribution of fluorescently labeled tubulin injected into sand dollar eggs from fertilization through cleavage.

PubMed

Hamaguchi, Y; Toriyama, M; Sakai, H; Hiramoto, Y

1985-04-01

Porcine brain tubulin labeled with fluorescein isothiocyanate (FITC) was able to polymerize by itself and co-polymerize with tubulin purified from starfish sperm flagella. When we injected the FITC-labeled tubulin into unfertilized eggs of the sand dollar, Clypeaster japonicus, and the eggs were then fertilized, the labeled tubulin was incorporated into the sperm aster. When injected into fertilized eggs at streak stage, the tubulin was quickly incorporated into each central region of growing asters. It was clearly visualized that the labeled tubulin, upon reaching metaphase, accumulated in the mitotic apparatus and later disappeared over the cytoplasm during interphase. The accumulation of the fluorescence in the mitotic apparatus was observed repeatedly at successive cleavage. After lysis of the fertilized eggs with a microtubule-stabilizing solution, fluorescent fibrous structures around the nucleus and those of the sperm aster and the mitotic apparatus were preserved and coincided with the fibrous structures observed by polarization and differential interference microscopy. We found the FITC-labeled tubulin to be incorporated into the entire mitotic apparatus within 20-30 s when injected into the eggs at metaphase or anaphase. This rapid incorporation of the labeled tubulin into the mitotic apparatus suggests that the equilibrium between mitotic microtubules and tubulin is attained very rapidly in the living eggs. Axonemal tubulin purified from starfish sperm flagella and labeled with FITC was also incorporated into microtubular structures in the same fashion as the FITC-labeled brain tubulin. These results suggest that even FITC-labeled heterogeneous tubulins undergo spatial and stage-specific regulation of assembly-disassembly in the same manner as does sand dollar egg tubulin.

Distribution of fluorescently labeled tubulin injected into sand dollar eggs from fertilization through cleavage

PubMed Central

1985-01-01

Porcine brain tubulin labeled with fluorescein isothiocyanate (FITC) was able to polymerize by itself and co-polymerize with tubulin purified from starfish sperm flagella. When we injected the FITC- labeled tubulin into unfertilized eggs of the sand dollar, Clypeaster japonicus, and the eggs were then fertilized, the labeled tubulin was incorporated into the sperm aster. When injected into fertilized eggs at streak stage, the tubulin was quickly incorporated into each central region of growing asters. It was clearly visualized that the labeled tubulin, upon reaching metaphase, accumulated in the mitotic apparatus and later disappeared over the cytoplasm during interphase. The accumulation of the fluorescence in the mitotic apparatus was observed repeatedly at successive cleavage. After lysis of the fertilized eggs with a microtubule-stabilizing solution, fluorescent fibrous structures around the nucleus and those of the sperm aster and the mitotic apparatus were preserved and coincided with the fibrous structures observed by polarization and differential interference microscopy. We found the FITC-labeled tubulin to be incorporated into the entire mitotic apparatus within 20-30 s when injected into the eggs at metaphase or anaphase. This rapid incorporation of the labeled tubulin into the mitotic apparatus suggests that the equilibrium between mitotic microtubules and tubulin is attained very rapidly in the living eggs. Axonemal tubulin purified from starfish sperm flagella and labeled with FITC was also incorporated into microtubular structures in the same fashion as the FITC-labeled brain tubulin. These results suggest that even FITC-labeled heterogeneous tubulins undergo spatial and stage-specific regulation of assembly-disassembly in the same manner as does sand dollar egg tubulin. PMID:3920225

Label Review Training: Module 1: Label Basics, Page 16

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. Learn about the importance of labels and the role in enforcement.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Switching Cyclic Nucleotide-Selective Activation of Cyclic Adenosine Monophosphate-Dependent Protein Kinase Holoenzyme Reveals Distinct Roles of Tandem Cyclic Nucleotide-Binding Domains.

PubMed

He, Daniel; Lorenz, Robin; Kim, Choel; Herberg, Friedrich W; Lim, Chinten James

2017-12-15

The cyclic adenosine monophosphate (cAMP)- and cyclic guanosine monophosphate (cGMP)-dependent protein kinases (PKA and PKG) are key effectors of cyclic nucleotide signaling. Both share structural features that include tandem cyclic nucleotide-binding (CNB) domains, CNB-A and CNB-B, yet their functions are separated through preferential activation by either cAMP or cGMP. Based on structural studies and modeling, key CNB contact residues have been identified for both kinases. In this study, we explored the requirements for conversion of PKA activation from cAMP-dependent to cGMP-dependent. The consequences of the residue substitutions T192R/A212T within CNB-A or G316R/A336T within CNB-B of PKA-RIα on cyclic nucleotide binding and holoenzyme activation were assessed in vitro using purified recombinant proteins, and ex vivo using RIα-deficient mouse embryonic fibroblasts genetically reconstituted with wild-type or mutant PKA-RIα. In vitro, a loss of binding and activation selectivity was observed when residues in either one of the CNB domains were mutated, while mutations in both CNB domains resulted in a complete switch of selectivity from cAMP to cGMP. The switch in selectivity was also recapitulated ex vivo, confirming their functional roles in cells. Our results highlight the importance of key cyclic nucleotide contacts within each CNB domain and suggest that these domains may have evolved from an ancestral gene product to yield two distinct cyclic nucleotide-dependent protein kinases.

Large epidemic thresholds emerge in heterogeneous networks of heterogeneous nodes

NASA Astrophysics Data System (ADS)

Yang, Hui; Tang, Ming; Gross, Thilo

2015-08-01

One of the famous results of network science states that networks with heterogeneous connectivity are more susceptible to epidemic spreading than their more homogeneous counterparts. In particular, in networks of identical nodes it has been shown that network heterogeneity, i.e. a broad degree distribution, can lower the epidemic threshold at which epidemics can invade the system. Network heterogeneity can thus allow diseases with lower transmission probabilities to persist and spread. However, it has been pointed out that networks in which the properties of nodes are intrinsically heterogeneous can be very resilient to disease spreading. Heterogeneity in structure can enhance or diminish the resilience of networks with heterogeneous nodes, depending on the correlations between the topological and intrinsic properties. Here, we consider a plausible scenario where people have intrinsic differences in susceptibility and adapt their social network structure to the presence of the disease. We show that the resilience of networks with heterogeneous connectivity can surpass those of networks with homogeneous connectivity. For epidemiology, this implies that network heterogeneity should not be studied in isolation, it is instead the heterogeneity of infection risk that determines the likelihood of outbreaks.

Large epidemic thresholds emerge in heterogeneous networks of heterogeneous nodes.

PubMed

Yang, Hui; Tang, Ming; Gross, Thilo

2015-08-21

One of the famous results of network science states that networks with heterogeneous connectivity are more susceptible to epidemic spreading than their more homogeneous counterparts. In particular, in networks of identical nodes it has been shown that network heterogeneity, i.e. a broad degree distribution, can lower the epidemic threshold at which epidemics can invade the system. Network heterogeneity can thus allow diseases with lower transmission probabilities to persist and spread. However, it has been pointed out that networks in which the properties of nodes are intrinsically heterogeneous can be very resilient to disease spreading. Heterogeneity in structure can enhance or diminish the resilience of networks with heterogeneous nodes, depending on the correlations between the topological and intrinsic properties. Here, we consider a plausible scenario where people have intrinsic differences in susceptibility and adapt their social network structure to the presence of the disease. We show that the resilience of networks with heterogeneous connectivity can surpass those of networks with homogeneous connectivity. For epidemiology, this implies that network heterogeneity should not be studied in isolation, it is instead the heterogeneity of infection risk that determines the likelihood of outbreaks.

Measuring the labeling efficiency of pseudocontinuous arterial spin labeling.

PubMed

Chen, Zhensen; Zhang, Xingxing; Yuan, Chun; Zhao, Xihai; van Osch, Matthias J P

2017-05-01

Optimization and validation of a sequence for measuring the labeling efficiency of pseudocontinuous arterial spin labeling (pCASL) perfusion MRI. The proposed sequence consists of a labeling module and a single slice Look-Locker echo planar imaging readout. A model-based algorithm was used to calculate labeling efficiency from the signal acquired from the main brain-feeding arteries. Stability of the labeling efficiency measurement was evaluated with regard to the use of cardiac triggering, flow compensation and vein signal suppression. Accuracy of the measurement was assessed by comparing the measured labeling efficiency to mean brain pCASL signal intensity over a wide range of flip angles as applied in the pCASL labeling. Simulations show that the proposed algorithm can effectively calculate labeling efficiency when correcting for T1 relaxation of the blood spins. Use of cardiac triggering and vein signal suppression improved stability of the labeling efficiency measurement, while flow compensation resulted in little improvement. The measured labeling efficiency was found to be linearly (R = 0.973; P < 0.001) related to brain pCASL signal intensity over a wide range of pCASL flip angles. The optimized labeling efficiency sequence provides robust artery-specific labeling efficiency measurement within a short acquisition time (∼30 s), thereby enabling improved accuracy of pCASL CBF quantification. Magn Reson Med 77:1841-1852, 2017. © 2016 International Society for Magnetic Resonance in Medicine Magn Reson Med 77:1841-1852, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

PubMed Central

2015-01-01

Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

Nucleotide exchange and excision technology DNA shuffling and directed evolution.

PubMed

Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M

2011-01-01

Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.

Nucleotide Intermediates in the Biosynthesis of Heteropolymeric Polysaccharides

PubMed Central

Strominger, Jack L.

1964-01-01

The role of nucleotides as “carriers” of small molecules for biosynthetic reactions is discussed. Following this introduction, the particular problem of nucleotide intermediates in chondroitin sulfate synthesis is presented. The egg shell of the hen contains a form of chondroitin sulfate and particular emphasis is placed on the biosynthesis of sulfated polysaccharides in the hen oviduct, which has been studied in the author's laboratory. ImagesFigure 16Figure 19 PMID:14104074

Defects in maintenance of mitochondrial DNA are associated with intramitochondrial nucleotide imbalances.

PubMed

Ashley, Neil; Adams, Susan; Slama, Abdelhamid; Zeviani, Massimo; Suomalainen, Anu; Andreu, Antonio L; Naviaux, Robert K; Poulton, Joanna

2007-06-15

Defects in mtDNA maintenance range from fatal multisystem childhood diseases, such as Alpers syndrome, to milder diseases in adults, including mtDNA depletion syndromes (MDS) and familial progressive external ophthalmoplegia (AdPEO). Most are associated with defects in genes involved in mitochondrial deoxynucleotide metabolism or utilization, such as mutations in thymidine kinase 2 (TK2) as well as the mtDNA replicative helicase, Twinkle and gamma polymerase (POLG). We have developed an in vitro system to measure incorporation of radiolabelled dNTPs into mitochondria of saponin permeabilized cells. We used this to compare the rates of mtDNA synthesis in cells from 12 patients with diseases of mtDNA maintenance. We observed reduced incorporation of exogenous alpha (32)P-dTTP in fibroblasts from a patient with Alpers syndrome associated with the A467T substitution in POLG, a patient with dGK mutations, and a patient with mtDNA depletion of unknown origin compared to controls. However, incorporation of alpha (32)P-dTTP relative to either cell doubling time or alpha (32)P-dCTP incorporation was increased in patients with thymidine kinase deficiency or PEO as the result of TWINKLE mutations compared with controls. The specific activity of newly synthesized mtDNA depends on the size of the endogenous pool diluting the exogenous labelled nucleotide. Our result is consistent with a deficiency in the intramitochondrial pool of dTTP relative to dCTP in cells from patients with TK2 deficiency and TWINKLE mutations. Such DNA precursor asymmetry could cause pausing of the replication complex and hence exacerbate the propensity for age-related mtDNA mutations. Because deviations from the normal concentrations of dNTPs are known to be mutagenic, we suggest that intramitochondrial nucleotide imbalance could underlie the multiple mtDNA mutations observed in these patients.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

A movie of the RNA polymerase nucleotide addition cycle.

PubMed

Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

2009-06-01

During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

Incidental Detection of Type B2 Thymoma on 68Ga-Labeled Prostate-Specific Membrane Antigen PET/CT Imaging.

PubMed

Krishnaraju, Venkata Subramanian; Basher, Rajender Kumar; Singh, Harmandeep; Singh, Shrawan Kumar; Bal, Amanjit; Mittal, Bhagwant Rai

2018-05-01

Ga-labeled prostate-specific membrane antigen is a novel radiotracer for imaging of prostate cancer. We report a hormonally treated patient with prostate carcinoma, presenting with lower urinary tract symptoms and rising prostate-specific antigen levels, who underwent Ga-labeled prostate-specific membrane antigen PET/CT for suspected recurrence. No tracer avid lesion was noted in the prostate gland and locoregional area. However, intense tracer avid heterogeneously enhancing soft tissue lesion with cystic areas and coarse calcifications was seen in the anterior mediastinum. PET/CT-guided biopsy from the mediastenal lesion revealed type B2 thymoma.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Flow cytometric single cell analysis reveals heterogeneity between adipose depots

PubMed Central

Boumelhem, Badwi B.; Assinder, Stephen J.; Bell-Anderson, Kim S.; Fraser, Stuart T.

2017-01-01

ABSTRACT Understanding adipose tissue heterogeneity is hindered by the paucity of methods to analyze mature adipocytes at the single cell level. Here, we report a system for analyzing live adipocytes from different adipose depots in the adult mouse. Single cell suspensions of buoyant adipocytes were separated from the stromal vascular fraction and analyzed by flow cytometry. Compared to other lipophilic dyes, Nile Red uptake effectively distinguished adipocyte populations. Nile Red fluorescence increased with adipocyte size and granularity and could be combined with MitoTracker® Deep Red or fluorescent antibody labeling to further dissect adipose populations. Epicardial adipocytes exhibited the least mitochondrial membrane depolarization and highest fatty-acid translocase CD36 surface expression. In contrast, brown adipocytes showed low surface CD36 expression. Pregnancy resulted in reduced mitochondrial membrane depolarisation and increased CD36 surface expression in brown and epicardial adipocyte populations respectively. Our protocol revealed unreported heterogeneity between adipose depots and highlights the utility of flow cytometry for screening adipocytes at the single cell level. PMID:28453382

Nucleotide excision repair is a potential therapeutic target in multiple myeloma

PubMed Central

Szalat, R; Samur, M K; Fulciniti, M; Lopez, M; Nanjappa, P; Cleynen, A; Wen, K; Kumar, S; Perini, T; Calkins, A S; Reznichenko, E; Chauhan, D; Tai, Y-T; Shammas, M A; Anderson, K C; Fermand, J-P; Arnulf, B; Avet-Loiseau, H; Lazaro, J-B; Munshi, N C

2018-01-01

Despite the development of novel drugs, alkylating agents remain an important component of therapy in multiple myeloma (MM). DNA repair processes contribute towards sensitivity to alkylating agents and therefore we here evaluate the role of nucleotide excision repair (NER), which is involved in the removal of bulky adducts and DNA crosslinks in MM. We first evaluated NER activity using a novel functional assay and observed a heterogeneous NER efficiency in MM cell lines and patient samples. Using next-generation sequencing data, we identified that expression of the canonical NER gene, excision repair cross-complementation group 3 (ERCC3), significantly impacted the outcome in newly diagnosed MM patients treated with alkylating agents. Next, using small RNA interference, stable knockdown and overexpression, and small-molecule inhibitors targeting xeroderma pigmentosum complementation group B (XPB), the DNA helicase encoded by ERCC3, we demonstrate that NER inhibition significantly increases sensitivity and overcomes resistance to alkylating agents in MM. Moreover, inhibiting XPB leads to the dual inhibition of NER and transcription and is particularly efficient in myeloma cells. Altogether, we show that NER impacts alkylating agents sensitivity in myeloma cells and identify ERCC3 as a potential therapeutic target in MM. PMID:28588253

High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells.

PubMed

Lin, Eric; Rivera-Báez, Lianette; Fouladdel, Shamileh; Yoon, Hyeun Joong; Guthrie, Stephanie; Wieger, Jacob; Deol, Yadwinder; Keller, Evan; Sahai, Vaibhav; Simeone, Diane M; Burness, Monika L; Azizi, Ebrahim; Wicha, Max S; Nagrath, Sunitha

2017-09-27

We present "Labyrinth," a label-free microfluidic device to isolate circulating tumor cells (CTCs) using the combination of long loops and sharp corners to focus both CTCs and white blood cells (WBCs) at a high throughput of 2.5 mL/min. The high yield (>90%) and purity (600 WBCs/mL) of Labyrinth enabled us to profile gene expression in CTCs. As proof of principle, we used previously established cancer stem cell gene signatures to profile single cells isolated from the blood of breast cancer patients. We observed heterogeneous subpopulations of CTCs expressing genes for stem cells, epithelial cells, mesenchymal cells, and cells transitioning between epithelial and mesenchymal. Labyrinth offers a cell-surface marker-independent single-cell isolation platform to study heterogeneous CTC subpopulations. Copyright © 2017 Elsevier Inc. All rights reserved.

Dietary nucleotides and early growth in formula-fed infants: a randomized controlled trial.

PubMed

Singhal, Atul; Kennedy, Kathy; Lanigan, J; Clough, Helen; Jenkins, Wendy; Elias-Jones, Alun; Stephenson, Terrence; Dudek, Peter; Lucas, Alan

2010-10-01

Dietary nucleotides are nonprotein nitrogenous compounds that are found in high concentrations in breast milk and are thought to be conditionally essential nutrients in infancy. A high nucleotide intake has been suggested to explain some of the benefits of breastfeeding compared with formula feeding and to promote infant growth. However, relatively few large-scale randomized trials have tested this hypothesis in healthy infants. We tested the hypothesis that nucleotide supplementation of formula benefits early infant growth. Occipitofrontal head circumference, weight, and length were assessed in infants who were randomly assigned to groups fed nucleotide-supplemented (31 mg/L; n=100) or control formula without nucleotide supplementation (n=100) from birth to the age of 20 weeks, and in infants who were breastfed (reference group; n=101). Infants fed with nucleotide-supplemented formula had greater occipitofrontal head circumference at ages 8, 16, and 20 weeks than infants fed control formula (mean difference in z scores at 8 weeks: 0.4 [95% confidence interval: 0.1-0.7]; P=.006) even after adjustment for potential confounding factors (P=.002). Weight at 8 weeks and the increase in both occipitofrontal head circumference and weight from birth to 8 weeks were also greater in infants fed nucleotide-supplemented formula than in those fed control formula. Our data support the hypothesis that nucleotide supplementation leads to increased weight gain and head growth in formula-fed infants. Therefore, nucleotides could be conditionally essential for optimal infant growth in some formula-fed populations. Additional research is needed to test the hypothesis that the benefits of nucleotide supplementation for early head growth, a critical period for brain growth, have advantages for long-term cognitive development.

Subcellular SIMS imaging of isotopically labeled amino acids in cryogenically prepared cells

NASA Astrophysics Data System (ADS)

Chandra, Subhash

2004-06-01

Ion microscopy is a potentially powerful technique for localization of isotopically labeled molecules. In this study, L-arginine and phenylalanine amino acids labeled with stable isotopes 13C and 15N were localized in cultured cells with the ion microscope at 500 nm spatial resolution. Cells were exposed to the labeled amino acids and cryogenically prepared. SIMS analyses were made in fractured freeze-dried cells. A dynamic distribution was observed from labeled arginine-treated LLC-PK 1 kidney cells at mass 28 ( 13C15N) in negative secondaries, revealing cell-to-cell heterogeneity and preferential accumulation of the amino acid (or its metabolite) in the nucleus and nucleolus of some cells. The smaller nucleolus inside the nucleus was clearly resolved in SIMS images and confirmed by correlative light microscopy. The distribution of labeled phenylalanine contrasted with arginine as it was rather homogeneously distributed in T98G human glioblastoma cells. Images of 39K, 23Na and 40Ca were also recorded to confirm the reliability of sample preparation and authenticity of the observed amino acid distributions. These observations indicate that SIMS techniques can provide a valuable technology for subcellular localization of nitrogen-containing molecules in proteomics since nitrogen does not have a radionuclide tracer isotope. Amino acids labeled with stable isotopes can be used as tracers for studying their transport and metabolism in distinct subcellular compartments with SIMS. Further studies of phenylalanine uptake in human glioblastoma cells may have special significance in boron neutron capture therapy (BNCT) as a boron analogue of phenylalanine, boronophenylalanine is a clinically approved compound for the treatment of brain tumors.

LS³: A Method for Improving Phylogenomic Inferences When Evolutionary Rates Are Heterogeneous among Taxa

PubMed Central

Rivera-Rivera, Carlos J.; Montoya-Burgos, Juan I.

