STRUCTURED JETS IN BL LAC OBJECTS: EFFICIENT PeV NEUTRINO FACTORIES?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tavecchio, Fabrizio; Ghisellini, Gabriele; Guetta, Dafne
2014-09-20
The origin of high-energy neutrinos (0.1–1 PeV range) detected by IceCube remains a mystery. In this work, we explore the possibility that efficient neutrino production can occur in structured jets of BL Lac objects, characterized by a fast inner spine surrounded by a slower layer. This scenario has been widely discussed in the framework of the high-energy emission models for BL Lac objects and radio galaxies. One of the relevant consequences of a velocity structure is the enhancement of the inverse Compton emission caused by the radiative coupling of the two zones. We show that a similar boosting could occurmore » for the neutrino output of the spine through the photo-meson reaction of high-energy protons scattering off the amplified soft target photon field of the layer. Assuming the local density and the cosmological evolution of γ-ray BL Lac object derived from Fermi Large Area Telescope data, we calculate the expected diffuse neutrino intensity, which can match the IceCube data for a reasonable choice of parameters.« less
NASA Astrophysics Data System (ADS)
Bondi, M.; Dallacasa, D.; Stanghellini, C.; Marchã, M. J. M.
We obtained two-epoch VLBA observations at 5 GHz of a list of radio galaxies drawn from the 200 mJy sample (Marcha et al. 1996). The objects selected for milli-arcsecond scale observations are classified, on the basis of their optical spectroscopic and polarimetric properties, as BL Lac objects, normal weak line radio galaxies, broad line radio galaxies, and transition objects (those with intermediate properties). We present preliminary results on the radio polarization properties, on the milli-arcsecond scale, of objects with different optical properties and discuss structural variations detected from the two epochs.
NASA Astrophysics Data System (ADS)
Bondi, M.; Marchã, M. J. M.; Dallacasa, D.; Stanghellini, C.
2001-08-01
The 200-mJy sample, defined by Marchã et al., contains about 60 nearby, northern, flat-spectrum radio sources. In particular, the sample has proved effective at finding nearby radio-selected BL Lac objects with radio luminosities comparable to those of X-ray-selected objects, and low-luminosity flat-spectrum weak emission-line radio galaxies (WLRGs). The 200-mJy sample contains 23 BL Lac objects (including 6 BL Lac candidates) and 19 WLRGs. We will refer to these subsamples as the 200-mJy BL Lac sample and the 200-mJy WLRG sample, respectively. We have started a systematic analysis of the morphological pc-scale properties of the 200-mJy radio sources using VLBI observations. This paper presents VLBI observations at 5 and 1.6GHz of 14 BL Lac objects and WLRGs selected from the 200-mJy sample. The pc-scale morphology of these objects is briefly discussed. We derive the radio beaming parameters of the 200-mJy BL Lac objects and WLRGs and compare them with those of other BL Lac samples and with a sample of FR I radio galaxies. The overall broad-band radio, optical and X-ray properties of the 200-mJy BL Lac sample are discussed and compared with those of other BL Lac samples, radio- and X-ray-selected. We find that the 200-mJy BL Lac objects fill the gap between HBL and LBL objects in the colour-colour plot, and have intermediate αXOX as expected in the spectral energy distribution unification scenario. Finally, we briefly discuss the role of the WLRGs.
Evolutionary behaviour of AGN: Investigations on BL Lac objects and Seyfert II galaxies
NASA Astrophysics Data System (ADS)
Beckmann, V.
2000-12-01
The evolution and nature of AGN is still one of the enigmatic questions in astrophysics. While large and complete Quasar samples are available, special classes of AGN, like BL Lac objects and Seyfert II galaxies, are still rare objects. In this work I present two new AGN samples. The first one is the HRX-BL Lac survey, resulting in a sample of X-ray selected BL Lac objects. This sample results from 223 BL Lac candidates based on a correlation of X-ray sources with radio sources. The identification of this sample is 98% complete. 77 objects have been identified as BL Lac objects and form the HRX-BL Lac complete sample, the largest homogeneous sample of BL Lac objects existing today. For this sample, redshifts are now known for 62 objects (81 %). In total I present 101 BL Lac objects in the enlarged HRX-BL Lac survey, for which redshift information is available for 84 objects. During the HRX-BL Lac survey I found several objects of special interest. 1ES 1517+656 turned out to be the brightest known BL Lac object in the universe. 1ES 0927+500 could be the first BL Lac object with a line detected in the X-ray region. RX J1211+2242 is probably the the counterpart of the up to now unidentified gamma-ray source 3EG J1212+2304. Additionally I present seven candidates for ultra high frequency peaked BL Lac objects. RX J1054+3855 and RX J1153+3517 are rare high redshift X-ray bright QSO or accreting binary systems with huge magnetic fields. For the BL Lac objects I suggest an unified scenario in which giant elliptical galaxies, formed by merging events of spiral galaxies at z > 2, start as powerful, radio dominated BL Lacs. As the jet gets less powerful, the BL Lacs start to get more X-ray dominated, showing less total luminosities (for z < 1). This effect is seen in the different evolutionary behavior detected in high and low frequency cut off BL Lac objects (HBL and LBL, respectively). The model of negative evolution is supported by assumptions about the energetic effects which contribute to the BL Lac phenomenon. I also suggest an extension of the BL Lac definition to objects with a calcium break up to 40%, but do not support for the HBL the idea of allowing emission lines in the spectra of BL Lac galaxies. A way to find high redshift BL Lac objects might be the identification of faint X-ray sources (e.g. from the ROSAT All-Sky Survey) with neither optical nor radio counterpart in prominent databases (e.g. POSS plates for the optical, and NVSS/FIRST radio catalogues). The Seyfert II survey on the southern hemisphere derived a sample of 29 galaxies with 22 in a complete sample. The selection procedure developed in this work is able to select Seyfert II candidates with a success rate of ~40%. The Seyfert II galaxies outnumber the Seyfert I by a factor of 3...4 when comparing the total flux of the objects, but are less numerous than the type I objects when studying the core luminosity function. This luminosity function of the Seyfert II cores is the first one presented up to now. Hence it is possible to estimate the number of luminous Type II AGN, and the conclusion is drawn that absorbed AGN with MV < -28 mag might not exist within the universe. In 25 % of the Seyfert II galaxies I find evidence for merging events. In collaboration with Roberto Della Ceca I also showed that it is possible to find Type II AGN by selecting "hard" X-ray sources. I present a prototype of a Type II AGN found within this project. This work might be the basis to explore the universe for rare objects like BL Lacs and Seyfert II galaxies at higher redshifts. This could give an answer to the question: Whether there are BL Lac objects at redshifts z >> 1 and Type II Quasars or not. In summary the AGN phenomenon appears to be linked closely to merging and interacting events. For the BL Lac phenomenon the merging area seems to form the progenitor, while the Seyfert II phenomenon could be triggered by merging events. The role of star burst activity in terms of activity of the central engine remains illusive.
Optical and radio properties of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Stocke, J. T.; Liebert, J.; Schmidt, G.; Gioia, I. M.; Maccacaro, T.
1985-01-01
The eight BL Lac objects from the HEAO 1 A-2 all-sky survey and from the Einstein medium-sensitivity survey (MSS) form a flux-limited complete X-ray selected sample. The optical and radio properties of the MSS BL Lac objects are presented and compared with those of the HEAO 1 A-2 sample and with those of radio-selected BL Lac objects. The X-ray selected BL Lac objects possess smaller polarized fractions and less violent optical variability than radio-selected BL Lac objects. These properties are consistent with the substantial starlight fraction seen in the optical spectra of a majority of these objects. This starlight allows a determination of definite redshifts for two of four MSS BL Lac objects and a probable redshift for a third. These redshifts are 0.2, 0.3, and 0.6. Despite the differences in characteristics between the X-ray selected and radio-selected samples, it is concluded that these eight objects possess most of the basic qualities of BL Lac objects and should be considered members of that class. Moreover, as a class, these X-ray selected objects have the largest ratio of X-ray to optical flux of any active galactic nuclei yet discovered.
Radio constraints on the nature of BL Lacertae objects and their parent population
NASA Technical Reports Server (NTRS)
Kollgaard, R. I.; Wardle, J. F. C.; Roberts, D. H.; Gabuzda, D. C.
1992-01-01
5 GHz VLA observations of 17 BL Lac objects with bright radio cores at both high and low resolution are reported. Extended emission is detected around most objects. None of the sources observed at low resolution show evidence of giant halos on the scale of tens of arcmin. In general, the sources with the most luminous extended emission exhibit FR II characteristics in both morphology and polarization, and less luminous sources exhibit FR I characteristics. Thus, the parent population of the BL Lac objects contains both FR I and FR II radio sources. No BL Lac objects are found that clearly exhibit quasarlike polarization at milliarcsec resolution. This argues against the view that the more luminous BL Lac objects are simply an extension of the quasar/OVV population, or that most BL Lac objects are gravitationally microlensed images of distant quasars. Other properties are generally consistent with the view the BL Lac objects are normal radio galaxies whose jets make a small angle to the line of sight.
NASA Astrophysics Data System (ADS)
Landt, H.; Padovani, P.
1999-12-01
In the optical wavelength range the distinction between a radio galaxy and a BL Lac object is mainly based on the Ca II H and K break observed in the optical spectrum. Marchã et al. (1996, MNRAS, 281, 425) have expanded on the previously used division by suggesting objects with Ca II break values lower than 0.4 to be classified as BL Lacs and sources with values higher than 0.4 to be classified as galaxies. We present new evidence that there is a smooth transition between BL Lac objects and Fanaroff-Riley type I radio galaxies. We find an increase in X-ray and radio core luminosity as the Ca II break gets more and more diluted. This suggests that the only difference between BL Lac objects and their parent population lies in orientation. The closer the jet of the radio galaxy to the observer's line of sight, the more its luminosity gets amplified and the object becomes BL Lac-like. We will address the question of the BL Lac parent population and will propose to unify the beamed and unbeamed objects in nomenclature.
X-Ray Variability of BL Lac Objects
NASA Astrophysics Data System (ADS)
McHardy, Ian
I present an overview of the X-ray temporal and spectral variability of BL Lacs on both short and long timescales. The previously observed behaviour of short (~days) flares superimposed on a relatively steady `quiescent' level is still broadly correct. However, for the brighter BL Lacs, the well sampled lightcurves from the RXTE ASM show that the `quiescent' level also varies considerably on timescales of ~100 days in a manner similar to that seen in Optically Violently Variable Quasars (OVVs) such as 3C279 and 3C273. Possible reasons for this behaviour are discussed. For the large majority of BL Lacs the soft and medium energy X-ray bands are dominated by synchrotron emission and, unlike the case of OVVs, the emission mechanism is not in doubt. Most interest then centres on the structure of the emitting region, and the electron acceleration processes, particularly during outbursts. That structure, and the acceleration processes, can be investigated by consideration of the spectral variability during flares, which is not simple. I review the observations of spectral variability and consider the evidence for and against homogeneous models. I also briefly compare the X-ray spectral variability of BL Lacs with that of OVVs such as 3C273.
The cosmic evolution of Fermi BL lacertae objects
Ajello, M.; Romani, R. W.; Gasparrini, D.; ...
2013-12-13
Fermi has provided the largest sample of γ-ray-selected blazars to date. We use a uniformly selected set of 211 BL Lacertae (BL Lac) objects detected by Fermi during its first year of operation. We obtained redshift constraints for 206 out of the 211 BL Lac objects in our sample, making it the largest and most complete sample of BL Lac objects available in the literature. We use this sample to determine the luminosity function of BL Lac objects and its evolution with cosmic time. Here, we find that for most BL Lac classes the evolution is positive, with a space density peaking at modest redshift (z ≈ 1.2). Low-luminosity, high-synchrotron-peaked (HSP) BL Lac objects are an exception, showing strong negative evolution, with number density increasing for z lesssim 0.5. Since this rise corresponds to a drop-off in the density of flat-spectrum radio quasars (FSRQs), a possible interpretation is that these HSPs represent an accretion-starved end state of an earlier merger-driven gas-rich phase. Additionally, we find that the known BL Lac correlation between luminosity and photon spectral index persists after correction for the substantial observational selection effects with implications for the so-called "blazar sequence." Finally, by estimating the beaming corrections to the luminosity function, we find that BL Lac objects have an average Lorentz factor ofmore » $$\\gamma =6.1^{+1.1}_{-0.8}$$, and that most are seen within 10° of the jet axis.« less
A Search for Low-Luminosity BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Rector, Travis A.; Stocke, John T.; Perlman, Eric S.
1999-05-01
Many properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis, whereby BL Lacs are FR 1 radio galaxies viewed nearly along the jet axis. However, a possible problem with this model is that a transition population between beamed BL Lacs and unbeamed FR 1 galaxies has not been detected. A transition population of ``low-luminosity BL Lacs'' was predicted to exist in abundance in X-ray-selected samples such as the Einstein Extended Medium Sensitivity Survey (EMSS) by Browne & Marcha. However, these BL Lacs may have been misidentified as clusters of galaxies. We have conducted a search for such objects in the EMSS with the ROSAT High-Resolution Imager (HRI) here we present ROSAT HRI images, optical spectra, and VLA radio maps for a small number of BL Lacs that were previously misidentified in the EMSS catalog as clusters of galaxies. While these objects are slightly lower in luminosity than other EMSS BL Lacs, their properties are too similar to the other BL Lacs in the EMSS sample to ``bridge the gap'' between BL Lacs and FR 1 radio galaxies. Also, the number of new BL Lacs found is too low to alter significantly the X-ray luminosity function or
The intraday variability in the radio-selected and X-ray-selected BL Lacertae objects
NASA Astrophysics Data System (ADS)
Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.
1998-10-01
Seven BL Lac objects have been photometrically observed in an effort to study the difference of optical intraday variability between the radio-selected BL Lac objects (RBLs) and X-ray-selected BL Lac objects (XBLs). The objects we observed are selected arbitrarily. They are four RBLs, PKS 0735+178, PKS 0754+101, OJ 287 and BL Lac, and three XBLs, H 0323+022, H 0548-322 and H 2154-304. During the observation all of them exhibited microvariation, and H 0323+022 and H 0548-322 sometimes showed brightness oscillation. PKS 0735+178 and BL Lac were in their faint states and not very active. It seems that RBLs do not show microvariability more frequently than XBLs. Table 2 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5)
Glaser, Tina; Dickel, Nina; Liersch, Benjamin; Rees, Jonas; Süssenbach, Philipp; Bohner, Gerd
2015-08-01
The authors propose a framework distinguishing two types of lateral attitude change (LAC): (a) generalization effects, where attitude change toward a focal object transfers to related objects, and (b) displacement effects, where only related attitudes change but the focal attitude does not change. They bring together examples of LAC from various domains of research, outline the conditions and underlying processes of each type of LAC, and develop a theoretical framework that enables researchers to study LAC more systematically in the future. Compared with established theories of attitude change, the LAC framework focuses on lateral instead of focal attitude change and encompasses both generalization and displacement. Novel predictions and designs for studying LAC are presented. © 2014 by the Society for Personality and Social Psychology, Inc.
Lee, Jung-Kul; Pan, Cheol-Ho
2013-01-01
D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26), which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD), catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi). Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays. PMID:24015281
The flaring activity of Markarian 421 during April 2000
NASA Astrophysics Data System (ADS)
Fegan, D. J.; VERITAS Collaboration
2001-08-01
Evidence for correlated TeV γ and X-ray flaring of the extreme blazar Mrk421 during April 2000 is presented and discussed. The remarkably persistent TeV flare of April 30th 2000 (40 σ significance), exhibiting structure over almost six hours of continuous observation, is analysed in detail. 1 Extreme BL Lac objects The most extreme members of the Active Galactic Nucleus (AGN) family are BL Lac objects and optically violently variable (OVV) quasars, collectively known as blazars. These objects are dominated by the presence of relativistic jets. For jets fortuitously aligned with an observers line of sight, emission may exhibit dramatic variability over very short time scales, in turn implying remarkably compact emission regions. For blazars, the Spectral Energy Distribution (SED) is dominated by non-thermal continuum emission, extending from radio to TeV gamma rays. The broadband nature of the blazar emission offers unique insights into energetic physical processes at work in a very compact region, close to the base of the jet and near the underlying central engine, most likely a supermassive black hole. BL Lacs are very effectively characterized on the basis of their SED shape. X-ray and radio flux limited surveys apear to display a bimodal distribution of properties, with LBL (Low-energy peaked, or "Red" BL Lacs) having synchrotron peaks in the IR-optical bands, and HBL (High-energy peaked, or "Blue" BL Lacs) in the UV to soft X-ray band. Recent comprehensive surveys such as DXRBS, REX and RGB have extended, by almost two orders of magnitude, the range of observable synchrotron peak frequencies. For blazar class objects, broadband emission confirms that the synchrotron peak may span the entire IR Xray range, thus accounting for the multi-frequency emission properties of this class of object. Mrk421, Mrk501, 1ES2344 and 1H1426 all exhibit broadband emission properties, high
The Discovery of Low-Luminosity BL Lacs
NASA Astrophysics Data System (ADS)
Rector, Travis A.; Stocke, John T.
1995-12-01
Many of the properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis whereby BL Lacs are ``highly beamed'' FR-I radio galaxies (i.e. our line of sight to these objects is nearly along the jet axis). Further, radio-selected BL Lacs (RBLs) are believed to be seen nearly ``on-axis'' (the line-of-sight angle theta ~ 8deg ) while X-ray selected BL Lacs (XBLs) are seen at larger angles (theta ~ 30deg ; the X-ray emitting jet is believed to be less collimated). However, a major problem with this model was that a transition population between beamed BL Lacs and unbeamed FR-Is had not been detected. Low-luminosity BL Lacs may be such a transition population, and were predicted to exist by Browne and Marcha (1993). We present ROSAT HRI images, VLA radio maps and optical spectra which confirm the existence of low-luminosity BL Lacs, objects which were previously mis-identified in the EMSS catalog as clusters of galaxies. Thus our results strengthen the relativistic beaming hypothesis.
Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T
2016-10-01
Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Low-luminosity Blazars in Wise: A Mid-infrared View of Unification
NASA Astrophysics Data System (ADS)
Plotkin, Richard M.; Anderson, S. F.; Brandt, W. N.; Markoff, S.; Shemmer, O.; Wu, J.
2012-01-01
We use the preliminary data release from the Wide-Field Infrared Survey Explorer (WISE) to perform the first statistical study on the mid-infrared (IR) properties of a large number ( 102) of BL Lac objects -- low-luminosity Active Galactic Nuclei (AGN) with a jet beamed toward the Earth. As expected, many BL Lac objects are so highly beamed that their jet synchrotron emission dominates their IR spectral energy distributions (SEDs), and the shape of their SEDs in the IR correlates well with SED peak frequency. In other BL Lac objects, the jet is not strong enough to completely dilute the rest of the AGN, and we do not see observational signatures of the dusty torus from these weakly beamed BL Lac objects. While at odds with simple unification, the missing torus is consistent with recent suggestions that BL Lac objects are fed by radiatively inefficient accretion flows. We discuss implications on the ``nature vs. nurture" debate for FR I and FR II galaxies, and also on the standard orientation-based AGN unification model.
HESS J1943+213: A Non-classical High-frequency-peaked BL Lac Object
NASA Astrophysics Data System (ADS)
Straal, S. M.; Gabányi, K. É.; van Leeuwen, J.; Clarke, T. E.; Dubner, G.; Frey, S.; Giacani, E.; Paragi, Z.
2016-05-01
HESS J1943+213 is an unidentified TeV source that is likely a high-frequency-peaked BL Lac (HBL) object, but that is also compatible with a pulsar wind nebula (PWN) nature. Each of these enormously different astronomical interpretations is supported by some of the observed unusual characteristics. In order to finally classify and understand this object, we took a three-pronged approach, through time-domain, high angular resolution, and multi-frequency radio studies. First, our deep time-domain observations with the Arecibo telescope failed to uncover the putative pulsar powering the proposed PWN. We conclude with ˜70% certainty that HESS J1943+213 does not host a pulsar. Second, long-baseline interferometry of the source with e-MERLIN at 1.5 and 5 GHz shows only a core, that is, a point source at ˜ 1-100 mas resolution. Its 2013 flux density is about one-third lower than that detected in the 2011 observations with similar resolution. This radio variability of the core strengthens the HBL object hypothesis. Third, additional evidence against the PWN scenario comes from the radio spectrum we compiled. The extended structure follows a power-law behavior with spectral index α \\=\\-0.54+/- 0.04 while the core component displays a flat spectrum (α \\=\\-0.03+/- 0.03). In contrast, the radio synchrotron emission of PWNe predicts a single power-law distribution. Overall, we rule out the PWN hypothesis and conclude that the source is a BL Lac object. The consistently high fraction (70%) of the flux density from the extended structure then leads us to conclude that HESS J1943+213 must be a non-classical HBL object.
Photometric monitoring of three BL Lacertae objects in 1993-1998
NASA Astrophysics Data System (ADS)
Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.
1999-05-01
The results of optical photometric (BVRI) monitoring of three BL Lac objects over a time interval of about four years are presented. The sources are three classical radio-selected BL Lac objects, BL Lac, OJ 287 and PKS 0735+178. During our observation OJ 287 was in the stage of a large periodic outburst which consisted of at least two peaks. Almost all the observations obtained over consecutive nights detected intranight variations. In 1995 and 1996 BL Lac kept in faint states, with fewer and smaller rapid flares and fluctuations. On the contrary, in late 1997 BL Lac was at the stage of a large outburst, accompanied with much more large amplitude rapid flares and fluctuations. PKS 0735+178 was almost at its faint end from 1994 to early 1998. Over this time interval, the intraday variations and microvariations in PKS 0735+178 were rare and the amplitude was very small, except a rapid darkening of ~ 0.4 mag on 24 January 1995. Previous work by \\cite[Webb et al. (1988);]{web88} \\cite[Wagner et al. (1996);]{wag96} \\cite[Pian et al. (1997)]{pia97} also showed the same behaviour of variability as BL Lac and PKS 0735+178 in BL Lac, S5 0716+714, PKS 2155-304, respectively. We propose that the motion of orientation of the relativistic jet in a BL Lac object be responsible for these variability behaviours. Table~1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html
On the surface density of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Maccacaro, T.; Gioia, I. M.; Maccagni, D.; Stocke, J. T.
1984-01-01
Only a handful of BL Lac objects have been found as a result of systematic optical identification of serendipitous Einstein X-ray sources. By combining the data from two flux-limited complete X-ray surveys (the HEAO 1 A-2 and the Einstein Observatory Medium Sensitivity Survey) the surface density of X-ray emitting BL Lac objects is evaluated as a function of their X-ray flux. It is found that a single power law is not an acceptable representation of the BL Lac objects' X-ray log N-log S. The number-flux relationship is consistent with the Euclidean slope at 'high' flux levels but shows a drastic flattnring below fluxes of the order of 10 to the -12th ergs per sq cm/s. The implications of this result are briefly discussed with respect to the luminosity function, the cosmological evolution, and the X-ray to optical flux ratio in BL Lac objects.
The Cosmic Evolution of Fermi BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Ajello, Marco; Gasparrini, Dario; Romani, Roger W.; Shaw, Michael S.
2014-06-01
It has been notoriously difficult in the past to measure the cosmological evolution of BL Lacs because of the challenges related to measure their redshift. Extensive optical follow-up observations of a sample of ~200 Fermi-detected BL Lac objects have provided much-needed redshift information for many of them. This stands as the largest and most complete sample of BL Lacs available in the literature and was used to determine the cosmological properties of this elusive source class. This talk will review the cosmic evolution of BL Lacs and discuss the link to their siblings flat-spectrum radio quasars (FSRQs). Evidence suggests that BL Lacs of the high-synchrotron peaked class might be an accretion-starved end-state of an earlier merger-driven gas-rich phase.
The Radio-optical Spectra of BL Lacs and Possible Relatives
NASA Astrophysics Data System (ADS)
Dennett-Thorpe, J.
I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?
Are some BL Lac objects artefacts of gravitational lensing?
NASA Technical Reports Server (NTRS)
Ostriker, J. P.; Vietri, M.
1985-01-01
It is proposed here that a significant fraction of BL Lac objects are optically violently variable quasars whose continuum emission has been greatly amplified, relative to the line emission, by pointlike gravitational lenses in intervening galaxies. Several anomalous physical and statistical properties of BL Lacs can be understood on the basis of this model, which is immediately testable on the basis of absorption line studies and by direct imaging.
Clustering environments of BL Lac objects
NASA Technical Reports Server (NTRS)
Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.
1993-01-01
We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.
Hiblot, Julien; Bzdrenga, Janek; Champion, Charlotte; Chabriere, Eric; Elias, Mikael
2015-01-01
A new representative of the Phosphotriesterase-Like Lactonases (PLLs) family from the hyperthermophilic crenarchaeon Vulcanisaeta moutnovskia has been characterized and crystallized. VmoLac is a native, proficient lactonase with promiscuous, low phosphotriesterase activity. VmoLac therefore represents an interesting candidate for engineering studies, with the aim of developing an efficient bacterial quorum-quenching agent. Here, we provide an extensive biochemical and kinetic characterization of VmoLac and describe the X-ray structures of the enzyme bound to a fatty acid and to its cognate substrate 3-oxo-C10 AHL (Acyl-Homoserine Lactone). The structures highlight possible structural determinants that may be involved in its extreme thermal stability (Tm = 128°C). Moreover, the structure reveals that the substrate binding mode of VmoLac significantly differs from those of its close homologues, possibly explaining the substrate specificity of the enzyme. Finally, we describe the specific interactions between the enzyme and its substrate, and discuss the possible lactone hydrolysis mechanism of VmoLac. PMID:25670483
AGN jets under the microscope: A divide? Doctoral Thesis Award Lecture 2011
NASA Astrophysics Data System (ADS)
Karouzos, M.; Britzen, S.; Witzel, A.; Zensus, A. J.; Eckart, A.
2012-06-01
A new paradigm for active galactic jet kinematics has emerged through detailed investigations of BL Lac objects using very long baseline radio interferometry. In this new scheme, most, if not all, jet components appear to remain stationary with respect to the core but show significant non-radial motions. This paper presents results from our kinematic investigation of the jets of a statistically complete sample of radio-loud flat-spectrum active galaxies, focusing on the comparison between the jet kinematic properties of BL Lacs and flat-spectrum radio-quasars. It is shown that there is a statistically significant difference between the kinematics of the two AGN classes, with BL Lacs showing more bent jets, that are wider and show slower movement along the jet axis, compared to flat-spectrum radio-quasars. This is interpreted as evidence for helically structured jets.
Swigon, David; Coleman, Bernard D.; Olson, Wilma K.
2006-01-01
Repression of transcription of the Escherichia coli Lac operon by the Lac repressor (LacR) is accompanied by the simultaneous binding of LacR to two operators and the formation of a DNA loop. A recently developed theory of sequence-dependent DNA elasticity enables one to relate the fine structure of the LacR–DNA complex to a wide range of heretofore-unconnected experimental observations. Here, that theory is used to calculate the configuration and free energy of the DNA loop as a function of its length and base-pair sequence, its linking number, and the end conditions imposed by the LacR tetramer. The tetramer can assume two types of conformations. Whereas a rigid V-shaped structure is observed in the crystal, EM images show extended forms in which two dimer subunits are flexibly joined. Upon comparing our computed loop configurations with published experimental observations of permanganate sensitivities, DNase I cutting patterns, and loop stabilities, we conclude that linear DNA segments of short-to-medium chain length (50–180 bp) give rise to loops with the extended form of LacR and that loops formed within negatively supercoiled plasmids induce the V-shaped structure. PMID:16785444
Time-dependent inhomogeneous jet models for BL Lac objects
NASA Technical Reports Server (NTRS)
Marlowe, A. T.; Urry, C. M.; George, I. M.
1992-01-01
Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.
Time-dependent inhomogeneous jet models for BL Lac objects
NASA Astrophysics Data System (ADS)
Marlowe, A. T.; Urry, C. M.; George, I. M.
1992-05-01
Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.
Are some BL Lacs artefacts of gravitational lensing?
Ostriker, J P; Vietri, M
1990-03-01
WE suggested in 1985 that a significant fraction of BL Lacertae objects, a kind of lineless quasar, seen in nearby galaxies are in fact images, gravitationally lensed and substantially amplified by stars in the nearby galaxy, of background objects, optically violent variable (OVV) quasars at redshifts z > 1 (ref. 1). This hypothesis was made on the basis of certain general similarities between BL Lacs and O Ws, but for two recently observed BL Lacs(2,3) a strong case can be made that the accompanying elliptical galaxy is a foreground object. In addition, we argue that the distribution of BL Lac redshifts is hard to understand without gravitational lensing, unless we happen to be at a very local maximum of the spatial cosmic distribution of BL Lacs. Our analysis also indicates that the galaxies whose stars are likely to act as microlenses will be found in two peaks, one nearby, with redshift 0.05-0.10, and the other near the distant quasar.
NASA Technical Reports Server (NTRS)
Stocke, John; Perlman, Eric; Granados, Arno; Schachter, Jonathan; Elvis, Martin; Urry, Meg; Impey, Chris; Smith, Paul
1993-01-01
We present a new, efficient method for discovering new BL Lac Objects based upon the results of the Einstein Extended Medium Sensitivity Survey (EMSS). We have found that all x-ray selected BL Lacs are radio emitters, and further, that in a 'color-color' diagram (radio/optical and optical/x-ray) the BL Lac Objects occupy an area distinct from both radio loud quasars and the radio quiet QSOs and Seyferts which dominate x-ray selected samples. After obtaining radio counterparts via VLA 'snapshot' observations of a large sample of unidentified x-ray sources, the list of candidates is reduced. These candidates then can be confirmed with optical spectroscopy and/or polarimetry. Since greater than 70 percent of these sources are expected to be BL Lacs, the optical observations are very efficient. We have tested this method using unidentified sources found in the Einstein Slew Survey. The 162 Slew Survey x-ray source positions were observed with the VLA in a mixed B/C configuration at 6 cm resulting in 60 detections within 1.5 position error circle radii. These x-ray/optical/radio sources were then plotted, and 40 BL Lac candidates were identified. To date, 10 candidates have been spectroscopically observed resulting in 10 new BL Lac objects! Radio flux, optical magnitude, and polarization statistics (obtained in white light with the Steward Observatory 2.3 m CCD polarimeter) for each are given.
Preparation of a Ammonia-Treated Lac Dye and Structure Elucidation of Its Main Component.
Nishizaki, Yuzo; Ishizuki, Kyoko; Akiyama, Hiroshi; Tada, Atsuko; Sugimoto, Naoki; Sato, Kyoko
2016-01-01
Lac dye and cochineal extract contain laccaic acids and carminic acid as the main pigments, respectively. Both laccaic acids and carminic acid are anthraquinone derivatives. 4-Aminocarminic acid (acid-stable carmine), an illegal colorant, has been detected in several processed foods. 4-Aminocarminic acid is obtained by heating cochineal extract (carminic acid) in ammonia solution. We attempted to prepare ammonia-treated lac dye and to identify the structures of the main pigment components. Ammonia-treated lac dye showed acid stability similar to that of 4-aminocarminic acid. The structures of the main pigments in ammonia-treated lac dye were analyzed using LC/MS. One of the main pigments was isolated and identified as 4-aminolaccaic acid C using various NMR techniques, including 2D-INADEQUATE. These results indicated that ammonia-treatment of lac dye results in the generation of 4-aminolaccaic acids.
Structural dynamics of the lac repressor-DNA complex revealed by a multiscale simulation.
Villa, Elizabeth; Balaeff, Alexander; Schulten, Klaus
2005-05-10
A multiscale simulation of a complex between the lac repressor protein (LacI) and a 107-bp-long DNA segment is reported. The complex between the repressor and two operator DNA segments is described by all-atom molecular dynamics; the size of the simulated system comprises either 226,000 or 314,000 atoms. The DNA loop connecting the operators is modeled as a continuous elastic ribbon, described mathematically by the nonlinear Kirchhoff differential equations with boundary conditions obtained from the coordinates of the terminal base pairs of each operator. The forces stemming from the looped DNA are included in the molecular dynamics simulations; the loop structure and the forces are continuously recomputed because the protein motions during the simulations shift the operators and the presumed termini of the loop. The simulations reveal the structural dynamics of the LacI-DNA complex in unprecedented detail. The multiple domains of LacI exhibit remarkable structural stability during the simulation, moving much like rigid bodies. LacI is shown to absorb the strain from the looped DNA mainly through its mobile DNA-binding head groups. Even with large fluctuating forces applied, the head groups tilt strongly and keep their grip on the operator DNA, while the remainder of the protein retains its V-shaped structure. A simulated opening of the cleft of LacI by 500-pN forces revealed the interactions responsible for locking LacI in the V-conformation.
Sousa, Filipa L; Parente, Daniel J; Shis, David L; Hessman, Jacob A; Chazelle, Allen; Bennett, Matthew R; Teichmann, Sarah A; Swint-Kruse, Liskin
2016-02-22
Protein families evolve functional variation by accumulating point mutations at functionally important amino acid positions. Homologs in the LacI/GalR family of transcription regulators have evolved to bind diverse DNA sequences and allosteric regulatory molecules. In addition to playing key roles in bacterial metabolism, these proteins have been widely used as a model family for benchmarking structural and functional prediction algorithms. We have collected manually curated sequence alignments for >3000 sequences, in vivo phenotypic and biochemical data for >5750 LacI/GalR mutational variants, and noncovalent residue contact networks for 65 LacI/GalR homolog structures. Using this rich data resource, we compared the noncovalent residue contact networks of the LacI/GalR subfamilies to design and experimentally validate an allosteric mutant of a synthetic LacI/GalR repressor for use in biotechnology. The AlloRep database (freely available at www.AlloRep.org) is a key resource for future evolutionary studies of LacI/GalR homologs and for benchmarking computational predictions of functional change. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fermi LAT detection of a GeV flare from the BL Lac object PKS 2233-148
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2012-06-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2233-148 (also known as 2FGL J2236.5-1431, Nolan et al. 2012, ApJS, 199, 31, and OY -156) placed at R.A.: 339.1420296 deg, Dec.: -14.5561633 (J2000, Petrov et al. 2008, AJ, 136, 580). No redshift for the source has been measured up to now, demonstrating the BL Lac object character type of this source.
NASA Technical Reports Server (NTRS)
Stocke, John T.
1998-01-01
This grant has contributed to one of the original goals of the NAS/LTSA program, the goal of junior faculty development. Below I briefly summarize the following major results on BL Lacertae Objects that we have obtained. An invited talk on BL Lac Objects at IAU 175 "Extragalactic Radio Sources" at Bologna Italy in October 1995 summarized some of these results. A second invited talk in Oct 1998 at Green Bamk, WVA presented other BL Lac results at the conference entitled: "Highly Redshifted Radio Lines". We have used the EMSS sample to measure the X-ray luminosity function and cosmological evolution of BL Lacs. A new large sample of XBLs has been discovered.
The REX survey as a Tool to Test the Beaming Model for BL Lacs
NASA Astrophysics Data System (ADS)
Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.
We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.
Program Evaluation of Community College Learning Assistance Centers: What Do LAC Directors Think?
ERIC Educational Resources Information Center
Franklin, Doug; Blankenberger, Bob
2016-01-01
Objective: This study seeks to determine the nature of current program evaluation practices for learning assistance centers (LACs), the practices being used for program evaluation, and whether LAC directors believe their practices are appropriate for evaluating program effectiveness. Method: We conducted a survey (n = 61) of community college LAC…
Optical polarimetry and photometry of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Jannuzi, Buell T.; Smith, Paul S.; Elston, Richard
1993-01-01
We present the data from 3 years of monitoring the optical polarization and apparent brightness of 37 X-ray-selected BL Lacertae objects. The monitored objects include a complete sample drawn from the Einstein Extended Medium Sensitivity Survey. We confirm the BL Lac identifications for 15 of these 22 objects. We include descriptions of the objects and samples in our monitoring program and of the existing complete samples of BL Lac objects, highly polarized quasars, optically violent variable quasars, and blazars.
Using the Markov chain Monte Carlo method to study the physical properties of GeV-TeV BL Lac objects
NASA Astrophysics Data System (ADS)
Qin, Longhua; Wang, Jiancheng; Yang, Chuyuan; Yuan, Zunli; Mao, Jirong; Kang, Shiju
2018-01-01
We fit the spectral energy distributions (SEDs) of 46 GeV-TeV BL Lac objects in the frame of leptonic one-zone synchrotron self-Compton (SSC) model and investigate the physical properties of these objects. We use the Markov chain Monte Carlo (MCMC) method to obtain the basic parameters, such as magnetic field (B), the break energy of the relativistic electron distribution (γ ^' }b), and the electron energy spectral index. Based on the modeling results, we support the following scenarios for GeV-TeV BL Lac objects. (1) Some sources have large Doppler factors, implying other radiation mechanism should be considered. (2) Compared with flat spectrum quasars (FSRQs), GeV-TeV BL Lac objects have weaker magnetic fields and larger Doppler factors, which cause the ineffective cooling and shift the SEDs to higher bands. Their jet powers are around 4.0 × 1045 erg s-1, compared with radiation power, 5.0 × 1042 erg s-1, indicating that only a small fraction of jet power is transformed into the emission power. (3) For some BL Lacs with large Doppler factors, their jet components could have two substructures, e.g., the fast core and the slow sheath. For most GeV-TeV BL Lacs, Kelvin-Helmholtz instabilities are suppressed by their higher magnetic fields, leading to micro-variability or intro-day variability in the optical bands. (4) Combined with a sample of FSRQs, an anti-correlation between the peak luminosity, Lpk, and the peak frequency, νpk, is obtained, favoring the blazar sequence scenario. In addition, an anti-correlation between the jet power, Pjet, and the break Lorentz factor, γb, also supports the blazar sequence.
NASA Technical Reports Server (NTRS)
Rau, A.; Schady, P.; Greiner, J.; Salvato, M.; Ajello, M.; Bottacini, E.; Gehrels, N.; Afonso, P. M. J.; Elliott, J.; Filgas, R.;
2011-01-01
Context. Observations of the gamma-ray sky with Fermi led to significant advances towards understanding blazars, the most extreme class of Active Galactic Nuclei. A large fraction of the population detected by Fermi is formed by BL Lacertae (BL Lac) objects, whose sample has always suffered from a severe redshift incompleteness due to the quasi-featureless optical spectra. Aims. Our goal is to provide a significant increase of the number of confirmed high-redshift BL Lac objects contained in the 2 LAC Fermi/LAT catalog. Methods. For 103 Fermi/LAT blazars, photometric redshifts using spectral energy distribution fitting have been obtained. The photometry includes 13 broad-band filters from the far ultraviolet to the near-IR observed with Swift/UVOT and the multi-channel imager GROND at the MPG/ESO 2.2m telescope. Data have been taken quasi-simultaneously and the remaining source-intrinsic variability has been corrected for. Results. We release the UV-to-near-IR 13-band photometry for all 103 sources and provide redshift constraints for 75 sources without previously known redshift. Out of those, eight have reliable photometric redshifts at z > or approx. 1.3, while for the other 67 sources we provide upper limits. Six of the former eight are BL Lac objects, which quadruples the sample of confirmed high-redshift BL Lac. This includes three sources with redshifts higher than the previous record for BL Lac, including CRATES J0402-2615, with the best-fit solution at z approx. = 1.9.
Active galaxies observed during the Extreme Ultraviolet Explorer all-sky survey
NASA Technical Reports Server (NTRS)
Marshall, H. L.; Fruscione, A.; Carone, T. E.
1995-01-01
We present observations of active galactic nuclei (AGNs) obtained with the Extreme Ultraviolet Explorer (EUVE) during the all-sky survey. A total of 13 sources were detected at a significance of 2.5 sigma or better: seven Seyfert galaxies, five BL Lac objects, and one quasar. The fraction of BL Lac objects is higher in our sample than in hard X-ray surveys but is consistent with the soft X-ray Einstein Slew Survey, indicating that the main reason for the large number of BL Lac objects in the extreme ulktraviolet (EUV) and soft X-ray bands is their steeper X-ray spectra. We show that the number of AGNs observed in both the EUVE and ROSAT Wide Field Camera surveys can readily be explained by modelling the EUV spectra with a simple power law in the case of BL Lac objects and with an additional EUV excess in the case of Seyferts and quasars. Allowing for cold matter absorption in Seyfert galaxy hosts drive up the inferred average continuum slope to 2.0 +/- 0.5 (at 90% confidence), compared to a slope of 1.0 usually found from soft X-ray data. If Seyfert galaxies without EUV excesses form a significant fraction of the population, then the average spectrum of those with bumps should be even steeper. We place a conservative limit on neutral gas in BL Lac objects: N(sub H) less than 10(exp 20)/sq cm.
Polarimetry of optically selected BL Lacertae candidates from the SDSS
NASA Astrophysics Data System (ADS)
Heidt, J.; Nilsson, K.
2011-05-01
We present and discuss polarimetric observations of 182 targets drawn from an optically selected sample of 240 probable BL Lac candidates out of the SDSS compiled by Collinge et al. (2005, AJ, 129, 2542). In contrast to most other BL Lac candidate samples extracted from the SDSS, its radio- and/or X-ray properties have not been taken into account for its derivation. Thus, because its selection is based on optical properties alone, it may be less prone to selection effects inherent in other samples derived at different frequencies, so it offers a unique opportunity to extract the first unbiased BL Lac luminosity function that is suitably large in size. We found 124 out of 182 targets (68%) to be polarized, 95 of the polarized targets (77%) to be highly polarized (>4%). The low-frequency peaked BL Lac candidates in the sample are on average only slightly more polarized than the high-frequency peaked ones. Compared to earlier studies, we found a high duty cycle in high polarization (˜ 66+2-14% to be >4% polarized) in high-frequency peaked BL Lac candidates. This may come from our polarization analysis, which minimizes the contamination by host galaxy light. No evidence of radio-quiet BL Lac objects in the sample was found. Our observations show that the probable sample of BL Lac candidates of Collinge et al. (2005) indeed contains a large number of bona fide BL Lac objects. High S/N spectroscopy and deep X-ray observations are required to construct the first luminosity function of optically selected BL Lac objects and to test more stringently for any radio-quiet BL Lac objects in the sample. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory in the course of the observing proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Andalucia (CSIC).Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway, and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.Table 1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/529/A162
NASA Astrophysics Data System (ADS)
Master, Sharad
2010-11-01
Lac Télé is a large lake, ˜5.6 km in diameter, with an ovoid shape, situated at 17°10'E, 1°20'N, in the great tropical rain forest region of the Republic of Congo. This lake has attracted widespread attention, mainly because of the legends among the local people that it harbours a strange animal known as the Mokele-Mbembe, but also because it is situated in a region that is a hotbed of biodiversity and conservation efforts with respect to various endangered mammalian species, including gorillas and chimpanzees. Because of its appearance, Lac Télé has been regarded as a possible meteorite impact structure. Various expeditions, studying cryptozoology, conservation ecology, biodiversity, and the impact hypothesis, have visited Lac Télé in the past several decades. The Lac Télé structure is located in the NW part of the intracratonic Congo Basin, in a region dominated by Holocene alluvium, dense tropical rain forest, and swamps which form part of the basin of the Likouala aux Herbes, a multi-branched meandering river flowing over very low gradients into the Sangha river, a major tributary of the Congo river. Previous bathymetric studies have shown that the average depth of Lac Télé is only 4 m, including organic-rich silty sediments. The structure is that of a flat-bottomed dish. Modelling of the Lac Télé as an impact structure indicates a number of features which ought to be present. The absence of any of these features, coupled with the irregular ovoid shape, the palynological record, and the location of the structure at the intersection of major regional lineaments, is regarded as evidence against the impact hypothesis. Lac Télé as an isolated lake ecosystem is not unique in the Congo Basin, and there are several other similar small shallow isolated lakes surrounded by rain forest and marshes, some of which formed by damming of drainage systems by neotectonic faults. It is suggested that the formation of Lac Télé may be related to its location over neotectonically reactivated regional lineaments, which are also seismically active. Lac Télé and other similar hydrologic systems may be biodiversity hotspots because they acted as refugia following neotectonic hydrological re-organization of the Congo Basin.
Miallau, Linda; Hunter, William N; McSweeney, Sean M; Leonard, Gordon A
2007-07-06
High resolution structures of Staphylococcus aureus d-tagatose-6-phosphate kinase (LacC) in two crystal forms are herein reported. The structures define LacC in apoform, in binary complexes with ADP or the co-factor analogue AMP-PNP, and in a ternary complex with AMP-PNP and D-tagatose-6-phosphate. The tertiary structure of the LacC monomer, which is closely related to other members of the pfkB subfamily of carbohydrate kinases, is composed of a large alpha/beta core domain and a smaller, largely beta "lid." Four extended polypeptide segments connect these two domains. Dimerization of LacC occurs via interactions between lid domains, which come together to form a beta-clasp structure. Residues from both subunits contribute to substrate binding. LacC adopts a closed structure required for phosphoryl transfer only when both substrate and co-factor are bound. A reaction mechanism similar to that used by other phosphoryl transferases is proposed, although unusually, when both substrate and co-factor are bound to the enzyme two Mg(2+) ions are observed in the active site. A new motif of amino acid sequence conservation common to the pfkB subfamily of carbohydrate kinases is identified.
γ-Ray and Parsec-scale Jet Properties of a Complete Sample of Blazars From the MOJAVE Program
NASA Astrophysics Data System (ADS)
Lister, M. L.; Aller, M.; Aller, H.; Hovatta, T.; Kellermann, K. I.; Kovalev, Y. Y.; Meyer, E. T.; Pushkarev, A. B.; Ros, E.; MOJAVE Collaboration; Ackermann, M.; Antolini, E.; Baldini, L.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bechtol, K.; Bellazzini, R.; Berenji, B.; Blandford, R. D.; Bloom, E. D.; Boeck, M.; Bonamente, E.; Borgland, A. W.; Bregeon, J.; Brigida, M.; Bruel, P.; Buehler, R.; Buson, S.; Caliandro, G. A.; Cameron, R. A.; Caraveo, P. A.; Casandjian, J. M.; Cavazzuti, E.; Cecchi, C.; Chang, C. S.; Charles, E.; Chekhtman, A.; Cheung, C. C.; Chiang, J.; Ciprini, S.; Claus, R.; Cohen-Tanugi, J.; Conrad, J.; Cutini, S.; de Palma, F.; Dermer, C. D.; Silva, E. do Couto e.; Drell, P. S.; Drlica-Wagner, A.; Favuzzi, C.; Fegan, S. J.; Ferrara, E. C.; Finke, J.; Focke, W. B.; Fortin, P.; Fukazawa, Y.; Fusco, P.; Gargano, F.; Gasparrini, D.; Gehrels, N.; Germani, S.; Giglietto, N.; Giordano, F.; Giroletti, M.; Glanzman, T.; Godfrey, G.; Grenier, I. A.; Guiriec, S.; Hadasch, D.; Hayashida, M.; Hays, E.; Horan, D.; Hughes, R. E.; Jóhannesson, G.; Johnson, A. S.; Kadler, M.; Katagiri, H.; Kataoka, J.; Knödlseder, J.; Kuss, M.; Lande, J.; Longo, F.; Loparco, F.; Lott, B.; Lovellette, M. N.; Lubrano, P.; Madejski, G. M.; Mazziotta, M. N.; McConville, W.; McEnery, J. E.; Mehault, J.; Michelson, P. F.; Mizuno, T.; Monte, C.; Monzani, M. E.; Morselli, A.; Moskalenko, I. V.; Murgia, S.; Naumann-Godo, M.; Nishino, S.; Nolan, P. L.; Norris, J. P.; Nuss, E.; Ohno, M.; Ohsugi, T.; Okumura, A.; Omodei, N.; Orlando, E.; Ozaki, M.; Paneque, D.; Parent, D.; Pesce-Rollins, M.; Pierbattista, M.; Piron, F.; Pivato, G.; Rainò, S.; Readhead, A.; Reimer, A.; Reimer, O.; Richards, J. L.; Ritz, S.; Sadrozinski, H. F.-W.; Sgrò, C.; Shaw, M. S.; Siskind, E. J.; Spandre, G.; Spinelli, P.; Takahashi, H.; Tanaka, T.; Thayer, J. G.; Thayer, J. B.; Thompson, D. J.; Tosti, G.; Tramacere, A.; Troja, E.; Usher, T. L.; Vandenbroucke, J.; Vasileiou, V.; Vianello, G.; Vitale, V.; Waite, A. P.; Wang, P.; Winer, B. L.; Wood, K. S.; Zimmer, S.; Fermi LAT Collaboration
2011-11-01
We investigate the Fermi Large Area Telescope γ-ray and 15 GHz Very Long Baseline Array radio properties of a joint γ-ray and radio-selected sample of active galactic nuclei (AGNs) obtained during the first 11 months of the Fermi mission (2008 August 4-2009 July 5). Our sample contains the brightest 173 AGNs in these bands above declination -30° during this period, and thus probes the full range of γ-ray loudness (γ-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least 4 orders of magnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing γ-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the γ-ray emission in these BL Lac objects over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED-peak-γ-ray-loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQs) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lac objects have generally lower Doppler factors than the lower-synchrotron peaked BL Lac objects or FSRQs in our sample.
{gamma}-RAY AND PARSEC-SCALE JET PROPERTIES OF A COMPLETE SAMPLE OF BLAZARS FROM THE MOJAVE PROGRAM
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lister, M. L.; Hovatta, T.; Aller, M.
We investigate the Fermi Large Area Telescope {gamma}-ray and 15 GHz Very Long Baseline Array radio properties of a joint {gamma}-ray and radio-selected sample of active galactic nuclei (AGNs) obtained during the first 11 months of the Fermi mission (2008 August 4-2009 July 5). Our sample contains the brightest 173 AGNs in these bands above declination -30 Degree-Sign during this period, and thus probes the full range of {gamma}-ray loudness ({gamma}-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least 4 orders of magnitude, reflecting a wide range of spectral energy distribution (SED)more » parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing {gamma}-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the {gamma}-ray emission in these BL Lac objects over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED-peak-{gamma}-ray-loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQs) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lac objects have generally lower Doppler factors than the lower-synchrotron peaked BL Lac objects or FSRQs in our sample.« less
Defining fire and wilderness objectives: Applying limits of acceptable change
David N. Cole
1995-01-01
The Limits of Acceptable Change (LAC) planning process was developed to help define objectives for recreation management in wilderness. This process can be applied to fire in wilderness if its conceptual foundation is broadened. LAC would lead decision makers to identify a compromise between the goal of allowing fire to play its natural role in wilderness and various...
X-Ray Spectral Variability Signatures of Flares in BL Lac Objects
NASA Technical Reports Server (NTRS)
Boettcher, Markus; Chiang, James; White, Nicholas E. (Technical Monitor)
2002-01-01
We are presenting a detailed parameter study of the time-dependent electron injection and kinematics and the self-consistent radiation transport in jets of intermediate and low-frequency peaked BL Lac objects. Using a time-dependent, combined synchrotron-self-Compton and external-Compton jet model, we study the influence of variations of several essential model parameters, such as the electron injection compactness, the relative contribution of synchrotron to external soft photons to the soft photon compactness, the electron- injection spectral index, and the details of the time profiles of the electron injection episodes giving rise to flaring activity. In the analysis of our results, we focus on the expected X-ray spectral variability signatures in a region of parameter space particularly well suited to reproduce the broadband spectral energy distributions of intermediate and low-frequency peaked BL Lac objects. We demonstrate that SSC- and external-Compton dominated models for the gamma-ray emission from blazars are producing significantly different signatures in the X-ray variability, in particular in the soft X-ray light curves and the spectral hysteresis at soft X-ray energies, which can be used as a powerful diagnostic to unveil the nature of the high-energy emission from BL Lac objects.
Soft X-Ray Observations of a Complete Sample of X-Ray--selected BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Perlman, Eric S.; Stocke, John T.; Wang, Q. Daniel; Morris, Simon L.
1996-01-01
We present the results of ROSAT PSPC observations of the X-ray selected BL Lacertae objects (XBLs) in the complete Einstein Extended Medium Sensitivity Survey (EM MS) sample. None of the objects is resolved in their respective PSPC images, but all are easily detected. All BL Lac objects in this sample are well-fitted by single power laws. Their X-ray spectra exhibit a variety of spectral slopes, with best-fit energy power-law spectral indices between α = 0.5-2.3. The PSPC spectra of this sample are slightly steeper than those typical of flat ratio-spectrum quasars. Because almost all of the individual PSPC spectral indices are equal to or slightly steeper than the overall optical to X-ray spectral indices for these same objects, we infer that BL Lac soft X-ray continua are dominated by steep-spectrum synchrotron radiation from a broad X-ray jet, rather than flat-spectrum inverse Compton radiation linked to the narrower radio/millimeter jet. The softness of the X-ray spectra of these XBLs revives the possibility proposed by Guilbert, Fabian, & McCray (1983) that BL Lac objects are lineless because the circumnuclear gas cannot be heated sufficiently to permit two stable gas phases, the cooler of which would comprise the broad emission-line clouds. Because unified schemes predict that hard self-Compton radiation is beamed only into a small solid angle in BL Lac objects, the steep-spectrum synchrotron tail controls the temperature of the circumnuclear gas at r ≤ 1018 cm and prevents broad-line cloud formation. We use these new ROSAT data to recalculate the X-ray luminosity function and cosmological evolution of the complete EMSS sample by determining accurate K-corrections for the sample and estimating the effects of variability and the possibility of incompleteness in the sample. Our analysis confirms that XBLs are evolving "negatively," opposite in sense to quasars, with Ve/Va = 0.331±0.060. The statistically significant difference between the
Rosey, E L; Oskouian, B; Stewart, G C
1991-01-01
The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose 6-phosphate pathway enzymes utilizing galactose 6-phosphate or fructose phosphate analogs as substrate, is described. Expression of both lacA and lacB was required for galactose 6-phosphate isomerase activity. LacC (34 kDa) demonstrated tagatose 6-phosphate kinase activity and was found to share significant homology with LacC from Lactococcus lactis and with both the minor 6-phosphofructokinase (PfkB) and 1-phosphofructokinase (FruK) from E. coli. Detection of tagatose 1,6-bisphosphate aldolase activity was dependent on expression of the 36-kDa protein specified by lacD. The LacD protein is highly homologous with LacD of L. lactis. Thus, the lacABCD genes comprise the tagatose 6-phosphate pathway and are cotranscribed with genes lacFEG, which specify proteins for transport and cleavage of lactose in S. aureus. PMID:1655695
Properties of optically selected BL Lacertae candidates from the SDSS
NASA Astrophysics Data System (ADS)
Kügler, S. D.; Nilsson, K.; Heidt, J.; Esser, J.; Schultz, T.
2014-09-01
Context. Deep optical surveys open the avenue for finding large numbers of BL Lac objects that are hard to identify because they lack the unique properties classifying them as such. While radio or X-ray surveys typically reveal dozens of sources, recent compilations based on optical criteria alone have increased the number of BL Lac candidates considerably. However, these compilations are subject to biases and may contain a substantial number of contaminating sources. Aims: In this paper we extend our analysis of 182 optically selected BL Lac object candidates from the SDSS with respect to an earlier study. The main goal is to determine the number of bona fide BL Lac objects in this sample. Methods: We examine their variability characteristics, determine their broad-band radio-UV spectral energy distributions (SEDs), and search for the presence of a host galaxy. In addition we present new optical spectra for 27 targets with improved signal-to-noise ratio with respect to the SDSS spectra. Results: At least 59% of our targets have shown variability between SDSS DR2 and our observations by more than 0.1-0.27 mag depending on the telescope used. A host galaxy was detected in 36% of our targets. The host galaxy type and luminosities are consistent with earlier studies of BL Lac host galaxies. Simple fits to broad-band SEDs for 104 targets of our sample derived synchrotron peak frequencies between 13.5 ≤ log 10(νpeak) ≤ 16 with a peak at log 10 ~ 14.5. Our new optical spectra do not reveal any new redshift for any of our objects. Thus the sample contains a large number of bona fide BL Lac objects and seems to contain a substantial fraction of intermediate-frequency peaked BL Lacs. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory under proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Canarias.Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway, and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.
THE SECOND CATALOG OF ACTIVE GALACTIC NUCLEI DETECTED BY THE FERMI LARGE AREA TELESCOPE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ackermann, M.; Ajello, M.; Allafort, A.
The second catalog of active galactic nuclei (AGNs) detected by the Fermi Large Area Telescope (LAT) in two years of scientific operation is presented. The second LAT AGN catalog (2LAC) includes 1017 {gamma}-ray sources located at high Galactic latitudes (|b| > 10 Degree-Sign ) that are detected with a test statistic (TS) greater than 25 and associated statistically with AGNs. However, some of these are affected by analysis issues and some are associated with multiple AGNs. Consequently, we define a Clean Sample which includes 886 AGNs, comprising 395 BL Lacertae objects (BL Lac objects), 310 flat-spectrum radio quasars (FSRQs), 157more » candidate blazars of unknown type (i.e., with broadband blazar characteristics but with no optical spectral measurement yet), 8 misaligned AGNs, 4 narrow-line Seyfert 1 (NLS1s), 10 AGNs of other types, and 2 starburst galaxies. Where possible, the blazars have been further classified based on their spectral energy distributions (SEDs) as archival radio, optical, and X-ray data permit. While almost all FSRQs have a synchrotron-peak frequency <10{sup 14} Hz, about half of the BL Lac objects have a synchrotron-peak frequency >10{sup 15} Hz. The 2LAC represents a significant improvement relative to the first LAT AGN catalog (1LAC), with 52% more associated sources. The full characterization of the newly detected sources will require more broadband data. Various properties, such as {gamma}-ray fluxes and photon power-law spectral indices, redshifts, {gamma}-ray luminosities, variability, and archival radio luminosities and their correlations are presented and discussed for the different blazar classes. The general trends observed in 1LAC are confirmed.« less
Chandrasekaran, E V; Xue, Jun; Xia, Jie; Khaja, Siraj D; Piskorz, Conrad F; Locke, Robert D; Neelamegham, Sriram; Matta, Khushi L
2016-10-01
Plant lectins through their multivalent quaternary structures bind intrinsically flexible oligosaccharides. They recognize fine structural differences in carbohydrates and interact with different sequences in mucin core 2 or complex-type N-glycan chain and also in healthy and malignant tissues. They are used in characterizing cellular and extracellular glycoconjugates modified in pathological processes. We study here, the complex carbohydrate-lectin interactions by determining the effects of substituents in mucin core 2 tetrasaccharide Galβ1-4GlcNAcβ1-6(Galβ1-3)GalNAcα-O-R and fetuin glycopeptides on their binding to agarose-immobilized lectins PNA, RCA-I, SNA-I and WGA. Briefly, in mucin core 2 tetrasaccharide (i) structures modified by α2-3/6-Sialyl LacNAc, LewisX and α1-3-Galactosyl LacNAc resulted in regular binding to PNA whereas compounds with 6-sulfo LacNAc displayed no-binding; (ii) strucures bearing α2-6-sialyl 6-sulfo LacNAc, or 6-sialyl LacdiNAc carbohydrates displayed strong binding to SNA-I; (iii) structures with α2-3/6-sialyl, α1-3Gal LacNAc or LewisX were non-binder to RCA-I and compounds with 6-sulfo LacNAc only displayed weak binding; (iv) structures containing LewisX, 6-Sulfo LewisX, α2-3/6-sialyl LacNAc, α2-3/6-sialyl 6-sulfo LacNAc and GalNAc Lewis-a were non-binding to WGA, those with α1-2Fucosyl, α1-3-Galactosyl LacNAc, α2-3-sialyl T-hapten plus 3'/6'sulfo LacNAc displayed weak binding, and compounds with α2-3-sialyl T-hapten, α2.6-Sialyl LacdiNAc, α2-3-sialyl D-Fucβ1-3 GalNAc and Fucα-1-2 D-Fucβ-1-3GalNAc displaying regular binding and GalNAc LewisX and LacdiNAc plus D-Fuc β-1-3 GalNAcα resulting in tight binding. RCA-I binds Fetuin triantennary asialoglycopeptide 100 % after α-2-3 and 25 % after α-2-6 sialylation, 30 % after α-1-2 and 100 % after α-1-3 fucosylation, and 50 % after α-1-3 galactosylation. WGA binds 3-but not 6-Fucosyl chitobiose core. Thus, information on the influence of complex carbohydrate chain constituents on lectin binding is apparently essential for the potential application of lectins in glycoconjugate research.
Characteristics of Gamma-Ray Loud Blazars in the VLBA Imaging and Polarimetry Survey
NASA Technical Reports Server (NTRS)
Linford, J. D.; Taylor, G. B.; Romani, R. W.; Healey, S. E.; Helmboldt, J. F.; Readhead, A. C.; Reeves, R.; Richards, J. L.; Cotter, G.
2010-01-01
The radio properties of blazars detected by the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope have been observed as part of the VLBA Imaging and Polarimetry Survey. This large, flux-limited sample of active galactic nuclei (AGNs) provides insights into the mechanism that produces strong gamma-ray emission. At lower flux levels, radio flux density does not directly correlate with gamma-ray flux. We find that the LAT-detected BL Lac objects tend to be similar to the non-LAT BL Lac objects, but that the LAT-detected FSRQs are often significantly different from the non-LAT FSRQs. The differences between the gamma-ray loud and quiet FSRQS can be explained by Doppler boosting; these objects appear to require larger Doppler factors than those of the BL Lac objects. It is possible that the gamma-ray loud FSRQs are fundamentally different from the gamma-ray quiet FSRQs. Strong polarization at the base of the jet appears to be a signature for gamma-ray loud AGNs.
Very high energy observations of the BL Lac objects 3C 66A and OJ 287
NASA Astrophysics Data System (ADS)
Lindner, T.; Hanna, D. S.; Kildea, J.; Ball, J.; Bramel, D. A.; Carson, J.; Covault, C. E.; Driscoll, D.; Fortin, P.; Gingrich, D. M.; Jarvis, A.; Mueller, C.; Mukherjee, R.; Ong, R. A.; Ragan, K.; Scalzo, R. A.; Williams, D. A.; Zweerink, J.
2007-11-01
Using the Solar Tower Atmospheric Cherenkov Effect Experiment (STACEE), we have observed the BL Lac objects 3C 66A and OJ 287. These are members of the class of low-frequency-peaked BL Lac objects (LBLs) and are two of the three LBLs predicted by Costamante and Ghisellini [L. Costamante, G. Ghisellini, Astron. Astrophys. 384 (2002) 56] to be potential sources of very high energy (>100 GeV) gamma-ray emission. The third candidate, BL Lacertae, has recently been detected by the MAGIC collaboration [J. Albert et al., arXiv:astro-ph/0703084v1 (2007)]. Our observations have not produced detections; we calculate a 99% CL upper limit of flux from 3C 66A of 0.15 Crab flux units and from OJ 287 our limit is 0.52 Crab. These limits assume a Crab-like energy spectrum with an effective energy threshold of 185 GeV.
Stellar Populations in BL Lac type Objects
NASA Astrophysics Data System (ADS)
Serote Roos, Margarida
The relationship between an Active Galactic Nucleus (AGN) and its host galaxy is a crucial question in the study of galaxy evolution. We present an estimate of the stellar contribution in a sample of low luminosity BL Lac type objects. We have performed stellar population synthesis for a sample of 19 objects selected from Marchã et al. (1996, MNRAS 281, 425). The stellar content is quantified using the equivalent widths of all absorption features available throughout the spectrum. The synthesis is done by a variant of the GPG method (Pelat: 1997, MNRAS 284, 365).
A revised and updated catalog of quasi-stellar objects
NASA Technical Reports Server (NTRS)
Hewitt, A.; Burbidge, G.
1993-01-01
The paper contains a catalog of all known quasi-stellar objects (QSOs) with measured emission redshifts, and BL Lac objects, complete to 1992 December 31. The catalog contains 7315 objects, nearly all QSOs including about 90 BL Lac objects. The catalog and references contain extensive information on names, positions, magnitudes, colors, emission-line redshifts, absorption, variability, polarization, and X-ray, radio, and infrared data. A key in the form of subsidiary tables enables the reader to relate the name of a given object to its coordinate name, which is used throughout the compilation. Plots of the Hubble diagram, the apparent magnitude distribution, the emission redshift distribution, and the distribution of the QSOs on the sky are also given.
Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1
Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah
2002-01-01
Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346
Beckman, Sarah A.; Chen, William C.W.; Tang, Ying; Proto, Jonathan D.; Mlakar, Logan; Wang, Bing; Huard, Johnny
2016-01-01
Objective We previously reported that mechanical stimulation increased the effectiveness of muscle-derived stem cells (MDSCs) for tissue repair. The objective of this study was to determine the importance of vascular endothelial growth factor (VEGF) on mechanically stimulated MDSCs in a murine model of muscle regeneration. Approach and Results MDSCs were transduced with retroviral vectors encoding the LacZ reporter gene (lacZ-MDSCs), the soluble VEGF receptor Flt1 (sFlt1-MDSCs), or a short hairpin RNA (shRNA) targeting messenger RNA of VEGF (shRNA_VEGF MDSCs). Cells were subjected to 24 hours of mechanical cyclic strain and immediately transplanted into the gastrocnemius muscles of mdx/scid mice. Two weeks after transplantation, angiogenesis, fibrosis, and regeneration were analyzed. There was an increase in angiogenesis in the muscles transplanted with mechanically stimulated lacZMDSCs compared with nonstimulated lacZ-MDSCs, sFlt1-MDSCs, and shRNA _VEGF MDSCs. Dystrophin-positive myofiber regeneration was significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. In vitro proliferation of MDSCs was not decreased by inhibition of VEGF; however, differentiation into myotubes and adhesion to collagen were significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. Conclusions The beneficial effects of mechanical stimulation on MDSC-mediated muscle repair are lost by inhibiting VEGF. PMID:23723372
Standardized emergency management system and response to a smallpox emergency.
Kim-Farley, Robert J; Celentano, John T; Gunter, Carol; Jones, Jessica W; Stone, Rogelio A; Aller, Raymond D; Mascola, Laurene; Grigsby, Sharon F; Fielding, Jonathan E
2003-01-01
The smallpox virus is a high-priority, Category-A agent that poses a global, terrorism security risk because it: (1) easily can be disseminated and transmitted from person to person; (2) results in high mortality rates and has the potential for a major public health impact; (3) might cause public panic and social disruption; and (4) requires special action for public health preparedness. In recognition of this risk, the Los Angeles County Department of Health Services (LAC-DHS) developed the Smallpox Preparedness, Response, and Recovery Plan for LAC to prepare for the possibility of an outbreak of smallpox. A unique feature of the LAC-DHS plan is its explicit use of the Standardized Emergency Management System (SEMS) framework for detailing the functions needed to respond to a smallpox emergency. The SEMS includes the Incident Command System (ICS) structure (management, operations, planning/intelligence, logistics, and finance/administration), the mutual-aid system, and the multi/interagency coordination required during a smallpox emergency. Management for incident command includes setting objectives and priorities, information (risk communications), safety, and liaison. Operations includes control and containment of a smallpox outbreak including ring vaccination, mass vaccination, adverse events monitoring and assessment, management of confirmed and suspected smallpox cases, contact tracing, active surveillance teams and enhanced hospital-based surveillance, and decontamination. Planning/intelligence functions include developing the incident action plan, epidemiological investigation and analysis of smallpox cases, and epidemiological assessment of the vaccination coverage status of populations at risk. Logistics functions include receiving, handling, inventorying, and distributing smallpox vaccine and vaccination clinic supplies; personnel; transportation; communications; and health care of personnel. Finally, finance/administration functions include monitoring costs related to the smallpox emergency, procurement, and administrative aspects that are not handled by other functional divisions of incident command systems. The plan was developed and is under frequent review by the LAC-DHS Smallpox Planning Working Group, and is reviewed periodically by the LAC Bioterrorism Advisory Committee, and draws upon the Smallpox Response Plan and Guidelines of the Centers for Disease Control and Prevention (CDC) and recommendations of the Advisory Committee on Immunization Practices (ACIP). The Smallpox Preparedness, Response, and Recovery Plan, with its SEMS framework and ICS structure, now is serving as a model for the development of LAC-DHS plans for responses to other terrorist or natural-outbreak responses.
