NASA Astrophysics Data System (ADS)
Bondi, M.; Marchã, M. J. M.; Dallacasa, D.; Stanghellini, C.
2001-08-01
The 200-mJy sample, defined by Marchã et al., contains about 60 nearby, northern, flat-spectrum radio sources. In particular, the sample has proved effective at finding nearby radio-selected BL Lac objects with radio luminosities comparable to those of X-ray-selected objects, and low-luminosity flat-spectrum weak emission-line radio galaxies (WLRGs). The 200-mJy sample contains 23 BL Lac objects (including 6 BL Lac candidates) and 19 WLRGs. We will refer to these subsamples as the 200-mJy BL Lac sample and the 200-mJy WLRG sample, respectively. We have started a systematic analysis of the morphological pc-scale properties of the 200-mJy radio sources using VLBI observations. This paper presents VLBI observations at 5 and 1.6GHz of 14 BL Lac objects and WLRGs selected from the 200-mJy sample. The pc-scale morphology of these objects is briefly discussed. We derive the radio beaming parameters of the 200-mJy BL Lac objects and WLRGs and compare them with those of other BL Lac samples and with a sample of FR I radio galaxies. The overall broad-band radio, optical and X-ray properties of the 200-mJy BL Lac sample are discussed and compared with those of other BL Lac samples, radio- and X-ray-selected. We find that the 200-mJy BL Lac objects fill the gap between HBL and LBL objects in the colour-colour plot, and have intermediate αXOX as expected in the spectral energy distribution unification scenario. Finally, we briefly discuss the role of the WLRGs.
STRUCTURED JETS IN BL LAC OBJECTS: EFFICIENT PeV NEUTRINO FACTORIES?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tavecchio, Fabrizio; Ghisellini, Gabriele; Guetta, Dafne
2014-09-20
The origin of high-energy neutrinos (0.1–1 PeV range) detected by IceCube remains a mystery. In this work, we explore the possibility that efficient neutrino production can occur in structured jets of BL Lac objects, characterized by a fast inner spine surrounded by a slower layer. This scenario has been widely discussed in the framework of the high-energy emission models for BL Lac objects and radio galaxies. One of the relevant consequences of a velocity structure is the enhancement of the inverse Compton emission caused by the radiative coupling of the two zones. We show that a similar boosting could occurmore » for the neutrino output of the spine through the photo-meson reaction of high-energy protons scattering off the amplified soft target photon field of the layer. Assuming the local density and the cosmological evolution of γ-ray BL Lac object derived from Fermi Large Area Telescope data, we calculate the expected diffuse neutrino intensity, which can match the IceCube data for a reasonable choice of parameters.« less
Clustering environments of BL Lac objects
NASA Technical Reports Server (NTRS)
Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.
1993-01-01
We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.
Evolutionary behaviour of AGN: Investigations on BL Lac objects and Seyfert II galaxies
NASA Astrophysics Data System (ADS)
Beckmann, V.
2000-12-01
The evolution and nature of AGN is still one of the enigmatic questions in astrophysics. While large and complete Quasar samples are available, special classes of AGN, like BL Lac objects and Seyfert II galaxies, are still rare objects. In this work I present two new AGN samples. The first one is the HRX-BL Lac survey, resulting in a sample of X-ray selected BL Lac objects. This sample results from 223 BL Lac candidates based on a correlation of X-ray sources with radio sources. The identification of this sample is 98% complete. 77 objects have been identified as BL Lac objects and form the HRX-BL Lac complete sample, the largest homogeneous sample of BL Lac objects existing today. For this sample, redshifts are now known for 62 objects (81 %). In total I present 101 BL Lac objects in the enlarged HRX-BL Lac survey, for which redshift information is available for 84 objects. During the HRX-BL Lac survey I found several objects of special interest. 1ES 1517+656 turned out to be the brightest known BL Lac object in the universe. 1ES 0927+500 could be the first BL Lac object with a line detected in the X-ray region. RX J1211+2242 is probably the the counterpart of the up to now unidentified gamma-ray source 3EG J1212+2304. Additionally I present seven candidates for ultra high frequency peaked BL Lac objects. RX J1054+3855 and RX J1153+3517 are rare high redshift X-ray bright QSO or accreting binary systems with huge magnetic fields. For the BL Lac objects I suggest an unified scenario in which giant elliptical galaxies, formed by merging events of spiral galaxies at z > 2, start as powerful, radio dominated BL Lacs. As the jet gets less powerful, the BL Lacs start to get more X-ray dominated, showing less total luminosities (for z < 1). This effect is seen in the different evolutionary behavior detected in high and low frequency cut off BL Lac objects (HBL and LBL, respectively). The model of negative evolution is supported by assumptions about the energetic effects
X-Ray Variability of BL Lac Objects
NASA Astrophysics Data System (ADS)
McHardy, Ian
I present an overview of the X-ray temporal and spectral variability of BL Lacs on both short and long timescales. The previously observed behaviour of short (~days) flares superimposed on a relatively steady `quiescent' level is still broadly correct. However, for the brighter BL Lacs, the well sampled lightcurves from the RXTE ASM show that the `quiescent' level also varies considerably on timescales of ~100 days in a manner similar to that seen in Optically Violently Variable Quasars (OVVs) such as 3C279 and 3C273. Possible reasons for this behaviour are discussed. For the large majority of BL Lacs the soft and medium energy X-ray bands are dominated by synchrotron emission and, unlike the case of OVVs, the emission mechanism is not in doubt. Most interest then centres on the structure of the emitting region, and the electron acceleration processes, particularly during outbursts. That structure, and the acceleration processes, can be investigated by consideration of the spectral variability during flares, which is not simple. I review the observations of spectral variability and consider the evidence for and against homogeneous models. I also briefly compare the X-ray spectral variability of BL Lacs with that of OVVs such as 3C273.
Time-dependent inhomogeneous jet models for BL Lac objects
NASA Technical Reports Server (NTRS)
Marlowe, A. T.; Urry, C. M.; George, I. M.
1992-01-01
Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.
Time-dependent inhomogeneous jet models for BL Lac objects
NASA Astrophysics Data System (ADS)
Marlowe, A. T.; Urry, C. M.; George, I. M.
1992-05-01
Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.
Are some BL Lac objects artefacts of gravitational lensing?
NASA Technical Reports Server (NTRS)
Ostriker, J. P.; Vietri, M.
1985-01-01
It is proposed here that a significant fraction of BL Lac objects are optically violently variable quasars whose continuum emission has been greatly amplified, relative to the line emission, by pointlike gravitational lenses in intervening galaxies. Several anomalous physical and statistical properties of BL Lacs can be understood on the basis of this model, which is immediately testable on the basis of absorption line studies and by direct imaging.
Stellar Populations in BL Lac type Objects
NASA Astrophysics Data System (ADS)
Serote Roos, Margarida
The relationship between an Active Galactic Nucleus (AGN) and its host galaxy is a crucial question in the study of galaxy evolution. We present an estimate of the stellar contribution in a sample of low luminosity BL Lac type objects. We have performed stellar population synthesis for a sample of 19 objects selected from Marchã et al. (1996, MNRAS 281, 425). The stellar content is quantified using the equivalent widths of all absorption features available throughout the spectrum. The synthesis is done by a variant of the GPG method (Pelat: 1997, MNRAS 284, 365).
Radio-weak BL Lac Objects in the Fermi Era
NASA Astrophysics Data System (ADS)
Massaro, F.; Marchesini, E. J.; D'Abrusco, R.; Masetti, N.; Andruchow, I.; Smith, Howard A.
2017-01-01
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]-[4.6]-[12] μm color-color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.
X-Ray Spectral Variability Signatures of Flares in BL Lac Objects
NASA Technical Reports Server (NTRS)
Boettcher, Markus; Chiang, James; White, Nicholas E. (Technical Monitor)
2002-01-01
We are presenting a detailed parameter study of the time-dependent electron injection and kinematics and the self-consistent radiation transport in jets of intermediate and low-frequency peaked BL Lac objects. Using a time-dependent, combined synchrotron-self-Compton and external-Compton jet model, we study the influence of variations of several essential model parameters, such as the electron injection compactness, the relative contribution of synchrotron to external soft photons to the soft photon compactness, the electron- injection spectral index, and the details of the time profiles of the electron injection episodes giving rise to flaring activity. In the analysis of our results, we focus on the expected X-ray spectral variability signatures in a region of parameter space particularly well suited to reproduce the broadband spectral energy distributions of intermediate and low-frequency peaked BL Lac objects. We demonstrate that SSC- and external-Compton dominated models for the gamma-ray emission from blazars are producing significantly different signatures in the X-ray variability, in particular in the soft X-ray light curves and the spectral hysteresis at soft X-ray energies, which can be used as a powerful diagnostic to unveil the nature of the high-energy emission from BL Lac objects.
RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massaro, F.; Marchesini, E. J.; D’Abrusco, R.
2017-01-10
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated bymore » the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.« less
NASA Astrophysics Data System (ADS)
Bondi, M.; Dallacasa, D.; Stanghellini, C.; Marchã, M. J. M.
We obtained two-epoch VLBA observations at 5 GHz of a list of radio galaxies drawn from the 200 mJy sample (Marcha et al. 1996). The objects selected for milli-arcsecond scale observations are classified, on the basis of their optical spectroscopic and polarimetric properties, as BL Lac objects, normal weak line radio galaxies, broad line radio galaxies, and transition objects (those with intermediate properties). We present preliminary results on the radio polarization properties, on the milli-arcsecond scale, of objects with different optical properties and discuss structural variations detected from the two epochs.
HESS J1943+213: A Non-classical High-frequency-peaked BL Lac Object
NASA Astrophysics Data System (ADS)
Straal, S. M.; Gabányi, K. É.; van Leeuwen, J.; Clarke, T. E.; Dubner, G.; Frey, S.; Giacani, E.; Paragi, Z.
2016-05-01
HESS J1943+213 is an unidentified TeV source that is likely a high-frequency-peaked BL Lac (HBL) object, but that is also compatible with a pulsar wind nebula (PWN) nature. Each of these enormously different astronomical interpretations is supported by some of the observed unusual characteristics. In order to finally classify and understand this object, we took a three-pronged approach, through time-domain, high angular resolution, and multi-frequency radio studies. First, our deep time-domain observations with the Arecibo telescope failed to uncover the putative pulsar powering the proposed PWN. We conclude with ˜70% certainty that HESS J1943+213 does not host a pulsar. Second, long-baseline interferometry of the source with e-MERLIN at 1.5 and 5 GHz shows only a core, that is, a point source at ˜ 1-100 mas resolution. Its 2013 flux density is about one-third lower than that detected in the 2011 observations with similar resolution. This radio variability of the core strengthens the HBL object hypothesis. Third, additional evidence against the PWN scenario comes from the radio spectrum we compiled. The extended structure follows a power-law behavior with spectral index α \\=\\-0.54+/- 0.04 while the core component displays a flat spectrum (α \\=\\-0.03+/- 0.03). In contrast, the radio synchrotron emission of PWNe predicts a single power-law distribution. Overall, we rule out the PWN hypothesis and conclude that the source is a BL Lac object. The consistently high fraction (70%) of the flux density from the extended structure then leads us to conclude that HESS J1943+213 must be a non-classical HBL object.
NASA Astrophysics Data System (ADS)
Landt, H.; Padovani, P.
1999-12-01
In the optical wavelength range the distinction between a radio galaxy and a BL Lac object is mainly based on the Ca II H and K break observed in the optical spectrum. Marchã et al. (1996, MNRAS, 281, 425) have expanded on the previously used division by suggesting objects with Ca II break values lower than 0.4 to be classified as BL Lacs and sources with values higher than 0.4 to be classified as galaxies. We present new evidence that there is a smooth transition between BL Lac objects and Fanaroff-Riley type I radio galaxies. We find an increase in X-ray and radio core luminosity as the Ca II break gets more and more diluted. This suggests that the only difference between BL Lac objects and their parent population lies in orientation. The closer the jet of the radio galaxy to the observer's line of sight, the more its luminosity gets amplified and the object becomes BL Lac-like. We will address the question of the BL Lac parent population and will propose to unify the beamed and unbeamed objects in nomenclature.
Constraining the red shifts of TeV BL Lac objects
NASA Astrophysics Data System (ADS)
Qin, Longhua; Wang, Jiancheng; Yan, Dahai; Yang, Chuyuan; Yuan, Zunli; Zhou, Ming
2018-01-01
We present a model-dependent method to estimate the red shifts of three TeV BL Lac objects (BL Lacs) through fitting their (quasi-)simultaneous multi-waveband spectral energy distributions (SEDs) with a one-zone leptonic synchrotron self-Compton model. Considering the impact of electron energy distributions (EEDs) on the results, we use three types of EEDs to fit the SEDs: a power-law EED with exponential cut-off (PLC), a log-parabola (PLLP) EED and the broken power-law (BPL) EED. We also use a parameter α to describe the uncertainties of the extragalactic background light models, as in Abdo et al. We then use a Markov chain Monte Carlo method to explore the multi-dimensional parameter space and obtain the uncertainties of the model parameters based on the observational data. We apply our method to obtain the red shifts of three TeV BL Lac objects in the marginalized 68 per cent confidence, and find that the PLC EED does not fit the SEDs. For 3C66A, the red shift is 0.14-0.31 and 0.16-0.32 in the BPL and PLLP EEDs. For PKS1424+240, the red shift is 0.55-0.68 and 0.55-0.67 in the BPL and PLLP EEDs. For PG1553+113, the red shift is 0.22-0.48 and 0.22-0.39 in the BPL and PLLP EEDs. We also estimate the red shift of PKS1424+240 in the high stage to be 0.46-0.67 in the PLLP EED, roughly consistent with that in the low stage.
Structural dynamics of the lac repressor-DNA complex revealed by a multiscale simulation.
Villa, Elizabeth; Balaeff, Alexander; Schulten, Klaus
2005-05-10
A multiscale simulation of a complex between the lac repressor protein (LacI) and a 107-bp-long DNA segment is reported. The complex between the repressor and two operator DNA segments is described by all-atom molecular dynamics; the size of the simulated system comprises either 226,000 or 314,000 atoms. The DNA loop connecting the operators is modeled as a continuous elastic ribbon, described mathematically by the nonlinear Kirchhoff differential equations with boundary conditions obtained from the coordinates of the terminal base pairs of each operator. The forces stemming from the looped DNA are included in the molecular dynamics simulations; the loop structure and the forces are continuously recomputed because the protein motions during the simulations shift the operators and the presumed termini of the loop. The simulations reveal the structural dynamics of the LacI-DNA complex in unprecedented detail. The multiple domains of LacI exhibit remarkable structural stability during the simulation, moving much like rigid bodies. LacI is shown to absorb the strain from the looped DNA mainly through its mobile DNA-binding head groups. Even with large fluctuating forces applied, the head groups tilt strongly and keep their grip on the operator DNA, while the remainder of the protein retains its V-shaped structure. A simulated opening of the cleft of LacI by 500-pN forces revealed the interactions responsible for locking LacI in the V-conformation.
Fermi LAT detection of a GeV flare from the BL Lac object PKS 2233-148
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2012-06-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2233-148 (also known as 2FGL J2236.5-1431, Nolan et al. 2012, ApJS, 199, 31, and OY -156) placed at R.A.: 339.1420296 deg, Dec.: -14.5561633 (J2000, Petrov et al. 2008, AJ, 136, 580). No redshift for the source has been measured up to now, demonstrating the BL Lac object character type of this source.
Preparation of a Ammonia-Treated Lac Dye and Structure Elucidation of Its Main Component.
Nishizaki, Yuzo; Ishizuki, Kyoko; Akiyama, Hiroshi; Tada, Atsuko; Sugimoto, Naoki; Sato, Kyoko
2016-01-01
Lac dye and cochineal extract contain laccaic acids and carminic acid as the main pigments, respectively. Both laccaic acids and carminic acid are anthraquinone derivatives. 4-Aminocarminic acid (acid-stable carmine), an illegal colorant, has been detected in several processed foods. 4-Aminocarminic acid is obtained by heating cochineal extract (carminic acid) in ammonia solution. We attempted to prepare ammonia-treated lac dye and to identify the structures of the main pigment components. Ammonia-treated lac dye showed acid stability similar to that of 4-aminocarminic acid. The structures of the main pigments in ammonia-treated lac dye were analyzed using LC/MS. One of the main pigments was isolated and identified as 4-aminolaccaic acid C using various NMR techniques, including 2D-INADEQUATE. These results indicated that ammonia-treatment of lac dye results in the generation of 4-aminolaccaic acids.
Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.
2013-01-01
β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479
Afzal, Muhammad; Shafeeq, Sulman
2014-01-01
Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into two operons, i.e., lac operon I (lacABCD) and lac operon II (lacTFEG). Deletion of the DeoR family transcriptional regulator lacR that is present downstream of the lac gene cluster revealed elevated expression of lac operon I even in the absence of lactose. This suggests a function of LacR as a transcriptional repressor of lac operon I, which encodes enzymes involved in the phosphorylated tagatose pathway in the absence of lactose or galactose. Deletion of lacR did not affect the expression of lac operon II, which encodes a lactose-specific phosphotransferase. This finding was further confirmed by β-galactosidase assays with PlacA-lacZ and PlacT-lacZ in the presence of either lactose or glucose as the sole carbon source in the medium. This suggests the involvement of another transcriptional regulator in the regulation of lac operon II, which is the BglG-family transcriptional antiterminator LacT. We demonstrate the role of LacT as a transcriptional activator of lac operon II in the presence of lactose and CcpA-independent regulation of the lac gene cluster in S. pneumoniae. PMID:24951784
Swigon, David; Coleman, Bernard D.; Olson, Wilma K.
2006-01-01
Repression of transcription of the Escherichia coli Lac operon by the Lac repressor (LacR) is accompanied by the simultaneous binding of LacR to two operators and the formation of a DNA loop. A recently developed theory of sequence-dependent DNA elasticity enables one to relate the fine structure of the LacR–DNA complex to a wide range of heretofore-unconnected experimental observations. Here, that theory is used to calculate the configuration and free energy of the DNA loop as a function of its length and base-pair sequence, its linking number, and the end conditions imposed by the LacR tetramer. The tetramer can assume two types of conformations. Whereas a rigid V-shaped structure is observed in the crystal, EM images show extended forms in which two dimer subunits are flexibly joined. Upon comparing our computed loop configurations with published experimental observations of permanganate sensitivities, DNase I cutting patterns, and loop stabilities, we conclude that linear DNA segments of short-to-medium chain length (50–180 bp) give rise to loops with the extended form of LacR and that loops formed within negatively supercoiled plasmids induce the V-shaped structure. PMID:16785444
Hiblot, Julien; Bzdrenga, Janek; Champion, Charlotte; Chabriere, Eric; Elias, Mikael
2015-01-01
A new representative of the Phosphotriesterase-Like Lactonases (PLLs) family from the hyperthermophilic crenarchaeon Vulcanisaeta moutnovskia has been characterized and crystallized. VmoLac is a native, proficient lactonase with promiscuous, low phosphotriesterase activity. VmoLac therefore represents an interesting candidate for engineering studies, with the aim of developing an efficient bacterial quorum-quenching agent. Here, we provide an extensive biochemical and kinetic characterization of VmoLac and describe the X-ray structures of the enzyme bound to a fatty acid and to its cognate substrate 3-oxo-C10 AHL (Acyl-Homoserine Lactone). The structures highlight possible structural determinants that may be involved in its extreme thermal stability (Tm = 128°C). Moreover, the structure reveals that the substrate binding mode of VmoLac significantly differs from those of its close homologues, possibly explaining the substrate specificity of the enzyme. Finally, we describe the specific interactions between the enzyme and its substrate, and discuss the possible lactone hydrolysis mechanism of VmoLac. PMID:25670483
The Discovery of Low-Luminosity BL Lacs
NASA Astrophysics Data System (ADS)
Rector, Travis A.; Stocke, John T.
1995-12-01
Many of the properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis whereby BL Lacs are ``highly beamed'' FR-I radio galaxies (i.e. our line of sight to these objects is nearly along the jet axis). Further, radio-selected BL Lacs (RBLs) are believed to be seen nearly ``on-axis'' (the line-of-sight angle theta ~ 8deg ) while X-ray selected BL Lacs (XBLs) are seen at larger angles (theta ~ 30deg ; the X-ray emitting jet is believed to be less collimated). However, a major problem with this model was that a transition population between beamed BL Lacs and unbeamed FR-Is had not been detected. Low-luminosity BL Lacs may be such a transition population, and were predicted to exist by Browne and Marcha (1993). We present ROSAT HRI images, VLA radio maps and optical spectra which confirm the existence of low-luminosity BL Lacs, objects which were previously mis-identified in the EMSS catalog as clusters of galaxies. Thus our results strengthen the relativistic beaming hypothesis.
Using the Markov chain Monte Carlo method to study the physical properties of GeV-TeV BL Lac objects
NASA Astrophysics Data System (ADS)
Qin, Longhua; Wang, Jiancheng; Yang, Chuyuan; Yuan, Zunli; Mao, Jirong; Kang, Shiju
2018-01-01
We fit the spectral energy distributions (SEDs) of 46 GeV-TeV BL Lac objects in the frame of leptonic one-zone synchrotron self-Compton (SSC) model and investigate the physical properties of these objects. We use the Markov chain Monte Carlo (MCMC) method to obtain the basic parameters, such as magnetic field (B), the break energy of the relativistic electron distribution (γ ^' }b), and the electron energy spectral index. Based on the modeling results, we support the following scenarios for GeV-TeV BL Lac objects. (1) Some sources have large Doppler factors, implying other radiation mechanism should be considered. (2) Compared with flat spectrum quasars (FSRQs), GeV-TeV BL Lac objects have weaker magnetic fields and larger Doppler factors, which cause the ineffective cooling and shift the SEDs to higher bands. Their jet powers are around 4.0 × 1045 erg s-1, compared with radiation power, 5.0 × 1042 erg s-1, indicating that only a small fraction of jet power is transformed into the emission power. (3) For some BL Lacs with large Doppler factors, their jet components could have two substructures, e.g., the fast core and the slow sheath. For most GeV-TeV BL Lacs, Kelvin-Helmholtz instabilities are suppressed by their higher magnetic fields, leading to micro-variability or intro-day variability in the optical bands. (4) Combined with a sample of FSRQs, an anti-correlation between the peak luminosity, Lpk, and the peak frequency, νpk, is obtained, favoring the blazar sequence scenario. In addition, an anti-correlation between the jet power, Pjet, and the break Lorentz factor, γb, also supports the blazar sequence.
A hadronic origin for ultra-high-frequency-peaked BL Lac objects
NASA Astrophysics Data System (ADS)
Cerruti, M.; Zech, A.; Boisson, C.; Inoue, S.
2015-03-01
Current Cherenkov telescopes have identified a population of ultra-high-frequency peaked BL Lac objects (UHBLs), also known as extreme blazars, that exhibit exceptionally hard TeV spectra, including 1ES 0229+200, 1ES 0347-121, RGB J0710+591, 1ES 1101-232, and 1ES 1218+304. Although one-zone synchrotron-self-Compton (SSC) models have been generally successful in interpreting the high-energy emission observed in other BL Lac objects, they are problematic for UHBLs, necessitating very large Doppler factors and/or extremely high minimum Lorentz factors of the emitting leptonic population. In this context, we have investigated alternative scenarios where hadronic emission processes are important, using a newly developed (lepto-)hadronic numerical code to systematically explore the physical parameters of the emission region that reproduces the observed spectra while avoiding the extreme values encountered in pure SSC models. Assuming a fixed Doppler factor δ = 30, two principal parameter regimes are identified, where the high-energy emission is due to: (1) proton-synchrotron radiation, with magnetic fields B ˜ 1-100 G and maximum proton energies Ep; max ≲ 1019 eV; and (2) synchrotron emission from p-γ-induced cascades as well as SSC emission from primary leptons, with B ˜ 0.1-1 G and Ep; max ≲ 1017 eV. This can be realized with plausible, sub-Eddington values for the total (kinetic plus magnetic) power of the emitting plasma, in contrast to hadronic interpretations for other blazar classes that often warrant highly super-Eddington values.