2016-01-01

Phylogenetic inference artifacts can occur when sequence evolution deviates from assumptions made by the models used to analyze them. The combination of strong model assumption violations and highly heterogeneous lineage evolutionary rates can become problematic in phylogenetic inference, and lead to the well-described long-branch attraction (LBA) artifact. Here, we define an objective criterion for assessing lineage evolutionary rate heterogeneity among predefined lineages: the result of a likelihood ratio test between a model in which the lineages evolve at the same rate (homogeneous model) and a model in which different lineage rates are allowed (heterogeneous model). We implement this criterion in the algorithm Locus Specific Sequence Subsampling (LS³), aimed at reducing the effects of LBA in multi-gene datasets. For each gene, LS³ sequentially removes the fastest-evolving taxon of the ingroup and tests for lineage rate homogeneity until all lineages have uniform evolutionary rates. The sequences excluded from the homogeneously evolving taxon subset are flagged as potentially problematic. The software implementation provides the user with the possibility to remove the flagged sequences for generating a new concatenated alignment. We tested LS³ with simulations and two real datasets containing LBA artifacts: a nucleotide dataset regarding the position of Glires within mammals and an amino-acid dataset concerning the position of nematodes within bilaterians. The initially incorrect phylogenies were corrected in all cases upon removing data flagged by LS³. PMID:26912812

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

NASA Astrophysics Data System (ADS)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

HETEROGENEOUS INTEGRATION TECHNOLOGY

DTIC Science & Technology

2017-08-24

provide a structure for this review. The history and the current status of integration technologies in each category are examined and product examples are...NEED HETEROGENEOUS INTEGRATION?............................................. 6 5. IMPACT OF HETEROGENEOUS INTEGRATION ON PRODUCT DEVELOPMENT ... 8 6...58 12. SUMMARY OF HETEROGENEOUS INTEGRATION TECHNIQUES........................... 63 13. HETEROGENEOUS INTEGRATION PRODUCT EXAMPLES

Phenotypic and genetic heterogeneity among subjects with mild airflow obstruction in COPDGene.

PubMed

Lee, Jin Hwa; Cho, Michael H; McDonald, Merry-Lynn N; Hersh, Craig P; Castaldi, Peter J; Crapo, James D; Wan, Emily S; Dy, Jennifer G; Chang, Yale; Regan, Elizabeth A; Hardin, Megan; DeMeo, Dawn L; Silverman, Edwin K

2014-10-01

Chronic obstructive pulmonary disease (COPD) is characterized by marked phenotypic heterogeneity. Most previous studies have focused on COPD subjects with FEV1 < 80% predicted. We investigated the clinical and genetic heterogeneity in subjects with mild airflow limitation in spirometry grade 1 defined by the Global Initiative for chronic Obstructive Lung Disease (GOLD 1). Data from current and former smokers participating in the COPDGene Study (NCT00608764) were analyzed. K-means clustering was performed to explore subtypes within 794 GOLD 1 subjects. For all subjects with GOLD 1 and with each cluster, a genome-wide association study and candidate gene testing were performed using smokers with normal lung function as a control group. Combinations of COPD genome-wide significant single nucleotide polymorphisms (SNPs) were tested for association with FEV1 (% predicted) in GOLD 1 and in a combined group of GOLD 1 and smoking control subjects. K-means clustering of GOLD 1 subjects identified putative "near-normal", "airway-predominant", "emphysema-predominant" and "lowest FEV1% predicted" subtypes. In non-Hispanic whites, the only SNP nominally associated with GOLD 1 status relative to smoking controls was rs7671167 (FAM13A) in logistic regression models with adjustment for age, sex, pack-years of smoking, and genetic ancestry. The emphysema-predominant GOLD 1 cluster was nominally associated with rs7671167 (FAM13A) and rs161976 (BICD1). The lowest FEV1% predicted cluster was nominally associated with rs1980057 (HHIP) and rs1051730 (CHRNA3). Combinations of COPD genome-wide significant SNPs were associated with FEV1 (% predicted) in a combined group of GOLD 1 and smoking control subjects. Our results indicate that GOLD 1 subjects show substantial clinical heterogeneity, which is at least partially related to genetic heterogeneity. Copyright © 2014 Elsevier Ltd. All rights reserved.

PHENOTYPIC AND GENETIC HETEROGENEITY AMONG SUBJECTS WITH MILD AIRFLOW OBSTRUCTION IN COPDGENE

PubMed Central

Lee, Jin Hwa; Cho, Michael H.; McDonald, Merry-Lynn N.; Hersh, Craig P.; Castaldi, Peter J.; Crapo, James D.; Wan, Emily S.; Dy, Jennifer G.; Chang, Yale; Regan, Elizabeth A.; Hardin, Megan; DeMeo, Dawn L.; Silverman, Edwin K.

2014-01-01

Background Chronic obstructive pulmonary disease (COPD) is characterized by marked phenotypic heterogeneity. Most previous studies have focused on COPD subjects with FEV1 < 80% predicted. We investigated the clinical and genetic heterogeneity in subjects with mild airflow limitation in spirometry grade 1 defined by the Global Initiative for chronic Obstructive Lung Disease (GOLD 1). Methods Data from current and former smokers participating in the COPDGene Study (NCT00608764) were analyzed. K-means clustering was performed to explore subtypes within 794 GOLD 1 subjects. For all subjects with GOLD 1 and with each cluster, a genome-wide association study and candidate gene testing were performed using smokers with normal lung function as a control group. Combinations of COPD genome-wide significant single nucleotide polymorphisms (SNPs) were tested for association with FEV1 (% predicted) in GOLD 1 and in a combined group of GOLD1 and smoking control subjects. Results K-means clustering of GOLD 1 subjects identified putative “near-normal”, “airway-predominant”, “emphysema-predominant” and “lowest FEV1 % predicted” subtypes. In non-Hispanic whites, the only SNP nominally associated with GOLD 1 status relative to smoking controls was rs7671167 (FAM13A) in logistic regression models with adjustment for age, sex, pack-years of smoking, and genetic ancestry. The emphysema-predominant GOLD 1 cluster was nominally associated with rs7671167 (FAM13A) and rs161976 (BICD1). The lowest FEV1 % predicted cluster was nominally associated with rs1980057 (HHIP) and rs1051730 (CHRNA3). Combinations of COPD genome-wide significant SNPs were associated with FEV1 (% predicted) in a combined group of GOLD 1 and smoking control subjects. Conclusions Our results indicate that GOLD 1 subjects show substantial clinical heterogeneity, which is at least partially related to genetic heterogeneity. PMID:25154699

Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

PubMed

Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

2018-05-01

Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Retrospective Study on Genetic Heterogeneity within Treponema Strains: Subpopulations Are Genetically Distinct in a Limited Number of Positions.

PubMed

Čejková, Darina; Strouhal, Michal; Norris, Steven J; Weinstock, George M; Šmajs, David

2015-01-01

Pathogenic uncultivable treponemes comprise human and animal pathogens including agents of syphilis, yaws, bejel, pinta, and venereal spirochetosis in rabbits and hares. A set of 10 treponemal genome sequences including those of 4 Treponema pallidum ssp. pallidum (TPA) strains (Nichols, DAL-1, Mexico A, SS14), 4 T. p. ssp. pertenue (TPE) strains (CDC-2, Gauthier, Samoa D, Fribourg-Blanc), 1 T. p. ssp. endemicum (TEN) strain (Bosnia A) and one strain (Cuniculi A) of Treponema paraluisleporidarum ecovar Cuniculus (TPLC) were examined with respect to the presence of nucleotide intrastrain heterogeneous sites. The number of identified intrastrain heterogeneous sites in individual genomes ranged between 0 and 7. Altogether, 23 intrastrain heterogeneous sites (in 17 genes) were found in 5 out of 10 investigated treponemal genomes including TPA strains Nichols (n = 5), DAL-1 (n = 4), and SS14 (n = 7), TPE strain Samoa D (n = 1), and TEN strain Bosnia A (n = 5). Although only one heterogeneous site was identified among 4 tested TPE strains, 16 such sites were identified among 4 TPA strains. Heterogeneous sites were mostly strain-specific and were identified in four tpr genes (tprC, GI, I, K), in genes involved in bacterial motility and chemotaxis (fliI, cheC-fliY), in genes involved in cell structure (murC), translation (prfA), general and DNA metabolism (putative SAM dependent methyltransferase, topA), and in seven hypothetical genes. Heterogeneous sites likely represent both the selection of adaptive changes during infection of the host as well as an ongoing diversifying evolutionary process.

Artificial plasmid labeled with 5-bromo-2'-deoxyuridine: a universal molecular system for strand break detection.

PubMed

Zylicz-Stachula, Agnieszka; Polska, Katarzyna; Skowron, Piotr; Rak, Janusz

2014-07-07

DNA strand breaks (SBs) are among the most cytotoxic forms of DNA damage, and their residual levels correlate directly with cell death. Hence, the type and amount of SBs is directly related to the efficacy of a given anticancer therapy. In this study, we describe a molecular tool that can differentiate between single (SSBs) and double (DSBs) strand breaks and also assess them quantitatively. Our method involves PCR amplification of a linear DNA fragment labeled with a sensitizing nucleotide, circularization of that fragment, and enzymatic introduction of supercoils to transform the circular relaxed form of the synthesized plasmid into a supercoiled one. After exposure of the molecule to a damaging factor, SSB and DSB levels can be easily assayed with gel electrophoresis. We applied this method to prepare an artificial plasmid labeled with 5-bromo-2'-deoxyuridine and to assay SBs photoinduced in the synthesized plasmid. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Monitoring conformational heterogeneity of the lid of DnaK substrate-binding domain during its chaperone cycle.

PubMed

Banerjee, Rupa; Jayaraj, Gopal Gunanathan; Peter, Joshua Jebakumar; Kumar, Vignesh; Mapa, Koyeli

2016-08-01

DnaK or Hsp70 of Escherichia coli is a master regulator of the bacterial proteostasis network. Allosteric communication between the two functional domains of DnaK, the N-terminal nucleotide-binding domain (NBD) and the C-terminal substrate- or peptide-binding domain (SBD) regulate its activity. X-ray crystallography and NMR studies have provided snapshots of distinct conformations of Hsp70 proteins in various physiological states; however, the conformational heterogeneity and dynamics of allostery-driven Hsp70 activity remains underexplored. In this work, we employed single-molecule Förster resonance energy transfer (sm-FRET) measurements to capture distinct intradomain conformational states of a region within the DnaK-SBD known as the lid. Our data conclusively demonstrate prominent conformational heterogeneity of the DnaK lid in ADP-bound states; in contrast, the ATP-bound open conformations are homogeneous. Interestingly, a nonhydrolysable ATP analogue, AMP-PNP, imparts heterogeneity to the lid conformations mimicking the ADP-bound state. The cochaperone DnaJ confers ADP-like heterogeneous lid conformations to DnaK, although the presence of the cochaperone accelerates the substrate-binding rate by a hitherto unknown mechanism. Irrespective of the presence of DnaJ, binding of a peptide substrate to the DnaK-SBD leads to prominent lid closure. Lid closure is only partial upon binding to molten globule-like authentic cellular substrates, probably to accommodate non-native substrate proteins of varied structures. © 2016 Federation of European Biochemical Societies.

Method for producing labeled single-stranded nucleic acid probes

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

1999-10-19

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

Food Labels

MedlinePlus

... Staying Safe Videos for Educators Search English Español Food Labels KidsHealth / For Teens / Food Labels What's in ... to have at least 95% organic ingredients. Making Food Labels Work for You The first step in ...

Label Review Training: Module 1: Label Basics, Page 25

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review: clarity, accuracy, consistency with EPA policy, and enforceability.

Label Review Training: Module 1: Label Basics, Page 29

EPA Pesticide Factsheets

This module of the pesticide label review training provides basic information about pesticides, their labeling and regulation, and the core principles of pesticide label review. This page is a quiz on Module 1.

L-RCA (ligation-rolling circle amplification): a general method for genotyping of single nucleotide polymorphisms (SNPs)

PubMed Central

Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne

2001-01-01

A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

PubMed

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Some parameters relevant to affinity chromatography on immobilized nucleotides

PubMed Central

Lowe, C. R.; Harvey, M. J.; Craven, D. B.; Dean, P. D. G.

1973-01-01

1. The suitability of cellulose and Sepharose as supports for affinity chromatography of two groups of cofactor-linked enzymes, dehydrogenases and kinases, was examined. Sepharose was found to be superior. 2. The selective capacities of the columns were measured by frontal analysis and are discussed in relation to the nucleotide contents. 3. The effect of various concentrations of enzyme and of non-specific protein on the performance of the affinity columns, and the effects of equilibration time, flow rate, sample volume and dilution of the nucleotide were examined. 4. The effect of interposing polymethylene and polyglycine extension arms between the matrix backbone and the nucleotide was investigated for several cofactor-dependent enzymes. Maximum binding was observed with an extension arm 0.8–1nm long. PMID:4354739

Lack of replication of thirteen single-nucleotide polymorphisms implicated in Parkinson’s disease: a large-scale international study

PubMed Central

Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A

2013-01-01

Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658

A microfluidics-based technique for automated and rapid labeling of cells for flow cytometry

NASA Astrophysics Data System (ADS)

Patibandla, Phani K.; Estrada, Rosendo; Kannan, Manasaa; Sethu, Palaniappan

2014-03-01

Flow cytometry is a powerful technique capable of simultaneous multi-parametric analysis of heterogeneous cell populations for research and clinical applications. In recent years, the flow cytometer has been miniaturized and made portable for application in clinical- and resource-limited settings. The sample preparation procedure, i.e. labeling of cells with antibodies conjugated to fluorescent labels, is a time consuming (˜45 min) and labor-intensive procedure. Microfluidics provides enabling technologies to accomplish rapid and automated sample preparation. Using an integrated microfluidic device consisting of a labeling and washing module, we demonstrate a new protocol that can eliminate sample handling and accomplish sample and reagent metering, high-efficiency mixing, labeling and washing in rapid automated fashion. The labeling module consists of a long microfluidic channel with an integrated chaotic mixer. Samples and reagents are precisely metered into this device to accomplish rapid and high-efficiency mixing. The mixed sample and reagents are collected in a holding syringe and held for up to 8 min following which the mixture is introduced into an inertial washing module to obtain ‘analysis-ready’ samples. The washing module consists of a high aspect ratio channel capable of focusing cells to equilibrium positions close to the channel walls. By introducing the cells and labeling reagents in a narrow stream at the center of the channel flanked on both sides by a wash buffer, the elution of cells into the wash buffer away from the free unbound antibodies is accomplished. After initial calibration experiments to determine appropriate ‘holding time’ to allow antibody binding, both modules were used in conjunction to label MOLT-3 cells (T lymphoblast cell line) with three different antibodies simultaneously. Results confirm no significant difference in mean fluorescence intensity values for all three antibodies labels (p < 0.01) between the

A label distance maximum-based classifier for multi-label learning.

PubMed

Liu, Xiaoli; Bao, Hang; Zhao, Dazhe; Cao, Peng

2015-01-01

Multi-label classification is useful in many bioinformatics tasks such as gene function prediction and protein site localization. This paper presents an improved neural network algorithm, Max Label Distance Back Propagation Algorithm for Multi-Label Classification. The method was formulated by modifying the total error function of the standard BP by adding a penalty term, which was realized by maximizing the distance between the positive and negative labels. Extensive experiments were conducted to compare this method against state-of-the-art multi-label methods on three popular bioinformatic benchmark datasets. The results illustrated that this proposed method is more effective for bioinformatic multi-label classification compared to commonly used techniques.

Less label, more free: approaches in label-free quantitative mass spectrometry.

PubMed

Neilson, Karlie A; Ali, Naveid A; Muralidharan, Sridevi; Mirzaei, Mehdi; Mariani, Michael; Assadourian, Gariné; Lee, Albert; van Sluyter, Steven C; Haynes, Paul A

2011-02-01

In this review we examine techniques, software, and statistical analyses used in label-free quantitative proteomics studies for area under the curve and spectral counting approaches. Recent advances in the field are discussed in an order that reflects a logical workflow design. Examples of studies that follow this design are presented to highlight the requirement for statistical assessment and further experiments to validate results from label-free quantitation. Limitations of label-free approaches are considered, label-free approaches are compared with labelling techniques, and forward-looking applications for label-free quantitative data are presented. We conclude that label-free quantitative proteomics is a reliable, versatile, and cost-effective alternative to labelled quantitation. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution

PubMed Central

König, Julian; Zarnack, Kathi; Rot, Gregor; Curk, Tomaž; Kayikci, Melis; Zupan, Blaž; Turner, Daniel J.; Luscombe, Nicholas M.; Ule, Jernej

2010-01-01

In the nucleus of eukaryotic cells, nascent transcripts are associated with heterogeneous nuclear ribonucleoprotein (hnRNP) particles that are nucleated by hnRNP C. Despite their abundance however, it remained unclear whether these particles control pre-mRNA processing. Here, we developed individual-nucleotide resolution UV-cross-linking and immunoprecipitation (iCLIP) to study the role of hnRNP C in splicing regulation. iCLIP data demonstrate that hnRNP C recognizes uridine tracts with a defined long-range spacing consistent with hnRNP particle organization. hnRNP particles assemble on both introns and exons, but remain generally excluded from splice sites. Integration of transcriptome-wide iCLIP data and alternative splicing profiles into an ‘RNA map’ indicates how the positioning of hnRNP particles determines their effect on inclusion of alternative exons. The ability of high-resolution iCLIP data to provide insights into the mechanism of this regulation holds promise for studies of other higher-order ribonucleoprotein complexes. PMID:20601959

Detection of clonal evolution in hematopoietic malignancies by combining comparative genomic hybridization and single nucleotide polymorphism arrays.

PubMed

Hartmann, Luise; Stephenson, Christine F; Verkamp, Stephanie R; Johnson, Krystal R; Burnworth, Bettina; Hammock, Kelle; Brodersen, Lisa Eidenschink; de Baca, Monica E; Wells, Denise A; Loken, Michael R; Zehentner, Barbara K

2014-12-01

Array comparative genomic hybridization (aCGH) has become a powerful tool for analyzing hematopoietic neoplasms and identifying genome-wide copy number changes in a single assay. aCGH also has superior resolution compared with fluorescence in situ hybridization (FISH) or conventional cytogenetics. Integration of single nucleotide polymorphism (SNP) probes with microarray analysis allows additional identification of acquired uniparental disomy, a copy neutral aberration with known potential to contribute to tumor pathogenesis. However, a limitation of microarray analysis has been the inability to detect clonal heterogeneity in a sample. This study comprised 16 samples (acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, plasma cell neoplasm) with complex cytogenetic features and evidence of clonal evolution. We used an integrated manual peak reassignment approach combining analysis of aCGH and SNP microarray data for characterization of subclonal abnormalities. We compared array findings with results obtained from conventional cytogenetic and FISH studies. Clonal heterogeneity was detected in 13 of 16 samples by microarray on the basis of log2 values. Use of the manual peak reassignment analysis approach improved resolution of the sample's clonal composition and genetic heterogeneity in 10 of 13 (77%) patients. Moreover, in 3 patients, clonal disease progression was revealed by array analysis that was not evident by cytogenetic or FISH studies. Genetic abnormalities originating from separate clonal subpopulations can be identified and further characterized by combining aCGH and SNP hybridization results from 1 integrated microarray chip by use of the manual peak reassignment technique. Its clinical utility in comparison to conventional cytogenetic or FISH studies is demonstrated. © 2014 American Association for Clinical Chemistry.

Systematic Comparison of Label-Free, Metabolic Labeling, and Isobaric Chemical Labeling for Quantitative Proteomics on LTQ Orbitrap Velos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Zhou; Adams, Rachel M; Chourey, Karuna

2012-01-01

A variety of quantitative proteomics methods have been developed, including label-free, metabolic labeling, and isobaric chemical labeling using iTRAQ or TMT. Here, these methods were compared in terms of the depth of proteome coverage, quantification accuracy, precision, and reproducibility using a high-performance hybrid mass spectrometer, LTQ Orbitrap Velos. Our results show that (1) the spectral counting method provides the deepest proteome coverage for identification, but its quantification performance is worse than labeling-based approaches, especially the quantification reproducibility; (2) metabolic labeling and isobaric chemical labeling are capable of accurate, precise, and reproducible quantification and provide deep proteome coverage for quantification. Isobaricmore » chemical labeling surpasses metabolic labeling in terms of quantification precision and reproducibility; (3) iTRAQ and TMT perform similarly in all aspects compared in the current study using a CID-HCD dual scan configuration. Based on the unique advantages of each method, we provide guidance for selection of the appropriate method for a quantitative proteomics study.« less

Online Heterogeneous Transfer by Hedge Ensemble of Offline and Online Decisions.