Frederiksen, Rikki F; Yoshimura, Yayoi; Storgaard, Birgit G; Paspaliari, Dafni K; Petersen, Bent O; Chen, Kowa; Larsen, Tanja; Duus, Jens Ø; Ingmer, Hanne; Bovin, Nicolai V; Westerlind, Ulrika; Blixt, Ola; Palcic, Monica M; Leisner, Jørgen J
2015-02-27
There is emerging evidence that chitinases have additional functions beyond degrading environmental chitin, such as involvement in innate and acquired immune responses, tissue remodeling, fibrosis, and serving as virulence factors of bacterial pathogens. We have recently shown that both the human chitotriosidase and a chitinase from Salmonella enterica serovar Typhimurium hydrolyze LacNAc from Galβ1-4GlcNAcβ-tetramethylrhodamine (LacNAc-TMR (Galβ1-4GlcNAcβ(CH2)8CONH(CH2)2NHCO-TMR)), a fluorescently labeled model substrate for glycans found in mammals. In this study we have examined the binding affinities of the Salmonella chitinase by carbohydrate microarray screening and found that it binds to a range of compounds, including five that contain LacNAc structures. We have further examined the hydrolytic specificity of this enzyme and chitinases from Sodalis glossinidius and Polysphondylium pallidum, which are phylogenetically related to the Salmonella chitinase, as well as unrelated chitinases from Listeria monocytogenes using the fluorescently labeled substrate analogs LacdiNAc-TMR (GalNAcβ1-4GlcNAcβ-TMR), LacNAc-TMR, and LacNAcβ1-6LacNAcβ-TMR. We found that all chitinases examined hydrolyzed LacdiNAc from the TMR aglycone to various degrees, whereas they were less active toward LacNAc-TMR conjugates. LacdiNAc is found in the mammalian glycome and is a common motif in invertebrate glycans. This substrate specificity was evident for chitinases of different phylogenetic origins. Three of the chitinases also hydrolyzed the β1-6 bond in LacNAcβ1-6LacNAcβ-TMR, an activity that is of potential importance in relation to mammalian glycans. The enzymatic affinities for these mammalian-like structures suggest additional functional roles of chitinases beyond chitin hydrolysis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Enhanced phenol removal in an innovative lignite activated coke-assisted biological process.
Zhang, Chen; Li, Jianfeng; Cheng, Fangqin; Liu, Yu
2018-07-01
In this study, a lignite activated coke (LAC)-assisted activated sludge (AS) process was developed for enhancing biodegradation of phenol, while the effects of LAC on sludge properties and microbial community structure were investigated. It was found that more than 90% of phenol was removed within 1 h in the LAC/AS, which was 3 times higher than the conventional AS process. Moreover, the floc size and settleability were also significantly improved in the LAC/AS. These results suggested that LAC could serve as the nucleating agent to promote the formation of compact floc, which was beneficial for toxicity mitigation and system stability. The microbial community analysis by 16S high-throughput pyrosequencing technology further revealed a more abundant bacterial richness and diversity in the LAC/AS process loaded with phenol, while some phenol degraders, such as Propionibacteriaceae were enriched. Engineering implications further suggests the LAC-assisted AS process is technically sound and economically viable. Copyright © 2018 Elsevier Ltd. All rights reserved.
Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.
2013-01-01
β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479
γ-Ray And Parsec-Scale Jet Properties Of A Complete Sample Of Blazars From The Mojave Program
Lister, M. L.
2011-11-02
We investigate the Fermi LAT -ray and 15 GHz VLBA radio properties of a joint -ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -30° during this period, and thus probes the full range of -ray loudness ( -ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders ofmagnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. Themore » BL Lac objects, however, display a linear correlation of increasing -ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the -ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - -ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.« less
Gamma-Ray and Parsec-Scale Jet Properties of a Complete Sample of Blazars from the MOJAVE Program
NASA Technical Reports Server (NTRS)
Lister, M.L.; Aller, M.; Aller, H.; Hovatta, T.; Kellermann, K. I.; Kovalev, Y. Y.; Meyer, E. T.; Pushkarev, A. B.; Ros, E.; Ackermann, M.;
2011-01-01
We investigate the Fermi LAT gamma-ray and 15 GHz VLBA radio properties of a joint gamma-ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -300 during this period, and thus probes the full range of gamma-ray loudness (gamma-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders of magnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing gamma-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the gamma-ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - gamma-ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.
The environment of x ray selected BL Lacs: Host galaxies and galaxy clustering
NASA Technical Reports Server (NTRS)
Wurtz, Ron; Stocke, John T.; Ellingson, Erica; Yee, Howard K. C.
1993-01-01
Using the Canada-France-Hawaii Telescope, we have imaged a complete, flux-limited sample of Einstein Medium Sensitivity Survey BL Lacertae objects in order to study the properties of BL Lac host galaxies and to use quantitative methods to determine the richness of their galaxy cluster environments.
NASA Astrophysics Data System (ADS)
Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Sbarrato, T.
2015-07-01
High-energy observations of extreme BL Lac objects, such as 1ES 0229+200 or 1ES 0347-121, recently focused interest both for blazar and jet physics and for the implication on the extragalactic background light and intergalactic magnetic field estimate. However, the number of these extreme highly peaked BL Lac objects (EHBL) is still rather small. Aiming at increase their number, we selected a group of EHBL candidates starting from the BL Lac sample of Plotkin et al. (2011), considering those undetected (or only barely detected) by the Large Area Telescope onboard Fermi and characterized by a high X-ray versus radio flux ratio. We assembled the multiwavelength spectral energy distribution of the resulting nine sources, profiting of publicly available archival observations performed by Swift, GALEX, and Fermi satellites, confirming their nature. Through a simple one-zone synchrotron self-Compton model we estimate the expected very high energy flux, finding that in the majority of cases it is within the reach of present generation of Cherenkov arrays or of the forthcoming Cherenkov Telescope Array.
Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping
2018-04-11
Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .
Coarse-grained Simulations of Sugar Transport and Conformational Changes of Lactose Permease
NASA Astrophysics Data System (ADS)
Liu, Jin; Jewel, S. M. Yead; Dutta, Prashanta
2016-11-01
Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves sugar translocation, H+ transfer, as well as large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear due to the complexity and multiscale nature of the process. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the transport of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule across a wild-type LacY during lactose/H+ symport process. Results show that the local interactions between TDG and LacY at the binding pocket are consistent with the X-ray experiment. Protonation of Glu325 stabilizes the TDG and inward-facing conformation of LacY. Protonation of Glu269 induces a dramatic protein structural reorganization and causes the expulsion of TDG from LacY to both sides of the membrane. The structural changes occur primarily in the N-terminal domain of LacY. This work is supported by NSF Grants: CBET-1250107 and CBET -1604211.
Depreter, Barbara; Devreese, Katrien M J
2016-09-01
Lupus anticoagulant (LAC) testing includes a screening, mixing and confirmation step. Although recently published guidelines on LAC testing are a useful step towards standardization, a lack of consensus remains whether to express mixing tests in clotting time (CT) or index of circulating anticoagulant (ICA). The influence of anticoagulant therapy, e.g. vitamin K antagonists (VKA) or direct oral anticoagulants (DOAC) on both methods of interpretation remains to be investigated. The objective of this study was to contribute to a simplification and standardization of the LAC three-step interpretation on the level of the mixing test. Samples from 148 consecutive patients with LAC request and prolonged screening step, and 77 samples from patients non-suspicious for LAC treated with VKA (n=37) or DOAC (n=30) were retrospectively evaluated. An activated partial thromboplastin time (aPTT) and dilute Russell's viper venom time (dRVVT) were used for routine LAC testing. The supplemental anticoagulant samples were tested with dRVVT only. We focused on the interpretation differences for mixing tests expressed as CT or ICA and compared the final LAC conclusion within each distinct group of concordant and discordant mixing test results. Mixing test interpretation by CT resulted in 10 (dRVVT) and 16 (aPTT) more LAC positive patients compared to interpretation with ICA. Isolated prolonged dRVVT screen mix ICA results were exclusively observed in samples from VKA-treated patients without suspicion for LAC. We recommend using CT in respect to the 99th percentile cut-off for interpretation of mixing steps in order to reach the highest sensitivity and specificity in LAC detection.
NASA Astrophysics Data System (ADS)
Krawczynski, Henric
2007-04-01
In this contribution we discuss models of the X-rays and TeV gamma-ray emission from BL Lac objects based on parallel electron-positron or electron-proton beams that form close to the central black hole owing to the strong electric fields generated by the accretion disk and possibly also by the black hole itself. Fitting the energy spectrum of the BL Lac object Mrk 501, we obtain tight constrains on the beam properties. Launching a sufficiently energetic beam requires rather strong magnetic fields close to the black hole 100-1000 G. However, the model fits imply that the magnetic field in the emission region is only 0.02 G. Thus, the particles are accelerated close to the black hole and propagate a considerable distance before instabilities trigger the dissipation of energy through synchrotron and self-Compton emission. We discuss various approaches to generate enough power to drive the jet and, at the same time, to accelerate particles to 20 TeV energies. Although the parallel beam model has its own problems, it explains some of the long-standing problems that plague models based on Fermi type particle acceleration, like the presence of a very high minimum Lorentz factor of accelerated particles. We conclude with a brief discussion of the implications of the model for the difference between the processes of jet formation in BL Lac type objects and in quasars.
RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massaro, F.; Marchesini, E. J.; D’Abrusco, R.
2017-01-10
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated bymore » the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.« less
Radio-weak BL Lac Objects in the Fermi Era
NASA Astrophysics Data System (ADS)
Massaro, F.; Marchesini, E. J.; D'Abrusco, R.; Masetti, N.; Andruchow, I.; Smith, Howard A.
2017-01-01
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]-[4.6]-[12] μm color-color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.
Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun
2016-08-01
Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC-MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. © 2016 The Author(s).
Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun
2016-01-01
Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC–MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. PMID:27354563
Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample
NASA Astrophysics Data System (ADS)
Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.
1994-12-01
The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15
Fermi LAT detection of a GeV flare from the high redshift BL Lac object PKS 2131-021
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2012-08-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2131-021 (also known as 2FGL J2133.8-0154, Nolan et al. 2012, ApJS, 199, 31, and 4C -02.81) placed at radio coordinates R.A.: 323.5429567 deg, Dec.: -1.8881217 deg (J2000, Johnston et al. 1995, AJ, 110, 880).
Fermi LAT detection of a GeV flare from the BL Lac object Mrk 421
NASA Astrophysics Data System (ADS)
D'Ammando, F.; Orienti, M.
2012-07-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object Mrk 421 (also known as 2FGL J1104.4+3812, Nolan et al. 2012, ApJS, 199, 31; R.A.= 11h04m27.3139s, Dec.= +38d12m31.799s, J2000.0, Fey et al. 2004, AJ, 127, 3587) at redshift z=0.03 (De Vaucouleurs et al.
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Institutional barriers and opportunities in application of the limits of acceptable change
George H. Stankey
1997-01-01
Although the Limits of Acceptable Change (LAC) process has been in use since the mid-1980âs and has contributed to improved wilderness management, significant barriers and challenges remain. Formal and informal institutional barriers are the principal constraint to more effective implementation. Although grounded in a traditional management-by-objectives model, the LAC...
Modification of natural matrix lac-bagasse for matrix composite films
NASA Astrophysics Data System (ADS)
Nurhayati, Nanik Dwi; Widjaya, Karna; Triyono
2016-02-01
Material technology continues to be developed in order to a material that is more efficient with composite technology is a combination of two or more materials to obtain the desired material properties. The objective of this research was to modification and characterize the natural matrix lac-bagasse as composite films. The first step, natural matrix lac was changed from solid to liquid using an ethanol as a solvent so the matrix homogenly. Natural matrix lac was modified by adding citric acid with concentration variation. Secondly, the bagasse delignification using acid hydrolysis method. The composite films natural matrix lac-bagasse were prepared with optimum modified the addition citric acid 5% (v/v) and delignification bagasse optimum at 1,5% (v/v) in hot press at 80°C 6 Kg/cm-1. Thirdly, composite films without and with modification were characterized functional group analysis using FTIR spectrophotometer and mechanical properties using Universal Testing Machine. The result of research showed natural matrix lac can be modified by reaction with citric acid. FTIR spectra showed without and with modification had functional groups wide absorption 3448 cm-1 group -OH, C=O ester strong on 1712 cm-1 and the methylene group -CH2 on absorption 1465 cm-1. The mechanical properties showed tensile strength 0,55 MPa and elongation at break of 0,95 %. So that composite films natural matrix lac can be made with reinforcement bagasse for material application.
New High-z BL Lacs Using the Photometric Method with Swift and SARA
NASA Astrophysics Data System (ADS)
Kaur, A.; Rau, A.; Ajello, M.; Domínguez, A.; Paliya, V. S.; Greiner, J.; Hartmann, D. H.; Schady, P.
2018-06-01
BL Lacertae (BL Lac) objects are prominent members of the third Fermi Large Area Telescope catalog of γ-ray sources. Half of the members of the BL Lac population (∼300) lack redshift measurements, which is due to the absence of lines in their optical spectra, thereby making it difficult to utilize spectroscopic methods. Our photometric dropout technique can be used to establish the redshift for a fraction of these sources. This work employed six filters mounted on the Swift-UVOT and four optical filters on two telescopes, the 0.65 m SARA-CTIO in Chile and 1.0 m SARA-ORM in the Canary Islands, Spain. A sample of 15 sources was extracted from the Swift archival data for which six filter UVOT observations were conducted. By complementing the Swift observations with the SARA ones, we were able to discover two high-redshift sources: 3FGL J1155.4-3417 and 3FGL J1156.7–2250 at z={1.83}-0.13+0.10 and z={1.73}-0.19+0.11, respectively, resulting from the dropouts in the power-law template fits to these data. The discoveries add to the important (26 total) sample of high-redshift BL Lacs. While the sample of high-z BL Lacs is still rather small, these objects do not seem to fit well within known schemes of the blazar population and represent the best probes of the extragalactic background light.
NASA Technical Reports Server (NTRS)
Kondo, D. M.; Worrall, D. M.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. H.; Oke, J. B.; Yee, H.; Neugebauer, G.; Matthews, K.; Feldman, P. A.
1980-01-01
Quasi-simultaneous observations of the BL Lacertae (Lac) objects MK 501 were performed for the first time at X-ray, ultraviolet, visible, infrared, and radio frequencies. The observed spectral slope from the X-ray to UV regions is positive and continuous, but that from the mid UV to visible light region becomes gradually flat and possibly turns down toward lower frequencies; the optical radio emission can not be accounted for by a single power law. Several theoretical models were considered for the emission mechanism. A quantitative comparison was performed with the synchrotron-self-Compton model; the total spectrum is found consistent with this model. The spectrum from visible light to X-ray is consistent with synchrotron radiation or with inverse-Compton scattering by a hot thermal cloud of electrons. The continuity of the spectral slope from X-ray to UV implied by the current data suggests that the previous estimates of the total luminosity of this BL Lac object is underestimated by a factor of about three or four.
An Analysis of Periodic Components in BL Lac Object S5 0716 +714 with MUSIC Method
NASA Astrophysics Data System (ADS)
Tang, J.
2012-01-01
Multiple signal classification (MUSIC) algorithms are introduced to the estimation of the period of variation of BL Lac objects.The principle of MUSIC spectral analysis method and theoretical analysis of the resolution of frequency spectrum using analog signals are included. From a lot of literatures, we have collected a lot of effective observation data of BL Lac object S5 0716 + 714 in V, R, I bands from 1994 to 2008. The light variation periods of S5 0716 +714 are obtained by means of the MUSIC spectral analysis method and periodogram spectral analysis method. There exist two major periods: (3.33±0.08) years and (1.24±0.01) years for all bands. The estimation of the period of variation of the algorithm based on the MUSIC spectral analysis method is compared with that of the algorithm based on the periodogram spectral analysis method. It is a super-resolution algorithm with small data length, and could be used to detect the period of variation of weak signals.
An Analysis of Light Periods of BL Lac Object S5 0716+714 with the MUSIC Algorithm
NASA Astrophysics Data System (ADS)
Tang, Jie
2012-07-01
The multiple signal classification (MUSIC) algorithm is introduced to the estimation of light periods of BL Lac objects. The principle of the MUSIC algorithm is given, together with a testing on its spectral resolution by using a simulative signal. From a lot of literature, we have collected a large number of effective observational data of the BL Lac object S5 0716+714 in the three optical wavebands V, R, and I from 1994 to 2008. The light periods of S5 0716+714 are obtained by means of the MUSIC algorithm and average periodogram algorithm, respectively. It is found that there exist two major periodic components, one is the period of (3.33±0.08) yr, another is the period of (1.24±0.01) yr. The comparison of the performances of periodicity analysis of two algorithms indicates that the MUSIC algorithm has a smaller requirement on the sample length, as well as a good spectral resolution and anti-noise ability, to improve the accuracy of periodicity analysis in the case of short sample length.
Regulation of lac Operon Expression: Reappraisal of the Theory of Catabolite Repression
Wanner, Barry L.; Kodaira, Ryoji; Neidhardt, Frederick C.
1978-01-01
The physiological state of Escherichia coli with respect to (permanent) catabolite repression was assessed by measuring the steady-state level of β-galactosidase in induced or in constitutive cells under a variety of growth conditions. Four results were obtained. (i) Catabolite repression had a major effect on fully induced or constitutive expression of the lac gene, and the magnitude of this effect was found to be dependent on the promoter structure; cells with a wild-type lac promoter showed an 18-fold variation in lac expression, and cells with the lacP37 (formerly lac-L37) promoter exhibited several hundred-fold variation. (ii) Exogenous adenosine cyclic 3′,5′-monophosphoric acid (cAMP) could not abolish catabolite repression, even though several controls demonstrated that cAMP was entering the cells in significant amounts. (Rapid intracellular degradation of cAMP could not be ruled out.) (iii) Neither the growth rate nor the presence of biosynthetic products altered the degree of catabolite repression; all variation could be related to the catabolites present in the growth medium. (iv) Slowing by imposing an amino acid restriction decreased the differential rate of β-galactosidase synthesis from the wild-type lac promoter when bacteria were cultured in either the absence or presence of cAMP; this decreased lac expression also occurred when the bacteria harbored the catabolite-insensitive lacP5 (formerly lacUV5) promoter mutation. These findings support the idea that (permanent) catabolite repression is set by the catabolites in the growth medium and may not be related to an imbalance between catabolism and anabolism. PMID:214424
He, Xi; Han, Ning; Wang, Yan-Ping
2016-01-01
Lactobacillus kefiranofaciens ZW3 was obtained from kefir grains, which have high lactose hydrolytic activity. In this study, a heterodimeric LacLM-type β-galactosidase gene (lacLM) from ZW3 was isolated, which was composed of two overlapping genes, lacL (1,884 bp) and lacM (960 bp) encoding large and small subunits with calculated molecular masses of 73,620 and 35,682 Da, respectively. LacLM, LacL, and LacM were expressed in Escherichia coli BL21(DE3) and these recombinant proteins were purified and characterized. The results showed that, compared with the recombinant holoenzyme, the recombinant large subunit exhibits obviously lower thermostability and hydrolytic activity. Moreover, the optimal temperature and pH of the holoenzyme and large subunit are 60°C and 7.0, and 50°C and 8.0, respectively. However, the recombinant small subunit alone has no activity. Interestingly, the activity and thermostability of the large subunit were greatly improved after mixing it with the recombinant small subunit. Therefore, the results suggest that the small subunit might play an important role in maintaining the stability of the structure of the catalytic center located in the large subunit.
Lupus anticoagulant: a multicenter study for a standardized and harmonized reporting.
Poz, Alessandra; Pradella, Paola; Azzarini, Gabriella; Santarossa, Liliana; Bardin, Cristina; Zardo, Lorena; Giacomello, Roberta
2016-03-01
Laboratory assessment of Lupus anticoagulant (LAC) is very challenging because of inter and intralaboratory variability, which makes it difficult to standardize and harmonize results expression. Five hospital laboratories in North-eastern Italy shared their efforts and their experience in a cross-laboratory study, conducting the diagnostic process as homogeneously as possible and providing a better interpretation for LAC positivity. Hundred normal samples from healthy subjects (20 from each center) were processed to confirm negative upper limits and calculate positivity cutoffs of LAC integrated assays, that is dilute Russell's viper venom time (dRVVT) and silica clotting time (SCT). Moreover, 311 samples previously diagnosed by the laboratories as positive for LAC were analyzed to characterize different positivity levels for each assay. As far as the analysis of healthy subjects is concerned, negative upper limits are set at 1.17 and 1.19 for dRVVT and SCT screen ratio, respectively. Positivity cutoffs are set at 1.20 for dRVVT and 1.23 for SCT, expressed as Test Ratio calculated on screen and confirm integrated tests. Positive results for each integrated assay are subsequently divided into three subgroups: weak, moderate and strong; the results obtained are presented as a score proposal that can provide LAC interpretation. The combined use of both dRVVT and SCT assays and the definition of different positivity levels may lead to clearer, more objective LAC reporting. An interpretative table for LAC-proposed score provides LAC-positive results and it is now adopted by all centers involved in the study.
Yuan, Shaoxin; Gao, Yusong; Ji, Wenqing; Song, Junshuai; Mei, Xue
2018-05-01
The aim of this study was to assess the ability of acute physiology and chronic health evaluation II (APACHE II) score, poisoning severity score (PSS) as well as sequential organ failure assessment (SOFA) score combining with lactate (Lac) to predict mortality in the Emergency Department (ED) patients who were poisoned with organophosphate.A retrospective review of 59 stands-compliant patients was carried out. Receiver operating characteristic (ROC) curves were constructed based on the APACHE II score, PSS, SOFA score with or without Lac, respectively, and the areas under the ROC curve (AUCs) were determined to assess predictive value. According to SOFA-Lac (a combination of SOFA and Lac) classification standard, acute organophosphate pesticide poisoning (AOPP) patients were divided into low-risk and high-risk groups. Then mortality rates were compared between risk levels.Between survivors and non-survivors, there were significant differences in the APACHE II score, PSS, SOFA score, and Lac (all P < .05). The AUCs of the APACHE II score, PSS, and SOFA score were 0.876, 0.811, and 0.837, respectively. However, after combining with Lac, the AUCs were 0.922, 0.878, and 0.956, respectively. According to SOFA-Lac, the mortality of high-risk group was significantly higher than low-risk group (P < .05) and the patients of the non-survival group were all at high risk.These data suggest the APACHE II score, PSS, SOFA score can all predict the prognosis of AOPP patients. For its simplicity and objectivity, the SOFA score is a superior predictor. Lac significantly improved the predictive abilities of the 3 scoring systems, especially for the SOFA score. The SOFA-Lac system effectively distinguished the high-risk group from the low-risk group. Therefore, the SOFA-Lac system is significantly better at predicting mortality in AOPP patients.
Balani, Prashant N; Ng, Wai Kiong; Tan, Reginald B H; Chan, Sui Yung
2010-05-01
The feasibility of using excipients to suppress the amorphization or structural disorder of crystalline salbutamol sulphate (SS) during milling was investigated. SS was subjected to ball-milling in the presence of alpha-lactose monohydrate (LAC), adipic acid (AA), magnesium stearate (MgSt), or polyvinyl pyrrolidone (PVP). X-ray powder diffraction, dynamic vapor sorption (DVS), high sensitivity differential scanning calorimetry (HSDSC) were used to analyze the crystallinity of the milled mixtures. Comilling with crystalline excipients, LAC, AA, and MgSt proved effective in reducing the amorphization of SS. LAC, AA, or MgSt acting as seed crystals to induce recrystallization of amorphous SS formed by milling. During comilling, both SS and LAC turned predominantly amorphous after 45 min but transformed back to a highly crystalline state after 60 min. Amorphous content was below the detection limits of DVS (0.5%) and HSDSC (5%). Comilled and physical mixtures of SS and ALM were stored under normal and elevated humidity conditions. This was found to prevent subsequent changes in crystallinity and morphology of comilled SS:LAC as compared to significant changes in milled SS and physical mixture. These results demonstrate a promising application of comilling with crystalline excipients in mitigating milling induced amorphization of pharmaceutical actives.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costamante, L.; Aharonian, F.; Khangulyan, D.
2007-07-12
An often overlooked fact is that the MeV-GeV emission from High-energy peaked BL Lacs (HBL) is basically unknown: there are only 3 objects of this type among all EGRET identified blazars with measured spectra. GLAST will be able to measure the spectrum for many of them, in particular TeV-blazars, and surprises are expected. GLAST will tell if the {gamma}-ray peak in some HBL is actually a ''double peak'', as suggested by the comparison of EGRET and HESS data in PKS 2155-304, We also remind and argue that a new class of BL Lacs could exist, where particles are shock-accelerated nearmore » the maximum possible rate, characterized by the synchrotron emission peaking in the GLAST band (100 MeV - few GeV). Such objects could easily have escaped detection or identification so far, and could now be unveiled by GLAST.« less
Continuum radiation from active galactic nuclei: A statistical study
NASA Technical Reports Server (NTRS)
Isobe, T.; Feigelson, E. D.; Singh, K. P.; Kembhavi, A.
1986-01-01
The physics of the continuum spectrum of active galactic nuclei (AGNs) was examined using a large data set and rigorous statistical methods. A data base was constructed for 469 objects which include radio selected quasars, optically selected quasars, X-ray selected AGNs, BL Lac objects, and optically unidentified compact radio sources. Each object has measurements of its radio, optical, X-ray core continuum luminosity, though many of them are upper limits. Since many radio sources have extended components, the core component were carefully selected out from the total radio luminosity. With survival analysis statistical methods, which can treat upper limits correctly, these data can yield better statistical results than those previously obtained. A variety of statistical tests are performed, such as the comparison of the luminosity functions in different subsamples, and linear regressions of luminosities in different bands. Interpretation of the results leads to the following tentative conclusions: the main emission mechanism of optically selected quasars and X-ray selected AGNs is thermal, while that of BL Lac objects is synchrotron; radio selected quasars may have two different emission mechanisms in the X-ray band; BL Lac objects appear to be special cases of the radio selected quasars; some compact radio sources show the possibility of synchrotron self-Compton (SSC) in the optical band; and the spectral index between the optical and the X-ray bands depends on the optical luminosity.
Mezey, Gillian; Meyer, Deborah; Robinson, Fiona; Bonell, Chris; Campbell, Rona; Gillard, Steve; Jordan, Peter; Mantovani, Nadia; Wellings, Kaye; White, Sarah
2015-01-01
BACKGROUND: Looked-after children (LAC) are at greater risk of teenage pregnancy than non-LAC, which is associated with adverse health and social consequences. Existing interventions have failed to reduce rates of teenage pregnancy in LAC. Peer mentoring is proposed as a means of addressing many of the factors associated with the increased risk of teenage pregnancy in this group. OBJECTIVE: To develop a peer mentoring intervention to reduce teenage pregnancy in LAC. DESIGN: Phase I and II randomised controlled trial of a peer mentoring intervention for LAC; scoping exercise and literature search; national surveys of social care professionals and LAC; and focus groups and interviews with social care professionals, mentors and mentees. SETTING: Three local authorities (LAs) in England. PARTICIPANTS: LAC aged 14-18 years (mentees/care as usual) and 19-25 years (mentors). INTERVENTION: Recruitment and training of mentors; randomisation and matching of mentors to mentees; and 1-year individual peer mentoring. MAIN OUTCOME MEASURES: PRIMARY OUTCOME: pregnancy in LAC aged 14-18 years. SECONDARY OUTCOMES: sexual attitudes, behaviour and knowledge; psychological health; help-seeking behaviour; locus of control; and attachment style. A health economic evaluation was also carried out. RESULTS: In total, 54% of target recruitment was reached for the exploratory trial and 13 out of 20 mentors (65%) and 19 out of 30 LAC aged 14-18 years (63%) (recruited during Phases I and II) were retained in the research. The training programme was acceptable and could be manualised and replicated. Recruitment and retention difficulties were attributed to systemic problems and LA lack of research infrastructure and lack of additional funding to support and sustain such an intervention. Mentees appeared to value the intervention but had difficulty in meeting weekly as required. Only one in four of the relationships continued for the full year. A future Phase III trial would require the intervention to be modified to include provision of group and individual peer mentoring; internal management of the project, with support from an external agency such as a charity or the voluntary sector; funds to cover LA research costs, including the appointment of a dedicated project co-ordinator; a reduction in the lower age for mentee recruitment and an increase in the mentor recruitment age to 21 years; and the introduction of a more formal recruitment and support structure for mentors. CONCLUSIONS: Given the problems identified and described in mounting this intervention, a new development phase followed by a small-scale exploratory trial incorporating these changes would be necessary before proceeding to a Phase III trial. FUNDING: This project was funded by the NIHR Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 19, No. 85. See the NIHR Journals Library website for further project information. PMID:26497730
Fermi-LAT detection of a GeV flare from the BL Lac object 1ES 2322-409
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2013-10-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed an increasing gamma-ray flux from a source positionally consistent with the BL Lac object 1ES 2322-409 (also know as 2FGL J2324.7-4042, Nolan et al. 2012, ApJS, 199, 31, and as 1FHL J2324.6-4041, Ackermann et al., ApJS, submitted, arXiv:1306.6772), with 2MASS counterpart coordinates, (J2000.0), R.A.: 351.18612 deg, Dec: -40.68036 deg (Mao 2011, New Ast., 16, 503).
The reinvigoration of public health nursing: methods and innovations.
Avila, Margaret; Smith, Kathleen
2003-01-01
Los Angeles County (LAC) restructured and reinvigorated public health in response to nationwide concern over the adequacy of all public health infrastructures and functions. LAC's reorganization into geographically defined service planning areas (SPAs) has facilitated the integration of core public health functions into local practice. Public health nurses practicing as generalists within their SPA identified three initial objectives to address in population-based care: (1) expanding practice beyond disease control to a more holistic approach, (2) providing consultation using the Ask-the-Nurse innovation, and (3) developing a community assessment database for interdisciplinary SPA health planning. Additional innovative objectives are planned for the future.
Role of protein kinase C-η in cigarette smoke extract-induced apoptosis in MRC-5-cells.
Son, E S; Kyung, S Y; Lee, S P; Jeong, S H; Shin, J Y; Ohba, M; Yeo, E J; Park, J W
2015-09-01
Cigarette smoke (CS) is a major risk factor for emphysema, which causes cell death in structural cells of the lung by mechanisms that are still not completely understood. We demonstrated previously that CS extract (CSE) induces caspase activation in MRC-5 human lung fibroblasts, activated protein kinase C-η (PKC-η), and translocated PKC-η from the cytosol to the membrane. The objective of this study was to investigate the involvement of PKC-η activation in a CSE-induced extrinsic apoptotic pathway. We determined that CSE increases expression of caspase 3 and 8 cleavage in MRC-5 cells and overexpression of PKC-η significantly increased expression of caspase 3 and 8 cleavage compared with control LacZ-infected cells. In contrast, dominant negative (dn) PKC-η inhibited apoptosis in MRC-5 cells exposed to CSE and decreased expression of caspase 3 and 8 compared with control cells. Exposure to 10% CSE for >8 h significantly increased lactate dehydrogenase release in PKC-η-infected cells compared with LacZ-infected cells. Additionally, PKC-η-infected cells had an increased number of Hoechst 33342 stained nuclei compared with LacZ-infected cells, while dn PKC-η-infected cells exhibited fewer morphological changes than LacZ-infected cells under phase-contrast microscopy. In conclusion, PKC-η activation plays a pro-apoptotic role in CSE-induced extrinsic apoptotic pathway in MRC-5 cells. These results suggest that modulation of PKC-η may be a useful tool for regulating the extrinsic apoptosis of MRC-5 cells by CSE and may have therapeutic potential in the treatment of CS-induced lung injury. © The Author(s) 2014.
Komori, Hirofumi; Miyazaki, Kentaro; Higuchi, Yoshiki
2009-04-02
A multi-copper protein with two cupredoxin-like domains was identified from our in-house metagenomic database. The recombinant protein, mgLAC, contained four copper ions/subunits, oxidized various phenolic and non-phenolic substrates, and had spectroscopic properties similar to common laccases. X-ray structure analysis revealed a homotrimeric architecture for this enzyme, which resembles nitrite reductase (NIR). However, a difference in copper coordination was found at the domain interface. mgLAC contains a T2/T3 tri-nuclear copper cluster at this site, whereas a mononuclear T2 copper occupies this position in NIR. The trimer is thus an essential part of the architecture of two-domain multi-copper proteins, and mgLAC may be an evolutionary precursor of NIR.
Constraining the red shifts of TeV BL Lac objects
NASA Astrophysics Data System (ADS)
Qin, Longhua; Wang, Jiancheng; Yan, Dahai; Yang, Chuyuan; Yuan, Zunli; Zhou, Ming
2018-01-01
We present a model-dependent method to estimate the red shifts of three TeV BL Lac objects (BL Lacs) through fitting their (quasi-)simultaneous multi-waveband spectral energy distributions (SEDs) with a one-zone leptonic synchrotron self-Compton model. Considering the impact of electron energy distributions (EEDs) on the results, we use three types of EEDs to fit the SEDs: a power-law EED with exponential cut-off (PLC), a log-parabola (PLLP) EED and the broken power-law (BPL) EED. We also use a parameter α to describe the uncertainties of the extragalactic background light models, as in Abdo et al. We then use a Markov chain Monte Carlo method to explore the multi-dimensional parameter space and obtain the uncertainties of the model parameters based on the observational data. We apply our method to obtain the red shifts of three TeV BL Lac objects in the marginalized 68 per cent confidence, and find that the PLC EED does not fit the SEDs. For 3C66A, the red shift is 0.14-0.31 and 0.16-0.32 in the BPL and PLLP EEDs. For PKS1424+240, the red shift is 0.55-0.68 and 0.55-0.67 in the BPL and PLLP EEDs. For PG1553+113, the red shift is 0.22-0.48 and 0.22-0.39 in the BPL and PLLP EEDs. We also estimate the red shift of PKS1424+240 in the high stage to be 0.46-0.67 in the PLLP EED, roughly consistent with that in the low stage.
Galactose transport in Kluyveromyces lactis: major role of the glucose permease Hgt1.
Baruffini, Enrico; Goffrini, Paola; Donnini, Claudia; Lodi, Tiziana
2006-12-01
In Kluyveromyces lactis, galactose transport has been thought to be mediated by the lactose permease encoded by LAC12. In fact, a lac12 mutant unable to grow on lactose did not grow on galactose either and showed low and uninducible galactose uptake activity. The existence of other galactose transport systems, at low and at high affinity, had, however, been hypothesized on the basis of galactose uptake kinetics studies. Here we confirmed the existence of a second galactose transporter and we isolated its structural gene. It turned out to be HGT1, previously identified as encoding the high-affinity glucose carrier. Analysis of galactose transporter mutants, hgt1 and lac12, and the double mutant hgt1lac12, suggested that Hgt1 was the high-affinity and Lac12 was the low-affinity galactose transporter. HGT1 expression was strongly induced by galactose and insensitive to glucose repression. This could explain the rapid adaptation to galactose observed in K. lactis after a shift from glucose to galactose medium.
Evidence for an intermediate conformational state of LacY.
Jiang, Xiaoxu; Guan, Lan; Zhou, Yonggang; Hong, Wen-Xu; Zhang, Qinghai; Kaback, H Ronald
2012-03-20
LacY mutant Cys154 → Gly exhibits a periplasmic-closed crystal structure identical to the WT, but is periplasmic-open in the membrane. The mutant hardly catalyzes transport, but binds galactosides from either side of the membrane with the same affinity and is resistant to site-directed proteolysis relative to the pseudo-WT. Site-directed alkylation was also applied to 11 single-Cys mutants in Cys154 → Gly LacY in right-side-out membrane vesicles or after solubilization and purification in dodecyl-β-D-maltopyranoside (DDM). Unlike the pseudo-WT, Cys replacements on the periplasmic side of the Cys154 → Gly mutant label rapidly in the membrane without sugar, but labeling decreases markedly after the mutant proteins are purified. Thus, Cys154 → Gly LacY likely favors a higher-energy intermediate periplasmic-open conformation in situ, but collapses to a lower-energy periplasmic-closed conformation in DDM after purification. Notably, branched-chain or neopentyl glycol maltoside detergents stabilize Cys154 → Gly LacY in the membrane-embedded form.
Schwartz, Michal; Travesa, Anna; Martell, Steven W; Forbes, Douglass J
2015-01-01
Nuclear pore complexes (NPCs) form the gateway to the nucleus, mediating virtually all nucleocytoplasmic trafficking. Assembly of a nuclear pore complex requires the organization of many soluble sub-complexes into a final massive structure embedded in the nuclear envelope. By use of a LacI/LacO reporter system, we were able to assess nucleoporin (Nup) interactions, show that they occur with a high level of specificity, and identify nucleoporins sufficient for initiation of the complex process of NPC assembly in vivo. Eleven nucleoporins from different sub-complexes were fused to LacI-CFP and transfected separately into a human cell line containing a stably integrated LacO DNA array. The LacI-Nup fusion proteins, which bound to the array, were examined for their ability to recruit endogenous nucleoporins to the intranuclear LacO site. Many could recruit nucleoporins of the same sub-complex and a number could also recruit other sub-complexes. Strikingly, Nup133 and Nup107 of the Nup107/160 subcomplex and Nup153 and Nup50 of the nuclear pore basket recruited a near full complement of nucleoporins to the LacO array. Furthermore, Nup133 and Nup153 efficiently targeted the LacO array to the nuclear periphery. Our data support a hierarchical, seeded assembly pathway and identify Nup133 and Nup153 as effective “seeds” for NPC assembly. In addition, we show that this system can be applied to functional studies of individual nucleoporin domains as well as to specific nucleoporin disease mutations. We find that the R391H cardiac arrhythmia/sudden death mutation of Nup155 prevents both its subcomplex assembly and nuclear rim targeting of the LacO array. PMID:25602437
Laser-Assisted Cold-Sprayed Corrosion- and Wear-Resistant Coatings: A Review
NASA Astrophysics Data System (ADS)
Olakanmi, E. O.; Doyoyo, M.
2014-06-01
Laser-assisted cold spray (LACS) process will be increasingly employed for depositing coatings because of its unique advantages: solid-state deposition of dense, homogeneous, and pore-free coatings onto a range of substrates; and high build rate at reduced operating costs without the use of expensive heating and process inert gases. Depositing coatings with excellent performance indicators via LACS demands an accurate knowledge and control of processing and materials' variables. By varying the LACS process parameters and their interactions, the functional properties of coatings can be manipulated. Moreover, thermal effect due to laser irradiation and microstructural evolution complicate the interpretation of LACS mechanical deformation mechanism which is essential for elucidating its physical phenomena. In order to provide a basis for follow-on-research that leads to the development of high-productivity LACS processing of coatings, this review focuses on the latest developments in depositing corrosion- and wear-resistant coatings with the emphasis on the composition, structure, and mechanical and functional properties. Historical developments and fundamentals of LACS are addressed in an attempt to describe the physics behind the process. Typical technological applications of LACS coatings are also identified. The investigations of all process sequences, from laser irradiation of the powder-laden gas stream and the substrate, to the impingement of thermally softened particles on the deposition site, and subsequent further processes, are described. Existing gaps in the literature relating to LACS-dependent microstructural evolution, mechanical deformation mechanisms, correlation between functional properties and process parameters, processing challenges, and industrial applications have been identified in order to provide insights for further investigations and innovation in LACS deposition of wear- and corrosion-resistant coatings.
Optical polarization of high-energy BL Lacertae objects
NASA Astrophysics Data System (ADS)
Hovatta, T.; Lindfors, E.; Blinov, D.; Pavlidou, V.; Nilsson, K.; Kiehlmann, S.; Angelakis, E.; Fallah Ramazani, V.; Liodakis, I.; Myserlis, I.; Panopoulou, G. V.; Pursimo, T.
2016-12-01
Context. We investigate the optical polarization properties of high-energy BL Lac objects using data from the RoboPol blazar monitoring program and the Nordic Optical Telescope. Aims: We wish to understand if there are differences between the BL Lac objects that have been detected with the current-generation TeV instruments and those objects that have not yet been detected. Methods: We used a maximum-likelihood method to investigate the optical polarization fraction and its variability in these sources. In order to study the polarization position angle variability, we calculated the time derivative of the electric vector position angle (EVPA) change. We also studied the spread in the Stokes Q/I-U/I plane and rotations in the polarization plane. Results: The mean polarization fraction of the TeV-detected BL Lacs is 5%, while the non-TeV sources show a higher mean polarization fraction of 7%. This difference in polarization fraction disappears when the dilution by the unpolarized light of the host galaxy is accounted for. The TeV sources show somewhat lower fractional polarization variability amplitudes than the non-TeV sources. Also the fraction of sources with a smaller spread in the Q/I-U/I plane and a clumped distribution of points away from the origin, possibly indicating a preferred polarization angle, is larger in the TeV than in the non-TeV sources. These differences between TeV and non-TeV samples seem to arise from differences between intermediate and high spectral peaking sources instead of the TeV detection. When the EVPA variations are studied, the rate of EVPA change is similar in both samples. We detect significant EVPA rotations in both TeV and non-TeV sources, showing that rotations can occur in high spectral peaking BL Lac objects when the monitoring cadence is dense enough. Our simulations show that we cannot exclude a random walk origin for these rotations. Conclusions: These results indicate that there are no intrinsic differences in the polarization properties of the TeV-detected and non-TeV-detected high-energy BL Lac objects. This suggests that the polarization properties are not directly related to the TeV-detection, but instead the TeV loudness is connected to the general flaring activity, redshift, and the synchrotron peak location. The polarization curve data are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/596/A78
Nie, Mengyun; Demeaux, Julien; Young, Benjamin T.; ...
2015-07-23
Binder free (BF) graphite electrodes were utilized to investigate the effect of electrolyte additives fluoroethylene carbonate (FEC) and vinylene carbonate (VC) on the structure of the solid electrolyte interface (SEI). The structure of the SEI has been investigated via ex-situ surface analysis including X-ray Photoelectron spectroscopy (XPS), Hard XPS (HAXPES), Infrared spectroscopy (IR) and transmission electron microscopy (TEM). The components of the SEI have been further investigated via nuclear magnetic resonance (NMR) spectroscopy of D2O extractions. The SEI generated on the BF-graphite anode with a standard electrolyte (1.2 M LiPF6 in ethylene carbonate (EC) / ethyl methyl carbonate (EMC), 3/7more » (v/v)) is composed primarily of lithium alkyl carbonates (LAC) and LiF. Incorporation of VC (3% wt) results in the generation of a thinner SEI composed of Li2CO3, poly(VC), LAC, and LiF. Incorporation of VC inhibits the generation of LAC and LiF. Incorporation of FEC (3% wt) also results in the generation of a thinner SEI composed of Li2CO3, poly(FEC), LAC, and LiF. The concentration of poly(FEC) is lower than the concentration of poly(VC) and the generation of LAC is inhibited in the presence of FEC. The SEI appears to be a homogeneous film for all electrolytes investigated.« less
Spectroscopic and polarimetric study of radio-quiet weak emission line quasars
NASA Astrophysics Data System (ADS)
Kumar, Parveen; Chand, Hum; Gopal-Krishna; Srianand, Raghunathan; Stalin, Chelliah Subramonian; Petitjean, Patrick
2018-04-01
A small subset of optically selected radio-quiet QSOs with weak or no emission lines may turn out to be the elusive radio-quiet BL Lac objects, or simply be radio-quiet QSOs with an infant/shielded broad line region (BLR). High polarisation (p > 3-4%), a hallmark of BL Lacs, can be used to test whether some optically selected ‘radio-quiet weak emission line QSOs’ (RQWLQs) show a fractional polarisation high enough to qualify as radio-quiet analogues of BL Lac objects. To check this possibility, we have made optical spectral and polarisation measurements of a sample of 19 RQWLQs. Out of these, only 9 sources show a non-significant proper motion (hence very likely extragalactic) and only two of them are found to have p > 1%. For these two RQWLQs, namely J142505.59+035336.2 and J154515.77+003235.2, we found the highest polarization to be 1.59±0.53%, which is again too low to classify them as (radio-quiet) BL Lacs, although one may recall that even genuine BL Lacs sometimes appear weakly polarised. We also present a statistical comparison of the optical spectral index, for a sample of 45 RQWLQs with redshift-luminosity matched control samples of 900 QSOs and an equivalent sample of 120 blazars, assembled from the literature. The spectral index distribution of RQWLQs is found to differ, at a high significance level, from that of blazars. This, too, is consistent with the common view that the mechanism of the central engine in RQWLQs, as a population, is close to that operating in normal QSOs and the primary difference between them is related to the BLR.
Search for Cross-Correlations of Ultrahigh-Energy Cosmic Rays with BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Abbasi, R. U.; Abu-Zayyad, T.; Amann, J. F.; Archbold, G.; Belov, K.; Belz, J. W.; BenZvi, S.; Bergman, D. R.; Blake, S. A.; Boyer, J. H.; Burt, G. W.; Cao, Z.; Connolly, B. M.; Deng, W.; Fedorova, Y.; Findlay, J.; Finley, C. B.; Hanlon, W. F.; Hoffman, C. M.; Holzscheiter, M. H.; Hughes, G. A.; Hüntemeyer, P.; Jui, C. C. H.; Kim, K.; Kirn, M. A.; Knapp, B. C.; Loh, E. C.; Maestas, M. M.; Manago, N.; Mannel, E. J.; Marek, L. J.; Martens, K.; Matthews, J. A. J.; Matthews, J. N.; O'Neill, A.; Painter, C. A.; Perera, L.; Reil, K.; Riehle, R.; Roberts, M. D.; Rodriguez, D.; Sasaki, M.; Schnetzer, S. R.; Seman, M.; Sinnis, G.; Smith, J. D.; Snow, R.; Sokolsky, P.; Springer, R. W.; Stokes, B. T.; Thomas, J. R.; Thomas, S. B.; Thomson, G. B.; Tupa, D.; Westerhoff, S.; Wiencke, L. R.; Zech, A.; HIRES Collaboration
2006-01-01
Data taken in stereo mode by the High Resolution Fly's Eye (HiRes) air fluorescence experiment are analyzed to search for correlations between the arrival directions of ultrahigh-energy cosmic rays with the positions of BL Lacertae objects. Several previous claims of significant correlations between BL Lac objects and cosmic rays observed by other experiments are tested. These claims are not supported by the HiRes data. However, we verify a recent analysis of correlations between HiRes events and a subset of confirmed BL Lac objects from the 10th Veron Catalog, and we study this correlation in detail. Due to the a posteriori nature of the search, the significance level cannot be reliably estimated and the correlation must be tested independently before any claim can be made. We identify the precise hypotheses that will be tested with statistically independent data.
NASA Technical Reports Server (NTRS)
Pursimo, Tapio; Ojha, Roopesh; Jauncey, David L.; Rickett, Barney J.; Dutka, Michael S.; Koay, Jun Yi; Lovell, James E. J.; Bignall, Hayley E.; Kedziora-Chudczer, Lucyna; Macquart, Jean-Pierre
2013-01-01
Intraday variability (IDV) of the radio emission from active galactic nuclei is now known to be predominantly due to interstellar scintillation (ISS). The MASIV (The Microarcsecond Scintillation Induced Variability) survey of 443 at spectrum sources revealed that the IDV is related to the radio flux density and redshift. A study of the physical properties of these sources has been severely handicapped by the absence of reliable redshift measurements for many of these objects. This paper presents 79 new redshifts and a critical evaluation of 233 redshifts obtained from the literature. We classify spectroscopic identifications based on emission line properties, finding that 78% of the sources have broad emission lines and are mainly FSRQs. About 16% are weak lined objects, chiefly BL Lacs, and the remaining 6% are narrow line objects. The gross properties (redshift, spectroscopic class) of the MASIV sample are similar to those of other blazar surveys. However, the extreme compactness implied by ISS favors FSRQs and BL Lacs in the MASIV sample as these are the most compact object classes. We confirm that the level of IDV depends on the 5 GHz flux density for all optical spectral types. We find that BL Lac objects tend to be more variable than broad line quasars. The level of ISS decreases substantially above a redshift of about two. The decrease is found to be generally consistent with ISS expected for beamed emission from a jet that is limited to a fixed maximum brightness temperature in the source rest frame.
Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J
2011-08-09
The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society
Very high energy gamma-ray emission detected from PKS 1440-389 with H.E.S.S.
NASA Astrophysics Data System (ADS)
Hofmann, W.
2012-04-01
The BL Lac object PKS 1440-389, located at a tentative redshift of z=0.065 (6dF Galaxy Survey, Jones, D.H. et al. MNRAS 355, 747-763, 2004), has been reported as a hard (G=1.75+/-0.05), bright, and steady extragalactic source at GeV energies in the Fermi-LAT catalogue (2FGL J1443.9-3908, P.L. Nolan et al., 2012, ApJS, 199, 31). The extrapolation of the Fermi-LAT spectrum to very high energies (VHE; E> 100 GeV), together with its brightness in the radio and X-ray bands, makes this BL Lac object a good candidate for VHE emission.
NASA Astrophysics Data System (ADS)
Cortina, Juan
2013-05-01
H1722+119 is a BL Lac object, that was listed as candidate TeV blazar in Costamante & Ghisellini (2002) based on its X-ray and radio properties. Its redshift is uncertain; Sbarufatti et al. 2006 give z>0.17. The source has been detected by Fermi-LAT, in the Second Fermi Catalog with F(>1 GeV) (3.7+-0.3)e-09 cm^-2 s^-1 and with spectral index 1.92+-0.06. H1722+119 was observed for five nights by the MAGIC telescopes starting May 17th 2013 and collecting 11 hours of good quality data.
Inabu, Y; Saegusa, A; Inouchi, K; Koike, S; Oba, M; Sugino, T
2017-11-01
The objective of this study was to evaluate the effects of lactose inclusion in calf starters on plasma glucagon-like peptide (GLP)-1 and GLP-2 concentrations and gastrointestinal tract development in calves. Holstein bull calves (n = 45) were raised on an intensified nursing program using milk replacer containing 28.0% CP and 15.0% fat, and were fed a texturized calf starter containing 0 (control), 5.0 (LAC5), or 10.0% (LAC10; n = 15 for each treatment) lactose on a DM basis. Lactose was included in the starter by partially replacing dry ground corn in pelleted portion of the starter. All calf starters were formulated with 23.1% CP. The ethanol-soluble carbohydrate concentrations of the control, LAC5, and LAC10 starters were 7.3, 12.3, and 16.8% on a DM basis, respectively. Starch concentrations of the control, LAC5, and LAC10 starters were 29.7, 27.0, and 21.4% on a DM basis, respectively. All calves were fed treatment calf starters ad libitum. Blood samples were obtained weekly from 1 to 11 wk of age, and used to measure plasma GLP-1, GLP-2, and insulin concentrations, serum β-hydroxybutyrate (BHB) concentration, and blood glucose concentration. At 80 d of age, calves were euthanized, and weights of the reticulorumen, omasum, abomasum, small intestine, and large intestine tissue were measured. Serum BHB concentration was higher for calves fed the LAC10 (171 μmol/L) starter than for those fed the control (151 μmol/L) and LAC5 (145 μmol/L) starters. Plasma GLP-1 and GLP-2 concentrations did not differ between treatments. However, relative to the baseline (1 wk of age), the plasma GLP-1 concentration was higher for the LAC10 (125.9%) than for the LAC5 (68.2%) and control (36.8%), and for the LAC5 than for the control (36.8%). Moreover, similar differences between treatments were observed for GLP-2 concentration relative to the baseline (88.2, 76.9, and 74.9% for LAC10, LAC5, and control treatments, respectively). The serum BHB concentration was positively correlated with the plasma GLP-1 concentration (r = 0.428). Furthermore, the plasma GLP-1 concentration was positively correlated with the insulin concentration (r = 0.793). The weights of the reticulorumen, omasum, abomasum, small intestine, and large intestine were not affected by the treatments. In conclusion, inclusion of lactose in calf starters resulted in higher plasma GLP-1 and GLP-2 concentrations, and BHB might be associated with higher plasma GLP-1 concentration. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)
NASA Astrophysics Data System (ADS)
Marcha, M. J. M.; Caccianiga, A.
2014-04-01
This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).
Beckman, Sarah A; Chen, William C W; Tang, Ying; Proto, Jonathan D; Mlakar, Logan; Wang, Bing; Huard, Johnny
2013-08-01
We previously reported that mechanical stimulation increased the effectiveness of muscle-derived stem cells (MDSCs) for tissue repair. The objective of this study was to determine the importance of vascular endothelial growth factor (VEGF) on mechanically stimulated MDSCs in a murine model of muscle regeneration. MDSCs were transduced with retroviral vectors encoding the LacZ reporter gene (lacZ-MDSCs), the soluble VEGF receptor Flt1 (sFlt1-MDSCs), or a short hairpin RNA (shRNA) targeting messenger RNA of VEGF (shRNA_VEGF MDSCs). Cells were subjected to 24 hours of mechanical cyclic strain and immediately transplanted into the gastrocnemius muscles of mdx/scid mice. Two weeks after transplantation, angiogenesis, fibrosis, and regeneration were analyzed. There was an increase in angiogenesis in the muscles transplanted with mechanically stimulated lacZ-MDSCs compared with nonstimulated lacZ-MDSCs, sFlt1-MDSCs, and shRNA _VEGF MDSCs. Dystrophin-positive myofiber regeneration was significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. In vitro proliferation of MDSCs was not decreased by inhibition of VEGF; however, differentiation into myotubes and adhesion to collagen were significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. The beneficial effects of mechanical stimulation on MDSC-mediated muscle repair are lost by inhibiting VEGF.
Evaluation of anaerobic threshold in non-pregnant and pregnant rats.
Netto, Aline Oliveira; Macedo, Nathália C D; Gallego, Franciane Q; Sinzato, Yuri K; Volpato, Gustavo T; Damasceno, Débora C
2017-01-01
Several studies present different methodologies and results about intensity exercise, and many of them are performed in male rats. However, the impact of different type, intensity, frequency and duration of exercise on female rats needs more investigation. From the analysis of blood lactate concentration during lactate minimum test (LacMin) in the swimming exercise, the anaerobic threshold (AT) was identified, which parameter is defined as the transition point between aerobic and anaerobic metabolism. LacMin test is considered a good indicator of aerobic conditioning and has been used in prescription of training in different exercise modalities. However, there is no evidence of LacMin test in female rats. The objective was to determine AT in non-pregnant and pregnant Wistar rats. The LacMin test was performed and AT defined for mild exercise intensity was from a load equivalent to 1% of body weight (bw), moderate exercise as carrying 4% bw and severe intensity as carrying 7% bw. In pregnant rats, the AT was reached at a lower loading from 5.0% to 5.5% bw, while in non-pregnant the load was from 5.5% to 6.0% bw. Thus, this study was effective to identify exercise intensities in pregnant and non-pregnant rats using anaerobic threshold by LacMin test.
Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan
2014-01-01
Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with K m and k cat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987
Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio
2008-01-01
Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101
The X-ray spectra of the BL Lacertae objects PKS 0548 - 322 and 3C 66A
NASA Technical Reports Server (NTRS)
Maccacaro, T.; Maccagni, D.; Tarenghi, M.
1983-01-01
Einstein Observatory simultaneous imaging proportional counter and monitor proportional counter data are combined in order to derive the energy spectra of the BL Lac objects PKS 0548-322 and 3C 66A between 0.2 and 10 keV. While the latter is found to be variable in both intensity and spectral shape, the former, although constant in the present data, is found to have experienced a spectrum variation in view of results from other experiments. Attention is given to the implications of flux and spectral variability in BL Lac objects for models of X-ray emission mechanisms. It is suggested that the wide spread of the spectral index distribution is due to the detection of the highly variable synchrotron-produced X-rays that are generally undetected in QSOs.
A KPC-scale X-ray jet in the BL LAC Source S5 2007+777
NASA Technical Reports Server (NTRS)
Sambruna, Rita; Maraschi, Laura; Tavecchio, Fabrizio
2008-01-01
The BL Lac S3 2007++777, a classical radio-selected BL Lac from the sample of Stirkel et al. exhibiting an extended (19") radio jet. was observed with Chandra revealing an X-ray jet with simi1ar morphology. The hard X-ray spectrum and broad band SED is consistent with an IC/CMB origin for the X-ray emission, implying a highly relativistic flow at small angle to the line of sight with an unusually large deprojected length, 300 kpc. A structured jet consisting of a fast spine and slow wall is consistent with the observations.
Gamma-Ray-emitting Narrow-line Seyfert 1 Galaxies in the Sloan Digital Sky Survey
NASA Astrophysics Data System (ADS)
Paliya, Vaidehi S.; Ajello, M.; Rakshit, S.; Mandal, Amit Kumar; Stalin, C. S.; Kaur, A.; Hartmann, D.
2018-01-01
The detection of significant γ-ray emission from radio-loud narrow-line Seyfert 1 (NLSy1s) galaxies enables us to study jets in environments different than those in blazars. However, due to the small number of known γ-ray-emitting NLSy1 (γ-NLSy1) galaxies, a comprehensive study could not be performed. Here, we report the first detection of significant γ-ray emission from four active galactic nuclei (AGNs), recently classified as NLSy1 from their Sloan Digital Sky Survey (SDSS) optical spectrum. Three flat-spectrum radio quasars (FSRQs) present in the third Large Area Telescope AGN catalog (3LAC) are also found as γ-NLSy1 galaxies. Comparing the γ-ray properties of these objects with 3LAC blazars reveals their spectral shapes to be similar to FSRQs, however, with low γ-ray luminosity (≲1046–47 erg s‑1). In the Wide-field Infrared Survey Explorer color–color diagram, these objects occupy a region mainly populated by FSRQs. Using the H β emission line parameters, we find that on average γ-NLSy1 have smaller black hole masses than FSRQs at similar redshifts. In the low-resolution SDSS image of one of the γ-NLSy1 source, we find the evidence of an extended structure. We conclude by noting that overall many observational properties of γ-NLSy1 sources are similar to FSRQs, and therefore these objects could be their low black hole mass counterparts, as predicted in the literature.
Sutherland, K; del Río, J C
2014-04-18
A variety of lac resin samples obtained from artists' suppliers, industrial manufacturers, and museum collections were analysed using gas chromatography mass spectrometry (GCMS) and reactive pyrolysis GCMS with quaternary ammonium reagents. These techniques allowed a detailed chemical characterisation of microgram-sized samples, based on the detection and identification of derivatives of the hydroxy aliphatic and cyclic (sesquiterpene) acids that compose the resin. Differences in composition could be related to the nature of the resin, e.g. wax-containing (unrefined), bleached, or aged samples. Furthermore, differences in the relative abundances of aliphatic hydroxyacids appear to be associated with the biological source of the resin. The diagnostic value of newly characterised lac components, including 8-hydroxyacids, is discussed here for the first time. Identification of derivatised components was aided by AMDIS deconvolution software, and discrimination of samples was enhanced by statistical evaluation of data using principal component analysis. The robustness of the analyses, together with the minimal sample size required, make these very powerful approaches for the characterisation of lac resin in museum objects. The value of such analyses for enhancing the understanding of museum collections is illustrated by two case studies of objects in the collection of the Philadelphia Museum of Art: a restorer's varnish on a painting by Luca Signorelli, and a pictorial inlay in an early nineteenth-century High Chest by George Dyer. Copyright © 2014 Elsevier B.V. All rights reserved.
Radio morphology and parent population of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Laurent-Muehleisen, S. A.; Kollgaard, R. I.; Moellenbrock, G. A.; Feigelson, E. D.
1993-01-01
High-dynamic range (typically 1700:1) radio maps of 15 X-ray BL Lac (XBL) objects from the HEAO-1 Large Area Sky Survey are presented. Morphological characteristics of these sources are compared with Fanaroff-Riley (FR) class I radio galaxies in the context of unified schemes, with reference to one-sided kiloparsec-scale emission. Evidence that cluster membership of XBLs is significantly higher than previously thought is also presented. It is shown that the extended radio powers, X-ray emission, core-to-lobe ratios, and linear sizes of the radio selected BL Lac (RBL) and XBL populations are consistent with an FR I radio galaxy parent population. A source list and VLA observing log and map parameters are provided.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pursimo, Tapio; Ojha, Roopesh; Jauncey, David L.
2013-04-10
Intraday variability (IDV) of the radio emission from active galactic nuclei is now known to be predominantly due to interstellar scintillation (ISS). The MASIV (The Micro-Arcsecond Scintillation-Induced Variability) survey of 443 flat spectrum sources revealed that the IDV is related to the radio flux density and redshift. A study of the physical properties of these sources has been severely handicapped by the absence of reliable redshift measurements for many of these objects. This paper presents 79 new redshifts and a critical evaluation of 233 redshifts obtained from the literature. We classify spectroscopic identifications based on emission line properties, finding thatmore » 78% of the sources have broad emission lines and are mainly FSRQs. About 16% are weak lined objects, chiefly BL Lacs, and the remaining 6% are narrow line objects. The gross properties (redshift, spectroscopic class) of the MASIV sample are similar to those of other blazar surveys. However, the extreme compactness implied by ISS favors FSRQs and BL Lacs in the MASIV sample as these are the most compact object classes. We confirm that the level of IDV depends on the 5 GHz flux density for all optical spectral types. We find that BL Lac objects tend to be more variable than broad line quasars. The level of ISS decreases substantially above a redshift of about two. The decrease is found to be generally consistent with ISS expected for beamed emission from a jet that is limited to a fixed maximum brightness temperature in the source rest frame.« less
NASA Astrophysics Data System (ADS)
Krawczynski, H.
2007-04-01
In this paper we discuss models of the X-ray and TeV γ-ray emission from BL Lac objects based on parallel electron-positron or electron-proton beams that form close to the central black hole, due to the strong electric fields generated by the accretion disk and possibly also by the black hole itself. Fitting the energy spectrum of the BL Lac object Mrk 501, we obtain tight constraints on the beam properties. Launching a sufficiently energetic beam requires rather strong magnetic fields close to the black hole (~100-1000 G). However, the model fits imply that the magnetic field in the emission region is only ~0.02 G. Thus, the particles are accelerated close to the black hole and propagate a considerable distance before instabilities trigger the dissipation of energy through synchrotron and self-Compton emission. We discuss various approaches to generate enough power to drive the jet and, at the same time, to accelerate particles to ~20 TeV energies. Although the parallel beam model has its own problems, it explains some of the long-standing problems that plague models based on Fermi-type particle acceleration, such as the presence of a very high minimum Lorentz factor of accelerated particles. We conclude with a brief discussion of the implications of the model for the difference between the processes of jet formation in BL Lac-type objects and those in quasars.
Robinson, Patrick A; Orroth, Kate K; Stutts, Lauren A; Baron, Patrick A; Wessner, David R
2018-05-01
The prevalence of public health and global health (PH/GH) curricular offerings appear to be increasing in terms of undergraduate curricula and in the context of liberal arts education in the United States. Liberal arts colleges (LACs) represent stand-alone institutions, which exclusively focus on undergraduate education. The objective of this study was to assess the prevalence of PH/GH study pathways and PH/GH course offerings among LACs. All LACs identified through the US News and World Report (USNWR) college rankings were contacted with a survey about the following: formal majors, minors, or concentrations in PH/GH; independent study (IS) pathways for PH/GH; specific PH/GH courses offered; and the number of students graduating in 2016, 2017, and 2018 with formal and IS degrees in PH/GH. Demographic characteristics of the colleges came from the USNWR database. Almost half (43%) of all LACs in our sample offer a PH/GH major, minor, concentration, or IS pathway. Almost all (90%) colleges offer at least one course in PH/GH. Approximately 2,000 students attending these LACs pursued or are pursuing graduation with majors, minors, or concentrations in PH/GH for the years 2016-2018. The number of students pursuing formal PH/GH programs has increased by 25% from 2016 to 2018. Student interest in public health is rising in U.S. LACs, with more students seeking formal curricular or IS PH degree pathways. Public health messages are prevalent even among institutions without formal programs. Colleges without programs should consider integrating public health into their curriculum.
Afzal, Muhammad; Shafeeq, Sulman
2014-01-01
Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into two operons, i.e., lac operon I (lacABCD) and lac operon II (lacTFEG). Deletion of the DeoR family transcriptional regulator lacR that is present downstream of the lac gene cluster revealed elevated expression of lac operon I even in the absence of lactose. This suggests a function of LacR as a transcriptional repressor of lac operon I, which encodes enzymes involved in the phosphorylated tagatose pathway in the absence of lactose or galactose. Deletion of lacR did not affect the expression of lac operon II, which encodes a lactose-specific phosphotransferase. This finding was further confirmed by β-galactosidase assays with PlacA-lacZ and PlacT-lacZ in the presence of either lactose or glucose as the sole carbon source in the medium. This suggests the involvement of another transcriptional regulator in the regulation of lac operon II, which is the BglG-family transcriptional antiterminator LacT. We demonstrate the role of LacT as a transcriptional activator of lac operon II in the presence of lactose and CcpA-independent regulation of the lac gene cluster in S. pneumoniae. PMID:24951784
Spectroscopy of 10 γ -Ray BL Lac Objects at High Redshift
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paiano, Simona; Falomo, Renato; Landoni, Marco
2017-08-01
We present optical spectra with high signal-to-noise ratio of 10 BL Lac objects detected at GeV energies by the Fermi satellite (3FGL catalog), which previous observations suggested are at relatively high redshift. The new observations, obtained at the 10 m Gran Telescopio Canarias, allowed us to find the redshift for J0814.5+2943 ( z = 0.703), and we can set a spectroscopic lower limit for J0008.0+4713 ( z > 1.659) and J1107.7+0222 ( z > 1.0735) on the basis of Mg ii intervening absorption features. In addition we confirm the redshifts for J0505.5+0416 ( z = 0.423) and J1450+5200 ( zmore » > 2.470). Finally we contradict the previous z estimates for five objects (J0049.7+0237, J0243.5+7119, J0802.0+1005, J1109.4+2411, and J2116.1+3339).« less
NASA Technical Reports Server (NTRS)
Falomo, Renato; Pesce, Joseph E.; Treves, Aldo
1995-01-01
We report on direct, subarcsecond resolution imaging of the nebulosity and spectroscopy of galaxies in the field of the BL Lacertae object PKS 0548-322. Surface photometry of the nebulosity is used to derive the properties of the host galaxy (M(sub V) = -23.4), which exhibits signs of interaction with a close companion galaxy at approximately 25 kpc. The radial brightness profile of the nebulosity is well fitted by the contribution of a bulge (r(exp 1/4)) plus a point source and a small internal disk. An analysis of the galaxies in the field shows that the source is located in a rich cluster of galaxies. Spectra of five galaxies in the field indicate that they are at the same redshift as the BL Lac object, thus supporting the imaging result of a surrounding cluster associated with the BL Lac. This cluster is most likely Abell S0549.
NASA Astrophysics Data System (ADS)
Torres-Zafra, Juanita; Cellone, Sergio A.; Buzzoni, Alberto; Andruchow, Ileana; Portilla, José G.
2018-03-01
The BL Lac object 3C 66A is one of the most luminous extragalactic sources at TeV γ-rays (very high energy, i.e. E > 100 GeV). Since TeV γ-ray radiation is absorbed by the extragalactic background light (EBL), it is crucial to know the redshift of the source in order to reconstruct its original spectral energy distribution, as well as to constrain EBL models. However, the optical spectrum of this BL Lac is almost featureless, so a direct measurement of z is very difficult; in fact, the published redshift value for this source (z = 0.444) has been strongly questioned. Based on EBL absorption arguments, several constraints to its redshift, in the range 0.096 < z < 0.5, were proposed. Since these active galactic nuclei (AGNs) are hosted, typically, in early-type galaxies that are members of groups or clusters, we have analysed spectro-photometrically the environment of 3C 66A, with the goal of finding the galaxy group hosting this blazar. This study was made using optical images of a 5.5 × 5.5 arcmin2 field centred on the blazar, and spectra of 24 sources obtained with Gemini/GMOS-N multi-object spectroscopy. We found spectroscopic evidence of two galaxy groups along the blazar's line of sight: one at z ≃ 0.020 and the second one at z ≃ 0.340. The first one is consistent with a known foreground structure, while the second group presented here has six spectroscopically confirmed members. Their location along a red sequence in the colour-magnitude diagram allows us to identify 34 additional candidate members of the more distant group. The blazar's spectrum shows broad absorption features that we identify as arising in the intergalactic medium, thus allowing us to tentatively set a redshift lower limit at z_3C66A ≳ 0.33. As a consequence, we propose that 3C 66A is hosted in a galaxy that belongs to a cluster at z = 0.340.
NASA Astrophysics Data System (ADS)
Kranich, D.
1999-08-01
The BL Lac Object Mkn 501 was in a state of high activity in the TeV range in 1997. During this time Mkn 501 was observed by all Cherenkov-Telescopes of the HEGRA-Collaboration. Part of the data were also taken during moonshine thus providing a nearly continuous coverage for this object in the TeV-range. We have carried out a QPO analysis and found evidence for a 23 day periodicity. We applied the same analysis on the 'data by dwell' x-ray lightcurve from the RXTE/ASM database and found also evidence for the 23 day periodicity. The combined probability was -.