Very high energy observations of the BL Lac objects 3C 66A and OJ 287
NASA Astrophysics Data System (ADS)
Lindner, T.; Hanna, D. S.; Kildea, J.; Ball, J.; Bramel, D. A.; Carson, J.; Covault, C. E.; Driscoll, D.; Fortin, P.; Gingrich, D. M.; Jarvis, A.; Mueller, C.; Mukherjee, R.; Ong, R. A.; Ragan, K.; Scalzo, R. A.; Williams, D. A.; Zweerink, J.
2007-11-01
Using the Solar Tower Atmospheric Cherenkov Effect Experiment (STACEE), we have observed the BL Lac objects 3C 66A and OJ 287. These are members of the class of low-frequency-peaked BL Lac objects (LBLs) and are two of the three LBLs predicted by Costamante and Ghisellini [L. Costamante, G. Ghisellini, Astron. Astrophys. 384 (2002) 56] to be potential sources of very high energy (>100 GeV) gamma-ray emission. The third candidate, BL Lacertae, has recently been detected by the MAGIC collaboration [J. Albert et al., arXiv:astro-ph/0703084v1 (2007)]. Our observations have not produced detections; we calculate a 99% CL upper limit of flux from 3C 66A of 0.15 Crab flux units and from OJ 287 our limit is 0.52 Crab. These limits assume a Crab-like energy spectrum with an effective energy threshold of 185 GeV.
Extraordinary Activity in the BL Lac Object OJ 287
NASA Astrophysics Data System (ADS)
Hughes, P. A.; Aller, H. D.; Aller, M. F.
We present the results of a wavelet transform analysis of data for the BL Lac object OJ 287 acquired as part of the UMRAO variability program. We find clear evidence for a persistent modulation of the total flux and polarization with period 1.66 years, and for another signal that dominates activity in the 1980s with period 1.12 years. It appears that the longer time scale periodicity is associated with an otherwise quiescent jet, and the shorter time scale activity is associated with the passage of a shock, or shocks. The periodic behavior in polarization exhibits excursions in U which correspond to a direction 45circ from the VLBI jet axis. This behavior suggests a small amplitude, cyclic variation in the flow direction in that part of the flow that dominates cm-wavelength emission.
Spectroscopic monitoring of the BL Lac object AO 0235+164
NASA Astrophysics Data System (ADS)
Raiteri, C. M.; Villata, M.; Capetti, A.; Heidt, J.; Arnaboldi, M.; Magazzù, A.
2007-03-01
Aims:Spectroscopic monitoring of BL Lac objects is a difficult task that nonetheless can provide important information on the different components of the active galactic nucleus. Methods: We performed optical spectroscopic monitoring of the BL Lac object AO 0235+164 (z=0.94) with the VLT and TNG telescopes from Aug. 2003 to Dec. 2004, during an extended WEBT campaign. The flux of this source is both contaminated and absorbed by a foreground galactic system at z=0.524, the stars of which can act as gravitational micro-lenses. Results: In this period the object was in an optically faint, though variable state, and a broad Mg II emission line was visible at all epochs. The spectroscopic analysis reveals an overall variation in the Mg II line flux of a factor 1.9, while the corresponding continuum flux density changed by a factor 4.3. Most likely, the photoionising radiation can be identified with the emission component that was earlier recognised to be present as a UV-soft-X-ray bump in the source spectral energy distribution and that is visible in the optical domain only in very faint optical states. We estimate an upper limit to the broad line region (BLR) size of a few light months from the historical minimum brightness level; from this we infer the maximum amplification of the Mg II line predicted by the microlensing scenario. Conclusions: .Unless we have strongly overestimated the size of the BLR, only very massive stars could significantly magnify the broad Mg II emission line, but the time scale of variations due to these (rare) events would be of several years. In contrast, the continuum flux, coming from much smaller emission regions in the jet, could be affected by microlensing from the more plausible MACHO deflectors, with variability time scales of the order of some months. Based on observations collected at the European Southern Observatory, Chile (ESO Programme 71.A-0174), and on observations made with the Italian Telescopio Nazionale Galileo (TNG
Sousa, Filipa L; Parente, Daniel J; Shis, David L; Hessman, Jacob A; Chazelle, Allen; Bennett, Matthew R; Teichmann, Sarah A; Swint-Kruse, Liskin
2016-02-22
Protein families evolve functional variation by accumulating point mutations at functionally important amino acid positions. Homologs in the LacI/GalR family of transcription regulators have evolved to bind diverse DNA sequences and allosteric regulatory molecules. In addition to playing key roles in bacterial metabolism, these proteins have been widely used as a model family for benchmarking structural and functional prediction algorithms. We have collected manually curated sequence alignments for >3000 sequences, in vivo phenotypic and biochemical data for >5750 LacI/GalR mutational variants, and noncovalent residue contact networks for 65 LacI/GalR homolog structures. Using this rich data resource, we compared the noncovalent residue contact networks of the LacI/GalR subfamilies to design and experimentally validate an allosteric mutant of a synthetic LacI/GalR repressor for use in biotechnology. The AlloRep database (freely available at www.AlloRep.org) is a key resource for future evolutionary studies of LacI/GalR homologs and for benchmarking computational predictions of functional change. Copyright © 2015 Elsevier Ltd. All rights reserved.
Spectroscopy of 10 γ -Ray BL Lac Objects at High Redshift
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paiano, Simona; Falomo, Renato; Landoni, Marco
2017-08-01
We present optical spectra with high signal-to-noise ratio of 10 BL Lac objects detected at GeV energies by the Fermi satellite (3FGL catalog), which previous observations suggested are at relatively high redshift. The new observations, obtained at the 10 m Gran Telescopio Canarias, allowed us to find the redshift for J0814.5+2943 ( z = 0.703), and we can set a spectroscopic lower limit for J0008.0+4713 ( z > 1.659) and J1107.7+0222 ( z > 1.0735) on the basis of Mg ii intervening absorption features. In addition we confirm the redshifts for J0505.5+0416 ( z = 0.423) and J1450+5200 ( zmore » > 2.470). Finally we contradict the previous z estimates for five objects (J0049.7+0237, J0243.5+7119, J0802.0+1005, J1109.4+2411, and J2116.1+3339).« less
Are some BL Lacs artefacts of gravitational lensing?
Ostriker, J P; Vietri, M
1990-03-01
WE suggested in 1985 that a significant fraction of BL Lacertae objects, a kind of lineless quasar, seen in nearby galaxies are in fact images, gravitationally lensed and substantially amplified by stars in the nearby galaxy, of background objects, optically violent variable (OVV) quasars at redshifts z > 1 (ref. 1). This hypothesis was made on the basis of certain general similarities between BL Lacs and O Ws, but for two recently observed BL Lacs(2,3) a strong case can be made that the accompanying elliptical galaxy is a foreground object. In addition, we argue that the distribution of BL Lac redshifts is hard to understand without gravitational lensing, unless we happen to be at a very local maximum of the spatial cosmic distribution of BL Lacs. Our analysis also indicates that the galaxies whose stars are likely to act as microlenses will be found in two peaks, one nearby, with redshift 0.05-0.10, and the other near the distant quasar.
An Analysis of Periodic Components in BL Lac Object S5 0716 +714 with MUSIC Method
NASA Astrophysics Data System (ADS)
Tang, J.
2012-01-01
Multiple signal classification (MUSIC) algorithms are introduced to the estimation of the period of variation of BL Lac objects.The principle of MUSIC spectral analysis method and theoretical analysis of the resolution of frequency spectrum using analog signals are included. From a lot of literatures, we have collected a lot of effective observation data of BL Lac object S5 0716 + 714 in V, R, I bands from 1994 to 2008. The light variation periods of S5 0716 +714 are obtained by means of the MUSIC spectral analysis method and periodogram spectral analysis method. There exist two major periods: (3.33±0.08) years and (1.24±0.01) years for all bands. The estimation of the period of variation of the algorithm based on the MUSIC spectral analysis method is compared with that of the algorithm based on the periodogram spectral analysis method. It is a super-resolution algorithm with small data length, and could be used to detect the period of variation of weak signals.
The Gamma-Ray Bright BL Lac Object RX J1211+2242
NASA Technical Reports Server (NTRS)
Beckmann, V.; Favre, P.; Tavecchio, F.; Bussien, T.; Fliri, J.; Wolter, A.
2004-01-01
RX J1211+2242 is an optically faint (B approximately equal to 19.2mag) but X-ray bright (f2-10kev = 5 x l0(exp -12)erg per square centimeter per second) AGN, which has been shown to be a BL Lac object at redshift z = 0.455. The ROSAT X-ray, Calar Alto optical, and NVSS radio data suggest that the peak of the synchrotron emission of this object is at energies as high as several keV. BeppoSAX observations have been carried out simultaneously with optical observations in order to extend the coverage to higher energies. The new data indeed indicate a turn-over in the 2 - 10keV energy region. We propose that RX J1211+2242 is the counterpart of the unidentified EGRET source 3EG J1212+2304, making it a gamma-ray emitter with properties similar to, for example, Markarian 501 in its bright state, though being at a much larger distance.
An Analysis of Light Periods of BL Lac Object S5 0716+714 with the MUSIC Algorithm
NASA Astrophysics Data System (ADS)
Tang, Jie
2012-07-01
The multiple signal classification (MUSIC) algorithm is introduced to the estimation of light periods of BL Lac objects. The principle of the MUSIC algorithm is given, together with a testing on its spectral resolution by using a simulative signal. From a lot of literature, we have collected a large number of effective observational data of the BL Lac object S5 0716+714 in the three optical wavebands V, R, and I from 1994 to 2008. The light periods of S5 0716+714 are obtained by means of the MUSIC algorithm and average periodogram algorithm, respectively. It is found that there exist two major periodic components, one is the period of (3.33±0.08) yr, another is the period of (1.24±0.01) yr. The comparison of the performances of periodicity analysis of two algorithms indicates that the MUSIC algorithm has a smaller requirement on the sample length, as well as a good spectral resolution and anti-noise ability, to improve the accuracy of periodicity analysis in the case of short sample length.
NASA Astrophysics Data System (ADS)
Krawczynski, Henric
2007-04-01
In this contribution we discuss models of the X-rays and TeV gamma-ray emission from BL Lac objects based on parallel electron-positron or electron-proton beams that form close to the central black hole owing to the strong electric fields generated by the accretion disk and possibly also by the black hole itself. Fitting the energy spectrum of the BL Lac object Mrk 501, we obtain tight constrains on the beam properties. Launching a sufficiently energetic beam requires rather strong magnetic fields close to the black hole 100-1000 G. However, the model fits imply that the magnetic field in the emission region is only 0.02 G. Thus, the particles are accelerated close to the black hole and propagate a considerable distance before instabilities trigger the dissipation of energy through synchrotron and self-Compton emission. We discuss various approaches to generate enough power to drive the jet and, at the same time, to accelerate particles to 20 TeV energies. Although the parallel beam model has its own problems, it explains some of the long-standing problems that plague models based on Fermi type particle acceleration, like the presence of a very high minimum Lorentz factor of accelerated particles. We conclude with a brief discussion of the implications of the model for the difference between the processes of jet formation in BL Lac type objects and in quasars.
The Radio-optical Spectra of BL Lacs and Possible Relatives
NASA Astrophysics Data System (ADS)
Dennett-Thorpe, J.
I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?
Contemporaneous broadband observations of three high-redshift BL Lac objects
Ackerman, M.
2016-03-20
We have collected broadband spectral energy distributions (SEDs) of three BL Lac objects, 3FGL J0022.1-1855 (z=0.689), 3FGL J0630.9-2406 (z > ~1.239), and 3FGL J0811.2-7529 (z=0.774), detected by Fermi with relatively flat GeV spectra. By observing simultaneously in the near-IR to hard X-ray band, we can well characterize the high end of the synchrotron component of the SED. Thus, fitting the SEDs to synchro-Compton models of the dominant emission from the relativistic jet, we can constrain the underlying particle properties and predict the shape of the GeV Compton component. Standard extragalactic background light (EBL) models explain the high-energy absorption well, withmore » poorer fits for high UV models. The fits show clear evidence for EBL absorption in the Fermi spectrum of our highest redshift source 3FGL J0630.9-2406. While synchrotron self-Compton models adequately describe the SEDs, the situation may be complicated by possible external Compton components.« less
Fermi LAT detection of a GeV flare from the BL Lac object Mrk 421
NASA Astrophysics Data System (ADS)
D'Ammando, F.; Orienti, M.
2012-07-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object Mrk 421 (also known as 2FGL J1104.4+3812, Nolan et al. 2012, ApJS, 199, 31; R.A.= 11h04m27.3139s, Dec.= +38d12m31.799s, J2000.0, Fey et al. 2004, AJ, 127, 3587) at redshift z=0.03 (De Vaucouleurs et al.
Andersen, Joakim M.; Barrangou, Rodolphe; Abou Hachem, Maher; Lahtinen, Sampo; Goh, Yong Jun; Svensson, Birte; Klaenhammer, Todd R.
2011-01-01
Probiotic microbes rely on their ability to survive in the gastrointestinal tract, adhere to mucosal surfaces, and metabolize available energy sources from dietary compounds, including prebiotics. Genome sequencing projects have proposed models for understanding prebiotic catabolism, but mechanisms remain to be elucidated for many prebiotic substrates. Although β-galactooligosaccharides (GOS) are documented prebiotic compounds, little is known about their utilization by lactobacilli. This study aimed to identify genetic loci in Lactobacillus acidophilus NCFM responsible for the transport and catabolism of GOS. Whole-genome oligonucleotide microarrays were used to survey the differential global transcriptome during logarithmic growth of L. acidophilus NCFM using GOS or glucose as a sole source of carbohydrate. Within the 16.6-kbp gal-lac gene cluster, lacS, a galactoside-pentose-hexuronide permease-encoding gene, was up-regulated 5.1-fold in the presence of GOS. In addition, two β-galactosidases, LacA and LacLM, and enzymes in the Leloir pathway were also encoded by genes within this locus and up-regulated by GOS stimulation. Generation of a lacS-deficient mutant enabled phenotypic confirmation of the functional LacS permease not only for the utilization of lactose and GOS but also lactitol, suggesting a prominent role of LacS in the metabolism of a broad range of prebiotic β-galactosides, known to selectively modulate the beneficial gut microbiota. PMID:22006318
Louisiana SIP: LAC 33:III Ch. 5 Section 509. Prevention of Significant Deterioration; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) and 1991-07-01 (LAc57) and 1996-12-16 (LAc69) to 2011-08-17 (LAd36 - Revised)
NASA Technical Reports Server (NTRS)
Kondo, D. M.; Worrall, D. M.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. H.; Oke, J. B.; Yee, H.; Neugebauer, G.; Matthews, K.; Feldman, P. A.
1980-01-01
Quasi-simultaneous observations of the BL Lacertae (Lac) objects MK 501 were performed for the first time at X-ray, ultraviolet, visible, infrared, and radio frequencies. The observed spectral slope from the X-ray to UV regions is positive and continuous, but that from the mid UV to visible light region becomes gradually flat and possibly turns down toward lower frequencies; the optical radio emission can not be accounted for by a single power law. Several theoretical models were considered for the emission mechanism. A quantitative comparison was performed with the synchrotron-self-Compton model; the total spectrum is found consistent with this model. The spectrum from visible light to X-ray is consistent with synchrotron radiation or with inverse-Compton scattering by a hot thermal cloud of electrons. The continuity of the spectral slope from X-ray to UV implied by the current data suggests that the previous estimates of the total luminosity of this BL Lac object is underestimated by a factor of about three or four.
NASA Astrophysics Data System (ADS)
Master, Sharad
2010-11-01
Lac Télé is a large lake, ˜5.6 km in diameter, with an ovoid shape, situated at 17°10'E, 1°20'N, in the great tropical rain forest region of the Republic of Congo. This lake has attracted widespread attention, mainly because of the legends among the local people that it harbours a strange animal known as the Mokele-Mbembe, but also because it is situated in a region that is a hotbed of biodiversity and conservation efforts with respect to various endangered mammalian species, including gorillas and chimpanzees. Because of its appearance, Lac Télé has been regarded as a possible meteorite impact structure. Various expeditions, studying cryptozoology, conservation ecology, biodiversity, and the impact hypothesis, have visited Lac Télé in the past several decades. The Lac Télé structure is located in the NW part of the intracratonic Congo Basin, in a region dominated by Holocene alluvium, dense tropical rain forest, and swamps which form part of the basin of the Likouala aux Herbes, a multi-branched meandering river flowing over very low gradients into the Sangha river, a major tributary of the Congo river. Previous bathymetric studies have shown that the average depth of Lac Télé is only 4 m, including organic-rich silty sediments. The structure is that of a flat-bottomed dish. Modelling of the Lac Télé as an impact structure indicates a number of features which ought to be present. The absence of any of these features, coupled with the irregular ovoid shape, the palynological record, and the location of the structure at the intersection of major regional lineaments, is regarded as evidence against the impact hypothesis. Lac Télé as an isolated lake ecosystem is not unique in the Congo Basin, and there are several other similar small shallow isolated lakes surrounded by rain forest and marshes, some of which formed by damming of drainage systems by neotectonic faults. It is suggested that the formation of Lac Télé may be related to its location
POWERFUL HIGH-ENERGY EMISSION OF THE REMARKABLE BL Lac OBJECT S5 0716+714
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vittorini, V.; Chen, A. W.; Ferrari, A.
BL Lac objects of the intermediate subclass (IBLs) are known to emit a substantial fraction of their power in the energy range 0.1-10 GeV. Detecting gamma-ray emission from such sources provides therefore a direct probe of the emission mechanisms and of the underlying powerhouse. The gamma-ray satellite, AGILE, detected the remarkable IBL S5 0716+714 (z approx = 0.3) during a high state in the period from 2007 September-October, marked by two very intense flares reaching peak fluxes of 200 x 10{sup -8} photons cm{sup -2} s{sup -1} above 100 MeV, with simultaneous optical and X-ray observations. We present here amore » theoretical model for the two major flares and discuss the overall energetics of the source. We conclude that 0716+714 is among the brightest BL Lac's ever detected at gamma-ray energies. Because of its high power and lack of signs for ongoing accretion or surrounding gas, the source is an ideal candidate to test the maximal power extractable from a rotating supermassive black hole via the pure Blandford-Znajek (BZ) mechanism. We find that during the 2007 gamma-ray flares 0716+714 approached or just exceeded the upper limit set by BZ for a black hole of mass 10{sup 9} M{sub sun}.« less
Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T
2016-10-01
Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Rosey, E L; Oskouian, B; Stewart, G C
1991-01-01
The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose 6-phosphate pathway enzymes utilizing galactose 6-phosphate or fructose phosphate analogs as substrate, is described. Expression of both lacA and lacB was required for galactose 6-phosphate isomerase activity. LacC (34 kDa) demonstrated tagatose 6-phosphate kinase activity and was found to share significant homology with LacC from Lactococcus lactis and with both the minor 6-phosphofructokinase (PfkB) and 1-phosphofructokinase (FruK) from E. coli. Detection of tagatose 1,6-bisphosphate aldolase activity was dependent on expression of the 36-kDa protein specified by lacD. The LacD protein is highly homologous with LacD of L. lactis. Thus, the lacABCD genes comprise the tagatose 6-phosphate pathway and are cotranscribed with genes lacFEG, which specify proteins for transport and cleavage of lactose in S. aureus. PMID:1655695
Fermi LAT detection of a GeV flare from the high redshift BL Lac object PKS 2131-021
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2012-08-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2131-021 (also known as 2FGL J2133.8-0154, Nolan et al. 2012, ApJS, 199, 31, and 4C -02.81) placed at radio coordinates R.A.: 323.5429567 deg, Dec.: -1.8881217 deg (J2000, Johnston et al. 1995, AJ, 110, 880).
Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping
2018-04-11
Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .
Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J
2004-01-01
A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most
The REX survey as a Tool to Test the Beaming Model for BL Lacs
NASA Astrophysics Data System (ADS)
Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.
We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.
Fermi-LAT detection of a GeV flare from the BL Lac object 1ES 2322-409
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2013-10-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed an increasing gamma-ray flux from a source positionally consistent with the BL Lac object 1ES 2322-409 (also know as 2FGL J2324.7-4042, Nolan et al. 2012, ApJS, 199, 31, and as 1FHL J2324.6-4041, Ackermann et al., ApJS, submitted, arXiv:1306.6772), with 2MASS counterpart coordinates, (J2000.0), R.A.: 351.18612 deg, Dec: -40.68036 deg (Mao 2011, New Ast., 16, 503).
Program Evaluation of Community College Learning Assistance Centers: What Do LAC Directors Think?
ERIC Educational Resources Information Center
Franklin, Doug; Blankenberger, Bob
2016-01-01
Objective: This study seeks to determine the nature of current program evaluation practices for learning assistance centers (LACs), the practices being used for program evaluation, and whether LAC directors believe their practices are appropriate for evaluating program effectiveness. Method: We conducted a survey (n = 61) of community college LAC…
Modification of natural matrix lac-bagasse for matrix composite films
NASA Astrophysics Data System (ADS)
Nurhayati, Nanik Dwi; Widjaya, Karna; Triyono
2016-02-01
Material technology continues to be developed in order to a material that is more efficient with composite technology is a combination of two or more materials to obtain the desired material properties. The objective of this research was to modification and characterize the natural matrix lac-bagasse as composite films. The first step, natural matrix lac was changed from solid to liquid using an ethanol as a solvent so the matrix homogenly. Natural matrix lac was modified by adding citric acid with concentration variation. Secondly, the bagasse delignification using acid hydrolysis method. The composite films natural matrix lac-bagasse were prepared with optimum modified the addition citric acid 5% (v/v) and delignification bagasse optimum at 1,5% (v/v) in hot press at 80°C 6 Kg/cm-1. Thirdly, composite films without and with modification were characterized functional group analysis using FTIR spectrophotometer and mechanical properties using Universal Testing Machine. The result of research showed natural matrix lac can be modified by reaction with citric acid. FTIR spectra showed without and with modification had functional groups wide absorption 3448 cm-1 group -OH, C=O ester strong on 1712 cm-1 and the methylene group -CH2 on absorption 1465 cm-1. The mechanical properties showed tensile strength 0,55 MPa and elongation at break of 0,95 %. So that composite films natural matrix lac can be made with reinforcement bagasse for material application.
Optical and X-ray observations of the two BL Lac objects OJ 287 and MS 1458+22
NASA Astrophysics Data System (ADS)
Massaro, E.; Giommi, P.; Perri, M.; Tagliaferri, G.; Nesci, R.; Tosti, G.; Ciprini, S.; Montagni, F.; Ravasio, M.; Ghisellini, G.; Frasca, A.; Marilli, E.; Valentini, G.; Kurtanidze, O. M.; Nikolashvili, M. G.
2003-02-01
We present the results of recent BeppoSAX observations of the two BL Lac objects OJ 287 and MS 1458+22 in bright optical states and of simultaneous photometric measurements in the bandpasses from I to U. OJ 287 was observed in November 2001 and MS 1458+22 in February of the same year. The X-ray flux of OJ 287 was rather low, F(2-10 keV) = (1.35+/-0.15)x 10-12 erg cm-2 s-1 and its spectrum is well described by a single power law with an energy index 0.45+/-0.08, flatter than that measured in the optical, equal to 1.53+/-0.03. The X-ray emission of MS 1458+22 was characterized by a low flux level of F(2-10 keV) = (7.5+/-0.6)x 10-13 erg cm-2 s-1, with a steeper spectral index of 1.71+/-0.15, while in the optical it was 0.99+/-0.06. We show that the broad-band SEDs of these two sources can be well represented by log-parabolic spectral laws and evaluate their parameters. This law, already observed for the synchrotron components of other BL Lac sources, can be explained if the emitting particles are accelerated by some statistical mechanism having a probability of energy gain that is a decreasing function of the energy itself.