PubMed

Yan, Yuguang; Wu, Qingyao; Tan, Mingkui; Ng, Michael K; Min, Huaqing; Tsang, Ivor W

2017-10-10

In this paper, we study the online heterogeneous transfer (OHT) learning problem, where the target data of interest arrive in an online manner, while the source data and auxiliary co-occurrence data are from offline sources and can be easily annotated. OHT is very challenging, since the feature spaces of the source and target domains are different. To address this, we propose a novel technique called OHT by hedge ensemble by exploiting both offline knowledge and online knowledge of different domains. To this end, we build an offline decision function based on a heterogeneous similarity that is constructed using labeled source data and unlabeled auxiliary co-occurrence data. After that, an online decision function is learned from the target data. Last, we employ a hedge weighting strategy to combine the offline and online decision functions to exploit knowledge from the source and target domains of different feature spaces. We also provide a theoretical analysis regarding the mistake bounds of the proposed approach. Comprehensive experiments on three real-world data sets demonstrate the effectiveness of the proposed technique.

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

Organization of Nucleotides in Different Environments and the Formation of Pre-Polymers

NASA Astrophysics Data System (ADS)

Himbert, Sebastian; Chapman, Mindy; Deamer, David W.; Rheinstädter, Maikel C.

2016-08-01

RNA is a linear polymer of nucleotides linked by a ribose-phosphate backbone. Polymerization of nucleotides occurs in a condensation reaction in which phosphodiester bonds are formed. However, in the absence of enzymes and metabolism there has been no obvious way for RNA-like molecules to be produced and then encapsulated in cellular compartments. We investigated 5‧-adenosine monophosphate (AMP) and 5‧-uridine monophosphate (UMP) molecules confined in multi-lamellar phospholipid bilayers, nanoscopic films, ammonium chloride salt crystals and Montmorillonite clay, previously proposed to promote polymerization. X-ray diffraction was used to determine whether such conditions imposed a degree of order on the nucleotides. Two nucleotide signals were observed in all matrices, one corresponding to a nearest neighbour distance of 4.6 Å attributed to nucleotides that form a disordered, glassy structure. A second, smaller distance of 3.4 Å agrees well with the distance between stacked base pairs in the RNA backbone, and was assigned to the formation of pre-polymers, i.e., the organization of nucleotides into stacks of about 10 monomers. Such ordering can provide conditions that promote the nonenzymatic polymerization of RNA strands under prebiotic conditions. Experiments were modeled by Monte-Carlo simulations, which provide details of the molecular structure of these pre-polymers.

101 Labeled Brain Images and a Consistent Human Cortical Labeling Protocol

PubMed Central

Klein, Arno; Tourville, Jason

2012-01-01

We introduce the Mindboggle-101 dataset, the largest and most complete set of free, publicly accessible, manually labeled human brain images. To manually label the macroscopic anatomy in magnetic resonance images of 101 healthy participants, we created a new cortical labeling protocol that relies on robust anatomical landmarks and minimal manual edits after initialization with automated labels. The “Desikan–Killiany–Tourville” (DKT) protocol is intended to improve the ease, consistency, and accuracy of labeling human cortical areas. Given how difficult it is to label brains, the Mindboggle-101 dataset is intended to serve as brain atlases for use in labeling other brains, as a normative dataset to establish morphometric variation in a healthy population for comparison against clinical populations, and contribute to the development, training, testing, and evaluation of automated registration and labeling algorithms. To this end, we also introduce benchmarks for the evaluation of such algorithms by comparing our manual labels with labels automatically generated by probabilistic and multi-atlas registration-based approaches. All data and related software and updated information are available on the http://mindboggle.info/data website. PMID:23227001

n-Nucleotide circular codes in graph theory.

PubMed

Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz

2016-03-13

The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

PubMed

Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

2017-01-01

Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

The Structure of a High Fidelity DNA Polymerase Bound to a Mismatched Nucleotide Reveals an “Ajar” Intermediate Conformation in the Nucleotide Selection Mechanism*

PubMed Central

Wu, Eugene Y.; Beese, Lorena S.

2011-01-01

To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established “open” and “closed” states. In this “ajar” conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation. PMID:21454515

In Silico Labeling: Predicting Fluorescent Labels in Unlabeled Images.

PubMed

Christiansen, Eric M; Yang, Samuel J; Ando, D Michael; Javaherian, Ashkan; Skibinski, Gaia; Lipnick, Scott; Mount, Elliot; O'Neil, Alison; Shah, Kevan; Lee, Alicia K; Goyal, Piyush; Fedus, William; Poplin, Ryan; Esteva, Andre; Berndl, Marc; Rubin, Lee L; Nelson, Philip; Finkbeiner, Steven

2018-04-19

Microscopy is a central method in life sciences. Many popular methods, such as antibody labeling, are used to add physical fluorescent labels to specific cellular constituents. However, these approaches have significant drawbacks, including inconsistency; limitations in the number of simultaneous labels because of spectral overlap; and necessary perturbations of the experiment, such as fixing the cells, to generate the measurement. Here, we show that a computational machine-learning approach, which we call "in silico labeling" (ISL), reliably predicts some fluorescent labels from transmitted-light images of unlabeled fixed or live biological samples. ISL predicts a range of labels, such as those for nuclei, cell type (e.g., neural), and cell state (e.g., cell death). Because prediction happens in silico, the method is consistent, is not limited by spectral overlap, and does not disturb the experiment. ISL generates biological measurements that would otherwise be problematic or impossible to acquire. Copyright © 2018 Elsevier Inc. All rights reserved.

Optimization of the Divergent method for genotyping single nucleotide variations using SYBR Green-based single-tube real-time PCR.

PubMed

Gentilini, Fabio; Turba, Maria E

2014-01-01

A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.

A universal and label-free impedimetric biosensing platform for discrimination of single nucleotide substitutions in long nucleic acid strands.

PubMed

Mills, Dawn M; Martin, Christopher P; Armas, Stephanie M; Calvo-Marzal, Percy; Kolpashchikov, Dmitry M; Chumbimuni-Torres, Karin Y

2018-06-30

We report a label-free universal biosensing platform for highly selective detection of long nucleic acid strands. The sensor consists of an electrode-immobilized universal stem-loop (USL) probe and two adaptor strands that form a 4J structure in the presence of a specific DNA/RNA analyte. The sensor was characterized by electrochemical impedance spectroscopy (EIS) using K 3 [Fe(CN) 6 ]/K 4 [Fe(CN) 6 ] redox couple in solution. An increase in charge transfer resistance (R CT ) was observed upon 4J structure formation, the value of which depends on the analyte length. Cyclic voltammetry (CV) was used to further characterize the sensor and monitor the electrochemical reaction in conjunction with thickness measurements of the mixed DNA monolayer obtained using spectroscopic ellipsometry. In addition, the electron transfer was calculated at the electrode/electrolyte interface using a rotating disk electrode. Limits of detection in the femtomolar range were achieved for nucleic acid targets of different lengths (22 nt, 60 nt, 200 nt). The sensor produced only a background signal in the presence of single base mismatched analytes, even in hundred times excess in concentration. This label-free and highly selective biosensing platform is versatile and can be used for universal detection of nucleic acids of varied lengths which could revolutionize point of care diagnostics for applications such as bacterial or cancer screening. Copyright © 2018 Elsevier B.V. All rights reserved.

A label-free, fluorescence based assay for microarray

NASA Astrophysics Data System (ADS)

Niu, Sanjun

DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same

Do nutrition labels influence healthier food choices? Analysis of label viewing behaviour and subsequent food purchases in a labelling intervention trial.

PubMed

Ni Mhurchu, Cliona; Eyles, Helen; Jiang, Yannan; Blakely, Tony

2018-02-01

There are few objective data on how nutrition labels are used in real-world shopping situations, or how they affect dietary choices and patterns. The Starlight study was a four-week randomised, controlled trial of the effects of three different types of nutrition labels on consumer food purchases: Traffic Light Labels, Health Star Rating labels, or Nutrition Information Panels (control). Smartphone technology allowed participants to scan barcodes of packaged foods and receive randomly allocated labels on their phone screen, and to record their food purchases. The study app therefore provided objectively recorded data on label viewing behaviour and food purchases over a four-week period. A post-hoc analysis of trial data was undertaken to assess frequency of label use, label use by food group, and association between label use and the healthiness of packaged food products purchased. Over the four-week intervention, study participants (n = 1255) viewed nutrition labels for and/or purchased 66,915 barcoded packaged products. Labels were viewed for 23% of all purchased products, with decreasing frequency over time. Shoppers were most likely to view labels for convenience foods, cereals, snack foods, bread and bakery products, and oils. They were least likely to view labels for sugar and honey products, eggs, fish, fruit and vegetables, and meat. Products for which participants viewed the label and subsequently purchased the product during the same shopping episode were significantly healthier than products where labels were viewed but the product was not subsequently purchased: mean difference in nutrient profile score -0.90 (95% CI -1.54 to -0.26). In a secondary analysis of a nutrition labelling intervention trial, there was a significant association between label use and the healthiness of products purchased. Nutrition label use may therefore lead to healthier food purchases. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment

DOE PAGES

Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...

2015-04-09

Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less

Genetic heterogeneity of the hepatitis C virus.

PubMed

Bukh, J; Miller, R H; Purcell, R H

1995-01-01

Hepatitis C virus (HCV) is an important etiological agent in the development of chronic liver diseases such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). The virus, identified only recently, contains a single-stranded RNA genome of positive polarity, is distantly related to pestiviruses and flaviviruses, and has been classified as the first member of a third genus within the family Flaviviridae. Extensive analysis of HCV genomic sequences demonstrated that this virus possesses significant genetic heterogeneity. Different regions of the viral genome demonstrate a varying degree of heterogeneity; the regions coding for the putative envelope proteins are the most variable sites between different isolates. Furthermore, HCV circulates as a quasispecies in the host. During the course of acute and chronic infection, the sequence composition of the HCV population in one patient has been found to change sequentially with an extremely high rate of nonconserved nucleotide changes in the hypervariable region I (HVR1) of HCV. Such sequence changes alter the antigenicity of the epitopes coded within HVR1 so that these are not always recognized by preexisting antibodies. It has been suggested that this could represent one mechanism by which HCV evades host immune surveillance and may account for the high rate of chronicity observed in such infections. Continuous viral replication may, in turn, lead to the development of chronic liver disease, including HCC, in infected individuals. To date, at least nine major genetic groups (genotypes 1-9) and more than 30 subgroups of HCV have been recognized based on genetic differences. A distinct difference has been observed in the genotype distribution in Africa compared with other continents. Recent data have suggested a difference in pathogenesis and in the outcome of interferon therapy in individuals infected with HCV of certain genotypes. For example, genotype 1b (II) seems to be associated with more severe liver

Negro, Black, Black African, African Caribbean, African American or what? Labelling African origin populations in the health arena in the 21st century

PubMed Central

Agyemang, C.; Bhopal, R.; Bruijnzeels, M.

2005-01-01

Broad terms such as Black, African, or Black African are entrenched in scientific writings although there is considerable diversity within African descent populations and such terms may be both offensive and inaccurate. This paper outlines the heterogeneity within African populations, and discusses the strengths and limitations of the term Black and related labels from epidemiological and public health perspectives in Europe and the USA. This paper calls for debate on appropriate terminologies for African descent populations and concludes with the proposals that (1) describing the population under consideration is of paramount importance (2) the word African origin or simply African is an appropriate and necessary prefix for an ethnic label, for example, African Caribbean or African Kenyan or African Surinamese (3) documents should define the ethnic labels (4) the label Black should be phased out except when used in political contexts. PMID:16286485

Getting it Right: How DNA Polymerases Select the Right Nucleotide.

PubMed

Ludmann, Samra; Marx, Andreas

2016-01-01

All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

Do Consumers Want More Nutritional and Health Information on Wine Labels? Insights from the EU and USA.

PubMed

Annunziata, Azzurra; Pomarici, Eugenio; Vecchio, Riccardo; Mariani, Angela

2016-07-07

The global strategy to reduce the harmful use of alcohol launched in 2010 by the World Health Organization includes, amongst several areas of recommended actions, providing consumer information about, and labelling, alcoholic beverages to indicate alcohol-related harm. Labelling requirements worldwide for alcoholic drinks are currently quite diverse and somewhat limited compared to labelling on food products and on tobacco. In this context, the current paper contributes to the academic and political debate on the inclusion of nutritional and health information on wine labelling, providing some insights into consumer interest in, and preferences for, such information in four core wine-producing and -consuming countries: Italy, France, Spain, and the United States of America. A rating-based conjoint analysis was performed in order to ascertain consumer preferences for different formats of additional information on wine labels, and a segmentation of the sample was performed to determine the existence of homogeneous groups of consumers in relation to the degrees of usefulness attached to the nutritional and health information on wine labels. Our results highlight the interest expressed by European and United States consumers for introducing nutrition and health information on wine labels. However, the results of conjoint analysis show some significant differences among stated preferences of the information delivery modes in different countries. In addition, segmentation analysis reveal the existence of significant differences between consumer groups with respect to their interest in receiving additional information on wine labels. These differences are not only linked to the geographic origin of the consumers, or to socio-demographic variables, but are also related to wine consumption habits, attitudes towards nutritional information, and the degree of involvement with wine. This heterogeneity of consumer preferences indicates a need for a careful consideration of wine

Sousse: extreme genetic heterogeneity in North Africa.

PubMed

Fadhlaoui-Zid, Karima; Garcia-Bertrand, Ralph; Alfonso-Sánchez, Miguel A; Zemni, Ramzi; Benammar-Elgaaied, Amel; Herrera, Rene J

2015-01-01

The male genetic landscape of the territory currently known as Tunisia is hampered by the scarcity of data, especially from cosmopolitan areas such as the coastal city of Sousse. In order to alleviate this lacuna, 220 males from Sousse were examined, for the first time, for more than 50 Y-chromosome single-nucleotide polymorphisms (Y-SNPs) markers and compared with 3099 individuals from key geographically targeted locations in North Africa, Europe and the Near East. The paternal lineages observed belong to a common set of Y haplogroups previously described in North Africa. In addition to the prominent autochthonous North African E-M81 haplogroup which is exclusively represented by its subclade E-M183 (44.55% of Y-chromosomes), a number of Near Eastern Neolithic lineages including E-M78, J-M267 and J-M172 account for 39% of the Y-chromosomes detected. Principal component analysis based on haplogroup frequencies, multidimensional scaling based on Rst genetic distances and analyses of molecular variance using both Y-chromosome short tandem repeat haplotypes and Y-SNP haplogroup data revealed that the Tunisian and North African groups, as a whole, are intra- and inter-specific diverse with Sousse being highly heterogeneous.

Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

PubMed

Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

2017-12-01

Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

Receptor binding of somatostatin-14 and somatostatin-28 in rat brain: differential modulation by nucleotides and ions.

PubMed

Srikant, C B; Dahan, A; Craig, C

1990-02-04

The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2

Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

NASA Astrophysics Data System (ADS)

Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

2013-11-01

Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

GEO Label: User and Producer Perspectives on a Label for Geospatial Data

NASA Astrophysics Data System (ADS)

Lush, V.; Lumsden, J.; Masó, J.; Díaz, P.; McCallum, I.

2012-04-01

One of the aims of the Science and Technology Committee (STC) of the Group on Earth Observations (GEO) was to establish a GEO Label- a label to certify geospatial datasets and their quality. As proposed, the GEO Label will be used as a value indicator for geospatial data and datasets accessible through the Global Earth Observation System of Systems (GEOSS). It is suggested that the development of such a label will significantly improve user recognition of the quality of geospatial datasets and that its use will help promote trust in datasets that carry the established GEO Label. Furthermore, the GEO Label is seen as an incentive to data providers. At the moment GEOSS contains a large amount of data and is constantly growing. Taking this into account, a GEO Label could assist in searching by providing users with visual cues of dataset quality and possibly relevance; a GEO Label could effectively stand as a decision support mechanism for dataset selection. Currently our project - GeoViQua, - together with EGIDA and ID-03 is undertaking research to define and evaluate the concept of a GEO Label. The development and evaluation process will be carried out in three phases. In phase I we have conducted an online survey (GEO Label Questionnaire) to identify the initial user and producer views on a GEO Label or its potential role. In phase II we will conduct a further study presenting some GEO Label examples that will be based on Phase I. We will elicit feedback on these examples under controlled conditions. In phase III we will create physical prototypes which will be used in a human subject study. The most successful prototypes will then be put forward as potential GEO Label options. At the moment we are in phase I, where we developed an online questionnaire to collect the initial GEO Label requirements and to identify the role that a GEO Label should serve from the user and producer standpoint. The GEO Label Questionnaire consists of generic questions to identify whether

Vacuum ultraviolet photoionization of carbohydrates and nucleotides

NASA Astrophysics Data System (ADS)

Shin, Joong-Won; Bernstein, Elliot R.

2014-01-01

Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5'-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

Vacuum ultraviolet photoionization of carbohydrates and nucleotides.

PubMed

Shin, Joong-Won; Bernstein, Elliot R

2014-01-28

Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5(')-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

Vacuum ultraviolet photoionization of carbohydrates and nucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Joong-Won, E-mail: jshin@govst.edu; Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872; Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu

Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate,more » rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.« less

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Synthesis of Purine Nucleoside and Nucleotide Analogs as Antiparasitic Agents.

DTIC Science & Technology

1979-09-01

was to conduct studies on the synthesis of purine nucleoside and nucleotide analogs as anti- parasitic agents. The primary target compounds were 5...antiparasitic agents. - Jaffe has proposed that the susceptibility of pathogenic helminths and protozoa to fraudulent purine, in contrast to pyrimidine...8217-substituted derivatives are thus designed to inhibit nucleoside and nucleotide kinases as well as other parasitic enzymes. Mammalian cells, onthe

Dynamic map labeling.

PubMed

Been, Ken; Daiches, Eli; Yap, Chee

2006-01-01

We address the problem of filtering, selecting and placing labels on a dynamic map, which is characterized by continuous zooming and panning capabilities. This consists of two interrelated issues. The first is to avoid label popping and other artifacts that cause confusion and interrupt navigation, and the second is to label at interactive speed. In most formulations the static map labeling problem is NP-hard, and a fast approximation might have O(nlogn) complexity. Even this is too slow during interaction, when the number of labels shown can be several orders of magnitude less than the number in the map. In this paper we introduce a set of desiderata for "consistent" dynamic map labeling, which has qualities desirable for navigation. We develop a new framework for dynamic labeling that achieves the desiderata and allows for fast interactive display by moving all of the selection and placement decisions into the preprocessing phase. This framework is general enough to accommodate a variety of selection and placement algorithms. It does not appear possible to achieve our desiderata using previous frameworks. Prior to this paper, there were no formal models of dynamic maps or of dynamic labels; our paper introduces both. We formulate a general optimization problem for dynamic map labeling and give a solution to a simple version of the problem. The simple version is based on label priorities and a versatile and intuitive class of dynamic label placements we call "invariant point placements". Despite these restrictions, our approach gives a useful and practical solution. Our implementation is incorporated into the G-Vis system which is a full-detail dynamic map of the continental USA. This demo is available through any browser.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Mechanism of nucleotide sensing in group II chaperonins.

PubMed

Pereira, Jose H; Ralston, Corie Y; Douglas, Nicholai R; Kumar, Ramya; Lopez, Tom; McAndrew, Ryan P; Knee, Kelly M; King, Jonathan A; Frydman, Judith; Adams, Paul D

2012-02-01

Group II chaperonins mediate protein folding in an ATP-dependent manner in eukaryotes and archaea. The binding of ATP and subsequent hydrolysis promotes the closure of the multi-subunit rings where protein folding occurs. The mechanism by which local changes in the nucleotide-binding site are communicated between individual subunits is unknown. The crystal structure of the archaeal chaperonin from Methanococcus maripaludis in several nucleotides bound states reveals the local conformational changes associated with ATP hydrolysis. Residue Lys-161, which is extremely conserved among group II chaperonins, forms interactions with the γ-phosphate of ATP but shows a different orientation in the presence of ADP. The loss of the ATP γ-phosphate interaction with Lys-161 in the ADP state promotes a significant rearrangement of a loop consisting of residues 160-169. We propose that Lys-161 functions as an ATP sensor and that 160-169 constitutes a nucleotide-sensing loop (NSL) that monitors the presence of the γ-phosphate. Functional analysis using NSL mutants shows a significant decrease in ATPase activity, suggesting that the NSL is involved in timing of the protein folding cycle.