Kadam, Avinash A; Jang, Jiseon; Lee, Dae Sung
2017-05-10
Halloysite nanotubes (HNTs) were tuned with supermagnetic Fe 3 O 4 (M-HNTs) and functionalized with γ-aminopropyltriethoxysilane (APTES) (A-M-HNTs). Gluteraldehyde (GTA) was linked to A-M-HNTs (A-M-HNTs-GTA) and explored for covalent laccase immobilization. The structural characterization of M-HNTs, A-M-HNTs, and A-M-HNTs-GTA-immobilized laccase (A-M-HNTs-GTA-Lac) was determined by X-ray photoelectron spectroscopy, field-emission high-resolution transmission electron microscopy, a magnetic property measurement system, and thermogavimetric analyses. A-M-HNTs-GTA-Lac gave 90.20% activity recovery and a loading capability of 84.26 mg/g, with highly improved temperature and storage stabilities. Repeated usage of A-M-HNTs-GTA-Lac revealed a remarkably consistent relative activity of 80.49% until the ninth cycle. The A-M-HNTs-GTA-Lac gave consistent redox-mediated sulfamethoxazole (SMX) degradation up to the eighth cycle. In the presence of guaiacol, A-M-HNTs-GTA-Lac gave elevated SMX degradation compared with 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic acid) and syrinialdehyde. Therefore, the A-M-HNTs can serve as supermagnetic amino-functionalized nanoreactors for biomacromolecule immobilization. The obtained A-M-HNTs-GTA-Lac is an environmentally friendly biocatalyst for effective degradation of micropollutants, such as SMX, and can be easily retrieved from an aqueous solution by a magnet after decontamination of pollutants in water and wastewater.
Lee, Ji-Yeong; Kwak, Mi-Sun; Roh, Jong-Bok; Kim, Kwang; Sung, Moon-Hee
2017-03-28
Pediococcus pentosaceus ID-7 was isolated from kimchi, a Korean fermented food, and it showed high activity for lactose hydrolysis. The β-galactosidase of P. pentosaceus ID-7 belongs to the GH2 group, which is composed of two distinct proteins. The heterodimeric LacLM type of β-galactosidase found in P. pentosaceus ID-7 consists of two genes partially overlapped, lacL and lacM encoding LacL (72.2 kDa) and LacM (35.4 kDa). In this study, Escherichia coli MM294 was used for the production of LacL, LacM, and LacLM. These three types of recombinant proteins were expressed, purified, and characterized. The specific activities of LacLM and LacL were 339 and 31 U/mg, respectively. However, activity was not detected with LacM alone. The optimal pH of LacLM and LacL was pH 7.5 and pH 7.0, and the optimal temperature of LacLM and LacL was 40°C and 50°C, respectively. The optimal temperature changes indicate that LacLM is able to achieve higher activity at a relatively lower temperature. LacLM was strongly activated by Mg 2+ , Mn 2+ , and Zn 2+ , which was not true for LacL. Consistent with this, EDTA strongly inactivated LacLM and LacL, but the presence of reducing agents did not dramatically alter the activity. Taken together, multiple alignment of amino acid sequences and phylogenetic analysis results of LacL and LacM of P. pentosaceus ID-7 suggest the evolution of LacL into LacLM and that the use of divalent metal ions results in higher activity.
Application of Zoning and ``Limits of Acceptable Change'' to Manage Snorkelling Tourism
NASA Astrophysics Data System (ADS)
Roman, George S. J.; Dearden, Philip; Rollins, Rick
2007-06-01
Zoning and applying Limits of Acceptable Change (LAC) are two promising strategies for managing tourism in Marine Protected Areas (MPAs). Typically, these management strategies require the collection and integration of ecological and socioeconomic data. This problem is illustrated by a case study of Koh Chang National Marine Park, Thailand. Biophysical surveys assessed coral communities in the MPA to derive indices of reef diversity and vulnerability. Social surveys assessed visitor perceptions and satisfaction with conditions encountered on snorkelling tours. Notably, increased coral mortality caused a significant decrease in visitor satisfaction. The two studies were integrated to prescribe zoning and “Limits of Acceptable Change” (LAC). As a biophysical indicator, the data suggest a LAC value of 0.35 for the coral mortality index. As a social indicator, the data suggest that a significant fraction of visitors would find a LAC value of under 30 snorkellers per site as acceptable. The draft zoning plan prescribed four different types of zones: (I) a Conservation Zone with no access apart from monitoring or research; (II) Tourism Zones with high tourism intensities at less vulnerable reefs; (III) Ecotourism zones with a social LAC standard of <30 snorkellers per site, and (IV) General Use Zones to meet local artisanal fishery needs. This study illustrates how ecological and socioeconomic field studies in MPAs can be integrated to craft zoning plans addressing multiple objectives.
Application of zoning and "limits of acceptable change" to manage snorkelling tourism.
Roman, George S J; Dearden, Philip; Rollins, Rick
2007-06-01
Zoning and applying Limits of Acceptable Change (LAC) are two promising strategies for managing tourism in Marine Protected Areas (MPAs). Typically, these management strategies require the collection and integration of ecological and socioeconomic data. This problem is illustrated by a case study of Koh Chang National Marine Park, Thailand. Biophysical surveys assessed coral communities in the MPA to derive indices of reef diversity and vulnerability. Social surveys assessed visitor perceptions and satisfaction with conditions encountered on snorkelling tours. Notably, increased coral mortality caused a significant decrease in visitor satisfaction. The two studies were integrated to prescribe zoning and "Limits of Acceptable Change" (LAC). As a biophysical indicator, the data suggest a LAC value of 0.35 for the coral mortality index. As a social indicator, the data suggest that a significant fraction of visitors would find a LAC value of under 30 snorkellers per site as acceptable. The draft zoning plan prescribed four different types of zones: (I) a Conservation Zone with no access apart from monitoring or research; (II) Tourism Zones with high tourism intensities at less vulnerable reefs; (III) Ecotourism zones with a social LAC standard of <30 snorkellers per site, and (IV) General Use Zones to meet local artisanal fishery needs. This study illustrates how ecological and socioeconomic field studies in MPAs can be integrated to craft zoning plans addressing multiple objectives.
Louisiana SIP: LAC 33:III Ch. 5 Section 509. Prevention of Significant Deterioration; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) and 1991-07-01 (LAc57) and 1996-12-16 (LAc69) to 2011-08-17 (LAd36 - Revised)
Zheng, Weijiang; Ji, Xu; Zhang, Qing; Yao, Wen
2018-06-16
The objective of the current experiment was to explore the intestinal microbiota ecological response to oral administrations of hydrogen-rich water (HRW) and lactulose (LAC) in female piglets fed a Fusarium mycotoxin-contaminated diet. A total of 24 individually-housed female piglets (Landrace × large × white; initial average body weight, 7.25 ± 1.02 kg) were randomly assigned to receive four treatments (six pigs/treatment): uncontaminated basal diet (negative control, NC), mycotoxin-contaminated diet (MC), MC diet + HRW (MC + HRW), and MC diet + LAC (MC + LAC) for 25 days. Hydrogen levels in the mucosa of different intestine segments were measured at the end of the experiment. Fecal scoring and diarrhea rate were recorded every day during the whole period of the experiment. Short-chain fatty acids (SCFAs) profiles in the digesta of the foregut and hindgut samples were assayed. The populations of selected bacteria and denaturing gradient gel electrophoresis (DGGE) profiles of total bacteria and methanogenic Archaea were also evaluated. Results showed that Fusarium mycotoxins not only reduced the hydrogen levels in the caecum but also shifted the SCFAs production, and populations and communities of microbiota. HRW treatment increased the hydrogen levels of the stomach and duodenum. HRW and LAC groups also had higher colon and caecum hydrogen levels than the MC group. Both HRW and LAC protected against the mycotoxin-contaminated diet-induced higher diarrhea rate and lower SCFA production in the digesta of the colon and caecum. In addition, the DGGE profile results indicated that HRW and LAC might shift the pathways of hydrogen-utilization bacteria, and change the diversity of intestine microbiota. Moreover, HRW and LAC administrations reversed the mycotoxin-contaminated diet-induced changing of the populations of Escherichia coli (E. coli) and Bifidobacterium in ileum digesta and hydrogen-utilizing bacteria in colon digesta.
Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise
2011-01-01
Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792
Mitchell, J M; McNab, W B; Yee, A J; Griffiths, M W; McEwen, S A; Spilsbury, L; Boison, J O
1998-08-01
The Lactek test, marketed for antimicrobial residue detection in milk, was validated for the detection of antimicrobial residues in tissues. A previous study found that the LacTek test could confidently identify tissue samples spiked with antimicrobial residues. However, the test could not reliably distinguish violative from nonviolative spiked samples relative to Canadian maximum residue limits (MRLs). The objectives of this study were to assess and compare the performance of the LacTek tests for beta-lactams, tetracyclines, gentamicin, and sulfamethazine on samples containing naturally incurred residues by running the test in parallel with the standard microbial inhibition test (MIT) presently used for the routine testing of tissues at our facility and to assess the agreement with high pressure liquid chromatographic (HPLC) determinative methods. Parallel testing with the official MIT found that the Lactek tests could be confidently used for testing tissue samples containing incurred residues. Among 1,008 MIT-positive samples, the LacTek test found that 90% contained beta-lactams and/or tetracyclines. A further 7.3% of violative residues could not be identified to an antimicrobial class. In addition, 9% of samples testing negative on the MIT were found to contain an antimicrobial residue by the LacTek tests. Comparative testing with HPLC methods found that there was very good agreement between the two tests and that most violations were due to penicillin G and oxytetracycline. Although the LacTek test cannot be used to distinguish violative from nonviolative residue levels, it does offer several advantages over the present MIT. These include speed, ease of use, the ability to identify residues to a specific class, and an improved sensitivity at the MRL level for the most commonly found antimicrobials in tissue.
The Second Catalog Of Active Galactic Nuclei Detected By The Fermi Large Area Telescope
Ackermann, M.
2011-12-02
The second catalog of active galactic nuclei (AGNs) detected by the Fermi Large Area Telescope (LAT) in two years of scientific operation is presented. The Second LAT AGN Catalog (2LAC) includes 1017 γ-ray sources located at high Galactic latitudes (|b| > 10°) that are detected with a test statistic (TS) greater than 25 and associated statistically with AGNs. However some of these are affected by analysis issues and some are associated with multiple AGNs. Consequently we define a clean sample which includes 886 AGNs, comprising 395 BL Lacertae objects (BL Lacs), 310 flat-spectrum radio quasars (FSRQs), 157 candidate blazars ofmore » unknown type (i.e., with broad-band blazar characteristics but with no optical spectral measurement yet), eight misaligned AGNs, four narrow-line Seyfert 1 (NLS1s), 10 AGNs of other types and two starburst galaxies. Where possible, the blazars have been further classified based on their spectral energy distributions (SEDs) as archival radio, optical, and X-ray data permit. While almost all FSRQs have a synchrotron-peak frequency < 10 14 Hz, about half of the BL Lacs have a synchrotron-peak frequency > 10 15 Hz. The 2LAC represents a significant improvement relative to the First LAT AGN Catalog (1LAC), with 52% more associated sources. The full characterization of the newly detected sources will require more broad-band data. Various properties, such as γ-ray fluxes and photon power law spectral indices, redshifts, γ-ray luminosities, variability, and archival radio luminosities—and their correlations are presented and discussed for the different blazar classes. The general trends observed in 1LAC are confirmed.« less
Kumar, Hemant; Finer-Moore, Janet S.; Kaback, H. Ronald; Stroud, Robert M.
2015-01-01
The X-ray crystal structure of a conformationally constrained mutant of the Escherichia coli lactose permease (the LacY double-Trp mutant Gly-46→Trp/Gly-262→Trp) with bound p-nitrophenyl-α-d-galactopyranoside (α-NPG), a high-affinity lactose analog, is described. With the exception of Glu-126 (helix IV), side chains Trp-151 (helix V), Glu-269 (helix VIII), Arg-144 (helix V), His-322 (helix X), and Asn-272 (helix VIII) interact directly with the galactopyranosyl ring of α-NPG to provide specificity, as indicated by biochemical studies and shown directly by X-ray crystallography. In contrast, Phe-20, Met-23, and Phe-27 (helix I) are within van der Waals distance of the benzyl moiety of the analog and thereby increase binding affinity nonspecifically. Thus, the specificity of LacY for sugar is determined solely by side-chain interactions with the galactopyranosyl ring, whereas affinity is increased by nonspecific hydrophobic interactions with the anomeric substituent. PMID:26157133
Investigating Self-Perceptions and Resilience in Looked after Children
ERIC Educational Resources Information Center
Honey, Kyla L.; Rees, Paul; Griffey, Simon
2011-01-01
The perceptions of Looked After Children (LAC; n = 51), their Designated Teachers (DTs), and a sample of non-LAC (n = 99) were elicited. LAC held more positive self-perceptions than the non-LAC, and similarly positive ratings were given for the LAC by their DTs; but LAC held lower career aspirations than the non-LAC. LAC differed in their levels…
Two modes of control of pilA, the gene encoding type 1 pilin in Escherichia coli.
Orndorff, P E; Spears, P A; Schauer, D; Falkow, S
1985-01-01
Type 1 piliation in Escherichia coli is subject to metastable regulation at the transcriptional level (B. I. Eisenstein, Science 214:337-339, 1981). However, the genes controlling in this fashion are not known. We present evidence that the pilA gene, encoding the structural subunit of type 1 pili, is subject to metastable transcriptional regulation. A pilA'-lacZ fusion, constructed in vitro on a recombinant plasmid, was used in conjunction with a recBC sbcB mutant of E. coli K-12 to introduce the fusion into the chromosomal region encoding Pil. This fusion was found to be subject to metastable transcriptional control. The rate of switching from the Lac+ to the Lac- phenotype was 4 X 10(-4) per cell per generation and 6.2 X 10(-4) in the opposite direction. A ca. 10-fold difference in beta-galactosidase activity was observed between phenotypically "ON" (Lac+) and "OFF" (Lac-) populations. P1 transduction experiments showed that the element determining the ON or OFF phenotype was tightly linked to pilA. In addition to the metastable regulation of pilA, a second type of transcriptional regulation was effected by the product of a gene, hyp, adjacent to pilA. By using a recombinant plasmid containing just a pilA'-lacZ fusion and the putative pilA promoter, we found that a lesion in hyp conferred a beta-galactosidase activity about fivefold higher than that of a strain possessing the parental hyp gene. Mutants constructed to have a pilA'-lacZ fusion and a hyp::Tn5-132 mutation in the chromosome exhibited a frequency of switching from Lac+ to Lac- and vice versa indistinguishable from that of the parental strain. However, in the ON mode, hyp::Tn5-132 mutants showed a twofold-higher beta-galactosidase activity. Thus, hyp does not appear to affect metastable variation but does affect the level of transcription of the pilA gene in the ON (transcribed) mode. Images PMID:3930469
Meinhardt, Sarah; Swint-Kruse, Liskin
2008-12-01
In protein families, conserved residues often contribute to a common general function, such as DNA-binding. However, unique attributes for each homolog (e.g. recognition of alternative DNA sequences) must arise from variation in other functionally-important positions. The locations of these "specificity determinant" positions are obscured amongst the background of varied residues that do not make significant contributions to either structure or function. To isolate specificity determinants, a number of bioinformatics algorithms have been developed. When applied to the LacI/GalR family of transcription regulators, several specificity determinants are predicted in the 18 amino acids that link the DNA-binding and regulatory domains. However, results from alternative algorithms are only in partial agreement with each other. Here, we experimentally evaluate these predictions using an engineered repressor comprising the LacI DNA-binding domain, the LacI linker, and the GalR regulatory domain (LLhG). "Wild-type" LLhG has altered DNA specificity and weaker lacO(1) repression compared to LacI or a similar LacI:PurR chimera. Next, predictions of linker specificity determinants were tested, using amino acid substitution and in vivo repression assays to assess functional change. In LLhG, all predicted sites are specificity determinants, as well as three sites not predicted by any algorithm. Strategies are suggested for diminishing the number of false negative predictions. Finally, individual substitutions at LLhG specificity determinants exhibited a broad range of functional changes that are not predicted by bioinformatics algorithms. Results suggest that some variants have altered affinity for DNA, some have altered allosteric response, and some appear to have changed specificity for alternative DNA ligands.
Fantini, Jacques; Garmy, Nicolas; Yahi, Nouara
2006-09-12
Protein-glycolipid interactions mediate the attachment of various pathogens to the host cell surface as well as the association of numerous cellular proteins with lipid rafts. Thus, it is of primary importance to identify the protein domains involved in glycolipid recognition. Using structure similarity searches, we could identify a common glycolipid-binding domain in the three-dimensional structure of several proteins known to interact with lipid rafts. Yet the three-dimensional structure of most raft-targeted proteins is still unknown. In the present study, we have identified a glycolipid-binding domain in the amino acid sequence of a bacterial adhesin (Helicobacter pylori adhesin A, HpaA). The prediction was based on the major properties of the glycolipid-binding domains previously characterized by structural searches. A short (15-mer) synthetic peptide corresponding to this putative glycolipid-binding domain was synthesized, and we studied its interaction with glycolipid monolayers at the air-water interface. The synthetic HpaA peptide recognized LacCer but not Gb3. This glycolipid specificity was in line with that of the whole bacterium. Molecular modeling studies gave some insights into this high selectivity of interaction. It also suggested that Phe147 in HpaA played a key role in LacCer recognition, through sugar-aromatic CH-pi stacking interactions with the hydrophobic side of the galactose ring of LacCer. Correspondingly, the replacement of Phe147 with Ala strongly affected LacCer recognition, whereas substitution with Trp did not. Our method could be used to identify glycolipid-binding domains in microbial and cellular proteins interacting with lipid shells, rafts, and other specialized membrane microdomains.
NASA Astrophysics Data System (ADS)
Bolle, Olivier; Charlier, Bernard; Bascou, Jérôme; Diot, Hervé; McEnroe, Suzanne A.
2014-08-01
The Lac Tio hemo-ilmenite ore body crops out in the outer portion of the 1.06 Ga Lac Allard anorthosite, a member of the Havre-Saint-Pierre anorthosite suite from the Grenville province of North America. It is made up of ilmenitite (commonly with more than 95% hemo-ilmenite) associated with noritic lithologies and anorthosite. The present study compares the magnetic fabric of the ore body, as deduced from anisotropy of magnetic susceptibility (AMS) measurements, with the crystallographic and shape fabrics, obtained from lattice-preferred orientation (LPO) and shape-preferred orientation (SPO) measurements made using electron backscattered diffraction (EBSD) and 3D image analysis, respectively. Room-temperature hysteresis measurements, thermomagnetic curves and values of the bulk magnetic susceptibility reveal a magnetic mineralogy dominated by a mixed contribution of hemo-ilmenite and magnetite. The hemo-ilmenite grains display a LPO characterized by a strong preferred orientation of the basal (0001) plane of ilmenite along which hematite was exsolved. This LPO and the magnetic fabric fit well (angle between the crystallographic c-axis and the axis of minimum susceptibility ≤ ca. 15° for most samples), and the latter is thus strongly influenced by the hemo-ilmenite magneto-crystalline anisotropy. A magnetite SPO, concordant with the hemo-ilmenite LPO, may also influence and even dominate the magnetic fabric. The rock shape fabric is coaxial with the magnetic fabric that can thus be used to perform detailed structural mapping. Interpretation of the magnetic fabric and field structural data suggests that the Lac Tio ore body would be a sag point at the margin of the Lac Allard anorthosite, deformed by ballooning during the final stage of diapiric emplacement of the anorthosite body.
Zhang, Yijia; Chu, Mi; Yang, Lu; Tan, Yueming; Deng, Wenfang; Ma, Ming; Su, Xiaoli; Xie, Qingji
2014-08-13
We report here three-dimensional graphene networks (3D-GNs) as a novel substrate for the immobilization of laccase (Lac) and dopamine (DA) and its application in glucose/O2 biofuel cell. 3D-GNs were synthesized with an Ni(2+)-exchange/KOH activation combination method using a 732-type sulfonic acid ion-exchange resin as the carbon precursor. The 3D-GNs exhibited an interconnected network structure and a high specific surface area. DA was noncovalently functionalized on the surface of 3D-GNs with 3,4,9,10-perylene tetracarboxylic acid (PTCA) as a bridge and used as a novel immobilized mediating system for Lac-based bioelectrocatalytic reduction of oxygen. The 3D-GNs-PTCA-DA nanocomposite modified glassy carbon electrode (GCE) showed stable and well-defined redox current peaks for the catechol/o-quinone redox couple. Due to the mediated electron transfer by the 3D-GNs-PTCA-DA nanocomposite, the Nafion/Lac/3D-GNs-PTCA-DA/GCE exhibited high catalytic activity for oxygen reduction. The 3D-GNs are proven to be a better substrate for Lac and its mediator immobilization than 2D graphene nanosheets (2D-GNs) due to the interconnected network structure and high specific surface area of 3D-GNs. A glucose/O2 fuel cell using Nafion/Lac/3D-GNs-PTCA-DA/GCE as the cathode and Nafion/glucose oxidase/ferrocence/3D-GNs/GCE as the anode can output a maximum power density of 112 μW cm(-2) and a short-circuit current density of 0.96 mA cm(-2). This work may be helpful for exploiting the popular 3D-GNs as an efficient electrode material for many other biotechnology applications.
Lightning Arrestor Connectors Production Readiness
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marten, Steve; Linder, Kim; Emmons, Jim
2008-10-20
The Lightning Arrestor Connector (LAC), part “M”, presented opportunities to improve the processes used to fabricate LACs. The A## LACs were the first production LACs produced at the KCP, after the product was transferred from Pinnellas. The new LAC relied on the lessons learned from the A## LACs; however, additional improvements were needed to meet the required budget, yield, and schedule requirements. Improvement projects completed since 2001 include Hermetic Connector Sealing Improvement, Contact Assembly molding Improvement, development of a second vendor for LAC shells, general process improvement, tooling improvement, reduction of the LAC production cycle time, and documention of themore » LAC granule fabrication process. This report summarizes the accomplishments achieved in improving the LAC Production Readiness.« less
Extraordinary Activity in the BL Lac Object OJ 287
NASA Astrophysics Data System (ADS)
Hughes, P. A.; Aller, H. D.; Aller, M. F.
We present the results of a wavelet transform analysis of data for the BL Lac object OJ 287 acquired as part of the UMRAO variability program. We find clear evidence for a persistent modulation of the total flux and polarization with period 1.66 years, and for another signal that dominates activity in the 1980s with period 1.12 years. It appears that the longer time scale periodicity is associated with an otherwise quiescent jet, and the shorter time scale activity is associated with the passage of a shock, or shocks. The periodic behavior in polarization exhibits excursions in U which correspond to a direction 45circ from the VLBI jet axis. This behavior suggests a small amplitude, cyclic variation in the flow direction in that part of the flow that dominates cm-wavelength emission.
The Gamma-Ray Bright BL Lac Object RX J1211+2242
NASA Technical Reports Server (NTRS)
Beckmann, V.; Favre, P.; Tavecchio, F.; Bussien, T.; Fliri, J.; Wolter, A.
2004-01-01
RX J1211+2242 is an optically faint (B approximately equal to 19.2mag) but X-ray bright (f2-10kev = 5 x l0(exp -12)erg per square centimeter per second) AGN, which has been shown to be a BL Lac object at redshift z = 0.455. The ROSAT X-ray, Calar Alto optical, and NVSS radio data suggest that the peak of the synchrotron emission of this object is at energies as high as several keV. BeppoSAX observations have been carried out simultaneously with optical observations in order to extend the coverage to higher energies. The new data indeed indicate a turn-over in the 2 - 10keV energy region. We propose that RX J1211+2242 is the counterpart of the unidentified EGRET source 3EG J1212+2304, making it a gamma-ray emitter with properties similar to, for example, Markarian 501 in its bright state, though being at a much larger distance.
NASA Astrophysics Data System (ADS)
Shi, Shukai; Wang, Xin; Chen, Weimin; Chen, Minzhi; Zhou, Xiaoyan
2018-05-01
The as-prepared lignin-based activated carbon (LAC) was post-treated by urea and radio-frequency cold plasma separately. The obtained results demonstrated that the BET surface and total volumes of the LAC and plasma-treated LACs were greater than the urea-modified sample. The analysis of surface elemental composition showed that the nitrogen content of urea-modified LAC and nitrogen plasma-treated LAC are 3.79% and 2.62% higher than that of original LAC respectively, while the oxygen content of air plasma-treated LAC is 10.23% higher than that of original LAC. The Fe(III) ions adsorbed studies with pseudo-second order kinetic model revealed that urea-modified LAC had faster chemisorption rates while air plasma-treated LAC had larger adsorption capacity within 3 h. Moreover, the adsorption capacity and chemisorption rates of LAC post-treated by nitrogen plasma are inferior to the air plasma-treated LAC.
Gamma-Ray Light Curves And Variability Of Bright Fermi -Detected Blazars
Abdo, A. A.
2010-09-22
This paper presents light curves as well as the first systematic characterization of variability of the 106 objects in the high-confidence Fermi Large Area Telescope Bright AGN Sample (LBAS). Weekly light curves of this sample, obtained during the first 11 months of the Fermi survey (2008 August 4-2009 July 4), are tested for variability and their properties are quantified through autocorrelation function and structure function analysis. For the brightest sources, 3 or 4 day binned light curves are extracted in order to determine power density spectra (PDSs) and to fit the temporal structure of major flares. More than 50% ofmore » the sources are found to be variable with high significance, where high states do not exceed 1/4 of the total observation range. Variation amplitudes are larger for flat spectrum radio quasars and low/intermediate synchrotron frequency peaked BL Lac objects. Autocorrelation timescales derived from weekly light curves vary from four to a dozen of weeks. Variable sources of the sample have weekly and 3-4 day bin light curves that can be described by 1/f α PDS, and show two kinds of gamma-ray variability: (1) rather constant baseline with sporadic flaring activity characterized by flatter PDS slopes resembling flickering and red noise with occasional intermittence and (2)—measured for a few blazars showing strong activity—complex and structured temporal profiles characterized by long-term memory and steeper PDS slopes, reflecting a random walk underlying mechanism. The average slope of the PDS of the brightest 22 FSRQs and of the 6 brightest BL Lacs is 1.5 and 1.7, respectively. The study of temporal profiles of well-resolved flares observed in the 10 brightest LBAS sources shows that they generally have symmetric profiles and that their total duration vary between 10 and 100 days. Results presented here can assist in source class recognition for unidentified sources and can serve as reference for more detailed analysis of the brightest gamma-ray blazars.« less
MAGIC detection of very high energy γ-ray emission from the low-luminosity blazar 1ES 1741+196
Ahnen, M. L.; Ansoldi, S.; Antonelli, L. A.; ...
2017-02-23
Here, we present the first detection of the nearby (z = 0.084) low-luminosity BL Lac object 1ES 1741+196 in the very high energy (E > 100 GeV) band. This object lies in a triplet of interacting galaxies. Early predictions had suggested 1ES 1741+196 to be, along with several other high-frequency BL Lac sources, within the reach of MAGIC detectability. Its detection by MAGIC, later confirmed by VERITAS, helps to expand the small population of known TeV BL Lacs. The source was observed with the MAGIC telescopes between 2010 April and 2011 May, collecting 46 h of good quality data. Thesemore » observations led to the detection of the source at 6.0 σ confidence level, with a steady flux F(>100 GeV) = (6.4 ± 1.7stat ± 2.6syst) × 10–12 ph cm–2s–1 and a differential spectral photon index Γ = 2.4 ± 0.2stat ± 0.2syst in the range of ~80 GeV–3 TeV. To study the broad-band spectral energy distribution (SED) simultaneous with MAGIC observations, we use KVA, Swift/UVOT and XRT and Fermi/LAT data. One-zone synchrotron-self-Compton (SSC) modelling of the SED of 1ES 1741+196 suggests values for the SSC parameters that are quite common among known TeV BL Lacs except for a relatively low Doppler factor and slope of electron energy distribution. A thermal feature seen in the SED is well matched by a giant elliptical's template. As a result, this appears to be the signature of thermal emission from the host galaxy, which is clearly resolved in optical observations.« less
Franco-Marina, Francisco; López-Carrillo, Lizbeth; Keating, Nancy L; Arreola-Ornelas, Hector; Marie Knaul, Felicia
2015-12-01
In the Latin America countries (LAC), one in five breast cancer (BC) cases occur in women younger than 45 years, almost twice the frequency seen in developed countries. Most BC cases in younger women are premenopausal and are generally more difficult to detect at early stages and to treat than postmenopausal cancers. We employ data from four high quality population-based registries located in LAC and assess the extent to which the higher frequency of BC occurring in younger women is due to a younger population structure, compared to that of developed countries. Next, we analyze secular and generational trends of incidence rates in search for additional explanations. Using data from the International Agency for Research on cancer, between 1988 and 2007, the age distribution of BC incident cases for registries located in Brazil, Colombia, Costa Rica, Ecuador is compared to that of USA and Canadian registries, both before and after removing differences in population age structure. An age-period-cohort modelling of incidence rates is also conducted in all compared registries to identify secular and generational effects. BC incident cases in the LAC registries present, on average, at an earlier age than in the USA and Canadian registries and for 2003-2007, between 20 and 27% of cases occur in women aged 20-44. About two thirds of the difference in age distribution between LAC and USA registries is attributable to the younger age distribution in the LAC base populations. The USA registries show the highest age-specific BC incidence rates of all compared aggregated registries, at all ages. However, in all the LAC registries incidence rates are rapidly increasing, fueled by a strong birth cohort effect. This cohort effect may be explained by important reduction in fertility rates occurring during the second half of the 20th century, but also by a greater exposure to other risk factors for BC related to the adoption of life styles more prevalent in developed countries. The younger age at presentation of BC incident cases seen in the analyzed LAC registries, and possibly in many Latin American countries, is not only attributable to their relatively young population age structure but also to the low incidence rates in older women. As more recently born cohorts, with greater exposure to risk factors for postmenopausal BC, reach older age, incidence rates will be more similar to the rates seen in the USA and Canadian registries. There is a need for additional research to identify determinants of the higher BC rate among younger women in these countries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song
2016-03-10
The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5'-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis.
Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song
2016-01-01
The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5′-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis. PMID:26962011
Parsec-Scale Kinematic and Polarization Properties of MOJAVE AGN Jets
NASA Astrophysics Data System (ADS)
Lister, Matthew L.
2013-12-01
We describe the parsec-scale kinematics and statistical polarization properties of 200 AGN jets based on 15 GHz VLBA data obtained between 1994 Aug 31 and 2011 May 1. Nearly all of the 60 most heavily observed jets show significant changes in their innermost position angle over a 12 to 16 year interval, ranging from 10° to 150° on the sky, corresponding to intrinsic variations of ~ 0.5° to ~ 2°. The BL Lac jets show smaller variations than quasars. Roughly half of the heavily observed jets show systematic position angle trends with time, and 20 show indications of oscillatory behavior. The time spans of the data sets are too short compared to the fitted periods (5 to 12 y), however, to reliably establish periodicity. The rapid changes and large jumps in position angle seen in many cases suggest that the superluminal AGN jet features occupy only a portion of the entire jet cross section, and may be energized portions of thin instability structures within the jet. We have derived vector proper motions for 887 moving features in 200 jets having at least five VLBA epochs. For 557 well-sampled features, there are sufficient data to additionally study possible accelerations. The moving features are generally non-ballistic, with 70% of the well-sampled features showing either significant accelerations or non-radial motions. Inward motions are rare (2% of all features), are slow (< 0.1 mas per y), are more prevalent in BL Lac jets, and are typically found within 1 mas of the unresolved core feature. There is a general trend of increasing apparent speed with distance down the jet for both radio galaxies and BL Lac objects. In most jets, the speeds of the features cluster around a characteristic value, yet there is a considerable dispersion in the distribution. Orientation variations within the jet cannot fully account for the dispersion, implying that the features have a range of Lorentz factor and/or pattern speed. Very slow pattern speed features are rare, comprising only 4% of the sample, and are more prevalent in radio galaxy and BL Lac jets. We confirm a previously reported upper envelope to the distribution of speed versus beamed luminosity for moving jet features. Below 1026 W Hz-1 there is a fall-off in maximum speed with decreasing 15 GHz radio luminosity. A preliminary analysis of the multi-epoch jet polarization properties indicates a wide range of behavior in the core electric vector position angles over time, with the latter remaining relatively stable in some jets, and varying rapidly in others. The fractional polarization level generally increases down the jet, and high-synchrotron peaked (HSP) blazars tend to have lower core fractional polarization levels. A general trend of decreasing maximum jet speed for higher synchrotron peaked blazars further suggests lower Doppler factors in the radio-emitting jets of HSP BL Lac objects.
Complex genomic rearrangement in CCS-LacZ transgenic mice.
Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I
2007-02-01
The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.
Le, Thao Thanh; Murugesan, Kumarasamy; Lee, Chung-Seop; Vu, Chi Huong; Chang, Yoon-Seok; Jeon, Jong-Rok
2016-09-01
Immobilization of laccase has been highlighted to enhance their stability and reusability in bioremediation. In this study, we provide a novel immobilization technique that is very suitable to real wastewater treatment. A perfect core-shell system composing copper alginate for the immobilization of laccase (Lac-beads) was produced. Additionally, nFe2O3 was incorporated for the bead recycling through magnetic force. The beads were proven to immobilize 85.5% of total laccase treated and also to be structurally stable in water, acetate buffer, and real wastewater. To test the Lac-beads reactivity, triclosan (TCS) and Remazol Brilliant Blue R (RBBR) were employed. The Lac-beads showed a high percentage of TCS removal (89.6%) after 8h and RBBR decolonization at a range from 54.2% to 75.8% after 4h. Remarkably, the pollutants removal efficacy of the Lac-beads was significantly maintained in real wastewater with the bead recyclability, whereas that of the corresponding free laccase was severely deteriorated. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ramisetti, Nageswara Rao; Kuntamukkala, Ramakrishna; Lakshetti, Sridhar; Sripadi, Prabhakar
2014-07-01
The current study dealt with the degradation behavior of lacosamide (LAC) under ICH prescribed stress conditions. LAC was found to be labile under acid and base hydrolytic stress conditions, while it was stable to neutral hydrolytic, oxidative, photolytic and thermal stress. In total, seven degradation products (DPs) were formed, which were separated on a C18 column using a stability-indicating method. LC-MS analyses indicated that one of the DPs had the same molecular mass as that of the drug. Structural characterization of DPs was carried out using ESI-Q-TOF-MS/MS technique. The degradation pathways and mechanisms of degradation of the drug were delineated by carrying out the degradation in different co-solvents viz. methanol, deuterated methanol, ethanol, 1-propanol and acetonitrile. The developed LC method was validated for the determination of related substances and assay of LAC as per ICH guidelines. This study demonstrates a comprehensive approach of LAC degradation studies during its development phase. Copyright © 2014. Published by Elsevier B.V.
EGRET observations of the BL Lacertae objects 0716+714 and 0521-365
NASA Technical Reports Server (NTRS)
Lin, Y. C.; Bertsch, D. L.; Dingus, B. L.; Esposito, J. A.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Mayer-Hasselwander, H. A.
1995-01-01
During the Compton Observatory's viewing programs Phase 1 (1991 April to 1992 November, also known as the All-Sky Survey) and Phase 2 (1992 November to 1993 September), the BL Lac object 0716+714 was in the field of view of the EGRET telescope a total of six times, three times in Phase 1 and three more times in Phase 2, while the BL Lac object 0521-365 was in the field of view of EGRET only once in Phase 1. The source 0716+714 was detected in high-energy gamma rays by EGRET at a flux level of (2.0 +/- 0.4) x 10(exp -7) photons/sq cm/s for E greater than 100 MeV with a 6 sigma significance when it was first observed by EGRET in 1992 January 10 to 23. The corresponding spectral slope of the photon number distribution is determined to be -2.04 +/- 0.33. The gamma-ray flux of 0716+714 showed considerable time variability in subsequent EGRET observations. But the spectral slope stayed about the same within the statistical uncertainties of the EGRET data. The average spectral slope of the four viewing periods during which the photon flux of 0716+714 stayed above the EGRET detection threshold is found to be -1.85 +/- 0.20 from the combined data. The source 0521+365 was detected by EGRET in 1992 May 14 to June 4 at a flux level of (1.8 +/- 0.5) x 10(exp -7) photons/sq cm/s for E greater than 100 MeV with a 4 sigma significance. The corresponding spectral slope of the photon number distribution is found to be 2.16 +/- 0.36. Details of the observations of these two BL Lac objects with the EGRET telescope are presented.
Barthel, Steven R.; Antonopoulos, Aristotelis; Cedeno-Laurent, Filiberto; Schaffer, Lana; Hernandez, Gilberto; Patil, Shilpa A.; North, Simon J.; Dell, Anne; Matta, Khushi L.; Neelamegham, Sriram; Haslam, Stuart M.; Dimitroff, Charles J.
2011-01-01
Prior studies have shown that treatment with the peracetylated 4-fluorinated analog of glucosamine (4-F-GlcNAc) elicits anti-skin inflammatory activity by ablating N-acetyllactosamine (LacNAc), sialyl Lewis X (sLeX), and related lectin ligands on effector leukocytes. Based on anti-sLeX antibody and lectin probing experiments on 4-F-GlcNAc-treated leukocytes, it was hypothesized that 4-F-GlcNAc inhibited sLeX formation by incorporating into LacNAc and blocking the addition of galactose or fucose at the carbon 4-position of 4-F-GlcNAc. To test this hypothesis, we determined whether 4-F-GlcNAc is directly incorporated into N- and O-glycans released from 4-F-GlcNAc-treated human sLeX (+) T cells and leukemic KG1a cells. At concentrations that abrogated galectin-1 (Gal-1) ligand and E-selectin ligand expression and related LacNAc and sLeX structures, MALDI-TOF and MALDI-TOF/TOF mass spectrometry analyses showed that 4-F-GlcNAc 1) reduced content and structural diversity of tri- and tetra-antennary N-glycans and of O-glycans, 2) increased biantennary N-glycans, and 3) reduced LacNAc and sLeX on N-glycans and on core 2 O-glycans. Moreover, MALDI-TOF MS did not reveal any m/z ratios relating to the presence of fluorine atoms, indicating that 4-F-GlcNAc did not incorporate into glycans. Further analysis showed that 4-F-GlcNAc treatment had minimal effect on expression of 1200 glycome-related genes and did not alter the activity of LacNAc-synthesizing enzymes. However, 4-F-GlcNAc dramatically reduced intracellular levels of uridine diphosphate-N-acetylglucosamine (UDP-GlcNAc), a key precursor of LacNAc synthesis. These data show that Gal-1 and E-selectin ligand reduction by 4-F-GlcNAc is not caused by direct 4-F-GlcNAc glycan incorporation and consequent chain termination but rather by interference with UDP-GlcNAc synthesis. PMID:21493714
Msx1 is expressed in retina endothelial cells at artery branching sites.
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît
2012-04-15
Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1(lacZ) is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2(lacZ) is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1(lacZ) and Msx2(lacZ) reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1(lacZ) is expressed more broadly and dynamically. At birth Msx1(lacZ) expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature.
Msx1 is expressed in retina endothelial cells at artery branching sites
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît
2012-01-01
Summary Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1lacZ is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2lacZ is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1lacZ and Msx2lacZ reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1lacZ is expressed more broadly and dynamically. At birth Msx1lacZ expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature. PMID:23213427
Lac-L-TTA, a novel lactose-based amino acid-sugar conjugate for anti-metastatic applications.
Roviello, Giovanni N; Iannitti, Roberta; Palumbo, Rosanna; Simonyan, Hayarpi; Vicidomini, Caterina; Roviello, Valentina
2017-08-01
Here we describe the synthesis, chromatographic purification, MS and NMR characterization of a new lactosyl-derivative, i.e. a lactosyl thiophenyl-substituted triazolyl-thione L-alanine (Lac-L-TTA). This amino acid-sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore, we investigated the inhibition of PC-3 prostate cancer cell colony formation by this lactose derivative in comparison with the less polar fructose-based derivative, Fru-L-TTA. This let us to compare the properties of the artificial derivative, object of the present work, with the monosaccharide-based counterpart and to obtain a preliminary information on the influence of polarity on such biological activity. A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose.
Photometric Redshifts of High-z BL Lacs from 3FGL Catalog
NASA Astrophysics Data System (ADS)
Kaur, A.; Rau, Arne; Ajello, Marco; Paliya, Vaidehi; Hartmann, Dieter; Greiner, Jochen; Bolmer, Jan; Schady, Patricia
2017-08-01
Determining redshifts for BL Lacertae (BL Lac) objects using the traditional spectroscopic method is challenging due to the absence of strong emission lines in their optical spectra. We employ the photometric dropout technique to determine redshifts for this class of blazars using the combined 13 broad-band filters from Swift-UVOT and the multi-channel imager GROND at the MPG 2.2 m telescope at ESO's La Silla Observatory. The wavelength range covered by these 13 filters extends from far ultraviolet to the near-Infrared. We report results on 40 new Fermi detected BL Lacs with the photometric redshifts determinations for 5 sources, with 3FGL J1918.2-4110 being the most distance in our sample at z=2.16. Reliable upper limits are provided for 20 sources in this sample. Using the highest energy photons for these Fermi-LAT sources, we evaluate the consistency with the Gamma-ray horizon due to the extragalactic background light.
The Luminosity Function of the Host Galaxies of QSOs and BL Lac Objects
NASA Astrophysics Data System (ADS)
Carangelo, Nicoletta; Falomo, Renato; Treves, Aldo
A clear insight of the galaxies hosting active galactic nuclei is of fundamental importance for understanding the processes of galaxies and nuclei formation and their cosmic evolution. A good characterization of the host galaxies properties requires images of excellent quality in order to disentangle the light of the galaxy from that of the bright nucleus. To this aim HST has provided a major improvement of data on QSOs (Disney et al. 1995; Bahcall et al. 1996,1997; Boyce et al. 1998; McLure et al. 1999; Hamilton et al. 2000; Kukula et al. 2001) and BL Lacs (Scarpa et al. 2000, Urry et al. 2000).
VizieR Online Data Catalog: Gamma-ray AGN type determination (Hassan+, 2013)
NASA Astrophysics Data System (ADS)
Hassan, T.; Mirabal, N.; Contreras, J. L.; Oya, I.
2013-11-01
In this paper, we employ Support Vector Machines (SVMs) and Random Forest (RF) that embody two of the most robust supervised learning algorithms available today. We are interested in building classifiers that can distinguish between two AGN classes: BL Lacs and FSRQs. In the 2FGL, there is a total set of 1074 identified/associated AGN objects with the following labels: 'bzb' (BL Lacs), 'bzq' (FSRQs), 'agn' (other non-blazar AGN) and 'agu' (active galaxies of uncertain type). From this global set, we group the identified/associated blazars ('bzb' and 'bzq' labels) as the training/testing set of our algorithms. (2 data files).
Parra, Mario A.; Baez, Sandra; Allegri, Ricardo; Nitrini, Ricardo; Lopera, Francisco; Slachevsky, Andrea; Custodio, Nilton; Lira, David; Piguet, Olivier; Kumfor, Fiona; Huepe, David; Cogram, Patricia; Bak, Thomas; Manes, Facundo
2018-01-01
The demographic structure of Latin American countries (LAC) is fast approaching that of developing countries, and the predicted prevalence of dementia in the former already exceeds the latter. Dementia has been declared a global challenge, yet regions around the world show differences in both the nature and magnitude of such a challenge. This article provides evidence and insights on barriers which, if overcome, would enable the harmonization of strategies to tackle the dementia challenge in LAC. First, we analyze the lack of available epidemiologic data, the need for standardizing clinical practice and improving physician training, and the existing barriers regarding resources, culture, and stigmas. We discuss how these are preventing timely care and research. Regarding specific health actions, most LAC have minimal mental health facilities and do not have specific mental health policies or budgets specific to dementia. In addition, local regulations may need to consider the regional context when developing treatment and prevention strategies. The support needed nationally and internationally to enable a smooth and timely transition of LAC to a position that integrates global strategies is highlighted. We focus on shared issues of poverty, cultural barriers, and socioeconomic vulnerability. We identify avenues for collaboration aimed to study unique populations, improve valid assessment methods, and generate opportunities for translational research, thus establishing a regional network. The issues identified here point to future specific actions aimed at tackling the dementia challenge in LAC. PMID:29305437
NASA Astrophysics Data System (ADS)
Fernandes, Sunil; Schlegel, E.
2012-01-01
Recently, a tentative negative correlation between jet power and BH mass in a sample of GeV-TeV BL Lac objects(Zhang et al 2011). It was suggested that spin energy extraction could play a significant role in producing the jets and the jets are not purely accretion driven. Broderick et al (2011) recently explored the relationship between jet power and radio core luminosity building on Blanford et al (1979) theoretical work. Using this work we have studied the relationship between radio core luminosity (as a stand in for jet power) and black hole mass and have found a possible positive correlation in a sample of nearby BL Lac objects. The present poster attempts to explore this relationship in the context of the Blanford-Znajek mechanism which predicts jet power increases with black hole mass, spin rate, and accretion rate.
Xie, Wei; Chojnowski, Alexandre; Boudier, Thomas; Lim, John S Y; Ahmed, Sohail; Ser, Zheng; Stewart, Colin; Burke, Brian
2016-10-10
The nuclear lamina is a universal feature of metazoan nuclear envelopes (NEs) [1]. In mammalian cells, it appears as a 10-30 nm filamentous layer at the nuclear face of the inner nuclear membrane (INM) and is composed primarily of A- and B-type lamins, members of the intermediate filament family [2]. While providing structural integrity to the NE, the lamina also represents an important signaling and regulatory platform [3]. Two A-type lamin isoforms, lamins A and C (LaA and LaC), are expressed in most adult human cells. Encoded by a single gene, these proteins are largely identical, diverging only in their C-terminal tail domains. By contrast with that of LaC, the unique LaA tail undergoes extensive processing, including farnesylation and endo-proteolysis [4, 5]. However, functional differences between LaA and LaC are still unclear. Compounding this uncertainty, the structure of the lamina remains ill defined. In this study, we used BioID, an in vivo proximity-labeling method to identify differential interactors of A-type lamins [6]. One of these, Tpr, a nuclear pore complex (NPC) protein, is highlighted by its selective association with LaC. By employing superresolution microscopy, we demonstrate that this Tpr association is mirrored in enhanced interaction of LaC with NPCs. Further superresolution studies visualizing both endogenous A- and B-type lamins have allowed us to construct a nanometer-scale model of the mammalian nuclear lamina. Our data indicate that different A- and B-type lamin species assemble into separate filament networks that together form an extended composite structure at the nuclear periphery providing attachment sites for NPCs, thereby regulating their distribution. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo
2014-01-01
The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003
Lü, Shiyou; Song, Tao; Kosma, Dylan K; Parsons, Eugene P; Rowland, Owen; Jenks, Matthew A
2009-08-01
Plant cuticle is an extracellular lipid-based matrix of cutin and waxes, which covers aerial organs and protects them from many forms of environmental stress. We report here the characterization of CER8/LACS1, one of nine Arabidopsis long-chain acyl-CoA synthetases thought to activate acyl chains. Mutations in LACS1 reduced the amount of wax in all chemical classes on the stem and leaf, except in the very long-chain fatty acid (VLCFA) class wherein acids longer than 24 carbons (C(24)) were elevated more than 155%. The C(16) cutin monomers on lacs1 were reduced by 37% and 22%, whereas the C(18) monomers were increased by 28% and 20% on stem and leaf, respectively. Amounts of wax and cutin on a lacs1-1 lacs2-3 double mutant were much lower than on either parent, and lacs1-1 lacs2-3 had much higher cuticular permeability than either parent. These additive effects indicate that LACS1 and LACS2 have overlapping functions in both wax and cutin synthesis. We demonstrated that LACS1 has synthetase activity for VLCFAs C(20)-C(30), with highest activity for C(30) acids. LACS1 thus appears to function as a very long-chain acyl-CoA synthetase in wax metabolism. Since C(16) but not C(18) cutin monomers are reduced in lacs1, and C(16) acids are the next most preferred acid (behind C(30)) by LACS1 in our assays, LACS1 also appears to be important for the incorporation of C(16) monomers into cutin polyester. As such, LACS1 defines a functionally novel acyl-CoA synthetase that preferentially modifies both VLCFAs for wax synthesis and long-chain (C(16)) fatty acids for cutin synthesis.
A hadronic origin for ultra-high-frequency-peaked BL Lac objects
NASA Astrophysics Data System (ADS)
Cerruti, M.; Zech, A.; Boisson, C.; Inoue, S.
2015-03-01
Current Cherenkov telescopes have identified a population of ultra-high-frequency peaked BL Lac objects (UHBLs), also known as extreme blazars, that exhibit exceptionally hard TeV spectra, including 1ES 0229+200, 1ES 0347-121, RGB J0710+591, 1ES 1101-232, and 1ES 1218+304. Although one-zone synchrotron-self-Compton (SSC) models have been generally successful in interpreting the high-energy emission observed in other BL Lac objects, they are problematic for UHBLs, necessitating very large Doppler factors and/or extremely high minimum Lorentz factors of the emitting leptonic population. In this context, we have investigated alternative scenarios where hadronic emission processes are important, using a newly developed (lepto-)hadronic numerical code to systematically explore the physical parameters of the emission region that reproduces the observed spectra while avoiding the extreme values encountered in pure SSC models. Assuming a fixed Doppler factor δ = 30, two principal parameter regimes are identified, where the high-energy emission is due to: (1) proton-synchrotron radiation, with magnetic fields B ˜ 1-100 G and maximum proton energies Ep; max ≲ 1019 eV; and (2) synchrotron emission from p-γ-induced cascades as well as SSC emission from primary leptons, with B ˜ 0.1-1 G and Ep; max ≲ 1017 eV. This can be realized with plausible, sub-Eddington values for the total (kinetic plus magnetic) power of the emitting plasma, in contrast to hadronic interpretations for other blazar classes that often warrant highly super-Eddington values.
Sousa, Filipa L; Parente, Daniel J; Hessman, Jacob A; Chazelle, Allen; Teichmann, Sarah A; Swint-Kruse, Liskin
2016-09-01
The AlloRep database (www.AlloRep.org) (Sousa et al., 2016) [1] compiles extensive sequence, mutagenesis, and structural information for the LacI/GalR family of transcription regulators. Sequence alignments are presented for >3000 proteins in 45 paralog subfamilies and as a subsampled alignment of the whole family. Phenotypic and biochemical data on almost 6000 mutants have been compiled from an exhaustive search of the literature; citations for these data are included herein. These data include information about oligomerization state, stability, DNA binding and allosteric regulation. Protein structural data for 65 proteins are presented as easily-accessible, residue-contact networks. Finally, this article includes example queries to enable the use of the AlloRep database. See the related article, "AlloRep: a repository of sequence, structural and mutagenesis data for the LacI/GalR transcription regulators" (Sousa et al., 2016) [1].
Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)
NASA Astrophysics Data System (ADS)
Madala, Srikanth; Satyanarayana, A. N. V.; Srinivas, C. V.; Tyagi, Bhishma
2016-05-01
In the present study, advanced research WRF (ARW) model is employed to simulate convective thunderstorm episodes over Kharagpur (22°30'N, 87°20'E) region of Gangetic West Bengal, India. High-resolution simulations are conducted using 1 × 1 degree NCEP final analysis meteorological fields for initial and boundary conditions for events. The performance of two non-local [Yonsei University (YSU), Asymmetric Convective Model version 2 (ACM2)] and two local turbulence kinetic energy closures [Mellor-Yamada-Janjic (MYJ), Bougeault-Lacarrere (BouLac)] are evaluated in simulating planetary boundary layer (PBL) parameters and thermodynamic structure of the atmosphere. The model-simulated parameters are validated with available in situ meteorological observations obtained from micro-meteorological tower as well has high-resolution DigiCORA radiosonde ascents during STORM-2007 field experiment at the study location and Doppler Weather Radar (DWR) imageries. It has been found that the PBL structure simulated with the TKE closures MYJ and BouLac are in better agreement with observations than the non-local closures. The model simulations with these schemes also captured the reflectivity, surface pressure patterns such as wake-low, meso-high, pre-squall low and the convective updrafts and downdrafts reasonably well. Qualitative and quantitative comparisons reveal that the MYJ followed by BouLac schemes better simulated various features of the thunderstorm events over Kharagpur region. The better performance of MYJ followed by BouLac is evident in the lesser mean bias, mean absolute error, root mean square error and good correlation coefficient for various surface meteorological variables as well as thermo-dynamical structure of the atmosphere relative to other PBL schemes. The better performance of the TKE closures may be attributed to their higher mixing efficiency, larger convective energy and better simulation of humidity promoting moist convection relative to non-local schemes.
POWERFUL HIGH-ENERGY EMISSION OF THE REMARKABLE BL Lac OBJECT S5 0716+714
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vittorini, V.; Chen, A. W.; Ferrari, A.
BL Lac objects of the intermediate subclass (IBLs) are known to emit a substantial fraction of their power in the energy range 0.1-10 GeV. Detecting gamma-ray emission from such sources provides therefore a direct probe of the emission mechanisms and of the underlying powerhouse. The gamma-ray satellite, AGILE, detected the remarkable IBL S5 0716+714 (z approx = 0.3) during a high state in the period from 2007 September-October, marked by two very intense flares reaching peak fluxes of 200 x 10{sup -8} photons cm{sup -2} s{sup -1} above 100 MeV, with simultaneous optical and X-ray observations. We present here amore » theoretical model for the two major flares and discuss the overall energetics of the source. We conclude that 0716+714 is among the brightest BL Lac's ever detected at gamma-ray energies. Because of its high power and lack of signs for ongoing accretion or surrounding gas, the source is an ideal candidate to test the maximal power extractable from a rotating supermassive black hole via the pure Blandford-Znajek (BZ) mechanism. We find that during the 2007 gamma-ray flares 0716+714 approached or just exceeded the upper limit set by BZ for a black hole of mass 10{sup 9} M{sub sun}.« less
The Spectral Energy Distributions of Blazars and the Connections among XBLs, RBLs, and OVV Quasars
NASA Astrophysics Data System (ADS)
Xie, Guangzhong; Dai, Benzhong; Liang, Enwei; Ma, Li; Jiang, Zejun
2001-06-01
In this paper, we introduce two composite spectral indices, αxox=αox-αx and αoro=αor-αo. In the composite color-color (αxoxαoro) diagram, there are three regions: (1) For XBLs and XBL-like RBLs, the values of αxox is in the range of -1.0 -0.0; (2) For RBLs, αxox is in 0.0-1.5, and αxox < -0.75; (3) For OVV quasars, αxox is in 0.0-1.5 and the αxox > -0.75. Our results support the conclusion that RBLs are intermediate between XBLs and OVV quasars, which has been given by Sambruna et al. (1996, AAA 65.159.120). On the other hand, based on the idea that a group of extragalactic objects which can be regarded as a category with similar physical properties must fit the same relation, using the HST new observational data, we found that there is a strong correlation between the apparent magnitude of the host galaxies and log z for all BL Lac objects (XBLs + RBLs), but OVV quasars lie about 4 magnitude above the Hubble line of 86 BL Lacs. This implies that all XBL-like and XBLs belong to a single category with similar physical properties, while OVV quasars and BL Lacs belong to different populations.
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
Lemieux, M Joanne
2007-01-01
The major facilitator superfamily (MFS) of transporters represents the largest family of secondary active transporters and has a diverse range of substrates. With structural information for four MFS transporters, we can see a strong structural commonality suggesting, as predicted, a common architecture for MFS transporters. The rate for crystal structure determination of MFS transporters is slow, making modeling of both prokaryotic and eukaryotic transporters more enticing. In this review, models of eukaryotic transporters Glut1, G6PT, OCT1, OCT2 and Pho84, based on the crystal structures of the prokaryotic GlpT, based on the crystal structure of LacY are discussed. The techniques used to generate the different models are compared. In addition, the validity of these models and the strategy of using prokaryotic crystal structures to model eukaryotic proteins are discussed. For comparison, E. coli GlpT was modeled based on the E. coli LacY structure and compared to the crystal structure of GlpT demonstrating that experimental evidence is essential for accurate modeling of membrane proteins.
Genome sequences of two closely related strains of Escherichia coli K-12 GM4792.
Zhang, Yan-Cong; Zhang, Yan; Zhu, Bi-Ru; Zhang, Bo-Wen; Ni, Chuan; Zhang, Da-Yong; Huang, Ying; Pang, Erli; Lin, Kui
2015-01-01
Escherichia coli lab strains K-12 GM4792 Lac(+) and GM4792 Lac(-) carry opposite lactose markers, which are useful for distinguishing evolved lines as they produce different colored colonies. The two closely related strains are chosen as ancestors for our ongoing studies of experimental evolution. Here, we describe the genome sequences, annotation, and features of GM4792 Lac(+) and GM4792 Lac(-). GM4792 Lac(+) has a 4,622,342-bp long chromosome with 4,061 protein-coding genes and 83 RNA genes. Similarly, the genome of GM4792 Lac(-) consists of a 4,621,656-bp chromosome containing 4,043 protein-coding genes and 74 RNA genes. Genome comparison analysis reveals that the differences between GM4792 Lac(+) and GM4792 Lac(-) are minimal and limited to only the targeted lac region. Moreover, a previous study on competitive experimentation indicates the two strains are identical or nearly identical in survivability except for lactose utilization in a nitrogen-limited environment. Therefore, at both a genetic and a phenotypic level, GM4792 Lac(+) and GM4792 Lac(-), with opposite neutral markers, are ideal systems for future experimental evolution studies.
Extraction of organic materials from red water by metal-impregnated lignite activated carbon.
Wei, Fangfang; Zhang, Yihe; Lv, Fengzhu; Chu, Paul K; Ye, Zhengfang
2011-12-15
Extraction of organic materials from 2,4,6-trinitrotoluene (TNT) red water by lignite activated carbon (LAC) impregnated with Cu(2+), Ba(2+), Sn(2+), Fe(3+), Ca(2+) and Ag(+) was investigated. The affinity to organic materials in red water was found to follow the order: Cu/LAC>Sn/LAC>Ag/LAC>Ba/LAC>Fe/LAC>Ca/LAC, which was explained by the hard and soft acid base (HSAB) theory. Cu(2+) showed the best performance and several parameters were further studied. X-ray photoelectron spectroscopy (XPS) verified effective loading of Cu(2+) on the LAC surface. The water quality before and after treated by Cu/LAC was evaluated using high performance liquid chromatograph, Gas Chromatography/Mass Spectroscopy (GC/MS), UV-vis spectroscopy and other analyses. The extraction performances and mechanism of organic materials on Cu/LAC were investigated through static methods. The experimental results showed that Cu/LAC possessed stronger extraction ability for the sulfonated nitrotoluenes than the non-sulfonated nitrotoluenes, the kinetic data fitted the pseudo-second-order kinetic model well. In addition, the leaching out of Cu(2+) from Cu/LAC was found much lower in the 100 times diluted red water (0.074%) than in the raw water (10.201%). Column adsorptions with more concentrated red water were also studied. Finally, Cu/LAC was observed to possess excellent reusability as well. Copyright © 2011 Elsevier B.V. All rights reserved.
Mou, Quanbing; Ma, Yuan; Zhu, Xinyuan; Yan, Deyue
2016-05-28
Targeted drug delivery is a broadly applicable approach for cancer therapy. However, the nanocarrier-based targeted delivery system suffers from batch-to-batch variation, quality concerns and carrier-related toxicity issues. Thus, to develop a carrier-free targeted delivery system with nanoscale characteristics is very attractive. Here, a novel targeting small molecule nanodrug self-delivery system consisting of targeting ligand and chemotherapy drug was constructed, which combined the advantages of small molecules and nano-assemblies together and showed excellent targeting ability and long blood circulation time with well-defined structure, high drug loading ratio and on-demand drug release behavior. As a proof-of-concept, lactose (Lac) and doxorubicin (DOX) were chosen as the targeting ligand and chemotherapy drug, respectively. Lac and DOX were conjugated through a pH-responsive hydrazone group. For its intrinsic amphiphilic property, Lac-DOX conjugate could self-assemble into nanoparticles in water. Both in vitro and in vivo assays indicated that Lac-DOX nanoparticles exhibited enhanced anticancer activity and weak side effects. This novel active targeting nanodrug delivery system shows great potential in cancer therapy. Copyright © 2016 Elsevier B.V. All rights reserved.
Discovery of VHE γ -ray emission from the BL Lacertae object B3 2247+381 with the MAGIC telescopes
Aleksić, J.; Alvarez, E. A.; Antonelli, L. A.; ...
2012-03-02
Here, we study the non-thermal jet emission of the BL Lac object B3 2247+381 during a high optical state. The MAGIC telescopes observed the source during 13 nights between September 30th and October 30th 2010, collecting a total of 14.2 h of good quality very high energy (VHE) γ-ray data. Simultaneous multiwavelength data was obtained with X-ray observations by the Swift satellite and optical R-band observations at the KVA-telescope. We also use high energy γ-ray (HE, 0.1-100 GeV) data from the Fermi satellite. We also dedected the BL Lac object B3 2247+381 (z = 0.119) , for the first time,more » at VHE γ-rays at a statistical significance of 5.6σ. A soft VHE spectrum with a photon index of -3.2 ± 0.6 was determined. No significant short term flux variations were found. Finally, we model the spectral energy distribution using a one-zone SSC-model, which can successfully describe our data.« less
NASA Technical Reports Server (NTRS)
Madejski, Greg
1994-01-01
We report the soft X-ray spectrum of BL Lac object AO 0235+164, observed with the Einstein Observatory Imaging Proportional Counter (IPC). This object (z = 0.94) has an intervening galaxy (or a protogalactic disk) at z = 0.524 present in the line of sight, producing both radio and optical absorption lines in the background BL Lac continuum. The X-ray spectrum exhibits a substantial soft X-ray cutoff, corresponding to several times that expected from our own Galaxy; we interpret that excess cutoff as due to the intervening galaxy. The comparison of the hydrogen column density inferred from the 21 cm radio data and the X-ray absorption allows, in principle, the determination of the elemental abundances in the intervening galaxy. However, the uncertainties in both the H I spin temperature and X-ray spectral parameters only loosely restrict these abundances to be 2 +/- 1 solar, which even at the lower limit appears higher than that inferred from studies of samples of optical absoprtion-line systems.
Boulay, G; Francoz, D; Doré, E; Dufour, S; Veillette, M; Badillo, M; Bélanger, A-M; Buczinski, S
2014-01-01
The objectives of the current study were (1) to determine the gain in prognostic accuracy of preoperative l-lactate concentration (LAC) measured on farm on cows with right displaced abomasum (RDA) or abomasal volvulus (AV) for predicting negative outcome; and (2) to suggest clinically relevant thresholds for such use. A cohort of 102 cows with on-farm surgical diagnostic of RDA or AV was obtained from June 2009 through December 2011. Blood was drawn from coccygeal vessels before surgery and plasma LAC was immediately measured by using a portable clinical analyzer. Dairy producers were interviewed by phone 30 d following surgery and the outcome was determined: a positive outcome if the owner was satisfied of the overall evolution 30 d postoperatively, and a negative outcome if the cow was culled, died, or if the owner reported being unsatisfied 30 d postoperatively. The area under the curve of the receiver operating characteristic curve for LAC was 0.92 and was significantly greater than the area under the curve of the receiver operating characteristic curve of heart rate (HR; 0.77), indicating that LAC, in general, performed better than HR to predict a negative outcome. Furthermore, the ability to predict a negative outcome was significantly improved when LAC measurement was considered in addition to the already available HR data (area under the curve: 0.93 and 95% confidence interval: 0.87, 0.99). Important inflection points of the misclassification cost term function were noted at thresholds of 2 and 6 mmol/L, suggesting the potential utility of these cut-points. The 2 and 6 mmol/L thresholds had a sensitivity, specificity, positive predictive value, and negative predictive value for predicting a negative outcome of 76.2, 82.7, 53.3, and 93.1%, and of 28.6, 97.5, 75, and 84%, respectively. In terms of clinical interpretation, LAC ≤2 mmol/L appeared to be a good indicator of positive outcome and could be used to support a surgical treatment decision. The treatment decision for cows with LAC between 2 and 6 mmol/L, however, would depend on the economic context and the owner's attitude to risk in regard to potential return on its investment. Finally, performing a surgical correction on commercial cows with RDA or AV and a LAC ≥6 mmol/L appeared to be unjustified and these animals should be culled based on their high probability of negative outcome. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Tamí-Maury, Irene; Aigner, Carrie J.; Hong, Judy; Strom, Sara; Chambers, Mark S.; Gritz, Ellen R.
2014-01-01
Rates of tobacco use are increasing in regions of Latin America and the Caribbean (LAC). Unfortunately, tobacco cessation education is not a standard component of dental curriculum in LAC dental schools. The objective of this study was to identify the perceptions of LAC dental faculty members regarding the tobacco use prevention and cessation (TUPAC) competencies that should be addressed in dental curricula. Dental deans and faculty completed a web-based questionnaire in Spanish, Portuguese, French, or English. The questionnaire contained 32 competencies grouped into the 5A’s (Ask, Advise, Assess, Assist, and Arrange) of tobacco cessation and 6 supplementary questions for identifying barriers to providing TUPAC education to dental students. Respondents indicated the degree to which they believed each competency should be incorporated into dental curricula using a 5-point Likert scale (“1”= strongly disagree to “5”=strongly agree). Responses were obtained from 390 faculty members (66% South America, 18% Mexico/Central America, 16% the Caribbean). Two%, 12%, and 83% of respondents reported that smoking was allowed in clinical environments, other indoor environments, and outdoor environments of their dental schools, respectively. Mean importance ratings for each of the competencies were as follows: Ask (4.71), Advise (4.54), Assess (4.41), Assist (4.07), and Arrange (4.01). Overall, LAC dental educators agree that TUPAC training should be incorporated in dental curricula. Assist and Arrange competencies were rated lower, relative to other competencies. Tobacco use among dental educators and high rates of on-campus smoking could potentially pose barriers to promoting cessation interventions in the LAC dental schools. PMID:24385339
Tamí-Maury, Irene; Aigner, Carrie J; Hong, Judy; Strom, Sara; Chambers, Mark S; Gritz, Ellen R
2014-12-01
Rates of tobacco use are increasing in the regions of Latin America and the Caribbean (LAC). Unfortunately, tobacco cessation education is not a standard component of the dental curriculum in LAC dental schools. The objective of this study was to identify the perceptions of LAC dental faculty members regarding the tobacco use prevention and cessation (TUPAC) competencies that should be addressed in the dental curricula. Dental deans and faculty completed a web-based questionnaire in Spanish, Portuguese, French, or English. The questionnaire contained 32 competencies grouped into the five A's (Ask, Advise, Assess, Assist, and Arrange) of tobacco cessation and six supplementary questions for identifying barriers to providing TUPAC education to dental students. Respondents indicated the degree to which they believed each competency should be incorporated into the dental curricula using a five-point Likert scale ("1" = strongly disagree to "5" = strongly agree). Responses were obtained from 390 faculty members (66 % South America, 18 % Mexico/Central America, 16 % the Caribbean). Of the respondents, 2, 12, and 83 % reported that smoking was allowed in clinical environments, other indoor environments, and outdoor environments of their dental schools, respectively. Mean importance ratings for each of the competencies were as follows: Ask (4.71), Advise (4.54), Assess (4.41), Assist (4.07), and Arrange (4.01). Overall, LAC dental educators agree that TUPAC training should be incorporated into the dental curricula. Assist and Arrange competencies were rated lower, relative to other competencies. Tobacco use among dental educators and high rates of on-campus smoking could potentially pose barriers to promoting cessation interventions in the LAC dental schools.
X-ray flux variability of active galactic nuclei observed using NuSTAR
NASA Astrophysics Data System (ADS)
Rani, Priyanka; Stalin, C. S.; Rakshit, Suvendu
2017-04-01
We present results of a systematic study of flux variability on hourly time-scales in a large sample of active galactic nuclei (AGN) in the 3-79 keV band using data from Nuclear Spectroscopic Telescope Array. Our sample consists of four BL Lac objects (BL Lacs), three flat spectrum radio quasars (FSRQs) 24 Seyfert 1, 42 Seyfert 2 and eight narrow line Seyfert 1 (NLSy1) galaxies. We find that in the 3-79 keV band, about 65 per cent of the sources in our sample show significant variations on hourly time-scales. Using the Mann-Whitney U-test and the Kolmogorov-Smirnov test, we find no difference in the variability behaviour between Seyfert 1 and 2 galaxies. The blazar sources (FSRQs and BL Lacs) in our sample are more variable than Seyfert galaxies that include Seyfert 1 and Seyfert 2 in the soft (3-10 keV), hard (10-79 keV) and total (3-79 keV) bands. NLSy1 galaxies show the highest duty cycle of variability (87 per cent), followed by BL Lacs (82 per cent), Seyfert galaxies (56 per cent) and FSRQs (23 per cent). We obtained flux doubling/halving time in the hard X-ray band less than 10 min in 11 sources. The flux variations between the hard and soft bands in all the sources in our sample are consistent with zero lag.