On the Redshift of TeV BL Lac Objects
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paiano, Simona; Falomo, Renato; Landoni, Marco
2017-03-10
We report results of a spectroscopic campaign carried out at the 10 m Gran Telescopio Canarias for a sample of 22 BL Lac objects detected (or candidates) at TeV energies, aiming to determine or constrain their redshift. This is of fundamental importance for the interpretation of their emission models and for population studies and is also mandatory for studying the interaction of high-energy photons with the extragalactic background light using TeV sources. Optical spectra with high signal-to-noise ratios in the range 4250–10000 Å were obtained to search for faint emission or absorption lines from both the host galaxy and themore » nucleus. We determine a new redshift for PKS 1424+240 ( z = 0.604) and a tentative one for 1ES 0033+595 ( z = 0.467). We are able to set new spectroscopic redshift lower limits for three other sources on the basis of Mg ii and Ca ii intervening absorption features: BZB J1243+3627 ( z > 0.483), BZB J1540+8155 ( z > 0.672), and BZB 0J2323+4210 ( z > 0.267). We confirm previous redshift estimates for four blazars: S3 0218+357 ( z = 0.944), 1ES 1215+303 ( z = 0.129), W Comae ( z = 0.102), and MS 1221.8+2452 ( z = 0.218). For the remaining targets, in seven cases (S2 0109+22, 3C 66A, VER J0521+211, S4 0954+65, BZB J1120+4214, S3 1227+25, BZB J2323+4210), we do not validate the proposed redshift. Finally, for all sources of still-unknown redshift, we set a lower limit based on the minimum equivalent width of absorption features expected from the host galaxy.« less
Evidence for an intermediate conformational state of LacY.
Jiang, Xiaoxu; Guan, Lan; Zhou, Yonggang; Hong, Wen-Xu; Zhang, Qinghai; Kaback, H Ronald
2012-03-20
LacY mutant Cys154 → Gly exhibits a periplasmic-closed crystal structure identical to the WT, but is periplasmic-open in the membrane. The mutant hardly catalyzes transport, but binds galactosides from either side of the membrane with the same affinity and is resistant to site-directed proteolysis relative to the pseudo-WT. Site-directed alkylation was also applied to 11 single-Cys mutants in Cys154 → Gly LacY in right-side-out membrane vesicles or after solubilization and purification in dodecyl-β-D-maltopyranoside (DDM). Unlike the pseudo-WT, Cys replacements on the periplasmic side of the Cys154 → Gly mutant label rapidly in the membrane without sugar, but labeling decreases markedly after the mutant proteins are purified. Thus, Cys154 → Gly LacY likely favors a higher-energy intermediate periplasmic-open conformation in situ, but collapses to a lower-energy periplasmic-closed conformation in DDM after purification. Notably, branched-chain or neopentyl glycol maltoside detergents stabilize Cys154 → Gly LacY in the membrane-embedded form.
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Cortina, Juan
2013-05-01
H1722+119 is a BL Lac object, that was listed as candidate TeV blazar in Costamante & Ghisellini (2002) based on its X-ray and radio properties. Its redshift is uncertain; Sbarufatti et al. 2006 give z>0.17. The source has been detected by Fermi-LAT, in the Second Fermi Catalog with F(>1 GeV) (3.7+-0.3)e-09 cm^-2 s^-1 and with spectral index 1.92+-0.06. H1722+119 was observed for five nights by the MAGIC telescopes starting May 17th 2013 and collecting 11 hours of good quality data.
Regulation of lac Operon Expression: Reappraisal of the Theory of Catabolite Repression
Wanner, Barry L.; Kodaira, Ryoji; Neidhardt, Frederick C.
1978-01-01
The physiological state of Escherichia coli with respect to (permanent) catabolite repression was assessed by measuring the steady-state level of β-galactosidase in induced or in constitutive cells under a variety of growth conditions. Four results were obtained. (i) Catabolite repression had a major effect on fully induced or constitutive expression of the lac gene, and the magnitude of this effect was found to be dependent on the promoter structure; cells with a wild-type lac promoter showed an 18-fold variation in lac expression, and cells with the lacP37 (formerly lac-L37) promoter exhibited several hundred-fold variation. (ii) Exogenous adenosine cyclic 3′,5′-monophosphoric acid (cAMP) could not abolish catabolite repression, even though several controls demonstrated that cAMP was entering the cells in significant amounts. (Rapid intracellular degradation of cAMP could not be ruled out.) (iii) Neither the growth rate nor the presence of biosynthetic products altered the degree of catabolite repression; all variation could be related to the catabolites present in the growth medium. (iv) Slowing by imposing an amino acid restriction decreased the differential rate of β-galactosidase synthesis from the wild-type lac promoter when bacteria were cultured in either the absence or presence of cAMP; this decreased lac expression also occurred when the bacteria harbored the catabolite-insensitive lacP5 (formerly lacUV5) promoter mutation. These findings support the idea that (permanent) catabolite repression is set by the catabolites in the growth medium and may not be related to an imbalance between catabolism and anabolism. PMID:214424
The cosmic evolution of Fermi BL lacertae objects
Ajello, M.; Romani, R. W.; Gasparrini, D.; ...
2013-12-13
Fermi has provided the largest sample of γ-ray-selected blazars to date. We use a uniformly selected set of 211 BL Lacertae (BL Lac) objects detected by Fermi during its first year of operation. We obtained redshift constraints for 206 out of the 211 BL Lac objects in our sample, making it the largest and most complete sample of BL Lac objects available in the literature. We use this sample to determine the luminosity function of BL Lac objects and its evolution with cosmic time. Here, we find that for most BL Lac classes the evolution is positive, with a space density peaking at modest redshift (z ≈ 1.2). Low-luminosity, high-synchrotron-peaked (HSP) BL Lac objects are an exception, showing strong negative evolution, with number density increasing for z lesssim 0.5. Since this rise corresponds to a drop-off in the density of flat-spectrum radio quasars (FSRQs), a possible interpretation is that these HSPs represent an accretion-starved end state of an earlier merger-driven gas-rich phase. Additionally, we find that the known BL Lac correlation between luminosity and photon spectral index persists after correction for the substantial observational selection effects with implications for the so-called "blazar sequence." Finally, by estimating the beaming corrections to the luminosity function, we find that BL Lac objects have an average Lorentz factor ofmore » $$\\gamma =6.1^{+1.1}_{-0.8}$$, and that most are seen within 10° of the jet axis.« less
VERITAS Observations of the BL Lac Object PG 1553+113
NASA Astrophysics Data System (ADS)
Aliu, E.; Archer, A.; Aune, T.; Barnacka, A.; Behera, B.; Beilicke, M.; Benbow, W.; Berger, K.; Bird, R.; Buckley, J. H.; Bugaev, V.; Byrum, K.; Cardenzana, J. V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dickinson, H. J.; Dumm, J.; Eisch, J. D.; Errando, M.; Falcone, A.; Federici, S.; Feng, Q.; Finley, J. P.; Fortin, P.; Fortson, L.; Furniss, A.; Galante, N.; Gillanders, G. H.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Håkansson, N.; Hanna, D.; Holder, J.; Hughes, G.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krawczynski, H.; Krennrich, F.; Kumar, S.; Lang, M. J.; Madhavan, A.; McArthur, S.; McCann, A.; Meagher, K.; Millis, J.; Moriarty, P.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Orr, M.; Otte, A. N.; Park, N.; Perkins, J. S.; Pohl, M.; Popkow, A.; Prokoph, H.; Pueschel, E.; Quinn, J.; Ragan, K.; Rajotte, J.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Sembroski, G. H.; Shahinyan, K.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Varlotta, A.; Vassiliev, V. V.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.
2015-01-01
We present results from VERITAS observations of the BL Lac object PG 1553+113 spanning the years 2010, 2011, and 2012. The time-averaged spectrum, measured between 160 and 560 GeV, is well described by a power law with a spectral index of 4.33 ± 0.09. The time-averaged integral flux above 200 GeV measured for this period was (1.69 ± 0.06) × 10-11 photons cm-2 s-1, corresponding to 6.9% of the Crab Nebula flux. We also present the combined γ-ray spectrum from the Fermi Large Area Telescope and VERITAS covering an energy range from 100 MeV to 560 GeV. The data are well fit by a power law with an exponential cutoff at 101.9 ± 3.2 GeV. The origin of the cutoff could be intrinsic to PG 1553+113 or be due to the γ-ray opacity of our universe through pair production off the extragalactic background light (EBL). Given lower limits to the redshift of z > 0.395 based on optical/UV observations of PG 1553+113, the cutoff would be dominated by EBL absorption. Conversely, the small statistical uncertainties of the VERITAS energy spectrum have allowed us to provide a robust upper limit on the redshift of PG 1553+113 of z <= 0.62. A strongly elevated mean flux of (2.50 ± 0.14) × 10-11 photons cm-2 s-1 (10.3% of the Crab Nebula flux) was observed during 2012, with the daily flux reaching as high as (4.44 +/- 0.71) × 10-11 {photons} {cm}-2 {s}-1 (18.3% of the Crab Nebula flux) on MJD 56048. The light curve measured during the 2012 observing season is marginally inconsistent with a steady flux, giving a χ2 probability for a steady flux of 0.03%.
Indian Americans at Mille Lacs.
ERIC Educational Resources Information Center
Holbert, Victoria L.; And Others
The Training Center for Community Programs prepared a report on the Mille Lacs (Chippewa) Reservation in Minnesota. Data for the report were from 2 separate sources: a survey conducted by the Training Center with the assistance of the Mille Lacs community action program (1967) and an attitudinal survey conducted by Victoria Holbert during 1969.…
Optical and radio properties of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Stocke, J. T.; Liebert, J.; Schmidt, G.; Gioia, I. M.; Maccacaro, T.
1985-01-01
The eight BL Lac objects from the HEAO 1 A-2 all-sky survey and from the Einstein medium-sensitivity survey (MSS) form a flux-limited complete X-ray selected sample. The optical and radio properties of the MSS BL Lac objects are presented and compared with those of the HEAO 1 A-2 sample and with those of radio-selected BL Lac objects. The X-ray selected BL Lac objects possess smaller polarized fractions and less violent optical variability than radio-selected BL Lac objects. These properties are consistent with the substantial starlight fraction seen in the optical spectra of a majority of these objects. This starlight allows a determination of definite redshifts for two of four MSS BL Lac objects and a probable redshift for a third. These redshifts are 0.2, 0.3, and 0.6. Despite the differences in characteristics between the X-ray selected and radio-selected samples, it is concluded that these eight objects possess most of the basic qualities of BL Lac objects and should be considered members of that class. Moreover, as a class, these X-ray selected objects have the largest ratio of X-ray to optical flux of any active galactic nuclei yet discovered.
NASA Technical Reports Server (NTRS)
Stocke, John T.
1998-01-01
This grant has contributed to one of the original goals of the NAS/LTSA program, the goal of junior faculty development. Below I briefly summarize the following major results on BL Lacertae Objects that we have obtained. An invited talk on BL Lac Objects at IAU 175 "Extragalactic Radio Sources" at Bologna Italy in October 1995 summarized some of these results. A second invited talk in Oct 1998 at Green Bamk, WVA presented other BL Lac results at the conference entitled: "Highly Redshifted Radio Lines". We have used the EMSS sample to measure the X-ray luminosity function and cosmological evolution of BL Lacs. A new large sample of XBLs has been discovered.
Kumar, Hemant; Finer-Moore, Janet S.; Kaback, H. Ronald; Stroud, Robert M.
2015-01-01
The X-ray crystal structure of a conformationally constrained mutant of the Escherichia coli lactose permease (the LacY double-Trp mutant Gly-46→Trp/Gly-262→Trp) with bound p-nitrophenyl-α-d-galactopyranoside (α-NPG), a high-affinity lactose analog, is described. With the exception of Glu-126 (helix IV), side chains Trp-151 (helix V), Glu-269 (helix VIII), Arg-144 (helix V), His-322 (helix X), and Asn-272 (helix VIII) interact directly with the galactopyranosyl ring of α-NPG to provide specificity, as indicated by biochemical studies and shown directly by X-ray crystallography. In contrast, Phe-20, Met-23, and Phe-27 (helix I) are within van der Waals distance of the benzyl moiety of the analog and thereby increase binding affinity nonspecifically. Thus, the specificity of LacY for sugar is determined solely by side-chain interactions with the galactopyranosyl ring, whereas affinity is increased by nonspecific hydrophobic interactions with the anomeric substituent. PMID:26157133
Slechta, E Susan; Liu, Jing; Andersson, Dan I; Roth, John R
2002-01-01
In the genetic system of Cairns and Foster, a nongrowing population of an E. coli lac frameshift mutant appears to specifically accumulate Lac(+) revertants when starved on medium including lactose (adaptive mutation). This behavior has been attributed to stress-induced general mutagenesis in a subpopulation of starved cells (the hypermutable state model). We have suggested that, on the contrary, stress has no direct effect on mutability but favors only growth of cells that amplify their leaky mutant lac region (the amplification mutagenesis model). Selection enhances reversion primarily by increasing the mutant lac copy number within each developing clone on the selection plate. The observed general mutagenesis is attributed to a side effect of growth with an amplification-induction of SOS by DNA fragments released from a tandem array of lac copies. Here we show that the S. enterica version of the Cairns system shows SOS-dependent general mutagenesis and behaves in every way like the original E. coli system. In both systems, lac revertants are mutagenized during selection. Eliminating the 35-fold increase in mutation rate reduces revertant number only 2- to 4-fold. This discrepancy is due to continued growth of amplification cells until some clones manage to revert without mutagenesis solely by increasing their lac copy number. Reversion in the absence of mutagenesis is still dependent on RecA function, as expected if it depends on lac amplification (a recombination-dependent process). These observations support the amplification mutagenesis model. PMID:12136002
NASA Astrophysics Data System (ADS)
Torres-Zafra, Juanita; Cellone, Sergio A.; Buzzoni, Alberto; Andruchow, Ileana; Portilla, José G.
2018-03-01
The BL Lac object 3C 66A is one of the most luminous extragalactic sources at TeV γ-rays (very high energy, i.e. E > 100 GeV). Since TeV γ-ray radiation is absorbed by the extragalactic background light (EBL), it is crucial to know the redshift of the source in order to reconstruct its original spectral energy distribution, as well as to constrain EBL models. However, the optical spectrum of this BL Lac is almost featureless, so a direct measurement of z is very difficult; in fact, the published redshift value for this source (z = 0.444) has been strongly questioned. Based on EBL absorption arguments, several constraints to its redshift, in the range 0.096 < z < 0.5, were proposed. Since these active galactic nuclei (AGNs) are hosted, typically, in early-type galaxies that are members of groups or clusters, we have analysed spectro-photometrically the environment of 3C 66A, with the goal of finding the galaxy group hosting this blazar. This study was made using optical images of a 5.5 × 5.5 arcmin2 field centred on the blazar, and spectra of 24 sources obtained with Gemini/GMOS-N multi-object spectroscopy. We found spectroscopic evidence of two galaxy groups along the blazar's line of sight: one at z ≃ 0.020 and the second one at z ≃ 0.340. The first one is consistent with a known foreground structure, while the second group presented here has six spectroscopically confirmed members. Their location along a red sequence in the colour-magnitude diagram allows us to identify 34 additional candidate members of the more distant group. The blazar's spectrum shows broad absorption features that we identify as arising in the intergalactic medium, thus allowing us to tentatively set a redshift lower limit at z_3C66A ≳ 0.33. As a consequence, we propose that 3C 66A is hosted in a galaxy that belongs to a cluster at z = 0.340.
Lü, Shiyou; Song, Tao; Kosma, Dylan K; Parsons, Eugene P; Rowland, Owen; Jenks, Matthew A
2009-08-01
Plant cuticle is an extracellular lipid-based matrix of cutin and waxes, which covers aerial organs and protects them from many forms of environmental stress. We report here the characterization of CER8/LACS1, one of nine Arabidopsis long-chain acyl-CoA synthetases thought to activate acyl chains. Mutations in LACS1 reduced the amount of wax in all chemical classes on the stem and leaf, except in the very long-chain fatty acid (VLCFA) class wherein acids longer than 24 carbons (C(24)) were elevated more than 155%. The C(16) cutin monomers on lacs1 were reduced by 37% and 22%, whereas the C(18) monomers were increased by 28% and 20% on stem and leaf, respectively. Amounts of wax and cutin on a lacs1-1 lacs2-3 double mutant were much lower than on either parent, and lacs1-1 lacs2-3 had much higher cuticular permeability than either parent. These additive effects indicate that LACS1 and LACS2 have overlapping functions in both wax and cutin synthesis. We demonstrated that LACS1 has synthetase activity for VLCFAs C(20)-C(30), with highest activity for C(30) acids. LACS1 thus appears to function as a very long-chain acyl-CoA synthetase in wax metabolism. Since C(16) but not C(18) cutin monomers are reduced in lacs1, and C(16) acids are the next most preferred acid (behind C(30)) by LACS1 in our assays, LACS1 also appears to be important for the incorporation of C(16) monomers into cutin polyester. As such, LACS1 defines a functionally novel acyl-CoA synthetase that preferentially modifies both VLCFAs for wax synthesis and long-chain (C(16)) fatty acids for cutin synthesis.
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K
2013-01-01
The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Complex genomic rearrangement in CCS-LacZ transgenic mice.
Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I
2007-02-01
The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.
NASA Astrophysics Data System (ADS)
Maloney, A. E.; Hing, S. N.; Richey, J. N.; Nelson, D. B.; Sachs, J. P.
2017-12-01
The South Pacific Convergence Zone (SPCZ) is the Southern Hemisphere's largest precipitation feature, yet little is known about the region's rainfall prior to the instrumental record. In the tropics, hydrogen isotopes of precipitation are controlled by the "amount effect" where higher mean annual rainfall rates result in 2H-depleted rain. In turn, hydrogen isotopes in tropical lakes are influenced by both rain water isotopes and evaporative enrichment. Molecular fossils preserved in lake sediments offer a promising tool for improving our understanding of the past SPCZ by tracking changes in lake water isotopes. Hydrogen isotope compositions (δ2H) of the algal lipid biomarker dinosterol were measured in duplicate sediment cores from lakes 2.75km apart on Wallis Island. The modern lakes differ in physical and chemical conditions but are both freshwater in the photic zone and experience identical climate conditions. They are an ideal setting to investigate the fidelity to which δ2Hdinosterol records climate. Duplicate records from Lac Lanutavake are in excellent agreement and reveal little change in during the past 1700 years with minor δ2Hdinosterol fluctuations between -280‰ and -290‰. Duplicate records from Lac Lalolalo also agree extremely well during the past 2,000 years. However, contrary to its neighbor, Lac Lalolalo has a highly variable δ2Hdinosterol history with 2H-depleted values of -300‰ during the youngest part of the record climbing to 2H-enriched values of -230‰ around 1000-2000 years ago. The large shift in Lac Lalolalo δ2Hdinosterol may be due to changes in lake biogeochemistry that impact growth conditions or shifts in dinoflagellate species composition. Alternatively, if the Lac Lalolalo record actually reflects changes in hydrology, large limnological changes must have occurred in Lac Lanutavke to mute the climate signal. This work emphasizes the importance of redundancy and duplication when investigating changes in past climate using
New High-z BL Lacs Using the Photometric Method with Swift and SARA
NASA Astrophysics Data System (ADS)
Kaur, A.; Rau, A.; Ajello, M.; Domínguez, A.; Paliya, V. S.; Greiner, J.; Hartmann, D. H.; Schady, P.
2018-06-01
BL Lacertae (BL Lac) objects are prominent members of the third Fermi Large Area Telescope catalog of γ-ray sources. Half of the members of the BL Lac population (∼300) lack redshift measurements, which is due to the absence of lines in their optical spectra, thereby making it difficult to utilize spectroscopic methods. Our photometric dropout technique can be used to establish the redshift for a fraction of these sources. This work employed six filters mounted on the Swift-UVOT and four optical filters on two telescopes, the 0.65 m SARA-CTIO in Chile and 1.0 m SARA-ORM in the Canary Islands, Spain. A sample of 15 sources was extracted from the Swift archival data for which six filter UVOT observations were conducted. By complementing the Swift observations with the SARA ones, we were able to discover two high-redshift sources: 3FGL J1155.4-3417 and 3FGL J1156.7–2250 at z={1.83}-0.13+0.10 and z={1.73}-0.19+0.11, respectively, resulting from the dropouts in the power-law template fits to these data. The discoveries add to the important (26 total) sample of high-redshift BL Lacs. While the sample of high-z BL Lacs is still rather small, these objects do not seem to fit well within known schemes of the blazar population and represent the best probes of the extragalactic background light.
A Search for Low-Luminosity BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Rector, Travis A.; Stocke, John T.; Perlman, Eric S.
1999-05-01
Many properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis, whereby BL Lacs are FR 1 radio galaxies viewed nearly along the jet axis. However, a possible problem with this model is that a transition population between beamed BL Lacs and unbeamed FR 1 galaxies has not been detected. A transition population of ``low-luminosity BL Lacs'' was predicted to exist in abundance in X-ray-selected samples such as the Einstein Extended Medium Sensitivity Survey (EMSS) by Browne & Marcha. However, these BL Lacs may have been misidentified as clusters of galaxies. We have conducted a search for such objects in the EMSS with the ROSAT High-Resolution Imager (HRI) here we present ROSAT HRI images, optical spectra, and VLA radio maps for a small number of BL Lacs that were previously misidentified in the EMSS catalog as clusters of galaxies. While these objects are slightly lower in luminosity than other EMSS BL Lacs, their properties are too similar to the other BL Lacs in the EMSS sample to ``bridge the gap'' between BL Lacs and FR 1 radio galaxies. Also, the number of new BL Lacs found is too low to alter significantly the X-ray luminosity function or
Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)
VERITAS OBSERVATIONS OF THE BL LAC OBJECT PG 1553+113
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aliu, E.; Archer, A.; Beilicke, M.
2015-01-20
We present results from VERITAS observations of the BL Lac object PG 1553+113 spanning the years 2010, 2011, and 2012. The time-averaged spectrum, measured between 160 and 560 GeV, is well described by a power law with a spectral index of 4.33 ± 0.09. The time-averaged integral flux above 200 GeV measured for this period was (1.69 ± 0.06) × 10{sup –11} photons cm{sup –2} s{sup –1}, corresponding to 6.9% of the Crab Nebula flux. We also present the combined γ-ray spectrum from the Fermi Large Area Telescope and VERITAS covering an energy range from 100 MeV to 560 GeV.more » The data are well fit by a power law with an exponential cutoff at 101.9 ± 3.2 GeV. The origin of the cutoff could be intrinsic to PG 1553+113 or be due to the γ-ray opacity of our universe through pair production off the extragalactic background light (EBL). Given lower limits to the redshift of z > 0.395 based on optical/UV observations of PG 1553+113, the cutoff would be dominated by EBL absorption. Conversely, the small statistical uncertainties of the VERITAS energy spectrum have allowed us to provide a robust upper limit on the redshift of PG 1553+113 of z ≤ 0.62. A strongly elevated mean flux of (2.50 ± 0.14) × 10{sup –11} photons cm{sup –2} s{sup –1} (10.3% of the Crab Nebula flux) was observed during 2012, with the daily flux reaching as high as (4.44±0.71)×10{sup −11} photons cm{sup −2} s{sup −1} (18.3% of the Crab Nebula flux) on MJD 56048. The light curve measured during the 2012 observing season is marginally inconsistent with a steady flux, giving a χ{sup 2} probability for a steady flux of 0.03%.« less
Radio constraints on the nature of BL Lacertae objects and their parent population
NASA Technical Reports Server (NTRS)
Kollgaard, R. I.; Wardle, J. F. C.; Roberts, D. H.; Gabuzda, D. C.
1992-01-01
5 GHz VLA observations of 17 BL Lac objects with bright radio cores at both high and low resolution are reported. Extended emission is detected around most objects. None of the sources observed at low resolution show evidence of giant halos on the scale of tens of arcmin. In general, the sources with the most luminous extended emission exhibit FR II characteristics in both morphology and polarization, and less luminous sources exhibit FR I characteristics. Thus, the parent population of the BL Lac objects contains both FR I and FR II radio sources. No BL Lac objects are found that clearly exhibit quasarlike polarization at milliarcsec resolution. This argues against the view that the more luminous BL Lac objects are simply an extension of the quasar/OVV population, or that most BL Lac objects are gravitationally microlensed images of distant quasars. Other properties are generally consistent with the view the BL Lac objects are normal radio galaxies whose jets make a small angle to the line of sight.
Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio
2008-01-01
Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101
NASA Technical Reports Server (NTRS)
Stocke, John; Perlman, Eric; Granados, Arno; Schachter, Jonathan; Elvis, Martin; Urry, Meg; Impey, Chris; Smith, Paul
1993-01-01
We present a new, efficient method for discovering new BL Lac Objects based upon the results of the Einstein Extended Medium Sensitivity Survey (EMSS). We have found that all x-ray selected BL Lacs are radio emitters, and further, that in a 'color-color' diagram (radio/optical and optical/x-ray) the BL Lac Objects occupy an area distinct from both radio loud quasars and the radio quiet QSOs and Seyferts which dominate x-ray selected samples. After obtaining radio counterparts via VLA 'snapshot' observations of a large sample of unidentified x-ray sources, the list of candidates is reduced. These candidates then can be confirmed with optical spectroscopy and/or polarimetry. Since greater than 70 percent of these sources are expected to be BL Lacs, the optical observations are very efficient. We have tested this method using unidentified sources found in the Einstein Slew Survey. The 162 Slew Survey x-ray source positions were observed with the VLA in a mixed B/C configuration at 6 cm resulting in 60 detections within 1.5 position error circle radii. These x-ray/optical/radio sources were then plotted, and 40 BL Lac candidates were identified. To date, 10 candidates have been spectroscopically observed resulting in 10 new BL Lac objects! Radio flux, optical magnitude, and polarization statistics (obtained in white light with the Steward Observatory 2.3 m CCD polarimeter) for each are given.
VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)
NASA Astrophysics Data System (ADS)
Marcha, M. J. M.; Caccianiga, A.
2014-04-01
This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).
Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample
NASA Astrophysics Data System (ADS)
Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.
1994-12-01
The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15
The Luminosity Function of the Host Galaxies of QSOs and BL Lac Objects
NASA Astrophysics Data System (ADS)
Carangelo, Nicoletta; Falomo, Renato; Treves, Aldo
A clear insight of the galaxies hosting active galactic nuclei is of fundamental importance for understanding the processes of galaxies and nuclei formation and their cosmic evolution. A good characterization of the host galaxies properties requires images of excellent quality in order to disentangle the light of the galaxy from that of the bright nucleus. To this aim HST has provided a major improvement of data on QSOs (Disney et al. 1995; Bahcall et al. 1996,1997; Boyce et al. 1998; McLure et al. 1999; Hamilton et al. 2000; Kukula et al. 2001) and BL Lacs (Scarpa et al. 2000, Urry et al. 2000).
The business of refractive laser assisted cataract surgery (ReLACS).
Berdahl, John P; Jensen, Matthew P
2014-01-01
Refractive Laser Assisted Cataract Surgery (ReLACS) combines the femtosecond laser with other noncovered tests and services in an attempt to reduce spectacle dependence in combination with cataract surgery. Significant interest is present among ophthalmologists who are considering adopting this technology, however significant capital outlays and continuing expenses can make the decision to adopt ReLACS foreboding. We review the financial considerations of ReLACS and review the trends seen in early adopters of this technology. Recent findings have shown that ReLACS is a growing segment of cataract surgery. Most practices who have implemented the technology have broken even and have a positive outlook on the financial return of implementing the ReLACS program. The average break-even analysis point for practices is around 230 cases a year. ReLACS is growing and appears to be a financial viable approach for many practices.
Adaptive Evolution of the Streptococcus pyogenes Regulatory Aldolase LacD.1
Cusumano, Zachary
2013-01-01
In the human-pathogenic bacterium Streptococcus pyogenes, the tagatose bisphosphate aldolase LacD.1 likely originated through a gene duplication event and was adapted to a role as a metabolic sensor for regulation of virulence gene transcription. Although LacD.1 retains enzymatic activity, its ancestral metabolic function resides in the LacD.2 aldolase, which is required for the catabolism of galactose. In this study, we compared these paralogous proteins to identify characteristics correlated with divergence and novel function. Surprisingly, despite the fact that these proteins have identical active sites and 82% similarity in amino acid sequence, LacD.1 was less efficient at cleaving both fructose and tagatose bisphosphates. Analysis of kinetic properties revealed that LacD.1's adaptation was associated with a decrease in kcat and an increase in Km. Construction and analysis of enzyme chimeras indicated that non-active-site residues previously associated with the variable activities of human aldolase isoenzymes modulated LacD.1's affinity for substrate. Mutant LacD.1 proteins engineered to have LacD.2-like levels of enzymatic efficiency lost the ability to function as regulators, suggesting that an alteration in efficiency was required for adaptation. In competition under growth conditions that mimic a deep-tissue environment, LacD.1 conferred a significant gain in fitness that was associated with its regulatory activity. Taken together, these data suggest that LacD.1's adaptation represents a form of neofunctionalization in which duplication facilitated the gain of regulatory function important for growth in tissue and pathogenesis. PMID:23316044
Jet Precession Driven by a Supermassive Black Hole Binary System in the BL Lac Object PG 1553+113
NASA Astrophysics Data System (ADS)
Caproni, Anderson; Abraham, Zulema; Motter, Juliana Cristina; Monteiro, Hektor
2017-12-01
The recent discovery of a roughly simultaneous periodic variability in the light curves of the BL Lac object PG 1553+113 at several electromagnetic bands represents the first case of such odd behavior reported in the literature. Motivated by this, we analyzed 15 GHz interferometric maps of the parsec-scale radio jet of PG 1553+113 to verify the presence of a possible counterpart of this periodic variability. We used the Cross-entropy statistical technique to obtain the structural parameters of the Gaussian components present in the radio maps of this source. We kinematically identified seven jet components formed coincidentally with flare-like features seen in the γ-ray light curve. From the derived jet component positions in the sky plane and their kinematics (ejection epochs, proper motions, and sky position angles), we modeled their temporal changes in terms of a relativistic jet that is steadily precessing in time. Our results indicate a precession period in the observer’s reference frame of 2.24 ± 0.03 years, compatible with the periodicity detected in the light curves of PG 1553+113. However, the maxima of the jet Doppler boosting factor are systematically delayed relative to the peaks of the main γ-ray flares. We propose two scenarios that could explain this delay, both based on the existence of a supermassive black hole binary system in PG 1553+113. We estimated the characteristics of this putative binary system that also would be responsible for driving the inferred jet precession.
The intraday variability in the radio-selected and X-ray-selected BL Lacertae objects
NASA Astrophysics Data System (ADS)
Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.
1998-10-01
Seven BL Lac objects have been photometrically observed in an effort to study the difference of optical intraday variability between the radio-selected BL Lac objects (RBLs) and X-ray-selected BL Lac objects (XBLs). The objects we observed are selected arbitrarily. They are four RBLs, PKS 0735+178, PKS 0754+101, OJ 287 and BL Lac, and three XBLs, H 0323+022, H 0548-322 and H 2154-304. During the observation all of them exhibited microvariation, and H 0323+022 and H 0548-322 sometimes showed brightness oscillation. PKS 0735+178 and BL Lac were in their faint states and not very active. It seems that RBLs do not show microvariability more frequently than XBLs. Table 2 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5)
The environment of x ray selected BL Lacs: Host galaxies and galaxy clustering
NASA Technical Reports Server (NTRS)
Wurtz, Ron; Stocke, John T.; Ellingson, Erica; Yee, Howard K. C.
1993-01-01
Using the Canada-France-Hawaii Telescope, we have imaged a complete, flux-limited sample of Einstein Medium Sensitivity Survey BL Lacertae objects in order to study the properties of BL Lac host galaxies and to use quantitative methods to determine the richness of their galaxy cluster environments.
Evaluation of coloring efficacy of lac dye in comminuted meat product.
Divya; Singh, R P; Baboo, B; Prasad, K M
2011-06-01
Effect of incorporation of graded levels (4, 6, 8, 10, 25 ppm) of lac dye on coloring efficacy and possible use of this natural color in processed meat products was studied. Inclusion of lac dye at different concentrations did not affect the pH significantly whereas a linear increase in the Lovibond red color unit of chicken nuggets was noted with raising the level of lac dye from 4 to 10 ppm. The sensory rating for color was highest at addition level of 25 ppm of lac dye and it was comparable to color score of the product containing 200 ppm sodium nitrite. Lac dye inclusion in nuggets at all concentrations studied had better antimicrobial properties as compared to 200 ppm sodium nitrite. It was concluded that lac dye from 10 to 25 ppm could be incorporated in comminuted meat products as a natural colorant with antimicrobial action.
Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])
Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)
The Cosmic Evolution of Fermi BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Ajello, Marco; Gasparrini, Dario; Romani, Roger W.; Shaw, Michael S.
2014-06-01
It has been notoriously difficult in the past to measure the cosmological evolution of BL Lacs because of the challenges related to measure their redshift. Extensive optical follow-up observations of a sample of ~200 Fermi-detected BL Lac objects have provided much-needed redshift information for many of them. This stands as the largest and most complete sample of BL Lacs available in the literature and was used to determine the cosmological properties of this elusive source class. This talk will review the cosmic evolution of BL Lacs and discuss the link to their siblings flat-spectrum radio quasars (FSRQs). Evidence suggests that BL Lacs of the high-synchrotron peaked class might be an accretion-starved end-state of an earlier merger-driven gas-rich phase.
Photometric monitoring of three BL Lacertae objects in 1993-1998
NASA Astrophysics Data System (ADS)
Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.
1999-05-01
The results of optical photometric (BVRI) monitoring of three BL Lac objects over a time interval of about four years are presented. The sources are three classical radio-selected BL Lac objects, BL Lac, OJ 287 and PKS 0735+178. During our observation OJ 287 was in the stage of a large periodic outburst which consisted of at least two peaks. Almost all the observations obtained over consecutive nights detected intranight variations. In 1995 and 1996 BL Lac kept in faint states, with fewer and smaller rapid flares and fluctuations. On the contrary, in late 1997 BL Lac was at the stage of a large outburst, accompanied with much more large amplitude rapid flares and fluctuations. PKS 0735+178 was almost at its faint end from 1994 to early 1998. Over this time interval, the intraday variations and microvariations in PKS 0735+178 were rare and the amplitude was very small, except a rapid darkening of ~ 0.4 mag on 24 January 1995. Previous work by \\cite[Webb et al. (1988);]{web88} \\cite[Wagner et al. (1996);]{wag96} \\cite[Pian et al. (1997)]{pia97} also showed the same behaviour of variability as BL Lac and PKS 0735+178 in BL Lac, S5 0716+714, PKS 2155-304, respectively. We propose that the motion of orientation of the relativistic jet in a BL Lac object be responsible for these variability behaviours. Table~1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html
On the surface density of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Maccacaro, T.; Gioia, I. M.; Maccagni, D.; Stocke, J. T.
1984-01-01
Only a handful of BL Lac objects have been found as a result of systematic optical identification of serendipitous Einstein X-ray sources. By combining the data from two flux-limited complete X-ray surveys (the HEAO 1 A-2 and the Einstein Observatory Medium Sensitivity Survey) the surface density of X-ray emitting BL Lac objects is evaluated as a function of their X-ray flux. It is found that a single power law is not an acceptable representation of the BL Lac objects' X-ray log N-log S. The number-flux relationship is consistent with the Euclidean slope at 'high' flux levels but shows a drastic flattnring below fluxes of the order of 10 to the -12th ergs per sq cm/s. The implications of this result are briefly discussed with respect to the luminosity function, the cosmological evolution, and the X-ray to optical flux ratio in BL Lac objects.
Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro
2010-11-01
Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Photometric Redshifts of High-z BL Lacs from 3FGL Catalog
NASA Astrophysics Data System (ADS)
Kaur, A.; Rau, Arne; Ajello, Marco; Paliya, Vaidehi; Hartmann, Dieter; Greiner, Jochen; Bolmer, Jan; Schady, Patricia
2017-08-01
Determining redshifts for BL Lacertae (BL Lac) objects using the traditional spectroscopic method is challenging due to the absence of strong emission lines in their optical spectra. We employ the photometric dropout technique to determine redshifts for this class of blazars using the combined 13 broad-band filters from Swift-UVOT and the multi-channel imager GROND at the MPG 2.2 m telescope at ESO's La Silla Observatory. The wavelength range covered by these 13 filters extends from far ultraviolet to the near-Infrared. We report results on 40 new Fermi detected BL Lacs with the photometric redshifts determinations for 5 sources, with 3FGL J1918.2-4110 being the most distance in our sample at z=2.16. Reliable upper limits are provided for 20 sources in this sample. Using the highest energy photons for these Fermi-LAT sources, we evaluate the consistency with the Gamma-ray horizon due to the extragalactic background light.
NASA Astrophysics Data System (ADS)
Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Sbarrato, T.
2015-07-01
High-energy observations of extreme BL Lac objects, such as 1ES 0229+200 or 1ES 0347-121, recently focused interest both for blazar and jet physics and for the implication on the extragalactic background light and intergalactic magnetic field estimate. However, the number of these extreme highly peaked BL Lac objects (EHBL) is still rather small. Aiming at increase their number, we selected a group of EHBL candidates starting from the BL Lac sample of Plotkin et al. (2011), considering those undetected (or only barely detected) by the Large Area Telescope onboard Fermi and characterized by a high X-ray versus radio flux ratio. We assembled the multiwavelength spectral energy distribution of the resulting nine sources, profiting of publicly available archival observations performed by Swift, GALEX, and Fermi satellites, confirming their nature. Through a simple one-zone synchrotron self-Compton model we estimate the expected very high energy flux, finding that in the majority of cases it is within the reach of present generation of Cherenkov arrays or of the forthcoming Cherenkov Telescope Array.
A KPC-scale X-ray jet in the BL LAC Source S5 2007+777
NASA Technical Reports Server (NTRS)
Sambruna, Rita; Maraschi, Laura; Tavecchio, Fabrizio
2008-01-01
The BL Lac S3 2007++777, a classical radio-selected BL Lac from the sample of Stirkel et al. exhibiting an extended (19") radio jet. was observed with Chandra revealing an X-ray jet with simi1ar morphology. The hard X-ray spectrum and broad band SED is consistent with an IC/CMB origin for the X-ray emission, implying a highly relativistic flow at small angle to the line of sight with an unusually large deprojected length, 300 kpc. A structured jet consisting of a fast spine and slow wall is consistent with the observations.
Optical polarimetry and photometry of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Jannuzi, Buell T.; Smith, Paul S.; Elston, Richard
1993-01-01
We present the data from 3 years of monitoring the optical polarization and apparent brightness of 37 X-ray-selected BL Lacertae objects. The monitored objects include a complete sample drawn from the Einstein Extended Medium Sensitivity Survey. We confirm the BL Lac identifications for 15 of these 22 objects. We include descriptions of the objects and samples in our monitoring program and of the existing complete samples of BL Lac objects, highly polarized quasars, optically violent variable quasars, and blazars.
Solving a discrete model of the lac operon using Z3
NASA Astrophysics Data System (ADS)
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Design of the lac gene circuit revisited
Savageau, Michael A.
2011-01-01
The lactose (lac) operon of Escherichia coli serves as the paradigm for gene regulation, not only for bacteria, but also for all biological systems from simple phage to humans. The details of the systems may differ, but the key conceptual framework remains, and the original system continues to reveal deeper insights with continued experimental and theoretical study. Nearly as long lasting in impact as the pivotal work of Jacob and Monod is the classic experiment of Novick and Weiner in which they demonstrated all-or-none gene expression in response to an artificial inducer. These results are often cited in claims that normal gene expression is in fact a discontinuous bistable phenomenon. In this paper, I review several levels of analysis of the lac system and introduce another perspective based on the construction of the system design space. These represent variations on a theme, based on a simply stated design principle, that captures the key qualitative features of the system in a largely mechanism-independent fashion. Moreover, this principle can be readily interpreted in terms of specific mechanisms to make predictions regarding monostable vs. bistable behavior. The regions of design space representing bifurcations are compared with the corresponding regions identified through bifurcation analysis. I present evidence based on biological considerations as well as modeling and analysis to suggest that induction of the lac system in its natural setting is a monostable continuously graded phenomenon. Nevertheless, it must be acknowledged that the lac stability question remains unsettled, and it undoubtedly will remain so until there are definitive experimental results. PMID:21414326
LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313
Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...
2016-12-21
Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costamante, L.; Aharonian, F.; Khangulyan, D.
2007-07-12
An often overlooked fact is that the MeV-GeV emission from High-energy peaked BL Lacs (HBL) is basically unknown: there are only 3 objects of this type among all EGRET identified blazars with measured spectra. GLAST will be able to measure the spectrum for many of them, in particular TeV-blazars, and surprises are expected. GLAST will tell if the {gamma}-ray peak in some HBL is actually a ''double peak'', as suggested by the comparison of EGRET and HESS data in PKS 2155-304, We also remind and argue that a new class of BL Lacs could exist, where particles are shock-accelerated nearmore » the maximum possible rate, characterized by the synchrotron emission peaking in the GLAST band (100 MeV - few GeV). Such objects could easily have escaped detection or identification so far, and could now be unveiled by GLAST.« less
van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M
1993-02-01
Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.
Flood Control Project Lac Qui Parle, Emergency Plan
1988-10-01
elevation of the breach (924.0 as shown in Table 1), is approximately 22.2 feet. The value of the envelope curve shown on Plate D-10 for a hydraulic...approximately 83% of the computed maximum outflow. Several failure scenarios for Lac qui Parle Dam were studied. The case of failure concurrent with a PKF ...discharge would plot very close to Lac qui Parle in Plate D-10. Plate D-10 shows that the value of the envelope curve for a hydraulic depth of 18.8 feet
Exploring the sequence-function relationship in transcriptional regulation by the lac O1 operator.
Maity, Tuhin S; Jha, Ramesh K; Strauss, Charlie E M; Dunbar, John
2012-07-01
Understanding how binding of a transcription factor to an operator is influenced by the operator sequence is an ongoing quest. It facilitates discovery of alternative binding sites as well as tuning of transcriptional regulation. We investigated the behavior of the Escherichia coli Lac repressor (LacI) protein with a large set of lac O(1) operator variants. The 114 variants examined contained a mean of 2.9 (range 0-4) mutations at positions -4, -2, +2 and +4 in the minimally required 17 bp operator. The relative affinity of LacI for the operators was examined by quantifying expression of a GFP reporter gene and Rosetta structural modeling. The combinations of mutations in the operator sequence created a wide range of regulatory behaviors. We observed variations in the GFP fluorescent signal among the operator variants of more than an order of magnitude under both uninduced and induced conditions. We found that a single nucleotide change may result in changes of up to six- and 12-fold in uninduced and induced GFP signals, respectively. Among the four positions mutated, we found that nucleotide G at position -4 is strongly correlated with strong repression. By Rosetta modeling, we found a significant correlation between the calculated binding energy and the experimentally observed transcriptional repression strength for many operators. However, exceptions were also observed, underscoring the necessity for further improvement in biophysical models of protein-DNA interactions. © 2012 The Authors Journal compilation © 2012 FEBS.
Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst
Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj; ...
2015-08-17
We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less
Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj
We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less
MULTI-WAVELENGTH STUDY OF FLARING ACTIVITY IN BL Lac OBJECT S5 0716+714 DURING THE 2015 OUTBURST
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chandra, Sunil; Kushwaha, Pankaj; Singh, K. P.
We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. The rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less
NASA Technical Reports Server (NTRS)
Kondo, Y.; Worrall, D. M.; Oke, J. B.; Yee, H. K. C.; Neugebauer, G.; Matthews, K.; Feldman, P. A.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. R. H.
1981-01-01
Observations in the X-ray, UV, visible, IR and radio regions of the BL Lac object Mrk 501 made over the course of two months are reported. The measurements were made with the A2 experiment on HEAO 1 (X-ray), the SWP and LWR cameras on IUE (UV), the 5-m Hale telescope (visible), the 2.5-m telescope at Mount Wilson (IR), the NRAO 92-m radio telescope at Green Bank (4750 MHz) and the 46-m radio telescope at the Algonquin Observatory (10275 and 10650 MHz). The quasi-simultaneously observed spectral slope is found to be positive and continuous from the X-ray to the UV, but to gradually flatten and possibly turn down from the mid-UV to the visible; the optical-radio emission cannot be accounted for by a single power law. The total spectrum is shown to be compatible with a synchrotron self-Compton emission mechanism, while the spectrum from the visible to the X-ray is consistent with synchrotron radiation or inverse-Compton scattering by a hot thermal electron cloud. The continuity of the spectrum from the UV to the X-ray is noted to imply a total luminosity greater than previous estimates by a factor of 3-4.
A revised and updated catalog of quasi-stellar objects
NASA Technical Reports Server (NTRS)
Hewitt, A.; Burbidge, G.
1993-01-01
The paper contains a catalog of all known quasi-stellar objects (QSOs) with measured emission redshifts, and BL Lac objects, complete to 1992 December 31. The catalog contains 7315 objects, nearly all QSOs including about 90 BL Lac objects. The catalog and references contain extensive information on names, positions, magnitudes, colors, emission-line redshifts, absorption, variability, polarization, and X-ray, radio, and infrared data. A key in the form of subsidiary tables enables the reader to relate the name of a given object to its coordinate name, which is used throughout the compilation. Plots of the Hubble diagram, the apparent magnitude distribution, the emission redshift distribution, and the distribution of the QSOs on the sky are also given.
Defining fire and wilderness objectives: Applying limits of acceptable change
David N. Cole
1995-01-01
The Limits of Acceptable Change (LAC) planning process was developed to help define objectives for recreation management in wilderness. This process can be applied to fire in wilderness if its conceptual foundation is broadened. LAC would lead decision makers to identify a compromise between the goal of allowing fire to play its natural role in wilderness and various...
LAC indicators: an evaluation of progress and list of proposed indicators
Alan E. Watson; David N. Cole
1992-01-01
One of the most critical, and difficult, steps in the Limits of Acceptable Change (LAC) process is the selection of indicators. To help with this step, this paper (I) briefly reviews some desirable characteristics of indicators and (2) lists indicators that have been proposed or adopted in LAC plans. From a comparison of this list of indicators and desirable...
The NuSTAR view on Hard-TeV BL Lacs
NASA Astrophysics Data System (ADS)
Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.
2018-05-01
Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of 5 objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of i) extreme electron energies with very low radiative efficiency, ii) conditions heavily out of equipartition (by 3 to 5 orders of magnitude), and iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not "see" the UV or lower-energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the VHE spectrum.
The NuSTAR view on hard-TeV BL Lacs
NASA Astrophysics Data System (ADS)
Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.
2018-07-01
Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of five objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of (i) extreme electron energies with very low radiative efficiency, (ii) conditions heavily out of equipartition (by three to five orders of magnitude), and (iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not `see' the UV or lower energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the very high energies spectrum.
Population Dynamics of a Lac(-) Strain of Escherichia Coli during Selection for Lactose Utilization
Foster, P. L.
1994-01-01
During selection for lactose utilization, Lac(+) revertants of FC40, a Lac(-) strain of Escherichia coli, appear at a high rate. Yet, no Lac(+) revertants appear in the absence of lactose, or in its presence if the cells have another, unfulfilled requirement for growth. This study investigates more fully the population dynamics of FC40 when incubated in the absence of a carbon source or when undergoing selection for lactose utilization. In the absence of a carbon source, the viable cell numbers do not change over 6 days. When incubated in liquid lactose medium, Lac(-) cells do not undergo any measurable increase in numbers or in turbidity for at least 2 days. When FC40 is plated on lactose minimum medium in the presence of scavenger cells, the upper limit to the amount of growth of Lac(-) cells during 5 days is one doubling, and there is no evidence for turnover (i.e., a balance between growth and death). The presence of a minority population that could form microcolonies was not detected. The implications of these results, plus the fact that the appearance of Lac(+) revertants during lactose selection is nearly constant with time, are discussed in reference to several models that have been postulated to account for adaptive mutations. PMID:7828809
Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.
Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina
2016-08-23
Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.