The Single Nucleotide Polymorphism Consortium

NASA Technical Reports Server (NTRS)

Morgan, Michael

2003-01-01

I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.

PubMed

Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth

2015-04-09

The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Single Nucleotide Variants Associated With Polygenic Hypercholesterolemia in Families Diagnosed Clinically With Familial Hypercholesterolemia.

PubMed

Lamiquiz-Moneo, Itziar; Pérez-Ruiz, María Rosario; Jarauta, Estíbaliz; Tejedor, María Teresa; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Baila-Rueda, Lucía; Marco-Benedí, Victoria; de Castro-Orós, Isabel; Cenarro, Ana; Civeira, Fernando

2018-05-01

Approximately 20% to 40% of clinically defined familial hypercholesterolemia cases do not show a causative mutation in candidate genes, and some of them may have a polygenic origin. A cholesterol gene risk score for the diagnosis of polygenic hypercholesterolemia has been demonstrated to be valuable to differentiate polygenic and monogenic hypercholesterolemia. The aim of this study was to determine the contribution to low-density lipoprotein cholesterol (LDL-C) of the single nucleotide variants associated with polygenic hypercholesterolemia in probands with genetic hypercholesterolemia without mutations in candidate genes (nonfamilial hypercholesterolemia genetic hypercholesterolemia) and the genetic score in cascade screening in their family members. We recruited 49 nonfamilial hypercholesterolemia genetic hypercholesterolemia families (294 participants) and calculated cholesterol gene scores, derived from single nucleotide variants in SORT1, APOB, ABCG8, APOE and LDLR and lipoprotein(a) plasma concentration. Risk alleles in SORT1, ABCG8, APOE, and LDLR showed a statistically significantly higher frequency in blood relatives than in the 1000 Genomes Project. However, there were no differences between affected and nonaffected members. The contribution of the cholesterol gene score to LDL-C was significantly higher in affected than in nonaffected participants (P = .048). The percentage of the LDL-C variation explained by the score was 3.1%, and this percentage increased to 6.9% in those families with the highest genetic score in the proband. Nonfamilial hypercholesterolemia genetic hypercholesterolemia families concentrate risk alleles for high LDL-C. Their contribution varies greatly among families, indicating the complexity and heterogeneity of these forms of hypercholesterolemias. The gene score explains a small percentage of LDL-C, which limits its use in diagnosis. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All

Selective enzymatic cleavage and labeling for sensitive capillary electrophoresis laser-induced fluorescence analysis of oxidized DNA bases.

PubMed

Li, Cuiping; Wang, Hailin

2015-08-07

Oxidatively generated DNA damage is considered to be a significant contributing factor to cancer, aging, and age-related human diseases. It is important to detect oxidatively generated DNA damage to understand and clinically diagnosis diseases caused by oxidative damage. In this study, using selective enzymatic cleavage and quantum dot (QD) labeling, we developed a novel capillary electrophoresis-laser induced fluorescence method for the sensitive detection of oxidized DNA bases. First, oxidized DNA bases are recognized and removed by one DNA base excision repair glycosylase, leaving apurinic and apyrimidinic sites (AP sites) at the oxidized positions. The AP sites are further excised by the AP nicking activity of the chosen glycosylase, generating a nucleotide gap with 5'- and 3'- phosphate groups. After dephosphorylation with one alkaline phosphatase, a biotinylated ddNTP is introduced into the nucleotide space within the DNA strand by DNA polymerase I. The biotin-tagged DNA is further labeled with a QD-streptavidin conjugate via non-covalent interactions. The DNA-bound QD is well-separated from excess DNA-unbound QD by highly efficient capillary electrophoresis and is sensitively detected by online coupled laser-induced fluorescence analysis. Using this method, we can assess the trace levels of oxidized DNA bases induced by the Fenton reaction and UV irradiation. Interestingly, the use of the formamidopyrimidine glycosylase (FPG) protein and endonuclease VIII enables the detection of oxidized purine and pyrimidine bases, respectively. Using the synthesized standard DNA, the approach has low limits of detection of 1.1×10(-19)mol in mass and 2.9pM in concentration. Copyright © 2015 Elsevier B.V. All rights reserved.

Understanding Food Labels

MedlinePlus

... Healthy eating for girls Understanding food labels Understanding food labels There is lots of info on food ... need to avoid because of food allergies. Other food label terms top In addition to the Nutrition ...

78 FR 66826 - Prior Label Approval System: Generic Label Approval

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-07

... container of a misleading form or size.\\1\\ FSIS has interpreted these provisions as requiring that the...-evaluating-labeling . Labels submitted as an extraordinary circumstance are given the highest priority for... submissions to FSIS headquarters, thus increasing the availability of FSIS labeling staff. Upon publication of...

Variations in Label Information and Nicotine Levels in Electronic Cigarette Refill Liquids in South Korea: Regulation Challenges

PubMed Central

Kim, Sungroul; Goniewicz, Maciej L.; Yu, Sol; Kim, Bokyeong; Gupta, Ribhav

2015-01-01

Background: In South Korea, the consumption of liquid nicotine used in electronic cigarettes has dramatically increased from 4310 L in 2012 to 7220 L in 2013. This study aimed to examine the level of heterogeneity of contents of the labels and discrepancy of the nicotine content between that indicated on the label and the actual values for electronic cigarette liquid refill products in South Korea. Methods: We purchased 32 electronic cigarette liquid refill products (17 Korean domestic, 15 imported ones) and one pure nicotine product at six different electronic cigarette retail stores in Seoul between May and June 2014. The actual nicotine concentrations of each product were measured by a blinded analyst at Roswell Park Cancer Institute, Buffalo, NY, USA. Results: Three out of 15 imported liquid refill products provided manufacturing dates, while expiration dates were available on eight products. The range of nicotine concentration was from “not detected” to 17.5 mg/mL. Labeling discrepancies of the concentrations ranged from −32.2% to 3.3% among electronic cigarette liquid refill products. The highest concentration (150.3 ± 7.9 mg/mL) was found in a sample labeled as “pure nicotine”. Conclusions: There is no standardization of labelling among electronic cigarette liquids sampled from retail stores and the labels did not accurately reflect the content. One product labeled “pure nicotine” raises concerns, since it may be poisonous to consumers, especially to children. This study revealed the urgent need for the development of product regulations in South Korea. PMID:25950652

Patterns of Emphysema Heterogeneity

PubMed Central

Valipour, Arschang; Shah, Pallav L.; Gesierich, Wolfgang; Eberhardt, Ralf; Snell, Greg; Strange, Charlie; Barry, Robert; Gupta, Avina; Henne, Erik; Bandyopadhyay, Sourish; Raffy, Philippe; Yin, Youbing; Tschirren, Juerg; Herth, Felix J.F.

2016-01-01

Background Although lobar patterns of emphysema heterogeneity are indicative of optimal target sites for lung volume reduction (LVR) strategies, the presence of segmental, or sublobar, heterogeneity is often underappreciated. Objective The aim of this study was to understand lobar and segmental patterns of emphysema heterogeneity, which may more precisely indicate optimal target sites for LVR procedures. Methods Patterns of emphysema heterogeneity were evaluated in a representative cohort of 150 severe (GOLD stage III/IV) chronic obstructive pulmonary disease (COPD) patients from the COPDGene study. High-resolution computerized tomography analysis software was used to measure tissue destruction throughout the lungs to compute heterogeneity (≥ 15% difference in tissue destruction) between (inter-) and within (intra-) lobes for each patient. Emphysema tissue destruction was characterized segmentally to define patterns of heterogeneity. Results Segmental tissue destruction revealed interlobar heterogeneity in the left lung (57%) and right lung (52%). Intralobar heterogeneity was observed in at least one lobe of all patients. No patient presented true homogeneity at a segmental level. There was true homogeneity across both lungs in 3% of the cohort when defining heterogeneity as ≥ 30% difference in tissue destruction. Conclusion Many LVR technologies for treatment of emphysema have focused on interlobar heterogeneity and target an entire lobe per procedure. Our observations suggest that a high proportion of patients with emphysema are affected by interlobar as well as intralobar heterogeneity. These findings prompt the need for a segmental approach to LVR in the majority of patients to treat only the most diseased segments and preserve healthier ones. PMID:26430783

Tracer-based estimates of protein flux in cases of incomplete product renewal: evidence and implications of heterogeneity in collagen turnover

PubMed Central

Zhou, Haihong; Wang, Sheng-Ping; Herath, Kithsiri; Kasumov, Takhar; Sadygov, Rovshan G.; Kelley, David E.

2015-01-01

The synthesis of various molecules can be estimated by measuring the incorporation of a labeled precursor into a product of interest. Unfortunately, a central problem in many studies has been an inability to estimate the intracellular dilution of the precursor and therein correctly calculate the synthesis of the product; it is generally assumed that measuring the true product labeling is straightforward. We initiated a study to examine liver collagen synthesis and identified an apparent problem with assumptions regarding measurements of the product labeling. Since it is well known that collagen production is relatively slow, we relied on the use of [2H]H2O labeling (analogous to a primed infusion) and sampled animals over the course of 16 days. Although the water labeling (the precursor) remained stable and we observed the incorporation of labeled amino acids into collagen, the asymptotic protein labeling was considerably lower than what would be expected based on the precursor labeling. Although this observation is not necessarily surprising (i.e., one might expect that a substantial fraction of the collagen pool would appear “inert” or turn over at a very slow rate), its implications are of interest in certain areas. Herein, we discuss a novel situation in which tracers are used to quantify rates of flux under conditions where a product may not undergo complete replacement. We demonstrate how heterogeneity in the product pool can lead one to the wrong conclusions regarding estimates of flux, and we outline an approach that may help to minimize errors surrounding data interpretation. PMID:26015435

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

Abandoning a label doesn’t make it disappear: The perseverance of labeling effects

PubMed Central

Foroni, Francesco; Rothbart, Myron

2012-01-01

Labels exert strong influence on perception and judgment. The present experiment examines the possibility that such effects may persist even when labels are abandoned. Participants judged the similarity of pairs of silhouette drawings of female body types, ordered on a continuum from very thin to very heavy, under conditions where category labels were, and were not, superimposed on the ordered stimuli. Consistent with earlier research, labels had strong effects on perceived similarity, with silhouettes sharing the same label judged as more similar than those having different labels. Moreover, when the labels were removed and no longer present, the effect of the labels, although diminished, persisted. It did not make any difference whether the labels were simply abandoned or, in addition, had their validity challenged. The results are important for our understanding of categorization and labeling processes. The potential theoretical and practical implications of these results for social processes are discussed. PMID:23105148

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

PubMed

Dunn, Joshua G; Weissman, Jonathan S

2016-11-22

Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

Formation of amino acids and nucleotide bases in a Titan atmosphere simulation experiment.

PubMed

Hörst, S M; Yelle, R V; Buch, A; Carrasco, N; Cernogora, G; Dutuit, O; Quirico, E; Sciamma-O'Brien, E; Smith, M A; Somogyi, A; Szopa, C; Thissen, R; Vuitton, V

2012-09-01

The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N(2)/CH(4)/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C(4)H(5)N(3)O, C(4)H(4)N(2)O(2), C(5)H(6)N(2)O(2), C(5)H(5)N(5), and C(6)H(9)N(3)O(2) are produced by chemistry in the simulation chamber. Gas chromatography-mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C(4)H(5)N(3)O), uracil (C(5)H(4)N(2)O(2)), thymine (C(5)H(6)N(2)O(2)), guanine (C(5)H(5)N(5)O), glycine (C(2)H(5)NO(2)), and alanine (C(3)H(7)NO(2)). Adenine (C(5)H(5)N(5)) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin.

Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators

PubMed Central

Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.

2015-01-01

Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

19F-perfluorocarbon-labeled human peripheral blood mononuclear cells can be detected in vivo using clinical MRI parameters in a therapeutic cell setting.

PubMed

Fink, Corby; Gaudet, Jeffrey M; Fox, Matthew S; Bhatt, Shashank; Viswanathan, Sowmya; Smith, Michael; Chin, Joseph; Foster, Paula J; Dekaban, Gregory A

2018-01-12

A 19 Fluorine ( 19 F) perfluorocarbon cell labeling agent, when employed with an appropriate cellular MRI protocol, allows for in vivo cell tracking. 19 F cellular MRI can be used to non-invasively assess the location and persistence of cell-based cancer vaccines and other cell-based therapies. This study was designed to determine the feasibility of labeling and tracking peripheral blood mononuclear cells (PBMC), a heterogeneous cell population. Under GMP-compliant conditions human PBMC were labeled with a 19 F-based MRI cell-labeling agent in a manner safe for autologous re-injection. Greater than 99% of PBMC labeled with the 19 F cell-labeling agent without affecting functionality or affecting viability. The 19 F-labeled PBMC were detected in vivo in a mouse model at the injection site and in a draining lymph node. A clinical cellular MR protocol was optimized for the detection of PBMC injected both at the surface of a porcine shank and at a depth of 1.2 cm, equivalent to depth of a human lymph node, using a dual 1 H/ 19 F dual switchable surface radio frequency coil. This study demonstrates it is feasible to label and track 19 F-labeled PBMC using clinical MRI protocols. Thus, 19 F cellular MRI represents a non-invasive imaging technique suitable to assess the effectiveness of cell-based cancer vaccines.

[Intra- and interpopulation variability of southwestern Kamchatka sockeye salmon Oncorhynchus nerka inferred from the data on single nucleotide polymorphism].

PubMed

Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E

2014-07-01

The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated.

Introduction to Pesticide Labels

EPA Pesticide Factsheets

Pesticide product labels provide critical information about how to safely and legally handle and use pesticide products. Unlike most other types of product labels, pesticide labels are legally enforceable. Learn about pesticide product labels.

Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

PubMed Central

Ren, Xiaomei; El-Sagheer, Afaf H.; Brown, Tom

2016-01-01

A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

A direct morphometric comparison of five labeling protocols for multi-atlas driven automatic segmentation of the hippocampus in Alzheimer's disease.

PubMed

Nestor, Sean M; Gibson, Erin; Gao, Fu-Qiang; Kiss, Alex; Black, Sandra E

2013-02-01

Hippocampal volumetry derived from structural MRI is increasingly used to delineate regions of interest for functional measurements, assess efficacy in therapeutic trials of Alzheimer's disease (AD) and has been endorsed by the new AD diagnostic guidelines as a radiological marker of disease progression. Unfortunately, morphological heterogeneity in AD can prevent accurate demarcation of the hippocampus. Recent developments in automated volumetry commonly use multi-template fusion driven by expert manual labels, enabling highly accurate and reproducible segmentation in disease and healthy subjects. However, there are several protocols to define the hippocampus anatomically in vivo, and the method used to generate atlases may impact automatic accuracy and sensitivity - particularly in pathologically heterogeneous samples. Here we report a fully automated segmentation technique that provides a robust platform to directly evaluate both technical and biomarker performance in AD among anatomically unique labeling protocols. For the first time we test head-to-head the performance of five common hippocampal labeling protocols for multi-atlas based segmentation, using both the Sunnybrook Longitudinal Dementia Study and the entire Alzheimer's Disease Neuroimaging Initiative 1 (ADNI-1) baseline and 24-month dataset. We based these atlas libraries on the protocols of (Haller et al., 1997; Killiany et al., 1993; Malykhin et al., 2007; Pantel et al., 2000; Pruessner et al., 2000), and a single operator performed all manual tracings to generate de facto "ground truth" labels. All methods distinguished between normal elders, mild cognitive impairment (MCI), and AD in the expected directions, and showed comparable correlations with measures of episodic memory performance. Only more inclusive protocols distinguished between stable MCI and MCI-to-AD converters, and had slightly better associations with episodic memory. Moreover, we demonstrate that protocols including more posterior

Systematic asymmetric nucleotide exchanges produce human mitochondrial RNAs cryptically encoding for overlapping protein coding genes.

PubMed

Seligmann, Hervé

2013-05-07

GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

PubMed

Woolfitt, A R; Kellett, G L; Hoggett, J G

1988-01-29

The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

Facial emotion labeling in unaffected offspring of adults with bipolar I disorder.

PubMed

Sharma, Aditya Narain; Barron, Evelyn; Le Couteur, James; Close, Andrew; Rushton, Steven; Grunze, Heinz; Kelly, Thomas; Nicol Ferrier, Ian; Le Couteur, Ann Simone

2017-01-15

Young people 'at risk' for developing Bipolar Disorder have been shown to have deficits in facial emotion labeling across emotions with some studies reporting deficits for one or more particular emotions. However, these have included a heterogeneous group of young people (siblings of adolescents and offspring of adults with bipolar disorder), who have themselves diagnosed psychopathology (mood disorders and neurodevelopmental disorders including ADHD). 24 offspring of adults with bipolar I disorder and 34 offspring of healthy controls were administered the Diagnostic Analysis of Non Verbal Accuracy 2 (DANVA 2) to investigate the ability of participants to correctly label 4 emotions: happy, sad, fear and anger using both child and adult faces as stimuli at low and high intensity. Mixed effects modelling revealed that the offspring of adults with bipolar I disorder made more errors in both the overall recognition of facial emotions and the specific recognition of fear compared with the offspring of healthy controls. Further more errors were made by offspring that were male, younger in age and also in recognition of emotions using 'child' stimuli. The sample size, lack of blinding of the study team and the absence of any stimuli that assess subjects' response to a neutral emotional stimulus are limitations of the study. Offspring (with no history of current or past psychopathology or psychotropic medication) of adults with bipolar I disorder displayed facial emotion labeling deficits (particularly fear) suggesting facial emotion labeling may be an endophenotype for bipolar disorder. Copyright © 2016 Elsevier B.V. All rights reserved.

Person Perception and Verbal Labeling: The Development of Social Labels.

ERIC Educational Resources Information Center

Brooks-Gunn, Jeanne; Lewis, Michael

This study examined the social labels which are first used by infants, social differentiation on the basis of labeling behavior, and overgeneralization of social labels. Subjects were 81 infants from 9 to 36 months of age. The 9- to 24-month-olds were shown slides of themselves, their mothers, their fathers, and unfamiliar children, babies, and…

Detecting Protected Health Information in Heterogeneous Clinical Notes.

PubMed

Henriksson, Aron; Kvist, Maria; Dalianis, Hercules

2017-01-01

To enable secondary use of healthcare data in a privacy-preserving manner, there is a need for methods capable of automatically identifying protected health information (PHI) in clinical text. To that end, learning predictive models from labeled examples has emerged as a promising alternative to rule-based systems. However, little is known about differences with respect to PHI prevalence in different types of clinical notes and how potential domain differences may affect the performance of predictive models trained on one particular type of note and applied to another. In this study, we analyze the performance of a predictive model trained on an existing PHI corpus of Swedish clinical notes and applied to a variety of clinical notes: written (i) in different clinical specialties, (ii) under different headings, and (iii) by persons in different professions. The results indicate that domain adaption is needed for effective detection of PHI in heterogeneous clinical notes.

Development of a nucleotide sugar purification method using a mixed mode column & mass spectrometry detection.

PubMed

Eastwood, Heather; Xia, Fang; Lo, Mei-Chu; Zhou, Jing; Jordan, John B; McCarter, John; Barnhart, Wesley W; Gahm, Kyung-Hyun

2015-11-10

Analysis of nucleotide sugars, nucleoside di- and triphosphates and sugar-phosphates is an essential step in the process of understanding enzymatic pathways. A facile and rapid separation method was developed to analyze these compounds present in an enzymatic reaction mixture utilized to produce nucleotide sugars. The Primesep SB column explored in this study utilizes hydrophobic interactions as well as electrostatic interactions with the phosphoric portion of the nucleotide sugars. Ammonium formate buffer was selected due to its compatibility with mass spectrometry. Negative ion mode mass spectrometry was adopted for detection of the sugar phosphate (fucose-1-phophate), as the compound is not amenable to UV detection. Various mobile phase conditions such as pH, buffer concentration and organic modifier were explored. The semi-preparative separation method was developed to prepare 30mg of the nucleotide sugar. (19)F NMR was utilized to determine purity of the purified fluorinated nucleotide sugar. The collected nucleotide sugar was found to be 99% pure. Published by Elsevier B.V.

LS³: A Method for Improving Phylogenomic Inferences When Evolutionary Rates Are Heterogeneous among Taxa.