Rabies in the Americas: 1998-2014
Vigilato, Marco A. N.; Pompei, Julio A.; Rocha, Felipe; Vokaty, Alexandra; Molina-Flores, Baldomero; Cosivi, Ottorino; Del Rio Vilas, Victor J.
2018-01-01
Through national efforts and regional cooperation under the umbrella of the Regional Program for the Elimination of Rabies, dog and human rabies have decreased significantly in Latin America and Caribbean (LAC) countries over the last three decades. To achieve this decline, LAC countries had to develop national plans, and consolidate capabilities such as regular mass dog vaccination, opportune post-exposure prophylaxis and sensitive surveillance. This paper presents longitudinal data for 21 LAC countries on dog vaccination, PEP and rabies surveillance collected from the biannual regional meeting for rabies directors from 1998–2014 and from the Regional Epidemiologic Surveillance System for Rabies (SIRVERA). Differences in human and dog rabies incidence rates and dog vaccination rates were shown between low, middle and high-income countries. At the peak, over 50 million dogs were vaccinated annually in national campaigns in the countries represented. The reported number of animal exposures remained fairly stable during the study period with an incidence rate ranging from 123 to 191 reported exposures per 100,000 people. On average, over 2 million doses of human vaccine were applied annually. In the most recent survey, only 37% of countries reported that they had sufficient financial resources to meet the program objectives. The data show a sufficient and sustained effort of the LAC countries in the area of dog vaccination and provide understanding of the baseline effort required to reduce dog-mediated rabies incidence. PMID:29558465
Rabies in the Americas: 1998-2014.
Freire de Carvalho, Mary; Vigilato, Marco A N; Pompei, Julio A; Rocha, Felipe; Vokaty, Alexandra; Molina-Flores, Baldomero; Cosivi, Ottorino; Del Rio Vilas, Victor J
2018-03-01
Through national efforts and regional cooperation under the umbrella of the Regional Program for the Elimination of Rabies, dog and human rabies have decreased significantly in Latin America and Caribbean (LAC) countries over the last three decades. To achieve this decline, LAC countries had to develop national plans, and consolidate capabilities such as regular mass dog vaccination, opportune post-exposure prophylaxis and sensitive surveillance. This paper presents longitudinal data for 21 LAC countries on dog vaccination, PEP and rabies surveillance collected from the biannual regional meeting for rabies directors from 1998-2014 and from the Regional Epidemiologic Surveillance System for Rabies (SIRVERA). Differences in human and dog rabies incidence rates and dog vaccination rates were shown between low, middle and high-income countries. At the peak, over 50 million dogs were vaccinated annually in national campaigns in the countries represented. The reported number of animal exposures remained fairly stable during the study period with an incidence rate ranging from 123 to 191 reported exposures per 100,000 people. On average, over 2 million doses of human vaccine were applied annually. In the most recent survey, only 37% of countries reported that they had sufficient financial resources to meet the program objectives. The data show a sufficient and sustained effort of the LAC countries in the area of dog vaccination and provide understanding of the baseline effort required to reduce dog-mediated rabies incidence.
Andersen, Joakim M.; Barrangou, Rodolphe; Abou Hachem, Maher; Lahtinen, Sampo; Goh, Yong Jun; Svensson, Birte; Klaenhammer, Todd R.
2011-01-01
Probiotic microbes rely on their ability to survive in the gastrointestinal tract, adhere to mucosal surfaces, and metabolize available energy sources from dietary compounds, including prebiotics. Genome sequencing projects have proposed models for understanding prebiotic catabolism, but mechanisms remain to be elucidated for many prebiotic substrates. Although β-galactooligosaccharides (GOS) are documented prebiotic compounds, little is known about their utilization by lactobacilli. This study aimed to identify genetic loci in Lactobacillus acidophilus NCFM responsible for the transport and catabolism of GOS. Whole-genome oligonucleotide microarrays were used to survey the differential global transcriptome during logarithmic growth of L. acidophilus NCFM using GOS or glucose as a sole source of carbohydrate. Within the 16.6-kbp gal-lac gene cluster, lacS, a galactoside-pentose-hexuronide permease-encoding gene, was up-regulated 5.1-fold in the presence of GOS. In addition, two β-galactosidases, LacA and LacLM, and enzymes in the Leloir pathway were also encoded by genes within this locus and up-regulated by GOS stimulation. Generation of a lacS-deficient mutant enabled phenotypic confirmation of the functional LacS permease not only for the utilization of lactose and GOS but also lactitol, suggesting a prominent role of LacS in the metabolism of a broad range of prebiotic β-galactosides, known to selectively modulate the beneficial gut microbiota. PMID:22006318
Exploring the sequence-function relationship in transcriptional regulation by the lac O1 operator.
Maity, Tuhin S; Jha, Ramesh K; Strauss, Charlie E M; Dunbar, John
2012-07-01
Understanding how binding of a transcription factor to an operator is influenced by the operator sequence is an ongoing quest. It facilitates discovery of alternative binding sites as well as tuning of transcriptional regulation. We investigated the behavior of the Escherichia coli Lac repressor (LacI) protein with a large set of lac O(1) operator variants. The 114 variants examined contained a mean of 2.9 (range 0-4) mutations at positions -4, -2, +2 and +4 in the minimally required 17 bp operator. The relative affinity of LacI for the operators was examined by quantifying expression of a GFP reporter gene and Rosetta structural modeling. The combinations of mutations in the operator sequence created a wide range of regulatory behaviors. We observed variations in the GFP fluorescent signal among the operator variants of more than an order of magnitude under both uninduced and induced conditions. We found that a single nucleotide change may result in changes of up to six- and 12-fold in uninduced and induced GFP signals, respectively. Among the four positions mutated, we found that nucleotide G at position -4 is strongly correlated with strong repression. By Rosetta modeling, we found a significant correlation between the calculated binding energy and the experimentally observed transcriptional repression strength for many operators. However, exceptions were also observed, underscoring the necessity for further improvement in biophysical models of protein-DNA interactions. © 2012 The Authors Journal compilation © 2012 FEBS.
Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])
Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)
Jet Precession Driven by a Supermassive Black Hole Binary System in the BL Lac Object PG 1553+113
NASA Astrophysics Data System (ADS)
Caproni, Anderson; Abraham, Zulema; Motter, Juliana Cristina; Monteiro, Hektor
2017-12-01
The recent discovery of a roughly simultaneous periodic variability in the light curves of the BL Lac object PG 1553+113 at several electromagnetic bands represents the first case of such odd behavior reported in the literature. Motivated by this, we analyzed 15 GHz interferometric maps of the parsec-scale radio jet of PG 1553+113 to verify the presence of a possible counterpart of this periodic variability. We used the Cross-entropy statistical technique to obtain the structural parameters of the Gaussian components present in the radio maps of this source. We kinematically identified seven jet components formed coincidentally with flare-like features seen in the γ-ray light curve. From the derived jet component positions in the sky plane and their kinematics (ejection epochs, proper motions, and sky position angles), we modeled their temporal changes in terms of a relativistic jet that is steadily precessing in time. Our results indicate a precession period in the observer’s reference frame of 2.24 ± 0.03 years, compatible with the periodicity detected in the light curves of PG 1553+113. However, the maxima of the jet Doppler boosting factor are systematically delayed relative to the peaks of the main γ-ray flares. We propose two scenarios that could explain this delay, both based on the existence of a supermassive black hole binary system in PG 1553+113. We estimated the characteristics of this putative binary system that also would be responsible for driving the inferred jet precession.
Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J
2004-01-01
A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most likely to be fixed as a mutation if it allows the cell to immediately exit the nondividing state. PMID:15020459
Multiwavelength Observations Of The Previously Unidentified Blazar RX J0648.7+1516
Aliu, E.
2011-11-15
We report on the VERITAS discovery of very-high-energy (VHE) gammaray emission above 200 GeV from the high-frequency-peaked BL Lac object RXJ0648.7+1516 (GBJ0648+1516), associated with 1FGL J0648.8+1516. The photon spectrum above 200 GeV is fit by a power law dN/dE = F0(E/E0) -Γ with a photon index Γ of 4.4 ± 0.8stat ± 0.3syst and a flux normalization F0 of (2.3±0.5stat ±1.2sys)×10 -11 TeV -1cm -2s -1 with E0 = 300 GeV. No VHE variability is detected during VERITAS observations of RXJ0648.7+1516 between 2010 March 4 and April 15. Following the VHE discovery, the optical identification and spectroscopic redshift were obtainedmore » using the Shane 3–m Telescope at the Lick Observatory, showing the unidentified object to be a BL Lac type with a redshift of z = 0.179. Broadband multiwavelength observations contemporaneous with the VERITAS exposure period can be used to sub-classify the blazar as a high-frequency-peaked BL Lac (HBL) object, including data from the MDM observatory, Swift -UVOT and XRT, and continuous monitoring at photon energies above 1 GeV from the Fermi Large Area Telescope (LAT). We find that in the absence of undetected, high-energy rapid variability, the one-zone synchrotron self-Compton model (SSC) overproduces the high-energy gamma-ray emission measured by the Fermi -LAT over 2.3 years. The SED can be parameterized satisfactorily with an external-Compton or lepto-hadronic model, which have two and six additional free parameters, respectively, compared to the one-zone SSC model.« less
Magnetic Fields in Blazar Jets: Radio and Optical Polarization over 20-30 Years
NASA Astrophysics Data System (ADS)
Caldwell, Caroline; Wills, B.; Wills, D.; Aller, H.; Aller, M.
2011-01-01
Blazars are highly active nuclei of distant galaxies. They produce synchrotron-emitting relativistic jets on scales of less than a parsec to many Kpc. When viewed head-on, as opposed to in the plane of the sky, the jet motion appears superluminal, and the emission is Doppler boosted. Blazars show rapid radio and optical variability in flux density and polarization. There are two types of blazars that can have strong synchrotron continua: non-BL Lac blazars with strong broad emission lines (quasars), and BL Lac objects with only weak lines. We have compiled optical linear polarization measurements of 22 blazars, incorporating much archival data from McDonald Observatory. While the optical data are somewhat sparsely sampled, The University of Michigan Radio Astronomical Observatory observed many blazars over 20-30 years, often well-sampled over days to weeks. These data enabled us to compare optical and radio polarization position angles. We constructed histograms of the separation of polarization position angles of the optical and radio. We found that in BL Lac objects, the histogram has a significant peak at zero separation. Since the polarization position angle indicates the direction perpendicular to the magnetic field vector, finding similar polarization position angles indicates a similar magnetic field at the origin of the optical and radio synchrotron radiation. Non-BL Lac blazars show peaks at zero and 90 degree separation of position angle. The 90 degree separation may be caused by optical depth effects within the jet. Although there are a few sources that do not strongly display the characteristics summarized by the histograms, most sources produce optical and radio polarization position angles that nearly coincide or are separated by 90 degrees. Using VLBA and VLA radio maps, we interpret the results in terms of the position angle of the jet in the sky plane.
Structure of the effector-binding domain of the arabinose repressor AraR from Bacillus subtilis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Procházková, Kateřina; Čermáková, Kateřina; Pachl, Petr
2012-02-01
The crystal structure of the effector-binding domain of the transcriptional repressor AraR from B. subtilis in complex with the effector molecule (l-arabinose) was determined at 2.2 Å resolution. A detailed analysis of the crystal identified a dimer organization that is distinctive from that of other members of the GalR/LacI family. In Bacillus subtilis, the arabinose repressor AraR negatively controls the expression of genes in the metabolic pathway of arabinose-containing polysaccharides. The protein is composed of two domains of different phylogenetic origin and function: an N-terminal DNA-binding domain belonging to the GntR family and a C-terminal effector-binding domain that shows similaritymore » to members of the GalR/LacI family. The crystal structure of the C-terminal effector-binding domain of AraR in complex with the effector l-arabinose has been determined at 2.2 Å resolution. The l-arabinose binding affinity was characterized by isothermal titration calorimetry and differential scanning fluorimetry; the K{sub d} value was 8.4 ± 0.4 µM. The effect of l-arabinose on the protein oligomeric state was investigated in solution and detailed analysis of the crystal identified a dimer organization which is distinctive from that of other members of the GalR/LacI family.« less
NASA Astrophysics Data System (ADS)
Aller, M. F.; Aller, H. D.; Hughes, P. A.
2003-03-01
Using UMRAO centimeter-band total flux density and linear polarization monitoring observations of the complete Pearson-Readhead extragalactic source sample obtained between 1984 August and 2001 March, we identify the range of variability in extragalactic objects as functions of optical and radio morphological classification and relate total flux density variations to structural changes in published coeval VLBI maps in selected objects. As expected, variability is common in flat- or inverted-spectrum (α<=0.5) core-dominated QSOs and BL Lac objects. Unexpectedly, we find flux variations in several steep-spectrum sample members, including the commonly adopted flux standard 3C 147. Such variations are characteristically several-year rises or declines or infrequent outbursts, requiring long-term observations for detection: we attribute them to the brightening of weak core components, a change that is suppressed by contributions from extended structure in all but the strongest events, and identify a wavelength dependence for the amplitude of this variability consistent with the presence of opacity in some portions of the jet flow. One morphological class of steep-spectrum objects, the compact symmetric objects (CSOs), characteristically shows only low-level variability. We examine the statistical relation between fractional polarization and radio class based on the data at 14.5 and 4.8 GHz. The blazars typically exhibit flat-to-inverted polarization spectra, a behavior attributed to opacity effects. Among the steep-spectrum objects, the lobe-dominated FR I galaxies have steep fractional polarization spectra, while the FR II galaxies exhibit fractional polarization spectra ranging from inverted to steep, with no identifiable common property that accounts for the range in behavior. For the CSO/gigahertz-peaked spectrum sources, we verify that the fractional polarizations at 4.8 GHz are only of the order of a few tenths of a percent, but at 14.5 GHz we find significantly higher polarizations, ranging from 1% to 3%; this frequency dependence supports a scenario invoking Faraday depolarization by a circumnuclear torus. We have identified preferred orientations of the electric vector of the polarized emission (EVPA) at 14.5 and 4.8 GHz in roughly half of the objects and compared these with orientations of the flow direction indicated by VLBI morphology. When comparing the distributions of the orientation offsets for the BL Lac objects and the QSOs, we find differences in both range and mean value, in support of intrinsic class differences. In the shock-in-jet scenario, we attribute this to the allowed range of obliquities of shocks developing in the flow relative to the flow direction: in the BL Lac objects the shocks are nearly transverse to the flow direction, while in the QSOs they include a broader range of obliquities and can be at large angles to it. The fact that we find long-term stability in EVPA over many events implies that a dominant magnetic field orientation persists; in the core-dominated objects, with small contribution from the underlying quiescent jet, this plausibly suggests that the magnetic field has a long-term memory, with subsequent shock events exhibiting similar EVPA orientation, or, alternatively, the presence of a standing shock in the core. We have looked for systematic, monotonic changes in EVPA, which might be expected in the emission from a precessing jet, a model currently invoked for some AGNs; none were identified. Further, we carried out a Scargle periodogram analysis of the total flux density observations, but found no strong evidence for periodicity in any of the sample sources. The only well-established case in support of both jet precession and periodic variability remains the non-sample member OJ 287.
Bao, Lei; Zhang, Min; Yan, Peixia; Wu, Xiaoyan; Shao, Jun; Zheng, Ruiqiang
2015-01-01
To explore the prognostic value of arterial blood lactate ( Lac ) levels and lactate clearance rate ( LCR ) in the patients with septic shock. A retrospective study was conducted. Clinical data of 94 septic patients admitted in the Department of Critical Care Medicine in Subei People's Hospital from January 2011 to June 2014 were analyzed. The arterial blood Lac levels at the moment of diagnosis of septic shock ( incipient value, 0 hour ) and early-stage after treatment ( 3, 6 and 24 hours ) were reviewed, and individual LCR was calculated at 3, 6, 24 hours for each patient. According to the outcome in intensive care unit ( ICU ), patients were divided into survival group ( n = 48 ) and death group ( n = 46 ). The Lac and LCR at different time points in two groups were analyzed, and the relationships between them and outcome were analyzed. The receiver-operating characteristic ( ROC ) curve was plotted to assess the value of Lac and LCR at different time points for predicting the outcome. Lac level after treatment in survival group was significantly lower than incipient value, but there was no obvious change in death group. Compared with death group, early Lac levels ( mmol/L ) in survival group were significantly reduced ( 0 hour: 3.80±2.14 vs. 5.75±3.21, 3 hours: 2.05±1.04 vs. 5.03±2.53, 6 hours: 1.80±0.77 vs. 4.40±2.02, 24 hours: 1.35±0.43 vs. 4.90±2.72, P<0.05 or P<0.01 ), the LCR was significantly increased [ 3 hours: 50.00 ( 72.35 )% vs. 13.51 ( 20.67 )%, 6 hours: 41.43 ( 58.42 )% vs. 22.00 ( 22.31 )%, 24 hours: 58.73 ( 29.94 )% vs. 18.92 ( 47.28 )%, P<0.05 or P<0.01 ]. The Lac levels at all time points were positively correlated with the outcome, and 6-hour and 24-hour LCR were negatively correlated with the outcome. According to the incipient Lac level, patients were divided into low Lac group ( Lac<2 mmol/L ), mild Lac group ( Lac 2-3 mmol/L ) and high Lac group ( Lac ≥ 4 mmol/L ). The mortality in low Lac group, mild Lac group, high Lac group was gradually increased [ 23.07% ( 6/26 ), 50.00% ( 8/16 ), 61.54% ( 32/52 ), χ(2) = 10.270, P = 0.006 ]. ROC curves demonstrated that the area under ROC curve ( AUC ) of 24-hour Lac was the largest, 0.944, and it was more sensitive and specific in the prognosis evaluation ( 100% and 78.3%, respectively ). According to the cut-off value of 24-hour Lac as 2.35 mmol/L, patients were divided into high Lac and low Lac groups, and mortality rate in high Lac group was significantly higher than that in low Lac group [ 100.0% ( 36/36 ) vs. 17.24% ( 10/58 ), χ(2) = 30.441,P = 0.000 ]. The AUC of 24-hour LCR was the largest, 0.865, and it was more sensitive and specific for the prognosis evaluation ( 83.3% and 91.3%, respectively ). According to the cut-off value of 24-hour LCR as 36.8%, patients were divided into high LCR group and low LCR group, and mortality rate in low LCR group was significantly higher than that in high LCR group [ 84.00% ( 42/50 ) vs. 9.09% ( 4/44 ), χ(2) = 26.278, P = 0.000 ]. Early high Lac in patients with septic shock prompts a poor prognosis, and 24-hour Lac levels and LCR are indicators of assessment of clinical therapeutic effect and prognosis of patients with septic shock.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chaptal, Vincent; Kwon, Seunghyug; Sawaya, Michael R.
Lactose permease of Escherichia coli (LacY) with a single-Cys residue in place of A122 (helix IV) transports galactopyranosides and is specifically inactivated by methanethiosulfonyl-galactopyranosides (MTS-gal), which behave as unique suicide substrates. In order to study the mechanism of inactivation more precisely, we solved the structure of single-Cys122 LacY in complex with covalently bound MTS-gal. This structure exhibits an inward-facing conformation similar to that observed previously with a slight narrowing of the cytoplasmic cavity. MTS-gal is bound covalently, forming a disulfide bond with C122 and positioned between R144 and W151. E269, a residue essential for binding, coordinates the C-4 hydroxyl ofmore » the galactopyranoside moiety. The location of the sugar is in accord with many biochemical studies.« less
The Origin of Mutants Under Selection: How Natural Selection Mimics Mutagenesis (Adaptive Mutation)
Maisnier-Patin, Sophie; Roth, John R.
2015-01-01
Selection detects mutants but does not cause mutations. Contrary to this dictum, Cairns and Foster plated a leaky lac mutant of Escherichia coli on lactose medium and saw revertant (Lac+) colonies accumulate with time above a nongrowing lawn. This result suggested that bacteria might mutagenize their own genome when growth is blocked. However, this conclusion is suspect in the light of recent evidence that revertant colonies are initiated by preexisting cells with multiple copies the conjugative F′lac plasmid, which carries the lac mutation. Some plated cells have multiple copies of the simple F′lac plasmid. This provides sufficient LacZ activity to support plasmid replication but not cell division. In nongrowing cells, repeated plasmid replication increases the likelihood of a reversion event. Reversion to lac+ triggers exponential cell growth leading to a stable Lac+ revertant colony. In 10% of these plated cells, the high-copy plasmid includes an internal tandem lac duplication, which provides even more LacZ activity—sufficient to support slow growth and formation of an unstable Lac+ colony. Cells with multiple copies of the F′lac plasmid have an increased mutation rate, because the plasmid encodes the error-prone (mutagenic) DNA polymerase, DinB. Without DinB, unstable and stable Lac+ revertant types form in equal numbers and both types arise with no mutagenesis. Amplification and selection are central to behavior of the Cairns–Foster system, whereas mutagenesis is a system-specific side effect or artifact caused by coamplification of dinB with lac. Study of this system has revealed several broadly applicable principles. In all populations, gene duplications are frequent stable genetic polymorphisms, common near-neutral mutant alleles can gain a positive phenotype when amplified under selection, and natural selection can operate without cell division when variability is generated by overreplication of local genome subregions. PMID:26134316
Multiwavelength Observations of Markarian 421 During a TeV/X-Ray Flare
NASA Technical Reports Server (NTRS)
Bertsch, D. L.; Bruhweiler, F.; Macomb, D. J.; Cheng, K.-P.; Carter-Lewis, D. A.; Akerlof, C. W.; Aller, H. D.; Aller, M. F.; Buckley, J. H.; Cawley, M. F.
1995-01-01
A TeV flare from the BL Lac object Mrk 421 was detected in May of 1994 by the Whipple Observatory air Cherenkov experiment during which the flux above 250 GeV increased by nearly an order of magnitude over a 2-day period. Contemporaneous observations by ASCA showed the X-ray flux to be in a very high state. We present these results, combined with the first ever simultaneous or nearly simultaneous observations at GeV gamma-ray, UV, IR, mm, and radio energies for this nearest BL Lac object. While the GeV gamma-ray flux increased slightly, there is little evidence for variability comparable to that seen at TeV and X-ray energies. Other wavelengths show even less variability. This provides important constraints on the emission mechanisms at work. We present the multiwavelength spectrum of this gamma-ray blazar for both quiescent and flaring states and discuss the data in terms of current models of blazar emission.
3FGLzoo: classifying 3FGL unassociated Fermi-LAT γ-ray sources by artificial neural networks
NASA Astrophysics Data System (ADS)
Salvetti, D.; Chiaro, G.; La Mura, G.; Thompson, D. J.
2017-09-01
In its first four years of operation, the Fermi-Large Area Telescope (LAT) detected 3033 γ-ray emitting sources. In the Fermi-LAT Third Source Catalogue (3FGL) about 50 per cent of the sources have no clear association with a likely γ-ray emitter. We use an artificial neural network algorithm aimed at distinguishing BL Lacs from FSRQs to investigate the source subclass of 559 3FGL unassociated sources characterized by γ-ray properties very similar to those of active galactic nuclei. Based on our method, we can classify 271 objects as BL Lac candidates, 185 as FSRQ candidates, leaving only 103 without a clear classification. We suggest a new zoo for γ-ray objects, where the percentage of sources of uncertain type drops from 52 per cent to less than 10 per cent. The result of this study opens up new considerations on the population of the γ-ray sky, and it will facilitate the planning of significant samples for rigorous analyses and multiwavelength observational campaigns.
Herrick, K J; Hippen, A R; Kalscheur, K F; Schingoethe, D J; Casper, D P; Moreland, S C; van Eys, J E
2017-01-01
Several studies have identified beneficial effects of butyrate on rumen development and intestinal health in preruminants. These encouraging findings led to further investigations related to butyrate supplementation in the mature ruminant. However, the effects of elevated butyrate concentrations on rumen metabolism have not been investigated, and consequently the maximum tolerable dosage rate of butyrate has not been established. Therefore, the first objective of this work was to evaluate the effect of a short-term increase in rumen butyrate concentration on key metabolic indicators. The second objective was to evaluate the source of butyrate, either directly dosed in the rumen or indirectly supplied via lactose fermentation in the rumen. Jugular catheters were inserted into 4 ruminally fistulated Holstein cows in a 4×4 Latin square with 3-d periods. On d 1 of each period, 1h after feeding, cows were ruminally dosed with 1 of 4 treatments: (1) 2L of water (CON), (2) 3.5g/kg of body weight (BW) of lactose (LAC), (3) 1g/kg of BW of butyrate (1GB), or (4) 2g/kg of BW of butyrate (2GB). Sodium butyrate was the source of butyrate, and NaCl was added to CON (1.34g/kg of BW), LAC (1.34g/kg of BW), and 1GB (0.67g/kg of BW) to provide equal amounts of sodium as the 2GB treatment. Serial plasma and rumen fluid samples were collected during d 1 of each period. Rumen fluid pH was greater in cows given the 1GB and 2GB treatments compared with the cows given the LAC treatment. Cows administered the 1GB and 2GB treatments had greater rumen butyrate concentrations compared with LAC. Those cows also had greater plasma butyrate concentrations compared with cows given the LAC treatment. Plasma β-hydroxybutyrate was greater and insulin tended to be greater for butyrate treatments compared with LAC. No difference in insulin was found between the 1GB and 2GB treatments. Based on plasma and rumen metabolites, singly infusing 3.5g/kg of BW of lactose into the rumen is not as effective at providing a source of butyrate as compared with singly infusing 1 or 2g/kg of BW of butyrate into the rumen. Additionally, rumen pH, rumen butyrate, plasma β-hydroxybutyrate, glucose, and plasma butyrate were less affected in cows administered the 1GB treatment than in cows given the 2GB treatment. This finding suggests that singly dosing 1g/kg of BW of butyrate could serve as the maximum tolerable concentration for future research. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
φ-evo: A program to evolve phenotypic models of biological networks.
Henry, Adrien; Hemery, Mathieu; François, Paul
2018-06-01
Molecular networks are at the core of most cellular decisions, but are often difficult to comprehend. Reverse engineering of network architecture from their functions has proved fruitful to classify and predict the structure and function of molecular networks, suggesting new experimental tests and biological predictions. We present φ-evo, an open-source program to evolve in silico phenotypic networks performing a given biological function. We include implementations for evolution of biochemical adaptation, adaptive sorting for immune recognition, metazoan development (somitogenesis, hox patterning), as well as Pareto evolution. We detail the program architecture based on C, Python 3, and a Jupyter interface for project configuration and network analysis. We illustrate the predictive power of φ-evo by first recovering the asymmetrical structure of the lac operon regulation from an objective function with symmetrical constraints. Second, we use the problem of hox-like embryonic patterning to show how a single effective fitness can emerge from multi-objective (Pareto) evolution. φ-evo provides an efficient approach and user-friendly interface for the phenotypic prediction of networks and the numerical study of evolution itself.
Magnetic Fields in Blazar Jets: Jet-Alignment of Radio and Optical Polarization over 20-30 Years
NASA Astrophysics Data System (ADS)
Wills, Beverley J.; Aller, M. F.; Caldwell, C.; Aller, H. D.
2012-01-01
Blazars are highly active nuclei of distant galaxies. They produce synchrotron-emitting relativistic jets on scales of less than a parsec to many Kpc. When viewed head-on, as opposed to in the plane of the sky, the jet motion appears superluminal, and the emission is Doppler boosted. Blazars show rapid radio and optical variability in flux density and polarization. There are two types of blazars that can have strong synchrotron continua: some quasars with strong broad emission lines, and BL Lac objects with weak or undetected broad lines. We have compiled optical linear polarization measurements of more than 100 blazars, including archival data from McDonald Observatory. While the optical data are somewhat sparsely sampled, The University of Michigan Radio Astronomical Observatory observed many blazars over 20-30 years, often well-sampled over days to weeks, enabling quasi-simultaneous comparison of optical and radio polarization position angles (EVPAs). We also collected data on jet direction -- position angles of the jet component nearest the radio core. The project is unique in examining the polarization and jet behavior over many years. BL Lac objects tend to have stable optically thin EVPA in the jet direction, meaning magnetic field is perpendicular to jet flow, often interpreted as the magnetic field compressed by shocks. In quasar-blazars optical and radio EVPA often changes between parallel or perpendicular to the jet direction, even in the same object. The underlying B field of the jet is is parallel to the flow, with approximately 90 degree changes resulting from shocks. For both BL Lac objects & quasars, the scatter in EVPA usually increases from low frequencies (4.8 GHz) through 14.5 GHz through optical. The wide optical-radio frequency range allows us to investigate optical depth effects and the spatial origin of radio and optical emission.
Optical and X-ray observations of the two BL Lac objects OJ 287 and MS 1458+22
NASA Astrophysics Data System (ADS)
Massaro, E.; Giommi, P.; Perri, M.; Tagliaferri, G.; Nesci, R.; Tosti, G.; Ciprini, S.; Montagni, F.; Ravasio, M.; Ghisellini, G.; Frasca, A.; Marilli, E.; Valentini, G.; Kurtanidze, O. M.; Nikolashvili, M. G.
2003-02-01
We present the results of recent BeppoSAX observations of the two BL Lac objects OJ 287 and MS 1458+22 in bright optical states and of simultaneous photometric measurements in the bandpasses from I to U. OJ 287 was observed in November 2001 and MS 1458+22 in February of the same year. The X-ray flux of OJ 287 was rather low, F(2-10 keV) = (1.35+/-0.15)x 10-12 erg cm-2 s-1 and its spectrum is well described by a single power law with an energy index 0.45+/-0.08, flatter than that measured in the optical, equal to 1.53+/-0.03. The X-ray emission of MS 1458+22 was characterized by a low flux level of F(2-10 keV) = (7.5+/-0.6)x 10-13 erg cm-2 s-1, with a steeper spectral index of 1.71+/-0.15, while in the optical it was 0.99+/-0.06. We show that the broad-band SEDs of these two sources can be well represented by log-parabolic spectral laws and evaluate their parameters. This law, already observed for the synchrotron components of other BL Lac sources, can be explained if the emitting particles are accelerated by some statistical mechanism having a probability of energy gain that is a decreasing function of the energy itself.
Effective spectral index properties for Fermi blazars
NASA Astrophysics Data System (ADS)
Yang, JiangHe; Fan, JunHui; Liu, Yi; Zhang, YueLian; Tuo, ManXian; Nie, JianJun; Yuan, YuHai
2018-05-01
Blazars are a special subclass of active galactic nuclei with extreme observation properties. This subclass can be divided into two further subclasses of flat spectrum radio quasars (FSRQs) and BL Lacertae objects (BL Lacs) according to their emission line features. To compare the spectral properties of FSRQs and BL Lacs, the 1.4 GHz radio, optical R-band, 1 keV X-ray, and 1 GeV γ-ray flux densities for 1108 Fermi blazars are calculated to discuss the properties of the six effective spectral indices of radio to optical ( α RO), radio to X-ray ( α RX), radio to γ ray ( α Rγ), optical to X-ray ( α OX), optical to γ ray ( α Oγ), and X-ray to γ ray ( α Xγ). The main results are as follows: For the averaged effective spectral indices, \\overline {{α _{OX}}} > \\overline {{α _{Oγ }}} > \\overline {{α _{Xγ }}} > \\overline {{α _{Rγ }}} > \\overline {{α _{RX}}} > \\overline {{α _{RO}}} for samples of whole blazars and BL Lacs; \\overline {{α _{Xγ }}} ≈ \\overline {{α _{Rγ }}} ≈ \\overline {{α _{RX}}} for FSRQs and low-frequency-peaked BL Lacs (LBLs); and \\overline {{α _{OX}}} ≈ \\overline {{α _{Oγ }}} ≈ \\overline {{α _{Xγ }}} for high-synchrotron-frequency-peaked BL Lacs (HBLs). The distributions of the effective spectral indices involving optical emission ( α RO, α OX, and α Oγ) for LBLs are different from those for FSRQs, but if the effective spectral index does not involve optical emission ( α RX, α Rγ, and α Xγ), the distributions for LBLs and FSRQs almost come from the same parent population. X-ray emissions from blazars include both synchrotron and inverse Compton (IC) components; the IC component for FSRQs and LBLs accounts for a larger proportion than that for HBLs; and the radiation mechanism for LBLs is similar to that for FSRQs, but the radiation mechanism for HBLs is different from that for both FSRQs and LBLs in X-ray bands. The tendency of α Rγ decreasing from LBLs to HBLs suggests that the synchrotron self-Compton model explains the main process for highly energetic γ rays in BL Lacs.
Pastrana, Tania; De Lima, Liliana; Eisenchlas, Jorge; Wenk, Roberto
2012-03-01
Research in palliative care has increased significantly in the last decade, while the vast majority of the global disease burden occurs in developing countries. To explore the palliative care research activity in Latin America and the Caribbean (LAC) and its visibility in the international palliative care literature, with a special focus on research studies. A bibliometric analysis was conducted in MEDLINE(®), Embase(®), PsycINFO(®), and CINAHL(®). Inclusion criteria were: (1) articles published in peer-reviewed scientific journals; (2) main subject was palliative care; (3) research study; (4) the first author or coauthors was based in LAC; and/or (5) the data collected derived from LAC. One hundred six articles from 10 countries were identified in the literature research. The first publication dates from 1989 and was a qualitative study in Brazil. This study shows a modest contribution of publications from LAC. However, the volume of publications within the region is distributed unequally, reflecting the heterogeneity of the region: Brazil published more than half of the articles, while 35 countries have no publications. Most of the studies were quantitative research, predominantly cross-sectional studies. Qualitative studies often used interviews. Health care service was the most researched issue. Seventy percent of studies were carried out in institutions. Palliative care research should have a place in LAC. The development of a regional research agenda tailored to the needs and features of the region considering the health care structure and local resources available is indispensable.
24 CFR 3280.305 - Structural design requirements.
Code of Federal Regulations, 2010 CFR
2010-04-01
... Kandiyohi Carver Blue Earth Cass Meeker Dakota Martin Crow Wing Wright Goodhue Watonwan Aitkin Lac qui Parle... Charlevoix Benzie Marquette Menominee Montmorency Grand Traverse Alger Delta Alpena Kalkaska Luce Schoolcraft...
24 CFR 3280.305 - Structural design requirements.
Code of Federal Regulations, 2011 CFR
2011-04-01
... Kandiyohi Carver Blue Earth Cass Meeker Dakota Martin Crow Wing Wright Goodhue Watonwan Aitkin Lac qui Parle... Charlevoix Benzie Marquette Menominee Montmorency Grand Traverse Alger Delta Alpena Kalkaska Luce Schoolcraft...
Zabeau, M; Stanley, K K
1982-01-01
Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257
NASA Astrophysics Data System (ADS)
Liu, Jin; Jewel, Yead; Dutta, Prashanta
2017-11-01
Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the binding of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule to a wild-type LacY. Transitions from inward-facing to outward-facing conformations upon TDG binding and protonation of Glu269 have been achieved from microsecond simulations. Both the opening of the periplasmic side and closure of the cytoplasmic side of LacY are consistent with experiments. Our analysis suggest that the conformational changes of LacY are a cumulative consequence of inter-domain H-bonds breaking at the periplasmic side, inter-domain salt-bridge formation at the cytoplasmic side, as well as the TDG orientational changes during the transition. This work is supported by US National Science Foundation under Grant No. CBET-1604211.
The Impact of Developmental Education at Triton College.
ERIC Educational Resources Information Center
Chand, Sunil
1985-01-01
Describes the following aspects of the Developmental Education Program at Triton College: student placement, courses, faculty selection, reading and writing instruction, mathematics instruction, the Learning Assistance Center (LAC), LAC tutoring, LAC special projects, LAC management, special needs assistance program for disabled students, and…
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
The first catalog of active galactic nuclei detected by the FERMI large area telescope
Abdo, A. A.; Ackermann, M.; Ajello, M.; ...
2010-04-29
Here, we present the first catalog of active galactic nuclei (AGNs) detected by the Large Area Telescope (LAT), corresponding to 11 months of data collected in scientific operation mode. The First LAT AGN Catalog (1LAC) includes 671 γ-ray sources located at high Galactic latitudes (|b|>10°) that are detected with a test statistic greater than 25 and associated statistically with AGNs. Some LAT sources are associated with multiple AGNs, and consequently, the catalog includes 709 AGNs, comprising 300 BL Lacertae objects, 296 flat-spectrum radio quasars, 41 AGNs of other types, and 72 AGNs of unknown type. We also classify the blazarsmore » based on their spectral energy distributions as archival radio, optical, and X-ray data permit. In addition to the formal 1LAC sample, we provide AGN associations for 51 low-latitude LAT sources and AGN "affiliations" (unquantified counterpart candidates) for 104 high-latitude LAT sources without AGN associations. The overlap of the 1LAC with existing γ-ray AGN catalogs (LBAS, EGRET, AGILE, Swift, INTEGRAL, TeVCat) is briefly discussed. Various properties—such as γ-ray fluxes and photon power-law spectral indices, redshifts, γ-ray luminosities, variability, and archival radio luminosities—and their correlations are presented and discussed for the different blazar classes. Lastly, we compare the 1LAC results with predictions regarding the γ-ray AGN populations, and we comment on the power of the sample to address the question of the blazar sequence.« less
van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M
1993-02-01
Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.
Mezey, Gillian; Meyer, Deborah; Robinson, Fiona; Bonell, Chris; Campbell, Rona; Gillard, Steve; Jordan, Peter; Mantovani, Nadia; Wellings, Kaye; White, Sarah
2015-10-01
Looked-after children (LAC) are at greater risk of teenage pregnancy than non-LAC, which is associated with adverse health and social consequences. Existing interventions have failed to reduce rates of teenage pregnancy in LAC. Peer mentoring is proposed as a means of addressing many of the factors associated with the increased risk of teenage pregnancy in this group. To develop a peer mentoring intervention to reduce teenage pregnancy in LAC. Phase I and II randomised controlled trial of a peer mentoring intervention for LAC; scoping exercise and literature search; national surveys of social care professionals and LAC; and focus groups and interviews with social care professionals, mentors and mentees. Three local authorities (LAs) in England. LAC aged 14-18 years (mentees/care as usual) and 19-25 years (mentors). Recruitment and training of mentors; randomisation and matching of mentors to mentees; and 1-year individual peer mentoring. pregnancy in LAC aged 14-18 years. sexual attitudes, behaviour and knowledge; psychological health; help-seeking behaviour; locus of control; and attachment style. A health economic evaluation was also carried out. In total, 54% of target recruitment was reached for the exploratory trial and 13 out of 20 mentors (65%) and 19 out of 30 LAC aged 14-18 years (63%) (recruited during Phases I and II) were retained in the research. The training programme was acceptable and could be manualised and replicated. Recruitment and retention difficulties were attributed to systemic problems and LA lack of research infrastructure and lack of additional funding to support and sustain such an intervention. Mentees appeared to value the intervention but had difficulty in meeting weekly as required. Only one in four of the relationships continued for the full year. A future Phase III trial would require the intervention to be modified to include provision of group and individual peer mentoring; internal management of the project, with support from an external agency such as a charity or the voluntary sector; funds to cover LA research costs, including the appointment of a dedicated project co-ordinator; a reduction in the lower age for mentee recruitment and an increase in the mentor recruitment age to 21 years; and the introduction of a more formal recruitment and support structure for mentors. Given the problems identified and described in mounting this intervention, a new development phase followed by a small-scale exploratory trial incorporating these changes would be necessary before proceeding to a Phase III trial. This project was funded by the NIHR Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 19, No. 85. See the NIHR Journals Library website for further project information.
Shi, Xiaowei; Liu, Qian; Ma, Jiangshan; Liao, Hongdong; Xiong, Xianqiu; Zhang, Keke; Wang, Tengfei; Liu, Xuanmin; Xu, Ting; Yuan, Shanshan; Zhang, Xin; Zhu, Yonghua
2015-11-01
Isolation and identification of a novel laccase (namely Lac4) with various industrial applications potentials from an endophytical bacterium. Endophyte Sd-1 cultured in rice straw showed intra- and extra-cellular laccase activities. Genomic analysis of Sd-1 identified four putative laccases, Lac1 to Lac4. However, only Lac4 contains the complete signature sequence of laccase and shares at most 64 % sequence identity with other characterized bacterial multi-copper oxidases. Recombinant Lac4 can oxidize non-phenolic and phenolic compounds under acidic conditions and at 30-50 °C; Km values of Lac4 for ABTS at pH 2.5 and for guaiacol at pH 4.5 were 1 ± 0.15 and 6.1 ± 1.7 mM, respectively. The activity of Lac4 was stimulated by 0.8 mM Cu(2+) and 5 mM Fe(2+). In addition, Lac4 could decolorize various synthetic dyes and exhibit the degradation rate of 38 % for lignin. The data suggest that Lac4 possesses promising biotechnological potentials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Landoni, M.; Zanutta, A.; Bianco, A.
2016-02-15
The haunt of high-redshift BL Lacerate objects is day by day more compelling to firmly understand their intrinsic nature and evolution. SDSS J004054.65-0915268 is, at the moment, one of the most distant BL Lac candidates, at z ∼ 5. We present a new optical-near-IR spectrum obtained with ALFOSC-NOT with a new, custom designed dispersive grating aimed to detect broad emission lines that could disprove this classification. In the obtained spectra, we do not detect any emission features and we provide an upper limit to the luminosity of the C iv broad emission line. Therefore, the nature of the object is then discussed,more » building the overall spectral energy distribution (SED) and fitting it with three different models. Our fits, based on SED modeling with different possible scenarios, cannot rule out the possibility that this source is indeed a BL Lac object, though the absence of optical variability and the lack of strong radio flux seem to suggest that the observed optical emission originates from a thermalized accretion disk.« less
NASA Astrophysics Data System (ADS)
Landoni, M.; Zanutta, A.; Bianco, A.; Tavecchio, F.; Bonnoli, G.; Ghisellini, G.
2016-02-01
The haunt of high-redshift BL Lacerate objects is day by day more compelling to firmly understand their intrinsic nature and evolution. SDSS J004054.65-0915268 is, at the moment, one of the most distant BL Lac candidates, at z ˜ 5. We present a new optical-near-IR spectrum obtained with ALFOSC-NOT with a new, custom designed dispersive grating aimed to detect broad emission lines that could disprove this classification. In the obtained spectra, we do not detect any emission features and we provide an upper limit to the luminosity of the C IV broad emission line. Therefore, the nature of the object is then discussed, building the overall spectral energy distribution (SED) and fitting it with three different models. Our fits, based on SED modeling with different possible scenarios, cannot rule out the possibility that this source is indeed a BL Lac object, though the absence of optical variability and the lack of strong radio flux seem to suggest that the observed optical emission originates from a thermalized accretion disk.
Optical Spectra of Four Objects Identified with Variable Radio Sources
NASA Astrophysics Data System (ADS)
Chavushyan, V.; Mujica, R.; Gorshkov, A. G.; Konnikova, V. K.; Mingaliev, M. G.
2000-06-01
We obtained optical spectra of four objects identified with variable radio sources. Three objects (0029+0554, 0400+0550, 2245+0500) were found to be quasars with redshifts of 1.314, 0.761, and 1.091. One object (2349+0534) has a continuum spectrum characteristic of BL Lac objects. We analyze spectra of the radio sources in the range 0.97-21.7 GHz for the epoch 1997 and in the range 3.9-11.1 GHz for the epoch 1990, as well as the pattern of variability of their flux densities on time scales of 1.5 and 7 years.
2004-12-01
were primarily responsible for the organic chemistry and the analytical chemistry, and to Dr. F . Bikker, Mrs. Roos Mars and Mrs. Helma van Dijk for...study as hosts for bacteriophages: TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36proA+ B+ laclq lacZ AM 15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B...TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36 proA+ B+ lacPq lacZ AM15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B+ laclq Z AM15]. Both strains were
Adaptive Evolution of the Streptococcus pyogenes Regulatory Aldolase LacD.1
Cusumano, Zachary
2013-01-01
In the human-pathogenic bacterium Streptococcus pyogenes, the tagatose bisphosphate aldolase LacD.1 likely originated through a gene duplication event and was adapted to a role as a metabolic sensor for regulation of virulence gene transcription. Although LacD.1 retains enzymatic activity, its ancestral metabolic function resides in the LacD.2 aldolase, which is required for the catabolism of galactose. In this study, we compared these paralogous proteins to identify characteristics correlated with divergence and novel function. Surprisingly, despite the fact that these proteins have identical active sites and 82% similarity in amino acid sequence, LacD.1 was less efficient at cleaving both fructose and tagatose bisphosphates. Analysis of kinetic properties revealed that LacD.1's adaptation was associated with a decrease in kcat and an increase in Km. Construction and analysis of enzyme chimeras indicated that non-active-site residues previously associated with the variable activities of human aldolase isoenzymes modulated LacD.1's affinity for substrate. Mutant LacD.1 proteins engineered to have LacD.2-like levels of enzymatic efficiency lost the ability to function as regulators, suggesting that an alteration in efficiency was required for adaptation. In competition under growth conditions that mimic a deep-tissue environment, LacD.1 conferred a significant gain in fitness that was associated with its regulatory activity. Taken together, these data suggest that LacD.1's adaptation represents a form of neofunctionalization in which duplication facilitated the gain of regulatory function important for growth in tissue and pathogenesis. PMID:23316044
Teste, Bruno; Vial, Jérôme; Descroix, Stéphanie; Georgelin, Thomas; Siaugue, Jean-Michel; Petr, Jan; Varenne, Anne; Hennion, Marie-Claire
2010-06-15
A chemometric approach was developed to optimize the grafting of a bovine milk allergen: alpha-Lactalbumin (alpha-Lac) on colloidal functionalized magnetic core-shell nanoparticles (MCSNP). Such nanoparticles, functionalized with polyethyleneglycol and amino groups, exhibit a 30nm physical diameter and behave as a quasi-homogeneous system. The alpha-Lac immobilization was achieved through the covalent binding between MCSNP amino groups and alpha-Lac carboxylic moieties using the well-known tandem carbodiimide (EDC) and hydroxysulfosuccinimide (NHS). In this study, a chemometric approach was employed to highlight the parameters influencing the number of grafted proteins on the MCSNP. Three factors were evaluated: the ratio in concentration between EDC and alpha-Lac, between NHS and EDC and the concentration of alpha-Lac. After a first full factorial design to delimit the region of the space where the optimum could be located, a central composite design was then carried out to predict the best grafting conditions. It was established and experimentally confirmed that the optimum parameters are [EDC]/[alpha-Lac]=25; [NHS]/[EDC]=1.55 and alpha-Lac=24.85nmolmL(-1). In these optimal conditions, MCSNP surface was successfully saturated with alpha-Lac (34 alpha-Lac/MCSNP) with a high reproducibility (RSD=2%). The colloidal stability of MCSNP grafted with alpha-Lac as well as the immunological interactions using anti alpha-Lac antibody were then investigated in different buffers. The results emphasized that a 50mM MES buffer (pH 6) allows an efficient immune capture and a satisfying colloidal stability which provide an immunological interaction in homogeneous liquid phase.
Peng, Wenjie; Pranskevich, Jennifer; Nycholat, Corwin; Gilbert, Michel; Wakarchuk, Warren; Paulson, James C; Razi, Nahid
2012-01-01
Poly-N-acetyllactosamine extensions on N- and O-linked glycans are increasingly recognized as biologically important structural features, but access to these structures has not been widely available. Here, we report a detailed substrate specificity and catalytic efficiency of the bacterial β3-N-acetylglucosaminyltransferase (β3GlcNAcT) from Helicobacter pylori that can be adapted to the synthesis of a rich diversity of glycans with poly-LacNAc extensions. This glycosyltransferase has surprisingly broad acceptor specificity toward type-1, -2, -3 and -4 galactoside motifs on both linear and branched glycans, found commonly on N-linked, O-linked and I-antigen glycans. This finding enables the production of complex ligands for glycan-binding studies. Although the enzyme shows preferential activity for type 2 (Galβ1-4GlcNAc) acceptors, it is capable of transferring N-acetylglucosamine (GlcNAc) in β1-3 linkage to type-1 (Galβ1-3GlcNAc) or type-3/4 (Galβ1-3GalNAcα/β) sequences. Thus, by alternating the use of the H. pylori β3GlcNAcT with galactosyltransferases that make the β1-4 or β1-3 linkages, various N-linked, O-linked and I-antigen acceptors could be elongated with type-2 and type-1 LacNAc repeats. Finally, one-pot incubation of di-LacNAc biantennary N-glycopeptide with the β3GlcNAcT and GalT-1 in the presence of uridine diphosphate (UDP)-GlcNAc and UDP-Gal, yielded products with 15 additional LacNAc units on the precursor, which was seen as a series of sequential ion peaks representing alternative additions of GlcNAc and Gal residues, on matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis. Overall, our data demonstrate a broader substrate specificity for the H. pylori β3GlcNAcT than previously recognized and demonstrate its ability as a potent resource for preparative chemo-enzymatic synthesis of complex glycans. PMID:22786570
Barcelo, Alberto; Arredondo, Armando; Gordillo-Tobar, Amparo; Segovia, Johanna; Qiang, Anthony
2017-12-01
The financial implications of the increase in the prevalence of diabetes in middle-income countries represents one of the main challenges to health system financing and to the society as a whole. The objective of this study was to estimate the economic cost of diabetes in Latin America and the Caribbean (LAC) in 2015. The study used a prevalence-based approach to estimate the direct and indirect costs related to diabetes in 29 LAC countries in 2015. Direct costs included health care expenditures such as medications (insulin and oral hypoglycemic agents), tests, consultations, hospitalizations, emergency visits and treating complications. Two different scenarios (S1 and S2) were used to analyze direct cost. S1 assumed conservative estimates while S2 assumed broader coverage of medication and services. Indirect costs included lost resources due to premature mortality, temporary and permanent disabilities. In 2015 over 41 million adults (20 years of age and more) were estimated to have Diabetes Mellitus in LAC. The total indirect cost attributed to Diabetes was US$ 57.1 billion, of which US$ 27.5 billion was due to premature mortality, US$16.2 billion to permanent disability, and US$ 13.3 billion to temporary disability. The total direct cost was estimated between US$ 45 and US$ 66 billion, of which the highest estimated cost was due to treatment of complications (US$ 1 616 to US$ 26 billion). Other estimates indicated the cost of insulin between US$ 6 and US$ 11 billion; oral medication US$ 4 to US$ 6 billion; consultations between US$ 5 and US$ 6 billion; hospitalization US$ 10 billion; emergency visits US$ 1 billion; test and laboratory exams between US$ 1 and US$ 3 million. The total cost of diabetes in 2015 in LAC was estimated to be between US$ 102 and US$ 123 billion. On average, the annual cost of treating one case of diabetes mellitus (DM) in LAC was estimated between US$ 1088 and US$ 1818. Per capita National Health Expenditures averaged US$ 1061 in LAC. Diabetes represented a major economic burden to the countries of Latin America and the Caribbean in 2015. The estimates presented here are key information for decision-making that can be used in the formulation of policies and programs to achieve greater efficiency and effectiveness in the use of resources for diabetes prevention in the 29 countries of LAC.
Barcelo, Alberto; Arredondo, Armando; Gordillo–Tobar, Amparo; Segovia, Johanna; Qiang, Anthony
2017-01-01
BACKGROUND The financial implications of the increase in the prevalence of diabetes in middle–income countries represents one of the main challenges to health system financing and to the society as a whole. The objective of this study was to estimate the economic cost of diabetes in Latin America and the Caribbean (LAC) in 2015. METHODS The study used a prevalence–based approach to estimate the direct and indirect costs related to diabetes in 29 LAC countries in 2015. Direct costs included health care expenditures such as medications (insulin and oral hypoglycemic agents), tests, consultations, hospitalizations, emergency visits and treating complications. Two different scenarios (S1 and S2) were used to analyze direct cost. S1 assumed conservative estimates while S2 assumed broader coverage of medication and services. Indirect costs included lost resources due to premature mortality, temporary and permanent disabilities. RESULTS In 2015 over 41 million adults (20 years of age and more) were estimated to have Diabetes Mellitus in LAC. The total indirect cost attributed to Diabetes was US$ 57.1 billion, of which US$ 27.5 billion was due to premature mortality, US$16.2 billion to permanent disability, and US$ 13.3 billion to temporary disability. The total direct cost was estimated between US$ 45 and US$ 66 billion, of which the highest estimated cost was due to treatment of complications (US$ 1 616 to US$ 26 billion). Other estimates indicated the cost of insulin between US$ 6 and US$ 11 billion; oral medication US$ 4 to US$ 6 billion; consultations between US$ 5 and US$ 6 billion; hospitalization US$ 10 billion; emergency visits US$ 1 billion; test and laboratory exams between US$ 1 and US$ 3 million. The total cost of diabetes in 2015 in LAC was estimated to be between US$ 102 and US$ 123 billion. On average, the annual cost of treating one case of diabetes mellitus (DM) in LAC was estimated between US$ 1088 and US$ 1818. Per capita National Health Expenditures averaged US$ 1061 in LAC. CONCLUSIONS Diabetes represented a major economic burden to the countries of Latin America and the Caribbean in 2015. The estimates presented here are key information for decision–making that can be used in the formulation of policies and programs to achieve greater efficiency and effectiveness in the use of resources for diabetes prevention in the 29 countries of LAC. PMID:29163935
Design and application of a lactulose biosensor.
Wu, Jieyuan; Jiang, Peixia; Chen, Wei; Xiong, Dandan; Huang, Linglan; Jia, Junying; Chen, Yuanyuan; Jin, Jian-Ming; Tang, Shuang-Yan
2017-04-07
In this study the repressor of Escherichia coli lac operon, LacI, has been engineered for altered effector specificity. A LacI saturation mutagenesis library was subjected to Fluorescence Activated Cell Sorting (FACS) dual screening. Mutant LacI-L5 was selected and it is specifically induced by lactulose but not by other disaccharides tested (lactose, epilactose, maltose, sucrose, cellobiose and melibiose). LacI-L5 has been successfully used to construct a whole-cell lactulose biosensor which was then applied in directed evolution of cellobiose 2-epimerase (C2E) for elevated lactulose production. The mutant C2E enzyme with ~32-fold enhanced expression level was selected, demonstrating the high efficiency of the lactulose biosensor. LacI-L5 can also be used as a novel regulatory tool. This work explores the potential of engineering LacI for customized molecular biosensors which can be applied in practice.
Evaluation of coloring efficacy of lac dye in comminuted meat product.
Divya; Singh, R P; Baboo, B; Prasad, K M
2011-06-01
Effect of incorporation of graded levels (4, 6, 8, 10, 25 ppm) of lac dye on coloring efficacy and possible use of this natural color in processed meat products was studied. Inclusion of lac dye at different concentrations did not affect the pH significantly whereas a linear increase in the Lovibond red color unit of chicken nuggets was noted with raising the level of lac dye from 4 to 10 ppm. The sensory rating for color was highest at addition level of 25 ppm of lac dye and it was comparable to color score of the product containing 200 ppm sodium nitrite. Lac dye inclusion in nuggets at all concentrations studied had better antimicrobial properties as compared to 200 ppm sodium nitrite. It was concluded that lac dye from 10 to 25 ppm could be incorporated in comminuted meat products as a natural colorant with antimicrobial action.
The business of refractive laser assisted cataract surgery (ReLACS).
Berdahl, John P; Jensen, Matthew P
2014-01-01
Refractive Laser Assisted Cataract Surgery (ReLACS) combines the femtosecond laser with other noncovered tests and services in an attempt to reduce spectacle dependence in combination with cataract surgery. Significant interest is present among ophthalmologists who are considering adopting this technology, however significant capital outlays and continuing expenses can make the decision to adopt ReLACS foreboding. We review the financial considerations of ReLACS and review the trends seen in early adopters of this technology. Recent findings have shown that ReLACS is a growing segment of cataract surgery. Most practices who have implemented the technology have broken even and have a positive outlook on the financial return of implementing the ReLACS program. The average break-even analysis point for practices is around 230 cases a year. ReLACS is growing and appears to be a financial viable approach for many practices.
NASA Astrophysics Data System (ADS)
Fallah Ramazani, V.; Lindfors, E.; Nilsson, K.
2017-12-01
Aim: We have collected the most complete multi-wavelength (6.0-6.0 × 10-18 cm) dataset of very high energy (VHE) γ-ray emitting (TeV) BL Lacs, which are the most numerous extragalactic VHE sources. Using significant correlations between different bands, we aim to identify the best TeV BL Lac candidates that can be discovered by the current and next generation of imaging air Cherenkov telescopes. Methods: We formed five datasets from lower energy data, i.e. radio, mid-infrared, optical, X-rays, and GeV γ-ray, and five VHE γ-ray datasets to perform a correlation study between different bands and to construct the prediction method. The low energy datasets were averaged for individual sources, while the VHE γ-ray data were divided into subsets according to the flux state of the source. We then looked for significant correlations and determined their best-fit parameters. Using the best-fit parameters we predicted the level of VHE γ-ray flux for a sample of 182 BL Lacs, which have not been detected at TeV energies. We identified the most promising TeV BL Lac candidates based on the predicted VHE γ-ray flux for each source. Results: We found 14 significant correlations between radio, mid-infrared, optical, γ-ray, and VHE γ-ray bands. The correlation between optical and VHE γ-ray luminosity is established for the first time. We attribute this to the more complete sample and more accurate handling of host galaxy flux in our work. We found nine BL Lac candidates whose predicted VHE γ-ray flux is high enough for detection in less than 25 h with current imaging air Cherenkov telescopes. Full Tables A.1 and A.2 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/608/A68
Resolving the host galaxy of a distant blazar with LBT/LUCI 1 + ARGOS
NASA Astrophysics Data System (ADS)
Farina, E. P.; Georgiev, I. Y.; Decarli, R.; Terzić, T.; Busoni, L.; Gässler, W.; Mazzoni, T.; Borelli, J.; Rosensteiner, M.; Ziegleder, J.; Bonaglia, M.; Rabien, S.; Buschkamp, P.; Orban de Xivry, G.; Rahmer, G.; Kulas, M.; Peter, D.
2018-05-01
BL Lac objects emitting in the very high energy (VHE) regime are unique tools to peer into the properties of the extragalactic background light (EBL). However, due to the typical absence of features in their spectra, the determination of their redshifts has proven challenging. In this work, we exploit the superb spatial resolution delivered by the new Advanced Rayleigh guided Ground layer adaptive Optics System (ARGOS) at the Large Binocular Telescope to detect the host galaxy of HESS J1943+213, a VHE emitting BL Lac shining through the Galaxy. Deep H-band imaging collected during the ARGOS commissioning allowed us to separate the contribution of the nuclear emission and to unveil the properties of the host galaxy with unprecedented detail. The host galaxy is well fitted by a Sérsic profile with index of n ˜ 2 and total magnitude of HHost ˜ 16.15 mag. Under the assumption that BL Lac host galaxies are standard candles, we infer a redshift of z ˜ 0.21. In the framework of the current model for the EBL, this value is in agreement with the observed dimming of the VHE spectrum due to the annihilation of energetic photons on the EBL
Slechta, E Susan; Liu, Jing; Andersson, Dan I; Roth, John R
2002-01-01
In the genetic system of Cairns and Foster, a nongrowing population of an E. coli lac frameshift mutant appears to specifically accumulate Lac(+) revertants when starved on medium including lactose (adaptive mutation). This behavior has been attributed to stress-induced general mutagenesis in a subpopulation of starved cells (the hypermutable state model). We have suggested that, on the contrary, stress has no direct effect on mutability but favors only growth of cells that amplify their leaky mutant lac region (the amplification mutagenesis model). Selection enhances reversion primarily by increasing the mutant lac copy number within each developing clone on the selection plate. The observed general mutagenesis is attributed to a side effect of growth with an amplification-induction of SOS by DNA fragments released from a tandem array of lac copies. Here we show that the S. enterica version of the Cairns system shows SOS-dependent general mutagenesis and behaves in every way like the original E. coli system. In both systems, lac revertants are mutagenized during selection. Eliminating the 35-fold increase in mutation rate reduces revertant number only 2- to 4-fold. This discrepancy is due to continued growth of amplification cells until some clones manage to revert without mutagenesis solely by increasing their lac copy number. Reversion in the absence of mutagenesis is still dependent on RecA function, as expected if it depends on lac amplification (a recombination-dependent process). These observations support the amplification mutagenesis model. PMID:12136002
Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S
1989-01-01
A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.
Proteins mediating DNA loops effectively block transcription.
Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David
2017-07-01
Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Kraatz, Mareike; Wallace, R John; Svensson, Liselott
2011-04-01
Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of 'Olsenella (basonym Atopobium) oviles'. Three phenotypically similar bacterial strains (lac15, lac16 and lac31(T)) were isolated in concert with Veillonella magna lac18(T) from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31(T) formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella-Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31(T) were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA-DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31(T) represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31(T) ( = CCUG 58604(T) = DSM 22620(T) = JCM 16156(T)) as the type strain and A2 ( = CCUG 58212 = DSM 22619 = JCM 16157) as an additionally available reference strain. Also, based on our data, we propose emended descriptions of the genus Olsenella and the species Olsenella uli and Olsenella profusa.
Mika, Agnieszka; Day, Heidi E W; Martinez, Alexander; Rumian, Nicole L; Greenwood, Benjamin N; Chichlowski, Maciej; Berg, Brian M; Fleshner, Monika
2017-02-01
Manipulating gut microbes may improve mental health. Prebiotics are indigestible compounds that increase the growth and activity of health-promoting microorganisms, yet few studies have examined how prebiotics affect CNS function. Using an acute inescapable stressor known to produce learned helplessness behaviours such as failure to escape and exaggerated fear, we tested whether early life supplementation of a blend of two prebiotics, galactooligosaccharide (GOS) and polydextrose (PDX), and the glycoprotein lactoferrin (LAC) would attenuate behavioural and biological responses to stress later in life. Juvenile, male F344 rats were fed diets containing either GOS and PDX alone, LAC alone, or GOS, PDX and LAC. All diets altered gut bacteria, while diets containing GOS and PDX increased Lactobacillus spp. After 4 weeks, rats were exposed to inescapable stress, and either immediately killed for blood and tissues, or assessed for learned helplessness 24 h later. Diets did not attenuate stress effects on spleen weight, corticosterone and blood glucose; however, all diets differentially attenuated stress-induced learned helplessness. Notably, in situ hybridization revealed that all diets reduced stress-evoked cfos mRNA in the dorsal raphe nucleus (DRN), a structure important for learned helplessness behaviours. In addition, GOS, PDX and LAC diet attenuated stress-evoked decreases in mRNA for the 5-HT 1A autoreceptor in the DRN and increased basal BDNF mRNA within the prefrontal cortex. These data suggest early life diets containing prebiotics and/or LAC promote behavioural stress resistance and uniquely modulate gene expression in corresponding circuits. © 2016 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Peptidoglycan Cross-Linking in Glycopeptide-Resistant Actinomycetales
Hugonnet, Jean-Emmanuel; Haddache, Nabila; Veckerlé, Carole; Dubost, Lionel; Marie, Arul; Shikura, Noriyasu; Mainardi, Jean-Luc; Rice, Louis B.
2014-01-01
Synthesis of peptidoglycan precursors ending in d-lactate (d-Lac) is thought to be responsible for glycopeptide resistance in members of the order Actinomycetales that produce these drugs and in related soil bacteria. More recently, the peptidoglycan of several members of the order Actinomycetales was shown to be cross-linked by l,d-transpeptidases that use tetrapeptide acyl donors devoid of the target of glycopeptides. To evaluate the contribution of these resistance mechanisms, we have determined the peptidoglycan structure of Streptomyces coelicolor A(3)2, which harbors a vanHAX gene cluster for the production of precursors ending in d-Lac, and Nonomuraea sp. strain ATCC 39727, which is devoid of vanHAX and produces the glycopeptide A40296. Vancomycin retained residual activity against S. coelicolor A(3)2 despite efficient incorporation of d-Lac into cytoplasmic precursors. This was due to a d,d-transpeptidase-catalyzed reaction that generated a stem pentapeptide recognized by glycopeptides by the exchange of d-Lac for d-Ala and Gly. The contribution of l,d-transpeptidases to resistance was limited by the supply of tetrapeptide acyl donors, which are essential for the formation of peptidoglycan cross-links by these enzymes. In the absence of a cytoplasmic metallo-d,d-carboxypeptidase, the tetrapeptide substrate was generated by hydrolysis of the C-terminal d-Lac residue of the stem pentadepsipeptide in the periplasm in competition with the exchange reaction catalyzed by d,d-transpeptidases. In Nonomuraea sp. strain ATCC 39727, the contribution of l,d-transpeptidases to glycopeptide resistance was limited by the incomplete conversion of pentapeptides into tetrapeptides despite the production of a cytoplasmic metallo-d,d-carboxypeptidase. Since the level of drug production exceeds the level of resistance, we propose that l,d-transpeptidases merely act as a tolerance mechanism in this bacterium. PMID:24395229
Peptidoglycan cross-linking in glycopeptide-resistant Actinomycetales.
Hugonnet, Jean-Emmanuel; Haddache, Nabila; Veckerlé, Carole; Dubost, Lionel; Marie, Arul; Shikura, Noriyasu; Mainardi, Jean-Luc; Rice, Louis B; Arthur, Michel
2014-01-01
Synthesis of peptidoglycan precursors ending in D-lactate (D-Lac) is thought to be responsible for glycopeptide resistance in members of the order Actinomycetales that produce these drugs and in related soil bacteria. More recently, the peptidoglycan of several members of the order Actinomycetales was shown to be cross-linked by L,D-transpeptidases that use tetrapeptide acyl donors devoid of the target of glycopeptides. To evaluate the contribution of these resistance mechanisms, we have determined the peptidoglycan structure of Streptomyces coelicolor A(3)2, which harbors a vanHAX gene cluster for the production of precursors ending in D-Lac, and Nonomuraea sp. strain ATCC 39727, which is devoid of vanHAX and produces the glycopeptide A40296. Vancomycin retained residual activity against S. coelicolor A(3)2 despite efficient incorporation of D-Lac into cytoplasmic precursors. This was due to a D,D-transpeptidase-catalyzed reaction that generated a stem pentapeptide recognized by glycopeptides by the exchange of D-Lac for D-Ala and Gly. The contribution of L,D-transpeptidases to resistance was limited by the supply of tetrapeptide acyl donors, which are essential for the formation of peptidoglycan cross-links by these enzymes. In the absence of a cytoplasmic metallo-D,D-carboxypeptidase, the tetrapeptide substrate was generated by hydrolysis of the C-terminal D-Lac residue of the stem pentadepsipeptide in the periplasm in competition with the exchange reaction catalyzed by D,D-transpeptidases. In Nonomuraea sp. strain ATCC 39727, the contribution of L,D-transpeptidases to glycopeptide resistance was limited by the incomplete conversion of pentapeptides into tetrapeptides despite the production of a cytoplasmic metallo-D,D-carboxypeptidase. Since the level of drug production exceeds the level of resistance, we propose that L,D-transpeptidases merely act as a tolerance mechanism in this bacterium.
Appelbe, Oliver K.; Bollman, Bryan; Attarwala, Ali; Triebes, Lindy A.; Muniz-Talavera, Hilmarie; Curry, Daniel J.; Schmidt, Jennifer V.
2013-01-01
SUMMARY Congenital hydrocephalus, the accumulation of excess cerebrospinal fluid (CSF) in the ventricles of the brain, affects one of every 1,000 children born today, making it one of the most common human developmental disorders. Genetic causes of hydrocephalus are poorly understood in humans, but animal models suggest a broad genetic program underlying the regulation of CSF balance. In this study, the random integration of a transgene into the mouse genome led to the development of an early onset and rapidly progressive hydrocephalus. Juvenile hydrocephalus transgenic mice (JhylacZ) inherit communicating hydrocephalus in an autosomal recessive fashion with dilation of the lateral ventricles observed as early as postnatal day 1.5. Ventricular dilation increases in severity over time, becoming fatal at 4-8 weeks of age. The ependymal cilia lining the lateral ventricles are morphologically abnormal and reduced in number in JhylacZ/lacZ brains, and ultrastructural analysis revealed disorganization of the expected 9+2 microtubule pattern. Rather, the majority of JhylacZ/lacZ cilia develop axonemes with 9+0 or 8+2 microtubule structures. Disruption of an unstudied gene, 4931429I11Rik (now named Jhy) appears to underlie the hydrocephalus of JhylacZ/lacZ mice, and the Jhy transcript and protein are decreased in JhylacZ/lacZ mice. Partial phenotypic rescue was achieved in JhylacZ/lacZ mice by the introduction of a bacterial artificial chromosome (BAC) carrying 60-70% of the JHY protein coding sequence. Jhy is evolutionarily conserved from humans to basal vertebrates, but the predicted JHY protein lacks identifiable functional domains. Ongoing studies are directed at uncovering the physiological function of JHY and its role in CSF homeostasis. PMID:23906841
Weaver, T.L.; Neff, B.P.; Ellis, J.M.