Mitchell, J M; McNab, W B; Yee, A J; Griffiths, M W; McEwen, S A; Spilsbury, L; Boison, J O
1998-08-01
The Lactek test, marketed for antimicrobial residue detection in milk, was validated for the detection of antimicrobial residues in tissues. A previous study found that the LacTek test could confidently identify tissue samples spiked with antimicrobial residues. However, the test could not reliably distinguish violative from nonviolative spiked samples relative to Canadian maximum residue limits (MRLs). The objectives of this study were to assess and compare the performance of the LacTek tests for beta-lactams, tetracyclines, gentamicin, and sulfamethazine on samples containing naturally incurred residues by running the test in parallel with the standard microbial inhibition test (MIT) presently used for the routine testing of tissues at our facility and to assess the agreement with high pressure liquid chromatographic (HPLC) determinative methods. Parallel testing with the official MIT found that the Lactek tests could be confidently used for testing tissue samples containing incurred residues. Among 1,008 MIT-positive samples, the LacTek test found that 90% contained beta-lactams and/or tetracyclines. A further 7.3% of violative residues could not be identified to an antimicrobial class. In addition, 9% of samples testing negative on the MIT were found to contain an antimicrobial residue by the LacTek tests. Comparative testing with HPLC methods found that there was very good agreement between the two tests and that most violations were due to penicillin G and oxytetracycline. Although the LacTek test cannot be used to distinguish violative from nonviolative residue levels, it does offer several advantages over the present MIT. These include speed, ease of use, the ability to identify residues to a specific class, and an improved sensitivity at the MRL level for the most commonly found antimicrobials in tissue.
Lac-L-TTA, a novel lactose-based amino acid-sugar conjugate for anti-metastatic applications.
Roviello, Giovanni N; Iannitti, Roberta; Palumbo, Rosanna; Simonyan, Hayarpi; Vicidomini, Caterina; Roviello, Valentina
2017-08-01
Here we describe the synthesis, chromatographic purification, MS and NMR characterization of a new lactosyl-derivative, i.e. a lactosyl thiophenyl-substituted triazolyl-thione L-alanine (Lac-L-TTA). This amino acid-sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore, we investigated the inhibition of PC-3 prostate cancer cell colony formation by this lactose derivative in comparison with the less polar fructose-based derivative, Fru-L-TTA. This let us to compare the properties of the artificial derivative, object of the present work, with the monosaccharide-based counterpart and to obtain a preliminary information on the influence of polarity on such biological activity. A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose.
Poly-LacNAc as an Age-Specific Ligand for Rotavirus P[11] in Neonates and Infants
Liu, Yang; Huang, Pengwei; Jiang, Baoming; Tan, Ming; Morrow, Ardythe L.; Jiang, Xi
2013-01-01
Rotavirus (RV) P[11] is an unique genotype that infects neonates. The mechanism of such age-specific host restriction remains unknown. In this study, we explored host mucosal glycans as a potential age-specific factor for attachment of P[11] RVs. Using in vitro binding assays, we demonstrated that VP8* of a P[11] RV (N155) could bind saliva of infants (60.3%, N = 151) but not of adults (0%, N = 48), with a significantly negative correlation between binding of VP8* and ages of infants (P<0.01). Recognition to the infant saliva did not correlate with the ABO, secretor and Lewis histo-blood group antigens (HBGAs) but with the binding of the lectin Lycopersicon esculentum (LEA) that is known to recognize the oligomers of N-acetyllactosamine (LacNAc), a precursor of human HBGAs. Direct evidence of LacNAc involvement in P[11] binding was obtained from specific binding of VP8* with homopolymers of LacNAc in variable lengths through a glycan array analysis of 611 glycans. These results were confirmed by strong binding of VP8* to the Lec2 cell line that expresses LacNAc oligomers but not to the Lec8 cell line lacking the LacNAc. In addition, N155 VP8* and authentic P[11] RVs (human 116E and bovine B223) hemagglutinated human red blood cells that are known to express poly-LacNAc. The potential role of poly-LacNAc in host attachment and infection of RVs has been obtained by abrogation of 116E replication by the PAA-conjugated poly-LacNAc, human milk, and LEA positive infant saliva. Overall, our results suggested that the poly-LacNAc could serve as an age-specific receptor for P[11] RVs and well explained the epidemiology that P[11] RVs mainly infect neonates and young children. PMID:24244290
Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.
Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min
Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.
Sutherland, K; del Río, J C
2014-04-18
A variety of lac resin samples obtained from artists' suppliers, industrial manufacturers, and museum collections were analysed using gas chromatography mass spectrometry (GCMS) and reactive pyrolysis GCMS with quaternary ammonium reagents. These techniques allowed a detailed chemical characterisation of microgram-sized samples, based on the detection and identification of derivatives of the hydroxy aliphatic and cyclic (sesquiterpene) acids that compose the resin. Differences in composition could be related to the nature of the resin, e.g. wax-containing (unrefined), bleached, or aged samples. Furthermore, differences in the relative abundances of aliphatic hydroxyacids appear to be associated with the biological source of the resin. The diagnostic value of newly characterised lac components, including 8-hydroxyacids, is discussed here for the first time. Identification of derivatised components was aided by AMDIS deconvolution software, and discrimination of samples was enhanced by statistical evaluation of data using principal component analysis. The robustness of the analyses, together with the minimal sample size required, make these very powerful approaches for the characterisation of lac resin in museum objects. The value of such analyses for enhancing the understanding of museum collections is illustrated by two case studies of objects in the collection of the Philadelphia Museum of Art: a restorer's varnish on a painting by Luca Signorelli, and a pictorial inlay in an early nineteenth-century High Chest by George Dyer. Copyright © 2014 Elsevier B.V. All rights reserved.
Active Galactic Nuclei, Quasars, BL Lac Objects and X-Ray Background
NASA Technical Reports Server (NTRS)
Mushotzky, Richard (Technical Monitor); Elvis, Martin
2005-01-01
The XMM COSMOS survey is producing the large surface density of X-ray sources anticipated. The first batch of approx. 200 sources is being studied in relation to the large scale structure derived from deep optical/near-IR imaging from Subaru and CFHT. The photometric redshifts from the opt/IR imaging program allow a first look at structure vs. redshift, identifying high z clusters. A consortium of SAO, U. Arizona and the Carnegie Institute of Washington (Pasadena) has started a large program using the 6.5meter Magellan telescopes in Chile with the prime objective of identifying the XMM X-ray sources in the COSMOS field. The first series of observing runs using the new IMACS multi-slit spectrograph on Magellan will take place in January and February of 2005. Some 300 spectra per field will be taken, including 70%-80% of the XMM sources in each field. The four first fields cover the center of the COSMOS field. A VLT consortium is set to obtain bulk redshifts of the field galaxies. The added accuracy of the spectroscopic redshifts over the photo-z's will allow much lower density structures to be seen, voids and filaments. The association of X-ray selected AGNs, and quasars with these filaments, is a major motivation for our studies. Comparison to the deep VLA radio data now becoming available is about to begin.
Soft X-Ray Observations of a Complete Sample of X-Ray--selected BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Perlman, Eric S.; Stocke, John T.; Wang, Q. Daniel; Morris, Simon L.
1996-01-01
We present the results of ROSAT PSPC observations of the X-ray selected BL Lacertae objects (XBLs) in the complete Einstein Extended Medium Sensitivity Survey (EM MS) sample. None of the objects is resolved in their respective PSPC images, but all are easily detected. All BL Lac objects in this sample are well-fitted by single power laws. Their X-ray spectra exhibit a variety of spectral slopes, with best-fit energy power-law spectral indices between α = 0.5-2.3. The PSPC spectra of this sample are slightly steeper than those typical of flat ratio-spectrum quasars. Because almost all of the individual PSPC spectral indices are equal to or slightly steeper than the overall optical to X-ray spectral indices for these same objects, we infer that BL Lac soft X-ray continua are dominated by steep-spectrum synchrotron radiation from a broad X-ray jet, rather than flat-spectrum inverse Compton radiation linked to the narrower radio/millimeter jet. The softness of the X-ray spectra of these XBLs revives the possibility proposed by Guilbert, Fabian, & McCray (1983) that BL Lac objects are lineless because the circumnuclear gas cannot be heated sufficiently to permit two stable gas phases, the cooler of which would comprise the broad emission-line clouds. Because unified schemes predict that hard self-Compton radiation is beamed only into a small solid angle in BL Lac objects, the steep-spectrum synchrotron tail controls the temperature of the circumnuclear gas at r ≤ 1018 cm and prevents broad-line cloud formation. We use these new ROSAT data to recalculate the X-ray luminosity function and cosmological evolution of the complete EMSS sample by determining accurate K-corrections for the sample and estimating the effects of variability and the possibility of incompleteness in the sample. Our analysis confirms that XBLs are evolving "negatively," opposite in sense to quasars, with Ve/Va = 0.331±0.060. The statistically significant difference between the
The mechanism and high-free-energy transition state of lac repressor–lac operator interaction
Sengupta, Rituparna; Capp, Michael W.; Shkel, Irina A.
2017-01-01
Abstract Significant, otherwise-unavailable information about mechanisms and transition states (TS) of protein folding and binding is obtained from solute effects on rate constants. Here we characterize TS for lac repressor(R)–lac operator(O) binding by analyzing effects of RO-stabilizing and RO-destabilizing solutes on association (ka) and dissociation (kd) rate constants. RO-destabilizing solutes (urea, KCl) reduce ka comparably (urea) or more than (KCl) they increase kd, demonstrating that they destabilize TS relative to reactants and RO, and that TS exhibits most of the Coulombic interactions between R and O. Strikingly, three solutes which stabilize RO by favoring burial/dehydration of amide oxygens and anionic phosphate oxygens all reduce kd without affecting ka significantly. The lack of stabilization of TS by these solutes indicates that O phosphates remain hydrated in TS and that TS preferentially buries aromatic carbons and amide nitrogens while leaving amide oxygens exposed. In our proposed mechanism, DNA-binding-domains (DBD) of R insert in major grooves of O pre-TS, forming most Coulombic interactions of RO and burying aromatic carbons. Nucleation of hinge helices creates TS, burying sidechain amide nitrogens. Post-TS, hinge helices assemble and the DBD-hinge helix-O-DNA module docks on core repressor, partially dehydrating phosphate oxygens and tightening all interfaces to form RO. PMID:29036376
NASA Astrophysics Data System (ADS)
Archambault, S.; Archer, A.; Beilicke, M.; Benbow, W.; Bird, R.; Biteau, J.; Bouvier, A.; Bugaev, V.; Cardenzana, J. V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dickinson, H. J.; Dumm, J.; Eisch, J. D.; Errando, M.; Falcone, A.; Feng, Q.; Finley, J. P.; Fleischhack, H.; Fortin, P.; Fortson, L.; Furniss, A.; Gillanders, G. H.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Håkansson, N.; Hanna, D.; Holder, J.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krause, M.; Krennrich, F.; Kumar, S.; Lang, M. J.; Maier, G.; McArthur, S.; McCann, A.; Meagher, K.; Millis, J.; Moriarty, P.; Mukherjee, R.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Otte, A. N.; Park, N.; Pohl, M.; Popkow, A.; Prokoph, H.; Pueschel, E.; Quinn, J.; Ragan, K.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Santander, M.; Sembroski, G. H.; Shahinyan, K.; Smith, A. W.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Varlotta, A.; Vincent, S.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.; Veritas Collaboration; Hughes, Z. D.
2015-08-01
During moonlit nights, observations with ground-based Cherenkov telescopes at very high energies (VHEs, E\\gt 100 GeV) are constrained since the photomultiplier tubes (PMTs) in the telescope camera are extremely sensitive to the background moonlight. Observations with the VERITAS telescopes in the standard configuration are performed only with a moon illumination less than 35% of full moon. Since 2012, the VERITAS collaboration has implemented a new observing mode under bright moonlight, by either reducing the voltage applied to the PMTs (reduced-high-voltage; RHV configuration), or by utilizing UV-transparent filters. While these operating modes result in lower sensitivity and increased energy thresholds, the extension of the available observing time is useful for monitoring variable sources such as blazars and sources requiring spectral measurements at the highest energies. In this paper we report the detection of γ-ray flaring activity from the BL Lac object 1ES 1727+502 during RHV observations. This detection represents the first evidence of VHE variability from this blazar. The integral flux is (1.1+/- 0.2)× {10}-11 {{cm}}-2 {{{s}}}-1 above 250 GeV, which is about five times higher than the low-flux state. The detection triggered additional VERITAS observations during standard dark-time. Multiwavelength observations with the FLWO 48″ telescope, and the Swift and Fermi satellites are presented and used to produce the first spectral energy distribution (SED) of this object during γ-ray flaring activity. The SED is then fitted with a standard synchrotron-self-Compton model, placing constraints on the properties of the emitting region and of the acceleration mechanism at the origin of the relativistic particle population in the jet.
Long-term spectral and temporal behavior of the high-frequency peaked BL LAC object 1ES 1959+650
NASA Astrophysics Data System (ADS)
Backes, M.; Uellenbeck, M.; Hayashida, M.; Satalecka, K.; Tescaro, D.; Terzić, T.; MAGIC Collaboration; Fuhrmann, L.; Nestoras, I.; F-GAMMA project; Lähteenmäki, A.; Tornikoski, M.; Nieppola, E.; Metsähovi; Böttcher, M.; Collmar, W.; Weidinger, M.
2012-12-01
The high-frequency peaked BL Lac object 1ES 1959+650 is well-known for an exceptional outburst, which was observed at very high energy (VHE) γ-rays by the Whipple 10m and HEGRA telescopes in 2002. Remarkably, this outburst lacked associated X-ray emission (a socalled "orphan flare") and by this cannot easily be described by standard Synchrotron Self Compton (SSC) models. Models based on hadronic emission processes have also been proposed to explain the observed behavior. Subsequent multi-wavelength observations during a low flux state at TeV energies in 2006 can, instead, be explained by a standard single-zone SSC model. In this context, 1ES 1959+650 has been regularly monitored by the MAGIC telescope since 2005. During these years, no significant variation in the VHE γ-ray flux has been observed. The low energy part of this is in very good agreement with the high-energy part of the time-integrated energy spectrum as measured by Fermi-LAT. Based on this constant flux level in VHE γ-rays, we assembled the time-integrated spectral energy distribution (SED) of 1ES 1959+650 from radio to VHE γ-rays. Despite the non-variability at very high energies, significant flux and spectral variations have been observed at optical and X-ray frequencies in the meanwhile. Furthermore, the shape of the SED at high energy γ-rays as measured by Fermi-LAT is essentially flat which cannot be explained by either conventional single-zone SSC models, or models invoking external radiation fields (EC).
NASA Astrophysics Data System (ADS)
Djannati-Ataï, A.; Khelifi, B.; Vorobiov, S.; Bazer-Bachi, R.; Chounet, L. M.; Debiais, G.; Degrange, B.; Espigat, P.; Fabre, B.; Fontaine, G.; Goret, P.; Gouiffes, C.; Masterson, C.; Piron, F.; Punch, M.; Rivoal, M.; Rob, L.; Tavernet, J.-P.
2002-08-01
The BL Lac Object 1ES 1426+428, at a red-shift of z=0.129, has been monitored by the CAT telescope from February 1998 to June 2000. The accumulation of 26 h of observations shows a gamma -ray signal of 321 events above 250 GeV at 5.2 standard deviations, determined using data analysis cuts adapted to a weak, steep-spectrum source. The source emission has an average flux of Phidiff(400 GeV)= 6.73+/-1.27stat+/-1.45syst*E-11 cm-2 s-1 TeV-1, and a very steep spectrum, with a differential spectral index of gamma =-3.60 +/- 0.57 which can be refined to gamma =-3.66 +/- 0.41 using a higher flux data subset. If, as expected from its broad-band properties, the Very High Energy emission is hard at the source, these observations support a strong absorption effect of gamma-rays by the Intergalactic Infrared field.
Kepler Observations of Rapid Optical Variability in the BL Lac Object W2r192+42
NASA Technical Reports Server (NTRS)
R.Edelson; Mushotzky, R.; Vaughn, S.; Scargle, J.; Gandhi, P.; Malkan, M.; Baumgartner, W.
2013-01-01
We present the first Kepler monitoring of a strongly variable BL Lac, W2R1926+42. The light curve covers 181 days with approx. 0.2% errors, 30 minute sampling and >90% duty cycle, showing numerous delta-I/I > 25% flares over timescales as short as a day. The flux distribution is highly skewed and non-Gaussian. The variability shows a strong rms-flux correlation with the clearest evidence to date for non-linearity in this relation. We introduce a method to measure periodograms from the discrete autocorrelation function, an approach that may be well-suited to a wide range of Kepler data. The periodogram is not consistent with a simple power-law, but shows a flattening at frequencies below 7x10(exp -5) Hz. Simple models of the power spectrum, such as a broken power law, do not produce acceptable fits, indicating that the Kepler blazar light curve requires more sophisticated mathematical and physical descriptions than currently in use.
Period Variations of the Eclipsing Binary Systems T LMi and VX Lac
NASA Astrophysics Data System (ADS)
Yılmaz, M.; İzci, D. D.; Gümüş, D.; Özavci, İ.; Selam, S. O.
2015-07-01
We present a period analysis of the two Algol-type eclipsing binary systems T LMi and VX Lac using all available times of minimum in the literature, as well as new minima obtained at the Ankara University Kreiken Observatory. The period analysis of T LMi suggests mass transfer between the components and also a third body that is dynamically bound to the binary system. The analysis of VX Lac also suggests mass transfer between the components, and the presence of a third and a fourth body under the assumption of a Light-Time Effect. In addition, the periodic variation of VX Lac was examined under the hypothesis of magnetic activity, and the corresponding parameters were derived. We report here the orbital parameters for both systems, along with the ones related to mass transfer, and those for the third and fourth bodies.
Frederiksen, Rikki F; Yoshimura, Yayoi; Storgaard, Birgit G; Paspaliari, Dafni K; Petersen, Bent O; Chen, Kowa; Larsen, Tanja; Duus, Jens Ø; Ingmer, Hanne; Bovin, Nicolai V; Westerlind, Ulrika; Blixt, Ola; Palcic, Monica M; Leisner, Jørgen J
2015-02-27
There is emerging evidence that chitinases have additional functions beyond degrading environmental chitin, such as involvement in innate and acquired immune responses, tissue remodeling, fibrosis, and serving as virulence factors of bacterial pathogens. We have recently shown that both the human chitotriosidase and a chitinase from Salmonella enterica serovar Typhimurium hydrolyze LacNAc from Galβ1-4GlcNAcβ-tetramethylrhodamine (LacNAc-TMR (Galβ1-4GlcNAcβ(CH2)8CONH(CH2)2NHCO-TMR)), a fluorescently labeled model substrate for glycans found in mammals. In this study we have examined the binding affinities of the Salmonella chitinase by carbohydrate microarray screening and found that it binds to a range of compounds, including five that contain LacNAc structures. We have further examined the hydrolytic specificity of this enzyme and chitinases from Sodalis glossinidius and Polysphondylium pallidum, which are phylogenetically related to the Salmonella chitinase, as well as unrelated chitinases from Listeria monocytogenes using the fluorescently labeled substrate analogs LacdiNAc-TMR (GalNAcβ1-4GlcNAcβ-TMR), LacNAc-TMR, and LacNAcβ1-6LacNAcβ-TMR. We found that all chitinases examined hydrolyzed LacdiNAc from the TMR aglycone to various degrees, whereas they were less active toward LacNAc-TMR conjugates. LacdiNAc is found in the mammalian glycome and is a common motif in invertebrate glycans. This substrate specificity was evident for chitinases of different phylogenetic origins. Three of the chitinases also hydrolyzed the β1-6 bond in LacNAcβ1-6LacNAcβ-TMR, an activity that is of potential importance in relation to mammalian glycans. The enzymatic affinities for these mammalian-like structures suggest additional functional roles of chitinases beyond chitin hydrolysis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Weaver, T.L.; Neff, B.P.; Ellis, J.M.
2005-01-01
Lac Vieux Desert is a prominent 6.6 square-mile lake that straddles the Michigan-Wisconsin border and forms the headwaters of the Wisconsin River. For generations, the Lac Vieux Desert Band of Lake Superior Chippewa Indians have used Lac Vieux Desert and the surrounding area for growing and harvesting wild rice, and hunting and fishing. The Lac Vieux Desert Band is concerned about the impact of lake-stage regulation on hydrology and ecology, and the impact on water quality of development along and near the shore, and recreational watercraft use and sport fishing. In 2005, the U.S. Geological Survey completed a water-resources investigation of the Lac Vieux Desert watershed in cooperation with the Lac Vieux Desert Band of Lake Superior Chippewa Indians.Water quality of Lac Vieux Desert is typical of many lakes in the northern United States. Trophic State Index calculations classify Lac Vieux Desert as a highly productive eutrophic lake. The pH of water in Lac Vieux Desert ranged from 6.5 to 9.5, and specific conductance ranged from 62 to 114 µs/cm. Chloride concentration was less than 1.5 mg/L, indicating little effect from septic-tank or road-salt input. Results indicate that the water can be classified as soft, with hardness concentrations reported as calcium carbonate ranging from 29 to 49 mg/L. Concentrations of calcium, magnesium, chloride, and other dissolved solids ranged from 47 to 77 mg/L. Alkalinity of Lac Vieux Desert ranged from 27 to 38 mg/L.Pervasive aquatic blooms, including a bloom noted during the September 2003 sampling, are apparently common in late summer. Biological productivity at Lac Vieux Desert does not appear to have changed appreciably between 1973 and 2004. In the current study, total phosphorus concentrations ranged from 0.01 to 0.064 mg/L and dissolved nitrite plus nitrate nitrogen concentrations ranged from at, or below detection limit to 0.052 mg/L. Overabundance of nutrients in Lac Vieux Desert, particularly nitrogen and phosphorus
Zhang, Mengzi; Zhou, Xiaoju; Wang, Bo; Yung, Bryant C.; Lee, Ly J.; Ghoshal, Kalpana; Lee, Robert J.
2013-01-01
Lactosylated gramicidin-containing lipid nanoparticles (Lac-GLN) were developed for delivery of anti-microRNA-155 (anti-miR-155) to hepatocellular carcinoma (HCC) cells. MiR-155 is an oncomiR frequently elevated in HCC. The Lac-GLN formulation contained N-lactobionyl-dioleoyl phosphatidylethanolamine (Lac-DOPE), a ligand for the asialoglycoprotein receptor (ASGR), and an antibiotic peptide gramicidin A. The nanoparticles exhibited a mean particle diameter of 73 nm, zeta potential of +3.5 mV, anti-miR encapsulation efficiency of 88%, and excellent colloidal stability at 4°C. Lac-GLN effectively delivered anti-miR-155 to HCC cells with a 16.1- and 4.1-fold up-regulation of miR-155 targets C/EBPβ and FOXP3 genes, respectively, and exhibited significant greater efficiency over Lipofectamine 2000. In mice, intravenous injection of Lac-GLN containing Cy3-anti-miR-155 led to preferential accumulation of the anti-miR-155 in hepatocytes. Intravenous administration of 1.5 mg/kg anti-miR-155 loaded Lac-GLN resulted in up-regulation of C/EBPβ and FOXP3 by 6.9- and 2.2- fold, respectively. These results suggest potential application of Lac-GLN as a liver-specific delivery vehicle for anti-miR therapy. PMID:23567045
Optical polarization of high-energy BL Lacertae objects
NASA Astrophysics Data System (ADS)
Hovatta, T.; Lindfors, E.; Blinov, D.; Pavlidou, V.; Nilsson, K.; Kiehlmann, S.; Angelakis, E.; Fallah Ramazani, V.; Liodakis, I.; Myserlis, I.; Panopoulou, G. V.; Pursimo, T.