PubMed

Rivera-Rivera, Carlos J; Montoya-Burgos, Juan I

2016-06-01

Phylogenetic inference artifacts can occur when sequence evolution deviates from assumptions made by the models used to analyze them. The combination of strong model assumption violations and highly heterogeneous lineage evolutionary rates can become problematic in phylogenetic inference, and lead to the well-described long-branch attraction (LBA) artifact. Here, we define an objective criterion for assessing lineage evolutionary rate heterogeneity among predefined lineages: the result of a likelihood ratio test between a model in which the lineages evolve at the same rate (homogeneous model) and a model in which different lineage rates are allowed (heterogeneous model). We implement this criterion in the algorithm Locus Specific Sequence Subsampling (LS³), aimed at reducing the effects of LBA in multi-gene datasets. For each gene, LS³ sequentially removes the fastest-evolving taxon of the ingroup and tests for lineage rate homogeneity until all lineages have uniform evolutionary rates. The sequences excluded from the homogeneously evolving taxon subset are flagged as potentially problematic. The software implementation provides the user with the possibility to remove the flagged sequences for generating a new concatenated alignment. We tested LS³ with simulations and two real datasets containing LBA artifacts: a nucleotide dataset regarding the position of Glires within mammals and an amino-acid dataset concerning the position of nematodes within bilaterians. The initially incorrect phylogenies were corrected in all cases upon removing data flagged by LS³. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

PubMed Central

Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

2011-01-01

Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology.

PubMed

Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H

2011-11-27

Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.

Synthesis, salvage, and catabolism of uridine nucleotides in boron-deficient squash roots.

PubMed

Lovatt, C J; Albert, L S; Tremblay, G C

1981-12-01

Previous work has provided evidence that plants may require boron to maintain adequate levels of pyrimidine nucleotides, suggesting that the state of boron deficiency may actually be one of pyrimidine starvation. Since the availability of pyrimidine nucleotides is influenced by their rates of synthesis, salvage, and catabolism, we compared these activities in the terminal 3 centimeters of roots excised from boron-deficient and -sufficient squash plants (Cucurbita pepo L.). Transferring 5-day-old squash plants to a boron-deficient nutrient solution resulted in cessation of root elongation within 18 hours. However, withholding boron for up to 30 hours did not result in either impaired de novo pyrimidine biosynthesis or a change in the sensitivity of the de novo pathway to regulation by end product inhibition. Boron deprivation had no significant effect on pyrimidine salvage or catabolism. These results provide evidence that boron-deficient plants are not starved for uridine nucleotides collectively. Whether a particular pyrimidine nucleotide or derivative is limiting during boron deprivation remains to be examined.

Regulation of Endothelial Barrier Function by Cyclic Nucleotides: The Role of Phosphodiesterases

PubMed Central

Surapisitchat, James

2014-01-01

The endothelium plays an important role in maintaining normal vascular function. Endothelial barrier dysfunction leading to increased permeability and vascular leakage is associated with several pathological conditions such as edema and sepsis. Thus, the development of drugs that improve endothelial barrier function is an active area of research. In this chapter, the current knowledge concerning the signaling pathways regulating endothelial barrier function is discussed with a focus on cyclic nucleotide second messengers (cAMP and cGMP) and cyclic nucleotide phosphodiesterases (PDEs). Both cAMP and cGMP have been shown to have differential effects on endothelial permeability in part due to the various effector molecules, crosstalk, and compartmentalization of cyclic nucleotide signaling. PDEs, by controlling the amplitude, duration, and localization of cyclic nucleotides, have been shown to play a critical role in regulating endothelial barrier function. Thus, PDEs are attractive drug targets for the treatment of disease states involving endothelial barrier dysfunction. PMID:21695641

Regulation of endothelial barrier function by cyclic nucleotides: the role of phosphodiesterases.

PubMed

Surapisitchat, James; Beavo, Joseph A

2011-01-01

The endothelium plays an important role in maintaining normal vascular function. Endothelial barrier dysfunction leading to increased permeability and vascular leakage is associated with several pathological conditions such as edema and sepsis. Thus, the development of drugs that improve endothelial barrier function is an active area of research. In this chapter, the current knowledge concerning the signaling pathways regulating endothelial barrier function is discussed with a focus on cyclic nucleotide second messengers (cAMP and cGMP) and cyclic nucleotide phosphodiesterases (PDEs). Both cAMP and cGMP have been shown to have differential effects on endothelial permeability in part due to the various effector molecules, crosstalk, and compartmentalization of cyclic nucleotide signaling. PDEs, by controlling the amplitude, duration, and localization of cyclic nucleotides, have been shown to play a critical role in regulating endothelial barrier function. Thus, PDEs are attractive drug targets for the treatment of disease states involving endothelial barrier dysfunction.

Heterogeneous atmospheric chemistry

NASA Technical Reports Server (NTRS)

Schryer, D. R.

1982-01-01

The present conference on heterogeneous atmospheric chemistry considers such topics concerning clusters, particles and microparticles as common problems in nucleation and growth, chemical kinetics, and catalysis, chemical reactions with aerosols, electron beam studies of natural and anthropogenic microparticles, and structural studies employing molecular beam techniques, as well as such gas-solid interaction topics as photoassisted reactions, catalyzed photolysis, and heterogeneous catalysis. Also discussed are sulfur dioxide absorption, oxidation, and oxidation inhibition in falling drops, sulfur dioxide/water equilibria, the evidence for heterogeneous catalysis in the atmosphere, the importance of heterogeneous processes to tropospheric chemistry, soot-catalyzed atmospheric reactions, and the concentrations and mechanisms of formation of sulfate in the atmospheric boundary layer.

Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips.

PubMed

Zhong, Xiao-Bo; Reynolds, Robert; Kidd, Judith R; Kidd, Kenneth K; Jenison, Robert; Marlar, Richard A; Ward, David C

2003-09-30

Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30-40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate.

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Array heterogeneity prevents catastrophic forgetting in infants

PubMed Central

Zosh, Jennifer M.; Feigenson, Lisa

2015-01-01

Working memory is limited in adults and infants. But unlike adults, infants whose working memory capacity is exceeded often fail in a particularly striking way: they do not represent any of the presented objects, rather than simply remembering as many objects as they can and ignoring anything further (Feigenson & Carey 2003, 2005). Here we explored the nature of this “catastrophic forgetting,” asking whether stimuli themselves modulate the way in which infants’ memory fails. We showed 13-month old infants object arrays that either were within or that exceeded working memory capacity—but, unlike previous experiments, presented objects with contrasting features. Although previous studies have repeatedly documented infants’ failure to represent four identical hidden objects, in Experiments 1 and 2 we found that infants who saw four contrasting objects hidden, and then retrieved just two of the four, successfully continued searching for the missing objects. Perceptual contrast between objects sufficed to drive this success; infants succeeded regardless of whether the different objects were contrastively labeled, and regardless of whether the objects were semantically familiar or completely novel. In Experiment 3 we explored the nature of this surprising success, asking whether array heterogeneity actually expanded infants’ working memory capacity or rather prevented catastrophic forgetting. We found that infants successfully continued searching after seeing four contrasting objects hidden and retrieving two of them, but not after retrieving three of them. This suggests that, like adults, infants were able to remember up to, but not beyond, the limits of their working memory capacity when representing heterogeneous arrays. PMID:25543889

Do Consumers Want More Nutritional and Health Information on Wine Labels? Insights from the EU and USA

PubMed Central

Annunziata, Azzurra; Pomarici, Eugenio; Vecchio, Riccardo; Mariani, Angela

2016-01-01

The global strategy to reduce the harmful use of alcohol launched in 2010 by the World Health Organization includes, amongst several areas of recommended actions, providing consumer information about, and labelling, alcoholic beverages to indicate alcohol-related harm. Labelling requirements worldwide for alcoholic drinks are currently quite diverse and somewhat limited compared to labelling on food products and on tobacco. In this context, the current paper contributes to the academic and political debate on the inclusion of nutritional and health information on wine labelling, providing some insights into consumer interest in, and preferences for, such information in four core wine-producing and -consuming countries: Italy, France, Spain, and the United States of America. A rating-based conjoint analysis was performed in order to ascertain consumer preferences for different formats of additional information on wine labels, and a segmentation of the sample was performed to determine the existence of homogeneous groups of consumers in relation to the degrees of usefulness attached to the nutritional and health information on wine labels. Our results highlight the interest expressed by European and United States consumers for introducing nutrition and health information on wine labels. However, the results of conjoint analysis show some significant differences among stated preferences of the information delivery modes in different countries. In addition, segmentation analysis reveal the existence of significant differences between consumer groups with respect to their interest in receiving additional information on wine labels. These differences are not only linked to the geographic origin of the consumers, or to socio-demographic variables, but are also related to wine consumption habits, attitudes towards nutritional information, and the degree of involvement with wine. This heterogeneity of consumer preferences indicates a need for a careful consideration of wine

Improved treatment of nucleosides and nucleotides in the OPLS-AA force field

NASA Astrophysics Data System (ADS)

Robertson, Michael J.; Tirado-Rives, Julian; Jorgensen, William L.

2017-09-01

DFT calculations have been used to develop improved descriptions of the torsional energetics for nucleosides and nucleotides in the OPLS-AA force field. Scans of nucleotide dihedral angles (γ, χ, and β) and methyl phosphates provided the bases for the new torsional parameters. In addition, the angle-bending parameters of phosphodiesters and ribose were updated, and adjustments were made to existing carbohydrate torsions to better capture the sugar puckering landscape of ribose. MD simulations of nucleosides with the new parameters demonstrate a significant improvement in the ribose sugar puckering and χ angle distributions. Additionally, energy-minimization of protein-nucleotide crystal structures with the new parameters produced accurate poses.

A Direct Morphometric Comparison of Five Labeling Protocols for Multi-Atlas Driven Automatic Segmentation of the Hippocampus in Alzheimer’s Disease

PubMed Central

Nestor, Sean M.; Gibson, Erin; Gao, Fu-Qiang; Kiss, Alex; Black, Sandra E.

2012-01-01

Hippocampal volumetry derived from structural MRI is increasingly used to delineate regions of interest for functional measurements, assess efficacy in therapeutic trials of Alzheimer’s disease (AD) and has been endorsed by the new AD diagnostic guidelines as a radiological marker of disease progression. Unfortunately, morphological heterogeneity in AD can prevent accurate demarcation of the hippocampus. Recent developments in automated volumetry commonly use multitemplate fusion driven by expert manual labels, enabling highly accurate and reproducible segmentation in disease and healthy subjects. However, there are several protocols to define the hippocampus anatomically in vivo, and the method used to generate atlases may impact automatic accuracy and sensitivity – particularly in pathologically heterogeneous samples. Here we report a fully automated segmentation technique that provides a robust platform to directly evaluate both technical and biomarker performance in AD among anatomically unique labeling protocols. For the first time we test head-to-head the performance of five common hippocampal labeling protocols for multi-atlas based segmentation, using both the Sunnybrook Longitudinal Dementia Study and the entire Alzheimer’s Disease Neuroimaging Initiative 1 (ADNI-1) baseline and 24-month dataset. We based these atlas libraries on the protocols of (Haller et al., 1997; Killiany et al., 1993; Malykhin et al., 2007; Pantel et al., 2000; Pruessner et al., 2000), and a single operator performed all manual tracings to generate de facto “ground truth” labels. All methods distinguished between normal elders, mild cognitive impairment (MCI), and AD in the expected directions, and showed comparable correlations with measures of episodic memory performance. Only more inclusive protocols distinguished between stable MCI and MCI-to-AD converters, and had slightly better associations with episodic memory. Moreover, we demonstrate that protocols including more

Evidence for the role of hydrophobic forces on the interactions of nucleotide-monophosphates with cationic liposomes.

PubMed

Cuomo, Francesca; Mosca, Monica; Murgia, Sergio; Avino, Pasquale; Ceglie, Andrea; Lopez, Francesco

2013-11-15

In this work, the interaction of nucleotide-monophosphates (NMPs) with unilamellar liposomes made of 1,2-Dioleoyl-3-Trimethylammonium-Propane (DOTAP) and 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine (DOPE) was investigated. Here, we demonstrate how adsorption is affected by the type of nucleotide-monophosphate. Dynamic light scattering (DLS) results revealed, for each NMP, that a distinguishable concentration exists at which a significant growth of the aggregates occurs. Adenosine 5'-monophosphate (AMP) and guanosine 5'-monophosphate (GMP) have shown a higher propensity to induce liposome aggregation process and in particular GMP appears to be the most effective. From ζ-potential experiments we found that liposomes loaded with purine based nucleotides (AMP and GMP) are able to decrease the ζ-potential values to a greater extent in comparison with the pyrimidine based nucleotides thimydine 5'-monophosphate (TMP) and uridine 5'-monophosphate (UMP). Moreover, a careful analysis of nucleotide-liposome interactions revealed that nucleotides have different capacity to induce the formation of nucleotide-liposome complexes, and purine based nucleotides have higher affinities with lipid membranes. On the whole, the data emphasize that the mechanisms driving the interactions between liposomes and NMPs are also influenced by the existence of hydrophobic forces. Copyright © 2013 Elsevier Inc. All rights reserved.

Nucleotide variation in genes invloved in wood formation in two pine species

Treesearch

David Pot; Lisa McMillan; Craig Echt; Gregoire Le Provost; Pauline Garnier-Gere; Sheree Cato; Christophe Plomion

2005-01-01

Nucleotide diversity in eight genes related to wood formation was investigated in two pine species, Pinus pinaster and P. radiata. The nucleotide diversity patterns observed and their properties were compared between the two species according to the specific characteristics of the samples analysed. A lower diversity was observed in P. radiata...

Tumor Heterogeneity in Breast Cancer

PubMed Central

Turashvili, Gulisa; Brogi, Edi

2017-01-01

Breast cancer is a heterogeneous disease and differs greatly among different patients (intertumor heterogeneity) and even within each individual tumor (intratumor heterogeneity). Clinical and morphologic intertumor heterogeneity is reflected by staging systems and histopathologic classification of breast cancer. Heterogeneity in the expression of established prognostic and predictive biomarkers, hormone receptors, and human epidermal growth factor receptor 2 oncoprotein is the basis for targeted treatment. Molecular classifications are indicators of genetic tumor heterogeneity, which is probed with multigene assays and can lead to improved stratification into low- and high-risk groups for personalized therapy. Intratumor heterogeneity occurs at the morphologic, genomic, transcriptomic, and proteomic levels, creating diagnostic and therapeutic challenges. Understanding the molecular and cellular mechanisms of tumor heterogeneity that are relevant to the development of treatment resistance is a major area of research. Despite the improved knowledge of the complex genetic and phenotypic features underpinning tumor heterogeneity, there has been only limited advancement in diagnostic, prognostic, or predictive strategies for breast cancer. The current guidelines for reporting of biomarkers aim to maximize patient eligibility for targeted therapy, but do not take into account intratumor heterogeneity. The molecular classification of breast cancer is not implemented in routine clinical practice. Additional studies and in-depth analysis are required to understand the clinical significance of rapidly accumulating data. This review highlights inter- and intratumor heterogeneity of breast carcinoma with special emphasis on pathologic findings, and provides insights into the clinical significance of molecular and cellular mechanisms of heterogeneity. PMID:29276709

The possible role of human milk nucleotides as sleep inducers.

PubMed

Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

2009-02-01

Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P < 0.05) circadian rhythms, the acrophases of the first two being during the night, and of the latter two during the day. While 5'UMP did not show a clear circadian rhythm, there was an increase in its levels at night. In conclusion, the rise in nocturnal levels of 5'AMP, 5'GMP, and 5'UMP could be involved in inducing the 'hypnotic' action of breast-milk at night in the infant.

Interaction between macrocyclic nickel complexes and the nucleotides GMP, AMP and ApG.

PubMed

Liu, Yangzhong; Sletten, Einar

2003-01-15

Reactions between the nucleotides GMP, AMP and ApG and the complexes Ni(tren), Ni(cyclam) and NiCR in aqueous solution have been monitored by (1)H, (15)N NMR and UV spectroscopy. The three nickel complexes display different properties in reactions with nucleotides. Ni(tren) which has a pseudo-octahedral coordination geometry was shown to bind to all three nucleotides. Ni(cyclam) and NiCR, both with four nitrogen atoms in a square planar arrangement are not able to bind to nucleotides efficiently because of steric hindrance. Oxidation of Ni(cyclam) by KHSO(5) to produce trivalent Ni(III)(cyclam) improves the coordination capacity, while oxidation of NiCR does not produce a similar effect. The nucleotides interact with trivalent nickel complexes to different extent. Ni(III)CR is seen to oxidize GMP gradually but does not affect AMP significantly. Ni(III)(cyclam), on the other hand, does not oxidize either GMP or AMP at the 1:1 concentration of oxidant used. This result is probably due to the lower redox potential of Ni(cyclam). ApG binds less efficiently to the Ni complexes but is easier oxidized than the mononucleotides.

Label Review Training: Module 1: Label Basics, Page 7

EPA Pesticide Factsheets

Page 7, Label Training, Pesticide labels translate results of our extensive evaluations of pesticide products into conditions, directions and precautions that define parameters for use of a pesticide with the goal of ensuring protection of human he

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

PubMed Central

Galipeau, Jacques; Nooka, Ajay K.

2013-01-01

The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

Labelling fashion magazine advertisements: Effectiveness of different label formats on social comparison and body dissatisfaction.

PubMed

Tiggemann, Marika; Brown, Zoe

2018-06-01

The experiment investigated the impact on women's body dissatisfaction of different forms of label added to fashion magazine advertisements. Participants were 340 female undergraduate students who viewed 15 fashion advertisements containing a thin and attractive model. They were randomly allocated to one of five label conditions: no label, generic disclaimer label (indicating image had been digitally altered), consequence label (indicating that viewing images might make women feel bad about themselves), informational label (indicating the model in the advertisement was underweight), or a graphic label (picture of a paint brush). Although exposure to the fashion advertisements resulted in increased body dissatisfaction, there was no significant effect of label type on body dissatisfaction; no form of label demonstrated any ameliorating effect. In addition, the consequence and informational labels resulted in increased perceived realism and state appearance comparison. Yet more extensive research is required before the effective implementation of any form of label. Copyright © 2018 Elsevier Ltd. All rights reserved.

Bar Code Labels

NASA Technical Reports Server (NTRS)

1988-01-01

American Bar Codes, Inc. developed special bar code labels for inventory control of space shuttle parts and other space system components. ABC labels are made in a company-developed anodizing aluminum process and consecutively marketed with bar code symbology and human readable numbers. They offer extreme abrasion resistance and indefinite resistance to ultraviolet radiation, capable of withstanding 700 degree temperatures without deterioration and up to 1400 degrees with special designs. They offer high resistance to salt spray, cleaning fluids and mild acids. ABC is now producing these bar code labels commercially or industrial customers who also need labels to resist harsh environments.

OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

NASA Astrophysics Data System (ADS)

Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

2016-09-01

The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

21 CFR 1302.04 - Location and size of symbol on label and labeling.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Location and size of symbol on label and labeling. 1302.04 Section 1302.04 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE LABELING AND PACKAGING REQUIREMENTS FOR CONTROLLED SUBSTANCES § 1302.04 Location and size of symbol on label...

21 CFR 1302.04 - Location and size of symbol on label and labeling.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 9 2011-04-01 2011-04-01 false Location and size of symbol on label and labeling. 1302.04 Section 1302.04 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE LABELING AND PACKAGING REQUIREMENTS FOR CONTROLLED SUBSTANCES § 1302.04 Location and size of symbol on label...

21 CFR 1302.04 - Location and size of symbol on label and labeling.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 9 2012-04-01 2012-04-01 false Location and size of symbol on label and labeling. 1302.04 Section 1302.04 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE LABELING AND PACKAGING REQUIREMENTS FOR CONTROLLED SUBSTANCES § 1302.04 Location and size of symbol on label...

40 CFR 60.536 - Permanent label, temporary label, and owner's manual.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Performance for New Residential Wood Heaters § 60.536 Permanent label, temporary label, and owner's manual. (a... section. (2) Except for wood heaters subject to § 60.530 (e), (f), or (g), the permanent label shall... material expected to last the lifetime of the wood heater, (iv) Present required information in a manner so...

40 CFR 60.536 - Permanent label, temporary label, and owner's manual.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Performance for New Residential Wood Heaters § 60.536 Permanent label, temporary label, and owner's manual. (a... section. (2) Except for wood heaters subject to § 60.530 (e), (f), or (g), the permanent label shall... material expected to last the lifetime of the wood heater, (iv) Present required information in a manner so...

40 CFR 60.536 - Permanent label, temporary label, and owner's manual.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Performance for New Residential Wood Heaters § 60.536 Permanent label, temporary label, and owner's manual. (a... section. (2) Except for wood heaters subject to § 60.530 (e), (f), or (g), the permanent label shall... material expected to last the lifetime of the wood heater, (iv) Present required information in a manner so...

40 CFR 60.536 - Permanent label, temporary label, and owner's manual.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Performance for New Residential Wood Heaters § 60.536 Permanent label, temporary label, and owner's manual. (a... section. (2) Except for wood heaters subject to § 60.530 (e), (f), or (g), the permanent label shall... material expected to last the lifetime of the wood heater, (iv) Present required information in a manner so...