2005-01-01
Lac Vieux Desert is a prominent 6.6 square-mile lake that straddles the Michigan-Wisconsin border and forms the headwaters of the Wisconsin River. For generations, the Lac Vieux Desert Band of Lake Superior Chippewa Indians have used Lac Vieux Desert and the surrounding area for growing and harvesting wild rice, and hunting and fishing. The Lac Vieux Desert Band is concerned about the impact of lake-stage regulation on hydrology and ecology, and the impact on water quality of development along and near the shore, and recreational watercraft use and sport fishing. In 2005, the U.S. Geological Survey completed a water-resources investigation of the Lac Vieux Desert watershed in cooperation with the Lac Vieux Desert Band of Lake Superior Chippewa Indians.Water quality of Lac Vieux Desert is typical of many lakes in the northern United States. Trophic State Index calculations classify Lac Vieux Desert as a highly productive eutrophic lake. The pH of water in Lac Vieux Desert ranged from 6.5 to 9.5, and specific conductance ranged from 62 to 114 µs/cm. Chloride concentration was less than 1.5 mg/L, indicating little effect from septic-tank or road-salt input. Results indicate that the water can be classified as soft, with hardness concentrations reported as calcium carbonate ranging from 29 to 49 mg/L. Concentrations of calcium, magnesium, chloride, and other dissolved solids ranged from 47 to 77 mg/L. Alkalinity of Lac Vieux Desert ranged from 27 to 38 mg/L.Pervasive aquatic blooms, including a bloom noted during the September 2003 sampling, are apparently common in late summer. Biological productivity at Lac Vieux Desert does not appear to have changed appreciably between 1973 and 2004. In the current study, total phosphorus concentrations ranged from 0.01 to 0.064 mg/L and dissolved nitrite plus nitrate nitrogen concentrations ranged from at, or below detection limit to 0.052 mg/L. Overabundance of nutrients in Lac Vieux Desert, particularly nitrogen and phosphorus, could result in considerable degradation in lake-water quality.The estimated water balance includes the following inputs from the surrounding watershed: direct precipitation (35 percent); runoff, composed of streamflow and overland flow (50 percent); and ground-water flow (15 percent). Outputs from Lac Vieux Desert include streamflow into the Wisconsin River (68 percent) and evaporation from the lake surface (32 percent). Seasonal regulation of Lac Vieux Desert outflow results in an artificially high lake stage throughout the year, except from late winter to very early spring, prior to snowmelt and runoff. Regulation of Lac Vieux Desert outflow causes Wisconsin River streamflow to be artificially low during spring and summer and artificially high in fall and winter.Recent studies indicate that lake-level regulation over the past century may have affected wild rice growth and propagation in Lac Vieux Desert. As per licensing agreement between the Federal Energy Regulatory Commission and the Wisconsin Valley Improvement Company (operators of the dam at the outlet), the maximum lake level of Lac Vieux Desert was lowered about 0.8 feet to investigate the relation between lake-level regulation and propagation of wild rice from 2003 through 2012. Recent plantings of wild rice by the Lac Vieux Desert Band have been successful, indicating that suitable habitat and hydrologic regime were present in 2004-05.
NASA Technical Reports Server (NTRS)
Worrall, Diana M.
1994-01-01
This report summarizes the activities related to two ROSAT investigations: (1) x-ray properties of radio galaxies thought to contain BL Lac type nuclei; and (2) x-ray spectra of a complete sample of flat-spectrum radio sources. The following papers describing the research are provided as attachments: Multiple X-ray Emission Components in Low Power Radio Galaxies; New X-ray Results on Radio Galaxies; Analysis Techniques for a Multiwavelength Study of Radio Galaxies; Separation of X-ray Emission Components in Radio Galaxies; X-ray Emission in Powerful Radio Galaxies and Quasars; Extended and Compact X-ray Emission in Powerful Radio Galaxies; and X-ray Spectra of a Complete Sample of Extragalactic Core-dominated Radio Sources.
On Three-dimensional Structures in Relativistic Hydrodynamic Jets
NASA Astrophysics Data System (ADS)
Hardee, Philip E.
2000-04-01
The appearance of wavelike helical structures on steady relativistic jets is studied using a normal mode analysis of the linearized fluid equations. Helical structures produced by the normal modes scale relative to the resonant (most unstable) wavelength and not with the absolute wavelength. The resonant wavelength of the normal modes can be less than the jet radius even on highly relativistic jets. High-pressure regions helically twisted around the jet beam may be confined close to the jet surface, penetrate deeply into the jet interior, or be confined to the jet interior. The high-pressure regions range from thin and ribbon-like to thick and tubelike depending on the mode and wavelength. The wave speeds can be significantly different at different wavelengths but are less than the flow speed. The highest wave speed for the jets studied has a Lorentz factor somewhat more than half that of the underlying flow speed. A maximum pressure fluctuation criterion found through comparison between theory and a set of relativistic axisymmetric jet simulations is applied to estimate the maximum amplitudes of the helical, elliptical, and triangular normal modes. Transverse velocity fluctuations for these asymmetric modes are up to twice the amplitude of those associated with the axisymmetric pinch mode. The maximum amplitude of jet distortions and the accompanying velocity fluctuations at, for example, the resonant wavelength decreases as the Lorentz factor increases. Long-wavelength helical surface mode and shorter wavelength helical first body mode generated structures should be the most significant. Emission from high-pressure regions as they twist around the jet beam can vary significantly as a result of angular variation in the flow direction associated with normal mode structures if they are viewed at about the beaming angle θ=1/γ. Variation in the Doppler boost factor can lead to brightness asymmetries by factors up to 6 as long-wavelength helical structure produced by the helical surface mode winds around the jet. Higher order surface modes and first body modes produce less variation. Angular variation in the flow direction associated with the helical mode appears consistent with precessing jet models that have been proposed to explain the variability in 3C 273 and BL Lac object AO 0235+164. In particular, cyclic angular variation in the flow direction produced by the normal modes could produce the activity seen in BL Lac object OJ 287. Jet precession provides a mechanism for triggering the helical modes on multiple length scales, e.g., the galactic superluminal GRO J1655-40.
The NuSTAR view on Hard-TeV BL Lacs
NASA Astrophysics Data System (ADS)
Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.
2018-05-01
Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of 5 objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of i) extreme electron energies with very low radiative efficiency, ii) conditions heavily out of equipartition (by 3 to 5 orders of magnitude), and iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not "see" the UV or lower-energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the VHE spectrum.
Chichlowski, Maciej; De Lartigue, Guillaume; German, J. Bruce; Raybould, Helen E.; Mills, David A.
2012-01-01
Objectives Human milk oligosaccharides (HMO) are the third most abundant component of breast milk. Our laboratory has previously revealed gene clusters specifically linked to HMO metabolism in select bifidobacteria isolated from fecal samples of infants. Our objective was to test the hypothesis that growth of select bifidobacteria on HMO stimulates the intestinal epithelium. Methods Caco-2 and HT-29 cells were incubated with lactose (LAC) or HMO-grown Bifidobacterium longum subsp. infantis (B. infantis) or B. bifidum. Bacterial adhesion and translocation was measured by real-time quantitative PCR. Expression of pro- and anti-inflammatory cytokines and tight junction proteins was analyzed by real time reverse transcriptase. Distribution of tight junction proteins was measured using immunofluorescent microscopy. Results We showed that HMO-grown B. infantis had significantly higher rate of adhesion to HT-29 cells compared to B. bifidum. B. infantis also induced expression of a cell membrane glycoprotein, P-selectin glycoprotein ligand -1. Both B. infantis and B. bifidum grown on HMO caused less occludin relocalization and higher expression of anti-inflammatory cytokine, interleukin (IL)-10 compared to LAC-grown bacteria in Caco-2 cells. B. bifidum grown on HMO showed higher expression of junctional adhesion molecule and occludin in Caco-2 cell and HT-29 cells. There were no significant differences between LAC or HMO treatments in bacterial translocation. Conclusions This study provides evidence for the specific relationship between HMO-grown bifidobacteria and intestinal epithelial cells. To our knowledge, this is the first study describing HMO-induced changes in the bifidobacteria-intestinal cells interaction. PMID:22383026
The NuSTAR view on hard-TeV BL Lacs
NASA Astrophysics Data System (ADS)
Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.
2018-07-01
Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of five objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of (i) extreme electron energies with very low radiative efficiency, (ii) conditions heavily out of equipartition (by three to five orders of magnitude), and (iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not `see' the UV or lower energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the very high energies spectrum.
Data Collection: A Cybernetic Aspect of a Learning Assistance Center.
ERIC Educational Resources Information Center
Devirian, Margaret Coda
Data collection and analysis as a cybernetic aspect of a Learning Assistance Center (LAC) is discussed. Using the LAC at California State University Long Beach (CSULB) as a model, the LAC is defined as a support, delivery, and referral service for the entire campus community. A LAC is held accountable to itself and its users through a cybernetics…
The Health Role of Local Area Coordinators in Scotland: A Mixed Methods Study
ERIC Educational Resources Information Center
Brown, Michael; Karatzias, Thanos; O'Leary, Lisa
2013-01-01
The study set out to explore whether local area coordinators (LACs) and their managers view the health role of LACs as an essential component of their work and identify the health-related activities undertaken by LACs in Scotland. A mixed methods cross-sectional phenomenological study involving local authority service managers (n = 25) and LACs (n…
Wang, Xiyong; Zhu, Xiaoli; Zhang, Hongming; Wei, Shuzhen; Chen, Yan; Chen, Yang; Wang, Fei; Fan, Xiaobo; Han, Shuhua; Wu, Guoqiu
2018-02-19
Recent reports have indicated that circular RNA (circRNA) may regulate Lung adenocarcinoma (LAC) development. Our previous studies showed that hsa_circ_0012673 was up-regulated in a circRNA microarray. However, its expression level in LAC has not been verified, and the underlying molecular mechanisms in LAC are unknown. In this study, we found that the expression of hsa_circ_0012673 was up-regulated in LAC tissues compared to pair-matched adjacent non-tumor tissues (P = 0.0079), and that the expression level was associated with tumour size (P = 0.015). Furthermore, hsa_circ_0012673 was primarily localized in the cytoplasm and promoted cell proliferation of LAC cells by sponging miR-22, which targeted erb-b2 receptor tyrosine kinase 3 (ErbB3) in LAC. Hsa_circ_0012673 promotes LAC proliferation by suppressing miR-22, which targets ErbB3. Copyright © 2018 Elsevier Inc. All rights reserved.
Light absorbing carbon emissions from commercial shipping
NASA Astrophysics Data System (ADS)
Lack, Daniel; Lerner, Brian; Granier, Claire; Baynard, Tahllee; Lovejoy, Edward; Massoli, Paola; Ravishankara, A. R.; Williams, Eric
2008-07-01
Extensive measurements of the emission of light absorbing carbon aerosol (LAC) from commercial shipping are presented. Vessel emissions were sampled using a photoacoustic spectrometer in the Gulf of Mexico region. The highest emitters (per unit fuel burnt) are tug boats, thus making significant contributions to local air quality in ports. Emission of LAC from cargo and non cargo vessels in this study appears to be independent of engine load. Shipping fuel consumption data (2001) was used to calculate a global LAC contribution of 133(+/-27) Ggyr-1, or ~1.7% of global LAC. This small fraction could have disproportionate effects on both air quality near port areas and climate in the Arctic if direct emissions of LAC occur in that region due to opening Arctic sea routes. The global contribution of this LAC burden was investigated using the MOZART model. Increases of 20-50 ng m-3 LAC (relative increases up to 40%) due to shipping occur in the tropical Atlantic, Indonesia, central America and the southern regions of South America and Africa.
NASA Astrophysics Data System (ADS)
Djannati-Ataï, A.; Khelifi, B.; Vorobiov, S.; Bazer-Bachi, R.; Chounet, L. M.; Debiais, G.; Degrange, B.; Espigat, P.; Fabre, B.; Fontaine, G.; Goret, P.; Gouiffes, C.; Masterson, C.; Piron, F.; Punch, M.; Rivoal, M.; Rob, L.; Tavernet, J.-P.
2002-08-01
The BL Lac Object 1ES 1426+428, at a red-shift of z=0.129, has been monitored by the CAT telescope from February 1998 to June 2000. The accumulation of 26 h of observations shows a gamma -ray signal of 321 events above 250 GeV at 5.2 standard deviations, determined using data analysis cuts adapted to a weak, steep-spectrum source. The source emission has an average flux of Phidiff(400 GeV)= 6.73+/-1.27stat+/-1.45syst*E-11 cm-2 s-1 TeV-1, and a very steep spectrum, with a differential spectral index of gamma =-3.60 +/- 0.57 which can be refined to gamma =-3.66 +/- 0.41 using a higher flux data subset. If, as expected from its broad-band properties, the Very High Energy emission is hard at the source, these observations support a strong absorption effect of gamma-rays by the Intergalactic Infrared field.
Contemporaneous broadband observations of three high-redshift BL Lac objects
Ackerman, M.
2016-03-20
We have collected broadband spectral energy distributions (SEDs) of three BL Lac objects, 3FGL J0022.1-1855 (z=0.689), 3FGL J0630.9-2406 (z > ~1.239), and 3FGL J0811.2-7529 (z=0.774), detected by Fermi with relatively flat GeV spectra. By observing simultaneously in the near-IR to hard X-ray band, we can well characterize the high end of the synchrotron component of the SED. Thus, fitting the SEDs to synchro-Compton models of the dominant emission from the relativistic jet, we can constrain the underlying particle properties and predict the shape of the GeV Compton component. Standard extragalactic background light (EBL) models explain the high-energy absorption well, withmore » poorer fits for high UV models. The fits show clear evidence for EBL absorption in the Fermi spectrum of our highest redshift source 3FGL J0630.9-2406. While synchrotron self-Compton models adequately describe the SEDs, the situation may be complicated by possible external Compton components.« less
Imaging and characterizing cells using tomography
Do, Myan; Isaacson, Samuel A.; McDermott, Gerry; Le Gros, Mark A.; Larabell, Carolyn A.
2015-01-01
We can learn much about cell function by imaging and quantifying sub-cellular structures, especially if this is done non-destructively without altering said structures. Soft x-ray tomography (SXT) is a high-resolution imaging technique for visualizing cells and their interior structure in 3D. A tomogram of the cell, reconstructed from a series of 2D projection images, can be easily segmented and analyzed. SXT has a very high specimen throughput compared to other high-resolution structure imaging modalities; for example, tomographic data for reconstructing an entire eukaryotic cell is acquired in a matter of minutes. SXT visualizes cells without the need for chemical fixation, dehydration, or staining of the specimen. As a result, the SXT reconstructions are close representations of cells in their native state. SXT is applicable to most cell types. The deep penetration of soft x-rays allows cells, even mammalian cells, to be imaged without being sectioned. Image contrast in SXT is generated by the differential attenuation soft x-ray illumination as it passes through the specimen. Accordingly, each voxel in the tomographic reconstruction has a measured linear absorption coefficient (LAC) value. LAC values are quantitative and give rise to each sub-cellular component having a characteristic LAC profile, allowing organelles to be identified and segmented from the milieu of other cell contents. In this chapter, we describe the fundamentals of SXT imaging and how this technique can answer real world questions in the study of the nucleus. We also describe the development of correlative methods for the localization of specific molecules in a SXT reconstruction. The combination of fluorescence and SXT data acquired from the same specimen produces composite 3D images, rich with detailed information on the inner workings of cells. PMID:25602704
Three new BL Lacertae objects in the Palomar-Green survey
NASA Technical Reports Server (NTRS)
Fleming, Thomas A.; Green, Richard F.; Jannuzi, Buell T.; Liebert, James; Smith, Paul S.; Fink, Henner
1993-01-01
We have identified three BL Lacertae objects in the Palomar-Green Survey which were previously misclassified as DC white dwarfs, namely PG 1246+586, PG 1424+240, and PG 1437+398. Our reclassification is based on the detection of these objects as x-ray sources in the ROSAT all-sky survey and upon our subsequent detection of intrinsic linearly polarized and variable optical emission from these sources. As a result of the ROSAT survey, the number of identified BL Lac objects in the Palomar-Green catalog of UV excess objects has been doubled. Corrected optical positions are presented for PG 1246+586 and PG 1437+398.
Louisiana SIP: LAC 33:III Ch 21 Subchap J, 2147--Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 1998-02-02 (LAc74) more...
Vashishtha, Amit; Rathi, Brijesh; Kaushik, Sandeep; Sharma, K K; Lakhanpaul, Suman
2013-10-01
Females of lac insects especially of Kerria lacca (Kerr) secret a resin known as lac for their own protection, which has tremendous applications. Lac insect completes its lifecycle on several host taxa where it exclusively feeds on phloem sap but Schleichera oleosa (Lour.) Oken, Butea monosperma (Lam.) and Ziziphus mauritiana (Lam.) are its major hosts. Analysis of phloem sap constituents as well as hemolymph of lac insect is important because it ultimately gets converted into lac by insect intervention. Main phloem sap constituent's viz. sugars and free amino acids and hemolymph of lac insect were analyzed using HPLC and tandem mass spectrometry, respectively. The results were transformed to relative percentage of the total sugars and free amino acids analyzed in each sample for comparison among lac insect hemolymph and the phloem sap of the three different host taxa. Sucrose (58.9 ± 3.6-85.6 ± 0.9) and trehalose (62.3 ± 0.4) were the predominant sugars in phloem sap of three taxa and hemolymph of lac insect, respectively. Glutamic acid (33.1 ± 1.4-39.8 ± 1.4) was found to be main amino acid among the phloem sap of three taxa while tyrosine (61 ± 2.6) was the major amino acid in hemolymph of lac insect. The relative percentage of non-essential amino acids (60.8 %-69.9 %) was found to be more in all the three host taxa while essential amino acids (30.1 %-35.4 %) were present at a lower relative percentage. In contrast to this, the relative percentage of essential amino acids (81.9 %) was observed to be higher as compared to non-essential amino acids (17.7 %) in lac insect hemolymph. These results led to the detection of lac insect's endosymbionts. Moreover, this study revealed a clue regarding the importance of development of a synthetic diet for this insect so that a precise pathway of lac biosynthesis could be investigated for thorough understanding.
Multiwavelength observations of the blazar 1ES 1011+496 in Spring 2008
NASA Astrophysics Data System (ADS)
Ahnen, M. L.; Ansoldi, S.; Antonelli, L. A.; Antoranz, P.; Babic, A.; Banerjee, B.; Bangale, P.; Barres de Almeida, U.; Barrio, J. A.; Becerra González, J.; Bednarek, W.; Bernardini, E.; Biasuzzi, B.; Biland, A.; Blanch, O.; Bonnefoy, S.; Bonnoli, G.; Borracci, F.; Bretz, T.; Carmona, E.; Carosi, A.; Chatterjee, A.; Clavero, R.; Colin, P.; Colombo, E.; Contreras, J. L.; Cortina, J.; Covino, S.; Da Vela, P.; Dazzi, F.; De Angelis, A.; De Caneva, G.; De Lotto, B.; de Oña Wilhelmi, E.; Delgado Mendez, C.; Di Pierro, F.; Dominis Prester, D.; Dorner, D.; Doro, M.; Einecke, S.; Elsaesser, D.; Fernández-Barral, A.; Fidalgo, D.; Fonseca, M. V.; Font, L.; Frantzen, K.; Fruck, C.; Galindo, D.; García López, R. J.; Garczarczyk, M.; Garrido Terrats, D.; Gaug, M.; Giammaria, P.; Eisenacher Glawion, D.; Godinović, N.; González Muñoz, A.; Guberman, D.; Hanabata, Y.; Hayashida, M.; Herrera, J.; Hose, J.; Hrupec, D.; Hughes, G.; Idec, W.; Kodani, K.; Konno, Y.; Kubo, H.; Kushida, J.; La Barbera, A.; Lelas, D.; Lindfors, E.; Lombardi, S.; Longo, F.; López, M.; López-Coto, R.; López-Oramas, A.; Lorenz, E.; Majumdar, P.; Makariev, M.; Mallot, K.; Maneva, G.; Manganaro, M.; Mannheim, K.; Maraschi, L.; Marcote, B.; Mariotti, M.; Martínez, M.; Mazin, D.; Menzel, U.; Miranda, J. M.; Mirzoyan, R.; Moralejo, A.; Nakajima, D.; Neustroev, V.; Niedzwiecki, A.; Nievas Rosillo, M.; Nilsson, K.; Nishijima, K.; Noda, K.; Orito, R.; Overkemping, A.; Paiano, S.; Palacio, J.; Palatiello, M.; Paneque, D.; Paoletti, R.; Paredes, J. M.; Paredes-Fortuny, X.; Persic, M.; Poutanen, J.; Prada Moroni, P. G.; Prandini, E.; Puljak, I.; Reinthal, R.; Rhode, W.; Ribó, M.; Rico, J.; Rodriguez Garcia, J.; Rügamer, S.; Saito, T.; Satalecka, K.; Scapin, V.; Schultz, C.; Schweizer, T.; Shore, S. N.; Sillanpää, A.; Sitarek, J.; Snidaric, I.; Sobczynska, D.; Stamerra, A.; Steinbring, T.; Strzys, M.; Takalo, L.; Takami, H.; Tavecchio, F.; Temnikov, P.; Terzić, T.; Tescaro, D.; Teshima, M.; Thaele, J.; Torres, D. F.; Toyama, T.; Treves, A.; Verguilov, V.; Vovk, I.; Ward, J. E.; Will, M.; Wu, M. H.; Zanin, R.; Lucarelli, F.; Pittori, C.; Vercellone, S.; Berdyugin, A.; Carini, M. T.; Lähteenmäki, A.; Pasanen, M.; Pease, A.; Sainio, J.; Tornikoski, M.; Walters, R.
2016-07-01
The BL Lac object 1ES 1011+496 was discovered at very high energy (VHE, E > 100GeV) γ-rays by Major Atmospheric Gamma-ray Imaging Cherenkov (MAGIC) in Spring 2007. Before that the source was little studied in different wavelengths. Therefore, a multiwavelength (MWL) campaign was organized in Spring 2008. Along MAGIC, the MWL campaign included the Metsähovi Radio Observatory, Bell and Kungliga Vetenskapsakademien (KVA) optical telescopes and the Swift and AGILE satellites. MAGIC observations span from 2008 March to May for a total of 27.9 h, of which 19.4 h remained after quality cuts. The light curve showed no significant variability yielding an integral flux above 200 GeV of (1.3 ± 0.3) × 10-11 photons cm-2 s-1. The differential VHE spectrum could be described with a power-law function with a spectral index of 3.3 ± 0.4. Both results were similar to those obtained during the discovery. Swift X-ray Telescope observations revealed an X-ray flare, characterized by a harder-when-brighter trend, as is typical for high synchrotron peak BL Lac objects (HBL). Strong optical variability was found during the campaign, but no conclusion on the connection between the optical and VHE γ-ray bands could be drawn. The contemporaneous spectral energy distribution shows a synchrotron-dominated source, unlike concluded in previous work based on non-simultaneous data, and is well described by a standard one-zone synchrotron self-Compton model. We also performed a study on the source classification. While the optical and X-ray data taken during our campaign show typical characteristics of an HBL, we suggest, based on archival data, that 1ES 1011+496 is actually a borderline case between intermediate and high synchrotron peak frequency BL Lac objects.
Harder, H; Khol-Parisini, A; Metzler-Zebeli, B U; Klevenhusen, F; Zebeli, Q
2015-11-01
Recent data indicate positive effects of treating grain with citric (CAc) or lactic acid (LAc) on the hydrolysis of phytate phosphorus (P) and fermentation products of the grain. This study used a semicontinuous rumen simulation technique to evaluate the effects of processing of barley with 50.25 g/L (wt/vol) CAc or 76.25 g/L LAc on microbial composition, metabolic fermentation profile, and nutrient degradation at low or high dietary P supply. The low P diet [3.1g of P per kg of dry matter (DM) of dietary P sources only] was not supplemented with inorganic P, whereas the high P diet was supplemented with 0.5 g of inorganic P per kg of DM through mineral premix and 870 mg of inorganic P/d per incubation fermenter via artificial saliva. Target microbes were determined using quantitative PCR. Data showed depression of total bacteria but not of total protozoa or short-chain fatty acid (SCFA) concentration with the low P diet. In addition, the low P diet lowered the relative abundance of Ruminococcus albus and decreased neutral detergent fiber (NDF) degradation and acetate proportion, but increased the abundance of several predominantly noncellulolytic bacterial species and anaerobic fungi. Treatment of grain with LAc increased the abundance of total bacteria in the low P diet only, and this effect was associated with a greater concentration of SCFA in the ruminal fluid. Interestingly, in the low P diet, CAc treatment of barley increased the most prevalent bacterial group, the genus Prevotella, in ruminal fluid and increased NDF degradation to the same extent as did inorganic P supplementation in the high P diet. Treatment with either CAc or LAc lowered the abundance of Megasphaera elsdenii but only in the low P diet. On the other hand, CAc treatment increased the proportion of acetate in the low P diet, whereas LAc treatment decreased this variable at both dietary P levels. The propionate proportion was significantly increased by LAc at both P levels, whereas butyrate increased only with the low P diet. Treatments with CAc or LAc reduced the degradation of CP and ammonia concentration compared with the control diet at both P levels. In conclusion, the beneficial effects of CAc and LAc treatment on specific ruminal microbes, fermentation profile, and fiber degradation in the low P diet suggest the potential for the treatment to compensate for the lack of inorganic P supplementation in vitro. Further research is warranted to determine the extent to which the treatment can alleviate the shortage of inorganic P supplementation under in vivo conditions. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Lactation induces increases in the RANK/RANKL/OPG system in maxillary bone.
Macari, Soraia; Sharma, Lavanya A; Wyatt, Amanda; da Silva, Janine Maíra; Dias, George J; Silva, Tarcília A; Szawka, Raphael E; Grattan, David R
2018-05-01
The underlying causes of maxillary bone loss during lactation remain poorly understood. We evaluated the impact of lactation on physiological and mechanically-induced alveolar bone remodeling. Nulliparous non-lactating (N-LAC) and 21-day lactating (LAC) mice underwent mechanically-induced bone remodeling by orthodontic tooth movement (OTM). Micro-computed tomography (microCT) was performed in the maxilla, femur and vertebra. Tartrate-resistant-acid phosphatase (TRAP) and Masson's trichrome labelling was performed in the maxillary bone and gene expression was determined in the periodontal ligament. The effect of prolactin on osteoclast (OCL) and osteoblast (OBL) differentiation was also investigated in N-LAC and LAC mice. Lactation increased alveolar bone loss in the maxilla, femur and vertebra, while OTM was enhanced. The number of OCL and OBL was higher in the maxilla of LAC mice. OTM increased OCL in both groups; while OBL was increased only in N-LAC but not in LAC mice, in which cell numbers were already elevated. The alveolar bone loss during lactation was associated with increased expression of receptor activator of nuclear factor-KappaB (RANK), RANK ligand (RANKL), and osteoprotegerin (OPG) in the maxilla. OTM induced the same responses in N-LAC mice, whereas it had no further effect in LAC mice. Lactation enhanced differentiation of OCL and OBL from bone marrow cells, and prolactin recapitulated OCL differentiation in N-LAC mice. Thus, lactation increases physiological maxillary bone remodeling and OTM, and both require activation of RANK/RANKL/OPG system. These findings expand our knowledge of lactation-induced osteopenia and have possible impact on clinical practice regarding orthodontic treatments and dental implants in lactating women. Copyright © 2018 Elsevier Inc. All rights reserved.
Identification of a Dehydrogenase Required for Lactose Metabolism in Caulobacter crescentus▿ †‡
Arellano, Benjamin H.; Ortiz, Janett D.; Manzano, Janet; Chen, Joseph C.
2010-01-01
Caulobacter crescentus, which thrives in freshwater environments with low nutrient levels, serves as a model system for studying bacterial cell cycle regulation and organelle development. We examined its ability to utilize lactose (i) to gain insight into the metabolic capacities of oligotrophic bacteria and (ii) to obtain an additional genetic tool for studying this model organism, aiming to eliminate the basal enzymatic activity that hydrolyzes the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal). Using a previously isolated transposon mutant, we identified a gene, lacA, that is required for growth on lactose as the sole carbon source and for turning colonies blue in the presence of X-gal. LacA, which contains a glucose-methanol-choline (GMC) oxidoreductase domain, has homology to the flavin subunit of Pectobacterium cypripedii's gluconate dehydrogenase. Sequence comparisons indicated that two genes near lacA, lacB and lacC, encode the other subunits of the membrane-bound dehydrogenase. In addition to lactose, all three lac genes are involved in the catabolism of three other β-galactosides (lactulose, lactitol, and methyl-β-d-galactoside) and two glucosides (salicin and trehalose). Dehydrogenase assays confirmed that the lac gene products oxidize lactose, salicin, and trehalose. This enzymatic activity is inducible, and increased lac expression in the presence of lactose and salicin likely contributes to the induction. Expression of lacA also depends on the presence of the lac genes, implying that the dehydrogenase participates in induction. The involvement of a dehydrogenase suggests that degradation of lactose and other sugars in C. crescentus may resemble a proposed pathway in Agrobacterium tumefaciens. PMID:20190087
Aguila, Sergio A; Shimomoto, David; Ipinza, Franscisco; Bedolla-Valdez, Zaira I; Romo-Herrera, José; Contreras, Oscar E; Farías, Mario H; Alonso-Núñez, Gabriel
2015-01-01
The use of nanomaterials allows the design of ultrasensitive biosensors with advantages in the detection of organic molecules. Catechol and catechin are molecules that occur naturally in fruits, and their presence in products like dyes and wines affects quality standards. In this study, catechol and catechin were measured at the nanoscale by means of cyclic voltammetry. The oxidation of Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes (Lac/CNx-MWCNT) and on graphene oxide (Lac/GO) was used to measure the concentrations of catechol and catechin. Nitrogen-doped multiwalled carbon nanotubes (CNx-MWCNT) were synthesized by spray pyrolysis and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). Covalently bonded hybrids with laccase (Lac/CNx-MWCNT and Lac/GO) were generated. Catalytic activity of free enzymes determined with syringaldazine yielded 14 584 UmL−1. With Lac/CNx-MWCNT at concentrations of 6.4 mmol L−1 activity was 9326 U mL−1, while enzyme activity measured with Lac/GO at concentration of 6.4 mmol L−1 was 9 234 U mL−1. The Lac/CNx-MWCNT hybrid showed higher stability than Lac/GO at different ethyl alcohol concentrations. The Lac/CNx-MWCNT hybrid can measure concentrations, not previously reported, as low as 1 × 10−8 mol L−1 by measuring the electric current responses. PMID:27877839
NASA Astrophysics Data System (ADS)
Aguila, Sergio A.; Shimomoto, David; Ipinza, Franscisco; Bedolla-Valdez, Zaira I.; Romo-Herrera, José; Contreras, Oscar E.; Farías, Mario H.; Alonso-Núñez, Gabriel
2015-10-01
The use of nanomaterials allows the design of ultrasensitive biosensors with advantages in the detection of organic molecules. Catechol and catechin are molecules that occur naturally in fruits, and their presence in products like dyes and wines affects quality standards. In this study, catechol and catechin were measured at the nanoscale by means of cyclic voltammetry. The oxidation of Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes (Lac/CNx-MWCNT) and on graphene oxide (Lac/GO) was used to measure the concentrations of catechol and catechin. Nitrogen-doped multiwalled carbon nanotubes (CNx-MWCNT) were synthesized by spray pyrolysis and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). Covalently bonded hybrids with laccase (Lac/CNx-MWCNT and Lac/GO) were generated. Catalytic activity of free enzymes determined with syringaldazine yielded 14 584 UmL-1. With Lac/CNx-MWCNT at concentrations of 6.4 mmol L-1 activity was 9326 U mL-1, while enzyme activity measured with Lac/GO at concentration of 6.4 mmol L-1 was 9 234 U mL-1. The Lac/CNx-MWCNT hybrid showed higher stability than Lac/GO at different ethyl alcohol concentrations. The Lac/CNx-MWCNT hybrid can measure concentrations, not previously reported, as low as 1 × 10-8 mol L-1 by measuring the electric current responses.
Evidence for Moonlighting Functions of the θ Subunit of Escherichia coli DNA Polymerase III
Dietrich, M.; Pedró, L.; García, J.; Pons, M.; Hüttener, M.; Paytubi, S.; Madrid, C.
2014-01-01
The holE gene is an enterobacterial ORFan gene (open reading frame [ORF] with no detectable homology to other ORFs in a database). It encodes the θ subunit of the DNA polymerase III core complex. The precise function of the θ subunit within this complex is not well established, and loss of holE does not result in a noticeable phenotype. Paralogs of holE are also present on many conjugative plasmids and on phage P1 (hot gene). In this study, we provide evidence indicating that θ (HolE) exhibits structural and functional similarities to a family of nucleoid-associated regulatory proteins, the Hha/YdgT-like proteins that are also encoded by enterobacterial ORFan genes. Microarray studies comparing the transcriptional profiles of Escherichia coli holE, hha, and ydgT mutants revealed highly similar expression patterns for strains harboring holE and ydgT alleles. Among the genes differentially regulated in both mutants were genes of the tryptophanase (tna) operon. The tna operon consists of a transcribed leader region, tnaL, and two structural genes, tnaA and tnaB. Further experiments with transcriptional lacZ fusions (tnaL::lacZ and tnaA::lacZ) indicate that HolE and YdgT downregulate expression of the tna operon by possibly increasing the level of Rho-dependent transcription termination at the tna operon's leader region. Thus, for the first time, a regulatory function can be attributed to HolE, in addition to its role as structural component of the DNA polymerase III complex. PMID:24375106
Fuglestad, Brian; Stetz, Matthew A; Belnavis, Zachary; Wand, A Joshua
2017-12-01
Previous investigations of the sensitivity of the lac repressor to high-hydrostatic pressure have led to varying conclusions. Here high-pressure solution NMR spectroscopy is used to provide an atomic level view of the pressure induced structural transition of the lactose repressor regulatory domain (LacI* RD) bound to the ligand IPTG. As the pressure is raised from ambient to 3kbar the native state of the protein is converted to a partially unfolded form. Estimates of rotational correlation times using transverse optimized relaxation indicates that a monomeric state is never reached and that the predominate form of the LacI* RD is dimeric throughout this pressure change. Spectral analysis suggests that the pressure-induced transition is localized and is associated with a volume change of approximately -115mlmol -1 and an average pressure dependent change in compressibility of approximately 30mlmol -1 kbar -1 . In addition, a subset of resonances emerge at high-pressures indicating the presence of a non-native but folded alternate state. Copyright © 2017 Elsevier B.V. All rights reserved.
Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)
Sarabia-Sainz, Andre-I; Sarabia-Sainz, Hector Manuel; Montfort, Gabriela Ramos-Clamont; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz
2015-09-16
The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10-17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections.
Sarabia-Sainz, Andre-i; Sarabia-Sainz, Hector Manuel; Ramos-Clamont Montfort, Gabriela; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz
2015-01-01
The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10–17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections. PMID:26389896
Zhang, Mengzi; Zhou, Xiaoju; Wang, Bo; Yung, Bryant C.; Lee, Ly J.; Ghoshal, Kalpana; Lee, Robert J.
2013-01-01
Lactosylated gramicidin-containing lipid nanoparticles (Lac-GLN) were developed for delivery of anti-microRNA-155 (anti-miR-155) to hepatocellular carcinoma (HCC) cells. MiR-155 is an oncomiR frequently elevated in HCC. The Lac-GLN formulation contained N-lactobionyl-dioleoyl phosphatidylethanolamine (Lac-DOPE), a ligand for the asialoglycoprotein receptor (ASGR), and an antibiotic peptide gramicidin A. The nanoparticles exhibited a mean particle diameter of 73 nm, zeta potential of +3.5 mV, anti-miR encapsulation efficiency of 88%, and excellent colloidal stability at 4°C. Lac-GLN effectively delivered anti-miR-155 to HCC cells with a 16.1- and 4.1-fold up-regulation of miR-155 targets C/EBPβ and FOXP3 genes, respectively, and exhibited significant greater efficiency over Lipofectamine 2000. In mice, intravenous injection of Lac-GLN containing Cy3-anti-miR-155 led to preferential accumulation of the anti-miR-155 in hepatocytes. Intravenous administration of 1.5 mg/kg anti-miR-155 loaded Lac-GLN resulted in up-regulation of C/EBPβ and FOXP3 by 6.9- and 2.2- fold, respectively. These results suggest potential application of Lac-GLN as a liver-specific delivery vehicle for anti-miR therapy. PMID:23567045
Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.
Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min
Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.
Fermi LAT detection of increased gamma-ray activity from blazar S5 0716+71
NASA Astrophysics Data System (ADS)
Buson, S.
2014-04-01
The Large Area Telescope (LAT), one of two instruments on-board the Fermi Gamma-ray Space Telescope, has observed an increase in gamma-ray activity from a source positionally coincident with the BL Lac object S5 0716+71 (also known as 2FGL J0721.9+7120, Nolan et al. ...
SABE Colombia: Survey on Health, Well-Being, and Aging in Colombia—Study Design and Protocol
Corchuelo, Jairo; Curcio, Carmen-Lucia; Calzada, Maria-Teresa; Mendez, Fabian
2016-01-01
Objective. To describe the design of the SABE Colombia study. The major health study of the old people in Latin America and the Caribbean (LAC) is the Survey on Health, Well-Being, and Aging in LAC, SABE (from initials in Spanish: SAlud, Bienestar & Envejecimiento). Methods. The SABE Colombia is a population-based cross-sectional study on health, aging, and well-being of elderly individuals aged at least 60 years focusing attention on social determinants of health inequities. Methods and design were similar to original LAC SABE. The total sample size of the study at the urban and rural research sites (244 municipalities) was 23.694 elderly Colombians representative of the total population. The study had three components: (1) a questionnaire covering active aging determinants including anthropometry, blood pressure measurement, physical function, and biochemical and hematological measures; (2) a subsample survey among family caregivers; (3) a qualitative study with gender and cultural perspectives of quality of life to understand different dimensions of people meanings. Conclusions. The SABE Colombia is a comprehensive, multidisciplinary study of the elderly with respect to active aging determinants. The results of this study are intended to inform public policies aimed at tackling health inequalities for the aging society in Colombia. PMID:27956896
Jans, Christoph; Follador, Rainer; Hochstrasser, Mira; Lacroix, Christophe; Meile, Leo; Stevens, Marc J A
2013-03-22
Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC.We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ.Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations.
2013-01-01
Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. Conclusions The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations. PMID:23521820
Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)
Crow, V L; Davey, G P; Pearce, L E; Thomas, T D
1983-01-01
The three enzymes of the D-tagatose 6-phosphate pathway (galactose 6-phosphate isomerase, D-tagatose 6-phosphate kinase, and tagatose 1,6-diphosphate aldolase) were absent in lactose-negative (Lac-) derivatives of Streptococcus lactis C10, H1, and 133 grown on galactose. The lactose phosphoenolpyruvate-dependent phosphotransferase system and phospho-beta-galactosidase activities were also absent in Lac- derivatives of strains H1 and 133 and were low (possibly absent) in C10 Lac-. In all three Lac- derivatives, low galactose phosphotransferase system activity was found. On galactose, Lac- derivatives grew more slowly (presumably using the Leloir pathway) than the wild-type strains and accumulated high intracellular concentrations of galactose 6-phosphate (up to 49 mM); no intracellular tagatose 1,6-diphosphate was detected. The data suggest that the Lac phenotype is plasmid linked in the three strains studied, with the evidence being more substantial for strain H1. A Lac- derivative of H1 contained a single plasmid (33 megadaltons) which was absent from the Lac- mutant. We suggest that the genes linked to the lactose plasmid in S. lactis are more numerous than previously envisaged, coding for all of the enzymes involved in lactose metabolism from initial transport to the formation of triose phosphates via the D-tagatose 6-phosphate pathway. Images PMID:6294064
agr-Dependent Interactions of Staphylococcus aureus USA300 with Human Polymorphonuclear Neutrophils
Pang, Yun Yun; Schwartz, Jamie; Thoendel, Matthew; Ackermann, Laynez W.; Horswill, Alexander R.; Nauseef, William M.
2010-01-01
The emergence of serious infections due to community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) has fueled interest in the contributions of specific staphylococcal virulence factors to clinical disease. To assess the contributions of agr-dependent factors to the fate of organisms in polymorphonuclear neutrophils (PMN), we examined the consequences for organism and host cells of feeding PMN with wild-type CA-MRSA (LAC) or CA-MRSA (LAC agr KO) at different multiplicities of infection (MOIs). Phagocytosed organisms rapidly increased the transcription of RNAIII in a time- and MOI-dependent fashion; extracellular USA300 (LAC) did not increase RNAIII expression despite having the capacity to respond to autoinducing peptide-enriched culture medium. HOCl-mediated damage and intracellular survival were the same in the wild-type and USA300 (LAC agr KO). PMN lysis by ingested USA300 (LAC) was time- and MOI-dependent and, at MOIs >1, required α-hemolysin (hla) as USA300 (LAC agr KO) and USA300 (LAC hla KO) promoted PMN lysis only at high MOIs. Taken together, these data demonstrate activation of the agr operon in human PMN with the subsequent production of α-hemolysin and PMN lysis. The extent to which these events in the phagosomes of human PMN contribute to the increased morbidity and mortality of infections with USA300 (LAC) merits further study. PMID:20829608
Zhao, Qiao; Nakashima, Jin; Chen, Fang; Yin, Yanbin; Fu, Chunxiang; Yun, Jianfei; Shao, Hui; Wang, Xiaoqiang; Wang, Zeng-Yu; Dixon, Richard A.
2013-01-01
The evolution of lignin biosynthesis was critical in the transition of plants from an aquatic to an upright terrestrial lifestyle. Lignin is assembled by oxidative polymerization of two major monomers, coniferyl alcohol and sinapyl alcohol. Although two recently discovered laccases, LAC4 and LAC17, have been shown to play a role in lignin polymerization in Arabidopsis thaliana, disruption of both genes only leads to a relatively small change in lignin content and only under continuous illumination. Simultaneous disruption of LAC11 along with LAC4 and LAC17 causes severe plant growth arrest, narrower root diameter, indehiscent anthers, and vascular development arrest with lack of lignification. Genome-wide transcript analysis revealed that all the putative lignin peroxidase genes are expressed at normal levels or even higher in the laccase triple mutant, suggesting that lignin laccase activity is necessary and nonredundant with peroxidase activity for monolignol polymerization during plant vascular development. Interestingly, even though lignin deposition in roots is almost completely abolished in the lac11 lac4 lac17 triple mutant, the Casparian strip, which is lignified through the activity of peroxidase, is still functional. Phylogenetic analysis revealed that lignin laccase genes have no orthologs in lower plant species, suggesting that the monolignol laccase genes diverged after the evolution of seed plants. PMID:24143805
Poly-LacNAc as an Age-Specific Ligand for Rotavirus P[11] in Neonates and Infants
Liu, Yang; Huang, Pengwei; Jiang, Baoming; Tan, Ming; Morrow, Ardythe L.; Jiang, Xi
2013-01-01
Rotavirus (RV) P[11] is an unique genotype that infects neonates. The mechanism of such age-specific host restriction remains unknown. In this study, we explored host mucosal glycans as a potential age-specific factor for attachment of P[11] RVs. Using in vitro binding assays, we demonstrated that VP8* of a P[11] RV (N155) could bind saliva of infants (60.3%, N = 151) but not of adults (0%, N = 48), with a significantly negative correlation between binding of VP8* and ages of infants (P<0.01). Recognition to the infant saliva did not correlate with the ABO, secretor and Lewis histo-blood group antigens (HBGAs) but with the binding of the lectin Lycopersicon esculentum (LEA) that is known to recognize the oligomers of N-acetyllactosamine (LacNAc), a precursor of human HBGAs. Direct evidence of LacNAc involvement in P[11] binding was obtained from specific binding of VP8* with homopolymers of LacNAc in variable lengths through a glycan array analysis of 611 glycans. These results were confirmed by strong binding of VP8* to the Lec2 cell line that expresses LacNAc oligomers but not to the Lec8 cell line lacking the LacNAc. In addition, N155 VP8* and authentic P[11] RVs (human 116E and bovine B223) hemagglutinated human red blood cells that are known to express poly-LacNAc. The potential role of poly-LacNAc in host attachment and infection of RVs has been obtained by abrogation of 116E replication by the PAA-conjugated poly-LacNAc, human milk, and LEA positive infant saliva. Overall, our results suggested that the poly-LacNAc could serve as an age-specific receptor for P[11] RVs and well explained the epidemiology that P[11] RVs mainly infect neonates and young children. PMID:24244290
Hong, Gil-Sun; Goo, Hyun Woo; Song, Jae-Woo
2012-06-01
To investigate the prevalence of ligamentum arteriosum calcification (LAC) on multi-section spiral CT and digital radiography. Five hundred and eight children and 232 adults who performed multi-section chest CT were included in this study and were divided into nine age groups: A (0-5 years), B (6-10 years), C (11-15 years), D (16-20 years), E (21-30 years), F (31-40 years), G (41-50 years), H (51-60 years), and I (61-70 years). Two radiologists assessed the presence of LAC on axial and coronal CT images, defined as focal calcific density on both or on one plane with attenuation >100 Hounsfield unit. The prevalence of LAC on CT was compared between children and adults, and between unenhanced and enhanced CT in children. The prevalence of LAC on digital radiography was evaluated in 476 children. The prevalence of definite LAC on unenhanced multi-section CT was significantly higher in children (37.8 %) than in adults (11.2 %) (P < 0.001), with prevalences in groups: A through I of 35.8, 48.7, 35.1, 28.6, 25.0, 10.2, 15.5, 7.8, and 5.6 %, respectively. The prevalences of indeterminate LAC in age groups A-I on unenhanced multi-section CT were 4.5, 12.8, 8.1, 19.0, 0.0, 0.0, 0.0, 2.0, and 1.9 %. In children, the prevalence of LAC was significantly higher on unenhanced than on enhanced CT (37.8 vs. 16.4 %, P < 0.001). The prevalence of LAC on digital radiography was 3.6 % in children. LAC is frequently observed in children and adults on multi-section spiral CT, more frequently than previously reported. Compared with that on multi-section spiral CT, the prevalence of LAC on digital radiography is substantially low.
Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)
Chirinos, Julio A.; Gómez, Luis F.; Perel, Pablo; Pichardo, Rafael; González, Angel; Sánchez, José R.; Ferreccio, Catterina; Aguilera, Ximena; Silva, Eglé; Oróstegui, Myriam; Medina-Lezama, Josefina; Pérez, Cynthia M.; Suárez, Erick; Ortiz, Ana P.; Rosero, Luis; Schapochnik, Noberto; Ortiz, Zulma; Ferrante, Daniel; Casas, Juan P.
2013-01-01
Background Limited knowledge on the prevalence and distribution of risk factors impairs the planning and implementation of cardiovascular prevention programs in the Latin American and Caribbean (LAC) region. Methods and Findings Prevalence of hypertension, diabetes mellitus, abnormal lipoprotein levels, obesity, and smoking were estimated from individual-level patient data pooled from population-based surveys (1998–2007, n = 31,009) from eight LAC countries and from a national survey of the United States (US) population (1999–2004) Age and gender specific prevalence were estimated and age-gender adjusted comparisons between both populations were conducted. Prevalence of diabetes mellitus, hypertension, and low high-density lipoprotein (HDL)-cholesterol in LAC were 5% (95% confidence interval [95% CI]: 3.4, 7.9), 20.2% (95% CI: 12.5, 31), and 53.3% (95% CI: 47, 63.4), respectively. Compared to LAC region’s average, the prevalence of each risk factor tended to be lower in Peru and higher in Chile. LAC women had higher prevalence of obesity and low HDL-cholesterol than men. Obesity, hypercholesterolemia, and hypertriglyceridemia were more prevalent in the US population than in LAC population (31 vs. 16.1%, 16.8 vs. 8.9%, and 36.2 vs. 26.5%, respectively). However, the prevalence of low HDL-cholesterol was higher in LAC than in the US (53.3 vs. 33.7%). Conclusions Major cardiovascular risk factors are highly prevalent in LAC region, in particular low HDL-cholesterol. In addition, marked differences do exist in this prevalence profile between LAC and the US. The observed patterns of obesity-related risk factors and their current and future impact on the burden of cardiovascular diseases remain to be explained. PMID:23349785
Miranda, J Jaime; Herrera, Victor M; Chirinos, Julio A; Gómez, Luis F; Perel, Pablo; Pichardo, Rafael; González, Angel; Sánchez, José R; Ferreccio, Catterina; Aguilera, Ximena; Silva, Eglé; Oróstegui, Myriam; Medina-Lezama, Josefina; Pérez, Cynthia M; Suárez, Erick; Ortiz, Ana P; Rosero, Luis; Schapochnik, Noberto; Ortiz, Zulma; Ferrante, Daniel; Casas, Juan P; Bautista, Leonelo E
2013-01-01
Limited knowledge on the prevalence and distribution of risk factors impairs the planning and implementation of cardiovascular prevention programs in the Latin American and Caribbean (LAC) region. Prevalence of hypertension, diabetes mellitus, abnormal lipoprotein levels, obesity, and smoking were estimated from individual-level patient data pooled from population-based surveys (1998-2007, n=31,009) from eight LAC countries and from a national survey of the United States (US) population (1999-2004) Age and gender specific prevalence were estimated and age-gender adjusted comparisons between both populations were conducted. Prevalence of diabetes mellitus, hypertension, and low high-density lipoprotein (HDL)-cholesterol in LAC were 5% (95% confidence interval [95% CI]: 3.4, 7.9), 20.2% (95% CI: 12.5, 31), and 53.3% (95% CI: 47, 63.4), respectively. Compared to LAC region's average, the prevalence of each risk factor tended to be lower in Peru and higher in Chile. LAC women had higher prevalence of obesity and low HDL-cholesterol than men. Obesity, hypercholesterolemia, and hypertriglyceridemia were more prevalent in the US population than in LAC population (31 vs. 16.1%, 16.8 vs. 8.9%, and 36.2 vs. 26.5%, respectively). However, the prevalence of low HDL-cholesterol was higher in LAC than in the US (53.3 vs. 33.7%). Major cardiovascular risk factors are highly prevalent in LAC region, in particular low HDL-cholesterol. In addition, marked differences do exist in this prevalence profile between LAC and the US. The observed patterns of obesity-related risk factors and their current and future impact on the burden of cardiovascular diseases remain to be explained.
Plasticity of laccase generated by homeologous recombination in yeast.
Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry
2009-10-01
Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.
Solving a discrete model of the lac operon using Z3
NASA Astrophysics Data System (ADS)
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Ju, Yawen; Li, Jie; Xie, Chao; Ritchlin, Christopher T; Xing, Lianping; Hilton, Matthew J; Schwarz, Edward M
2013-09-01
The troponin complex, which consists of three regulatory proteins (troponin C, troponin I, and troponin T), is known to regulate muscle contraction in skeletal and cardiac muscle, but its role in smooth muscle remains controversial. Troponin T3 (TnnT3) is a fast skeletal muscle troponin believed to be expressed only in skeletal muscle cells. To determine the in vivo function and tissue-specific expression of Tnnt3, we obtained the heterozygous Tnnt3+/flox/lacZ mice from Knockout Mouse Project (KOMP) Repository. Tnnt3(lacZ/+) mice are smaller than their WT littermates throughout development but do not display any gross phenotypes. Tnnt3(lacZ/lacZ) embryos are smaller than heterozygotes and die shortly after birth. Histology revealed hemorrhagic tissue in Tnnt3(lacZ/lacZ) liver and kidney, which was not present in Tnnt3(lacZ/+) or WT, but no other gross tissue abnormalities. X-gal staining for Tnnt3 promoter-driven lacZ transgene expression revealed positive staining in skeletal muscle and diaphragm and smooth muscle cells located in the aorta, bladder, and bronchus. Collectively, these findings suggest that troponins are expressed in smooth muscle and are required for normal growth and breathing for postnatal survival. Moreover, future studies with this mouse model can explore TnnT3 function in adult muscle function using the conditional-inducible gene deletion approach Copyright © 2013 Wiley Periodicals, Inc.
Cunha, M N M; Felgueiras, H P; Gouveia, I; Zille, A
2017-06-01
Silver nanoparticles (AgNPs) were synthesized by citrate reduction method in the presence of polymers, poly(ethylene glycol) (PEG), poly(vinyl alcohol) (PVA) and chitosan, used as stabilizing agents, and an oxidoreductase enzyme, laccase (Lac), with the goal of expanding the NPs antimicrobial action. AgNPs were characterized by UV-vis spectrometry, dynamic light scattering and transmission electron microscopy. As protecting agents, PEG and PVA promoted the formation of spherical uniformly-shaped, small-sized, monodispersed AgNPs (≈20nm). High Mw polymers were established as most effective in producing small-sized NPs. Chitosan's viscosity led to the formation of aggregates. Despite the decrease in Lac activity registered for the hybrid formulation, AgNPs-polymer-Lac, a significant augment in stability over time (up to 13days, at 50°C) was observed. This novel formulation displays improved synergistic performance over AgNPs-Lac or polymer-Lac conjugates, since in the former the Lac activity becomes residual at the end of 3days. By enabling many ionic interactions, chitosan restricted the mass transfer between Lac and substrate and, thus, inhibited the enzymatic activity. These hybrid nanocomposites made up of inorganic NPs, organic polymers and immobilized antimicrobial oxidoreductive enzymes represent a new class of materials with improved synergistic performance. Moreover, the Lac and the AgNPs different antimicrobial action, both in time and mechanism, may also constitute a new alternative to reduce the probability of developing resistance-associated mutations. Copyright © 2017 Elsevier B.V. All rights reserved.
Radio variability in complete samples of extragalactic radio sources at 1.4 GHz
NASA Astrophysics Data System (ADS)
Rys, S.; Machalski, J.
1990-09-01
Complete samples of extragalactic radio sources obtained in 1970-1975 and the sky survey of Condon and Broderick (1983) were used to select sources variable at 1.4 GHz, and to investigate the characteristics of variability in the whole population of sources at this frequency. The radio structures, radio spectral types, and optical identifications of the selected variables are discussed. Only compact flat-spectrum sources vary at 1.4 GHz, and all but four are identified with QSOs, BL Lacs, or other (unconfirmed spectroscopically) stellar objects. No correlation of degree of variability at 1.4 GHz with Galactic latitude or variability at 408 MHz has been found, suggesting that most of the 1.4-GHz variability is intrinsic and not caused by refractive scintillations. Numerical models of the variability have been computed.
Woodall, L D; Russell, P W; Harris, S L; Orndorff, P E
1993-01-01
Type 1 pili are filamentous proteinaceous appendages produced by certain members of the family Enterobacteriaceae. In Escherichia coli, the adhesive properties of these pili are due to the binding of at least one minor pilus component to mannose, a sugar common to cell surface molecules of many eukaryotic cells. The study of pilus assembly may be benefited by a rapid way of inducing pilus synthesis de novo. We describe herein the construction and characterization of a strain in which piliation can be rapidly induced by the addition of lactose or its analog isopropyl-beta-D-thiogalactopyranoside. This was accomplished by placing the chromosomal fimA gene (encoding the major structural subunit of pili) under lacUV5 promoter control. Further experiments suggested that transcription of genes downstream of fimA, whose products are required for normal pilus assembly and function, may also be controlled by the lacUV5 promoter. The construction described herein may have a variety of applications apart from aiding the study of pilus assembly since its adhesive properties can be rapidly and easily turned on and off. Images PMID:8097517
NASA Astrophysics Data System (ADS)
Skulski, T.; Percival, J. A.
1996-04-01
Embedded within the vast granitoid terrane of the Minto block of northeastern Superior Province are Late Archean greenstone belts of the Goudalie domain that preserve a long-lived record of continent-ocean interaction. The Vizien greenstone belt is one such belt and it contains four fault-bounded structural panels. The 2786 Ma mafic-ultramafic sequence is an allochthonous package of pillowed basaltic andesite, komatiite and volcaniclastic rocks cut by peridotite and gabbro sills. The mafic rocks are LREE-depleted tholeiites which have primitive mantle (PRIM)-normalized abundances of Th < Nb < La, and ɛNd values of +1.5 to + 3.2 reflecting extraction from a depleted mantle source. The 2724 Ma lac Lintelle continental calc-alkaline volcanic sequence consists of massive basalt, plagioclase-porphyritic andesite, dacite, rhyolite, capped by quartz-rich sandstones/conglomerates with 2.97 Ga Nd model ages. Lac Lintelle volcanic rocks are LREE enriched, with low TiO 2 (< 1%) and Zr (< 200 ppm), PRIM-normalized enrichment in Th > La > Nb, and a range of ɛNd values from -0.1 to +1.7. The ~ 2722 Ma lac Serindac bimodal, subaerial tholeiitic volcanic sequence contains andesite (locally with tonalite xenoliths), basalt, gabbro sills, lenses of quartz-rich sedimentary rocks and a thick, upper rhyolite sequence. The lac Serindac tholeiites are LREE-enriched, have PRIM-normalized Th > La > Nb, high Zr (to 300 ppm) and Ti contents, and low ɛNd values from +0.8 in basalt to -1.4 in rhyolite. The < 2718 Ma basement-cover sequence comprises 2.94 Ga tonalitic gneiss unconformably overlain by clastic sediments and a thin upper sequence of 2700 Ma gabbro, siliceous high-Mg basalt (SHMB) and andesite. The SHMB are characterised by LREE depletion and ɛNd values of +2.6, whereas the andesite is LREE-enriched and has ɛNd values of -0.3. The 2786 Ma mafic-ultramafic sequence is interpreted as a sliver of plume-related oceanic plateau crust. The 2724 lac Lintelle sequence represents a continental arc formed on the eastern protocraton. The ~ 2722 Ma lac Serindac volcanic sequence represents late continental rift deposits. The various 2.8-2.7 Ga supracrustal sequences were accreted, deformed and metamorphosed to mid-amphibolite facies during late-stage assembly of the Minto block between 2.718 and 2.693 Ga.
XCOM intrinsic dimensionality for low-Z elements at diagnostic energies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bornefalk, Hans
2012-02-15
Purpose: To determine the intrinsic dimensionality of linear attenuation coefficients (LACs) from XCOM for elements with low atomic number (Z = 1-20) at diagnostic x-ray energies (25-120 keV). H{sub 0}{sup q}, the hypothesis that the space of LACs is spanned by q bases, is tested for various q-values. Methods: Principal component analysis is first applied and the LACs are projected onto the first q principal component bases. The residuals of the model values vs XCOM data are determined for all energies and atomic numbers. Heteroscedasticity invalidates the prerequisite of i.i.d. errors necessary for bootstrapping residuals. Instead wild bootstrap is applied,more » which, by not mixing residuals, allows the effect of the non-i.i.d residuals to be reflected in the result. Credible regions for the eigenvalues of the correlation matrix for the bootstrapped LAC data are determined. If subsequent credible regions for the eigenvalues overlap, the corresponding principal component is not considered to represent true data structure but noise. If this happens for eigenvalues l and l + 1, for any l{<=}q, H{sub 0}{sup q} is rejected. Results: The largest value of q for which H{sub 0}{sup q} is nonrejectable at the 5%-level is q = 4. This indicates that the statistically significant intrinsic dimensionality of low-Z XCOM data at diagnostic energies is four. Conclusions: The method presented allows determination of the statistically significant dimensionality of any noisy linear subspace. Knowledge of such significant dimensionality is of interest for any method making assumptions on intrinsic dimensionality and evaluating results on noisy reference data. For LACs, knowledge of the low-Z dimensionality might be relevant when parametrization schemes are tuned to XCOM data. For x-ray imaging techniques based on the basis decomposition method (Alvarez and Macovski, Phys. Med. Biol. 21, 733-744, 1976), an underlying dimensionality of two is commonly assigned to the LAC of human tissue at diagnostic energies. The finding of a higher statistically significant dimensionality thus raises the question whether a higher assumed model dimensionality (now feasible with the advent of multibin x-ray systems) might also be practically relevant, i.e., if better tissue characterization results can be obtained.« less
Active Galactic Nuclei, Quasars, BL Lac Objects and X-Ray Background
NASA Technical Reports Server (NTRS)
Mushotzky, Richard (Technical Monitor); Elvis, Martin
2005-01-01
The XMM COSMOS survey is producing the large surface density of X-ray sources anticipated. The first batch of approx. 200 sources is being studied in relation to the large scale structure derived from deep optical/near-IR imaging from Subaru and CFHT. The photometric redshifts from the opt/IR imaging program allow a first look at structure vs. redshift, identifying high z clusters. A consortium of SAO, U. Arizona and the Carnegie Institute of Washington (Pasadena) has started a large program using the 6.5meter Magellan telescopes in Chile with the prime objective of identifying the XMM X-ray sources in the COSMOS field. The first series of observing runs using the new IMACS multi-slit spectrograph on Magellan will take place in January and February of 2005. Some 300 spectra per field will be taken, including 70%-80% of the XMM sources in each field. The four first fields cover the center of the COSMOS field. A VLT consortium is set to obtain bulk redshifts of the field galaxies. The added accuracy of the spectroscopic redshifts over the photo-z's will allow much lower density structures to be seen, voids and filaments. The association of X-ray selected AGNs, and quasars with these filaments, is a major motivation for our studies. Comparison to the deep VLA radio data now becoming available is about to begin.
Latin America: A Development Pole for Phenomics
Camargo, Anyela V.; Lobos, Gustavo A.
2016-01-01
Latin America and the Caribbean (LAC) has long been associated with the production and export of a diverse range of agricultural commodities. Due to its strategic geographic location, which encompasses a wide range of climates, it is possible to produce almost any crop. The climate diversity in LAC is a major factor in its agricultural potential but this also means climate change represents a real threat to the region. Therefore, LAC farming must prepare and quickly adapt to an environment that is likely to feature long periods of drought, excessive rainfall and extreme temperatures. With the aim of moving toward a more resilient agriculture, LAC scientists have created the Latin American Plant Phenomics Network (LatPPN) which focuses on LAC's economically important crops. LatPPN's key strategies to achieve its main goal are: (1) training of LAC members on plant phenomics and phenotyping, (2) establish international and multidisciplinary collaborations, (3) develop standards for data exchange and research protocols, (4) share equipment and infrastructure, (5) disseminate data and research results, (6) identify funding opportunities and (7) develop strategies to guarantee LatPPN's relevance and sustainability across time. Despite the challenges ahead, LatPPN represents a big step forward toward the consolidation of a common mind-set in the field of plant phenotyping and phenomics in LAC. PMID:27999577
Latin America: A Development Pole for Phenomics.
Camargo, Anyela V; Lobos, Gustavo A
2016-01-01
Latin America and the Caribbean (LAC) has long been associated with the production and export of a diverse range of agricultural commodities. Due to its strategic geographic location, which encompasses a wide range of climates, it is possible to produce almost any crop. The climate diversity in LAC is a major factor in its agricultural potential but this also means climate change represents a real threat to the region. Therefore, LAC farming must prepare and quickly adapt to an environment that is likely to feature long periods of drought, excessive rainfall and extreme temperatures. With the aim of moving toward a more resilient agriculture, LAC scientists have created the Latin American Plant Phenomics Network (LatPPN) which focuses on LAC's economically important crops. LatPPN's key strategies to achieve its main goal are: (1) training of LAC members on plant phenomics and phenotyping, (2) establish international and multidisciplinary collaborations, (3) develop standards for data exchange and research protocols, (4) share equipment and infrastructure, (5) disseminate data and research results, (6) identify funding opportunities and (7) develop strategies to guarantee LatPPN's relevance and sustainability across time. Despite the challenges ahead, LatPPN represents a big step forward toward the consolidation of a common mind-set in the field of plant phenotyping and phenomics in LAC.
Population Dynamics of a Lac(-) Strain of Escherichia Coli during Selection for Lactose Utilization
Foster, P. L.
1994-01-01
During selection for lactose utilization, Lac(+) revertants of FC40, a Lac(-) strain of Escherichia coli, appear at a high rate. Yet, no Lac(+) revertants appear in the absence of lactose, or in its presence if the cells have another, unfulfilled requirement for growth. This study investigates more fully the population dynamics of FC40 when incubated in the absence of a carbon source or when undergoing selection for lactose utilization. In the absence of a carbon source, the viable cell numbers do not change over 6 days. When incubated in liquid lactose medium, Lac(-) cells do not undergo any measurable increase in numbers or in turbidity for at least 2 days. When FC40 is plated on lactose minimum medium in the presence of scavenger cells, the upper limit to the amount of growth of Lac(-) cells during 5 days is one doubling, and there is no evidence for turnover (i.e., a balance between growth and death). The presence of a minority population that could form microcolonies was not detected. The implications of these results, plus the fact that the appearance of Lac(+) revertants during lactose selection is nearly constant with time, are discussed in reference to several models that have been postulated to account for adaptive mutations. PMID:7828809
NASA Astrophysics Data System (ADS)
Willaarts, Barbara; Garrido, Alberto; Soriano, Barbara; De Stefano, Lucia; López Gunn, Elena; Aldaya, Maite; Martínez-Santos, Pedro; Llamas, Ramon
2014-05-01
Latin American and the Caribbean (LAC) is a water and land abundant region, and plays a key role in meeting global food and water security. During the last decade, LAC has experience a rapid socio-economic growth, largely sustained by its competitive advantage in the production and exports of agricultural and mining products and by the high commodity prices in the global market. This study seeks to quantify the contribution of LAC's agriculture to global food and water security, i.e. virtual water trade, and evaluate the environmental and societal implications for regional development. Results show that between 2000 and 2011, LAC has increase its agricultural production 27%, and it now accounts for nearly 18% of the global agricultural market. As a result, the agricultural water footprint (WF) of LAC was augmented 65%; and yet, nearly 19% to 44% of the actual agricultural WF - depending on the countries - is virtual water exported to third countries. In fact, almost 50% of the increase in global virtual water trade during the last decade, corresponds to LAC. Such global contribution has significant implications for regional water and food security. From an environmental perspective, crop expansion (mostly rain-fed) resulted in the deforestation of nearly 1 million km2, turning this region into the second most important deforestation hotspots worldwide. This land clearing is having large impacts of ecosystem services, e.g. carbon sequestration, water quality or biodiversity conservation. From a socio-economic perspective, increasing agricultural production has improved regional food security indicators, although one every seven children is still stunted in LAC and nearly 10% of the population remains undernourished. Dietary shifts and socio-cultural factors also lag behind the growing problem of malnutrition in the region, i.e. overweight and obesity. Improvements of water access and sanitation, have had a positive impact on food security indicators, especially among the high-income LAC countries. We conclude that despite the large contribution of LAC's agriculture to global water and food security, this goal is at present intensively tapping into LAC's natural capital. Also, regional improvements in water security have improved, but important goals remain and new challenges are emerging. Water governance in LAC is evolving to address the challenges posed by rapid socio-economic changes, however, as is often the case, the implementation of reforms lags behind.
Functional metagenomics reveals novel β-galactosidases not predictable from gene sequences.
Cheng, Jiujun; Romantsov, Tatyana; Engel, Katja; Doxey, Andrew C; Rose, David R; Neufeld, Josh D; Charles, Trevor C
2017-01-01
The techniques of metagenomics have allowed researchers to access the genomic potential of uncultivated microbes, but there remain significant barriers to determination of gene function based on DNA sequence alone. Functional metagenomics, in which DNA is cloned and expressed in surrogate hosts, can overcome these barriers, and make important contributions to the discovery of novel enzymes. In this study, a soil metagenomic library carried in an IncP cosmid was used for functional complementation for β-galactosidase activity in both Sinorhizobium meliloti (α-Proteobacteria) and Escherichia coli (γ-Proteobacteria) backgrounds. One β-galactosidase, encoded by six overlapping clones that were selected in both hosts, was identified as a member of glycoside hydrolase family 2. We could not identify ORFs obviously encoding possible β-galactosidases in 19 other sequenced clones that were only able to complement S. meliloti. Based on low sequence identity to other known glycoside hydrolases, yet not β-galactosidases, three of these ORFs were examined further. Biochemical analysis confirmed that all three encoded β-galactosidase activity. Lac36W_ORF11 and Lac161_ORF7 had conserved domains, but lacked similarities to known glycoside hydrolases. Lac161_ORF10 had neither conserved domains nor similarity to known glycoside hydrolases. Bioinformatic and structural modeling implied that Lac161_ORF10 protein represented a novel enzyme family with a five-bladed propeller glycoside hydrolase domain. By discovering founding members of three novel β-galactosidase families, we have reinforced the value of functional metagenomics for isolating novel genes that could not have been predicted from DNA sequence analysis alone.