2016-12-01
Context. We investigate the optical polarization properties of high-energy BL Lac objects using data from the RoboPol blazar monitoring program and the Nordic Optical Telescope. Aims: We wish to understand if there are differences between the BL Lac objects that have been detected with the current-generation TeV instruments and those objects that have not yet been detected. Methods: We used a maximum-likelihood method to investigate the optical polarization fraction and its variability in these sources. In order to study the polarization position angle variability, we calculated the time derivative of the electric vector position angle (EVPA) change. We also studied the spread in the Stokes Q/I-U/I plane and rotations in the polarization plane. Results: The mean polarization fraction of the TeV-detected BL Lacs is 5%, while the non-TeV sources show a higher mean polarization fraction of 7%. This difference in polarization fraction disappears when the dilution by the unpolarized light of the host galaxy is accounted for. The TeV sources show somewhat lower fractional polarization variability amplitudes than the non-TeV sources. Also the fraction of sources with a smaller spread in the Q/I-U/I plane and a clumped distribution of points away from the origin, possibly indicating a preferred polarization angle, is larger in the TeV than in the non-TeV sources. These differences between TeV and non-TeV samples seem to arise from differences between intermediate and high spectral peaking sources instead of the TeV detection. When the EVPA variations are studied, the rate of EVPA change is similar in both samples. We detect significant EVPA rotations in both TeV and non-TeV sources, showing that rotations can occur in high spectral peaking BL Lac objects when the monitoring cadence is dense enough. Our simulations show that we cannot exclude a random walk origin for these rotations. Conclusions: These results indicate that there are no intrinsic differences in the
Aflatoxin B1 and M1 Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators
Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C.; Quintieri, Laura; Cimmarusti, Maria T.; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F.; Sanjust, Enrico; Mulè, Giuseppina
2016-01-01
Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B1 (AFB1) and M1 (AFM1). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB1 degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2′-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB1 was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM1 was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB1 and, for the first time, AFM1, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB1 and AFM1. PMID:27563923
NASA Technical Reports Server (NTRS)
Rau, A.; Schady, P.; Greiner, J.; Salvato, M.; Ajello, M.; Bottacini, E.; Gehrels, N.; Afonso, P. M. J.; Elliott, J.; Filgas, R.;
2011-01-01
Context. Observations of the gamma-ray sky with Fermi led to significant advances towards understanding blazars, the most extreme class of Active Galactic Nuclei. A large fraction of the population detected by Fermi is formed by BL Lacertae (BL Lac) objects, whose sample has always suffered from a severe redshift incompleteness due to the quasi-featureless optical spectra. Aims. Our goal is to provide a significant increase of the number of confirmed high-redshift BL Lac objects contained in the 2 LAC Fermi/LAT catalog. Methods. For 103 Fermi/LAT blazars, photometric redshifts using spectral energy distribution fitting have been obtained. The photometry includes 13 broad-band filters from the far ultraviolet to the near-IR observed with Swift/UVOT and the multi-channel imager GROND at the MPG/ESO 2.2m telescope. Data have been taken quasi-simultaneously and the remaining source-intrinsic variability has been corrected for. Results. We release the UV-to-near-IR 13-band photometry for all 103 sources and provide redshift constraints for 75 sources without previously known redshift. Out of those, eight have reliable photometric redshifts at z > or approx. 1.3, while for the other 67 sources we provide upper limits. Six of the former eight are BL Lac objects, which quadruples the sample of confirmed high-redshift BL Lac. This includes three sources with redshifts higher than the previous record for BL Lac, including CRATES J0402-2615, with the best-fit solution at z approx. = 1.9.
UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.
UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less
THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aartsen, M. G.; Abraham, K.; Ackermann, M.
2017-01-20
The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in themore » 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.« less
Lee, Jung-Kul; Pan, Cheol-Ho
2013-01-01
D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26), which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD), catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi). Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays. PMID:24015281
Wind Resource Assessment Report: Mille Lacs Indian Reservation, Minnesota
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jimenez, Antonio C.; Robichaud, Robi
The U.S. Environmental Protection Agency (EPA) launched the RE-Powering America's Land initiative to encourage development of renewable energy on potentially contaminated land and mine sites. EPA collaborated with the U.S. Department of Energy's (DOE's) National Renewable Energy Laboratory (NREL) and the Mille Lacs Band of Chippewa Indians to evaluate the wind resource and examine the feasibility of a wind project at a contaminated site located on the Mille Lacs Indian Reservation in Minnesota. The wind monitoring effort involved the installation of a 60-m met tower and the collection of 18 months of wind data at multiple heights above the ground.more » This report focuses on the wind resource assessment, the estimated energy production of wind turbines, and an assessment of the economic feasibility of a potential wind project sited this site.« less
NASA Astrophysics Data System (ADS)
Bolle, Olivier; Charlier, Bernard; Bascou, Jérôme; Diot, Hervé; McEnroe, Suzanne A.
2014-08-01
The Lac Tio hemo-ilmenite ore body crops out in the outer portion of the 1.06 Ga Lac Allard anorthosite, a member of the Havre-Saint-Pierre anorthosite suite from the Grenville province of North America. It is made up of ilmenitite (commonly with more than 95% hemo-ilmenite) associated with noritic lithologies and anorthosite. The present study compares the magnetic fabric of the ore body, as deduced from anisotropy of magnetic susceptibility (AMS) measurements, with the crystallographic and shape fabrics, obtained from lattice-preferred orientation (LPO) and shape-preferred orientation (SPO) measurements made using electron backscattered diffraction (EBSD) and 3D image analysis, respectively. Room-temperature hysteresis measurements, thermomagnetic curves and values of the bulk magnetic susceptibility reveal a magnetic mineralogy dominated by a mixed contribution of hemo-ilmenite and magnetite. The hemo-ilmenite grains display a LPO characterized by a strong preferred orientation of the basal (0001) plane of ilmenite along which hematite was exsolved. This LPO and the magnetic fabric fit well (angle between the crystallographic c-axis and the axis of minimum susceptibility ≤ ca. 15° for most samples), and the latter is thus strongly influenced by the hemo-ilmenite magneto-crystalline anisotropy. A magnetite SPO, concordant with the hemo-ilmenite LPO, may also influence and even dominate the magnetic fabric. The rock shape fabric is coaxial with the magnetic fabric that can thus be used to perform detailed structural mapping. Interpretation of the magnetic fabric and field structural data suggests that the Lac Tio ore body would be a sag point at the margin of the Lac Allard anorthosite, deformed by ballooning during the final stage of diapiric emplacement of the anorthosite body.
Louisiana SIP: LAC 33:III Ch 21 Subchap J, 2147--Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 1998-02-02 (LAc74) more...
Meinhardt, Sarah; Swint-Kruse, Liskin
2008-12-01
In protein families, conserved residues often contribute to a common general function, such as DNA-binding. However, unique attributes for each homolog (e.g. recognition of alternative DNA sequences) must arise from variation in other functionally-important positions. The locations of these "specificity determinant" positions are obscured amongst the background of varied residues that do not make significant contributions to either structure or function. To isolate specificity determinants, a number of bioinformatics algorithms have been developed. When applied to the LacI/GalR family of transcription regulators, several specificity determinants are predicted in the 18 amino acids that link the DNA-binding and regulatory domains. However, results from alternative algorithms are only in partial agreement with each other. Here, we experimentally evaluate these predictions using an engineered repressor comprising the LacI DNA-binding domain, the LacI linker, and the GalR regulatory domain (LLhG). "Wild-type" LLhG has altered DNA specificity and weaker lacO(1) repression compared to LacI or a similar LacI:PurR chimera. Next, predictions of linker specificity determinants were tested, using amino acid substitution and in vivo repression assays to assess functional change. In LLhG, all predicted sites are specificity determinants, as well as three sites not predicted by any algorithm. Strategies are suggested for diminishing the number of false negative predictions. Finally, individual substitutions at LLhG specificity determinants exhibited a broad range of functional changes that are not predicted by bioinformatics algorithms. Results suggest that some variants have altered affinity for DNA, some have altered allosteric response, and some appear to have changed specificity for alternative DNA ligands.
Isolating LacZ-expressing cells from mouse inner ear tissues using flow cytometry.
Jan, Taha A; Chai, Renjie; Sayyid, Zahra N; Cheng, Alan G
2011-12-23
Isolation of specific cell types allows one to analyze rare cell populations such as stem/progenitor cells. Such an approach to studying inner ear tissues presents a unique challenge because of the paucity of cells of interest and few transgenic reporter mouse models. Here, we describe a protocol using fluorescence-conjugated probes to selectively label LacZ-positive cells from the neonatal cochleae. The most common underlying pathology of sensorineural hearing loss is the irreversible damage and loss of cochlear sensory hair cells, which are required to transduce sound waves to neural impulses. Recent evidence suggests that the murine auditory and vestibular organs harbor stem/progenitor cells that may have regenerative potential. These findings warrant further investigation, including identifying specific cell types with stem/progenitor cell characteristics. The Wnt signaling pathway has been demonstrated to play a critical role in maintaining stem/progenitor cell populations in several organ systems. We have recently identified Wnt-responsive Axin2-expressing cells in the neonatal cochlea, but their function is largely unknown. To better understand the behavior of these Wnt-responsive cells in vitro, we have developed a method of isolating Axin2-expressing cells from cochleae of Axin2-LacZ reporter mice. Using flow cytometry to isolate Axin2-LacZ positive cells from the neonatal cochleae, we could in turn execute a variety of experiments on live cells to interrogate their behavior as stem/progenitor cells. Here, we describe in detail the steps for the microdissection of neonatal cochlea, dissociation of these tissues, labeling of the LacZ-positive cells using a fluorogenic substrate, and cell sorting. Techniques for dissociating cochleae into single cells and isolating cochlear cells via flow cytometry have been described. We have made modifications to these techniques to establish a novel protocol to isolate LacZ-expressing cells from the neonatal cochlea.
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)
NASA Astrophysics Data System (ADS)
Bhatta, G.; Zola, S.; Stawarz, Ł.; Ostrowski, M.; Winiarski, M.; Ogłoza, W.; Dróżdż, M.; Siwak, M.; Liakos, A.; Kozieł-Wierzbowska, D.; Gazeas, K.; Debski, B.; Kundera, T.; Stachowski, G.; Paliya, V. S.
2016-11-01
The detection of periodicity in the broadband non-thermal emission of blazars has so far been proven to be elusive. However, there are a number of scenarios that could lead to quasi-periodic variations in blazar light curves. For example, an orbital or thermal/viscous period of accreting matter around central supermassive black holes could, in principle, be imprinted in the multi-wavelength emission of small-scale blazar jets, carrying such crucial information about plasma conditions within the jet launching regions. In this paper, we present the results of our time series analysis of the ˜9.2 yr long, and exceptionally well-sampled, optical light curve of the BL Lac object OJ 287. The study primarily used the data from our own observations performed at the Mt. Suhora and Kraków Observatories in Poland, and at the Athens Observatory in Greece. Additionally, SMARTS observations were used to fill some of the gaps in the data. The Lomb-Scargle periodogram and the weighted wavelet Z-transform methods were employed to search for possible quasi-periodic oscillations in the resulting optical light curve of the source. Both methods consistently yielded a possible quasi-periodic signal around the periods of ˜400 and ˜800 days, the former with a significance (over the underlying colored noise) of ≥slant 99 % . A number of likely explanations for this are discussed, with preference given to a modulation of the jet production efficiency by highly magnetized accretion disks. This supports previous findings and the interpretation reported recently in the literature for OJ 287 and other blazar sources.
An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.
Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K
2003-01-01
The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.
Asteri, Ioanna-Areti; Papadimitriou, Konstantinos; Boutou, Effrossyni; Anastasiou, Rania; Pot, Bruno; Vorgias, Constantinos E; Tsakalidou, Effie
2010-07-15
The pLAC1 plasmid of Lactobacillus acidipiscis ACA-DC 1533, a strain isolated from traditional Kopanisti cheese, was characterised. Nucleotide sequence analysis revealed a circular molecule of 3478bp with a G+C content of 37.2%. Ab initio annotation indicated four putative open reading frames (orfs). orf1 and orf4 were found to encode a replication initiation protein (Rep) and a mobilization protein (Mob), respectively. The deduced products of orf2 and orf3 revealed no significant homology to other known proteins. However, in silico examination of the plasmid sequence supported the existence of a novel operon that includes rep, orf2 and orf3 in pLAC1 and that this operon is highly conserved also in plasmids pLB925A02, pSMA23, pLC88 and pC7. RT-PCR experiments allowed us to verify that these three genes are co-transcribed as a single polycistronic mRNA species. Furthermore, phylogenetic analysis of pLAC1 Rep and Mob proteins demonstrated that they may have derived from different plasmid origins, suggesting that pLAC1 is a product of a modular evolution process. Comparative analysis of full length nucleotide sequences of pLAC1 and related Lactobacillus plasmids showed that pLAC1 shares a very similar replication backbone with pLB925A02, pSMA23 and pLC88. In contrast, mob of pLAC1 was almost identical with the respective gene of plasmids pLAB1000, pLB4 and pPB1. These findings lead to the conclusion that pLAC1 acquired mob probably via an ancestral recombination event. Our overall work highlights the importance of characterizing plasmids deriving from non-starter 'wild' isolates in order to better appreciate plasmid divergence and evolution of lactic acid bacteria. 2010 Elsevier B.V. All rights reserved.
Light Curve and Orbital Period Analysis of VX Lac
NASA Astrophysics Data System (ADS)
Yılmaz, M.; Nelson, R. H.; Şenavcı, H. V.; İzci, D.; Özavcı, İ.; Gümüş, D.
2017-04-01
In this study, we performed simultaneously light curve and radial velocity, and also period analyses of the eclipsing binary system VX Lac. Four color (BVRI) light curves of the system were analysed using the W-D code. The results imply that VX Lac is a classic Algol-type binary with a mass ratio of q=0.27, of which the less massive secondary component fills its Roche lobe. The orbital period behaviour of the system was analysed by assuming the light time effect (LITE) from a third body. The O-C analysis yielded a mass transfer rate of dM/dt=1.86×10-8M⊙yr-1 and the minimal mass of the third body to be M3=0.31M⊙. The residuals from mass transfer and the third body were also analysed because another cyclic variation is seen in O-C diagram. This periodic variation was examined under the hypotheses of stellar magnetic activity and fourth body.
Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo
2002-03-01
Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.
Mitchell, J M; Yee, A J; McNab, W B; Griffiths, M W; McEwen, S A
1999-01-01
LacTek tests are competitive enzyme-linked immunosorbent assays intended for rapid detection of antimicrobial residues in bovine milk. In this study, the LacTek test protocol was modified for use with extracts of bovine tissue to detect beta-lactam, tetracycline, and sulfamethazine residues. Test performance characteristics--precision, accuracy, ruggedness, practicability, and analytical specificity and sensitivity--were investigated. Results suggest that LacTek tests can be easily adapted to detect antimicrobial residues in extracts of lean ground beef. However, positive samples may not contain residues at violative concentrations (i.e., Canadian maximum residue limits), and therefore, additional analysis would be required for final confirmation and quantitation (e.g., chromatography).
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
Search for Cross-Correlations of Ultrahigh-Energy Cosmic Rays with BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Abbasi, R. U.; Abu-Zayyad, T.; Amann, J. F.; Archbold, G.; Belov, K.; Belz, J. W.; BenZvi, S.; Bergman, D. R.; Blake, S. A.; Boyer, J. H.; Burt, G. W.; Cao, Z.; Connolly, B. M.; Deng, W.; Fedorova, Y.; Findlay, J.; Finley, C. B.; Hanlon, W. F.; Hoffman, C. M.; Holzscheiter, M. H.; Hughes, G. A.; Hüntemeyer, P.; Jui, C. C. H.; Kim, K.; Kirn, M. A.; Knapp, B. C.; Loh, E. C.; Maestas, M. M.; Manago, N.; Mannel, E. J.; Marek, L. J.; Martens, K.; Matthews, J. A. J.; Matthews, J. N.; O'Neill, A.; Painter, C. A.; Perera, L.; Reil, K.; Riehle, R.; Roberts, M. D.; Rodriguez, D.; Sasaki, M.; Schnetzer, S. R.; Seman, M.; Sinnis, G.; Smith, J. D.; Snow, R.; Sokolsky, P.; Springer, R. W.; Stokes, B. T.; Thomas, J. R.; Thomas, S. B.; Thomson, G. B.; Tupa, D.; Westerhoff, S.; Wiencke, L. R.; Zech, A.; HIRES Collaboration
2006-01-01
Data taken in stereo mode by the High Resolution Fly's Eye (HiRes) air fluorescence experiment are analyzed to search for correlations between the arrival directions of ultrahigh-energy cosmic rays with the positions of BL Lacertae objects. Several previous claims of significant correlations between BL Lac objects and cosmic rays observed by other experiments are tested. These claims are not supported by the HiRes data. However, we verify a recent analysis of correlations between HiRes events and a subset of confirmed BL Lac objects from the 10th Veron Catalog, and we study this correlation in detail. Due to the a posteriori nature of the search, the significance level cannot be reliably estimated and the correlation must be tested independently before any claim can be made. We identify the precise hypotheses that will be tested with statistically independent data.
Bistability of the lac operon during growth of Escherichia coli on lactose and lactose+glucose.
Narang, Atul; Pilyugin, Sergei S
2008-05-01
The lac operon of Escherichia coli can exhibit bistability. Early studies showed that bistability occurs during growth on TMG/succinate and lactose+glucose, but not during growth on lactose. More recently, studies with lacGFP-transfected cells show bistability during growth on TMG/succinate, but not during growth on lactose and lactose+glucose. In the literature, these results are invariably attributed to variations in the destabilizing effect of the positive feedback generated by induction. Specifically, during growth on TMG/succinate, lac induction generates strong positive feedback because the permease stimulates the accumulation of intracellular TMG, which in turn, promotes the synthesis of even more permease. This positive feedback is attenuated during growth on lactose because hydrolysis of intracellular lactose by beta-galactosidase suppresses the stimulatory effect of the permease. It is attenuated even more during growth on lactose + glucose because glucose inhibits the uptake of lactose. But it is clear that the stabilizing effect of dilution also changes dramatically as a function of the medium composition. For instance, during growth on TMG/succinate, the dilution rate of lac permease is proportional to its activity, e, because the specific growth rate is independent of e (it is completely determined by the concentration of succinate). However, during growth on lactose, the dilution rate of the permease is proportional to e2 because the specific growth rate is proportional to the specific lactose uptake rate, which in turn, proportional to e. We show that: (a) This dependence on e2 creates such a strong stabilizing effect that bistability is virtually impossible during growth on lactose, even in the face of the intense positive feedback generated by induction. (b) This stabilizing effect is weakened during growth on lactose+glucose because the specific growth rate on glucose is independent of e, so that the dilution rate once again contains a term that
Lorenzo, José M; Fonseca, Sonia
2014-11-01
Dry-cured 'lacón' is a traditional cured meat product made in the north-west of Spain from the pigs' foreleg, with similar manufacturing process to that used in dry-cured ham. The aim of this study was to assess the influence of cross-breeding of Celta pig with Landrace or Duroc breeds on the formation of volatile compounds through the manufacture of 'lacón'. 'Lacón' from the crosses with Duroc presented lower final moisture (534 g kg(-1) ) and higher intra-muscular fat content [144 g kg(-1) dry matter (DM)] than 'lacón' from Celta pure breed (587 g kg(-1) and 36 g kg(-1) DM, respectively). Volatile compounds were extracted by solid-phase microextraction and analysed by gas chromatography-mass spectrometry. Volatile compounds from 'lacón' were affected by cross-breeding. The total amount of volatile compounds significantly (P < 0.001) increased during the manufacturing process, this increase being more marked in samples from the Landrace cross-breed. The most abundant group of flavour compounds at the end of the manufacturing process was esters in the three batches, followed by aldehydes, hydrocarbons and alcohols. The most abundant ester at the end of the process was hexanoic acid methyl ester, while the aldehyde found in a higher amount was hexanal. The profile of volatile compounds was affected by cross-breed, especially at the end of the 'lacón' dry-curing process. © 2014 Society of Chemical Industry.
LUNSORT list of lunar orbiter data by LAC area
NASA Technical Reports Server (NTRS)
Hixon, S.
1976-01-01
Lunar orbiter (missions 1-5) photographic data are listed sequentially according to the number (1 to 147) LAC (Lunar Aeronautical Chart) areas by use of a computer program called LUNSORT. This listing, as well as a similar one from Apollo would simplify the task of identifying images of a given Lunar area. Instructions and sample case are included.
Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)
Influence of salt content and processing time on sensory characteristics of cooked "lacón".
Purriños, Laura; Bermúdez, Roberto; Temperán, Sara; Franco, Daniel; Carballo, Javier; Lorenzo, José M
2011-04-01
The influence of salt content and processing time on the sensory properties of cooked "lacón" were determined. "Lacón" is a traditional dry-cured and ripened meat product made in the north-west of Spain from the fore leg of the pig, following a similar process to that of dry-cured ham. Six batches of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)) and ripened during two times (56 and 84 days of dry-ripening). Cured odour in all batches studied, red colour and rancid odour in MS and HS batches, flavour intensity in MS batch and fat yellowness, rancid flavour and hardness in the HS batch were significantly different with respect to the time of processing. Appearance, odour, flavour and texture were not significantly affected by the salt content (P>0.05). However, the saltiness score showed significant differences with respect to the salt levels in all studied batches (56 and 84 days of process). The principal component analysis showed that physicochemical traits were the most important ones concerning the quality of dry-cured "lacón" and offered a good separation of the mean samples according to the dry ripening days and salt level. © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.
Geology and ground-water resources of Fond du Lac County, Wisconsin
Newport, Thomas G.
1962-01-01
The principal water-bearing rocks underlying Fond du Lac County, Wis., are sandstones of Cambrian and Ordovician age and dolomite of Silurian age. Other aquifers include dolomite of Ordovician age and sand. and gravel of Quaternary age. Crystalline rocks of Precambrian age, which underlie all the water-bearing formations, form a practically impermeable basement complex and yield little or no water to wells. Ground water is the source of all public and most private and industrial water supplies in the county. The municipalities and industries obtain water chiefly from wells that penetrate the sandstones of Cambrian and Ordorician age. The Platteville formation and Galena dolomite of Ordovician age and the Niagara dolomite of Silurian age supply water to most domestic and stock wells and to a few industrial wells. Several buried valleys in the bedrock surface contain water-bearing deposits of sand and gravel. The source of the ground water in Fond du Lac County is local precipitation. Recharge to the water-bearing beds occurs in most of the county but is greatest where the bedrock formations are near the surface. Ground water is discharged by seeps and springs, by evaporation and transpiration, and by wells. Ground-water levels in wells fluctuate in response to recharge and to natural discharge and pumping. In areas not affected by pumping, water levels generally decline through the summer months because of natural discharge and lack of recharge, recover slightly in the fall after the first killing frost, decline during the winter, and recover in the spring when recharge is greatest. In areas of heavy pumping, the water levels are lowest in late summer and highest in late winter. Water levels in wells in the Fond du Lac area were about 5 to 50 feet above the land surface in 1885, but they had declined to as low as 185 feet below the land surface by 1957. Coefficients of transmissibility and storage of the sandstones of Cambrian and Ordovician age were determined by
NASA Astrophysics Data System (ADS)
Kaur, Navpreet; Chandra, S.; Baliyan, Kiran S.; Sameer; Ganesh, S.
2017-09-01
We present the results from a multiwavelength study of the flaring activity in the high-energy peaked BL Lac object 1ES 1959+650 during 2015 January-2016 June. The source underwent two major outbursts, during 2015 March and 2015 October, across the whole electromagnetic spectrum (EMS). We used data from Fermi-LAT and Swift-XRT/UVOT, and optical data from Mt. Abu InfraRed Observatory and Steward Observatory to look for possible correlations between the emissions at different energies and the nature of the variability during the flaring state. During the 2015 October outburst, the nightly averaged V-band brightest magnitude, 14.45(0.03), and faintest magnitude, 14.45(0.03), were recorded. Apart from long-term flares, rapid and short-term variabilities were noticed at all energies. Our study suggests that the flaring activities at all frequencies, with diverse flare durations and time lags, are correlated. The magnetic field strength is estimated to be 4 G using the synchrotron-cooling timescale (2.3 hr), and the upper limits on the sizes of both emission regions, γ-ray and optical, are estimated to be of the order of 1016 cm. The quasi-simultaneous flux enhancements in 15 GHz and VHE γ-ray emissions indicate a fresh injection of plasma into the jet, which interacts with a standing submillimeter core, resulting in co-spatial emissions across the EMS. The synchrotron peak shifts to higher frequency in the spectral energy distribution while the γ-ray spectra softens during the flaring. The shape of the inverse-Compton spectra indicates a change in the particle energy distribution pre- and post-flare.
Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†
Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald
2009-01-01
A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129
Salient Object Detection via Structured Matrix Decomposition.
Peng, Houwen; Li, Bing; Ling, Haibin; Hu, Weiming; Xiong, Weihua; Maybank, Stephen J
2016-05-04
Low-rank recovery models have shown potential for salient object detection, where a matrix is decomposed into a low-rank matrix representing image background and a sparse matrix identifying salient objects. Two deficiencies, however, still exist. First, previous work typically assumes the elements in the sparse matrix are mutually independent, ignoring the spatial and pattern relations of image regions. Second, when the low-rank and sparse matrices are relatively coherent, e.g., when there are similarities between the salient objects and background or when the background is complicated, it is difficult for previous models to disentangle them. To address these problems, we propose a novel structured matrix decomposition model with two structural regularizations: (1) a tree-structured sparsity-inducing regularization that captures the image structure and enforces patches from the same object to have similar saliency values, and (2) a Laplacian regularization that enlarges the gaps between salient objects and the background in feature space. Furthermore, high-level priors are integrated to guide the matrix decomposition and boost the detection. We evaluate our model for salient object detection on five challenging datasets including single object, multiple objects and complex scene images, and show competitive results as compared with 24 state-of-the-art methods in terms of seven performance metrics.
Analysis and Remediation of the 2013 LAC-MÉGANTIC Train Derailment
NASA Astrophysics Data System (ADS)
Brunke, Suzanne; Aubé, Guy; Legaré, Serge; Auger, Claude
2016-06-01
On July 6, 2013 a train owned by Montréal, Maine & Atlantic Railway (MMA) Company derailed in Lac-Mégantic, Quebec, Canada triggering the explosion of the tankers carrying crude oil. Several buildings in the downtown core were destroyed. The Sûreté du Québec confirmed the death of 47 people in the disaster. Through the Canadian Space Agency (CSA) Rapid Information Products and Services (RIPS) program, MDA developed value-added products that allowed stakeholders and all levels of government (municipal, provincial and federal) to get an accurate picture of the disaster. The goal of this RIPS Project was to identify the contribution that remote sensing technology can provide to disasters such as the train derailment and explosion at Lac-Mégantic through response and remediation monitoring. Through monitoring and analysis, the Lac-Mégantic train derailment response and remediation demonstrated how Earth observation data can be used for situational awareness in a disaster and in documenting the remediation process. Both high resolution optical and RADARSAT-2 SAR image products were acquired and analyzed over the disaster remediation period as each had a role in monitoring. High resolution optical imagery provided a very clear picture of the current state of remediation efforts, however it can be difficult to acquire due to cloud cover and weather conditions. The RADARSAT-2 SAR images can be acquired in all weather conditions at any time of day making it ideal for mission critical information gathering. MDA's automated change detection processing enabled rapid delivery of advanced information products.
NASA Astrophysics Data System (ADS)
Messina, Sergio
2007-10-01
The results of a long-term UBV photometric monitoring of the red supergiant (RSG) star V424 Lac are presented. V424 Lac shows multiperiodic brightness variations which can be attributed to pulsational oscillations. A much longer period ( P = 1601 d), that allows us to classify this star as a long secondary period variable star (LSPV) has been also detected. The B - V and U - B color variations related to the long secondary period (LSP) are similar to those related to the shorter periods, supporting the pulsational nature of LSP. The long period brightness variation of V424 Lac is accompanied by a near-UV (NUV) excess, which was spectroscopically detected in a previous study [Massey, P., Plez, B., Levesque, E.M., et al., 2005. ApJ 634, 1286] and which is now found to be variable from photometry. On the basis of the results found for V424 Lac, the NUV excess recently found in a number of RSGs may be due not solely to circumstellar dust but may also have a contribution from a still undetected LSP variability.
NASA Astrophysics Data System (ADS)
Olakanmi, E. O.; Tlotleng, M.; Meacock, C.; Pityana, S.; Doyoyo, M.
2013-06-01
Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries, and renewable energy systems. This article highlights some of those potential applications. In the LACS process, a laser beam irradiates the substrate and the particles, thereby softening both of them. Consequently, the particles deform upon impact at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS deposition mechanism and microstructural properties is presented. The deposition efficiency, the microstructure, and the microhardness of the LACS-deposited coatings produced by a 4.4-kW Nd:YAG laser system were evaluated. The outcome of this study shows that pore- and crack-free Al-12 wt.%Si coatings were deposited via softening by laser irradiation and adiabatic shearing phenomena at an optimum laser power of 2.5 kW.
Optical monitoring of BL Lac object S5 0716+714 and FSRQ 3C 273 from 2000 to 2014
NASA Astrophysics Data System (ADS)
Yuan, Yu-Hai; Fan, Jun-hui; Tao, Jun; Qian, Bo-Chen; Costantin, Denise; Xiao, Hu-Bing; Pei, Zhi-Yuan; Lin, Chao
2017-09-01
Context. Using the 1.56 m telescope at the Shanghai Observatory (ShAO), China, we monitored two sources, BL Lac object S5 0716+714 and flat spectrum radio quasar (FSRQ) 3C 273. For S5 0716+714, we report 4969 sets of CCD (Charge-coupled Device) photometrical optical observations (1369 for V band, 1861 for R band and 1739 for I band) in the monitoring time from Dec. 4, 2000 to Apr. 5, 2014. For 3C 273, we report 460 observations (138 for V band, 146 for R band and 176 for I band) in the monitoring time from Mar. 28, 2006 to Apr. 9, 2014. Aims: The observations provide us with a large amount of data to analyze the short-term and long-term optical variabilities. Based on the variable timescales, we can estimate the central black hole mass and the Doppler factor. An abundance of multi-band observations can help us to analyze the relations between the brightness and spectrum. Methods: We use Gaussian fitting to analyze the intra-day light curves and obtain the intra-day variability (IDV) timescales. We use the discrete correlation function (DCF) method and Jurkevich method to analyze the quasi-periodic variability. Based on the VRI observations, we use the linear fitting to analyze the relations between brightness and spectrum. Results: The two sources both show IDV properties for S5 0716+714. The timescales are in the range from 17.3 min to 4.82 h; for 3C 273, the timescale is ΔT = 35.6 min. Based on the periodic analysis methods, we find the periods PV = 24.24 ± 1.09 days, PR = 24.12 ± 0.76 days, PI = 24.82 ± 0.73 days for S5 0716+714, and P = 12.99 ± 0.72, 21.76 ± 1.45 yr for 3C 273. The two sources displayed the "bluer-when-brighter" spectral evolution properties. Conclusions: S5 0716+714 and 3C 273 are frequently studied objects. The violent optical variability and IDV may come from the jet. Gaussian fitting can be used to analyze IDVs. The relations between brightness (flux density) and spectrum are strongly influenced by the frequency. A table of the
Miallau, Linda; Hunter, William N; McSweeney, Sean M; Leonard, Gordon A
2007-07-06
High resolution structures of Staphylococcus aureus d-tagatose-6-phosphate kinase (LacC) in two crystal forms are herein reported. The structures define LacC in apoform, in binary complexes with ADP or the co-factor analogue AMP-PNP, and in a ternary complex with AMP-PNP and D-tagatose-6-phosphate. The tertiary structure of the LacC monomer, which is closely related to other members of the pfkB subfamily of carbohydrate kinases, is composed of a large alpha/beta core domain and a smaller, largely beta "lid." Four extended polypeptide segments connect these two domains. Dimerization of LacC occurs via interactions between lid domains, which come together to form a beta-clasp structure. Residues from both subunits contribute to substrate binding. LacC adopts a closed structure required for phosphoryl transfer only when both substrate and co-factor are bound. A reaction mechanism similar to that used by other phosphoryl transferases is proposed, although unusually, when both substrate and co-factor are bound to the enzyme two Mg(2+) ions are observed in the active site. A new motif of amino acid sequence conservation common to the pfkB subfamily of carbohydrate kinases is identified.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaur, Navpreet; Chandra, S.; Baliyan, Kiran S
We present the results from a multiwavelength study of the flaring activity in the high-energy peaked BL Lac object 1ES 1959+650 during 2015 January–2016 June. The source underwent two major outbursts, during 2015 March and 2015 October, across the whole electromagnetic spectrum (EMS). We used data from Fermi -LAT and Swift -XRT/UVOT, and optical data from Mt. Abu InfraRed Observatory and Steward Observatory to look for possible correlations between the emissions at different energies and the nature of the variability during the flaring state. During the 2015 October outburst, the nightly averaged V -band brightest magnitude, 14.45(0.03), and faintest magnitude,more » 14.45(0.03), were recorded. Apart from long-term flares, rapid and short-term variabilities were noticed at all energies. Our study suggests that the flaring activities at all frequencies, with diverse flare durations and time lags, are correlated. The magnetic field strength is estimated to be 4 G using the synchrotron-cooling timescale (2.3 hr), and the upper limits on the sizes of both emission regions, γ -ray and optical, are estimated to be of the order of 10{sup 16} cm. The quasi-simultaneous flux enhancements in 15 GHz and VHE γ -ray emissions indicate a fresh injection of plasma into the jet, which interacts with a standing submillimeter core, resulting in co-spatial emissions across the EMS. The synchrotron peak shifts to higher frequency in the spectral energy distribution while the γ -ray spectra softens during the flaring. The shape of the inverse-Compton spectra indicates a change in the particle energy distribution pre- and post-flare.« less
Quantitative approaches to the study of bistability in the lac operon of Escherichia coli.
Santillán, Moisés; Mackey, Michael C
2008-08-06
In this paper, the history and importance of the lac operon in the development of molecular and systems biology are briefly reviewed. We start by presenting a description of the regulatory mechanisms in this operon, taking into account the most recent discoveries. Then we offer a survey of the history of the lac operon, including the discovery of its main elements and the subsequent influence on the development of molecular and systems biology. Next the bistable behaviour of the operon is discussed, both with respect to its discovery and its molecular origin. A review of the literature in which this bistable phenomenon has been studied from a mathematical modelling viewpoint is then given. We conclude with some brief remarks.
A source of artifact in the lacZ reversion assay in Escherichia coli.
Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I
2015-06-01
The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its
Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
Optical Spectra of Four Objects Identified with Variable Radio Sources
NASA Astrophysics Data System (ADS)
Chavushyan, V.; Mujica, R.; Gorshkov, A. G.; Konnikova, V. K.; Mingaliev, M. G.
2000-06-01
We obtained optical spectra of four objects identified with variable radio sources. Three objects (0029+0554, 0400+0550, 2245+0500) were found to be quasars with redshifts of 1.314, 0.761, and 1.091. One object (2349+0534) has a continuum spectrum characteristic of BL Lac objects. We analyze spectra of the radio sources in the range 0.97-21.7 GHz for the epoch 1997 and in the range 3.9-11.1 GHz for the epoch 1990, as well as the pattern of variability of their flux densities on time scales of 1.5 and 7 years.
A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement
Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.
2013-01-01
A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700
SEMI-SUPERVISED OBJECT RECOGNITION USING STRUCTURE KERNEL
Wang, Botao; Xiong, Hongkai; Jiang, Xiaoqian; Ling, Fan
2013-01-01
Object recognition is a fundamental problem in computer vision. Part-based models offer a sparse, flexible representation of objects, but suffer from difficulties in training and often use standard kernels. In this paper, we propose a positive definite kernel called “structure kernel”, which measures the similarity of two part-based represented objects. The structure kernel has three terms: 1) the global term that measures the global visual similarity of two objects; 2) the part term that measures the visual similarity of corresponding parts; 3) the spatial term that measures the spatial similarity of geometric configuration of parts. The contribution of this paper is to generalize the discriminant capability of local kernels to complex part-based object models. Experimental results show that the proposed kernel exhibit higher accuracy than state-of-art approaches using standard kernels. PMID:23666108
Radio morphology and parent population of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Laurent-Muehleisen, S. A.; Kollgaard, R. I.; Moellenbrock, G. A.; Feigelson, E. D.
1993-01-01
High-dynamic range (typically 1700:1) radio maps of 15 X-ray BL Lac (XBL) objects from the HEAO-1 Large Area Sky Survey are presented. Morphological characteristics of these sources are compared with Fanaroff-Riley (FR) class I radio galaxies in the context of unified schemes, with reference to one-sided kiloparsec-scale emission. Evidence that cluster membership of XBLs is significantly higher than previously thought is also presented. It is shown that the extended radio powers, X-ray emission, core-to-lobe ratios, and linear sizes of the radio selected BL Lac (RBL) and XBL populations are consistent with an FR I radio galaxy parent population. A source list and VLA observing log and map parameters are provided.
Zhang, Jing; Lu, Luyao; Chen, Feng; Chen, Lingling; Yin, Jingang; Huang, Xing
2018-01-05
A bacterial strain Za capable of degrading diphenyl ether herbicide lactofen was isolated and identified as Bacillus sp. This strain could degrade 94.8% of 50mgL -1 lactofen after 4days of inoculation in flasks. It was revealed that lactofen was initially hydrolyzed to desethyl lactofen, which was further transformed to acifluorfen, followed by the reduction of the nitro group to yield aminoacifluorfen. The phytotoxicity of the transformed product aminoacifluorfen to maize was decreased significantly compared with the lactofen. A gene lacE, encoding an esterase responsible for lactofen hydrolysis to desethyl lactofen and acifluorfen continuously, was cloned from Bacillus sp. Za. The deduced amino acid belonging to the esterase family VII contained a typical Ser-His-Asp/Glu catalytic triad and the conserved motifs GXSXG. The purified recombinant protein LacE displayed maximal esterase activity at 40°C and pH 7.0. Additionally, LacE had broad substrate specificity and was capable of hydrolyzing p-nitrophenyl esters. The enantioselectivity of LacE during lactofen degradation was further studied, and the results indicated that the (S)-(+)-lactofen was degraded faster than the (R)-(-)-lactofen, which could illustrate the reported phenomenon that (S)-(+)-lactofen was preferentially degraded in soil and sediment. Copyright © 2017 Elsevier B.V. All rights reserved.
Structured Course Objects in a Digital Library
NASA Technical Reports Server (NTRS)
Maly, K.; Zubair, M.; Liu, X.; Nelson, M.; Zeil, S.
1999-01-01
We are developing an Undergraduate Digital Library Framework (UDLF) that will support creation/archiving of courses and reuse of existing course material to evolve courses. UDLF supports the publication of course materials for later instantiation for a specific offering and allows the addition of time-dependent and student-specific information and structures. Instructors and, depending on permissions, students can access the general course materials or the materials for a specific offering. We are building a reference implementation based on NCSTRL+, a digital library derived from NCSTRL. Digital objects in NCSTRL+ are called buckets, self-contained entities that carry their own methods for access and display. Current bucket implementations have a two level structure of packages and elements. This is not a rich enough structure for course objects in UDLF. Typically, courses can only be modeled as a multilevel hierarchy and among different courses, both the syntax and semantics of terms may vary. Therefore, we need a mechanism to define, within a particular library, course models, their constituent objects, and the associated semantics in a flexible, extensible way. In this paper, we describe our approach to define and implement these multilayered course objects. We use XML technology to emulate complex data structures within the NCSTRL+ buckets. We have developed authoring and browsing tools to manipulate these course objects. In our current implementation a user downloading an XML based course bucket also downloads the XML-aware tools: an applet that enables the user to edit or browse the bucket. We claim that XML provides an effective means to represent multi-level structure of a course bucket.
The X-ray spectra of the BL Lacertae objects PKS 0548 - 322 and 3C 66A
NASA Technical Reports Server (NTRS)
Maccacaro, T.; Maccagni, D.; Tarenghi, M.
1983-01-01
Einstein Observatory simultaneous imaging proportional counter and monitor proportional counter data are combined in order to derive the energy spectra of the BL Lac objects PKS 0548-322 and 3C 66A between 0.2 and 10 keV. While the latter is found to be variable in both intensity and spectral shape, the former, although constant in the present data, is found to have experienced a spectrum variation in view of results from other experiments. Attention is given to the implications of flux and spectral variability in BL Lac objects for models of X-ray emission mechanisms. It is suggested that the wide spread of the spectral index distribution is due to the detection of the highly variable synchrotron-produced X-rays that are generally undetected in QSOs.
Three new BL Lacertae objects in the Palomar-Green survey
NASA Technical Reports Server (NTRS)
Fleming, Thomas A.; Green, Richard F.; Jannuzi, Buell T.; Liebert, James; Smith, Paul S.; Fink, Henner
1993-01-01
We have identified three BL Lacertae objects in the Palomar-Green Survey which were previously misclassified as DC white dwarfs, namely PG 1246+586, PG 1424+240, and PG 1437+398. Our reclassification is based on the detection of these objects as x-ray sources in the ROSAT all-sky survey and upon our subsequent detection of intrinsic linearly polarized and variable optical emission from these sources. As a result of the ROSAT survey, the number of identified BL Lac objects in the Palomar-Green catalog of UV excess objects has been doubled. Corrected optical positions are presented for PG 1246+586 and PG 1437+398.
Purified reconstituted lac carrier protein from Escherichia coli is fully functional.
Viitanen, P; Garcia, M L; Kaback, H R
1984-03-01
Proteoliposomes reconstituted with lac carrier protein purified from the plasma membrane of Escherichia coli catalyze each of the translocation reactions typical of the beta-galactoside transport system (i.e., active transport, counterflow, facilitated influx and efflux) with turnover numbers and apparent Km values comparable to those observed in right-side-out membrane vesicles. Furthermore, detailed kinetic studies show that the reconstituted system exhibits properties analogous to those observed in membrane vesicles. Imposition of a membrane potential (delta psi, interior negative) causes a marked decrease in apparent Km (by a factor of 7 to 10) with a smaller increase in Vmax (approximately equal to 3-fold). At submaximal values of delta psi, the reconstituted carrier exhibits biphasic kinetics, with one component manifesting the kinetic parameters of active transport and the other exhibiting the characteristics of facilitated diffusion. Finally, at low lactose concentrations, the initial velocity of influx varies linearly with the square of the proton electro-chemical gradient. The results provide quantitative support for the contention that a single polypeptide species, the product of the lac y gene, is responsible for each of the transport reactions typical of the beta-galactoside transport system.
Chaudhary, Richa; Grover, Chander; Bhattacharya, S N; Sharma, Arun
2017-01-01
The assessment of dermatology undergraduates is being done through computer assisted objective structured clinical examination at our institution for the last 4 years. We attempted to compare objective structured clinical examination (OSCE) and computer assisted objective structured clinical examination (CA-OSCE) as assessment tools. To assess the relative effectiveness of CA-OSCE and OSCE as assessment tools for undergraduate dermatology trainees. Students underwent CA-OSCE as well as OSCE-based evaluation of equal weightage as an end of posting assessment. The attendance as well as the marks in both the examination formats were meticulously recorded and statistically analyzed using SPSS version 20.0. Intercooled Stata V9.0 was used to assess the reliability and internal consistency of the examinations conducted. Feedback from both students and examiners was also recorded. The mean attendance for the study group was 77% ± 12.0%. The average score on CA- OSCE and OSCE was 47.4% ± 19.8% and 53.5% ± 18%, respectively. These scores showed a mutually positive correlation, with Spearman's coefficient being 0.593. Spearman's rank correlation coefficient between attendance scores and assessment score was 0.485 for OSCE and 0.451 for CA-OSCE. The Cronbach's alpha coefficient for all the tests ranged from 0.76 to 0.87 indicating high reliability. The comparison was based on a single batch of 139 students. Such an evaluation on more students in larger number of batches over successive years could help throw more light on the subject. Computer assisted objective structured clinical examination was found to be a valid, reliable and effective format for dermatology assessment, being rated as the preferred format by examiners.
Conflict between object structural and functional affordances in peripersonal space.
Kalénine, Solène; Wamain, Yannick; Decroix, Jérémy; Coello, Yann
2016-10-01
Recent studies indicate that competition between conflicting action representations slows down planning of object-directed actions. The present study aims to assess whether similar conflict effects exist during manipulable object perception. Twenty-six young adults performed reach-to-grasp and semantic judgements on conflictual objects (with competing structural and functional gestures) and non-conflictual objects (with similar structural and functional gestures) presented at difference distances in a 3D virtual environment. Results highlight a space-dependent conflict between structural and functional affordances. Perceptual judgments on conflictual objects were slower that perceptual judgments on non-conflictual objects, but only when objects were presented within reach. Findings demonstrate that competition between structural and functional affordances during object perception induces a processing cost, and further show that object position in space can bias affordance competition. Copyright © 2016 Elsevier B.V. All rights reserved.
Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.
Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco
2013-04-01
Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.
Peng, Wenjie; Pranskevich, Jennifer; Nycholat, Corwin; Gilbert, Michel; Wakarchuk, Warren; Paulson, James C; Razi, Nahid
2012-01-01
Poly-N-acetyllactosamine extensions on N- and O-linked glycans are increasingly recognized as biologically important structural features, but access to these structures has not been widely available. Here, we report a detailed substrate specificity and catalytic efficiency of the bacterial β3-N-acetylglucosaminyltransferase (β3GlcNAcT) from Helicobacter pylori that can be adapted to the synthesis of a rich diversity of glycans with poly-LacNAc extensions. This glycosyltransferase has surprisingly broad acceptor specificity toward type-1, -2, -3 and -4 galactoside motifs on both linear and branched glycans, found commonly on N-linked, O-linked and I-antigen glycans. This finding enables the production of complex ligands for glycan-binding studies. Although the enzyme shows preferential activity for type 2 (Galβ1-4GlcNAc) acceptors, it is capable of transferring N-acetylglucosamine (GlcNAc) in β1-3 linkage to type-1 (Galβ1-3GlcNAc) or type-3/4 (Galβ1-3GalNAcα/β) sequences. Thus, by alternating the use of the H. pylori β3GlcNAcT with galactosyltransferases that make the β1-4 or β1-3 linkages, various N-linked, O-linked and I-antigen acceptors could be elongated with type-2 and type-1 LacNAc repeats. Finally, one-pot incubation of di-LacNAc biantennary N-glycopeptide with the β3GlcNAcT and GalT-1 in the presence of uridine diphosphate (UDP)-GlcNAc and UDP-Gal, yielded products with 15 additional LacNAc units on the precursor, which was seen as a series of sequential ion peaks representing alternative additions of GlcNAc and Gal residues, on matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis. Overall, our data demonstrate a broader substrate specificity for the H. pylori β3GlcNAcT than previously recognized and demonstrate its ability as a potent resource for preparative chemo-enzymatic synthesis of complex glycans. PMID:22786570
Woodall, L D; Russell, P W; Harris, S L; Orndorff, P E
1993-01-01
Type 1 pili are filamentous proteinaceous appendages produced by certain members of the family Enterobacteriaceae. In Escherichia coli, the adhesive properties of these pili are due to the binding of at least one minor pilus component to mannose, a sugar common to cell surface molecules of many eukaryotic cells. The study of pilus assembly may be benefited by a rapid way of inducing pilus synthesis de novo. We describe herein the construction and characterization of a strain in which piliation can be rapidly induced by the addition of lactose or its analog isopropyl-beta-D-thiogalactopyranoside. This was accomplished by placing the chromosomal fimA gene (encoding the major structural subunit of pili) under lacUV5 promoter control. Further experiments suggested that transcription of genes downstream of fimA, whose products are required for normal pilus assembly and function, may also be controlled by the lacUV5 promoter. The construction described herein may have a variety of applications apart from aiding the study of pilus assembly since its adhesive properties can be rapidly and easily turned on and off. Images PMID:8097517
EGRET observations of the BL Lacertae objects 0716+714 and 0521-365
NASA Technical Reports Server (NTRS)
Lin, Y. C.; Bertsch, D. L.; Dingus, B. L.; Esposito, J. A.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Mayer-Hasselwander, H. A.