40 CFR 60.536 - Permanent label, temporary label, and owner's manual.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Performance for New Residential Wood Heaters § 60.536 Permanent label, temporary label, and owner's manual. (a... section. (2) Except for wood heaters subject to § 60.530 (e), (f), or (g), the permanent label shall... material expected to last the lifetime of the wood heater, (iv) Present required information in a manner so...

Dietary nucleotides prevent decrease in cellular immunity in ground-based microgravity analog

NASA Technical Reports Server (NTRS)

Yamauchi, Keiko; Hales, Nathan W.; Robinson, Sandra M.; Niehoff, Michael L.; Ramesh, Vani; Pellis, Neal R.; Kulkarni, Anil D.

2002-01-01

Microgravity and stress of spaceflights result in immune dysfunction. The role of nutrition, especially nucleotide supplementation, has become an area of intensive research and significant interest in immunomodulation for maintenance of cellular immune responses. The studies presented here evaluate the plausibility of administering nucleotides to obviate immune dysfunction in an Earth-based in vivo analog of microgravity as studied in anti-orthostatic tail suspension (AOS) of mice. Mice were divided into three housing groups: group, isolation, and AOS. Mice were fed either control chow diet (CD), or RNA-, adenine-, or uracil-supplemented CD for the 1-wk duration of the experiments. In AOS mice, supplemental nucleotides significantly increased in vivo lymph node proliferation and ex vivo lymphoproliferation response to alloantigen and mitogens, respectively, and interleukin-2 and interferon-gamma production. A lower corticosterone level was observed in uracil-supplemented CD compared with CD. These results suggest that exogenous nucleotide supplementation, especially uracil, of normal diet is beneficial in the maintenance and restoration of the immune response during the microgravity analog conditions.

Improving Classification Performance through an Advanced Ensemble Based Heterogeneous Extreme Learning Machines.

PubMed

Abuassba, Adnan O M; Zhang, Dezheng; Luo, Xiong; Shaheryar, Ahmad; Ali, Hazrat

2017-01-01

Extreme Learning Machine (ELM) is a fast-learning algorithm for a single-hidden layer feedforward neural network (SLFN). It often has good generalization performance. However, there are chances that it might overfit the training data due to having more hidden nodes than needed. To address the generalization performance, we use a heterogeneous ensemble approach. We propose an Advanced ELM Ensemble (AELME) for classification, which includes Regularized-ELM, L 2 -norm-optimized ELM (ELML2), and Kernel-ELM. The ensemble is constructed by training a randomly chosen ELM classifier on a subset of training data selected through random resampling. The proposed AELM-Ensemble is evolved by employing an objective function of increasing diversity and accuracy among the final ensemble. Finally, the class label of unseen data is predicted using majority vote approach. Splitting the training data into subsets and incorporation of heterogeneous ELM classifiers result in higher prediction accuracy, better generalization, and a lower number of base classifiers, as compared to other models (Adaboost, Bagging, Dynamic ELM ensemble, data splitting ELM ensemble, and ELM ensemble). The validity of AELME is confirmed through classification on several real-world benchmark datasets.

Improving Classification Performance through an Advanced Ensemble Based Heterogeneous Extreme Learning Machines

PubMed Central

Abuassba, Adnan O. M.; Ali, Hazrat

2017-01-01

Extreme Learning Machine (ELM) is a fast-learning algorithm for a single-hidden layer feedforward neural network (SLFN). It often has good generalization performance. However, there are chances that it might overfit the training data due to having more hidden nodes than needed. To address the generalization performance, we use a heterogeneous ensemble approach. We propose an Advanced ELM Ensemble (AELME) for classification, which includes Regularized-ELM, L2-norm-optimized ELM (ELML2), and Kernel-ELM. The ensemble is constructed by training a randomly chosen ELM classifier on a subset of training data selected through random resampling. The proposed AELM-Ensemble is evolved by employing an objective function of increasing diversity and accuracy among the final ensemble. Finally, the class label of unseen data is predicted using majority vote approach. Splitting the training data into subsets and incorporation of heterogeneous ELM classifiers result in higher prediction accuracy, better generalization, and a lower number of base classifiers, as compared to other models (Adaboost, Bagging, Dynamic ELM ensemble, data splitting ELM ensemble, and ELM ensemble). The validity of AELME is confirmed through classification on several real-world benchmark datasets. PMID:28546808

Optical heterogeneous bioassay for the detection of the inflammatory biomarker suPAR

NASA Astrophysics Data System (ADS)

Tombelli, S.; Trono, C.; Adinolfi, B.; Chiavaioli, F.; Giannetti, A.; Eugen-Olsen, J.; Bernini, R.; Grimaldi, I. A.; Persichetti, G.; Testa, G.; Baldini, F.

2015-03-01

Soluble urokinase plasminogen activator receptor (suPAR) is an inflammatory protein present in blood and a marker of disease presence, severity and prognosis. A heterogeneous sandwich assay is proposed for quantifying suPAR by employing a capture antibody from rat and a biotinylated detection antibody from mouse. Optical detection was achieved by a successive exposure of the biotinylated sandwich to streptavidin labelled with ATTO647N. The heterogeneous assay was implemented on a multichannel polymethylmetacrylate (PMMA) optical biochip, potentially capable of the simultaneous detection of more than one analyte. Capture antibody was immobilized on the PMMA surface of the microfluidic channel and the assay was performed with the following protocol: i) surface blocking with BSA, ii) incubation with suPAR or PBS, iii) incubation with biotinylated suPAR detection Ab and iv) incubation with streptavidin-ATTO647N. Promising preliminary results were obtained with this protocol. Moreover, an improved optical setup is proposed which avoids the mechanical scanning of the chip and consequently the in-series fluorescence excitation and read out, allowing the simultaneous measurement of the fluorescence on all the channels of the microfluidic chip.

CryoEM structure of a prokaryotic cyclic nucleotide-gated ion channel

PubMed Central

James, Zachary M.; Borst, Andrew J.; Haitin, Yoni; Frenz, Brandon; DiMaio, Frank; Zagotta, William N.; Veesler, David

2017-01-01

Cyclic nucleotide-gated (CNG) and hyperpolarization-activated cyclic nucleotide-regulated (HCN) ion channels play crucial physiological roles in phototransduction, olfaction, and cardiac pace making. These channels are characterized by the presence of a carboxyl-terminal cyclic nucleotide-binding domain (CNBD) that connects to the channel pore via a C-linker domain. Although cyclic nucleotide binding has been shown to promote CNG and HCN channel opening, the precise mechanism underlying gating remains poorly understood. Here we used cryoEM to determine the structure of the intact LliK CNG channel isolated from Leptospira licerasiae—which shares sequence similarity to eukaryotic CNG and HCN channels—in the presence of a saturating concentration of cAMP. A short S4–S5 linker connects nearby voltage-sensing and pore domains to produce a non–domain-swapped transmembrane architecture, which appears to be a hallmark of this channel family. We also observe major conformational changes of the LliK C-linkers and CNBDs relative to the crystal structures of isolated C-linker/CNBD fragments and the cryoEM structures of related CNG, HCN, and KCNH channels. The conformation of our LliK structure may represent a functional state of this channel family not captured in previous studies. PMID:28396445

The influence of need for cognition and principal display panel factors on over-the-counter drug facts label comprehension.

PubMed

Catlin, Jesse R; Pechmann, Cornelia; Brass, Eric P

2012-01-01

Nearly all work aimed at optimizing the ability of labeling to communicate over-the-counter (OTC) drug information has focused on back-of-the-package characteristics, such as the Drug Facts label. The effects of front of the package, or principal display panel (PDP) factors, have largely been neglected by researchers. Similarly, heterogeneity in consumers' approach to new information has received scant attention in the context of OTC drugs. This preliminary study tested the hypothesis that display of a drug's brand name on the PDP and individuals' need for cognition influence comprehension of Drug Facts label information. University students (n = 212) that had experienced heartburn but not used the drug class being studied constituted the primary analysis cohort. Students were randomly assigned to review one of two PDPs (brand name or generic), followed by a Drug Facts label and a series of questions related to selection and usage of the drug. Participants with low need for cognition were influenced by the brand name PDP, as those exposed to a PDP featuring a brand (vs. generic) spent less time reading the Drug Facts label and demonstrated lower comprehension of the label information on proper drug selection. These findings suggest that further research is needed to understand the impact of PDP contents and cognitive characteristics of consumers on the communication of OTC drug information. Health care providers should consider communication strategies that account for the challenges patients face in using OTC drugs properly.

Defining the location of promoter-associated R-loops at near-nucleotide resolution using bisDRIP-seq

PubMed Central

Dumelie, Jason G

2017-01-01

R-loops are features of chromatin consisting of a strand of DNA hybridized to RNA, as well as the expelled complementary DNA strand. R-loops are enriched at promoters where they have recently been shown to have important roles in modifying gene expression. However, the location of promoter-associated R-loops and the genomic domains they perturb to modify gene expression remain unclear. To resolve this issue, we developed a bisulfite-based approach, bisDRIP-seq, to map R-loops across the genome at near-nucleotide resolution in MCF-7 cells. We found the location of promoter-associated R-loops is dependent on the presence of introns. In intron-containing genes, R-loops are bounded between the transcription start site and the first exon-intron junction. In intronless genes, the 3' boundary displays gene-specific heterogeneity. Moreover, intronless genes are often associated with promoter-associated R-loop formation. Together, these studies provide a high-resolution map of R-loops and identify gene structure as a critical determinant of R-loop formation. PMID:29072160

Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

PubMed Central

Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

2014-01-01

The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

PubMed

Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

2014-09-12

The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Synthesis of γ-Phosphate-Labeled and Doubly Labeled Adenosine Triphosphate Analogs.

PubMed

Hacker, Stephan M; Welter, Moritz; Marx, Andreas

2015-03-09

This unit describes the synthesis of γ-phosphate-labeled and doubly labeled adenosine triphosphate (ATP) analogs and their characterization using the phosphodiesterase I from Crotalus adamanteus (snake venom phosphodiesterase; SVPD). In the key step of the synthesis, ATP or an ATP analog, bearing a linker containing a trifluoroacetamide group attached to the nucleoside, are modified with an azide-containing linker at the terminal phosphate using an alkylation reaction. Subsequently, different labels are introduced to the linkers by transformation of one functional group to an amine and coupling to an N-hydroxysuccinimide ester. Specifically, the Staudinger reaction of the azide is employed as a straightforward means to obtain an amine in the presence of various labels. Furthermore, the fluorescence characteristics of a fluorogenic, doubly labeled ATP analog are investigated following enzymatic cleavage by SVPD. Copyright © 2015 John Wiley & Sons, Inc.

Evaluation of Brewer's spent yeast to produce flavor enhancer nucleotides: influence of serial repitching.

PubMed

Vieira, Elsa; Brandão, Tiago; Ferreira, Isabel M P L V O

2013-09-18

The present work evaluates the influence of serial yeast repitching on nucleotide composition of brewer's spent yeast extracts produced without addition of exogenous enzymes. Two procedures for disrupting cell walls were compared, and the conditions for low-cost and efficient RNA hydrolysis were selected. A HILIC methodology was validated for the quantification of nucleotides and nucleosides in yeast extracts. Thirty-seven samples of brewer's spent yeast ( Saccharomyces pastorianus ) organized according to the number of serial repitchings were analyzed. Nucleotides accounted for 71.1-88.2% of the RNA products; 2'AMP was the most abundant (ranging between 0.08 and 2.89 g/100 g dry yeast). 5'GMP content ranged between 0.082 and 0.907 g/100 g dry yeast. The sum of 5'GMP, 5'IMP, and 5'AMP represented between 25 and 32% of total nucleotides. This works highlights for the first time that although serial repitching influences the content of monophosphate nucleotides and nucleosides, the profiles of these RNA hydrolysis products are not affected.

Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

PubMed

Silva-Junior, Orzenil B; Grattapaglia, Dario

2015-11-01

We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

78 FR 24211 - Draft Guidance for Industry on Safety Considerations for Container Labels and Carton Labeling...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-24

... container labels and carton labeling design, is the second in a series of three planned guidance documents...] Draft Guidance for Industry on Safety Considerations for Container Labels and Carton Labeling Design To... entitled ``Safety Considerations for Container Labels and Carton Labeling Design to Minimize Medication...

CCR5 RNA Pseudoknots: Residue and Site-Specific Labeling correlate Internal Motions with microRNA Binding.

PubMed

Chen, Bin; Longhini, Andrew P; Nußbaumer, Felix; Kreutz, Christoph; Dinman, Jonathan D; Dayie, T Kwaku

2018-04-11

Conformational dynamics of RNA molecules play a critical role in governing their biological functions. Measurements of RNA dynamic behavior sheds important light on sites that interact with their binding partners or cellular stimulators. However, such measurements using solution-state NMR are difficult for large RNA molecules (>70 nt; nt=nucleotides) owing to severe spectral overlap, homonuclear 13 C scalar couplings, and line broadening. Herein, a strategic combination of solid-phase synthesis, site-specific isotopic labeled phosphoramidites, and enzymatic ligation is introduced. This approach allowed the position-specific insertion of isotopic probes into a 96 nt CCR5 RNA fragment. Accurate measurements of functional dynamics using the Carr-Purcell-Meiboom-Gill (CPMG) relaxation dispersion (RD) experiments enabled extraction of the exchange rates and populations of this RNA. NMR chemical shift perturbation analysis of the RNA/microRNA-1224 complex indicated that A90-C1' of the pseudoknot exhibits similar changes in chemical shift observed in the excited state. This work demonstrates the general applicability of a NMR-labeling strategy to probe functional RNA structural dynamics. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Acharan sulfate, the new glycosaminoglycan from Achatina fulica Bowdich 1822. Structural heterogeneity, metabolic labeling and localization in the body, mucus and the organic shell matrix.

PubMed

Vieira, Tuane C R G; Costa-Filho, Adilson; Salgado, Norma C; Allodi, Silvana; Valente, Ana-Paula; Nasciutti, Luiz E; Silva, Luiz-Claudio F

2004-02-01

Acharan sulfate, a recently discovered glycosaminoglycan isolated from Achatina fulica, has a major disaccharide repeating unit of -->4)-2-acetyl,2-deoxy-alpha-d-glucopyranose(1-->4)-2-sulfo-alpha-l-idopyranosyluronic acid (1-->, making it structurally related to both heparin and heparan sulfate. It has been suggested that this glycosaminoglycan is polydisperse, with an average molecular mass of 29 kDa and known minor disaccharide sequence variants containing unsulfated iduronic acid. Acharan sulfate was found to be located in the body of this species using alcian blue staining and it was suggested to be the main constituent of the mucus. In the present work, we provide further information on the structure and compartmental distribution of acharan sulfate in the snail body. Different populations of acharan sulfate presenting charge and/or molecular mass heterogeneities were isolated from the whole body, as well as from mucus and from the organic shell matrix. A minor glycosaminoglycan fraction susceptible to degradation by nitrous acid was also purified from the snail body, suggesting the presence of N-sulfated glycosaminoglycan molecules. In addition, we demonstrate the in vivo metabolic labeling of acharan sulfate in the snail body after a meal supplemented with [35S]free sulfate. This simple approach might be applied to the study of acharan sulfate biosynthesis. Finally, we developed histochemical assays to localize acharan sulfate in the snail body by metachromatic staining and by histoautoradiography following metabolic radiolabeling with [35S]sulfate. Our results show that acharan sulfate is widely distributed among several organs.

Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

DOEpatents

Kwok, Pui-Yan; Chen, Xiangning

1999-01-01

A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

Off-Label Drug Use

MedlinePlus

... their drugs for off-label uses. Off-label marketing is very different from off-label use. Why ... at a higher risk for medication errors, side effects, and unwanted drug reactions. It’s important that the ...

Synthesis and Evaluation of a Novel Adenosine-Ribose Probe for Global-Scale Profiling of Nucleoside and Nucleotide-Binding Proteins

PubMed Central

Mahajan, Shikha; Manetsch, Roman; Merkler, David J.; Stevens Jr., Stanley M.

2015-01-01

Proteomics is a powerful approach used for investigating the complex molecular mechanisms of disease pathogenesis and progression. An important challenge in modern protein profiling approaches involves targeting of specific protein activities in order to identify altered molecular processes associated with disease pathophysiology. Adenosine-binding proteins represent an important subset of the proteome where aberrant expression or activity changes of these proteins have been implicated in numerous human diseases. Herein, we describe an affinity-based approach for the enrichment of adenosine-binding proteins from a complex cell proteome. A novel N 6-biotinylated-8-azido-adenosine probe (AdoR probe) was synthesized, which contains a reactive group that forms a covalent bond with the target proteins, as well as a biotin tag for affinity enrichment using avidin chromatography. Probe specificity was confirmed with protein standards prior to further evaluation in a complex protein mixture consisting of a lysate derived from mouse neuroblastoma N18TG2 cells. Protein identification and relative quantitation using mass spectrometry allowed for the identification of small variations in abundance of nucleoside- and nucleotide-binding proteins in these samples where a significant enrichment of AdoR-binding proteins in the labeled proteome from the neuroblastoma cells was observed. The results from this study demonstrate the utility of this method to enrich for nucleoside- and nucleotide-binding proteins in a complex protein mixture, pointing towards a unique set of proteins that can be examined in the context of further understanding mechanisms of disease, or fundamental biological processes in general. PMID:25671571

Pesticide Label Review Training

EPA Pesticide Factsheets

This training will help ensure that reviewers evaluate labels according to four core principles. It also will help pesticide registrants developing labels understand what EPA expects of pesticide labels, and what the Agency generally finds acceptable.

The interaction of the Eco R1 restriction enzyme E.coli with nucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hollis, Donald F.

1979-11-01

The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bondmore » which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.« less

Length and sequence heterogeneity in 5S rDNA of Populus deltoides.

PubMed

Negi, Madan S; Rajagopal, Jyothi; Chauhan, Neeti; Cronn, Richard; Lakshmikumaran, Malathi

2002-12-01

The 5S rRNA genes and their associated non-transcribed spacer (NTS) regions are present as repeat units arranged in tandem arrays in plant genomes. Length heterogeneity in 5S rDNA repeats was previously identified in Populus deltoides and was also observed in the present study. Primers were designed to amplify the 5S rDNA NTS variants from the P. deltoides genome. The PCR-amplified products from the two accessions of P. deltoides (G3 and G48) suggested the presence of length heterogeneity of 5S rDNA units within and among accessions, and the size of the spacers ranged from 385 to 434 bp. Sequence analysis of the non-transcribed spacer (NTS) revealed two distinct classes of 5S rDNA within both accessions: class 1, which contained GAA trinucleotide microsatellite repeats, and class 2, which lacked the repeats. The class 1 spacer shows length variation owing to the microsatellite, with two clones exhibiting 10 GAA repeat units and one clone exhibiting 16 such repeat units. However, distance analysis shows that class 1 spacer sequences are highly similar inter se, yielding nucleotide diversity (pi) estimates that are less than 0.15% of those obtained for class 2 spacers (pi = 0.0183 vs. 0.1433, respectively). The presence of microsatellite in the NTS region leading to variation in spacer length is reported and discussed for the first time in P. deltoides.

Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

PubMed

Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

2015-11-01

The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Managing Power Heterogeneity

NASA Astrophysics Data System (ADS)

Pruhs, Kirk

A particularly important emergent technology is heterogeneous processors (or cores), which many computer architects believe will be the dominant architectural design in the future. The main advantage of a heterogeneous architecture, relative to an architecture of identical processors, is that it allows for the inclusion of processors whose design is specialized for particular types of jobs, and for jobs to be assigned to a processor best suited for that job. Most notably, it is envisioned that these heterogeneous architectures will consist of a small number of high-power high-performance processors for critical jobs, and a larger number of lower-power lower-performance processors for less critical jobs. Naturally, the lower-power processors would be more energy efficient in terms of the computation performed per unit of energy expended, and would generate less heat per unit of computation. For a given area and power budget, heterogeneous designs can give significantly better performance for standard workloads. Moreover, even processors that were designed to be homogeneous, are increasingly likely to be heterogeneous at run time: the dominant underlying cause is the increasing variability in the fabrication process as the feature size is scaled down (although run time faults will also play a role). Since manufacturing yields would be unacceptably low if every processor/core was required to be perfect, and since there would be significant performance loss from derating the entire chip to the functioning of the least functional processor (which is what would be required in order to attain processor homogeneity), some processor heterogeneity seems inevitable in chips with many processors/cores.

Genetic Heterogeneity in Streptococcus mutans1

PubMed Central

Coykendall, Alan L.