Eye drop delivery of nano-polymeric micelle formulated genes with cornea-specific promoters.
Tong, Yaw-Chong; Chang, Shwu-Fen; Liu, Chia-Yang; Kao, Winston W-Y; Huang, Chong Heng; Liaw, Jiahorng
2007-11-01
This study evaluates the eye drop delivery of genes with cornea-specific promoters, i.e., keratin 12 (K12) and keratocan (Kera3.2) promoters, by non-ionic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles (PM) to mouse and rabbit eyes, and investigates the underlying mechanisms. Three PM-formulated plasmids (pCMV-Lac Z, pK12-Lac Z and pKera3.2-Lac Z) containing the Lac Z gene for beta-galactosidase (beta-Gal) whose expression was driven by the promoter of either the cytomegalovirus early gene, the keratin 12 gene or the keratocan gene, were characterized by critical micelle concentration (CMC), dynamic light scattering (DLS), and atomic force microscopy (AFM). Transgene expression in ocular tissue after gene delivery was analyzed by 5-bromo-4-chloro-3-indolyl-beta-D-galactoside (X-Gal) color staining, 1,2-dioxetane beta-Gal enzymatic activity measurement, and real-time polymerase chain reaction (PCR) analysis. The delivery mechanisms of plasmid-PM on mouse and rabbit corneas were evaluated by EDTA and RGD (arginine-glycine-aspartic acid) peptide. The sizes of the three plasmid-PM complexes were around 150-200 nm with unimodal distribution. Enhanced stability was found for three plasmid-PM formulations after DNase I treatment. After six doses of eye drop delivery of pK12-Lac Z-PM three times a day, beta-Gal activity was significantly increased in both mouse and rabbit corneas. Stroma-specific Lac Z expression was only found in pKera3.2-Lac Z-PM-treated animals with pretreatment by 5 mM EDTA, an opener of junctions. Lac Z gene expression in both pK12-Lac Z-PM and pKera3.2-Lac Z-PM delivery groups was decreased by RGD peptide pretreatment. Cornea epithelium- and stroma-specific gene expression could be achieved using cornea-specific promoters of keratin 12 and keratocan genes, and the gene was delivered with PM formulation through non-invasive, eye drop in mice and rabbits. The transfection mechanism of plasmid-PM may involve endocytosis and particle size dependent paracellular transport. 2007 John Wiley & Sons, Ltd
Tan, Yueming; Deng, Wenfang; Li, Yunyong; Huang, Zhao; Meng, Yue; Xie, Qingji; Ma, Ming; Yao, Shouzhuo
2010-04-22
We report here on the facile preparation of polymer-enzyme-multiwalled carbon nanotubes (MWCNTs) cast films accompanying in situ laccase (Lac)-catalyzed polymerization for electrochemical biosensing and biofuel cell applications. Lac-catalyzed polymerization of dopamine (DA) as a new substrate was examined in detail by UV-vis spectroscopy, cyclic voltammetry, quartz crystal microbalance, and scanning electron microscopy. Casting the aqueous mixture of DA, Lac and MWCNTs on a glassy carbon electrode (GCE) yielded a robust polydopamine (PDA)-Lac-MWCNTs/GCE that can sense hydroquinone with 643 microA mM(-1) cm(-2) sensitivity and 20-nM detection limit (S/N = 3). The DA substrate yielded the best biosensing performance, as compared with aniline, o-phenylenediamine, or o-aminophenol as the substrate for similar Lac-catalyzed polymerization. Casting the aqueous mixture of DA, glucose oxidase (GOx), Lac, and MWCNTs on a Pt electrode yielded a robust PDA-GOx-Lac-MWCNTs/Pt electrode that exhibits glucose-detection sensitivity of 68.6 microA mM(-1) cm(-2). In addition, 2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS) was also coimmobilized to yield a PDA-Lac-MWCNTs-ABTS/GCE that can effectively catalyze the reduction of O(2), and it was successfully used as the biocathode of a membraneless glucose/O(2) biofuel cell (BFC) in pH 5.0 Britton-Robinson buffer. The proposed biomacromolecule-immobilization platform based on enzyme-catalyzed polymerization may be useful for preparing many other multifunctional polymeric bionanocomposites for wide applications.
Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.
Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina
2016-08-23
Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.
Sand, Daniel; She, Rosemary; Shulman, Ira A; Chen, David S; Schur, Mathew; Hsu, Hugo Y
2015-05-01
To evaluate the spectrum and antibiotic susceptibility panel of infectious keratitis at a major tertiary care referral eye center and a major county hospital in Southern California. Retrospective case series. All cultured infectious keratitis cases from July 1, 2008, through December 31, 2012, from the Doheny Eye Institute (DEI) and the Los Angeles County + University of Southern California Medical Center (LAC+USC) were evaluated. Microbiology records were reviewed retrospectively. Microbial isolates as well as antibiotic susceptibility patterns were analyzed. One hundred eighty-four (63%) of 290 cases showed positive culture results at DEI and 152 (82%) of 186 cases showed positive culture results at LAC+USC. Gram-positive pathogens were found to be the most common at both DEI (70%) and LAC+USC (68%), with coagulase-negative Staphylococcus being the most common gram-positive organism (58% at DEI and 44% at LAC+USC). Pseudomonas aeruginosa was the most common gram-negative organism (57% at DEI and 43% at LAC+USC). Ciprofloxacin and levofloxacin susceptibility for all tested pathogens was 73% at DEI and 81% at LAC+USC (P = 0.16). Oxacillin-resistant Staphylococcus aureus (ORSA) was found in 42% of cases at DEI and in 45% of cases at LAC+USC (P = 1.00). There is no significant difference in the spectrum of pathogens or antibiotic susceptibility of pathogens at DEI versus LAC+USC, and ORSA was found in approximately half of all S. aureus samples. Copyright © 2015 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
Indian Americans at Mille Lacs.
ERIC Educational Resources Information Center
Holbert, Victoria L.; And Others
The Training Center for Community Programs prepared a report on the Mille Lacs (Chippewa) Reservation in Minnesota. Data for the report were from 2 separate sources: a survey conducted by the Training Center with the assistance of the Mille Lacs community action program (1967) and an attitudinal survey conducted by Victoria Holbert during 1969.…
Lactose-induced cell death of beta-galactosidase mutants in Kluyveromyces lactis.
Lodi, Tiziana; Donnini, Claudia
2005-05-01
The Kluyveromyces lactis lac4 mutants, lacking the beta-galactosidase gene, cannot assimilate lactose, but grow normally on many other carbon sources. However, when these carbon sources and lactose were simultaneously present in the growth media, the mutants were unable to grow. The effect of lactose was cytotoxic since the addition of lactose to an exponentially-growing culture resulted in 90% loss of viability of the lac4 cells. An osmotic stabilizing agent prevented cells killing, supporting the hypothesis that the lactose toxicity could be mainly due to intracellular osmotic pressure. Deletion of the lactose permease gene, LAC12, abolished the inhibitory effect of lactose and allowed the cell to assimilate other carbon substrates. The lac4 strains gave rise, with unusually high frequency, to spontaneous mutants tolerant to lactose (lar1 mutation: lactose resistant). These mutants were unable to take up lactose. Indeed, lar1 mutation turned out to be allelic to LAC12. The high mutability of the LAC12 locus may be an advantage for survival of K. lactis whose main habitat is lactose-containing niches.
NASA Astrophysics Data System (ADS)
Cao, Wenjin; Hewage, Dilrukshi; Yang, Dong-Sheng
2018-05-01
La atom reaction with isoprene is carried out in a laser-vaporization molecular beam source. The reaction yields an adduct as the major product and C—C cleaved and dehydrogenated species as the minor ones. La(C5H8), La(C2H2), and La(C3H4) are characterized with mass-analyzed threshold ionization (MATI) spectroscopy and quantum chemical computations. The MATI spectra of all three species exhibit a strong origin band and several weak vibronic bands corresponding to La-ligand stretch and ligand-based bend excitations. La(C5H8) is a five-membered metallacycle, whereas La(C2H2) and La(C3H4) are three-membered rings. All three metallacycles prefer a doublet ground state with a La 6s1-based valence electron configuration and a singlet ion. The five-membered metallacycle is formed through La addition and isoprene isomerization, whereas the two three-membered rings are produced by La addition and insertion, hydrogen migration, and carbon-carbon bond cleavage.
An Easy Method to Eliminate the Effect of Lupus Anticoagulants in the Coagulation Factor Assay.
Tang, Ning; Yin, Shiyu
2016-07-01
To build and evaluate intrinsic coagulation factor assays which can eliminate the effect of lupus anticoagulants (LAC). Commercial silica clotting time confirmatory (SCT-C) reagent containing sufficient synthetic phospholipid and routine activated partial thromboplastin time (APTT) reagent were each used for one-stage detection of FVIII, FIX, and FXI activities, in samples with or without LAC, and the results were compared. For samples without LAC, consistent results of FVIII, FIX, and FXI using both SCT-C reagent and APTT reagent were obtained. For samples with LAC, the assays with SCT-C reagent not only could eliminate the effect of strong lupus anticoagulants but also needed fewer dilutions than that with routine APTT reagent. The intrinsic factor detections by SCT-C reagent are credible and convenient to be used for samples with LAC.
An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.
Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K
2003-01-01
The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.
Asteri, Ioanna-Areti; Papadimitriou, Konstantinos; Boutou, Effrossyni; Anastasiou, Rania; Pot, Bruno; Vorgias, Constantinos E; Tsakalidou, Effie
2010-07-15
The pLAC1 plasmid of Lactobacillus acidipiscis ACA-DC 1533, a strain isolated from traditional Kopanisti cheese, was characterised. Nucleotide sequence analysis revealed a circular molecule of 3478bp with a G+C content of 37.2%. Ab initio annotation indicated four putative open reading frames (orfs). orf1 and orf4 were found to encode a replication initiation protein (Rep) and a mobilization protein (Mob), respectively. The deduced products of orf2 and orf3 revealed no significant homology to other known proteins. However, in silico examination of the plasmid sequence supported the existence of a novel operon that includes rep, orf2 and orf3 in pLAC1 and that this operon is highly conserved also in plasmids pLB925A02, pSMA23, pLC88 and pC7. RT-PCR experiments allowed us to verify that these three genes are co-transcribed as a single polycistronic mRNA species. Furthermore, phylogenetic analysis of pLAC1 Rep and Mob proteins demonstrated that they may have derived from different plasmid origins, suggesting that pLAC1 is a product of a modular evolution process. Comparative analysis of full length nucleotide sequences of pLAC1 and related Lactobacillus plasmids showed that pLAC1 shares a very similar replication backbone with pLB925A02, pSMA23 and pLC88. In contrast, mob of pLAC1 was almost identical with the respective gene of plasmids pLAB1000, pLB4 and pPB1. These findings lead to the conclusion that pLAC1 acquired mob probably via an ancestral recombination event. Our overall work highlights the importance of characterizing plasmids deriving from non-starter 'wild' isolates in order to better appreciate plasmid divergence and evolution of lactic acid bacteria. 2010 Elsevier B.V. All rights reserved.
Magnesium for treatment of acute lacunar stroke syndromes: further analysis of the IMAGES trial.
Aslanyan, Stella; Weir, Christopher J; Muir, Keith W; Lees, Kennedy R
2007-04-01
A prespecified interaction analysis of the neutral Intravenous Magnesium Efficacy in Stroke (IMAGES) trial revealed significant benefit from magnesium (Mg) in patients with noncortical stroke. Post hoc analysis indicated that this effect was seen in lacunar clinical syndromes (LACS), interaction P=0.005. We have now examined whether this interaction could be explained by confounding baseline factors. LACS was defined on the basis of neurological signs and did not include imaging. We investigated the interaction between baseline variables and Mg treatment on global outcome. We used logistic-regression models to test whether the Mg-LACS interaction remained significant after adjusting for stratification variables, sex, a novel stroke severity score, and baseline variables that had an interaction with treatment (P<0.1). The Mg (n=383) and placebo (n=382) groups of LACS patients were well matched on baseline factors. In addition to LACS, we found an interaction between beneficial Mg treatment effect and younger age (P=0.003), higher baseline diastolic blood pressure (P=0.02), higher mean blood pressure (P=0.02), and absence of ischemic heart disease (P=0.07). Even so, the adjusted Mg-LACS interaction remained significant (odds ratio [OR] 0.57; 95% CI, 0.39 to 0.83; P=0.003). In the LACS subgroup, Mg improved Barthel Index <95 (OR 0.73; 95% CI, 0.55 to 0.98), modified Rankin Scale >1 (OR 0.67; 95% CI, 0.50 to 0.91), and global outcome (OR 0.70; 95% CI, 0.53 to 0.92) but not Barthel Index <60 or mortality. The positive treatment effect of Mg in LACS cannot be ascribed to general issues of severity, time to treatment, blood pressure, or other baseline factors; equally, this finding may be due to chance. A large trial of Mg treatment in LACS appears justified.
Liu, Wan-Ting; Wang, Yang; Zhang, Jing; Ye, Fei; Huang, Xiao-Hui; Li, Bin; He, Qing-Yu
2018-07-01
Lung adenocarcinoma (LAC) is the most lethal cancer and the leading cause of cancer-related death worldwide. The identification of meaningful clusters of co-expressed genes or representative biomarkers may help improve the accuracy of LAC diagnoses. Public databases, such as the Gene Expression Omnibus (GEO), provide rich resources of valuable information for clinics, however, the integration of multiple microarray datasets from various platforms and institutes remained a challenge. To determine potential indicators of LAC, we performed genome-wide relative significance (GWRS), genome-wide global significance (GWGS) and support vector machine (SVM) analyses progressively to identify robust gene biomarker signatures from 5 different microarray datasets that included 330 samples. The top 200 genes with robust signatures were selected for integrative analysis according to "guilt-by-association" methods, including protein-protein interaction (PPI) analysis and gene co-expression analysis. Of these 200 genes, only 10 genes showed both intensive PPI network and high gene co-expression correlation (r > 0.8). IPA analysis of this regulatory networks suggested that the cell cycle process is a crucial determinant of LAC. CENPA, as well as two linked hub genes CDK1 and CDC20, are determined to be potential indicators of LAC. Immunohistochemical staining showed that CENPA, CDK1 and CDC20 were highly expressed in LAC cancer tissue with co-expression patterns. A Cox regression model indicated that LAC patients with CENPA + /CDK1 + and CENPA + /CDC20 + were high-risk groups in terms of overall survival. In conclusion, our integrated microarray analysis demonstrated that CENPA, CDK1 and CDC20 might serve as novel cluster of prognostic biomarkers for LAC, and the cooperative unit of three genes provides a technically simple approach for identification of LAC patients. Copyright © 2018 Elsevier B.V. All rights reserved.
Spectroscopic monitoring of the BL Lac object AO 0235+164
NASA Astrophysics Data System (ADS)
Raiteri, C. M.; Villata, M.; Capetti, A.; Heidt, J.; Arnaboldi, M.; Magazzù, A.
2007-03-01
Aims:Spectroscopic monitoring of BL Lac objects is a difficult task that nonetheless can provide important information on the different components of the active galactic nucleus. Methods: We performed optical spectroscopic monitoring of the BL Lac object AO 0235+164 (z=0.94) with the VLT and TNG telescopes from Aug. 2003 to Dec. 2004, during an extended WEBT campaign. The flux of this source is both contaminated and absorbed by a foreground galactic system at z=0.524, the stars of which can act as gravitational micro-lenses. Results: In this period the object was in an optically faint, though variable state, and a broad Mg II emission line was visible at all epochs. The spectroscopic analysis reveals an overall variation in the Mg II line flux of a factor 1.9, while the corresponding continuum flux density changed by a factor 4.3. Most likely, the photoionising radiation can be identified with the emission component that was earlier recognised to be present as a UV-soft-X-ray bump in the source spectral energy distribution and that is visible in the optical domain only in very faint optical states. We estimate an upper limit to the broad line region (BLR) size of a few light months from the historical minimum brightness level; from this we infer the maximum amplification of the Mg II line predicted by the microlensing scenario. Conclusions: .Unless we have strongly overestimated the size of the BLR, only very massive stars could significantly magnify the broad Mg II emission line, but the time scale of variations due to these (rare) events would be of several years. In contrast, the continuum flux, coming from much smaller emission regions in the jet, could be affected by microlensing from the more plausible MACHO deflectors, with variability time scales of the order of some months. Based on observations collected at the European Southern Observatory, Chile (ESO Programme 71.A-0174), and on observations made with the Italian Telescopio Nazionale Galileo (TNG) operated on the island of La Palma by the Fundación Galileo Galilei of the INAF (Istituto Nazionale di Astrofisica) at the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.
Tong, Kun; Lin, Aiguo; Ji, Guodong; Wang, Dong; Wang, Xinghui
2016-05-05
The adsorption of organic pollutants from super heavy oil wastewater (SHOW) by lignite activated coke (LAC) was investigated. Specifically, the effects of LAC adsorption on pH, BOD5/COD(Cr)(B/C), and the main pollutants before and after adsorption were examined. The removed organic pollutants were characterized by Fourier transform infrared spectroscopy (FTIR), Boehm titrations, gas chromatography-mass spectrometry (GC-MS), and liquid chromatography with organic carbon detection (LC-OCD). FTIR spectra indicated that organic pollutants containing -COOH and -NH2 functional groups were adsorbed from the SHOW. Boehm titrations further demonstrated that carboxyl, phenolic hydroxyl, and lactonic groups on the surface of the LAC increased. GC-MS showed that the removed main organic compounds are difficult to be degraded or extremely toxics to aquatic organisms. According to the results of LC-OCD, 30.37 mg/L of dissolved organic carbons were removed by LAC adsorption. Among these, hydrophobic organic contaminants accounted for 25.03 mg/L. Furthermore, LAC adsorption was found to increase pH and B/C ratio of the SHOW. The mechanisms of adsorption were found to involve between the hydrogen bonding and the functional groups of carboxylic, phenolic, and lactonic on the LAC surface. In summary, all these results demonstrated that LAC adsorption can remove bio-refractory DOCs, which is beneficial for biodegradation. Copyright © 2016. Published by Elsevier B.V.
NASA Technical Reports Server (NTRS)
Schwartz, Daniel A.
1987-01-01
The EXOSAT observations confirmed the identification and extended nature of PKS 2345-35. It gave a good 2 to 10 keV X-ray spectrum and a detailed spatial profile indicating asymmetry of the structure. In the high galactic latitidue investigation, the BL Lac object identified with the HEAO-1 source 1430+423 was detected, and the first X-ray spectrum was obtained. Several simulataneous observations of H0323+022 were obtained over a broad range of electromagnetic spectrum. Studies of luminous active galactic nuclei have given significant information on the spectrum of the quasar PKS 0558-504. In a study of Southern sky cataclysmic variables, the EXOSAT was used to determine the X-ray spectrum and search for periodicities in two objects. Studies of complete identifications have revealed that X-ray sources in two high galactic latitude fields are stars, and therefore are to be excluded from the Piccinotti extragalactic sample. Only one Piccinotti source remains to be identified.
Evaluating the Outcomes of a School Based Theraplay® Project for Looked after Children
ERIC Educational Resources Information Center
Francis, Yvonne J.; Bennion, Kim; Humrich, Sarah
2017-01-01
Research shows that Looked After Children (LAC) may experience emotional instability which can reduce their capacity to engage with education. This study evaluates an attachment based therapeutic Theraplay® intervention designed to bridge the gap between the emotional well-being of LAC and their engagement in education. Twenty LAC between the ages…
Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying
2015-01-01
Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.
Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying
2015-01-01
Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0–11.0 and thermostable at 40°C–90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters. PMID:25790466
Aflatoxin B1 and M1 Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators
Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C.; Quintieri, Laura; Cimmarusti, Maria T.; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F.; Sanjust, Enrico; Mulè, Giuseppina
2016-01-01
Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B1 (AFB1) and M1 (AFM1). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB1 degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2′-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB1 was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM1 was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB1 and, for the first time, AFM1, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB1 and AFM1. PMID:27563923
The third catalog of active galactic nuclei detected by the Fermi large area telescope
Ackermann, M.; Ajello, M.; Atwood, W. B.; ...
2015-08-25
We present the third catalog of active galactic nuclei (AGNs) detected by the Fermi-LAT (3LAC). It is based on the third Fermi-LAT catalog (3FGL) of sources detected between 100 MeV and 300 GeV with a Test Statistic greater than 25, between 2008 August 4 and 2012 July 31. The 3LAC includes 1591 AGNs located at high Galactic latitudes (more » $$| b| \\gt 10^\\circ $$), a 71% increase over the second catalog based on 2 years of data. There are 28 duplicate associations, thus 1563 of the 2192 high-latitude gamma-ray sources of the 3FGL catalog are AGNs. Most of them (98%) are blazars. About half of the newly detected blazars are of unknown type, i.e., they lack spectroscopic information of sufficient quality to determine the strength of their emission lines. Based on their gamma-ray spectral properties, these sources are evenly split between flat-spectrum radio quasars (FSRQs) and BL Lacs. The most abundant detected BL Lacs are of the high-synchrotron-peaked (HSP) type. There were about 50% of the BL Lacs that had no measured redshifts. A few new rare outliers (HSP-FSRQs and high-luminosity HSP BL Lacs) are reported. The general properties of the 3LAC sample confirm previous findings from earlier catalogs. The fraction of 3LAC blazars in the total population of blazars listed in BZCAT remains non-negligible even at the faint ends of the BZCAT-blazar radio, optical, and X-ray flux distributions, which hints that even the faintest known blazars could eventually shine in gamma-rays at LAT-detection levels. Furthermore, the energy-flux distributions of the different blazar populations are in good agreement with extrapolation from earlier catalogs.« less
LAC indicators: an evaluation of progress and list of proposed indicators
Alan E. Watson; David N. Cole
1992-01-01
One of the most critical, and difficult, steps in the Limits of Acceptable Change (LAC) process is the selection of indicators. To help with this step, this paper (I) briefly reviews some desirable characteristics of indicators and (2) lists indicators that have been proposed or adopted in LAC plans. From a comparison of this list of indicators and desirable...
David N. Cole; George H. Stankey
1997-01-01
The Limits of Acceptable Change (LAC) process was developed to deal with the issue of recreational carrying capacity. For that purpose, the LAC process sought to explicitly define a compromise between resource/visitor experience protection and recreation use goals. The most critical and unique element of the process is the specification of LAC standards that define...
An Actor-Network Theory Reading of Change for Children in Public Care
ERIC Educational Resources Information Center
Parker, Elisabeth
2017-01-01
The education of children in public, or Local Authority (LA), care, known in the United Kingdom (UK) as looked-after children (LAC), is supported by government initiatives to reduce the attainment gap that exists between LAC and their non-LAC peers. These children often find remaining in education a challenge, are twice as likely to be permanently…
Tappi, Silvia; Tylewicz, Urszula; Romani, Santina; Siroli, Lorenzo; Patrignani, Francesca; Dalla Rosa, Marco; Rocculi, Pietro
2016-10-05
Vacuum impregnation (VI) is a processing operation that permits the impregnation of fruit and vegetable porous tissues with a fast and more homogeneous penetration of active compounds compared to the classical diffusion processes. The objective of this research was to investigate the impact on VI treatment with the addition of calcium lactate on qualitative parameters of minimally processed melon during storage. For this aim, this work was divided in 2 parts. Initially, the optimization of process parameters was carried out in order to choose the optimal VI conditions for improving texture characteristics of minimally processed melon that were then used to impregnate melons for a shelf-life study in real storage conditions. On the basis of a 2 3 factorial design, the effect of Calcium lactate (CaLac) concentration between 0% and 5% and of minimum pressure (P) between 20 and 60 MPa were evaluated on color and texture. Processing parameters corresponding to 5% CaLac concentration and 60 MPa of minimum pressure were chosen for the storage study, during which the modifications of main qualitative parameters were evaluated. Despite of the high variability of the raw material, results showed that VI allowed a better maintenance of texture during storage. Nevertheless, other quality traits were negatively affected by the application of vacuum. Impregnated products showed a darker and more translucent appearance on the account of the alteration of the structural properties. Moreover microbial shelf-life was reduced to 4 d compared to the 7 obtained for control and dipped samples. © 2016 Institute of Food Technologists®.
Reclaiming the streets for people: Insights from Ciclovías Recreativas in Latin America.
Sarmiento, Olga L; Díaz Del Castillo, Adriana; Triana, Camilo A; Acevedo, María José; Gonzalez, Silvia A; Pratt, Michael
2017-10-01
The Ciclovías comprise worldwide programs in which streets are closed to motor-vehicles and open to individuals for leisure activities. Currently, 93% of the regular programs are in Latin American countries (LAC). The aims of this study were to describe the characteristics of regular Ciclovías in 7 LAC and to analyze the factors that influence the sustainability and scaling-up of five case studies. We conducted a survey of 67 Ciclovías in 2014-2015. In addition, we conducted semi-structured interviews with current and former program coordinators and reviewed policy documents from Ciclovías in 5 LAC. The greatest expansion of Ciclovías has occurred since 2000. The number of participants per event ranged from 40 to 1,500,000 (mean 41,399±193,330; median 1600), and the length ranged from 1 to 113.6km (mean 9.1±16.4; median 3). Ciclovía routes connect low-middle and high income neighborhoods (89.3%), and include the participation of minority populations (61.2%). The main complementary activity offered was physical activity (PA) classes (94.0%), and 80.0% of the programs included strategies to promote biking. All five case studies met definitions for sustainability and scaling-up. All programs shared some level of government support, alliances, community appropriation, champions, compatibility with the mission of the host organization, organizational capacity, flexibility, perceived benefits, and funding stability. However, they differed in operational conditions, political favorability, sources of funding, and number of alliances. The Ciclovías of LAC showed heterogeneity within their design and sustainability factors. Both their heterogeneity and flexibility to adjust to changes make them promising examples of socially inclusive programs to promote PA. Copyright © 2016 Elsevier Inc. All rights reserved.
Identifying clusters of active transportation using spatial scan statistics.
Huang, Lan; Stinchcomb, David G; Pickle, Linda W; Dill, Jennifer; Berrigan, David
2009-08-01
There is an intense interest in the possibility that neighborhood characteristics influence active transportation such as walking or biking. The purpose of this paper is to illustrate how a spatial cluster identification method can evaluate the geographic variation of active transportation and identify neighborhoods with unusually high/low levels of active transportation. Self-reported walking/biking prevalence, demographic characteristics, street connectivity variables, and neighborhood socioeconomic data were collected from respondents to the 2001 California Health Interview Survey (CHIS; N=10,688) in Los Angeles County (LAC) and San Diego County (SDC). Spatial scan statistics were used to identify clusters of high or low prevalence (with and without age-adjustment) and the quantity of time spent walking and biking. The data, a subset from the 2001 CHIS, were analyzed in 2007-2008. Geographic clusters of significantly high or low prevalence of walking and biking were detected in LAC and SDC. Structural variables such as street connectivity and shorter block lengths are consistently associated with higher levels of active transportation, but associations between active transportation and socioeconomic variables at the individual and neighborhood levels are mixed. Only one cluster with less time spent walking and biking among walkers/bikers was detected in LAC, and this was of borderline significance. Age-adjustment affects the clustering pattern of walking/biking prevalence in LAC, but not in SDC. The use of spatial scan statistics to identify significant clustering of health behaviors such as active transportation adds to the more traditional regression analysis that examines associations between behavior and environmental factors by identifying specific geographic areas with unusual levels of the behavior independent of predefined administrative units.
Identifying Clusters of Active Transportation Using Spatial Scan Statistics
Huang, Lan; Stinchcomb, David G.; Pickle, Linda W.; Dill, Jennifer; Berrigan, David
2009-01-01
Background There is an intense interest in the possibility that neighborhood characteristics influence active transportation such as walking or biking. The purpose of this paper is to illustrate how a spatial cluster identification method can evaluate the geographic variation of active transportation and identify neighborhoods with unusually high/low levels of active transportation. Methods Self-reported walking/biking prevalence, demographic characteristics, street connectivity variables, and neighborhood socioeconomic data were collected from respondents to the 2001 California Health Interview Survey (CHIS; N=10,688) in Los Angeles County (LAC) and San Diego County (SDC). Spatial scan statistics were used to identify clusters of high or low prevalence (with and without age-adjustment) and the quantity of time spent walking and biking. The data, a subset from the 2001 CHIS, were analyzed in 2007–2008. Results Geographic clusters of significantly high or low prevalence of walking and biking were detected in LAC and SDC. Structural variables such as street connectivity and shorter block lengths are consistently associated with higher levels of active transportation, but associations between active transportation and socioeconomic variables at the individual and neighborhood levels are mixed. Only one cluster with less time spent walking and biking among walkers/bikers was detected in LAC, and this was of borderline significance. Age-adjustment affects the clustering pattern of walking/biking prevalence in LAC, but not in SDC. Conclusions The use of spatial scan statistics to identify significant clustering of health behaviors such as active transportation adds to the more traditional regression analysis that examines associations between behavior and environmental factors by identifying specific geographic areas with unusual levels of the behavior independent of predefined administrative units. PMID:19589451
Aznar-Moreno, Jose A; Venegas Calerón, Mónica; Martínez-Force, Enrique; Garcés, Rafael; Mullen, Robert; Gidda, Satinder K; Salas, Joaquín J
2014-03-01
Long chain fatty acid synthetases (LACSs) activate the fatty acid chains produced by plastidial de novo biosynthesis to generate acyl-CoA derivatives, important intermediates in lipid metabolism. Oilseeds, like sunflower, accumulate high levels of triacylglycerols (TAGs) in their seeds to nourish the embryo during germination. This requires that sunflower seed endosperm supports very active glycerolipid synthesis during development. Sunflower seed plastids produce large amounts of fatty acids, which must be activated through the action of LACSs, in order to be incorporated into TAGs. We cloned two different LACS genes from developing sunflower endosperm, HaLACS1 and HaLACS2, which displayed sequence homology with Arabidopsis LACS9 and LACS8 genes, respectively. These genes were expressed at high levels in developing seeds and exhibited distinct subcellular distributions. We generated constructs in which these proteins were fused to green fluorescent protein and performed transient expression experiments in tobacco cells. The HaLACS1 protein associated with the external envelope of tobacco chloroplasts, whereas HaLACS2 was strongly bound to the endoplasmic reticulum. Finally, both proteins were overexpressed in Escherichia coli and recovered as active enzymes in the bacterial membranes. Both enzymes displayed similar substrate specificities, with a very high preference for oleic acid and weaker activity toward stearic acid. On the basis of our findings, we discuss the role of these enzymes in sunflower oil synthesis. © 2013 Scandinavian Plant Physiology Society.
Cigarette smoke induces the expression of Notch3, not Notch1, protein in lung adenocarcinoma.
Cheng, Zhenshun; Tan, Qiuyue; Tan, Weijun; Zhang, L I
2015-08-01
The aim of the present study was to determine the effect of cigarette smoke on the expression of Notch proteins in lung adenocarcinoma (LAC). Protein expression levels of Notch1 and Notch3 were analyzed using immunohistochemistry in 102 human LAC specimens. Of these, 52 were obtained from smokers and 50 from non-smokers. In addition, cigarette smoke extract (CSE) at varying concentrations (1, 2.5 and 5%) was administered to A549 cells. The expression of Notch1 and Notch3 protein was then detected by western blot analysis at different time points (0, 8, 24 and 48 h). Of the 102 LAC specimens, 42 (41.2%) were positive for Notch1 and 63 (61.8%) were positive for Notch3. There was no significant difference in the level of Notch1 expression between smokers and non-smokers with LAC (P>0.05). The positive rate and staining intensity of Notch3 expression were increased in the smokers compared with the non-smokers (P<0.05). The expression of Notch3 protein in A549 cells increased in a time- and dose-dependent manner following treatment with CSE, whilst the expression of Notch1 protein appeared stable. The results suggested that cigarette smoke was able to induce the expression of Notch3, not Notch1, protein in LAC. The data revealed an upregulation of Notch3 in LAC following cigarette smoke exposure. Such findings may provide a novel therapeutic target for the treatment of LAC.
A structural model for the osmosensor, transporter, and osmoregulator ProP of Escherichia coli.
Wood, Janet M; Culham, Doreen E; Hillar, Alexander; Vernikovska, Yaroslava I; Liu, Feng; Boggs, Joan M; Keates, Robert A B
2005-04-19
Transporter ProP of Escherichia coli, a member of the major facilitator superfamily (MFS), acts as an osmosensor and an osmoregulator in cells and after purification and reconstitution in proteoliposomes. H(+)-osmoprotectant symport via ProP is activated when medium osmolality is elevated with membrane impermeant osmolytes. The three-dimensional structure of ProP was modeled with the crystal structure of MFS member GlpT as a template. This GlpT structure represents the inward (or cytoplasm)-facing conformation predicted by the alternating access model for transport. LacZ-PhoA fusion analysis and site-directed fluorescence labeling substantiated the membrane topology and orientation predicted by this model and most hydropathy analyses. The model predicts the presence of a proton pathway within the N-terminal six-helix bundle of ProP (as opposed to the corresponding pathway found within the C-terminal helix bundle of its paralogue, LacY). Replacement of residues within the N-terminal helix bundle impaired the osmotic activation of ProP, providing the first indication that residues outside the C-terminal domain are involved in osmosensing. Some residues that were accessible from the periplasmic side, as predicted by the structural model, were more susceptible to covalent labeling in permeabilized membrane fractions than in intact bacteria. These residues may be accessible from the cytoplasmic side in structures not represented by our current model, or their limited exposure in vivo may reflect constraints on transporter structure that are related to its osmosensory mechanism.
The statistics of gravitational lenses. III - Astrophysical consequences of quasar lensing
NASA Technical Reports Server (NTRS)
Ostriker, J. P.; Vietri, M.
1986-01-01
The method of Schmidt and Green (1983) for calculating the luminosity function of quasars is combined with gravitational-lensing theory to compute expected properties of lensed systems. Multiple quasar images produced by galaxies are of order 0.001 of the observed quasars, with the numbers over the whole sky calculated to be (0.86, 120, 1600) to limiting B magnitudes of (16, 19, 22). The amount of 'false evolution' is small except for an interesting subset of apparently bright, large-redshift objects for which minilensing by starlike objects may be important. Some of the BL Lac objects may be in this category, with the galaxy identified as the parent object really a foreground object within which stars have lensed a background optically violent variable quasar.
ERIC Educational Resources Information Center
Goettsch, Marieke; Mateo Diaz, Mercedes; Canete, Nicolas
2018-01-01
One of the main objectives of the Inter-American Development Bank (IDB) is to improve the lives of people in the Latin America and Caribbean (LAC) region by reducing inequality. In 2008, the IDB's Division of Competitiveness, Technology and Innovation (CTI) developed the Innovation Lab (I-Lab), which falls under the umbrella of a growing set of…
Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst
Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj; ...
2015-08-17
We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less
Long Term Observations of B2 1215+30 with VERITAS
NASA Astrophysics Data System (ADS)
Aliu, E.; Archambault, S.; Arlen, T.; Aune, T.; Beilicke, M.; Benbow, W.; Bird, R.; Bouvier, A.; Buckley, J. H.; Bugaev, V.; Cesarini, A.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dumm, J.; Errando, M.; Falcone, A.; Federici, S.; Feng, Q.; Finley, J. P.; Fortin, P.; Fortson, L.; Furniss, A.; Galante, N.; Gérard, L.; Gillanders, G. H.; Griffin, S.; Grube, J.; Gyuk, G.; Hanna, D.; Holder, J.; Hughes, G.; Humensky, T. B.; Kaaret, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krawczynski, H.; Krennrich, F.; Lang, M. J.; Madhavan, A. S.; Maier, G.; Majumdar, P.; McArthur, S.; McCann, A.; Moriarty, P.; Mukherjee, R.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Orr, M.; Otte, A. N.; Park, N.; Perkins, J. S.; Pohl, M.; Popkow, A.; Prokoph, H.; Quinn, J.; Ragan, K.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Saxon, D. B.; Sembroski, G. H.; Skole, C.; Smith, A. W.; Soares-Furtado, M.; Staszak, D.; Telezhinsky, I.; Tešić, G.; Theiling, M.; Varlotta, A.; Vassiliev, V. V.; Vincent, S.; Wakely, S. P.; Weekes, T. C.; Weinstein, A.; Welsing, R.; Williams, D. A.; Zitzer, B.; VERITAS Collaboration; Böttcher, M.; Fumagalli, M.; Jadhav, J.
2013-12-01
We report on VERITAS observations of the BL Lac object B2 1215+30 between 2008 and 2012. During this period, the source was detected at very high energies (VHEs; E > 100 GeV) by VERITAS with a significance of 8.9σ and showed clear variability on timescales larger than months. In 2011, the source was found to be in a relatively bright state and a power-law fit to the differential photon spectrum yields a spectral index of 3.6 ± 0.4stat ± 0.3syst with an integral flux above 200 GeV of (8.0 ± 0.9stat ± 3.2syst) × 10-12 cm-2 s-1. No short term variability could be detected during the bright state in 2011. Multi-wavelength data were obtained contemporaneously with the VERITAS observations in 2011 and cover optical (Super-LOTIS, MDM, Swift/UVOT), X-ray (Swift/XRT), and gamma-ray (Fermi-LAT) frequencies. These were used to construct the spectral energy distribution (SED) of B2 1215+30. A one-zone leptonic model is used to model the blazar emission and the results are compared to those of MAGIC from early 2011 and other VERITAS-detected blazars. The SED can be reproduced well with model parameters typical for VHE-detected BL Lac objects.
Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj
We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less
MULTI-WAVELENGTH STUDY OF FLARING ACTIVITY IN BL Lac OBJECT S5 0716+714 DURING THE 2015 OUTBURST
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chandra, Sunil; Kushwaha, Pankaj; Singh, K. P.
We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. The rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less
NASA Technical Reports Server (NTRS)
Kondo, Y.; Worrall, D. M.; Oke, J. B.; Yee, H. K. C.; Neugebauer, G.; Matthews, K.; Feldman, P. A.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. R. H.
1981-01-01
Observations in the X-ray, UV, visible, IR and radio regions of the BL Lac object Mrk 501 made over the course of two months are reported. The measurements were made with the A2 experiment on HEAO 1 (X-ray), the SWP and LWR cameras on IUE (UV), the 5-m Hale telescope (visible), the 2.5-m telescope at Mount Wilson (IR), the NRAO 92-m radio telescope at Green Bank (4750 MHz) and the 46-m radio telescope at the Algonquin Observatory (10275 and 10650 MHz). The quasi-simultaneously observed spectral slope is found to be positive and continuous from the X-ray to the UV, but to gradually flatten and possibly turn down from the mid-UV to the visible; the optical-radio emission cannot be accounted for by a single power law. The total spectrum is shown to be compatible with a synchrotron self-Compton emission mechanism, while the spectrum from the visible to the X-ray is consistent with synchrotron radiation or inverse-Compton scattering by a hot thermal electron cloud. The continuity of the spectrum from the UV to the X-ray is noted to imply a total luminosity greater than previous estimates by a factor of 3-4.
Fukazawa, Yasushi; Finke, Justin; Stawarz, Łukasz; ...
2014-12-24
Here, we performed a systematic X-ray study of eight nearby γ-ray bright radio galaxies with Suzaku in order to understand the origins of their X-ray emissions. The Suzaku spectra for five of those have been presented previously, while the remaining three (M87, PKS 0625–354, and 3C 78) are presented here for the first time. Based on the Fe-K line strength, X-ray variability, and X-ray power-law photon indices, and using additional information on the [O III] line emission, we argue for a jet origin of the observed X-ray emission in these three sources. We also analyzed five years of Fermi Largemore » Area Telescope (LAT) GeV gamma-ray data on PKS 0625–354 and 3C 78 to understand these sources within the blazar paradigm. We found significant γ-ray variability in the former object. Overall, we note that the Suzaku spectra for both PKS 0625–354 and 3C 78 are rather soft, while the LAT spectra are unusually hard when compared with other γ-ray detected low-power (FR I) radio galaxies. We demonstrate that the constructed broadband spectral energy distributions of PKS 0625–354 and 3C 78 are well described by a one-zone synchrotron/synchrotron self-Compton model. The results of the modeling indicate lower bulk Lorentz factors compared to those typically found in other BL Lacertae (BL Lac) objects, but consistent with the values inferred from modeling other LAT-detected FR I radio galaxies. Interestingly, the modeling also implies very high peak (~10 16 Hz) synchrotron frequencies in the two analyzed sources, contrary to previously suggested scenarios for Fanaroff-Riley (FR) type I/BL Lac unification. Finally, we discuss the implications of our findings in the context of the FR I/BL Lac unification schemes.« less
40 CFR 272.951 - Louisiana State-administered program: Final authorization.
Code of Federal Regulations, 2010 CFR
2010-07-01
..., 1997. Copies of the document can be obtained from EPA Region 6, 1445 Ross Avenue, Dallas, Texas 75202... November 20, 1988 LR 18:1375 December 20, 1992. LAC § 303.K.1 (previously LHWR § 3.2(k)(1)) July 20, 1984 LR 14:790 November 20, 1988. LAC § 901 (LHWR § 6.1) March 20, 1984 LR 20:1000 September 20, 1994. LAC...
Husser, Oliver; Fujita, Buntaro; Hengstenberg, Christian; Frerker, Christian; Beckmann, Andreas; Möllmann, Helge; Walther, Thomas; Bekeredjian, Raffi; Böhm, Michael; Pellegrini, Costanza; Bleiziffer, Sabine; Lange, Rüdiger; Mohr, Friedrich; Hamm, Christian W; Bauer, Timm; Ensminger, Stephan
2018-03-26
The aims of this study were to report on the use of local anesthesia or conscious sedation (LACS) and general anesthesia in transcatheter aortic valve replacement and to analyze the impact on outcome. Transcatheter aortic valve replacement can be performed in LACS or general anesthesia. Potential benefits of LACS, such as faster procedures and shorter hospital stays, need to be balanced with safety. A total of 16,543 patients from the German Aortic Valve Registry from 2011 to 2014 were analyzed, and propensity-matched analyses were performed to correct for potential selection bias. LACS was used in 49% of patients (8,121 of 16,543). In hospital, LACS was associated with lower rates of low-output syndrome, respiratory failure, delirium, cardiopulmonary resuscitation, and death. There was no difference in paravalvular leakage (II+) between LACS and general anesthesia in the entire population (5% vs. 4.8%; p = 0.76) or in the matched population (3.9% vs. 4.9%, p = 0.13). The risk for prolonged intensive care unit stay (≥3 days) was significantly reduced with LACS (odds ratio: 0.82; 95% confidence interval [CI]: 0.73 to 0.92; p = 0.001). Thirty-day mortality was lower with LACS in the entire population (3.5% vs. 4.9%; hazard ratio [HR]: 0.72; 95% CI: 0.60 to 0.86; p < 0.001) and in the matched population (2.8% vs. 4.6%; HR: 0.6; 95% CI: 0.45 to 0.8; p < 0.001). However, no differences in 1-year mortality between both groups in the entire population (16.5% vs. 16.9%; HR: 0.93; 95% CI: 0.85 to 1.02; p = 0.140) and in the propensity-matched population (14.1% vs. 15.5%; HR: 0.90; 95% CI: 0.78 to 1.03; p = 0.130) were observed. Use of LACS in transcatheter aortic valve replacement is safe, with fewer post-procedural complications and lower early mortality, suggesting its broad application. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Analysis of Microvariable Activity of BL Lacertae
NASA Astrophysics Data System (ADS)
Sadun, Alberto C.; Asadi-Zeydabadi, Masoud; Hindman, Lauren; Moody, J. Ward
2018-06-01
BL Lac is a low-frequency peaked blazar (LBL) which emits synchrotron radiation at near-IR and optical wavelengths. Therefore optical observations are helpful in, among other things, studying the acceleration and cooling timescales of the electrons in the relativistic jets. We have made very high cadence observations of BL Lac over a number of nights with the Remote Observatory for Variable Object Research (ROVOR). Each night shows secular drift as well as a number of microvariable events lasting only a few minutes each. These data were then processed, compiled, and analyzed in order to examine the underlying mechanism that resulted in such activity. A geometric model is introduced that has worked well in the past on other similar sources.Our relativistic jet model consists of a slowly varying beamed source that already appears bright because it lies nearly to our line of sight. From this, individual relativistic components are ejected a few degrees relative to the aforementioned beaming angle. This is what we believe is responsible for the microvariability emission.
Kepler Observations of Rapid Optical Variability in the BL Lac Object W2r192+42
NASA Technical Reports Server (NTRS)
R.Edelson; Mushotzky, R.; Vaughn, S.; Scargle, J.; Gandhi, P.; Malkan, M.; Baumgartner, W.
2013-01-01
We present the first Kepler monitoring of a strongly variable BL Lac, W2R1926+42. The light curve covers 181 days with approx. 0.2% errors, 30 minute sampling and >90% duty cycle, showing numerous delta-I/I > 25% flares over timescales as short as a day. The flux distribution is highly skewed and non-Gaussian. The variability shows a strong rms-flux correlation with the clearest evidence to date for non-linearity in this relation. We introduce a method to measure periodograms from the discrete autocorrelation function, an approach that may be well-suited to a wide range of Kepler data. The periodogram is not consistent with a simple power-law, but shows a flattening at frequencies below 7x10(exp -5) Hz. Simple models of the power spectrum, such as a broken power law, do not produce acceptable fits, indicating that the Kepler blazar light curve requires more sophisticated mathematical and physical descriptions than currently in use.
Chandrasekaran, E V; Chawda, Ram; Locke, Robert D; Piskorz, Conrad F; Matta, Khushi L
2002-03-01
Prostate carcinoma LNCaP cells were unique among several human cancer cell lines which include two other prostate cancer cell lines, PC-3 and DU-145, in expressing alpha1,2-L-fucosyltransferase (FT) as an exclusive FT activity. Affinity gel-GDP and Sephacryl S100 HR columns were used for a partial purification of this enzyme from 3.9 x 10(9) LNCaP cells (approximately 200-fold; 40% yield). The K(m) value (2.7 mM) for the LacNAc type 2 acceptor was quite similar to the one reported for the cloned blood group H gene-specified alpha1,2-FT [Chandrasekaran et al. (1996) Biochemistry 35, 8914-8924]. N-Ethylmaleimide was a potent inhibitor (K(i ) 12.5 microM). The enzyme showed four-fold acceptor preference for the LacNAc type 2 unit in comparison to the T-hapten in mucin core 2 structure. Its main features were similar to those of the cloned enzyme: (1) C-6 sulfation of terminal Gal in the LacNAc unit increased the acceptor efficiency, whereas C-6 sialylation abolished acceptor ability; (2) C-6 sulfation of GlcNAc in LacNAc type 2 decreased by 80% the acceptor ability, whereas LacNAc type 1 was unaffected; (3) Lewis x did not serve as an acceptor; (4) the C-4 hydroxyl rather than the C-6 hydroxyl group of the GlcNAc moiety in LacNAc type1 was essential for activity; and (5) the acrylamide copolymer of Galbeta1,3GlcNAcbeta-O-Al was the best acceptor among the acrylamide copolymers. Additionally, highly significant biological features of alpha1,2FT were identified in the present study. The synthesis of Globo H and Lewis b determinants became evident from the fact that Galbeta1,3GalNAcbeta1,3Galalpha-O-Me and Galbeta1,3(Fucalpha1,4)Glc-NAcbeta1,3Galbeta-O-Me served as high-affinity acceptors for this enzyme. Further, D-Fucbeta1,3Gal-NAcbeta1,3Galalpha-O-Me was a very efficient acceptor, indicating that the C-6 hydroxyl group of the terminal Gal moiety in Globo H is not essential for the enzyme activity. Thus, the present study was able to demonstrate three different catalytic roles of LNCaP alpha1,2-FT, namely, the expressions of blood group H, Lewis b from Lewis a, and Globo H.
Li, Juan; Tao, Shujuan; Orlando, Ron; Murtaugh, Michael P.
2015-01-01
Porcine reproductive and respiratory syndrome virus (PRRSV) is a positive-sense ssRNA virus whose envelope contains four glycoproteins and three nonglycosylated proteins. Glycans of major envelope glycoprotein 5 (GP5) are proposed as important for virus assembly and entry into permissive cells. Structural characterization of GP5 glycans would facilitate the mechanistic understanding of these processes. Thus, we purified the PRRSV type 2 prototype strain, VR2332, and analyzed the virion-associated glycans by both biochemical and mass spectrometric methods. Endoglycosidase digestion showed that GP5 was the primary protein substrate, and that the carbohydrate moieties were primarily complex-type N-glycans. Mass spectrometric analysis (HPLC-ESI-MS/MS) of GP5 N-glycans revealed an abundance of N-acetylglucosamine (GlcNAc) and N-acetyllactosamine (LacNAc) oligomers in addition to sialic acids. GlcNAc and LacNAc accessibility to ligands was confirmed by lectin co-precipitation. Our findings help to explain PRRSV infection of cells lacking sialoadhesin and provide a glycan database to facilitate molecular structural studies of PRRSV. PMID:25726973
Mitchell, J M; Yee, A J; McNab, W B; Griffiths, M W; McEwen, S A
1999-01-01
LacTek tests are competitive enzyme-linked immunosorbent assays intended for rapid detection of antimicrobial residues in bovine milk. In this study, the LacTek test protocol was modified for use with extracts of bovine tissue to detect beta-lactam, tetracycline, and sulfamethazine residues. Test performance characteristics--precision, accuracy, ruggedness, practicability, and analytical specificity and sensitivity--were investigated. Results suggest that LacTek tests can be easily adapted to detect antimicrobial residues in extracts of lean ground beef. However, positive samples may not contain residues at violative concentrations (i.e., Canadian maximum residue limits), and therefore, additional analysis would be required for final confirmation and quantitation (e.g., chromatography).
High density growth of T7 expression strains with auto-induction option
Studier, F. William
2010-07-20
A bacterial growth medium for promoting auto-induction of transcription of cloned DNA in cultures of bacterial cells grown batchwise is disclosed. The transcription is under the control of a lac repressor. Also disclosed is a bacterial growth medium for improving the production of a selenomethionine-containing protein or polypeptide in a bacterial cell, the protein or polypeptide being produced by recombinant DNA techniques from a lac or T7lac promoter, the bacterial cell encoding a vitamin B12-dependent homocysteine methylase. Finally, disclosed is a bacterial growth medium for suppressing auto-induction of expression in cultures of bacterial cells grown batchwise, said transcription being under the control of lac repressor.
Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat
2014-01-01
Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727
Liu, Yujie; Liu, Zhifeng; Zeng, Guangming; Chen, Ming; Jiang, Yilin; Shao, Binbin; Li, Zhigang; Liu, Yang
2018-05-22
Some surfactants can enhance the removal of phenol by laccase (Lac) in various industrial effluents. Their behavior and function in the biodegradation of phenolic wastewater have been experimentally reported by many researchers, but the underlying molecular mechanism is still unclear. Therefore, the interaction mechanisms of phenol with Lac from Trametes versicolor were investigated in the presence or absence of Triton X-100 (TX100) or rhamnolipid (RL) by molecular docking and molecular dynamics (MD) simulations. The results indicate that phenol contacts with an active site of Lac by hydrogen bonds (HBs) and van der Waals (vdW) interactions in aqueous solution for maintaining its stability. The presence of TX100 or RL results in the significant changes of enzymatic conformations. Meanwhile, the hydrophobic parts of surfactants contact with the outside surface of Lac. These changes lead to the decrease of binding energy between phenol and Lac. The migration behavior of water molecules within hydration shell is also inevitably affected. Therefore, the amphipathic TX100 or RL may influence the phenol degradation ability of Lac by modulating their interactions and water environment. This study offers molecular level of understanding on the function of surfactants in biosystem. Copyright © 2018 Elsevier B.V. All rights reserved.
Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong
2011-02-01
Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.
Enhanced delignification of steam-pretreated poplar by a bacterial laccase
Singh, Rahul; Hu, Jinguang; Regner, Matthew R.; ...
2017-02-07
The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less
Involvement of glycosphingolipid-enriched lipid rafts in inflammatory responses.
Iwabuchi, Kazuhisa
2015-01-01
Glycosphingolipids (GSLs) are membrane components consisting of hydrophobic ceramide and hydrophilic sugar moieties. GSLs cluster with cholesterol in cell membranes to form GSL-enriched lipid rafts. Biochemical analyses have demonstrated that GSL-enriched lipid rafts contain several kinds of transducer molecules, including Src family kinases. Among the GSLs, lactosylceramide (LacCer, CDw17) can bind to various microorganisms, is highly expressed on the plasma membranes of human phagocytes, and forms lipid rafts containing the Src family tyrosine kinase Lyn. LacCer-enriched lipid rafts mediate immunological and inflammatory reactions, including superoxide generation, chemotaxis, and non-opsonic phagocytosis. Therefore, LacCer-enriched membrane microdomains are thought to function as pattern recognition receptors (PRRs), which recognize pathogen-associated molecular patterns (PAMPs) expressed on microorganisms. LacCer also serves as a signal transduction molecule for functions mediated by CD11b/CD18-integrin (αM/β2-integrin, CR3, Mac-1), as well as being associated with several key cellular processes. LacCer recruits PCKα/ε and phospholipase A2 to stimulate PECAM-1 expression in human monocytes and their adhesion to endothelial cells, as well as regulating β1-integrin clustering and endocytosis on cell surfaces. This review describes the organizational and inflammation-related functions of LacCer-enriched lipid rafts.
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Enhanced delignification of steam-pretreated poplar by a bacterial laccase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Rahul; Hu, Jinguang; Regner, Matthew R.
The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less
Yu, Yang; Li, Quan-Feng; Zhang, Jin-Ping; Zhang, Fan; Zhou, Yan-Fei; Feng, Yan-Zhao; Chen, Yue-Qin; Zhang, Yu-Chan
2017-01-01
Seed setting rate is one of the most important components of rice grain yield. To date, only several genes regulating setting rate have been identified in plant. In this study, we showed that laccase-13 ( OsLAC13 ), a member of laccase family genes which are known for their roles in modulating phenylpropanoid pathway and secondary lignification in cell wall, exerts a regulatory function in rice seed setting rate. OsLAC13 expressed in anthers and promotes hydrogen peroxide production both in vitro and in the filaments and anther connectives. Knock-out of OsLAC13 showed significantly increased seed setting rate, while overexpression of this gene exhibited induced mitochondrial damage and suppressed sugar transportation in anthers, which in turn affected seed setting rate. OsLAC13 also induced H 2 O 2 production and mitochondrial damage in the root tip cells which caused the lethal phenotype. We also showed that high abundant of OsmiR397, the suppressor of OsLAC13 mRNA, increased the seed setting rate of rice plants, and restrains H 2 O 2 accumulation in roots during oxidative stress. Our results suggested a novel regulatory role of OsLAC13 gene in regulating seed setting rate by affecting H 2 O 2 dynamics and mitochondrial integrity in rice.
Zhao, J.; Kwan, H. S.
1999-01-01
The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802
Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi
2015-01-01
In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808
Two Gene Clusters Coordinate Galactose and Lactose Metabolism in Streptococcus gordonii
Zeng, Lin; Martino, Nicole C.
2012-01-01
Streptococcus gordonii is an early colonizer of the human oral cavity and an abundant constituent of oral biofilms. Two tandemly arranged gene clusters, designated lac and gal, were identified in the S. gordonii DL1 genome, which encode genes of the tagatose pathway (lacABCD) and sugar phosphotransferase system (PTS) enzyme II permeases. Genes encoding a predicted phospho-β-galactosidase (LacG), a DeoR family transcriptional regulator (LacR), and a transcriptional antiterminator (LacT) were also present in the clusters. Growth and PTS assays supported that the permease designated EIILac transports lactose and galactose, whereas EIIGal transports galactose. The expression of the gene for EIIGal was markedly upregulated in cells growing on galactose. Using promoter-cat fusions, a role for LacR in the regulation of the expressions of both gene clusters was demonstrated, and the gal cluster was also shown to be sensitive to repression by CcpA. The deletion of lacT caused an inability to grow on lactose, apparently because of its role in the regulation of the expression of the genes for EIILac, but had little effect on galactose utilization. S. gordonii maintained a selective advantage over Streptococcus mutans in a mixed-species competition assay, associated with its possession of a high-affinity galactose PTS, although S. mutans could persist better at low pHs. Collectively, these results support the concept that the galactose and lactose systems of S. gordonii are subject to complex regulation and that a high-affinity galactose PTS may be advantageous when S. gordonii is competing against the caries pathogen S. mutans in oral biofilms. PMID:22660715
Lorenzo, José M; Fonseca, Sonia
2014-11-01
Dry-cured 'lacón' is a traditional cured meat product made in the north-west of Spain from the pigs' foreleg, with similar manufacturing process to that used in dry-cured ham. The aim of this study was to assess the influence of cross-breeding of Celta pig with Landrace or Duroc breeds on the formation of volatile compounds through the manufacture of 'lacón'. 'Lacón' from the crosses with Duroc presented lower final moisture (534 g kg(-1) ) and higher intra-muscular fat content [144 g kg(-1) dry matter (DM)] than 'lacón' from Celta pure breed (587 g kg(-1) and 36 g kg(-1) DM, respectively). Volatile compounds were extracted by solid-phase microextraction and analysed by gas chromatography-mass spectrometry. Volatile compounds from 'lacón' were affected by cross-breeding. The total amount of volatile compounds significantly (P < 0.001) increased during the manufacturing process, this increase being more marked in samples from the Landrace cross-breed. The most abundant group of flavour compounds at the end of the manufacturing process was esters in the three batches, followed by aldehydes, hydrocarbons and alcohols. The most abundant ester at the end of the process was hexanoic acid methyl ester, while the aldehyde found in a higher amount was hexanal. The profile of volatile compounds was affected by cross-breed, especially at the end of the 'lacón' dry-curing process. © 2014 Society of Chemical Industry.
Johnson, Philip L; Fitz, Stephanie D; Engleman, Eric A; Svensson, Kjell A; Schkeryantz, Jeffrey M; Shekhar, Anantha
2015-01-01
Rats with chronic inhibition of GABA synthesis by infusion of l-allyglycine, a glutamic acid decarboxylase inhibitor, into their dorsomedial/perifornical hypothalamus are anxious and exhibit panic-like cardio-respiratory responses to treatment with intravenous (i.v.) sodium lactate (NaLac) infusions, in a manner similar to what occurs in patients with panic disorder. We previously showed that either NMDA receptor antagonists or metabotropic glutamate receptor type 2/3 receptor agonists can block such a NaLac response, suggesting that a glutamate mechanism is contributing to this panic-like state. Using this animal model of panic, we tested the efficacy of CBiPES and THIIC, which are selective group II metabotropic glutamate type 2 receptor allosteric potentiators (at 10–30mg/kg i.p.), in preventing NaLac-induced panic-like behavioral and cardiovascular responses. The positive control was alprazolam (3mg/kg i.p.), a clinically effective anti-panic benzodiazepine. As predicted, panic-prone rats given a NaLac challenge displayed NaLac-induced panic-like cardiovascular (i.e. tachycardia and hypertensive) responses and “anxiety” (i.e. decreased social interaction time) and “flight” (i.e. increased locomotion) -associated behaviors; however, systemic injection of the panic-prone rats with CBiPES, THIIC or alprazolam prior to the NaLac dose blocked all NaLac-induced panic-like behaviors and cardiovascular responses. These data suggested that in a rat animal model, selective group II metabotropic glutamate type 2 receptor allosteric potentiators show an anti-panic efficacy similar to alprazolam. PMID:22914798
Imamura, Naoko; Horikoshi, Yosuke; Matsuzaki, Tomohiko; Toriumi, Kentaro; Kitatani, Kanae; Ogura, Go; Masuda, Ryota; Nakamura, Naoya; Takekoshi, Susumu; Iwazaki, Masayuki
2013-12-20
Atypical protein kinase C lambda/iota (aPKC λ/ι) is expressed in several human cancers; however, the correlation between aPKC λ/ι localization and cancer progression in human lung adenocarcinoma (LAC) remains to be clarified. We found that patients with a high level of aPKC λ/ι expression in LAC had significantly shorter overall survival than those with a low level of aPKC λ/ι expression. In addition, localization of aPKC λ/ι in the apical membrane or at the cell-cell contact was associated with both lymphatic invasion and metastasis. The intercellular adhesion molecule, E-cadherin, was decreased in LACs with highly expressed aPKC λ/ι at the invasion site of tumor cells. This result suggested that the expression levels of aPKC λ/ι and E-cadherin reflect the progression of LAC. On double-immunohistochemical analysis, aPKC λ/ι and Lgl2, a protein that interacts with aPKC λ/ι, were co-localized within LACs. Furthermore, we found that Lgl2 bound the aPKC λ/ι-Par6 complex in tumor tissue by immune-cosedimentation analysis. Apical membrane localization of Lgl2 was correlated with lymphatic invasion and lymph node metastasis. These results thus indicate that aPKC λ/ι expression is altered upon the progression of LAC. This is also the first evidence to show aPKC λ/ι overexpression in LAC and demonstrates that aPKC λ/ι localization at the apical membrane or cell-cell contact is associated with lymphatic invasion and metastasis of the tumor.
Malaguarnera, Mariano; Risino, Corrado; Cammalleri, Lisa; Malaguarnera, Lucia; Astuto, Marinella; Vecchio, Ignazio; Rampello, Liborio
2009-07-01
Our earlier study has demonstrated that the administration of L-acetylcarnitine (LAC) improves neurological symptoms and serum parameters in hepatic coma. The aim of this work has been to evaluate the efficacy of the LAC and branched chain amino acids (BCAA) versus BCAA, administered in intravenous infusion, in patients with cirrhotic hepatic coma. Forty-eight highly selected patients were enrolled in the study and, after randomization, received blindly LAC+BCAA (n=24) versus BCAA (n=24). The two groups were similar in age, sex, pathogenesis of cirrhosis, and severity of liver disease. The comparison between values before and after LAC planned treatment showed statistical significant differences in neurological findings, evaluated by the Glasgow Scale, ammonia serum levels, blood urea nitrogen, and EEG. After 60 min of the study period, the LAC+BCAA treated patients compared with BCCA treated showed a significant decrease of ammonia serum levels: 41.20 versus 10.40 mumol P<0.05. After 1 day of the study period, the LAC+BCAA treated patients compared with BCCA treated patients showed a significant increase of Glasgow's score: 3.60 versus 1.50 score P<0.05; a significant decrease of ammonia serum levels: 63.30 versus 27.00 mumol P<0.01; a significant improvement of EEG cps/s: 2.70 versus 0.6 P<0.001. No side-effects were observed in our study series. Our study demonstrated that the administration of BCAA supplemented with LAC might improve neurological symptoms and serum ammonium levels in selected cirrhotic patients with hepatic coma.
NASA Astrophysics Data System (ADS)
Maloney, A. E.; Hing, S. N.; Richey, J. N.; Nelson, D. B.; Sachs, J. P.
2017-12-01
The South Pacific Convergence Zone (SPCZ) is the Southern Hemisphere's largest precipitation feature, yet little is known about the region's rainfall prior to the instrumental record. In the tropics, hydrogen isotopes of precipitation are controlled by the "amount effect" where higher mean annual rainfall rates result in 2H-depleted rain. In turn, hydrogen isotopes in tropical lakes are influenced by both rain water isotopes and evaporative enrichment. Molecular fossils preserved in lake sediments offer a promising tool for improving our understanding of the past SPCZ by tracking changes in lake water isotopes. Hydrogen isotope compositions (δ2H) of the algal lipid biomarker dinosterol were measured in duplicate sediment cores from lakes 2.75km apart on Wallis Island. The modern lakes differ in physical and chemical conditions but are both freshwater in the photic zone and experience identical climate conditions. They are an ideal setting to investigate the fidelity to which δ2Hdinosterol records climate. Duplicate records from Lac Lanutavake are in excellent agreement and reveal little change in during the past 1700 years with minor δ2Hdinosterol fluctuations between -280‰ and -290‰. Duplicate records from Lac Lalolalo also agree extremely well during the past 2,000 years. However, contrary to its neighbor, Lac Lalolalo has a highly variable δ2Hdinosterol history with 2H-depleted values of -300‰ during the youngest part of the record climbing to 2H-enriched values of -230‰ around 1000-2000 years ago. The large shift in Lac Lalolalo δ2Hdinosterol may be due to changes in lake biogeochemistry that impact growth conditions or shifts in dinoflagellate species composition. Alternatively, if the Lac Lalolalo record actually reflects changes in hydrology, large limnological changes must have occurred in Lac Lanutavke to mute the climate signal. This work emphasizes the importance of redundancy and duplication when investigating changes in past climate using molecular tools that are also sensitive to environmental parameters.
NASA Astrophysics Data System (ADS)
Ajtai, Tibor; Pinter, Mate; Utry, Noemi; Kiss-Albert, Gergely; Palagyi, Andrea; Manczinger, Laszlo; Vagvölgyi, Csaba; Szabo, Gabor; Bozoki, Zoltan
2016-04-01
In this study we present results of field measurement campaigns focusing on the in-situ characterization of absorption spectra and the health relevance of light absorbing carbonaceous (LAC) in the ambient. The absorption spectra is measured @ 266, 355, 532 and 1064 nm by our state-of-the-art four-wavelength photoacoustic instrument, while for health relevance the eco- cito and genotoxicity parameters were measured using standardized methodologies. We experimentally demonstrated a correlation between the toxicities and the measured absorption spectra quantified by its wavelength dependency. Based on this correlation, we present novel possibilities on real-time air quality monitoring. LAC is extensively studied not only because of its considerable climate effects but as a serious air pollutant too. Gradually increasing number of studies demonstrated experimentally that the health effect of LAC is more serious than it is expected based on its share in total atmospheric aerosol mass. Furthermore during many local pollution events LAC not only has dominancy but it is close to exclusivity. Altogether due to its climate and health effects many studies and proposed regulations focus on the physical, chemical and toxicological properties of LAC as well as on its source apportionment. Despites of its importance, there is not yet a widely accepted standard methodology for the real-time and selective identification of LAC. There are many different reasons of that: starting from its complex inherent physicochemical features including many unknown constituents, via masking effect of ambient on the inherent physicochemical properties taking place even in case of a short residence, ending with the lack of reliable instrumentation for its health or source relevant parameters. Therefore, the methodology and instrument development for selective and reliable identification of LAC is timely and important issues in climate and air quality researches. Recently, many studies demonstrated correlation between the chemical compositions and the absorption features of LAC which open up novel possibilities in real time source apportionment and in air quality monitoring.
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K
2013-01-01
The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Liu, Huiping; Zhu, Yanyun; Yang, Xiaorong; Lin, Ying
2018-05-01
The multicopper oxidases catalyze 1-electron oxidation of four substrate molecules and concomitantly 4-electron reduction of dioxygen to water. The substrate loses the electrons at the type 1 copper (T1 Cu) site of the enzyme, while the dioxygen is reduced to water at the trinuclear copper center. A highly conserved Glu residue, which is at the dioxygen-entering channel, shuttles the proton to break the O-O bond of dioxygen. At the water-leaving channel, an Asp residue was found to be important in the protonation mechanism. In this study, laccase from Thermus thermophilus SG0.5JP17-16 (lacTT) was investigated to address how four second-sphere residues E356, E456, D106, and D423 affect the activity of the enzyme. Kinetic data indicate that catalytic activities of the enzyme are altered by site-directed mutagenesis on four second-sphere residues. The structural model of lacTT was generated by homology modeling. Structural and spectral data indicate that the E356 residue is situated at the substrate-binding site, responsible for the binding of the substrate and the geometry of the T1 Cu site by hydrogen-bonding networks; the E456 residue, located at the dioxygen-entering channel, plays a critical role in stabilizing the structure of all active copper centers and shuttling the proton to the trinuclear copper cluster (TNC) for the reductive reaction of dioxygen; the D106 and D423 residues are at the water-leaving channel, and they are important for the essential geometry of the TNC and the release of the water molecules. Altogether, this study contributes to the further understanding of the basic mechanism involving the oxidation of the substrate, electron transfer, and the reduction of dioxygen in lacTT.
Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj
2012-10-23
Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L(-1) in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation.
2012-01-01
Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L-1 in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation. PMID:23092193
Statins: cost analysis in Indian scenario from eight major clinical trials.
Sanmukhani, J; Shah, V
2010-01-01
Coronary heart disease (CHD) is the leading cause of death in India resulting in loss of young Indians. Statins have proved to reduce the CHD mortality in various clinical trials. The aim of the study is to find the cost-effectiveness ratio (CER) for each major coronary event averted and a coronary death avoided by use of statins in different clinical settings based on the data from the major clinical trials on statins. Using electronic database and as per our inclusion and exclusion criteria we selected the West of Scotland Coronary Prevention Study (WOSCOPS), the Air Force Coronary Atherosclerosis Prevention Study (AFCAPS) and the Anglo-Scandinavian Cardiac Outcomes Trial--Lipid Lowering Arm (ASCOT-LLA) study for primary prevention; the Cholesterol and Recurrent Events Trial (CARE), the Long-term Intervention with Pravastatin in Ischemic Disease (LIPID) Study and the Scandinavian Simvastatin Survival Study (4S) for secondary prevention and two studies, the Heart Protection Study (HPS) and the Pravastatin in elderly individuals at risk of vascular disease (PROSPER) study for high-risk patients. The results of these studies were used for cost-effectiveness analysis of statins in different patient groups. Absolute risk reduction, Number Needed to Benefit (NNTB), NNTB/year for total sample and in subgroups of males, females and age >65 was derived. CER for branded and generic versions was calculated by using the prices of statins listed in Indian Drug Review Triple i. Cost-effectiveness ratio (CER) in primary prevention studies i.e., the WOSCOPS, the AFCAPS and the ASCOT-LLA was Rs. 25.8 lacs, Rs. 23.8 lacs and Rs. 7.9 lacs per major coronary event averted respectively. CER in secondary prevention studies i.e., the CARE and the LIPID was approximately Rs. 20 lacs per major coronary event averted while it was Rs. 52.4 lacs and Rs. 37 lacs per coronary heart disease (CHD) death avoided. CER from the 4S was Rs. 6.9 lacs per major coronary event and Rs. 16.9 lacs per CHD death averted. CER in the HPS and the PROSPER study was Rs. 17.9 lacs and Rs. 27.1 lacs per major coronary event avoided in high-risk patients. Cost associated with the use of statins is higher in primary prevention as compared to secondary prevention. More studies are needed to confirm the cost-effectiveness of statins to make any decision for health policy.
A-3 scientific results - extragalactic
NASA Technical Reports Server (NTRS)
Schwartz, D. A.
1979-01-01
The results of the HEAO A-3 experiment are summarized. Specific contributions of the experiment to extragalactic astronomy are emphasized. The discovery of relatively condensed X-ray emission in the cores of those clusters of galaxies which are dominated by a giant elliptical or cD galaxy, the discovery of extended X-ray emitting plasma in groups of galaxies, and the demonstration that BL Lac objects are a class of X-ray sources are among the topics discussed.
Ferrazzi, Paola; Colombo, Anna; Di Micco, Pierpaolo; Lodigiani, Corrado; Librè, Luca; Rota, Lidia Luciana; Montanelli, Alessandro; Quaglia, Ilaria
2010-01-01
A possible interference between lupus anticoagulant (LAC), a well characterized clotting inhibitor, in the International Normalized Ratio (INR) determination during oral anticoagulation (OA) has been reported in the literature. Few data are available about the relationship between this kind of interference and the daily clinical management of oral anticoagulation. The aim of the study is to evaluate the role of two different thromboplastins-RecombiPlasTin 2G and HepatoComplex-in the determination of INR values of several patients' ongoing OA for a previous thrombotic disorder with and without positivity to LAC, and to evaluate possible interferences in the daily therapeutic approach. We selected 16 patients (13 females and 3 males, mean age 59 ± 16 years) with LAC positivity ongoing OA and 11 control subjects (7 females and 4 males, mean age 58 ± 14.5 years) with similar characteristics (ie, ethnic background and weight) with LAC negativity ongoing OA. 165 assays for INR determination were analyzed from both groups. Statistical analysis was performed using STATA 10 software. P values were considered significant if <0.05. Mean values of INR for patients with LAC positivity were 3.79 ± 1.63 when tested with RecombiPlasTin 2G vs 3.18 ± 1.15 when tested with HepatoComplex (P < 0.001, s); while mean values of INR for patients with antiphospholipid syndrome (APS) with LAC negativity were 3.54 ± 1.39 when tested with RecombiPlasTin 2G vs 3.23 ± 1.14 when tested with HepatoComplex (P < 0.002, s). An INR value > than 4.5 was found in 31/165 samples in 9 subjects, 8 patients with LAC positivity, and 1 control group subject with LAC negativity. There was a great difference in INR values in these subjects if we use the common thromboplastin (ie, RecombiPlasTin 2G) with a INR range varying from 5.14 ± 0.35 vs 3.79 ± 0.38 if we use another thromboplastin (ie, HepatoComplex) (P < 0.001, s). A change in the therapeutic approach for OA is possible in these cases because different INR values were obtained using different thromboplastins. Our data confirm that INR evaluation does not reveal significant changes also if tested with two different thromboplastins, for patients ongoing OA with and without LAC positivity, when the INR value is < than 4. Over this INR value there is a significant difference in patients with LAC positivity if we use a different thromboplastin for the INR determination. For this reason values obtained by RecombiPlasTin 2G need to be confirmed and matched with another thromboplastin (ie, HepatoComplex). This approach may be useful in order to have a good INR testing for the chronic long-term treatment with OA in particular in patients with LAC positivity.
LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313
Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...
2016-12-21
Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those genes encode global regulatory proteins with extensive regulons. This study indicates that there are small specificC. thermocellumLacI regulons. Finally, the identification of LacI repressor activity for hemicellulase gene expression is a key result of this work and will add to the small body of existing literature on the area of gene regulation inC. thermocellum.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagos, M. J.; Laboratório Nacional de Nanotecnologia-LNNANO, 13083-970 Campinas-SP; Autreto, P. A. S.
2015-03-07
We report here an atomistic study of the mechanical deformation of Au{sub x}Cu{sub (1−x)} atomic-size wires (nanowires (NWs)) by means of high resolution transmission electron microscopy experiments. Molecular dynamics simulations were also carried out in order to obtain deeper insights on the dynamical properties of stretched NWs. The mechanical properties are significantly dependent on the chemical composition that evolves in time at the junction; some structures exhibit a remarkable de-alloying behavior. Also, our results represent the first experimental realization of mixed linear atomic chains (LACs) among transition and noble metals; in particular, surface energies induce chemical gradients on NW surfacesmore » that can be exploited to control the relative LAC compositions (different number of gold and copper atoms). The implications of these results for nanocatalysis and spin transport of one-atom-thick metal wires are addressed.« less
Broder, Anna; Putterman, Chaim
2013-01-01
Antiphospholipid antibodies (aPL) play an active role in the pathogenesis of the antiphospholipid syndrome (APS). Primary prevention in APS may be aimed at decreasing existing elevated aPL levels, or preventing high aPL titers and/or lupus anticoagulant (LAC) from developing in the first place. Hydroxychloroquine (HCQ) has been shown in retrospective studies to decrease aPL titers in laboratory studies, and to decrease thrombosis risk in patients with systemic lupus erythematosus (SLE). We investigated an association between HCQ use and persistent aPL and/or LAC in SLE. We identified all patients over 21 years old with SLE from an urban tertiary care center who had aPL and LAC measured on at least 2 occasions at least 12 weeks apart. We defined the presence of persistent LAC+ and/or at least 1 aPL ≥ 40 U [immunoglobulin A (IgA), IgG, or IgM] as the main outcome variable. Among 90 patients included in the study, 17 (19%) had persistent LAC+ and/or at least 1 aPL ≥ 40 U. HCQ use was associated with significantly lower odds of having persistent LAC+ and/or aPL ≥ 40 U (OR 0.21, 95% CI 0.05, 0.79, p = 0.02), adjusted for age, ethnicity, and sex. This is the first study to show that HCQ use is associated with lower odds of having persistently positive LAC and/or aPL. Data from this study provide a basis for the design of future prospective studies investigating the role of HCQ in primary and secondary prevention of APS.
Inaba, Masaaki; Okuno, Senji; Nagayama, Harumi; Yamada, Shinsuke; Ishimura, Eiji; Imanishi, Yasuo; Shoji, Shigeichi
2015-03-01
Control of phosphate is the most critical in the treatment of chronic kidney disease with mineral and bone disorder (CKD-MBD). Because calcium-containing phosphate binder to CKD patients is known to induce adynamic bone disease with ectopic calcification by increasing calcium load, we examined the effect of lanthanum carbonate (LaC), a non-calcium containing phosphate binder, to restore bone turnover in 27 hemodialysis patients with suppressed parathyroid function (serum intact parathyroid hormone [iPTH] ≦ 150 pg/mL). At the initiation of LaC administration, the dose of calcium-containing phosphate binder calcium carbonate (CaC) was withdrawn or reduced based on serum phosphate. After initiation of LaC administration, serum calcium and phosphate decreased significantly by 4 weeks, whereas whole PTH and iPTH increased. A significant and positive correlation between decreases of serum calcium, but not phosphate, with increases of whole PTH and iPTH, suggested that the decline in serum calcium with reduction of calcium load by LaC might increase parathyroid function. Serum bone resorption markers, such as serum tartrate-resistant acid phosphatase 5b, and N-telopeptide of type I collagen increased significantly by 4 weeks after LaC administration, which was followed by increases of serum bone formation markers including serum bone alkaline phosphatase, intact procollagen N-propeptide, and osteocalcin. Therefore, it was suggested that LaC attenuated CaC-induced suppression of parathyroid function and bone turnover by decreasing calcium load. In conclusion, replacement of CaC with LaC, either partially or totally, could increase parathyroid function and resultant bone turnover in hemodialysis patients with serum iPTH ≦ 150 pg/mL. Copyright © 2015 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Fang, Fang; Zhang, Xue-lian; Luo, Hong-hui; Zhou, Jia-jian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi; Pang, Xue-qun
2015-12-01
In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. © 2015 American Society of Plant Biologists. All Rights Reserved.
Aponte, Maria; Ungaro, Francesca; d'Angelo, Ivana; De Caro, Carmen; Russo, Roberto; Blaiotta, Giuseppe; Dal Piaz, Fabrizio; Calignano, Antonio; Miro, Agnese
2018-05-30
This study reports novel food-grade granules for co-delivery of L. plantarum 299v and a standardized extract of Olea europaea leaves (Phenolea®) as oral carrier of probiotics and hydroxytyrosol. Different granule formulations containing either L. plantarum 299v (Lac), or the olive leave extract (Phe) or their combination (Lac-Phe) have been successfully produced through wet granulation employing excipients generally regarded as safe as granulating/binding agents. L. plantarum cells withstood the manufacturing process and were stable upon storage at 4 °C for more than 6 months. In vitro dissolution studies in simulated gastro-intestinal fluids showed the capability of the granules to rapidly dissolve and deliver both olive leave phenols and living L. plantarum cells. In simulated digestion conditions, Lac and Lac-Phe granules protected L. plantarum against the harsh environment of the gastro-intestinal tract. Co-administration of Lac and Phe oral granules to healthy mice provided for higher amounts of hydroxytyrosol in urines as compared to Phe granules alone, suggesting that L. plantarum 299v boosted in vivo conversion of oleuropein to hydroxytyrosol. On the other hand, PCR-assisted profiling of the Lactobacillus population in faeces obtained from mice treated with Lac or Lac plus Phe confirmed that the probiotic arrived alive to colon and was there able to exert a sort of perturbing effect on the climax colonic microflora. Overall, these results pave the way towards the development of a nutraceutical useful for combined delivery of bioactive hydroxytyrosol and probiotics to colon site. Copyright © 2018 Elsevier B.V. All rights reserved.
Ehara, Tatsuya; Izumi, Hirohisa; Tsuda, Muneya; Nakazato, Yuki; Iwamoto, Hiroshi; Namba, Kazuyoshi; Takeda, Yasuhiro
2016-07-01
It is important to provide formula-fed infants with a bifidobacteria-enriched gut microbiota similar to those of breastfed infants to ensure intestinal health. Prebiotics, such as certain oligosaccharides, are a useful solution to this problem, but the combinational benefits of these oligosaccharides have not been evaluated. This study investigated the benefits of oligosaccharide combinations and screened for an optimal combination of oligosaccharides to promote healthy gut microbiota of formula-fed infants. In vitro and in vivo experiments were performed to assess the bifidogenic effects of lactulose (LAC) alone and LAC combined with raffinose (RAF) and/or galacto-oligosaccharide (GOS), using a mixed culture model and neonatal mice orally administered with these oligosaccharides and Bifidobacterium breve. In the in vitro culture model, the combination of the three oligosaccharides (LAC-RAF-GOS) significantly increased cell numbers of B. breve and Bifidobacterium longum (P<0·05) compared with either LAC alone or the combination of two oligosaccharides, and resulted in the production of SCFA under anaerobic conditions. In the in vivo experiment, the LAC-RAF-GOS combination significantly increased cell numbers of B. breve and Bacteroidetes in the large intestinal content (P<0·05) and increased acetate concentrations in the caecal content and serum of neonatal mice. Genes related to metabolism and immune responses were differentially expressed in the liver and large intestine of mice administered with LAC-RAF-GOS. These results indicate a synergistic effect of the LAC-RAF-GOS combination on the growth of bifidobacteria and reveal possible benefits of this combination to the gut microbiota and health of infants.
Mechanisms of Mutation in Non-Dividing Cells
2003-05-01
which cells with a lac +1 frameshift allele on an F’ plasmid generate Lac+ mutants upon starvation on lactose medium (3). The stationary-phase mutations...starved on lactose . The accumulation of ampD mutants requires RecA, and is promoted at a greater frequency in RecG-deficient cells, similar to Lac...stationary-phase cells after they are starved in the presence of lactose . In studies performed to date by our lab and others, mutation in stationary-phase
Genetic and Molecular Studies of the Phlebotomus Fever Group of Viruses.
1980-08-01
unrelated rhabdovirus , VSV. Two sources of LAC viral antigens were used, those from virus grown in BHK-21 cells and those obtained from LAC virus grown in...KAR, SFS and CHG, as well as those of the bunyaviruses LAC, ORI and BUN, and the viral antigens of the unrelated rhabdovirus , VSV. Again two sources...and Shope, R.E., 1977b, Oligonucleotide fingerprints of RNA obtained from rhabdoviruses belonging to the vesicular stornatitis virus subgroup. J
hsa_circ_0013958: a circular RNA and potential novel biomarker for lung adenocarcinoma.
Zhu, Xiaoli; Wang, Xiyong; Wei, Shuzhen; Chen, Yan; Chen, Yang; Fan, Xiaobo; Han, Shuhua; Wu, Guoqiu
2017-07-01
Circular RNAs (circRNAs) are associated with cancer progression and metastasis, although little is known about their role in lung adenocarcinoma (LAC). In the present study, microarrays were first used to screen for tumour-specific circRNA candidates in LAC tissue. Thirty-nine circRNAs were found to be up-regulated and 20 were down-regulated (fold change > 2.0). Among them, hsa_circ_0013958 was further confirmed to be up-regulated in all of the LAC tissues, cells and plasma. In addition, hsa_circ_0013958 levels were associated with TNM stage (P = 0.009) and lymphatic metastasis (P = 0.006). The area under the receiver operating characteristic curve was 0.815 (95% confidence interval = 0.727-0.903; P < 0.001). In addition, to further illustrate the bioactivities of hsa_circ_0013958 in LAC, siRNA-mediated inhibition of hsa_circ_0013958 was performed in vitro. The results showed that hsa_circ_0013958 promoted cell proliferation and invasion and inhibited cell apoptosis in LAC. Moreover, hsa_circ_0013958 was identified as a sponge of miR-134, and thus it up-regulated oncogenic cyclin D1, which plays a pivotal role in the development of non-small cell lung cancer. In conclusion, our results suggested that hsa_circ_0013958 could be used as a potential non-invasive biomarker for the early detection and screening of LAC. © 2017 Federation of European Biochemical Societies.
Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon
Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier
2008-01-01
Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364
Gender differences in Latin-American patients with rheumatoid arthritis.
Barragán-Martínez, Carolina; Amaya-Amaya, Jenny; Pineda-Tamayo, Ricardo; Mantilla, Rubén D; Castellanos-de la Hoz, Juan; Bernal-Macías, Santiago; Rojas-Villarraga, Adriana; Anaya, Juan-Manuel
2012-12-01
Data on the effect of gender in rheumatoid arthritis (RA) in non-Caucasian populations is scarce. Latin America and the Caribbean (LAC) is a large population with unique characteristics, including high admixture. Our aim was to examine the effect of gender in patients with RA in LAC. This was a 2-phase study. First we conducted a cross-sectional and analytical study in which 1128 consecutive Colombian patients with RA were assessed. Second, a systematic review of the literature was done to evaluate the effect of gender in LAC patients with RA. Our results show a high prevalence of RA in LAC women with a ratio of 5.2 women per man. Colombian women with RA are more at risk of having an early age at onset and developing polyautoimmunity and abdominal obesity, and they perform more household duties than their male counterparts. However, male gender was associated with the presence of extra-articular manifestations. Of a total of 641 potentially relevant articles, 38 were considered for final analysis, in which several factors and outcomes related to gender were identified. RA in LAC women is not only more common but presents with some clinical characteristics that differ from RA presentation in men. Some of those characteristics could explain the high rates of disability and worse prognosis observed in women with RA in LAC. Copyright © 2012 Elsevier HS Journals, Inc. All rights reserved.
Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer
Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk
2014-01-01
Purpose Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). Methods This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. Results A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. Conclusion LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes. PMID:24761404
Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Baik, Seung Hyuk; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk
2014-01-01
Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes.
Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen
2014-07-14
The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions.
Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro
2010-11-01
Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Messina, Sergio
2007-10-01
The results of a long-term UBV photometric monitoring of the red supergiant (RSG) star V424 Lac are presented. V424 Lac shows multiperiodic brightness variations which can be attributed to pulsational oscillations. A much longer period ( P = 1601 d), that allows us to classify this star as a long secondary period variable star (LSPV) has been also detected. The B - V and U - B color variations related to the long secondary period (LSP) are similar to those related to the shorter periods, supporting the pulsational nature of LSP. The long period brightness variation of V424 Lac is accompanied by a near-UV (NUV) excess, which was spectroscopically detected in a previous study [Massey, P., Plez, B., Levesque, E.M., et al., 2005. ApJ 634, 1286] and which is now found to be variable from photometry. On the basis of the results found for V424 Lac, the NUV excess recently found in a number of RSGs may be due not solely to circumstellar dust but may also have a contribution from a still undetected LSP variability.
Osadchuk, L V; Salomacheva, I N; Osadchuk, A V
2010-01-01
The study was designed to investigate genetic differences in reproductive consequences of social hierarchy using inbred mice strains BALB/cLac, PT and CBA/Lac. Two adult males of different genotypes were housed together for 5 days. Hierarchical status of both partners was determined by asymmetry in agonistic behavior. The number of epididymal sperm and a proportion of abnormal sperm, weights of reproductive organs, serum concentration and testicular content of testosterone, and the testosterone response to introduction of a receptive female were determined. The testosterone measures were significantly decreased in the PT strain, the epididymal sperm number was significantly decreased in the BALB/cLac strain and a proportion of abnormal sperm heads was significantly increase in the CBA/Lac (in both dominants and subordinates) as compared to control mice. The testicular testosterone response to a receptive female and precopulatory behavior was unchanged in dominants and suppressed in subordinates of the BALB/cLac strain. The results indicate that in laboratory mice the pattern of reproductive response to social hierarchy is determined by genetic background.
Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho
2017-09-15
Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.
The effects of pre-slaughter pig management from the farm to the processing plant on pork quality.
Edwards, L N; Grandin, T; Engle, T E; Ritter, M J; Sosnicki, A A; Carlson, B A; Anderson, D B
2010-12-01
Two experiments (Exp.1, n=80; Exp.2, n=144) were conducted to determine the effects of pre-slaughter pig management on pork quality by monitoring blood lactate concentration ([LAC]) during marketing. [LAC] was measured at: (1) baseline at farm, (2) post-loading on truck, (3) pre-unloading after transport, (4) post-unloading at plant, (5) post-lairage, (6) post-movement to stun, and (7) exsanguination. Pearson correlations were used to determine relationships between [LAC] and meat quality. Higher [LAC] post-loading or a greater change in [LAC] during loading resulted in increased 24h pH (P=0.002, P=0.0006, Exp.1; P=0.0001, P=0.01, Exp.2, respectively), decreased L* (P=0.03, P=0.04; P=0.001, P=0.01) and decreased drip loss (P=0.02, P=0.12; P=0.002, P=0.01). Even though improved handling during loading is important to animal well-being, it will not necessarily translate into improved pork quality. Copyright © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.
Zieg, J; Maples, V F; Kushner, S R
1978-01-01
Escherichia coli strains containing mutations in lexA, rep, uvrA, uvrD, uvrE, lig, polA, dam, or xthA were constructed and tested for conjugation and transduction proficiencies and ability to form Lac+ recombinants in an assay system utilizing a nontandem duplication of two partially deleted lactose operons (lacMS286phi80dIIlacBK1). lexA and rep mutants were as deficient (20% of wild type) as recB and recC strains in their ability to produce Lac+ progeny. All the other strains exhibited increased frequencies of Lac+ recombinant formation, compared with wild type, ranging from 2- to 13-fold. Some strains showed markedly increased conjugation proficiency (dam uvrD) compared to wild type, while others appeared deficient (polA107). Some differences in transduction proficiency were also observed. Analysis of the Lac+ recombinants formed by the various mutants indicated that they were identical to the recombinants formed by a wild-type strain. The results indicate that genetic recombination in E. coli is a highly regulated process involving multiple gene products. PMID:350859
NASA Astrophysics Data System (ADS)
Olakanmi, E. O.; Tlotleng, M.; Meacock, C.; Pityana, S.; Doyoyo, M.
2013-06-01
Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries, and renewable energy systems. This article highlights some of those potential applications. In the LACS process, a laser beam irradiates the substrate and the particles, thereby softening both of them. Consequently, the particles deform upon impact at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS deposition mechanism and microstructural properties is presented. The deposition efficiency, the microstructure, and the microhardness of the LACS-deposited coatings produced by a 4.4-kW Nd:YAG laser system were evaluated. The outcome of this study shows that pore- and crack-free Al-12 wt.%Si coatings were deposited via softening by laser irradiation and adiabatic shearing phenomena at an optimum laser power of 2.5 kW.
Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo
2002-03-01
Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.
Patterns of expression of position-dependent integrated transgenes in mouse embryo.
Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F
1990-01-01
The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xia, Jun-Qing; Cuoco, Alessandro; Branchini, Enzo
Building on our previous cross-correlation analysis (Xia et al. 2011) between the isotropic γ-ray background (IGRB) and different tracers of the large-scale structure of the universe, we update our results using 60 months of data from the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope (Fermi). For this study, we perform a cross-correlation analysis both in configuration and spherical harmonics space between the IGRB and objects that may trace the astrophysical sources of the IGRB: QSOs in the Sloan Digital Sky Survey (SDSS) DR6, the SDSS DR8 Main Galaxy Sample, luminous red galaxies (LRGs) in the SDSS catalog, infrared-selected galaxies in the Two Micron All Sky Survey (2MASS), and radio galaxies in the NRAO VLA Sky Survey (NVSS). The benefit of correlating the Fermi-LAT signal with catalogs of objects at various redshifts is to provide tomographic information on the IGRB, which is crucial in separating the various contributions and clarifying its origin. The main result is that, unlike in our previous analysis, we now observe a significant (>3.5σ) cross-correlation signal on angular scales smaller than 1° in the NVSS, 2MASS, and QSO cases and, at lower statistical significance (~3.0σ), with SDSS galaxies. The signal is stronger in two energy bands, E > 0.5 GeV and E > 1 GeV, but it is also seen at E > 10 GeV. No cross-correlation signal is detected between Fermi data and the LRGs. These results are robust against the choice of the statistical estimator, estimate of errors, map cleaning procedure, and instrumental effects. Finally, we test the hypothesis that the IGRB observed by Fermi-LAT originates from the summed contributions of three types of unresolved extragalactic sources: BL Lacertae objects (BL Lacs), flat spectrum radio quasars (FSRQs), and star-forming galaxies (SFGs). Finally, we find that a model in which the IGRB is mainly produced by SFGs (more » $$72_{-37}^{+23}$$% with 2σ errors), with BL Lacs and FSRQs giving a minor contribution, provides a good fit to the data. We also consider a possible contribution from misaligned active galactic nuclei, and we find that, depending on the details of the model and its uncertainty, they can also provide a substantial contribution, partly degenerate with the SFG one.« less
Flood Control Project Lac Qui Parle, Emergency Plan
1988-10-01
elevation of the breach (924.0 as shown in Table 1), is approximately 22.2 feet. The value of the envelope curve shown on Plate D-10 for a hydraulic...approximately 83% of the computed maximum outflow. Several failure scenarios for Lac qui Parle Dam were studied. The case of failure concurrent with a PKF ...discharge would plot very close to Lac qui Parle in Plate D-10. Plate D-10 shows that the value of the envelope curve for a hydraulic depth of 18.8 feet
Investigation of physical parameters in stellar flares observed by GINGA
NASA Technical Reports Server (NTRS)
Stern, Robert A.
1994-01-01
This program involves analysis and interpretation of results from GINGA Large Area Counter (LAC) observations from a group of large stellar x-ray flares. All LAC data are re-extracted using the standard Hayashida method of LAC background subtraction and analyzed using various models available with the XSPEC spectral fitting program. Temperature-emission measure histories are available for a total of 5 flares observed by GINGA. These will be used to compare physical parameters of these flares with solar and stellar flare models.
Investigation of physical parameters in stellar flares observed by GINGA
NASA Technical Reports Server (NTRS)
Stern, Robert A.
1994-01-01
This program involves analysis and interpretation of results from GINGA Large Area Counter (LAC) observations from a group of large stellar X-ray flares. All LAC data are re-extracted using the standard Hayashida method of LAC background subtraction and analyzed using various models available with the XSPEC spectral fitting program.Temperature-emission measure histories are available for a total of 5 flares observed by GINGA. These will be used to compare physical parameters of these flares with solar and stellar flare models.
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less
López-Oliva, María Elvira; Garcimartin, Alba; Muñoz-Martínez, Emilia
2017-12-01
The effect and the role played by dietary α-lactalbumin (α-LAC) on hepatic fat metabolism are yet to be fully elucidated. We reported previously that α-LAC intake induced atherogenic dyslipidaemia in Balb/c mice. The aim of the present study was to investigate if this atherogenic effect could be due to a possible α-LAC-induced hepatic steatosis. We examine the ability of dietary α-LAC to induce liver steatosis, identifying the molecular mechanisms underlying hepatic lipid metabolism in association with the lipid profile, peripheral insulin resistance (IR) and changes in the hepatic oxidative environment. Male Balb/c mice (n 6) were fed with diets containing either chow or 14 % α-LAC for 4 weeks. The α-LAC-fed mice developed abdominal adiposity and IR. Moderate liver steatosis with increased TAG and NEFA contents was correlated with atherogenic dyslipidaemia. There was increased nuclear expression of liver X receptor αβ (LXRαβ), sterol regulatory element-binding protein-1c (SREBP-1c) and PPARγ transcription factors and of the cytosolic enzymes acetyl-CoA carboxylase 1 (ACC1) and fatty acid synthase involved in the hepatic de novo lipogenesis. The opposite was found for the nuclear receptor PPARα and the mitochondrial enzyme carnitine palmitoyltransferase-1 (CPT-1), leading to reduced fatty acid β-oxidation (FAO). These changes were associated with a significant decrease in both p-Thr172-AMP-activated protein kinase α (AMPKα) (inactivation) and p-Ser79-ACC1 (activation) and with a more oxidative liver environment increasing lipid peroxidation and protein oxidation and reducing GSH:GSSG ratio in the α-LAC-fed mice. In conclusion, 4 weeks of 14 % α-LAC feeding induced liver steatosis associated with atherogenic dyslipidaemia, IR and oxidative stress by enhancing nuclear LXRαβ/SREBP-1c/PPARγ expression and diminishing PPARα/CPT-1 expression and AMPKα phosphorylation shifting the hepatic FAO toward fatty acid synthesis in Balb/c mice.
Beach, Dale L; Alvarez, Consuelo J
2015-12-01
Synthetic biology offers an ideal opportunity to promote undergraduate laboratory courses with research-style projects, immersing students in an inquiry-based program that enhances the experience of the scientific process. We designed a semester-long, project-based laboratory curriculum using synthetic biology principles to develop a novel sensory device. Students develop subject matter knowledge of molecular genetics and practical skills relevant to molecular biology, recombinant DNA techniques, and information literacy. During the spring semesters of 2014 and 2015, the Synthetic Biology Laboratory Project was delivered to sophomore genetics courses. Using a cloning strategy based on standardized BioBrick genetic "parts," students construct a "reporter plasmid" expressing a reporter gene (GFP) controlled by a hybrid promoter regulated by the lac-repressor protein (lacI). In combination with a "sensor plasmid," the production of the reporter phenotype is inhibited in the presence of a target environmental agent, arabinose. When arabinose is absent, constitutive GFP expression makes cells glow green. But the presence of arabinose activates a second promoter (pBAD) to produce a lac-repressor protein that will inhibit GFP production. Student learning was assessed relative to five learning objectives, using a student survey administered at the beginning (pre-survey) and end (post-survey) of the course, and an additional 15 open-ended questions from five graded Progress Report assignments collected throughout the course. Students demonstrated significant learning gains (p < 0.05) for all learning outcomes. Ninety percent of students indicated that the Synthetic Biology Laboratory Project enhanced their understanding of molecular genetics. The laboratory project is highly adaptable for both introductory and advanced courses.
EPA Efforts in Latin America and the Caribbean
The Latin America and Caribbean (LAC) program provides environmental tools and information to build the capacity of LAC governments and civil society organizations to reduce environmental degradation and its impacts on public health.
University of Wisconsin - Extension
... Fond du Lac County Forest County Grant County Green County Green Lake County Iowa County Iron County Jackson County ... Fond du Lac County Forest County Grant County Green County Green Lake County Iowa County Iron County ...
Over-expression of phage HK022 Nun protein is toxic for Escherichia coli
Uc-Mass, Augusto; Khodursky, Arkady; Brown, Lewis; Gottesman, Max E.
2008-01-01
The Nun protein of coliphage HK022 excludes superinfecting λ phage. Nun recognizes and binds to the N utilization (nut) sites on phage λ nascent RNA and induces transcription termination. Over-expression of Nun from a high-copy plasmid is toxic for E.coli, despite the fact that nut sites are not encoded in the E.coli genome. Cells expressing Nun cannot exit stationary phase. Toxicity is related to transcription termination, since host and nun mutations that block termination also suppress cell killing. Nun inhibits expression of wild-type lacZ, but not lacZ expressed from the Crp/cAMP–independent lacUV5 promoter. Microarray and proteomics analyses show Nun down-regulates crp and tnaA. Crp over-expression and high indole concentrations partially reverse Nun-mediated toxicity and restore lacZ expression. PMID:18571198
Purriños, Laura; García Fontán, María C; Carballo, Javier; Lorenzo, José M
2013-05-01
The aim of this work was to study the yeast population during the manufacture of dry-cured "lacón" (a Spanish traditional meat product) and the effect of the salting time. For this study, six batches of "lacón" were manufactured with three different salting times (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). Yeast counts increased significantly (P < 0.001) during the whole process from 2.60 to 6.37 log cfu/g. An increased length of salting time did not affect yeast counts throughout the manufacture of dry-cured "lacón", although the highest yeast counts were obtained from LS batches. A total of 226 isolates were obtained from dry-cured "lacón" during drying-ripening stage, of which 151 were yeasts and were identified at the species level using molecular techniques. The total of 151 identified yeasts belonged to 4 different genera: Debaryomyces, Candida, Cryptococcus and Rhodotorula. Debaryomyces hansenii was the most abundant species isolated throughout the whole process as much in the interior as in the exterior of the pieces of three salt levels of "lacón" studied, while Candida zeylanoides was only isolated from the interior of MS and HS batches and from the exterior of LS and HS groups, but at lesser proportion than D. hansenii. Copyright © 2012. Published by Elsevier Ltd.
de Léséleuc, Louis; Harris, Greg; KuoLee, Rhonda; Xu, H Howard; Chen, Wangxue
2014-05-01
Bacteremia caused by Acinetobacter baumannii is a highly lethal complication of hospital-acquired pneumonia. In the present study, we investigated the serum resistance, gallium nitrate tolerance and heme consumption of A. baumannii strain LAC-4 which was recently reported to display high virulence in a mouse pneumonia model with extrapulmonary dissemination leading to fatal bacteremia. This strain showed enhanced growth in mouse and fetal bovine serum that was independent of complement and was not observed with regular growth media. The LAC-4 strain was found to possess a high tolerance to gallium nitrate (GaN), whereas serum synergized with GaN in inhibiting A. baumannii strain ATCC 17978. We found that LAC-4 contains a heme oxygenase gene and expresses a highly efficient heme consumption system. This system can be fully blocked in vitro and in vivo by gallium protoporphyrin IX (GaPPIX). Inhibition of heme consumption by GaPPIX completely abrogated the growth advantage of LAC-4 in serum as well as its tolerance to GaN. More importantly, GaPPIX treatment of mice intranasally infected with LAC-4 prevented extrapulmonary dissemination and death. Thus, we propose that heme provides an additional source of iron for LAC-4 to bypass iron restriction caused by serum transferrin, lactoferrin or free gallium salts. Heme consumption systems in A. baumannii may constitute major virulence factors for lethal bacteremic isolates. Copyright © 2014 Crown Copyright and Elsevier Inc. Published by Elsevier GmbH.. All rights reserved.
Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†
Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald
2009-01-01
A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129
Toscano, C M; Jauregui, B; Janusz, C B; Sinha, A; Clark, A D; Sanderson, C; Resch, S; Ruiz Matus, C; Andrus, J K
2013-07-02
The Pan American Health Organization's ProVac Initiative, designed to strengthen national decision making regarding the introduction of new vaccines, was initiated in 2004. Central to realizing ProVac's vision of regional capacity building, the ProVac Network of Centers of Excellence (CoEs) was established in 2010 to provide research support to the ProVac Initiative, leveraging existing capacity at Latin American and Caribbean (LAC) universities. We describe the process of establishing the ProVac Network of CoEs and its initial outcomes and challenges. A survey was sent to academic, not-for-profit institutions in LAC that had recently published work in the areas of clinical decision sciences and health economic analysis. Centers invited to join the Network were selected by an international committee on the basis of the survey results. Selection criteria included academic productivity in immunization-related work, team size and expertise, successful collaboration with governmental agencies and international organizations, and experience in training and education. The Network currently includes five academic institutions across LAC. Through open dialog and negotiation, specific projects were assigned to centers according to their areas of expertise. Collaboration among centers was highly encouraged. Faculty from ProVac's technical partners were assigned as focal points for each project. The resulting work led to the development and piloting of tools, methodological guides, and training materials that support countries in assessing existing evidence and generating new evidence on vaccine introduction. The evidence generated is shared with country-level decision makers and the scientific community. As the ProVac Initiative expands to other regions of the world with support from immunization and public health partners, the establishment of other regional and global networks of CoEs will be critical. The experience of LAC in creating the current network could benefit the formation of similar structures that support evidence-based decisions regarding new public health interventions. Copyright © 2013 Elsevier Ltd. All rights reserved.
Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun
2015-01-01
Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1) LacA, 109.9 mg L(-1) MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1), respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries.
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Bacterial recognition of thermal glycation products derived from porcine serum albumin with lactose.
Sarabia-Sainz, Andre-I; Ramos-Clamont, Gabriela; Winzerling, Joy; Vázquez-Moreno, Luz
2011-01-01
Recently, glyco-therapy is proposed to prevent the interaction of bacterial lectins with host ligands (glycoconjugates). This interaction represents the first step in infection. Neoglycans referred to as PSA-Lac (PSA-Glu (β1-4) Gal) were obtained by conjugation of porcine serum albumin (PSA) with lactose at 80 °C, 100 °C and 120 ºC. Characterization studies of the products showed that PSA could contain 1, 38 or 41 added lactoses, depending on the reaction temperature. These neoglycans were approximately 10 times more glycated than PSA-Lac obtained in previous work. Lactose conjugation occurred only at lysines and PSA-Lac contained terminal galactoses as confirmed by Ricinus communis lectin recognition. Furthermore, Escherichia coli K88+, K88ab, K88ac and K88ad adhesins showed affinity toward all PSA-Lac neoglycans, and the most effective was the PSA-Lac obtained after 100 ºC treatment. In vitro, this neoglycan partially inhibited the adhesion of E. coli K88+ to piglet mucin (its natural ligand). These results provide support for the hypothesis that glycated proteins can be used as an alternative for bioactive compounds for disease prevention.
Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun
2015-01-01
Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270
Lactosaminated- N-succinyl chitosan nanoparticles for hepatocyte-targeted delivery of acyclovir
NASA Astrophysics Data System (ADS)
Jain, Nivrati; Rajoriya, Vaibhav; Jain, Prateek Kumar; Jain, Ashish Kumar
2014-01-01
The present study discusses lactose-acyclovir- N-succinyl chitosan nanoparticles (Lac- N-Suc-CSNP) using lactose as an asialoglycoprotein receptor (ASGPR) ligand for hepatic parenchymatic cells targeting. For this purpose, N-succinyl chitosan nanoparticles ( N-Suc-CSNP) were prepared previously by ionotropic gelation method and lactose was conjugated to the free amino terminal group of chitosan. Lactose conjugation with N-Suc-CSNP was confirmed by FT-IR and zeta potential measurements. The Lac- N-Suc-CSNP obtained were characterized for their morphology, particle size, polydispersity index, and zeta potential. The Lac- N-Suc-CSNP showed spherical in shape with 220.3 ± 5.0 nm size range, +4.1 ± 0.2 mV zeta potential, 62.5 ± 1.2 % acyclovir entrapment efficiency and showed 27.3 ± 0.9 % cumulative acyclovir release up to 72 h. The acyclovir concentration from Lac- N-Suc-CSNP was found to be 19.9 ± 1.62 μg/g after 24 h administration revealed remarkably targeting potential to the hepatocytes and keep at a high level during the experiment. These results suggest that Lac- N-Suc-CSNP are potentially vector for hepatocytes targeting.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iyer, Sukanya; Karig, David K; Norred, Sarah E
Engineered gene circuits offer an opportunity to harness biological systems for biotechnological and biomedical applications. However, reliance on host E. coli promoters for the construction of circuit elements, such as logic gates, makes implementation of predictable, independently functioning circuits difficult. In contrast, T7 promoters offer a simple orthogonal expression system for use in a variety of cellular backgrounds and even in cell free systems. Here we develop a T7 promoter system that can be regulated by two different transcriptional repressors for the construction of a logic gate that functions in cells and in cell free systems. We first present LacImore » repressible T7lacO promoters that are regulated from a distal lac operator site for repression. We next explore the positioning of a tet operator site within the T7lacO framework to create T7 promoters that respond to tet and lac repressors and realize an IMPLIES gate. Finally, we demonstrate that these dual input sensitive promoters function in a commercially available E. coli cell-free protein expression system. Together, our results contribute to the first demonstration of multi-input regulation of T7 promoters and expand the utility of T7 promoters in cell based as well as cell-free gene circuits.« less
MAGIC discovers VHE gamma-ray emission from the blazar 1ES 1727+502
NASA Astrophysics Data System (ADS)
Mariotti, Mose
2011-11-01
The MAGIC Collaboration reports the discovery of Very High Energy (VHE; E>100 GeV) gamma-ray emission from the BL Lac object 1ES 1727+502 (also known as OT546) with redshift z=0.055. The source was selected from the compilation of Costamante, L. & Ghisellini, G. 2002, A&A, 384, 56. Previous observations with the single MAGIC-I telescope yielded an upper limit on the level of 11.8% of the Crab Nebula flux above 140 GeV (J.
Extent of warm haloes around medium-redshift galaxies
NASA Technical Reports Server (NTRS)
Burbidge, E. M.; Barlow, T. A.; Cohen, R. D.; Junkkarinen, V. T.; Womble, D. S.
1989-01-01
The properties of low-to-medium ionization gaseous haloes around galaxies are briefly reviewed. New observations concerning such haloes are presented. For the galaxy-QSO pair in the field of the radio source 3C303, the higher-redshift QSO has been found to show Mg II absorption at the lower redshift of the faint nearby galaxy. Secondly, new data are presented on one of the galaxies in the environment of the well-known BL Lac object AO 0235 + 164.
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
Zhang, Guo-rong; Geller, Alfred I
2010-05-17
Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.
Zammaretti, Francesca; Panzica, Giancarlo; Eva, Carola
2007-01-01
In this study we investigated whether long-term consumption of a moderate/high fat (MHF), high-energy diet can affect the gene expression of the Y1 receptor (Y1R) for neuropeptide Y (NPY) in the dorsomedial (DMH), ventromedial (VMH), arcuate (ARC) and paraventricular (PVN) hypothalamic nuclei of male and female Y1R/LacZ transgenic mice, carrying the murine Y1R promoter linked to the LacZ gene. MHF diet-fed male mice showed an increased consumption of metabolizable energy that was associated with a significant increase in body weight as compared with chow-fed controls. In parallel, consumption of a MHF diet for 8 weeks significantly decreased Y1R/LacZ transgene expression in the DMH and VMH of male mice whereas no changes were found in the ARC and PVN. Leptin treatment reduced body weight of both MHF diet- and chow-fed male mice but failed to prevent the decrease in Y1R/LacZ transgene expression apparent in the DMH and VMH of male mice after 8 weeks of MHF diet intake. Conversely, no significant changes of metabolizable energy intake, body weight or hypothalamic β-galactosidase expression were found in MHF diet-fed female Y1R/LacZ transgenic mice. A gender-related difference of Y1R/LacZ transgenic mice was also observed in response to leptin treatment that failed to decrease body weight of both MHF diet- and chow-fed female mice. Results herein demonstrate that Y1R/LacZ FVB mice show a sexual dimorphism both on energy intake and on nucleus-specific regulation of the NPY Y1R system in the hypothalamus. Overall, these results provide new insights into the mechanism by which diet composition affects the hypothalamic circuit that controls energy homeostasis. PMID:17584829
Period Variations of the Eclipsing Binary Systems T LMi and VX Lac
NASA Astrophysics Data System (ADS)
Yılmaz, M.; İzci, D. D.; Gümüş, D.; Özavci, İ.; Selam, S. O.
2015-07-01
We present a period analysis of the two Algol-type eclipsing binary systems T LMi and VX Lac using all available times of minimum in the literature, as well as new minima obtained at the Ankara University Kreiken Observatory. The period analysis of T LMi suggests mass transfer between the components and also a third body that is dynamically bound to the binary system. The analysis of VX Lac also suggests mass transfer between the components, and the presence of a third and a fourth body under the assumption of a Light-Time Effect. In addition, the periodic variation of VX Lac was examined under the hypothesis of magnetic activity, and the corresponding parameters were derived. We report here the orbital parameters for both systems, along with the ones related to mass transfer, and those for the third and fourth bodies.
NASA Astrophysics Data System (ADS)
Takahashi, Yukihiro; Sato, Mitsuteru; Imai, Masataka; Lorenz, Ralph; Yair, Yoav; Aplin, Karen; Fischer, Georg; Nakamura, Masato; Ishii, Nobuaki; Abe, Takumi; Satoh, Takehiko; Imamura, Takeshi; Hirose, Chikako; Suzuki, Makoto; Hashimoto, George L.; Hirata, Naru; Yamazaki, Atsushi; Sato, Takao M.; Yamada, Manabu; Murakami, Shin-ya; Yamamoto, Yukio; Fukuhara, Tetsuya; Ogohara, Kazunori; Ando, Hiroki; Sugiyama, Ko-ichiro; Kashimura, Hiroki; Ohtsuki, Shoko
2018-05-01
The existence of lightning discharges in the Venus atmosphere has been controversial for more than 30 years, with many positive and negative reports published. The lightning and airglow camera (LAC) onboard the Venus orbiter, Akatsuki, was designed to observe the light curve of possible flashes at a sufficiently high sampling rate to discriminate lightning from other sources and can thereby perform a more definitive search for optical emissions. Akatsuki arrived at Venus during December 2016, 5 years following its launch. The initial operations of LAC through November 2016 have included a progressive increase in the high voltage applied to the avalanche photodiode detector. LAC began lightning survey observations in December 2016. It was confirmed that the operational high voltage was achieved and that the triggering system functions correctly. LAC lightning search observations are planned to continue for several years.
The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.
Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H
1988-01-01
We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795
Chen, Juhong; Alcaine, Samuel D; Jackson, Angelyca A; Rotello, Vincent M; Nugen, Sam R
2017-04-28
T7 bacteriophages (phages) have been genetically engineered to carry the lacZ operon, enabling the overexpression of beta-galactosidase (β-gal) during phage infection and allowing for the enhanced colorimetric detection of Escherichia coli (E. coli). Following the phage infection of E. coli, the enzymatic activity of the released β-gal was monitored using a colorimetric substrate. Compared with a control T7 phage, our T7 lacZ phage generated significantly higher levels of β-gal expression following phage infection, enabling a lower limit of detection for E. coli cells. Using this engineered T7 lacZ phage, we were able to detect E. coli cells at 10 CFU·mL -1 within 7 h. Furthermore, we demonstrated the potential for phage-based sensing of bacteria antibiotic resistance profiling using our T7 lacZ phage, and subsequent β-gal expression to detect antibiotic resistant profile of E. coli strains.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu Jianghua; He Xiangtao; Boettcher, Markus
We present the results of our optical monitoring of the BL Lac object S5 0716+714 over seven nights in 2006 December. The monitoring was carried out simultaneously at three optical wavelengths with a novel photometric system. The object did not show large-amplitude internight variations during this period. Intranight variations were observed on four nights and probably on one more. Strong bluer-when-brighter chromatism was detected on both intranight and internight timescales. The intranight variation amplitude decreases in the wavelength sequence of B', R', and V'. Cross-correlation analyses revealed that the variability at the B' and V' bands leads that at themore » R' band by about 30 minutes on one night.« less
L'Huillier, P J; Davis, S R; Bellamy, A R
1992-01-01
Ribozymes targeted to five sites along the alpha-lactalbumin (alpha-lac) mRNA were delivered to the cytoplasm of mouse C127I mammary cells using the T7-vaccinia virus delivery system and the amount of alpha-lac mRNA was monitored 24-48 h post-transfection. Three target sites were selected in the alpha-lac coding region (nucleotides 15, 145 and 361) and two were located in the 3' non-coding region (nucleotides 442 and 694). Acting in trans and at a target:ribozyme ratio of 1:1000, ribozymes targeting sites 361 and 694 reduced alpha-lac mRNA by > 80%; another two ribozymes (targeting nucleotides 442 and 145) reduced mRNA levels by 80 and 60% respectively; the fifth ribozyme (targeting nucleotide 15, near the AUG) was largely ineffective. The kinetic activity (kcat) of each ribozyme in vitro was somewhat predictive of the activity of the two ribozymes that targeted nucleotides 361 and 694, but was not predictive of the in vivo activity of the other three ribozymes. Down-regulation of the intracellular levels of alpha-lac paralleled the ribozyme-dependent reduction achieved for mRNA. For site 442, the reduction in both mRNA and protein was attributed to the catalytic activity of the ribozyme rather than to the antisense effects of the flanking arms, because delivery of an engineered (catalytically-inactive) variant had no effect on mRNA levels and a minimal effect on the level of alpha-lac present in the cell. Images PMID:1425576
THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aartsen, M. G.; Abraham, K.; Ackermann, M.
2017-01-20
The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in themore » 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.« less
Arm-Gal4 inheritance influences development and lifespan in Drosophila melanogaster.
Slade, F A; Staveley, B E
2015-10-19
The UAS-Gal4 ectopic expression system is a widely used and highly valued tool that allows specific gene expression in Drosophila melanogaster. Yeast transcription factor Gal4 can be directed using D. melanogaster transcriptional control elements, and is often assumed to have little effect on the organism. By evaluation of the consequences of maternal and paternal inheritance of a Gal4 transgene under the transcriptional regulation of armadillo control elements (arm-Gal4), we demonstrated that Gal4 expression could be detrimental to development and longevity. Male progeny expressing arm-Gal4 in the presence of UAS-lacZ transgene had reduced numbers and size of ommatidia, compared to flies expressing UAS-lacZ transgene under the control of other Gal4 transgenes. Aged at 25°C, the median life span of male flies with maternally inherited elav-Gal4 was 70 days, without a responding transgene or with UAS-lacZ. The median life span of maternally inherited arm-Gal4 male flies without a responding transgene was 48 days, and 40 days with the UAS-lacZ transgene. A partial rescue of this phenotype was observed with the expression of UAS-lacZ under paternal arm-Gal4 control, having an average median lifespan of 60 days. This data suggests that arm-Gal4 has detrimental effects on Drosophila development and lifespan that are directly dependent upon parental inheritance, and that the benign responder and reporter gene UAS-lacZ may influence D. melanogaster development. These findings should be taken into consideration during the design and execution of UAS-Gal4 expression experiments.
NASA Technical Reports Server (NTRS)
Jaber, W. A.; Prior, D. L.; Thamilarasan, M.; Grimm, R. A.; Thomas, J. D.; Klein, A. L.; Asher, C. R.
2000-01-01
BACKGROUND: Transesophageal echocardiography (TEE) is the gold standard for evaluation of the left atrium and the left atrial appendage (LAA) for the presence of thrombi. Anticoagulation is conventionally used for patients with atrial fibrillation to prevent embolization of atrial thrombi. The mechanism of benefit and effectiveness of thrombi resolution with anticoagulation is not well defined. METHODS AND RESULTS: We used a TEE database of 9058 consecutive studies performed between January 1996 and November 1998 to identify all patients with thrombi reported in the left atrium and/or LAA. One hundred seventy-four patients with thrombi in the left atrial cavity (LAC) and LAA were identified (1.9% of transesophageal studies performed). The incidence of LAA thrombi was 6.6 times higher than LAC thrombi (151 vs 23, respectively). Almost all LAC thrombi were visualized on transthoracic echocardiography (90.5%). Mitral valve pathology was associated with LAC location of thrombi (P <.0001), whereas atrial fibrillation or flutter was present in most patients with LAA location of thrombi. Anticoagulation of 47 +/- 18 days was associated with thrombus resolution in 80.1% of the patients on follow-up TEE. Further anticoagulation resulted in limited additional benefit. CONCLUSIONS: LAC thrombi are rare and are usually associated with mitral valve pathology. Transthoracic echocardiography is effective in identifying these thrombi. LAA thrombi occur predominantly in patients with atrial fibrillation or flutter. Short-term anticoagulation achieves a high rate of resolution of LAA and LAC thrombi but does not obviate the need for follow-up TEE.
Nalos, Marek; Kholodniak, Euguenia; Smith, Louise; Orde, Sam; Ting, Iris; Slama, Michel; Seppelt, Ian; McLean, Anthony S; Huang, Stephen
2018-06-01
To investigate the metabolic and cardiac effects of intravenous administration of two hypertonic solutions - 3% saline (SAL) and 0.5M sodium lactate (LAC). A randomised, doubleblind, crossover study in ten human volunteers. Intravenous bolus of either SAL or LAC at 3 mL/kg over 20 min followed by a 2 mL/kg infusion over 60 min. Acid base parameters and echocardiographic indices of cardiac function, cardiac output (CO), left ventricular ejection fraction (LVEF) and mitral annular peak systolic velocity (Sm) before and after infusion of SAL or LAC. Despite haemodilution, we observed an increase in sodium (139 ± 2 mmol/L to 142 ± 2 mmol/L in both groups) and respective anions, chloride (106 ± 2 mmol/L to 112 ± 3 mmol/L) and lactate (1.01 ± 0.28 mmol/L to 2.38 ± 0.38 mmol/L) with SAL and LAC, respectively. The pH (7.37 ± 0.03 to 7.45 ± 0.03; P < 0.01) and simplified strong ion difference (SID) (36.3 ± 4.6 mmol/L to 39.2 ± 3.6 mmol/L; P < 0.01) increased during the LAC infusion. The pH was unchanged, but SID decreased during SAL infusion (36.3 ± 2.5 mmol/L to 33.9 ± 3.1 mmol/L; P = 0.01). Both solutions led to an increase in preload and cardiac function, CO (4.36 ± 0.79 L/min to 4.98 ± 1.37 L/ min v 4.62 ± 1.30 L/min to 5.13 ± 1.44 L/min), LVEF (61 ± 6% to 63 ± 8% v 64 ± 6% to 68 ± 7%). The averaged Sm improved in the LAC group as compared with the SAL group (0.088 ± 0.008 to 0.096 ± 0.016 v 0.086 ± 0.012 to 0.082 ± 0.012; P = 0.032). The administration of SAL or LAC has opposing effects on acid base variables such as SID. Hypertonic fluid infusion lead to increased cardiac preload and performance with Sm, suggesting better left ventricular systolic function during LAC as compared with SAL. Lactated hypertonic solutions should be evaluated as resuscitation fluids.
Progress in gene targeting and gene therapy for retinitis pigmentosa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farrar, G.J.; Humphries, M.M.; Erven, A.
1994-09-01
Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stroemberg, N.K.; Karlsson, K.A.
1990-07-05
Actinomyces naeslundii (ATCC 12104) and Actinomyces viscosus (ATCC 19246) were radiolabeled externally (125I) or metabolically (35S) and analyzed for their ability to bind glycosphingolipids separated on thin layer chromatograms or coated in microtiter wells. Two binding properties were found and characterized in detail. (i) Both bacteria showed binding to lactosylceramide (LacCer) in a fashion similar to bacteria characterized earlier. The activity of free LacCer was dependent on the ceramide structure; species with 2-hydroxy fatty acid and/or a trihydroxy base were positive, while species with nonhydroxy fatty acid and a dihydroxy base were negative binders. Several glycolipids with internal lactose weremore » active but only gangliotriaosylceramide and gangliotetraosylceramide were as active as free LacCer. The binding to these three species was half-maximal at about 200 ng of glycolipid and was not blocked by preincubation of bacteria with free lactose or lactose-bovine serum albumin. (ii) A. naeslundii, unlike A. viscosus, showed a superimposed binding concluded to be to terminal or internal GalNAc beta and equivalent to a lactose-inhibitable specificity previously analyzed by other workers. Terminal Gal beta was not recognized in several glycolipids, although free Gal and lactose were active as soluble inhibitors. The binding was half-maximal at about 10 ng of glycolipid. A glycolipid mixture prepared from a scraping of human buccal epithelium contained an active glycolipid with sites for both binding specificities.« less
Varela, M F; Brooker, R J; Wilson, T H
1997-09-01
The purpose of this research was to identify amino acid residues that mediate substrate recognition in the lactose carrier of Escherichia coli. The lactose carrier transports the alpha-galactoside sugar melibiose as well as the beta-galactoside sugar lactose. Mutants from cells containing the lac genes on an F factor were selected by the ability to grow on succinate in the presence of the toxic galactoside beta-thio-o-nitrophenylgalactoside. Mutants that grew on melibiose minimal plates but failed to grow on lactose minimal plates were picked. In sugar transport assays, mutant cells showed the striking result of having low levels of lactose downhill transport but high levels of melibiose downhill transport. Accumulation (uphill) of melibiose was completely defective in all of the mutants. Kinetic analysis of melibiose transport in the mutants showed either no change or a greater than normal apparent affinity for melibiose. PCR was used to amplify the lacY DNA of each mutant, which was then sequenced by the Sanger method. The following six mutations were found in the lacY structural genes of individual mutants: Tyr-26-->Asp, Phe-27-->Tyr, Phe-29-->Leu, Asp-240-->Val, Leu-321-->Gln, and His-322-->Tyr. We conclude from these experiments that Tyr-26, Phe-27, Phe-29 (helix 1), Asp-240 (helix 7), Leu-321, and His-322 (helix 10) either directly or indirectly mediate sugar recognition in the lactose carrier of E. coli.
NASA Astrophysics Data System (ADS)
Archambault, S.; Archer, A.; Beilicke, M.; Benbow, W.; Bird, R.; Biteau, J.; Bouvier, A.; Bugaev, V.; Cardenzana, J. V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dickinson, H. J.; Dumm, J.; Eisch, J. D.; Errando, M.; Falcone, A.; Feng, Q.; Finley, J. P.; Fleischhack, H.; Fortin, P.; Fortson, L.; Furniss, A.; Gillanders, G. H.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Håkansson, N.; Hanna, D.; Holder, J.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krause, M.; Krennrich, F.; Kumar, S.; Lang, M. J.; Maier, G.; McArthur, S.; McCann, A.; Meagher, K.; Millis, J.; Moriarty, P.; Mukherjee, R.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Otte, A. N.; Park, N.; Pohl, M.; Popkow, A.; Prokoph, H.; Pueschel, E.; Quinn, J.; Ragan, K.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Santander, M.; Sembroski, G. H.; Shahinyan, K.; Smith, A. W.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Varlotta, A.; Vincent, S.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.; Veritas Collaboration; Hughes, Z. D.
2015-08-01
During moonlit nights, observations with ground-based Cherenkov telescopes at very high energies (VHEs, E\\gt 100 GeV) are constrained since the photomultiplier tubes (PMTs) in the telescope camera are extremely sensitive to the background moonlight. Observations with the VERITAS telescopes in the standard configuration are performed only with a moon illumination less than 35% of full moon. Since 2012, the VERITAS collaboration has implemented a new observing mode under bright moonlight, by either reducing the voltage applied to the PMTs (reduced-high-voltage; RHV configuration), or by utilizing UV-transparent filters. While these operating modes result in lower sensitivity and increased energy thresholds, the extension of the available observing time is useful for monitoring variable sources such as blazars and sources requiring spectral measurements at the highest energies. In this paper we report the detection of γ-ray flaring activity from the BL Lac object 1ES 1727+502 during RHV observations. This detection represents the first evidence of VHE variability from this blazar. The integral flux is (1.1+/- 0.2)× {10}-11 {{cm}}-2 {{{s}}}-1 above 250 GeV, which is about five times higher than the low-flux state. The detection triggered additional VERITAS observations during standard dark-time. Multiwavelength observations with the FLWO 48″ telescope, and the Swift and Fermi satellites are presented and used to produce the first spectral energy distribution (SED) of this object during γ-ray flaring activity. The SED is then fitted with a standard synchrotron-self-Compton model, placing constraints on the properties of the emitting region and of the acceleration mechanism at the origin of the relativistic particle population in the jet.
Multiwavelength Observations of the Previously Unidentified Blazar RX J0648.7+1516
NASA Astrophysics Data System (ADS)
Aliu, E.; Aune, T.; Beilicke, M.; Benbow, W.; Böttcher, M.; Bouvier, A.; Bradbury, S. M.; Buckley, J. H.; Bugaev, V.; Cannon, A.; Cesarini, A.; Ciupik, L.; Connolly, M. P.; Cui, W.; Decerprit, G.; Dickherber, R.; Duke, C.; Errando, M.; Falcone, A.; Feng, Q.; Finnegan, G.; Fortson, L.; Furniss, A.; Galante, N.; Gall, D.; Gillanders, G. H.; Godambe, S.; Griffin, S.; Grube, J.; Gyuk, G.; Hanna, D.; Hivick, B.; Holder, J.; Huan, H.; Hughes, G.; Hui, C. M.; Humensky, T. B.; Kaaret, P.; Karlsson, N.; Kertzman, M.; Kieda, D.; Krawczynski, H.; Krennrich, F.; Maier, G.; Majumdar, P.; McArthur, S.; McCann, A.; Moriarty, P.; Mukherjee, R.; Nelson, T.; Ong, R. A.; Orr, M.; Otte, A. N.; Park, N.; Perkins, J. S.; Pichel, A.; Pohl, M.; Prokoph, H.; Quinn, J.; Ragan, K.; Reyes, L. C.; Reynolds, P. T.; Roache, E.; Rose, H. J.; Ruppel, J.; Saxon, D. B.; Sembroski, G. H.; Skole, C.; Smith, A. W.; Staszak, D.; Tešić, G.; Theiling, M.; Thibadeau, S.; Tsurusaki, K.; Tyler, J.; Varlotta, A.; Vassiliev, V. V.; Wakely, S. P.; Weekes, T. C.; Weinstein, A.; Williams, D. A.; Zitzer, B.; VERITAS Collaboration; Ciprini, S.; Fumagalli, M.; Kaplan, K.; Paneque, D.; Prochaska, J. X.
2011-12-01
We report on the VERITAS discovery of very high energy (VHE) gamma-ray emission above 200 GeV from the high-frequency-peaked BL Lac (HBL) object RX J0648.7+1516 (GB J0648+1516), associated with 1FGL J0648.8+1516. The photon spectrum above 200 GeV is fitted by a power law dN/dE = F 0(E/E 0)-Γ with a photon index Γ of 4.4 ± 0.8stat ± 0.3syst and a flux normalization F 0 of (2.3 ± 0.5stat ± 1.2sys) × 10-11 TeV-1 cm-2 s-1 with E 0 = 300 GeV. No VHE variability is detected during VERITAS observations of RX J0648.7+1516 between 2010 March 4 and April 15. Following the VHE discovery, the optical identification and spectroscopic redshift were obtained using the Shane 3 m Telescope at the Lick Observatory, showing the unidentified object to be a BL Lac type with a redshift of z = 0.179. Broadband multiwavelength observations contemporaneous with the VERITAS exposure period can be used to subclassify the blazar as an HBL object, including data from the MDM observatory, Swift-UVOT, and X-Ray Telescope, and continuous monitoring at photon energies above 1 GeV from the Fermi Large Area Telescope (LAT). We find that in the absence of undetected, high-energy rapid variability, the one-zone synchrotron self-Compton (SSC) model overproduces the high-energy gamma-ray emission measured by the Fermi-LAT over 2.3 years. The spectral energy distribution can be parameterized satisfactorily with an external-Compton or lepto-hadronic model, which have two and six additional free parameters, respectively, compared to the one-zone SSC model.
The Ionization Source in the Nucleus of M84
NASA Technical Reports Server (NTRS)
Bower, G. A.; Green, R. F.; Quillen, A. C.; Danks, A.; Malumuth, E. M.; Gull, T.; Woodgate, B.; Hutchings, J.; Joseph, C.; Kaiser, M. E.
2000-01-01
We have obtained new Hubble Space Telescope (HST) observations of M84, a nearby massive elliptical galaxy whose nucleus contains a approximately 1.5 X 10(exp 9) solar mass dark compact object, which presumably is a supermassive black hole. Our Space Telescope Imaging Spectrograph (STIS) spectrum provides the first clear detection of emission lines in the blue (e.g., [0 II] lambda 3727, HBeta and [0 III] lambda lambda4959,5007), which arise from a compact region approximately 0".28 across centered on the nucleus. Our Near Infrared Camera and MultiObject Spectrometer (NICMOS) images exhibit the best view through the prominent dust lanes evident at optical wavelengths and provide a more accurate correction for the internal extinction. The relative fluxes of the emission lines we have detected in the blue together with those detected in the wavelength range 6295 - 6867 A by Bower et al. indicate that the gas at the nucleus is photoionized by a nonstellar process, instead of hot stars. Stellar absorption features from cool stars at the nucleus are very weak. We update the spectral energy distribution of the nuclear point source and find that although it is roughly flat in most bands, the optical to UV continuum is very red, similar to the spectral energy distribution of BL Lac. Thus, the nuclear point source seen in high-resolution optical images is not a star cluster but is instead a nonstellar source. Assuming isotropic emission from this source, we estimate that the ratio of bolometric luminosity to Eddington luminosity is about 5 x 10(exp -7). However, this could be underestimated if this source is a misaligned BL Lac object, which is a possibility suggested by the spectral energy distribution and the evidence of optical variability we describe.
NASA Astrophysics Data System (ADS)
Brisson, Cathy; Boucher, Marie-Amélie; Latraverse, Marco
2014-05-01
This research focuses on the improvement of streamflow forecasts for two subcatchments in the Lac-St-Jean area, a northern part of the province of Quebec in Canada. Those two subcatchments, named Manouane and Passes-Dangereuses, are part of a bigger system, which comprises many reservoirs and six hydropower plants. This system is managed by Rio Tinto Alcan, an aluminium producer who needs this energy for its processes. Optimal management of the hydropower plants highly depends on the reliability of the inflow forecasts to the reservoirs and also on the reliability of observed streamflow. The latter are not directly measured, but rather deduced from the computation of a water balance. This water balance includes streamflow computation based on rating curves for river sections and upstream reservoirs and a modelling process using CEQUEAU hydrological model (Morin et al., 1981). In addition, mostly during the winter, the model has to account for a transfer of water from Lac Manouane reservoir to Passes-Dangereuses through Bonnard channel. Winter flow though Bonnard channel is controlled by a spillway, and represented in CEQUEAU by a transfer function and a fixed time delay (2 days). However, it is suspected that the evacuation function, as it is currently computed, is inaccurate. The main objective of this work is to reduce predictive uncertainty for Lac Manouane and Passes-Dangereuses catchment, for the one-day ahead horizon. This objective is twofold. First, the uncertainty related to the parameterization of the hydrological model had never been evaluated. It was to be investigated whether it is better to spatialize the calibration of the hydrological model. In its actual form, the calibration of the hydrological model CEQUEAU (Morin et al., 1981) is based exclusively on the downstream outflow. There is, however, intermediate streamflow measurements data available for an intermediate location. Our study shows that calibrating the model using streamflows for both locations (intermediate location and downstream) leads to improved forecasts, as measured by the Nash-Sutcliffe efficiency criterion. The parameter sets thus determined best represent the phenomena of exchange and runoff in the watershed. Second, this study aims at reducing the uncertainty associated to the evacuation function for the Bonnard channel as well as the time delay related to this transfer. Instead of using a fixed 2-day time delay for the transfer, it was attempted to represent the channel in the hydrological model CEQUEAU and compute the time delay from this model. The results show that hydrological modelling does not improve the results and that the 2-day time delay is adequate, especially for first days of opening and few days after closure of the gate. In addition, this research shows that the evacuation function of Bonnard spillway is inexact for large streamflows. It is considered the main source of uncertainty for the prediction of inflows to the reservoirs. We also show that the evacuated streamflows can be successfully corrected by hydrological modelling. This case study shows that a careful revision of the inflow forecasting process for those important watersheds can help reduce predictive uncertainty. Although the application is specific to the Lac-St-Jean area, we believe that our experience could serve other users and water managers with similar issues regarding inflow uncertainty. Reference Morin, G., J.-P. Fortin, J.-P. Lardeau, W. Sochanska and S. Paquette. 1981. Modèle CEQUEAU : Manuel d'utilisation. Rapport de recherche no R-93, INRS-Eau, Sainte-Foy
Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël
2014-01-01
Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Iwabuchi, Kazuhisa; Nakayama, Hitoshi; Masuda, Hiromi; Kina, Katsunari; Ogawa, Hideoki; Takamori, Kenji
2012-01-01
Over the last 30 years, many studies have indicated that glycosphingolipids (GSLs) expressed on the cell surface may act as binding sites for microorganisms. Based on their physicochemical characteristics, GSLs form membrane microdomains with cholesterol, sphingomyelin, glycosylphosphatidylinositol (GPI)-anchored proteins, and various signaling molecules, and GSL-enriched domains have been shown to be involved in these defense responses. Among the GSLs, lactosylceramide (LacCer, CDw17) can bind to various microorganisms. LacCer is expressed at high levels on the plasma membrane of human neutrophils, and forms membrane microdomains associated with the Src family tyrosine kinase Lyn. LacCer-enriched membrane microdomains mediate superoxide generation, chemotaxis, and non-opsonic phagocytosis. Therefore, LacCer-enriched membrane microdomains are thought to function as pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs) expressed on microorganisms. In contrast, several pathogens have developed infection mechanisms using membrane microdomains. In addition, some pathogens have the ability to avoid degradation by escaping from the vacuolar compartment or preventing phagosome maturation, utilizing membrane microdomains, such as LacCer-enriched domains, of host cells. The detailed molecular mechanisms of these membrane microdomain-associated host-pathogen interactions remain to be elucidated. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.
Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.
Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D
1993-01-01
Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005
2015-01-01
Changes in glycosylation have been shown to have a profound correlation with development/malignancy in many cancer types. Currently, two major enrichment techniques have been widely applied in glycoproteomics, namely, lectin affinity chromatography (LAC)-based and hydrazide chemistry (HC)-based enrichments. Here we report the LC–MS/MS quantitative analyses of human blood serum glycoproteins and glycopeptides associated with esophageal diseases by LAC- and HC-based enrichment. The separate and complementary qualitative and quantitative data analyses of protein glycosylation were performed using both enrichment techniques. Chemometric and statistical evaluations, PCA plots, or ANOVA test, respectively, were employed to determine and confirm candidate cancer-associated glycoprotein/glycopeptide biomarkers. Out of 139, 59 common glycoproteins (42% overlap) were observed in both enrichment techniques. This overlap is very similar to previously published studies. The quantitation and evaluation of significantly changed glycoproteins/glycopeptides are complementary between LAC and HC enrichments. LC–ESI–MS/MS analyses indicated that 7 glycoproteins enriched by LAC and 11 glycoproteins enriched by HC showed significantly different abundances between disease-free and disease cohorts. Multiple reaction monitoring quantitation resulted in 13 glycopeptides by LAC enrichment and 10 glycosylation sites by HC enrichment to be statistically different among disease cohorts. PMID:25134008
Elliott, T
1992-01-01
This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.