1971-01-01

The genetic homogeneity among eight cariogenic strains of Streptococcus mutans was assessed by deoxyribonucleic acid (DNA)-DNA reassociation experiments. DNA species were extracted from strains GS5, Ingbritt, 10449, FAl, BHT, E49, SLl, and KlR. Labeled DNA (14C-DNA) was extracted from strains 10449, FAl, and SLl. Denatured 14C-DNA fragments were allowed to reassociate, i.e., form hybrid duplexes, with denatured DNA immobilized on membrane filters incubated in 0.45 m NaCl-0.045 m sodium citrate at 67 or 75 C. At 67 C, 10449 14C-DNA reassociated extensively only with GS5 and Ingbritt DNA. FAl 14C-DNA hybridized extensively only with BHT DNA, and SLl 14C-DNA reassociated with KlR and E49 DNA. DNA which hybridized extensively at 67 C also reassociated to a high degree at 75 C. Thermal elution of 14C-FAl-BHT duplexes showed that the hybrid duplexes were thermostable. The results indicate that S. mutans is a genetically heterogeneous species. The strains studied can be divided into three (possibly four) genetic groups, and these groups closely parallel antigenic groups. PMID:5551636

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Label-Free Optofluidic Nanobiosensor Enables Real-Time Analysis of Single-Cell Cytokine Secretion.

PubMed

Li, Xiaokang; Soler, Maria; Szydzik, Crispin; Khoshmanesh, Khashayar; Schmidt, Julien; Coukos, George; Mitchell, Arnan; Altug, Hatice

2018-06-01

Single-cell analysis of cytokine secretion is essential to understand the heterogeneity of cellular functionalities and develop novel therapies for multiple diseases. Unraveling the dynamic secretion process at single-cell resolution reveals the real-time functional status of individual cells. Fluorescent and colorimetric-based methodologies require tedious molecular labeling that brings inevitable interferences with cell integrity and compromises the temporal resolution. An innovative label-free optofluidic nanoplasmonic biosensor is introduced for single-cell analysis in real time. The nanobiosensor incorporates a novel design of a multifunctional microfluidic system with small volume microchamber and regulation channels for reliable monitoring of cytokine secretion from individual cells for hours. Different interleukin-2 secretion profiles are detected and distinguished from single lymphoma cells. The sensor configuration combined with optical spectroscopic imaging further allows us to determine the spatial single-cell secretion fingerprints in real time. This new biosensor system is anticipated to be a powerful tool to characterize single-cell signaling for basic and clinical research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

On-chip integrated labelling, transport and detection of tumour cells.

PubMed

Woods, Jane; Docker, Peter T; Dyer, Charlotte E; Haswell, Stephen J; Greenman, John

2011-11-01

Microflow cytometry represents a promising tool for the investigation of diagnostic and prognostic cellular cancer markers, particularly if integrated within a device that allows primary cells to be freshly isolated from the solid tumour biopsies that more accurately reflect patient-specific in vivo tissue microenvironments at the time of staining. However, current tissue processing techniques involve several sequential stages with concomitant cell losses, and as such are inappropriate for use with small biopsies. Accordingly, we present a simple method for combined antibody-labelling and dissociation of heterogeneous cells from a tumour mass, which reduces the number of processing steps. Perfusion of ex vivo tissue at 4°C with antibodies and enzymes slows cellular activity while allowing sufficient time for the diffusion of minimally active enzymes. In situ antibody-labelled cells are then dissociated at 37°C from the tumour mass, whereupon hydrogel-filled channels allow the release of relatively low cell numbers (<1000) into a biomimetic microenvironment. This novel approach to sample processing is then further integrated with hydrogel-based electrokinetic transport of the freshly liberated fluorescent cells for downstream detection. It is anticipated that this integrated microfluidic methodology will have wide-ranging biomedical and clinical applications. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular recognition at adenine nucleotide (P2) receptors in platelets.

PubMed

Jacobson, Kenneth A; Mamedova, Liaman; Joshi, Bhalchandra V; Besada, Pedro; Costanzi, Stefano

2005-04-01

Transmembrane signaling through P2Y receptors for extracellular nucleotides controls a diverse array of cellular processes, including thrombosis. Selective agonists and antagonists of the two P2Y receptors present on the platelet surface-the G (q)-coupled P2Y (1) subtype and the G (i)-coupled P2Y (12) subtype-are now known. High-affinity antagonists of each have been developed from nucleotide structures. The (N)-methanocarba bisphosphate derivatives MRS2279 and MRS2500 are potent and selective P2Y (1) receptor antagonists. The carbocyclic nucleoside AZD6140 is an uncharged, orally active P2Y (12) receptor antagonist of nM affinity. Another nucleotide receptor on the platelet surface, the P2X (1) receptor, the activation of which may also be proaggregatory, especially under conditions of high shear stress, has high-affinity ligands, although high selectivity has not yet been achieved. Although alpha,beta-methylene-adenosine triphosphate (ATP) is the classic agonist for the P2X (1) receptor, where it causes rapid desensitization, the agonist BzATP is among the most potent in activating this subtype. The aromatic sulfonates NF279 and NF449 are potent antagonists of the P2X (1) receptor. The structures of the two platelet P2Y receptors have been modeled, based on a rhodopsin template, to explain the basis for nucleotide recognition within the putative transmembrane binding sites. The P2Y (1) receptor model, especially, has been exploited in the design and optimization of antagonists targeted to interact selectively with that subtype.

Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

NASA Astrophysics Data System (ADS)

Schechinger, Linda Sue

I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

[Nucleotidic variations of two captive groups of tepezcuintle, Agouti paca (Rodentia: Agoutidae), from two sites in Yucatan, Mexico].

PubMed

Montes-Pérez, Rubén C; García, Adán W Echeverría; Castro, Jorge Zavala; Gamboa, Militza G Alfaro

2006-09-01

The objective of this work was to estimate the nucleotidic variation between two groups of tepezcuintles (Agouti paca) from the states of Campeche and Quintana Roo, Mexico and within members of each group. Blood samples were collected from eleven A. paca kept in captivity. DNA from leukocytic cells was used for Ramdom Amplification of DNA Polimorphism (RAPD). The primers three 5'-d(GTAGACCCGT)- 3' and six 5'-d(CCCGTCAGCA)- 3' were selected from de Amersham kit (Ready.To.Go. RAPD Analysis Beads, Amersham Pharmacia Biotech), because they produced an adequate number of bands. The electrophoretic pattern of bands obtained was analyzed using software for phylogenetic analysis based on the UPGMA method, to estimate the units of nucleotidic variation. The phylogenetic tree obtained with primer three reveals a dicotomic grouping between the animals from both states in the Yucatan Peninsula showing a divergent value of 1.983 nucleotides per hundred. Animals from Quintana Roo show a grouping with primer six; an additional grouping was observed with animals from Campeche. Nucleotidic variation between both groups was 2.118 nucleotides per hundred. The nucleotidic variation for the two primers within the groups from both states, showed fluctuating values from 0.46 to 1.68 nucleotides per hundred, which indicates that nucleotidic variation between the two groups of animals is around two nucleotides per hundred and, within the groups, less than 1.7 nucleotides per hundred.

Substrate-Dependence of Competitive Nucleotide Pyrophosphatase/Phosphodiesterase1 (NPP1) Inhibitors

PubMed Central

Lee, Sang-Yong; Sarkar, Soumya; Bhattarai, Sanjay; Namasivayam, Vigneshwaran; De Jonghe, Steven; Stephan, Holger; Herdewijn, Piet; El-Tayeb, Ali; Müller, Christa E.

2017-01-01

Nucleotide pyrophosphatase/phosphodiesterase type 1 (NPP1) is a membrane glycoprotein involved in the hydrolysis of extracellular nucleotides. Its major substrate is ATP which is converted to AMP and diphosphate. NPP1 was proposed as a new therapeutic target in brain cancer and immuno-oncology. Several NPP1 inhibitors have been reported to date, most of which were evaluated vs. the artificial substrate p-nitrophenyl 5′-thymidine monophosphate (p-Nph-5′-TMP). Recently, we observed large discrepancies in inhibitory potencies for a class of competitive NPP1 inhibitors when tested vs. the artificial substrate p-Nph-5′-TMP as compared to the natural substrate ATP. Therefore, the goal of the present study was to investigate whether inhibitors of human NPP1 generally display substrate-dependent inhibitory potency. Systematic evaluation of nucleotidic as well as non-nucleotidic NPP1 inhibitors revealed significant differences in determined Ki values for competitive, but not for non- and un-competitive inhibitors when tested vs. the frequently used artificial substrate p-Nph-5′-TMP as compared to ATP. Allosteric modulation of NPP1 by p-Nph-5′-TMP may explain these discrepancies. Results obtained using the AMP derivative p-nitrophenyl 5′-adenosine monophosphate (p-Nph-5′-AMP) as an alternative artificial substrate correlated much better with those employing the natural substrate ATP. PMID:28261095

Phenotypically heterogeneous populations in spatially heterogeneous environments

NASA Astrophysics Data System (ADS)

Patra, Pintu; Klumpp, Stefan

2014-03-01

The spatial expansion of a population in a nonuniform environment may benefit from phenotypic heterogeneity with interconverting subpopulations using different survival strategies. We analyze the crossing of an antibiotic-containing environment by a bacterial population consisting of rapidly growing normal cells and slow-growing, but antibiotic-tolerant persister cells. The dynamics of crossing is characterized by mean first arrival times and is found to be surprisingly complex. It displays three distinct regimes with different scaling behavior that can be understood based on an analytical approximation. Our results suggest that a phenotypically heterogeneous population has a fitness advantage in nonuniform environments and can spread more rapidly than a homogeneous population.

Photoaffinity labelling of cyclic GMP-inhibited phosphodiesterase (PDE III) in human and rat platelets and rat tissues: effects of phosphodiesterase inhibitors.

PubMed

Tang, K M; Jang, E K; Haslam, R J

1994-06-15

Ultraviolet irradiation of human platelet cytosol in the presence of 32P-labelled cyclic GMP (cGMP) can specifically label 110, 80, 55, 49 and 38 kDa proteins; the 110 kDa species is the subunit of cGMP-inhibited phosphodiesterase (PDE III) and the 80 kDa species that of cGMP-dependent protein kinase (Tang et al., 1993, Biochem. J. 294, 329). We have now shown that although photolabelling of platelet PDE III was inhibited by unlabelled cGMP, 8-bromo-cGMP and cyclic AMP (cAMP), it was not affected by phosphorothioate analogues of these cyclic nucleotides. Specific concentration-dependent inhibitions of the photolabelling of PDE III were observed with the following PDE inhibitors: trequinsin (IC50 = 13 +/- 2 nM), lixazinone (IC50 = 22 +/- 4 nM), milrinone (IC50 = 56 +/- 12 nM), cilostamide (IC50 = 70 +/- 9 nM), siguazodan (IC50 = 117 +/- 29 nM) and 3-isobutyl 1-methylxanthine (IBMX) (IC50 = 3950 +/- 22 nM). Thus, measurements of the inhibitory effects of compounds on the photolabelling of platelet PDE III provide a simple quantitative means of investigating their actions at a molecular level that avoids the need to purify the enzyme. Photolabelling of rat platelet lysate or rat heart homogenate by [32P]cGMP showed that the 110 kDa PDE III present in human material was replaced by a 115 kDa protein, labelling of which was also blocked by PDE III inhibitors. Heart and other rat tissues contained much less of this putative 115 kDa PDE III than rat platelets. In contrast, the 80 kDa protein was labelled much less in platelets than in many other rat tissue homogenates (e.g., heart, aorta, uterus and lung). Thus, comparison of the relative amounts of specific photolabelled proteins in different cells may provide an indication of different patterns of cyclic nucleotide action. We compared the abilities of phosphodiesterase inhibitors to block the photolabelling of PDE III in human platelet cytosol and to increase the iloprost-stimulated accumulation of cAMP in intact

Cross Talk between Nucleotide Synthesis Pathways with Cellular Immunity in Constraining Hepatitis E Virus Replication

PubMed Central

Wang, Yijin; Wang, Wenshi; Xu, Lei; Zhou, Xinying; Shokrollahi, Ehsan; Felczak, Krzysztof; van der Laan, Luc J. W.; Pankiewicz, Krzysztof W.; Sprengers, Dave; Raat, Nicolaas J. H.; Metselaar, Herold J.; Peppelenbosch, Maikel P.

2016-01-01

Viruses are solely dependent on host cells to propagate; therefore, understanding virus-host interaction is important for antiviral drug development. Since de novo nucleotide biosynthesis is essentially required for both host cell metabolism and viral replication, specific catalytic enzymes of these pathways have been explored as potential antiviral targets. In this study, we investigated the role of different enzymatic cascades of nucleotide biosynthesis in hepatitis E virus (HEV) replication. By profiling various pharmacological inhibitors of nucleotide biosynthesis, we found that targeting the early steps of the purine biosynthesis pathway led to the enhancement of HEV replication, whereas targeting the later step resulted in potent antiviral activity via the depletion of purine nucleotide. Furthermore, the inhibition of the pyrimidine pathway resulted in potent anti-HEV activity. Interestingly, all of these inhibitors with anti-HEV activity concurrently triggered the induction of antiviral interferon-stimulated genes (ISGs). Although ISGs are commonly induced by interferons via the JAK-STAT pathway, their induction by nucleotide synthesis inhibitors is completely independent of this classical mechanism. In conclusion, this study revealed an unconventional novel mechanism of cross talk between nucleotide biosynthesis pathways and cellular antiviral immunity in constraining HEV infection. Targeting particular enzymes in nucleotide biosynthesis represents a viable option for antiviral drug development against HEV. HEV is the most common cause of acute viral hepatitis worldwide and is also associated with chronic hepatitis, especially in immunocompromised patients. Although often an acute and self-limiting infection in the general population, HEV can cause severe morbidity and mortality in certain patients, a problem compounded by the lack of FDA-approved anti-HEV medication available. In this study, we have investigated the role of the nucleotide synthesis pathway

Formation of Amino Acids and Nucleotide Bases in a Titan Atmosphere Simulation Experiment

PubMed Central

Yelle, R.V.; Buch, A.; Carrasco, N.; Cernogora, G.; Dutuit, O.; Quirico, E.; Sciamma-O'Brien, E.; Smith, M.A.; Somogyi, Á.; Szopa, C.; Thissen, R.; Vuitton, V.

2012-01-01

Abstract The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N2/CH4/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C4H5N3O, C4H4N2O2, C5H6N2O2, C5H5N5, and C6H9N3O2 are produced by chemistry in the simulation chamber. Gas chromatography–mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C4H5N3O), uracil (C5H4N2O2), thymine (C5H6N2O2), guanine (C5H5N5O), glycine (C2H5NO2), and alanine (C3H7NO2). Adenine (C5H5N5) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin. Key Words: Astrochemistry—Planetary atmospheres—Titan—Astrobiology. Astrobiology 12, 809–817. PMID:22917035

Generation of Small 32P-Labeled Peptides as a Potential Approach to Colorectal Cancer Therapy

PubMed Central

Abraham, John M.; Cheng, Yulan; Hamilton, James P.; Paun, Bogdan; Jin, Zhe; Agarwal, Rachana; Kan, Takatsugu; David, Stefan; Olaru, Alexandru; Yang, Jian; Ito, Tetsuo; Selaru, Florin M.; Mori, Yuriko; Meltzer, Stephen J.

2008-01-01

Cancers have been revealed to be extremely heterogenous in terms of the frequency and types of mutations present in cells from different malignant tumors. Thus, it is likely that uniform clinical treatment is not optimal for all patients, and that the development of individualized therapeutic regimens may be beneficial. We describe the generation of multiple, unique small peptides nine to thirty-four amino acids in length which, when labeled with the radioisotope 32P, bind with vastly differing efficiencies to cell lines derived from different colon adenocarcinomas. In addition, the most effective of these peptides permanently transfers the 32P radioisotope to colorectal cancer cellular proteins within two hours at a rate that is more than 150 times higher than in cell lines derived from other cancers or from the normal tissues tested. Currently, the only two FDA-approved radioimmunotherapeutic agents in use both employ antibodies directed against the B cell marker CD20 for the treatment of non-Hodgkin's lymphoma. By using the method described herein, large numbers of different 32P-labeled peptides can be readily produced and assayed against a broad spectrum of cancer types. This report proposes the development and use of 32P-labeled peptides as potential individualized peptide-binding therapies for the treatment of colon adenocarcinoma patients. PMID:18575578

Pyruvate kinase isoform expression alters nucleotide synthesis to impact cell proliferation

PubMed Central

Lunt, Sophia Y.; Muralidhar, Vinayak; Hosios, Aaron M.; Israelsen, William J.; Gui, Dan Y.; Newhouse, Lauren; Ogrodzinski, Martin; Hecht, Vivian; Xu, Kali; Acevedo, Paula N. Marín; Hollern, Daniel P.; Bellinger, Gary; Dayton, Talya L.; Christen, Stefan; Elia, Ilaria; Dinh, Anh T.; Stephanopoulos, Gregory; Manalis, Scott R.; Yaffe, Michael B.; Andrechek, Eran R.; Fendt, Sarah-Maria; Heiden, Matthew G. Vander

2014-01-01

SUMMARY Metabolic regulation influences cell proliferation. The influence of pyruvate kinase isoforms on tumor cells has been extensively studied, but whether PKM2 is required for normal cell proliferation is unknown. We examine how PKM2-deletion affects proliferation and metabolism in non-transformed, non-immortalized PKM2-expressing primary cells. We find that deletion of PKM2 in primary cells results in PKM1 expression and proliferation arrest. PKM1 expression, rather than PKM2 loss, is responsible for this effect, and proliferation arrest cannot be explained by cell differentiation, senescence, death, changes in gene expression, or prevention of cell growth. Instead, PKM1 expression impairs nucleotide production and the ability to synthesize DNA and progress through the cell cycle. Nucleotide biosynthesis is limiting, as proliferation arrest is characterized by severe thymidine depletion, and supplying exogenous thymine rescues both nucleotide levels and cell proliferation. Thus, PKM1 expression promotes a metabolic state that is unable to support DNA synthesis. PMID:25482511

Genome analysis of canine astroviruses reveals genetic heterogeneity and suggests possible inter-species transmission.

PubMed

Mihalov-Kovács, Eszter; Martella, Vito; Lanave, Gianvito; Bodnar, Livia; Fehér, Enikő; Marton, Szilvia; Kemenesi, Gábor; Jakab, Ferenc; Bányai, Krisztián

2017-03-15

Canine astrovirus RNA was detected in the stools of 17/63 (26.9%) samples, using either a broadly reactive consensus RT-PCR for astroviruses or random RT-PCR coupled with massive deep sequencing. The complete or nearly complete genome sequence of five canine astroviruses was reconstructed that allowed mapping the genome organization and to investigate the genetic diversity of these viruses. The genome was about 6.6kb in length and contained three open reading frames (ORFs) flanked by a 5' UTR, and a 3' UTR plus a poly-A tail. ORF1a and ORF1b overlapped by 43 nucleotides while the ORF2 overlapped by 8 nucleotides with the 3' end of ORF1b. Upon genome comparison, four strains (HUN/2012/2, HUN/2012/6, HUN/2012/115, and HUN/2012/135) were more related genetically to each other and to UK canine astroviruses (88-96% nt identity), whilst strain HUN/2012/126 was more divergent (75-76% nt identity). In the ORF1b and ORF2, strains HUN/2012/2, HUN/2012/6, and HUN/2012/135 were related genetically to other canine astroviruses identified formerly in Europe and China, whereas strain HUN/2012/126 was related genetically to a divergent canine astrovirus strain, ITA/2010/Zoid. For one canine astrovirus, HUN/2012/8, only a 3.2kb portion of the genome, at the 3' end, could be determined. Interestingly, this strain possessed unique genetic signatures (including a longer ORF1b/ORF2 overlap and a longer 3'UTR) and it was divergent in both ORF1b and ORF2 from all other canine astroviruses, with the highest nucleotide sequence identity (68% and 63%, respectively) to a mink astrovirus, thus suggesting a possible event of interspecies transmission. The genetic heterogeneity of canine astroviruses may pose a challenge for the diagnostics and for future prophylaxis strategies. Copyright © 2016 Elsevier B.V. All rights reserved.

Inter-labeler and intra-labeler variability of condition severity classification models using active and passive learning methods.