Pinna, C; Stefanelli, C; Biagi, G
2014-12-01
The aim of the present study was to evaluate in vitro the effect of some prebiotic substances and 2 dietary protein levels on the composition and activity of feline fecal microbiota. Two in vitro studies were conducted. First, 6 nondigestible oligosaccharides were studied; treatments were control diet (CTRL), gluconic acid (GA), carrot fiber (CF), fructooligosaccharides (FOS), galactooligosaccharides (GOS), lactitol (LAC), and pectins from citrus fruit (PEC). Substrates were added to feline fecal cultures at 2 g/L for 24 h incubation. Compared with the CTRL, ammonia had been reduced (P<0.05) by GOS (-9%) after 6 h and by GA (-14%), LAC (-12%), and PEC (-10%) after 24 h. After 24 h, all treatments had resulted in a lower pH versus the CTRL. Putrescine concentrations at 24 h were greater (P<0.05) in cultures treated with FOS (+90%), GOS (+96%), and LAC (+87%). Compared with the CTRL, total VFA were higher (P<0.05) in bottles containing CF (+41%), whereas the acetic to propionic acid ratio was reduced by LAC (-51%; P<0.05). After 24 h, Enterobacteriaceae had been reduced (P<0.05) by LAC and PEC. In a second study, LAC and FOS were selected to be tested in the presence of 2 diets differing in their protein content. There were 6 treatments: low-protein (LP) CTRL with no addition of prebiotics (CTRL-LP), high-protein (HP) CTRL with no addition of prebiotics (CTRL-HP), LP diet plus FOS, CTRL-HP plus FOS, LP diet plus LAC, and CTRL-HP plus LAC. Both FOS and LAC were added to feline fecal cultures at 2 g/L for 24 h incubation. Ammonia at 24 h was affected (P<0.05) by the protein level (36.2 vs. 50.2 mmol/L for LP and HP, respectively). The CTRL-HPs resulted in a higher pH and increased concentrations of biogenic amines were found after 6 and 24 h of incubation (P<0.05); putrescine at 24 h showed an increase (P<0.05) in cultures treated with FOS. Total VFA were influenced (P<0.05) by the protein level (40.9 vs. 32.6 mmol/L for LP and HP, respectively). At 24 h, the CTRL-HPs were associated with increased Clostridium perfringens and reduced Lactobacillus spp. and enterococci counts (P<0.05). The results from the present study show that different prebiotics exert different effects on the composition and activity of feline intestinal microbiota and that high dietary protein levels in a cat's diet can have negative effects on the animal intestinal environment.
Qiao, Liang; Liu, Zhi
2015-07-01
To discuss the risk factors of acute respiratory distress syndrome (ARDS) in patients with sepsis in emergency department. 312 patients with sepsis admitted to Department of Emergency of China Medical University Affiliated First Hospital were retrospectively analyzed, and they were divided into two groups according to development of ARDS, which was defined according to the Berlin new definition. The age, gender, vital signs, laboratory results, underlying disease, the mortality in emergency department sepsis (MEDS) score and lung injury prediction score (LIPS) were collected. Univariate analysis was done for each parameter. Statistical significance results were evaluated by multivariate logistic regression analysis. Receiver operating characteristic (ROC) curve was plotted to analyze the predictive value of the parameter for ARDS. The incidence of sepsis-related ARDS was 11.2% (35/312). Within 35 cases of ARDS, there were 10 cases of mild ARDS, 18 cases of moderate ARDS, and 7 cases of severe ARDS. Univariate analysis showed that age (t=-2.134, P=0.035), oxygenation index (t=-4.245, P=0.001), arterial lactate (Lac, t=6.245, P<0.001), drugs for vascular diseases (χ2=4.261, P=0.026), shock (χ2=4.386, P=0.021), MEDS (t=4.021, P=0.045), LIPS (t=5.569, P<0.001), lung infections (χ2=4.289, P=0.025), and mechanical ventilation (χ2=6.245, P=0.001) were related to ARDS. The incidence of ARDS was different in different levels of Lac, which was 5.00% (3/16) at low level of Lac (<2.0 mmol/L), 9.46% (14/148) at middle level of Lac (2.0-3.9 mmol/L) and 17.31% (18/104) at high level of Lac (≥4.0 mmol/L). It was shown by multivariate logistic regression analysis that LIPS [ odds ratio (OR)=5.124, 95% confidence interval (95%CI)=3.642-10.153, P=0.002], Lac (OR=18.180, 95%CI=7.677-32.989, P<0.001) were independent risk factors for ARDS. It was shown by area under ROC (AUC) that the predictive value of LIPS and Lac in ARDS occurrence was significant. AUC of LIPS was 0.725, the cut-off value was 7, when LIPS≥7, the sensitivity was 71.0%, specificity was 75.6%. AUC of Lac was 0.793, the cut-off value was 4.2 mmol/L, when Lac≥4.2 mmol/L, the sensitivity was 72.1%, and specificity was 81.9%. LIPS and Lac are independent risk factors of ARDS in patients with sepsis in emergency department, which may be a reference for the early clinical diagnosis of ARDS.
Ectopically tethered CP190 induces large-scale chromatin decondensation
NASA Astrophysics Data System (ADS)
Ahanger, Sajad H.; Günther, Katharina; Weth, Oliver; Bartkuhn, Marek; Bhonde, Ramesh R.; Shouche, Yogesh S.; Renkawitz, Rainer
2014-01-01
Insulator mediated alteration in higher-order chromatin and/or nucleosome organization is an important aspect of epigenetic gene regulation. Recent studies have suggested a key role for CP190 in such processes. In this study, we analysed the effects of ectopically tethered insulator factors on chromatin structure and found that CP190 induces large-scale decondensation when targeted to a condensed lacO array in mammalian and Drosophila cells. In contrast, dCTCF alone, is unable to cause such a decondensation, however, when CP190 is present, dCTCF recruits it to the lacO array and mediates chromatin unfolding. The CP190 induced opening of chromatin may not be correlated with transcriptional activation, as binding of CP190 does not enhance luciferase activity in reporter assays. We propose that CP190 may mediate histone modification and chromatin remodelling activity to induce an open chromatin state by its direct recruitment or targeting by a DNA binding factor such as dCTCF.
The Evolution of Swift/BAT blazars and the origin of the MeV background
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ajello, M.; /SLAC /KIPAC, Menlo Park; Costamante, L.
2009-10-17
We use 3 years of data from the Swift/BAT survey to select a complete sample of X-ray blazars above 15 keV. This sample comprises 26 Flat-Spectrum Radio Quasars (FSRQs) and 12 BL Lac objects detected over a redshift range of 0.03 < z < 4.0. We use this sample to determine, for the first time in the 15-55 keV band, the evolution of blazars. We find that, contrary to the Seyfert-like AGNs detected by BAT, the population of blazars shows strong positive evolution. This evolution is comparable to the evolution of luminous optical QSOs and luminous X-ray selected AGNs. Wemore » also find evidence for an epoch-dependence of the evolution as determined previously for radio-quiet AGNs. We interpret both these findings as a strong link between accretion and jet activity. In our sample, the FSRQs evolve strongly, while our best-fit shows that BL Lacs might not evolve at all. The blazar population accounts for 10-20% (depending on the evolution of the BL Lacs) of the Cosmic X-ray background (CXB) in the 15-55 keV band. We find that FSRQs can explain the entire CXB emission for energies above 500 keV solving the mystery of the generation of the MeV background. The evolution of luminous FSRQs shows a peak in redshift (z{sub c} = 4.3 {+-} 0.5) which is larger than the one observed in QSOs and X-ray selected AGNs. We argue that FSRQs can be used as tracers of massive elliptical galaxies in the early Universe.« less
Perez, Laura; Lurmann, Fred; Wilson, John; Pastor, Manuel; Brandt, Sylvia J.; Künzli, Nino
2012-01-01
Background: The emerging consensus that exposure to near-roadway traffic-related pollution causes asthma has implications for compact urban development policies designed to reduce driving and greenhouse gases. Objectives: We estimated the current burden of childhood asthma-related disease attributable to near-roadway and regional air pollution in Los Angeles County (LAC) and the potential health impact of regional pollution reduction associated with changes in population along major traffic corridors. Methods: The burden of asthma attributable to the dual effects of near-roadway and regional air pollution was estimated, using nitrogen dioxide and ozone as markers of urban combustion-related and secondary oxidant pollution, respectively. We also estimated the impact of alternative scenarios that assumed a 20% reduction in regional pollution in combination with a 3.6% reduction or 3.6% increase in the proportion of the total population living near major roads, a proxy for near-roadway exposure. Results: We estimated that 27,100 cases of childhood asthma (8% of total) in LAC were at least partly attributable to pollution associated with residential location within 75 m of a major road. As a result, a substantial proportion of asthma-related morbidity is a consequence of near-roadway pollution, even if symptoms are triggered by other factors. Benefits resulting from a 20% regional pollution reduction varied markedly depending on the associated change in near-roadway proximity. Conclusions: Our findings suggest that there are large and previously unappreciated public health consequences of air pollution in LAC and probably in other metropolitan areas with dense traffic corridors. To maximize health benefits, compact urban development strategies should be coupled with policies to reduce near-roadway pollution exposure. PMID:23008270
Beach, Dale L.; Alvarez, Consuelo J.
2015-01-01
Synthetic biology offers an ideal opportunity to promote undergraduate laboratory courses with research-style projects, immersing students in an inquiry-based program that enhances the experience of the scientific process. We designed a semester-long, project-based laboratory curriculum using synthetic biology principles to develop a novel sensory device. Students develop subject matter knowledge of molecular genetics and practical skills relevant to molecular biology, recombinant DNA techniques, and information literacy. During the spring semesters of 2014 and 2015, the Synthetic Biology Laboratory Project was delivered to sophomore genetics courses. Using a cloning strategy based on standardized BioBrick genetic “parts,” students construct a “reporter plasmid” expressing a reporter gene (GFP) controlled by a hybrid promoter regulated by the lac-repressor protein (lacI). In combination with a “sensor plasmid,” the production of the reporter phenotype is inhibited in the presence of a target environmental agent, arabinose. When arabinose is absent, constitutive GFP expression makes cells glow green. But the presence of arabinose activates a second promoter (pBAD) to produce a lac-repressor protein that will inhibit GFP production. Student learning was assessed relative to five learning objectives, using a student survey administered at the beginning (pre-survey) and end (post-survey) of the course, and an additional 15 open-ended questions from five graded Progress Report assignments collected throughout the course. Students demonstrated significant learning gains (p < 0.05) for all learning outcomes. Ninety percent of students indicated that the Synthetic Biology Laboratory Project enhanced their understanding of molecular genetics. The laboratory project is highly adaptable for both introductory and advanced courses. PMID:26753032
Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A
1998-06-01
We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.
Comparison of vonoprazan and proton pump inhibitors for eradication of Helicobacter pylori.
Shinozaki, Satoshi; Nomoto, Hiroaki; Kondo, Yoshie; Sakamoto, Hirotsugu; Hayashi, Yoshikazu; Yamamoto, Hironori; Lefor, Alan Kawarai; Osawa, Hiroyuki
2016-05-01
Alternative eradication therapies for Helicobacter pylori infection are needed because of an increasing failure rate over the past decade. The aim of this study was to determine if vonoprazan, a new potassium-competitive acid blocker, showed superiority to existing proton pump inhibitors for primary eradication of H. pylori in routine clinical practice. Data for 573 patients who underwent primary H. pylori eradication therapy were retrospectively reviewed. Regimens included clarithromycin 200 mg, amoxicillin 750 mg, and an acid-suppressing drug [lansoprazole 30 mg (LAC), rabeprazole 10 mg (RAC), esomeprazole 20 mg (EAC), or vonoprazan 20 mg (VAC)] twice daily for 1 week. Eradication was successful in 73% (419/573) of patients using intention-to-treat (ITT) analysis and 76% (419/549) of patients in per-protocol (PP) analysis. The VAC group had a significantly superior eradication rate compared with the LAC and RAC groups in ITT (VAC 83%, LAC 66% and RAC 67%, p < 0.01) and PP analysis (VAC 85%, LAC 69% and RAC 70%, p < 0.01), and had a similarly high eradication rate to the EAC group (83% in ITT and 87% in PP). Although the eradication rate in the VAC and EAC groups was not significantly higher than in the LAC and RAC groups in patients with mild gastric atrophy with both ITT and PP analyses, it was significantly higher in patients with severe gastric atrophy (p < 0.01). The VAC group had a significantly higher H. pylori eradication rate than the LAC and RAC groups, and a > 80% eradication rate regardless of the degree of atrophy. Copyright © 2016. Published by Elsevier Taiwan.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Staedtler, F.; Locher, F.; Sreenan, G.
1997-10-01
In order to evaluate the in vivo genotoxic potential of three putative genotoxic mouse liver carcinogens, high doses of 4-chloro-o-phenylenediamine, 2-nitro-p-phenylenediamine and 2, 4-diaminotoluene were tested short term in the Big Blue{reg_sign} transgenic mouse mutation assay. Small statistically significant increases in the lacI mutant frequencies in the liver by factors 1.7 to 2.0 were found. A representative number of 347 lacI mutants isolated from liver tissue of male and female animals were analyses by DNA sequencing. The mutational spectra were examined with the Adams-Skopek algorithm. The spontaneous mutational spectra from untreated male and female animals were similar and consistent withmore » spectral Big Blue{reg_sign} control data stored in the lacI database. Most of the background mutations were located in the 5{prime} portion of the coding region of the lacI gene. Single base substitutions were most prominent. G:C to A:T transitions and G:C to T:A transversions occurred predominatly and were preferentially located at CpG sites. Despite the increases observed in the mutant frequencies of the treated animals, the corresponding mutational spectra did not differ from the controls. However, it is possible that certain classes of point mutations were substantially increased but not detected due to the limited number of sequenced mutants. In two animals treated with 2, 4- diaminotoluene unusually high mutant frequencies and the multiple occurrence of certain mutations in the liver was observed. From one of these animals six lacI mutants isolated from colon tissue were all different. Since 2, 4-diaminotoluene was shown to induce liver cell proliferation these results may reflect clonal expansion of single mutated liver cells.« less
Shinkai, Yoichi; Kuramochi, Masahiro; Doi, Motomichi
2018-05-03
Recently, advances in next-generation sequencing technologies have enabled genome-wide analyses of epigenetic modifications; however, it remains difficult to analyze the states of histone modifications at a single-cell resolution in living multicellular organisms because of the heterogeneity within cellular populations. Here we describe a simple method to visualize histone modifications on the specific sequence of target locus at a single-cell resolution in living Caenorhabditis elegans , by combining the LacO/LacI system and a genetically-encoded H4K20me1-specific probe, "mintbody". We demonstrate that Venus-labeled mintbody and mTurquoise2-labeled LacI can co-localize on an artificial chromosome carrying both the target locus and LacO sequences, where H4K20me1 marks the target locus. We demonstrate that our visualization method can precisely detect H4K20me1 depositions on the her-1 gene sequences on the artificial chromosome, to which the dosage compensation complex binds to regulate sex determination. The degree of H4K20me1 deposition on the her-1 sequences on the artificial chromosome correlated strongly with sex, suggesting that, using the artificial chromosome, this method can reflect context-dependent changes of H4K20me1 on endogenous genomes. Furthermore, we demonstrate live imaging of H4K20me1 depositions on the artificial chromosome. Combined with ChIP assays, this mintbody-LacO/LacI visualization method will enable analysis of developmental and context-dependent alterations of locus-specific histone modifications in specific cells and elucidation of the underlying molecular mechanisms. Copyright © 2018, G3: Genes, Genomes, Genetics.
Bersani, Giuseppe; Meco, Giuseppe; Denaro, Alessandro; Liberati, Damien; Colletti, Chiara; Nicolai, Raffaella; Bersani, Francesco Saverio; Koverech, Aleardo
2013-10-01
L-Acetylcarnitine (LAC), the acetyl ester of carnitine naturally present in the central nervous system and involved in several neural pathways, has been demonstrated to be active in various animal experimental models resembling some features of human depression. The aim of the study is to verify whether LAC can have an antidepressant action in a population of elderly patients with dysthymic disorder in comparison with a traditional antidepressant such as fluoxetine. Multicentric, double-blind, double-dummy, controlled, randomized study based on a observation period of 7 weeks. 80 patients with DSM-IV diagnosis of dysthymic disorder were enrolled in the study and subdivided into 2 groups. Group A patients received LAC plus placebo; group B patients received fluoxetine 20 mg/die plus placebo. Clinical assessment was performed through several psychometric scales at 6 different moments. Group A patients showed a statistically significant improvement in the following scales: HAM-D, HAM-A, BDI and Touluse Pieron Test. Comparison between the two groups, A and B, generally showed very similar clinical progression. The results obtained with LAC and fluoxetine were equivalent. As the subjects in this study were of senile age, it is possible to hypothesize that the LAC positive effect on mood could be associated with improvement in subjective cognitive symptomatology. The difference in the latency time of clinical response (1 week of LAC treatment, compared with the 2 weeks' latency time with fluoxetine) suggests the existence of different mechanisms of action possibly in relation to the activation of rapid support processes of neuronal activity. Copyright © 2012 Elsevier B.V. and ECNP. All rights reserved.
Borrell, Jordi H; Montero, M Teresa; Morros, Antoni; Domènech, Òscar
2015-11-01
In this work, we will describe in quantitative terms the unspecific recognition between lactose permease (LacY) of Escherichia coli, a polytopic model membrane protein, and one of the main components of the inner membrane of this bacterium. Supported lipid bilayers of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) (3:1, mol/mol) in the presence of Ca(2+) display lateral phase segregation that can be distinguished by atomic force microscopy (AFM) as well as force spectroscopy. LacY shows preference for fluid (Lα) phases when it is reconstituted in POPE : POPG (3:1, mol/mol) proteoliposomes at a lipid-to-protein ratio of 40. When the lipid-to-protein ratio is decreased down to 0.5, two domains can be distinguished by AFM. While the upper domain is formed by self-segregated units of LacY, the lower domain is constituted only by phospholipids in gel (Lβ) phase. On the one hand, classical differential scanning calorimetry (DSC) measurements evidenced the segregation of a population of phospholipids and point to the existence of a boundary region at the lipid-protein interface. On the other hand, Förster Resonance Energy Transfer (FRET) measurements in solution evidenced that POPE is selectively recognized by LacY. A binary pseudophase diagram of POPE : POPG built from AFM observations enables to calculate the composition of the fluid phase where LacY is inserted. These results are consistent with a model where POPE constitutes the main component of the lipid-LacY interface segregated from the fluid bulk phase where POPG predominates. Copyright © 2015 John Wiley & Sons, Ltd.
Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.
Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco
2013-04-01
Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.
Deep Eutectic Solvents (DESs) for the Isolation of Willow Lignin (Salix matsudana cv. Zhuliu)
Li, Tengfei; Liu, Yu; Lou, Rui; Yang, Guihua; Chen, Jiachuan; Saeed, Haroon A. M.
2017-01-01
Deep eutectic solvents (DESs) are a potentially high-value lignin extraction methodology. DESs prepared from choline chloride (ChCl) and three hydrogen-bond donors (HBD)—lactic acid (Lac), glycerol, and urea—were evaluated for isolation of willow (Salix matsudana cv. Zhuliu) lignin. DESs types, mole ratio of ChCl to HBD, extraction temperature, and time on the fractionated DES-lignin yield demonstrated that the optimal DES-lignin yield (91.8 wt % based on the initial lignin in willow) with high purity of 94.5% can be reached at a ChCl-to-Lac molar ratio of 1:10, extraction temperature of 120 °C, and time of 12 h. Fourier transform infrared spectroscopy (FT-IR) , 13C-NMR, and 31P-NMR showed that willow lignin extracted by ChCl-Lac was mainly composed of syringyl and guaiacyl units. Serendipitously, a majority of the glucan in willow was preserved after ChCl-Lac treatment. PMID:29143790
An alkaline bacterial laccase for polymerization of natural precursors for hair dye synthesis.
Kumar, Deepak; Kumar, Aditya; Sondhi, Sonica; Sharma, Prince; Gupta, Naveen
2018-03-01
In the present study, an extracellular alkali stable laccase (Lac DS) from Bacillus subtilis DS which has pH optima at 8.5 using p -phenylenediamine (PPD) as substrate has been reported. Lac DS retained 70% activity for 4 h at pH 8.5 and 90% activity for 24 h at 55 °C. The enzyme yield was enhanced by optimization of fermentation conditions. A 746-fold increase in yield was observed under optimized conditions using 150 µM MgSO 4 , 1.2% yeast extract, 0.35% tryptone, and 150 µM vanillic acid. Lac DS was used to polymerize natural dye precursor catechol, pyrogallol, syringaldehyde, syringic acid, ferulic acid and gallic acid to develop a range of natural hair colors such as black, golden yellow, and reddish brown. The results indicate that alkaline Lac DS is a suitable candidate to develop a user-friendly and commercially applicable hair dyeing process in the area of cosmetic industry.
Direct adenovirus-mediated gene delivery to the temporomandibular joint in guinea-pigs.
Kuboki, T; Nakanishi, T; Kanyama, M; Sonoyama, W; Fujisawa, T; Kobayashi, K; Ikeda, T; Kubo, T; Yamashita, A; Takigawa, M
1999-09-01
Adenovirus vector system is expected to be useful for direct gene therapy for joint disease. This study first sought to confirm that foreign genes can be transferred to articular chondrocytes in primary culture. Next, recombinant adenovirus vectors harbouring beta-galactosidase gene (LacZ) was injected directly into the temporomandibular joints of Hartley guinea-pigs to clarify the in vivo transfer availability of the adenovirus vectors. Specifically, recombinant adenovirus harbouring LacZ gene (AxlCALacZ) was injected into the upper joint cavities of both mandibular joints of four male 6-week-old Hartley guinea-pigs. Either the same amount of recombinant adenovirus without LacZ gene (Axlw) suspension (placebo) or the same amount of phosphate-buffered saline solution (control) were injected into the upper joint cavities of both joints of another four male guinea-pigs. At 1, 2, 3 and 4 weeks after injection, the joints were dissected and the expression of delivered LacZ was examined by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal) staining and reverse transcriptase-polymerase chain reaction (RT-PCR). To investigate the expression of transferred gene in other organs, total RNA was extracted from liver, kidney, heart and brain and the expression of LacZ mRNA and 18 S ribosomal RNA were analysed by RT-PCR. Clear expression of LacZ was observed in the articular surfaces of the temporal tubercle, articular disc and synovium of the temporomandibular joints even 4 weeks after injection in the AxlCALacZ-injected group, while no expression was detected in placebo and control groups. Histological examination confirmed that LacZ activity was clearly detected in a few cell layers of the articular surface tissues, which is much more efficient than in a previously study of the knee joint. In the other organs, expression of the delivered transgene was not observed. Based on these findings, direct gene delivery into the articular surface of the temporomandibular joint using the adenovirus vector is feasible as an effective in vivo method.
NASA Astrophysics Data System (ADS)
Carby, B. E.
2015-12-01
Latin American and Caribbean (LAC) countries face multiple hazards such as earthquakes, volcanoes, accelerated erosion, landslides, drought, flooding, windstorms and the effects of climate variability and change. World Bank (2005) data indicate that seventeen of the top thirty-five countries with relatively high mortality risk from 3 or more hazards are located in LAC, El Salvador has the second highest per cent of its population at risk - 77.7% and 7 of the top 10 countries for population exposure to multiple hazards are in LAC. All LAC countries have half or more of GDP exposed to at least one hazard. The report underscores the need for better data and information on hazards and disasters to inform disaster risk reduction (DRR) and supports the view that reduction of disaster risk is essential for achieving Sustainable Development (SD). This suggests that DRR must be integrated into development planning of countries. However the Global Assessment Report notes that globally, there has been little progress in mainstreaming DRR in national development (UNISDR 2009). Without this, countries will not realise development goals. DRR efforts in LAC require an integrated approach including societal input in deciding priority DRR research themes and interdisciplinary, multi-hazard research informing DRR policy and practice. Jiminez (2015) from a study of countries across LAC reports that efforts are being made to link research to national planning through inclusion of policy makers in some university-led research projects. Research by the author in Jamaica reveals that the public sector has started to apply research on hazards to inform DRR policy, programmes and plans. As most research is done by universities, there is collaboration between the public sector and academia. Despite differences in scale among countries across the region, similarities in exposure to multiple hazards and potential hazard impacts suggest that collaboration among researchers in LAC could be beneficial. It is proposed here that this collaboration should go beyond the scientific community and should include sharing of experiences in linking DRR research to national development needs, inclusion of policy makers in research design and implementation and integration of research results in policy and programme development.
What are the blood lead levels of children living in Latin America and the Caribbean?
Olympio, Kelly Polido Kaneshiro; Gonçalves, Cláudia Gaudência; Salles, Fernanda Junqueira; Ferreira, Ana Paula Sacone da Silva; Soares, Agnes Silva; Buzalaf, Marília Afonso Rabelo; Cardoso, Maria Regina Alves; Bechara, Etelvino José Henriques
2017-04-01
Information on the prevalence of lead exposure is essential to formulate efficient public health policies. Developed countries have implemented successful public policies for the prevention and control of lead poisoning. In the United States, Canada, Japan and the European Union, for instance, periodically repeated prevalence studies show that blood lead levels (BLLs) in children have decreased overall. Although BLL of Latino children in the U.S. have also dropped in recent years, the geometric mean remains higher than that of white children. Little is known about lead exposure in children in Latin America and the Caribbean (LAC). In this review, we responded to two questions: What is currently known about lead sources and levels in children in LAC? Are there public policies to prevent children's exposure to lead in LAC? We conducted a literature review covering the period from January 2000 to March 2014 in the PubMed and Lilacs databases to obtain English, Portuguese and Spanish language studies reporting the prevalence of BLLs in children aged 0-18years living in LAC countries. No specific analytical method was selected, and given the scarcity of data, the study was highly inclusive. Fifty-six papers were selected from 16 different LAC countries. The children's BLLs found in this review are high (≥10μg/dL) compared to BLLs for the same age group in the U. S. However, most studies reported an association with some type of "lead hot spot", in which children can be exposed to lead levels similar to those of occupational settings. Only Peru and Mexico reported BLLs in children from population-based studies. Most BLLs prevalence studies carried out in LAC were in areas with known emission sources. The percentage of children at risk of lead poisoning in LAC is unknown, and probably underestimated. Thus, there is an urgent need to establish public health policies to quantify and prevent lead poisoning, specifically by prioritizing the identification and control of "hot spots". Copyright © 2017 Elsevier Ltd. All rights reserved.
Dangles, Olivier; Loirat, Jean; Freour, Claire; Serre, Sandrine; Vacher, Jean; Le Roux, Xavier
2016-01-01
Biodiversity loss and climate change are both globally significant issues that must be addressed through collaboration across countries and disciplines. With the December 2015 COP21 climate conference in Paris and the recent creation of the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES), it has become critical to evaluate the capacity for global research networks to develop at the interface between biodiversity and climate change. In the context of the European Union (EU) strategy to stand as a world leader in tackling global challenges, the European Commission has promoted ties between the EU and Latin America and the Caribbean (LAC) in science, technology and innovation. However, it is not clear how these significant interactions impact scientific cooperation at the interface of biodiversity and climate change. We looked at research collaborations between two major regions-the European Research Area (ERA) and LAC-that addressed both biodiversity and climate change. We analysed the temporal evolution of these collaborations, whether they were led by ERA or LAC teams, and which research domains they covered. We surveyed publications listed on the Web of Science that were authored by researchers from both the ERA and LAC and that were published between 2003 and 2013. We also run similar analyses on other topics and other continents to provide baseline comparisons. Our results revealed a steady increase in scientific co-authorships between ERA and LAC countries as a result of the increasingly complex web of relationships that has been weaved among scientists from the two regions. The ERA-LAC co-authorship increase for biodiversity and climate change was higher than those reported for other topics and for collaboration with other continents. We also found strong differences in international collaboration patterns within the LAC: co-publications were fewest from researchers in low- and lower-middle-income countries and most prevalent from researchers in emerging countries like Mexico and Brazil. Overall, interdisciplinary publications represented 25.8% of all publications at the interface of biodiversity and climate change in the ERA-LAC network. Further scientific collaborations should be promoted 1) to prevent less developed countries from being isolated from the global cooperation network, 2) to ensure that scientists from these countries are trained to lead visible and recognized biodiversity and climate change research, and 3) to develop common study models that better integrate multiple scientific disciplines and better support decision-making.
Influence of salt content and processing time on sensory characteristics of cooked "lacón".
Purriños, Laura; Bermúdez, Roberto; Temperán, Sara; Franco, Daniel; Carballo, Javier; Lorenzo, José M
2011-04-01
The influence of salt content and processing time on the sensory properties of cooked "lacón" were determined. "Lacón" is a traditional dry-cured and ripened meat product made in the north-west of Spain from the fore leg of the pig, following a similar process to that of dry-cured ham. Six batches of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)) and ripened during two times (56 and 84 days of dry-ripening). Cured odour in all batches studied, red colour and rancid odour in MS and HS batches, flavour intensity in MS batch and fat yellowness, rancid flavour and hardness in the HS batch were significantly different with respect to the time of processing. Appearance, odour, flavour and texture were not significantly affected by the salt content (P>0.05). However, the saltiness score showed significant differences with respect to the salt levels in all studied batches (56 and 84 days of process). The principal component analysis showed that physicochemical traits were the most important ones concerning the quality of dry-cured "lacón" and offered a good separation of the mean samples according to the dry ripening days and salt level. © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.
GSL-enriched membrane microdomains in innate immune responses.
Nakayama, Hitoshi; Ogawa, Hideoki; Takamori, Kenji; Iwabuchi, Kazuhisa
2013-06-01
Many pathogens target glycosphingolipids (GSLs), which, together with cholesterol, GPI-anchored proteins, and various signaling molecules, cluster on host cell membranes to form GSL-enriched membrane microdomains (lipid rafts). These GSL-enriched membrane microdomains may therefore be involved in host-pathogen interactions. Innate immune responses are triggered by the association of pathogens with phagocytes, such as neutrophils, macrophages and dendritic cells. Phagocytes express a diverse array of pattern-recognition receptors (PRRs), which sense invading microorganisms and trigger pathogen-specific signaling. PRRs can recognize highly conserved pathogen-associated molecular patterns expressed on microorganisms. The GSL lactosylceramide (LacCer, CDw17), which binds to various microorganisms, including Candida albicans, is expressed predominantly on the plasma membranes of human mature neutrophils and forms membrane microdomains together with the Src family tyrosine kinase Lyn. These LacCer-enriched membrane microdomains can mediate superoxide generation, migration, and phagocytosis, indicating that LacCer functions as a PRR in innate immunity. Moreover, the interactions of GSL-enriched membrane microdomains with membrane proteins, such as growth factor receptors, are important in mediating the physiological properties of these proteins. Similarly, we recently found that interactions between LacCer-enriched membrane microdomains and CD11b/CD18 (Mac-1, CR3, or αMβ2-integrin) are significant for neutrophil phagocytosis of non-opsonized microorganisms. This review describes the functional role of LacCer-enriched membrane microdomains and their interactions with CD11b/CD18.
Genome engineering using a synthetic gene circuit in Bacillus subtilis.
Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun
2015-03-31
Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing
2018-03-21
Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.
Zhang, Jing; Lu, Luyao; Chen, Feng; Chen, Lingling; Yin, Jingang; Huang, Xing
2018-01-05
A bacterial strain Za capable of degrading diphenyl ether herbicide lactofen was isolated and identified as Bacillus sp. This strain could degrade 94.8% of 50mgL -1 lactofen after 4days of inoculation in flasks. It was revealed that lactofen was initially hydrolyzed to desethyl lactofen, which was further transformed to acifluorfen, followed by the reduction of the nitro group to yield aminoacifluorfen. The phytotoxicity of the transformed product aminoacifluorfen to maize was decreased significantly compared with the lactofen. A gene lacE, encoding an esterase responsible for lactofen hydrolysis to desethyl lactofen and acifluorfen continuously, was cloned from Bacillus sp. Za. The deduced amino acid belonging to the esterase family VII contained a typical Ser-His-Asp/Glu catalytic triad and the conserved motifs GXSXG. The purified recombinant protein LacE displayed maximal esterase activity at 40°C and pH 7.0. Additionally, LacE had broad substrate specificity and was capable of hydrolyzing p-nitrophenyl esters. The enantioselectivity of LacE during lactofen degradation was further studied, and the results indicated that the (S)-(+)-lactofen was degraded faster than the (R)-(-)-lactofen, which could illustrate the reported phenomenon that (S)-(+)-lactofen was preferentially degraded in soil and sediment. Copyright © 2017 Elsevier B.V. All rights reserved.
Nielsen, J T; Liesack, W; Finster, K
1999-04-01
A sulfate-reducing bacterium, designated strain lacT, was isolated from surface-sterilized roots of the benthic macrophyte Zostera marina. Cells were motile by means of a single polar flagellum. Strain lacT utilized lactate, pyruvate, malate, ethanol, L-alanine, fumarate, choline and fructose with sulfate as electron acceptor. In addition, fumarate, pyruvate and fructose were also degraded without an external electron acceptor. Sulfate could be substituted with thiosulfate, sulfite and elemental sulfur. Optimal growth was observed between 32.5 and 34.5 degrees C, at an NaCl concentration of 0.2 M and in a pH range between 6.8 and 7.3. The G + C content of the DNA was 42.7 +/- 0.2 mol%. Desulfoviridin and catalase were present. Strain lacT contained c-type cytochromes. Comparative 16S rRNA gene sequence analysis and the fatty acid pattern grouped this isolate into the genus Desulfovibrio. However, strain lacT differs from all other described Desulfovibrio species on the bases of its 16S rRNA gene sequence, the G + C content, its cellular lipid pattern and the utilization pattern of substrates. These characteristics establish strain lacT (= DSM 11974T) as a novel species of the genus Desulfovibrio, for which the name Desulfovibrio zosterae sp. nov. is proposed.
A physical classification scheme for blazars
NASA Astrophysics Data System (ADS)
Landt, Hermine; Padovani, Paolo; Perlman, Eric S.; Giommi, Paolo
2004-06-01
Blazars are currently separated into BL Lacertae objects (BL Lacs) and flat spectrum radio quasars based on the strength of their emission lines. This is performed rather arbitrarily by defining a diagonal line in the Ca H&K break value-equivalent width plane, following Marchã et al. We readdress this problem and put the classification scheme for blazars on firm physical grounds. We study ~100 blazars and radio galaxies from the Deep X-ray Radio Blazar Survey (DXRBS) and 2-Jy radio survey and find a significant bimodality for the narrow emission line [OIII]λ5007. This suggests the presence of two physically distinct classes of radio-loud active galactic nuclei (AGN). We show that all radio-loud AGN, blazars and radio galaxies, can be effectively separated into weak- and strong-lined sources using the [OIII]λ5007-[OII]λ3727 equivalent width plane. This plane allows one to disentangle orientation effects from intrinsic variations in radio-loud AGN. Based on DXRBS, the strongly beamed sources of the new class of weak-lined radio-loud AGN are made up of BL Lacs at the ~75 per cent level, whereas those of the strong-lined radio-loud AGN include mostly (~97 per cent) quasars.
Fermi LAT detection of renewed GeV flaring activity from PKS 0426-380
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2012-12-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 0426-380 (also known as 2FGL J0428.6-3756, Nolan et al. 2012, ApJS, 199, 31, and RX J0428.6-3756) with radio coordinates R.A.: 67.16843 deg, Dec: -37.93877 deg, J2000 (Johnston et al. 1995, AJ, 110, 880) and redshift z=1.111 (Heidt et al....
Voids as alternatives to dark energy and the propagation of γ rays through the universe.
DeLavallaz, Arnaud; Fairbairn, Malcolm
2012-04-27
We test the opacity of a void universe to TeV energy γ rays having obtained the extragalactic background light in that universe using a simple model and the observed constraints on the star formation rate history. We find that the void universe has significantly more opacity than a Λ cold dark matter universe, putting it at odds with observations of BL-Lac objects. We argue that while this method of distinguishing between the two cosmologies contains uncertainties, it circumvents any debates over fine-tuning.
Lac Courte Oreilles Hydro Dam Assessment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weaver, Jason; Meyers, Amy
The main objective of this project was to investigate upgrading the existing hydro power generating system at the Winter Dam. The tribe would like to produce more energy and receive a fair market power purchase agreement so the dam is no longer a drain on our budget but a contributor to our economy. We contracted Kiser Hydro, LLC Engineering for this project and received an engineering report that includes options for producing more energy with cost effective upgrades to the existing turbines. Included in this project was a negotiation of energy price sales negotiations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdel-Kareem, O.; Eltokhy, A.; Harith, M. A.
2011-09-22
This study aims to evaluate the use of Laser Fluorescent as a non-destructive technique for identification of natural dyes on archaeological textile objects. In this study wool textile samples were dyed with 10 natural dyes such as cochineal, cutch, henna, indigo, Lac, madder, safflower, saffron, sumac and turmeric. These dyes common present on archaeological textile objects to be used as standard dyed textile samples. These selected natural dyes will be used as known references that can be used a guide to identify unknown archaeological dyes. The dyed textile samples were investigated with laser radiation in different wavelengths to detect themore » best wavelengths for identification each dye. This study confirms that Laser Florescent is very useful and a rapid technique can be used as a non-destructive technique for identification of natural dyes on archaeological textile objects. The results obtained with this study can be a guide for all conservators in identification of natural organic dyes on archaeological textile objects.« less
NASA Astrophysics Data System (ADS)
Abdel-Kareem, O.; Eltokhy, A.; Harith, M. A.
2011-09-01
This study aims to evaluate the use of Laser Fluorescent as a non-destructive technique for identification of natural dyes on archaeological textile objects. In this study wool textile samples were dyed with 10 natural dyes such as cochineal, cutch, henna, indigo, Lac, madder, safflower, saffron, sumac and turmeric. These dyes common present on archaeological textile objects to be used as standard dyed textile samples. These selected natural dyes will be used as known references that can be used a guide to identify unknown archaeological dyes. The dyed textile samples were investigated with laser radiation in different wavelengths to detect the best wavelengths for identification each dye. This study confirms that Laser Florescent is very useful and a rapid technique can be used as a non-destructive technique for identification of natural dyes on archaeological textile objects. The results obtained with this study can be a guide for all conservators in identification of natural organic dyes on archaeological textile objects.
Beyond wilderness: Broadening the applicability of limits of acceptable change
Mark W. Brunson
1977-01-01
The Limits of Acceptable Change (LAC) process helps managers preserve wilderness attributes along with recreation opportunities. Ecosystem management likewise requires managers to balance societal and ecosystem needs. Both are more likely to succeed through collaborative planning. Consequently, LAC can offer a conceptual framework for achieving sustainable solutions...
NPDES Permit – East Lake Sewage Lagoon – Mille Lacs Indian Reservation (Aitkin County, MN)
EPA proposes to reissue a NPDES permit for the treated wastewater discharges from the East Lake Sewage Lagoon located within the boundaries of the Mille Lacs Indian Reservation located in East Lake (McGregor), Minnesota (Aitkin County) to be issued by EPA.
Paratachardina pseudolobata (Cocccoidea: Kerriidae): bionomics in Florida
USDA-ARS?s Scientific Manuscript database
Observations on the bionomics of lobate lac scale, Paratachardina pseudolobata Kondo & Gullan in Florida are reported. Lobate lac scale infests primarily the branches and main stems of <2 cm in dia; rarely were they found on stems larger than 4 cm in dia or on leaves and never on roots. They produce...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-19
... Fredrichs, Assistant Division Administrator, Federal Highway Administration, Madison, Wisconsin. [FR Doc... capacity improvements to Wisconsin Highway 23 from U.S. Highway 151 to County Highway P in Fond du Lac and Sheboygan Counties, Wisconsin. FOR FURTHER INFORMATION CONTACT: Bethaney Bacher-Gresock, Environmental...
Manager Pumped on Tribal College Degree
ERIC Educational Resources Information Center
Ness, Jean E.
2005-01-01
This column relates the story of Dylan Olson, a struggling business student at Fond du Lac Tribal and Community College (Cloquet, Minnesota). During construction of a new gas and convenience store on the Fond du Lac Reservation, Olson recognized an opportunity, applied for the manager's position, and was hired. Olson's experience illustrates the…
Xia, Jun-Qing; Cuoco, Alessandro; Branchini, Enzo; ...
2015-03-24
Building on our previous cross-correlation analysis (Xia et al. 2011) between the isotropic γ-ray background (IGRB) and different tracers of the large-scale structure of the universe, we update our results using 60 months of data from the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope (Fermi). For this study, we perform a cross-correlation analysis both in configuration and spherical harmonics space between the IGRB and objects that may trace the astrophysical sources of the IGRB: QSOs in the Sloan Digital Sky Survey (SDSS) DR6, the SDSS DR8 Main Galaxy Sample, luminous red galaxies (LRGs) in the SDSS catalog, infrared-selected galaxies in the Two Micron All Sky Survey (2MASS), and radio galaxies in the NRAO VLA Sky Survey (NVSS). The benefit of correlating the Fermi-LAT signal with catalogs of objects at various redshifts is to provide tomographic information on the IGRB, which is crucial in separating the various contributions and clarifying its origin. The main result is that, unlike in our previous analysis, we now observe a significant (>3.5σ) cross-correlation signal on angular scales smaller than 1° in the NVSS, 2MASS, and QSO cases and, at lower statistical significance (~3.0σ), with SDSS galaxies. The signal is stronger in two energy bands, E > 0.5 GeV and E > 1 GeV, but it is also seen at E > 10 GeV. No cross-correlation signal is detected between Fermi data and the LRGs. These results are robust against the choice of the statistical estimator, estimate of errors, map cleaning procedure, and instrumental effects. Finally, we test the hypothesis that the IGRB observed by Fermi-LAT originates from the summed contributions of three types of unresolved extragalactic sources: BL Lacertae objects (BL Lacs), flat spectrum radio quasars (FSRQs), and star-forming galaxies (SFGs). Finally, we find that a model in which the IGRB is mainly produced by SFGs (more » $$72_{-37}^{+23}$$% with 2σ errors), with BL Lacs and FSRQs giving a minor contribution, provides a good fit to the data. We also consider a possible contribution from misaligned active galactic nuclei, and we find that, depending on the details of the model and its uncertainty, they can also provide a substantial contribution, partly degenerate with the SFG one.« less
Latent structure analysis in the pharmaceutical process of tablets prepared by wet granulation.
Uehara, Naoto; Hayashi, Yoshihiro; Mochida, Hiroshi; Otoguro, Saori; Onuki, Yoshinori; Obata, Yasuko; Takayama, Kozo
2016-01-01
Granule characteristics are some of the important intermediate qualities that determine tablet properties. However, the relationships between granule and tablet characteristics are poorly understood. The aim of this study was to elucidate relationships among formulation factors, granule characteristics, and tablet properties using a non-linear response surface method (RSM) incorporating a thin-plate spline interpolation (RSM-S) and a Bayesian network (BN). Tablets containing lactose (Lac), cornstarch (CS), and microcrystalline cellulose (MCC) were prepared by wet granulation. Ten formulations were prepared by an extreme vertices design. The angle of repose (Y 1 ), compressibility (Y 2 ), cohesion force (Y 3 ), internal friction angle (Y 4 ), and mean particle size (Y 5 ) were measured as granule characteristics. Tensile strength (TS) and disintegration time (DT) were measured as tablet properties. RSM-S results showed that TS increased with increasing amounts of MCC and Lac. DT decreased with increasing amounts of MCC and CS. The optimal BN models were predicted using four evaluation indices -Y 3 was shown to be the most important factor for TS, whereas Y 2 , Y 3 , and Y 4 were relatively important for predicting DT. Moreover, tablets with excellent tablet properties (i.e. high TS and low DT) were produced by relatively high Y 1 , low Y 2 , high Y 3 , high Y 4 , and middle Y 5 values, and resulted from the middle of MCC, middle-to-low CS, low Lac, and middle-to-low magnesium stearate (Mg-St) amounts. The RSM-S and BN techniques are useful for revealing complex relationships among formulation factors, granule characteristics, and tablet properties.
Langley, Ries J; Ting, Yi Tian; Clow, Fiona; Young, Paul G; Radcliff, Fiona J; Choi, Jeong Min; Sequeira, Richard P; Holtfreter, Silva; Baker, Heather; Fraser, John D
2017-09-01
Staphylococcus aureus is an opportunistic pathogen that produces many virulence factors. Two major families of which are the staphylococcal superantigens (SAgs) and the Staphylococcal Superantigen-Like (SSL) exoproteins. The former are immunomodulatory toxins that induce a Vβ-specific activation of T cells, while the latter are immune evasion molecules that interfere with a wide range of innate immune defences. The superantigenic properties of Staphylococcal enterotoxin-like X (SElX) have recently been established. We now reveal that SElX also possesses functional characteristics of the SSLs. A region of SElX displays high homology to the sialyl-lactosamine (sLacNac)-specific binding site present in a sub-family of SSLs. By analysing the interaction of SElX with sLacNac-containing glycans we show that SElX has an equivalent specificity and host cell binding range to the SSLs. Mutation of key amino acids in this conserved region affects the ability of SElX to bind to cells of myeloid origin and significantly reduces its ability to protect S. aureus from destruction in a whole blood killing (WBK) assay. Like the SSLs, SElX is up-regulated early during infection and is under the control of the S. aureus exotoxin expression (Sae) two component gene regulatory system. Additionally, the structure of SElX in complex with the sLacNac-containing tetrasaccharide sialyl Lewis X (sLeX) reveals that SElX is a unique single-domain SAg. In summary, SElX is an 'SSL-like' SAg.
Pharmacokinetics of intramuscular microparticle depot of valdecoxib in an experimental model.
Agnihotri, Sagar M; Vavia, Pradeep R
2009-09-01
We did a prospective study to investigate pharmacokinetics of a single intramuscularly (i.m.) administered Valdecoxib (VC) polymeric microparticles in New Zealand white rabbits. Poly[lac(glc-leu)] microparticles encapsulating a potent cyclooxygenase-2- selective inhibitor, VC, were prepared by emulsion and solvent evaporation technique and administered i.m. to rabbits for pharmacokinetic study. A single i.m. dose of drug-loaded poly[lac(glc-leu)] microparticles resulted in sustained therapeutic drug levels in the plasma for 49 days. The relative bioavailability was increased severalfold as compared with unencapsulated drug. Injectable poly[lac(glc-leu)] microparticles hold promise for increasing drug bioavailability and reducing dosing frequency for better management of rheumatoid arthritis.
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
Portage Lake: Memories of an Ojibwe Childhood.
ERIC Educational Resources Information Center
Kegg, Maude; Nichols, John D., Ed.
Anishinaabe (Ojibwe or Chippewa) elder Maude Kegg relates stories of her childhood nearly 90 years ago on the Mille Lacs Reservation in central Minnesota. The Nonremoval Mille Lacs Band of Chippewa to which she belonged accommodated their way of life to altered land and new neighbors, but retained their rich religious and social life. Traditional…
Teaching the Big Ideas of Biology with Operon Models
ERIC Educational Resources Information Center
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
40 CFR 272.951 - Louisiana State-Administered Program: Final Authorization.
Code of Federal Regulations, 2014 CFR
2014-07-01
..., Baton Rouge, LA 70804-9095; Phone number: (225) 342-5015; Web site: http://doa.louisiana.gov/osr/lac/lac.... Paul, Minnesota 55164-0526; Phone: 1-800-328-4880; Web site: http://west.thomson.com. You may inspect a... National Archives and Records Administration (NARA). For information on the availability of this material...
40 CFR 272.951 - Louisiana state-administered Program: Final authorization.
Code of Federal Regulations, 2013 CFR
2013-07-01
..., Baton Rouge, LA 70804-9095; Phone number: (225) 342-5015; Web site: http://doa.louisiana.gov/osr/lac/lac.... Paul, Minnesota 55164 0526; Phone: 1-800-328-4880; Web site: http://west.thomson.com. You may inspect a... National Archives and Records Administration (NARA). For information on the availability of this material...
76 FR 78974 - Wisconsin Central Ltd.-Abandonment Exemption-in Fond Du Lac County, WI
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-20
... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 303 (Sub-No. 38X)] Wisconsin Central Ltd.--Abandonment Exemption--in Fond Du Lac County, WI Wisconsin Central Ltd. (WCL) \\1\\ filed a verified notice of exemption under 49 CFR pt. 1152 subpart F--Exempt Abandonments to abandon...
ERIC Educational Resources Information Center
Hirt, Joan B.; Schneiter, Steven R.; Amelink, Catherine T.
2005-01-01
This study examined the nature of relationships and rewards for student affairs administrators at liberal arts colleges (LACs). Forty-three student affairs administrators from LACs participated in five focus groups. Results indicate that administrators tend to spend most of their time with students, followed try other student affairs…
A Modified Consumer Inkjet for Spatiotemporal Control of Gene Expression
Cohen, Daniel J.; Morfino, Roberto C.; Maharbiz, Michel M.
2009-01-01
This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 µm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer) and glucose (inhibitor), can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity. PMID:19763256
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ren, Y.L.; Garges, S.; Adhya, S.
1988-06-01
Four cAMP-independent receptor protein mutants (designated CRP* mutants) isolated previously are able to activate in vivo gene transcription in the absence of cAMP and their activity can be enhanced by cAMP or cGMP. One of the four mutant proteins, CRP*598 (Arg-142 to His, Ala-144 to Thr), has been characterized with regard to its conformational properties and ability to bind to and support abortive initiation from the lac promoter. Binding of wild-type CRP to its site on the lac promoter and activation of abortive initiation by RNA polymerase on this promoter are effected by cAMP but not by cGMP. CRP*598 canmore » activate lacP{sup +}-directed abortive initiation in the presence of cAMP and less efficiently in the presence of cGMP or in the absence of cyclic nucleotide. DNase I protection (footprinting) indicates that cAMP-CRP* binds to its site on the lac promoter whereas unliganded CRP* and cGMP-CRP* form a stable complex with the ({sup 32}P)lacP{sup +} fragment only in the presence of RNA polymerase, showing cooperative binding of two heterologous proteins. This cooperative binding provides strong evidence for a contact between CRP and RNA polymerase for activation of transcription. Although cGMP binds to CRP, it cannot replace cAMP in effecting the requisite conformational transition necessary for site-specific promoter binding.« less
Kim, Seong-Youl; Wang, Teng-ke; Singh, Raman Deep; Wheatley, Christine L; Marks, David L; Pagano, Richard E
2009-09-01
Plasma membrane (PM) microdomains, including caveolae and other cholesterol-enriched subcompartments, are involved in the regulation of many cellular processes, including endocytosis, attachment and signaling. We recently reported that brief incubation of human skin fibroblasts with the synthetic glycosphingolipid, D-erythro-octanoyl-lactosylceramide (C8-D-e-LacCer), stimulates endocytosis via caveolae and induces the appearance of micron-size microdomains on the PM. To further understand the effects of C8-D-e-LacCer treatment on PM microdomains, we used a detergent-free method to isolate microdomain-enriched membranes from fibroblasts treated +/-C8-D-e-LacCer, and performed 2-DE and mass spectrophotometry to identify proteins that were altered in their distribution in microdomains. Several proteins were identified in the microdomain-enriched fractions, including lipid transfer proteins and proteins related to the functions of small GTPases. One protein, Rho-associated protein kinase 2 (ROCK2), was verified by Western blotting to occur in microdomain fractions and to increase in these fractions after D-e-LacCer treatment. Immunofluorescence revealed that ROCK2 exhibited an increased localization at or near the PM in C8-D-e-LacCer-treated cells. In contrast, ROCK2 distribution in microdomains was decreased by treatment of cells with C8-L-threo-lactosylceramide, a glycosphingolipid with non-natural stereochemistry. This study identifies new microdomain-associated proteins and provides evidence that microdomains play a role in the regulation of the Rho/ROCK signaling pathway.
Shekhar, Anantha; Johnson, Philip L; Fitz, Stephanie D; Nakazato, Atsuro; Chaki, Shigeyuki; Steckler, Thomas; Schmidt, Mark
2011-04-01
Corticotropin releasing factor (CRF) is implicated in a variety of stress-related disorders such as depression and anxiety, and blocking CRF receptors is a putative strategy for treating such disorders. Using a well-studied animal model of panic, we tested the efficacy of JNJ19567470/CRA5626, a selective, non-peptidergic CRF type 1 receptor (CRF1) antagonist (3, 10 and 40 mg/kg intraperitoneal injection), in preventing the sodium lactate (NaLac)-induced panic-like behavioural and cardiovascular responses. Adult male rats with chronic reduction of GABA levels (by inhibition of GABA synthesis with l-allyglycine, a glutamic acid decarboxylase inhibitor) in the dorsomedial/perifornical hypothalamus are highly anxious and exhibit physiological and behavioural responses to intravenous NaLac infusions similar to patients with panic disorder. These 'panic-prone' rats pre-treated with vehicle injections displayed NaLac-induced increases in autonomic responses (i.e. tachycardia and hypertensive responses), anxiety-like behaviour in the social interaction test, and flight-like increases in locomotor activity. However, systemically injecting such panic-prone rats with the highest dose of CRF1 receptor antagonist prior to NaLac infusions blocked all NaLac-induced behaviour and cardiovascular responses. These data suggest that selective CRF1 receptor antagonists could be a novel target for developing anti-panic drugs that are as effective as benzodiazepines in acute treatment of a panic attack without the deleterious side-effects (e.g. sedation and cognitive impairment) associated with benzodiazepines.
Almonte, Maribel; Albero, Ginesa; Molano, Mónica; Carcamo, César; García, Patricia J; Pérez, Gonzalo
2008-08-19
The incidence of cervical cancer in Latin America and the Caribbean (LAC) is among the highest in the world. Because there are major demographic shifts happening in LAC countries (population growth, urbanization and ageing) cervical cancer incidence and mortality will likely continue to be a significant public health problem. Overall human papillomavirus (HPV) prevalence in the LAC general population has been found to be 2-fold higher than the average worldwide prevalence. The large HPV and cancer burden may be explained by the highly prevalent HPV variants of HPV types -16 and 18, which have an increased oncogenic potential. Given the major mode of transmission of genital HPV is sexual, certain, patterns of sexual behaviour (early age at first sexual intercourse, number of sexual partners and sexual behaviour of the partner) are associated with an increased risk of HPV genital acquisition. Although HPV infection is necessary for carcinogenesis, certain co-factors (high parity, long term use of oral contraceptives, smoking and co-infection with the human immunodeficiency virus (HIV)) help in the progression from infection to cancer. Many studies that have contributed to this evidence have been carried out in LAC and are reviewed and summarised in this article. Since HPV vaccines will likely take years to implement, and many more years to show impact on disease, cervical cancer screening programmes remain as the key intervention to control disease in LAC in the years to come.
Laparoscopic resection of transverse colon cancer at splenic flexure: technical aspects and results.
Okuda, Junji; Yamamoto, Masashi; Tanaka, Keitaro; Masubuchi, Shinsuke; Uchiyama, Kazuhisa
2016-03-01
Laparoscopic resection of transverse colon cancer at splenic flexure is technical demanding and its efficacy remains controversial. The aim of this study was to investigate its technical aspects such as pitfalls and overcoming them, and to demonstrate the short-term and oncologic long-term outcomes. To overcome the difficulty in laparoscopic resection of transverse colon cancer at splenic flexure, we recognized the following technical tips as essential. First of all, we have to precisely identify major vessels variations feeding tumor. Secondary, anatomical dissection of mesocolon through medial approach is indispensible. Third, safe takedown of splenic flexure to fully mobilization of left hemicolon is mandatory. This cohort study analyzed 95 patients with stage II (43) and III (52) underwent resection of transverse colon cancer at splenic flexure. 61 laparoscopic surgeries (LAC) and 34 conventional open surgeries (OC) from December 1996 to December 2009 were evaluated. Short-term and oncologic long-term outcomes were recorded. Operative time was longer in LAC. However, blood loss was less, recovery of bowel function and hospital stay were shorter in LAC. There was no conversion in LAC and no significant difference in the postoperative complications. Regarding oncologic long-term outcomes, there were no significant differences between OC and LAC. Laparoscopic resection of transverse colon cancer at splenic flexure resulted in acceptable short-term and oncologic long-term outcomes. Once technical tips acquired, laparoscopic resection of transverse colon cancer at splenic flexure could be feasible as minimally invasive surgery.
Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.
Cowing, D W; Kenyon, C
1992-10-01
mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.
NASA Astrophysics Data System (ADS)
Landoni, M.; Massaro, F.; Paggi, A.; D'Abrusco, R.; Milisavljevic, D.; Masetti, N.; Smith, H. A.; Tosti, G.; Chomiuk, L.; Strader, J.; Cheung, C. C.
2015-05-01
We report the results of our exploratory program carried out with the southern Astrophysical Research telescope aimed at associating counterparts and establishing the nature of the Fermi Unidentified γ-ray Sources (UGSs). We selected the optical counterparts of six UGSs from the Fermi catalog on the basis of our recently discovered tight connection between infrared and γ-ray emission found for the γ-ray blazars detected by the Wide-Field Infrared Survey Explorer in its all-sky survey. We perform for the first time a spectroscopic study of the low-energy counterparts of the Fermi UGSs, in the optical band, confirming the blazar-like nature of the whole sample. We also present new spectroscopic observations of six active galaxies of uncertain type associated with Fermi sources which appear to be BL Lac objects. Finally, we report the spectra collected for six known γ-ray blazars belonging to the Roma BZCAT that were obtained to establish their nature or better estimate their redshifts. Two interesting cases of high redshift and extremely luminous BL Lac objects (z ≥ 1.18 and z ≥ 1.02, based on the detection of Mg ii intervening systems) are also discussed. Based on observations obtained at the southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel Hill (UNC), and Michigan State University (MSU).
Long-term spectral and temporal behavior of the high-frequency peaked BL LAC object 1ES 1959+650
NASA Astrophysics Data System (ADS)
Backes, M.; Uellenbeck, M.; Hayashida, M.; Satalecka, K.; Tescaro, D.; Terzić, T.; MAGIC Collaboration; Fuhrmann, L.; Nestoras, I.; F-GAMMA project; Lähteenmäki, A.; Tornikoski, M.; Nieppola, E.; Metsähovi; Böttcher, M.; Collmar, W.; Weidinger, M.
2012-12-01
The high-frequency peaked BL Lac object 1ES 1959+650 is well-known for an exceptional outburst, which was observed at very high energy (VHE) γ-rays by the Whipple 10m and HEGRA telescopes in 2002. Remarkably, this outburst lacked associated X-ray emission (a socalled "orphan flare") and by this cannot easily be described by standard Synchrotron Self Compton (SSC) models. Models based on hadronic emission processes have also been proposed to explain the observed behavior. Subsequent multi-wavelength observations during a low flux state at TeV energies in 2006 can, instead, be explained by a standard single-zone SSC model. In this context, 1ES 1959+650 has been regularly monitored by the MAGIC telescope since 2005. During these years, no significant variation in the VHE γ-ray flux has been observed. The low energy part of this is in very good agreement with the high-energy part of the time-integrated energy spectrum as measured by Fermi-LAT. Based on this constant flux level in VHE γ-rays, we assembled the time-integrated spectral energy distribution (SED) of 1ES 1959+650 from radio to VHE γ-rays. Despite the non-variability at very high energies, significant flux and spectral variations have been observed at optical and X-ray frequencies in the meanwhile. Furthermore, the shape of the SED at high energy γ-rays as measured by Fermi-LAT is essentially flat which cannot be explained by either conventional single-zone SSC models, or models invoking external radiation fields (EC).
Characterizing the γ-ray long-term variability of PKS 2155-304 with H.E.S.S. and Fermi-LAT
NASA Astrophysics Data System (ADS)
H.E.S.S. Collaboration; Abdalla, H.; Abramowski, A.; Aharonian, F.; Ait Benkhali, F.; Akhperjanian, A. G.; Andersson, T.; Angüner, E. O.; Arrieta, M.; Aubert, P.; Backes, M.; Balzer, A.; Barnard, M.; Becherini, Y.; Becker Tjus, J.; Berge, D.; Bernhard, S.; Bernlöhr, K.; Blackwell, R.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Bregeon, J.; Brun, F.; Brun, P.; Bryan, M.; Bulik, T.; Capasso, M.; Carr, J.; Casanova, S.; Cerruti, M.; Chakraborty, N.; Chalme-Calvet, R.; Chaves, R. C. G.; Chen, A.; Chevalier, J.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Condon, B.; Conrad, J.; Cui, Y.; Davids, I. D.; Decock, J.; Degrange, B.; Deil, C.; Devin, J.; deWilt, P.; Dirson, L.; Djannati-Ataï, A.; Domainko, W.; Donath, A.; Drury, L. O.'C.; Dubus, G.; Dutson, K.; Dyks, J.; Edwards, T.; Egberts, K.; Eger, P.; Ernenwein, J.-P.; Eschbach, S.; Farnier, C.; Fegan, S.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Funk, S.; Füßling, M.; Gabici, S.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Gottschall, D.; Goyal, A.; Grondin, M.-H.; Hadasch, D.; Hahn, J.; Haupt, M.; Hawkes, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hinton, J. A.; Hofmann, W.; Hoischen, C.; Holler, M.; Horns, D.; Ivascenko, A.; Jacholkowska, A.; Jamrozy, M.; Janiak, M.; Jankowsky, D.; Jankowsky, F.; Jingo, M.; Jogler, T.; Jouvin, L.; Jung-Richardt, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kerszberg, D.; Khélifi, B.; Kieffer, M.; King, J.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Kraus, M.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lau, J.; Lees, J.-P.; Lefaucheur, J.; Lefranc, V.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Leser, E.; Lohse, T.; Lorentz, M.; Liu, R.; López-Coto, R.; Lypova, I.; Marandon, V.; Marcowith, A.; Mariaud, C.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; Meintjes, P. J.; Meyer, M.; Mitchell, A. M. W.; Moderski, R.; Mohamed, M.; Mohrmann, L.; Morå, K.; Moulin, E.; Murach, T.; de Naurois, M.; Niederwanger, F.; Niemiec, J.; Oakes, L.; O'Brien, P.; Odaka, H.; Öttl, S.; Ohm, S.; Ostrowski, M.; Oya, I.; Padovani, M.; Panter, M.; Parsons, R. D.; Pekeur, N. W.; Pelletier, G.; Perennes, C.; Petrucci, P.-O.; Peyaud, B.; Piel, Q.; Pita, S.; Poon, H.; Prokhorov, D.; Prokoph, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Reimer, A.; Reimer, O.; Renaud, M.; de los Reyes, R.; Rieger, F.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Salek, D.; Sanchez, D. A.; Santangelo, A.; Sasaki, M.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwemmer, S.; Settimo, M.; Seyffert, A. S.; Shafi, N.; Shilon, I.; Simoni, R.; Sol, H.; Spanier, F.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tibaldo, L.; Tiziani, D.; Tluczykont, M.; Trichard, C.; Tuffs, R.; Uchiyama, Y.; van der Walt, D. J.; van Eldik, C.; van Rensburg, C.; van Soelen, B.; Vasileiadis, G.; Veh, J.; Venter, C.; Viana, A.; Vincent, P.; Vink, J.; Voisin, F.; Völk, H. J.; Vuillaume, T.; Wadiasingh, Z.; Wagner, S. J.; Wagner, P.; Wagner, R. M.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Yang, R.; Zabalza, V.; Zaborov, D.; Zacharias, M.; Zdziarski, A. A.; Zech, A.; Zefi, F.; Ziegler, A.; Żywucka, N.
2017-02-01
Studying the temporal variability of BL Lac objects at the highest energies provides unique insights into the extreme physical processes occurring in relativistic jets and in the vicinity of super-massive black holes. To this end, the long-term variability of the BL Lac object PKS 2155-304 is analyzed in the high (HE, 100 MeV < E < 300 GeV) and very high energy (VHE, E > 200 GeV) γ-ray domain. Over the course of 9 yr of H.E.S.S. observations the VHE light curve in the quiescent state is consistent with a log-normal behavior. The VHE variability in this state is well described by flicker noise (power-spectral-density index ) on timescales larger than one day. An analysis of 5.5 yr of HE Fermi-LAT data gives consistent results (, on timescales larger than 10 days) compatible with the VHE findings. The HE and VHE power spectral densities show a scale invariance across the probed time ranges. A direct linear correlation between the VHE and HE fluxes could neither be excluded nor firmly established. These long-term-variability properties are discussed and compared to the red noise behavior (β 2) seen on shorter timescales during VHE-flaring states. The difference in power spectral noise behavior at VHE energies during quiescent and flaring states provides evidence that these states are influenced by different physical processes, while the compatibility of the HE and VHE long-term results is suggestive of a common physical link as it might be introduced by an underlying jet-disk connection.
Baezconde-Garbanati, Lourdes; Lienemann, Brianna A; Robles, Marisela; Johnson, Ethel; Sanchez, Kathleen; Singhal, Rita; Steinberg, Jane; Jaque, Jenny M; Pentz, Mary Ann; Gruber, Stephen
2017-09-05
Research shows that vaccination against human papillomavirus (HPV) infection is one of the most effective methods for reducing risk for cervical cancer; it also protects against other HPV-related cancers. Controversies exist regarding HPV vaccination in several communities; which may in part explain why although rates of HPV vaccination are increasing nationwide, Los Angeles County (LAC) data show that many adolescents are still not vaccinated. These adolescents remain at high-risk for infection. Using community-based participatory principles, we conducted an environmental scan that included a literature review, the development of a community advisory board, community feedback from HPV community meetings, and interviews with stakeholders to understand attitudes toward HPV vaccination and their impact in follow through with HPV vaccines. Twenty-eight key stakeholders participated in our coalition comprised of community organizations and clinics with strong ties to the local community. This is the only coalition dedicated exclusively to improving HPV vaccine uptake in LAC. Of these, twenty-one participated in an environmental scan via qualitative interviews about HPV vaccination programs, service delivery priorities, and proposed steps to increase HPV vaccination uptake in LAC. The environmental scan revealed targets for future efforts, barriers to HPV uptake, and next steps for improving local HPV vaccination uptake rates. The environmental scan also identified local HPV vaccination interventions and resources. Although LAC has developed important efforts for vaccination, some interventions are no longer being implemented due to lack of funds; others have not been evaluated with sufficient outcome data. The risk for cervical and other HPV-related cancers could be greatly reduced in LAC if a multilevel, multicultural, and multilingual approach is taken to better understand rates of HPV vaccination uptake, particularly among racial/ethnic minorities and LGBTQ youth. Our environmental scan provides guidance on attitudes toward vaccination, and how best to address the needs of LAC families and providers. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lukens, John R.; Cruise, Michael W.; Lassen, Matthew G.; Hahn, Young S.
2010-01-01
The impaired function of CD8+ T cells is characteristic of hepatitis C virus (HCV) persistent infection. HCV core protein has been reported to inhibit CD8+ T cell responses. To determine the mechanism of the HCV core in suppressing Ag-specific CD8+ T cell responses, we generated a transgenic mouse, core(+) mice, where the expression of core protein is directed to the liver using the albumin promoter. Using a recombinant adenovirus to deliver Ag, we demonstrated that core(+) mice failed to clear adenovirus-LacZ (Ad-LacZ) infection in the liver. The effector function of LacZ-specific CD8+ T cells was particularly impaired in the livers of core(+) mice, with suppression of IFN-γ, TNF-α, and granzyme B production by CD8+ T cells. In addition, the impaired CD8+ T cell responses in core(+) mice were accompanied by the enhanced expression of the inhibitory receptor programmed death-1 (PD-1) by LacZ-specific CD8+ T cells and its ligand B7-H1 on liver dendritic cells following Ad-LacZ infection. Importantly, blockade of the PD-1/B7-H1 inhibitory pathway (using a B7-H1 blocking antibody) in core(+) mice enhanced effector function of CD8+ T cells and cleared Ad-LacZ-infection as compared with that in mice treated with control Ab. This suggests that the regulation of the PD-1/B7-H1 inhibitory pathway is crucial for HCV core-mediated impaired T cell responses and viral persistence in the liver. This also suggests that manipulation of the PD-1/B7-H1 pathway may be a potential immunotherapy to enhance effector T cell responses during persistent HCV infection. PMID:18354211