PubMed

Nissim, Nir; Shahar, Yuval; Elovici, Yuval; Hripcsak, George; Moskovitch, Robert

2017-09-01

Labeling instances by domain experts for classification is often time consuming and expensive. To reduce such labeling efforts, we had proposed the application of active learning (AL) methods, introduced our CAESAR-ALE framework for classifying the severity of clinical conditions, and shown its significant reduction of labeling efforts. The use of any of three AL methods (one well known [SVM-Margin], and two that we introduced [Exploitation and Combination_XA]) significantly reduced (by 48% to 64%) condition labeling efforts, compared to standard passive (random instance-selection) SVM learning. Furthermore, our new AL methods achieved maximal accuracy using 12% fewer labeled cases than the SVM-Margin AL method. However, because labelers have varying levels of expertise, a major issue associated with learning methods, and AL methods in particular, is how to best to use the labeling provided by a committee of labelers. First, we wanted to know, based on the labelers' learning curves, whether using AL methods (versus standard passive learning methods) has an effect on the Intra-labeler variability (within the learning curve of each labeler) and inter-labeler variability (among the learning curves of different labelers). Then, we wanted to examine the effect of learning (either passively or actively) from the labels created by the majority consensus of a group of labelers. We used our CAESAR-ALE framework for classifying the severity of clinical conditions, the three AL methods and the passive learning method, as mentioned above, to induce the classifications models. We used a dataset of 516 clinical conditions and their severity labeling, represented by features aggregated from the medical records of 1.9 million patients treated at Columbia University Medical Center. We analyzed the variance of the classification performance within (intra-labeler), and especially among (inter-labeler) the classification models that were induced by using the labels provided by seven

To label or not to label: applications of quantitative proteomics in neuroscience research.

PubMed

Filiou, Michaela D; Martins-de-Souza, Daniel; Guest, Paul C; Bahn, Sabine; Turck, Christoph W

2012-02-01

Proteomics has provided researchers with a sophisticated toolbox of labeling-based and label-free quantitative methods. These are now being applied in neuroscience research where they have already contributed to the elucidation of fundamental mechanisms and the discovery of candidate biomarkers. In this review, we evaluate and compare labeling-based and label-free quantitative proteomic techniques for applications in neuroscience research. We discuss the considerations required for the analysis of brain and central nervous system specimens, the experimental design of quantitative proteomic workflows as well as the feasibility, advantages, and disadvantages of the available techniques for neuroscience-oriented questions. Furthermore, we assess the use of labeled standards as internal controls for comparative studies in humans and review applications of labeling-based and label-free mass spectrometry approaches in relevant model organisms and human subjects. Providing a comprehensive guide of feasible and meaningful quantitative proteomic methodologies for neuroscience research is crucial not only for overcoming current limitations but also for gaining useful insights into brain function and translating proteomics from bench to bedside. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates

Hierarchical Multi-atlas Label Fusion with Multi-scale Feature Representation and Label-specific Patch Partition

PubMed Central

Wu, Guorong; Kim, Minjeong; Sanroma, Gerard; Wang, Qian; Munsell, Brent C.; Shen, Dinggang

2014-01-01

Multi-atlas patch-based label fusion methods have been successfully used to improve segmentation accuracy in many important medical image analysis applications. In general, to achieve label fusion a single target image is first registered to several atlas images, after registration a label is assigned to each target point in the target image by determining the similarity between the underlying target image patch (centered at the target point) and the aligned image patch in each atlas image. To achieve the highest level of accuracy during the label fusion process it’s critical the chosen patch similarity measurement accurately captures the tissue/shape appearance of the anatomical structure. One major limitation of existing state-of-the-art label fusion methods is that they often apply a fixed size image patch throughout the entire label fusion procedure. Doing so may severely affect the fidelity of the patch similarity measurement, which in turn may not adequately capture complex tissue appearance patterns expressed by the anatomical structure. To address this limitation, we advance state-of-the-art by adding three new label fusion contributions: First, each image patch now characterized by a multi-scale feature representation that encodes both local and semi-local image information. Doing so will increase the accuracy of the patch-based similarity measurement. Second, to limit the possibility of the patch-based similarity measurement being wrongly guided by the presence of multiple anatomical structures in the same image patch, each atlas image patch is further partitioned into a set of label-specific partial image patches according to the existing labels. Since image information has now been semantically divided into different patterns, these new label-specific atlas patches make the label fusion process more specific and flexible. Lastly, in order to correct target points that are mislabeled during label fusion, a hierarchically approach is used to improve the

Comparative nucleotide diversity across North American and European populus species.

PubMed

Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A

2012-06-01

Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (<400 bp) in comparison to P. tremula (≫400 bp). The similarities in nucleotide diversity pattern and LD decay of the two balsam poplar species likely reflects the recent time of their divergence.

Characterizing pulmonary blood flow distribution measured using arterial spin labeling.

PubMed

Henderson, A Cortney; Prisk, G Kim; Levin, David L; Hopkins, Susan R; Buxton, Richard B

2009-12-01

The arterial spin labeling (ASL) method provides images in which, ideally, the signal intensity of each image voxel is proportional to the local perfusion. For studies of pulmonary perfusion, the relative dispersion (RD, standard deviation/mean) of the ASL signal across a lung section is used as a reliable measure of flow heterogeneity. However, the RD of the ASL signals within the lung may systematically differ from the true RD of perfusion because the ASL image also includes signals from larger vessels, which can reflect the blood volume rather than blood flow if the vessels are filled with tagged blood during the imaging time. Theoretical studies suggest that the pulmonary vasculature exhibits a lognormal distribution for blood flow and thus an appropriate measure of heterogeneity is the geometric standard deviation (GSD). To test whether the ASL signal exhibits a lognormal distribution for pulmonary blood flow, determine whether larger vessels play an important role in the distribution, and extract physiologically relevant measures of heterogeneity from the ASL signal, we quantified the ASL signal before and after an intervention (head-down tilt) in six subjects. The distribution of ASL signal was better characterized by a lognormal distribution than a normal distribution, reducing the mean squared error by 72% (p < 0.005). Head-down tilt significantly reduced the lognormal scale parameter (p = 0.01) but not the shape parameter or GSD. The RD increased post-tilt and remained significantly elevated (by 17%, p < 0.05). Test case results and mathematical simulations suggest that RD is more sensitive than the GSD to ASL signal from tagged blood in larger vessels, a probable explanation of the change in RD without a statistically significant change in GSD. This suggests that the GSD is a useful measure of pulmonary blood flow heterogeneity with the advantage of being less affected by the ASL signal from tagged blood in larger vessels.

Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

PubMed

Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

1999-03-01

The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Bijective transformation circular codes and nucleotide exchanging RNA transcription.

PubMed

Michel, Christian J; Seligmann, Hervé

2014-04-01

The C(3) self-complementary circular code X identified in genes of prokaryotes and eukaryotes is a set of 20 trinucleotides enabling reading frame retrieval and maintenance, i.e. a framing code (Arquès and Michel, 1996; Michel, 2012, 2013). Some mitochondrial RNAs correspond to DNA sequences when RNA transcription systematically exchanges between nucleotides (Seligmann, 2013a,b). We study here the 23 bijective transformation codes ΠX of X which may code nucleotide exchanging RNA transcription as suggested by this mitochondrial observation. The 23 bijective transformation codes ΠX are C(3) trinucleotide circular codes, seven of them are also self-complementary. Furthermore, several correlations are observed between the Reading Frame Retrieval (RFR) probability of bijective transformation codes ΠX and the different biological properties of ΠX related to their numbers of RNAs in GenBank's EST database, their polymerization rate, their number of amino acids and the chirality of amino acids they code. Results suggest that the circular code X with the functions of reading frame retrieval and maintenance in regular RNA transcription, may also have, through its bijective transformation codes ΠX, the same functions in nucleotide exchanging RNA transcription. Associations with properties such as amino acid chirality suggest that the RFR of X and its bijective transformations molded the origins of the genetic code's machinery. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Does the choice of nucleotide substitution models matter topologically?

PubMed

Hoff, Michael; Orf, Stefan; Riehm, Benedikt; Darriba, Diego; Stamatakis, Alexandros

2016-03-24

In the context of a master level programming practical at the computer science department of the Karlsruhe Institute of Technology, we developed and make available an open-source code for testing all 203 possible nucleotide substitution models in the Maximum Likelihood (ML) setting under the common Akaike, corrected Akaike, and Bayesian information criteria. We address the question if model selection matters topologically, that is, if conducting ML inferences under the optimal, instead of a standard General Time Reversible model, yields different tree topologies. We also assess, to which degree models selected and trees inferred under the three standard criteria (AIC, AICc, BIC) differ. Finally, we assess if the definition of the sample size (#sites versus #sites × #taxa) yields different models and, as a consequence, different tree topologies. We find that, all three factors (by order of impact: nucleotide model selection, information criterion used, sample size definition) can yield topologically substantially different final tree topologies (topological difference exceeding 10 %) for approximately 5 % of the tree inferences conducted on the 39 empirical datasets used in our study. We find that, using the best-fit nucleotide substitution model may change the final ML tree topology compared to an inference under a default GTR model. The effect is less pronounced when comparing distinct information criteria. Nonetheless, in some cases we did obtain substantial topological differences.

Cyclic Nucleotide Phosphodiesterases: important signaling modulators and therapeutic targets

PubMed Central

Ahmad, Faiyaz; Murata, Taku; Simizu, Kasumi; Degerman, Eva; Maurice, Donald; Manganiello, Vincent

2014-01-01

By catalyzing hydrolysis of cAMP and cGMP, cyclic nucleotide phosphodiesterases are critical regulators of their intracellular concentrations and their biological effects. Since these intracellular second messengers control many cellular homeostatic processes, dysregulation of their signals and signaling pathways initiate or modulate pathophysiological pathways related to various disease states, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication, chronic obstructive pulmonary disease, and psoriasis. Alterations in expression of PDEs and PDE-gene mutations (especially mutations in PDE6, PDE8B, PDE11A and PDE4) have been implicated in various diseases and cancer pathologies. PDEs also play important role in formation and function of multi-molecular signaling/regulatory complexes called signalosomes. At specific intracellular locations, individual PDEs, together with pathway-specific signaling molecules, regulators, and effectors, are incorporated into specific signalosomes, where they facilitate and regulate compartmentalization of cyclic nucleotide signaling pathways and specific cellular functions. Currently, only a limited number of PDE inhibitors (PDE3, PDE4, PDE5 inhibitors) are used in clinical practice. Future paths to novel drug discovery include the crystal structure-based design approach, which has resulted in generation of more effective family-selective inhibitors, as well as burgeoning development of strategies to alter compartmentalized cyclic nucleotide signaling pathways by selectively targeting individual PDEs and their signalosome partners. PMID:25056711

Inter-Labeler and Intra-Labeler Variability of Condition Severity Classification Models Using Active and Passive Learning Methods

PubMed Central

Nissim, Nir; Shahar, Yuval; Boland, Mary Regina; Tatonetti, Nicholas P; Elovici, Yuval; Hripcsak, George; Moskovitch, Robert

2018-01-01

Background and Objectives Labeling instances by domain experts for classification is often time consuming and expensive. To reduce such labeling efforts, we had proposed the application of active learning (AL) methods, introduced our CAESAR-ALE framework for classifying the severity of clinical conditions, and shown its significant reduction of labeling efforts. The use of any of three AL methods (one well known [SVM-Margin], and two that we introduced [Exploitation and Combination_XA]) significantly reduced (by 48% to 64%) condition labeling efforts, compared to standard passive (random instance-selection) SVM learning. Furthermore, our new AL methods achieved maximal accuracy using 12% fewer labeled cases than the SVM-Margin AL method. However, because labelers have varying levels of expertise, a major issue associated with learning methods, and AL methods in particular, is how to best to use the labeling provided by a committee of labelers. First, we wanted to know, based on the labelers’ learning curves, whether using AL methods (versus standard passive learning methods) has an effect on the Intra-labeler variability (within the learning curve of each labeler) and inter-labeler variability (among the learning curves of different labelers). Then, we wanted to examine the effect of learning (either passively or actively) from the labels created by the majority consensus of a group of labelers. Methods We used our CAESAR-ALE framework for classifying the severity of clinical conditions, the three AL methods and the passive learning method, as mentioned above, to induce the classifications models. We used a dataset of 516 clinical conditions and their severity labeling, represented by features aggregated from the medical records of 1.9 million patients treated at Columbia University Medical Center. We analyzed the variance of the classification performance within (intra-labeler), and especially among (inter-labeler) the classification models that were induced by

Capacitive label reader

DOEpatents

Arlowe, H. Duane

1985-01-01

A capacitive label reader includes an outer ring transmitting portion, an inner ring transmitting portion, and a plurality of insulated receiving portions. A label is the mirror-image of the reader except that identifying portions corresponding to the receiving portions are insulated from only one of two coupling elements. Positive and negative pulses applied, respectively, to the two transmitting rings biased a CMOS shift register positively to either a 1 or 0 condition. The output of the CMOS may be read as an indication of the label.

Capacitive label reader

DOEpatents

Arlowe, H.D.

1983-07-15

A capacitive label reader includes an outer ring transmitting portion, an inner ring transmitting portion, and a plurality of insulated receiving portions. A label is the mirror-image of the reader except that identifying portions corresponding to the receiving portions are insulated from only one of two coupling elements. Positive and negative pulses applied, respectively, to the two transmitting rings biased a CMOS shift register positively to either a 1 or 0 condition. The output of the CMOS may be read as an indication of the label.

16 CFR 460.12 - Labels.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must contain: (a) The type of insulation. (b) A chart showing these items: (1) For batts and blankets of any...

16 CFR 460.12 - Labels.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must contain: (a) The type of insulation. (b) A chart showing these items: (1) For batts and blankets of any...

16 CFR 460.12 - Labels.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must contain: (a) The type of insulation. (b) A chart showing these items: (1) For batts and blankets of any...

16 CFR 460.12 - Labels.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must contain: (a) The type of insulation. (b) A chart showing these items: (1) For batts and blankets of any...

16 CFR 460.12 - Labels.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must contain: (a) The type of insulation. (b) A chart showing these items: (1) For batts and blankets of any...

21 CFR 895.25 - Labeling.

Code of Federal Regulations, 2010 CFR

2010-04-01

... eliminated by labeling or a change in labeling, or change in advertising if the device is a restricted device... person(s) responsible for the labeling or advertising of the device specifying: (1) The deception or risk... labeling, or change in advertising if the device is a restricted device, necessary to correct the deception...

Adaptation of the TdT assay for semi-quantitative flow cytometric detection of DNA strand breaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bromidge, T.J.; Howe, D.J.; Johnson, S.A.

The enzyme Terminal Deoxynucleotidyl Transferase (TdT) is a DNA polymerase which can be used to label DNA strand breaks by the incorporation of a labelled nucleotide followed by a fluorescent detection step. The amount of label incorporated can then be assessed by flow cytometry. The mechanism of action of TdT, however, will allow the addition of varying numbers of nucleotides to the free 3{prime} termini produced by DNA strand breaks. The substitution of Digoxigenin (DIG){trademark} labelled dideoxynucleotides for labelled deoxy-nucleotides in the TdT assay will limit the addition of label to a DNA break to a single nucleotide, thus ensuringmore » a direct relationship between an increase in DNA strand breaks and an increase in fluorescence. We have used this adaptation of the TdT assay to evaluate DNA damage incurred in lymphocytes, from patients with Chronic Lymphocytic Leukemia (CLL), on exposure to UV irradiation and apoptosis-inducing drugs, fludarabine and 2-Chloro-2{prime}-deoxyadenosine (2-CdA). This technique may give a good indication of the susceptibility of CLL patients to apoptosis inducing drugs, and hence an indication of the likely response to these therapies. 7 refs., 2 figs., 2 tabs.« less

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

cGMP and cyclic nucleotide-gated channels participate in mouse sperm capacitation.

PubMed

Cisneros-Mejorado, Abraham; Sánchez Herrera, Daniel P

2012-01-20

During capacitation of mammalian sperm intracellular [Ca(2+)] and cyclic nucleotides increase, suggesting that CNG channels play a role in the physiology of sperm. Here we study the effect of capacitation, 8Br-cAMP (8-bromoadenosine 3',5'-cyclic monophosphate) and 8Br-cGMP (8-bromoguanosine 3',5'-cyclic monophosphate) on the macroscopic ionic currents of mouse sperm, finding the existence of different populations of sperm, in terms of the recorded current and its response to cyclic nucleotides. Our results show that capacitation and cyclic nucleotides increase the ionic current, having a differential sensitivity to cGMP (cyclic guanosine monophosphate) and cAMP (cyclic adenosine monophosphate). Using a specific inhibitor we determine the contribution of CNG channels to macroscopic current and capacitation. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Analysis of plant nucleotide sugars by hydrophilic interaction liquid chromatography and tandem mass spectrometry.

PubMed

Ito, Jun; Herter, Thomas; Baidoo, Edward E K; Lao, Jeemeng; Vega-Sánchez, Miguel E; Michelle Smith-Moritz, A; Adams, Paul D; Keasling, Jay D; Usadel, Björn; Petzold, Christopher J; Heazlewood, Joshua L

2014-03-01

Understanding the intricate metabolic processes involved in plant cell wall biosynthesis is limited by difficulties in performing sensitive quantification of many involved compounds. Hydrophilic interaction liquid chromatography is a useful technique for the analysis of hydrophilic metabolites from complex biological extracts and forms the basis of this method to quantify plant cell wall precursors. A zwitterionic silica-based stationary phase has been used to separate hydrophilic nucleotide sugars involved in cell wall biosynthesis from milligram amounts of leaf tissue. A tandem mass spectrometry operating in selected reaction monitoring mode was used to quantify nucleotide sugars. This method was highly repeatable and quantified 12 nucleotide sugars at low femtomole quantities, with linear responses up to four orders of magnitude to several 100pmol. The method was also successfully applied to the analysis of purified leaf extracts from two model plant species with variations in their cell wall sugar compositions and indicated significant differences in the levels of 6 out of 12 nucleotide sugars. The plant nucleotide sugar extraction procedure was demonstrated to have good recovery rates with minimal matrix effects. The approach results in a significant improvement in sensitivity when applied to plant samples over currently employed techniques. Copyright © 2013 Elsevier Inc. All rights reserved.

Review of nutrition labeling formats.

PubMed

Geiger, C J; Wyse, B W; Parent, C R; Hansen, R G

1991-07-01

This article examines nutrition labeling history as well as the findings of nine research studies of nutrition labeling formats. Nutrition labeling regulations were announced in 1973 and have been periodically amended since then. In response to requests from consumers and health care professionals for revision of the labeling system, the Food and Drug Administration initiated a three-phase plan for reform of nutrition labeling in 1990. President Bush signed the Nutrition Labeling and Education Act in November 1990. Literature analysis revealed that only nine studies with an experimental design have focused on nutrition labeling since 1971. Four were conducted before 1975, which was the year that nutrition labeling was officially implemented, two were conducted in 1980, and three were conducted after 1986. Only two of the nine studies supported the traditional label format mandated by the Code of Federal Regulations, and one study partially supported it. Four of the nine studies that evaluated graphic presentations of nutrition information found that consumer comprehension of nutrition information was improved with a graphic format for nutrition labeling: three studies supported the use of bar graphs and one study supported the use of a pie chart. Full disclosure (ie, complete nutrient and ingredient labeling) was preferred by consumers in two of the three studies that examined this variable. The third study supported three types of information disclosure dependent upon socioeconomic class. In those studies that tested graphics, a bar graph format was significantly preferred and showed better consumer comprehension than the traditional format.

40 CFR 168.65 - Pesticide export label and labeling requirements.

Code of Federal Regulations, 2010 CFR

2010-07-01

... toxic pesticides. If the pesticide, device or active ingredient is highly toxic to humans, the skull and... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Pesticide export label and labeling...) PESTICIDE PROGRAMS STATEMENTS OF ENFORCEMENT POLICIES AND INTERPRETATIONS Export Policy and Procedures for...

40 CFR 168.65 - Pesticide export label and labeling requirements.

Code of Federal Regulations, 2011 CFR

2011-07-01

... toxic pesticides. If the pesticide, device or active ingredient is highly toxic to humans, the skull and... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Pesticide export label and labeling...) PESTICIDE PROGRAMS STATEMENTS OF ENFORCEMENT POLICIES AND INTERPRETATIONS Export Policy and Procedures for...

40 CFR 168.65 - Pesticide export label and labeling requirements.

Code of Federal Regulations, 2012 CFR

2012-07-01

... toxic pesticides. If the pesticide, device or active ingredient is highly toxic to humans, the skull and... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Pesticide export label and labeling...) PESTICIDE PROGRAMS STATEMENTS OF ENFORCEMENT POLICIES AND INTERPRETATIONS Export Policy and Procedures for...

Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction.

PubMed

Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na

2013-03-15

We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.

Do nutrition labels improve dietary outcomes?

PubMed