1995-01-01
During the Compton Observatory's viewing programs Phase 1 (1991 April to 1992 November, also known as the All-Sky Survey) and Phase 2 (1992 November to 1993 September), the BL Lac object 0716+714 was in the field of view of the EGRET telescope a total of six times, three times in Phase 1 and three more times in Phase 2, while the BL Lac object 0521-365 was in the field of view of EGRET only once in Phase 1. The source 0716+714 was detected in high-energy gamma rays by EGRET at a flux level of (2.0 +/- 0.4) x 10(exp -7) photons/sq cm/s for E greater than 100 MeV with a 6 sigma significance when it was first observed by EGRET in 1992 January 10 to 23. The corresponding spectral slope of the photon number distribution is determined to be -2.04 +/- 0.33. The gamma-ray flux of 0716+714 showed considerable time variability in subsequent EGRET observations. But the spectral slope stayed about the same within the statistical uncertainties of the EGRET data. The average spectral slope of the four viewing periods during which the photon flux of 0716+714 stayed above the EGRET detection threshold is found to be -1.85 +/- 0.20 from the combined data. The source 0521+365 was detected by EGRET in 1992 May 14 to June 4 at a flux level of (1.8 +/- 0.5) x 10(exp -7) photons/sq cm/s for E greater than 100 MeV with a 4 sigma significance. The corresponding spectral slope of the photon number distribution is found to be 2.16 +/- 0.36. Details of the observations of these two BL Lac objects with the EGRET telescope are presented.
Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho
2017-09-15
Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Structure preserving clustering-object tracking via subgroup motion pattern segmentation
NASA Astrophysics Data System (ADS)
Fan, Zheyi; Zhu, Yixuan; Jiang, Jiao; Weng, Shuqin; Liu, Zhiwen
2018-01-01
Tracking clustering objects with similar appearances simultaneously in collective scenes is a challenging task in the field of collective motion analysis. Recent work on clustering-object tracking often suffers from poor tracking accuracy and terrible real-time performance due to the neglect or the misjudgment of the motion differences among objects. To address this problem, we propose a subgroup motion pattern segmentation framework based on a multilayer clustering structure and establish spatial constraints only among objects in the same subgroup, which entails having consistent motion direction and close spatial position. In addition, the subgroup segmentation results are updated dynamically because crowd motion patterns are changeable and affected by objects' destinations and scene structures. The spatial structure information combined with the appearance similarity information is used in the structure preserving object tracking framework to track objects. Extensive experiments conducted on several datasets containing multiple real-world crowd scenes validate the accuracy and the robustness of the presented algorithm for tracking objects in collective scenes.
NASA Technical Reports Server (NTRS)
Falomo, Renato; Pesce, Joseph E.; Treves, Aldo
1995-01-01
We report on direct, subarcsecond resolution imaging of the nebulosity and spectroscopy of galaxies in the field of the BL Lacertae object PKS 0548-322. Surface photometry of the nebulosity is used to derive the properties of the host galaxy (M(sub V) = -23.4), which exhibits signs of interaction with a close companion galaxy at approximately 25 kpc. The radial brightness profile of the nebulosity is well fitted by the contribution of a bulge (r(exp 1/4)) plus a point source and a small internal disk. An analysis of the galaxies in the field shows that the source is located in a rich cluster of galaxies. Spectra of five galaxies in the field indicate that they are at the same redshift as the BL Lac object, thus supporting the imaging result of a surrounding cluster associated with the BL Lac. This cluster is most likely Abell S0549.
Genotype to Phenotype Mapping of the E. coli lac Promoter
NASA Astrophysics Data System (ADS)
Otwinowski, Jakub; Nemenman, Ilya
2014-03-01
Genotype-to-phenotype maps and the related fitness landscapes that include epistatic interactions are difficult to measure because of their high dimensional structure. Here we construct such a map using the recently collected corpora of high-throughput sequence data from the 75 base pairs long mutagenized E. coli lac promoter region, where each sequence is associated with induced transcriptional activity measured by a fluorescent reporter. We find that the additive (non-epistatic) contributions of individual mutations account for about two-thirds of the explainable phenotype variance, while pairwise epistasis explains about 7% of the variance for the full mutagenized sequence and about 15% for the subsequence associated with protein binding sites. Surprisingly, there is no evidence for third order epistatic contributions, and our inferred fitness landscape is essentially single peaked, with a small amount of antagonistic epistasis. We identify transcription factor (CRP) and RNA polymerase binding sites in the promotor region and their interactions. We conclude with a cautionary note that inferred properties of fitness landscapes may be severely influenced by biases in the sequence data. Funded in part by HFSP and James S. McDonnell Foundation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Staedtler, F.; Locher, F.; Sreenan, G.
1997-10-01
In order to evaluate the in vivo genotoxic potential of three putative genotoxic mouse liver carcinogens, high doses of 4-chloro-o-phenylenediamine, 2-nitro-p-phenylenediamine and 2, 4-diaminotoluene were tested short term in the Big Blue{reg_sign} transgenic mouse mutation assay. Small statistically significant increases in the lacI mutant frequencies in the liver by factors 1.7 to 2.0 were found. A representative number of 347 lacI mutants isolated from liver tissue of male and female animals were analyses by DNA sequencing. The mutational spectra were examined with the Adams-Skopek algorithm. The spontaneous mutational spectra from untreated male and female animals were similar and consistent withmore » spectral Big Blue{reg_sign} control data stored in the lacI database. Most of the background mutations were located in the 5{prime} portion of the coding region of the lacI gene. Single base substitutions were most prominent. G:C to A:T transitions and G:C to T:A transversions occurred predominatly and were preferentially located at CpG sites. Despite the increases observed in the mutant frequencies of the treated animals, the corresponding mutational spectra did not differ from the controls. However, it is possible that certain classes of point mutations were substantially increased but not detected due to the limited number of sequenced mutants. In two animals treated with 2, 4- diaminotoluene unusually high mutant frequencies and the multiple occurrence of certain mutations in the liver was observed. From one of these animals six lacI mutants isolated from colon tissue were all different. Since 2, 4-diaminotoluene was shown to induce liver cell proliferation these results may reflect clonal expansion of single mutated liver cells.« less
Elliott, T
1992-01-01
This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.
Modeling Of Object- And Scene-Prototypes With Hierarchically Structured Classes
NASA Astrophysics Data System (ADS)
Ren, Z.; Jensch, P.; Ameling, W.
1989-03-01
The success of knowledge-based image analysis methodology and implementation tools depends largely on an appropriately and efficiently built model wherein the domain-specific context information about and the inherent structure of the observed image scene have been encoded. For identifying an object in an application environment a computer vision system needs to know firstly the description of the object to be found in an image or in an image sequence, secondly the corresponding relationships between object descriptions within the image sequence. This paper presents models of image objects scenes by means of hierarchically structured classes. Using the topovisual formalism of graph and higraph, we are currently studying principally the relational aspect and data abstraction of the modeling in order to visualize the structural nature resident in image objects and scenes, and to formalize. their descriptions. The goal is to expose the structure of image scene and the correspondence of image objects in the low level image interpretation. process. The object-based system design approach has been applied to build the model base. We utilize the object-oriented programming language C + + for designing, testing and implementing the abstracted entity classes and the operation structures which have been modeled topovisually. The reference images used for modeling prototypes of objects and scenes are from industrial environments as'well as medical applications.
76 FR 78974 - Wisconsin Central Ltd.-Abandonment Exemption-in Fond Du Lac County, WI
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-20
... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 303 (Sub-No. 38X)] Wisconsin Central Ltd.--Abandonment Exemption--in Fond Du Lac County, WI Wisconsin Central Ltd. (WCL) \\1\\ filed a verified notice of exemption under 49 CFR pt. 1152 subpart F--Exempt Abandonments to abandon...
NASA Technical Reports Server (NTRS)
Worrall, Diana M.
1994-01-01
This report summarizes the activities related to two ROSAT investigations: (1) x-ray properties of radio galaxies thought to contain BL Lac type nuclei; and (2) x-ray spectra of a complete sample of flat-spectrum radio sources. The following papers describing the research are provided as attachments: Multiple X-ray Emission Components in Low Power Radio Galaxies; New X-ray Results on Radio Galaxies; Analysis Techniques for a Multiwavelength Study of Radio Galaxies; Separation of X-ray Emission Components in Radio Galaxies; X-ray Emission in Powerful Radio Galaxies and Quasars; Extended and Compact X-ray Emission in Powerful Radio Galaxies; and X-ray Spectra of a Complete Sample of Extragalactic Core-dominated Radio Sources.
Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T
2015-09-01
To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
MAGIC detection of short-term variability of the high-peaked BL Lac object 1ES 0806+524
Aleksi , J.; Ansoldi, S.; Antonelli, L. A.; ...
2015-05-29
The high-frequency-peaked BL Lac (HBL) 1ES 0806+524 (z = 0.138) was discovered in very high energy (VHE) γ-rays in 2008. Until now, the broad-band spectrum of 1ES 0806+524 has been only poorly characterized, in particular at high energies. In this paper, we analysed multiwavelength observations from γ-rays to radio performed from 2011 January to March, which were triggered by the high activity detected at optical frequencies. These observations constitute the most precise determination of the broad-band emission of 1ES 0806+524 to date. The stereoscopic Major Atmospheric Gamma-Ray Imaging Cherenkov (MAGIC) observations yielded a γ-ray signal above 250 GeV of (3.7more » ± 0.7) per cent of the Crab Nebula flux with a statistical significance of 9.9σ. The multiwavelength observations showed significant variability in essentially all energy bands, including a VHE γ-ray flare that lasted less than one night, which provided unprecedented evidence for short-term variability in 1ES 0806+524. The spectrum of this flare is well described by a power law with a photon index of 2.97 ± 0.29 between ~150 GeV and 1 TeV and an integral flux of (9.3 ± 1.9) per cent of the Crab nebula flux above 250 GeV. The spectrum during the non-flaring VHE activity is compatible with the only available VHE observation performed in 2008 with VERITAS when the source was in a low optical state. Lastly, the broad-band spectral energy distribution can be described with a one-zone synchrotron self-Compton model with parameters typical for HBLs, indicating that 1ES 0806+524 is not substantially different from the HBLs previously detected.« less
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
NPDES Permit – East Lake Sewage Lagoon – Mille Lacs Indian Reservation (Aitkin County, MN)
EPA proposes to reissue a NPDES permit for the treated wastewater discharges from the East Lake Sewage Lagoon located within the boundaries of the Mille Lacs Indian Reservation located in East Lake (McGregor), Minnesota (Aitkin County) to be issued by EPA.
The LAC Test: A New Look at Auditory Conceptualization and Literacy Development K-12.
ERIC Educational Resources Information Center
Lindamood, Charles; And Others
The Lindamood Auditory Conceptualization (LAC) Test was constructed with the recognition that the process of decoding involves an integration of the auditory, visual, and motor senses. Requiring the manipulation of colored blocks to indicate conceptualization of test patterns spoken by the examiner, subtest 1 entails coding of identity, number,…
Purriños, Laura; García Fontán, María C; Carballo, Javier; Lorenzo, José M
2013-05-01
The aim of this work was to study the yeast population during the manufacture of dry-cured "lacón" (a Spanish traditional meat product) and the effect of the salting time. For this study, six batches of "lacón" were manufactured with three different salting times (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). Yeast counts increased significantly (P < 0.001) during the whole process from 2.60 to 6.37 log cfu/g. An increased length of salting time did not affect yeast counts throughout the manufacture of dry-cured "lacón", although the highest yeast counts were obtained from LS batches. A total of 226 isolates were obtained from dry-cured "lacón" during drying-ripening stage, of which 151 were yeasts and were identified at the species level using molecular techniques. The total of 151 identified yeasts belonged to 4 different genera: Debaryomyces, Candida, Cryptococcus and Rhodotorula. Debaryomyces hansenii was the most abundant species isolated throughout the whole process as much in the interior as in the exterior of the pieces of three salt levels of "lacón" studied, while Candida zeylanoides was only isolated from the interior of MS and HS batches and from the exterior of LS and HS groups, but at lesser proportion than D. hansenii. Copyright © 2012. Published by Elsevier Ltd.
Drawing skill is related to the efficiency of encoding object structure.
Perdreau, Florian; Cavanagh, Patrick
2014-01-01
Accurate drawing calls on many skills beyond simple motor coordination. A good internal representation of the target object's structure is necessary to capture its proportion and shape in the drawing. Here, we assess two aspects of the perception of object structure and relate them to participants' drawing accuracy. First, we assessed drawing accuracy by computing the geometrical dissimilarity of their drawing to the target object. We then used two tasks to evaluate the efficiency of encoding object structure. First, to examine the rate of temporal encoding, we varied presentation duration of a possible versus impossible test object in the fovea using two different test sizes (8° and 28°). More skilled participants were faster at encoding an object's structure, but this difference was not affected by image size. A control experiment showed that participants skilled in drawing did not have a general advantage that might have explained their faster processing for object structure. Second, to measure the critical image size for accurate classification in the periphery, we varied image size with possible versus impossible object tests centered at two different eccentricities (3° and 8°). More skilled participants were able to categorise object structure at smaller sizes, and this advantage did not change with eccentricity. A control experiment showed that the result could not be attributed to differences in visual acuity, leaving attentional resolution as a possible explanation. Overall, we conclude that drawing accuracy is related to faster encoding of object structure and better access to crowded details.
Drawing skill is related to the efficiency of encoding object structure
Perdreau, Florian; Cavanagh, Patrick
2014-01-01
Accurate drawing calls on many skills beyond simple motor coordination. A good internal representation of the target object's structure is necessary to capture its proportion and shape in the drawing. Here, we assess two aspects of the perception of object structure and relate them to participants' drawing accuracy. First, we assessed drawing accuracy by computing the geometrical dissimilarity of their drawing to the target object. We then used two tasks to evaluate the efficiency of encoding object structure. First, to examine the rate of temporal encoding, we varied presentation duration of a possible versus impossible test object in the fovea using two different test sizes (8° and 28°). More skilled participants were faster at encoding an object's structure, but this difference was not affected by image size. A control experiment showed that participants skilled in drawing did not have a general advantage that might have explained their faster processing for object structure. Second, to measure the critical image size for accurate classification in the periphery, we varied image size with possible versus impossible object tests centered at two different eccentricities (3° and 8°). More skilled participants were able to categorise object structure at smaller sizes, and this advantage did not change with eccentricity. A control experiment showed that the result could not be attributed to differences in visual acuity, leaving attentional resolution as a possible explanation. Overall, we conclude that drawing accuracy is related to faster encoding of object structure and better access to crowded details. PMID:25469216
NASA Astrophysics Data System (ADS)
Krawczynski, H.
2007-04-01
In this paper we discuss models of the X-ray and TeV γ-ray emission from BL Lac objects based on parallel electron-positron or electron-proton beams that form close to the central black hole, due to the strong electric fields generated by the accretion disk and possibly also by the black hole itself. Fitting the energy spectrum of the BL Lac object Mrk 501, we obtain tight constraints on the beam properties. Launching a sufficiently energetic beam requires rather strong magnetic fields close to the black hole (~100-1000 G). However, the model fits imply that the magnetic field in the emission region is only ~0.02 G. Thus, the particles are accelerated close to the black hole and propagate a considerable distance before instabilities trigger the dissipation of energy through synchrotron and self-Compton emission. We discuss various approaches to generate enough power to drive the jet and, at the same time, to accelerate particles to ~20 TeV energies. Although the parallel beam model has its own problems, it explains some of the long-standing problems that plague models based on Fermi-type particle acceleration, such as the presence of a very high minimum Lorentz factor of accelerated particles. We conclude with a brief discussion of the implications of the model for the difference between the processes of jet formation in BL Lac-type objects and those in quasars.
Different Measures of Structural Similarity Tap Different Aspects of Visual Object Processing
Gerlach, Christian
2017-01-01
The structural similarity of objects has been an important variable in explaining why some objects are easier to categorize at a superordinate level than to individuate, and also why some patients with brain injury have more difficulties in recognizing natural (structurally similar) objects than artifacts (structurally distinct objects). In spite of its merits as an explanatory variable, structural similarity is not a unitary construct, and it has been operationalized in different ways. Furthermore, even though measures of structural similarity have been successful in explaining task and category-effects, this has been based more on implication than on direct empirical demonstrations. Here, the direct influence of two different measures of structural similarity, contour overlap and within-item structural diversity, on object individuation (object decision) and superordinate categorization performance is examined. Both measures can account for performance differences across objects, but in different conditions. It is argued that this reflects differences between the measures in whether they tap: (i) global or local shape characteristics, and (ii) between- or within-category structural similarity. PMID:28861027
Temporal Variation of HCO+ 1_0 Galactic Absorption Lines Toward NRAO 150 and BL Lac
NASA Astrophysics Data System (ADS)
Han, Junghwan; Yun, Youngjoo; Park, Yong-Sun
2017-12-01
We present observations of HCO^+ 1-0 absorption lines toward two extragalactic compact radio sources, NRAO 150 and BL Lac with the Korean VLBI Network in order to investigate their time variation over 20 years by Galactic foreground clouds. It is found that the line shape of -17 km s^{-1} component changed marginally during 1993-1998 period and has remained unaltered thereafter for NRAO 150. Its behavior is different from that of H_2CO 1_{10}-1_{11}, suggesting chemical differentiation on ˜ 20 AU scale, the smallest ever seen. On the other hand, BL Lac exhibits little temporal variation for the HCO^+ and H_2CO lines. Our observation also suggests that Korea VLBI Network performs reliably in the spectrum mode in that the shapes of the new HCO^+ 1-0 spectra are in good agreement with the previous ones to an accuracy of a few percent except the time varying component toward NRAO 150.
Li, Qiao; Hoffmann, Benjamin D.; Zhang, Wei
2014-01-01
This study investigated the effects of ant attendance on the parasitoid community and parasitism of lac insect Kerria yunnanensis aggregations in Yunnan province, China. We manipulated ant attendance to establish three treatments: (1) ant exclusion; (2) low ant attendance by several ant species; and (3) high ant attendance by Crematogaster macaoensis. Five parasitoid species were collected, with two species contributing 82.7 and 13.2% of total abundance respectively. Total parasitoid abundance was lowest in the February sample when K. yunnanensis was in its younger life stage, being significantly lower in the ant exclusion treatment. In April, all three treatments had significantly different parasitoid abundances, being highest in the ant exclusion treatment and the lowest in the high ant attendance treatment. When ants were present, there were strong negative relationships between total parasitoid abundance and ant abundance, with the relationships being dependent upon the ant species composition and abundance. The patterns of total parasitoid abundance were driven by the two most abundant parasitoid species. Parasitoid species richness did not differ among treatments or between sample times, however, multivariate analysis confirmed that overall parasitoid community structure differed significantly among treatments and between sample times, with the high ant attendance treatment differing most from the other two treatments. Interestingly the absence of ants did not result in increased parasitism from four of the five parasitoids. Ants in lac insect farming systems have a clear role for agricultural pest management. A full understanding of the asymmetric abilities of ants to influence parasitoid communities, and affect parasitism of hosts will require further experimental manipulation to assess the relative roles of 1) the abundance of each individual ant species on parasitoid access to hosts, 2) competition among parasitoids, and 3) the interaction between the
Multi-objective optimization of composite structures. A review
NASA Astrophysics Data System (ADS)
Teters, G. A.; Kregers, A. F.
1996-05-01
Studies performed on the optimization of composite structures by coworkers of the Institute of Polymers Mechanics of the Latvian Academy of Sciences in recent years are reviewed. The possibility of controlling the geometry and anisotropy of laminar composite structures will make it possible to design articles that best satisfy the requirements established for them. Conflicting requirements such as maximum bearing capacity, minimum weight and/or cost, prescribed thermal conductivity and thermal expansion, etc. usually exist for optimal design. This results in the multi-objective compromise optimization of structures. Numerical methods have been developed for solution of problems of multi-objective optimization of composite structures; parameters of the structure of the reinforcement and the geometry of the design are assigned as controlling parameters. Programs designed to run on personal computers have been compiled for multi-objective optimization of the properties of composite materials, plates, and shells. Solutions are obtained for both linear and nonlinear models. The programs make it possible to establish the Pareto compromise region and special multicriterial solutions. The problem of the multi-objective optimization of the elastic moduli of a spatially reinforced fiberglass with stochastic stiffness parameters has been solved. The region of permissible solutions and the Pareto region have been found for the elastic moduli. The dimensions of the scatter ellipse have been determined for a multidimensional Gaussian probability distribution where correlation between the composite's properties being optimized are accounted for. Two types of problems involving the optimization of a laminar rectangular composite plate are considered: the plate is considered elastic and anisotropic in the first case, and viscoelastic properties are accounted for in the second. The angle of reinforcement and the relative amount of fibers in the longitudinal direction are controlling
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-19
... Fredrichs, Assistant Division Administrator, Federal Highway Administration, Madison, Wisconsin. [FR Doc... capacity improvements to Wisconsin Highway 23 from U.S. Highway 151 to County Highway P in Fond du Lac and Sheboygan Counties, Wisconsin. FOR FURTHER INFORMATION CONTACT: Bethaney Bacher-Gresock, Environmental...
Reppa, Irene; Leek, E Charles
2003-06-01
Recently, Vecera, Behrmann, and McGoldrick (2000), using a divided-attention task, reported that targets are detected more accurately when they occur on the same structural part of an object, suggesting that attention can be directed toward object-internal features. We present converging evidence using the object-based inhibition of return (IOR) paradigm as an implicit measure of selection. The results show that IOR is attenuated when cues and targets appear on the same part of an object relative to when they are separated by a part boundary. These findings suggest that object-based mechanisms of selection can operate over shape representations that make explicit information about object-internal structure.
Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1
Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah
2002-01-01
Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346
Organizational and Spatial Dynamics of Attentional Focusing in Hierarchically Structured Objects
ERIC Educational Resources Information Center
Yeari, Menahem; Goldsmith, Morris
2011-01-01
Is the focusing of visual attention object-based, space-based, both, or neither? Attentional focusing latencies in hierarchically structured compound-letter objects were examined, orthogonally manipulating global size (larger vs. smaller) and organizational complexity (two-level structure vs. three-level structure). In a dynamic focusing task,…
Styles, J A; Davies, R; Fenwick, S; Walker, J; White, I N; Smith, L L
2001-01-10
Administration of tamoxifen (TAM) (20 mg/kg per day p.o.) for 6 weeks to female lambda/lacI transgenic rats caused a 4-fold increase in mutation frequency (MF) at the lacI gene locus in the livers of dosed animals compared with controls. After cessation of dosing, the MF showed a further increase with time at 2, 12 and 24 weeks, respectively. Phenobarbital promotion of similarly treated animals resulted in no increase in mutation frequency compared with TAM alone. Treatment with phenobarbital or TAM+phenobarbital resulted in time-dependent increases in liver weight compared with the corresponding controls. There was an increase in cell proliferation in the phenobarbital and TAM+phenobarbital groups, and at 24 weeks in the TAM dosed animals compared with controls. There was also a progressive increase in the number of GST-P expressing foci in the livers of TAM and TAM + phenobarbital rats compared with controls. The induction of cell proliferation and GSTP foci in the rat liver by phenobarbital is consistent with its ability to promote tamoxifen-initiated liver tumours in the rat. If the lacI gene is regarded as being representative of the rat genome in general (albeit that the gene is bacterial) the above observations suggest that promotion by tamoxifen confers selective advantage on mutated genes at loci that contribute to the tumour phenotype and that promotion of rat liver tumours by tamoxifen is not dependent simply upon the enhancement of cellular proliferation.
Object-oriented structures supporting remote sensing databases
NASA Technical Reports Server (NTRS)
Wichmann, Keith; Cromp, Robert F.
1995-01-01
Object-oriented databases show promise for modeling the complex interrelationships pervasive in scientific domains. To examine the utility of this approach, we have developed an Intelligent Information Fusion System based on this technology, and applied it to the problem of managing an active repository of remotely-sensed satellite scenes. The design and implementation of the system is compared and contrasted with conventional relational database techniques, followed by a presentation of the underlying object-oriented data structures used to enable fast indexing into the data holdings.
NASA Astrophysics Data System (ADS)
Brisson, Cathy; Boucher, Marie-Amélie; Latraverse, Marco
2014-05-01
This research focuses on the improvement of streamflow forecasts for two subcatchments in the Lac-St-Jean area, a northern part of the province of Quebec in Canada. Those two subcatchments, named Manouane and Passes-Dangereuses, are part of a bigger system, which comprises many reservoirs and six hydropower plants. This system is managed by Rio Tinto Alcan, an aluminium producer who needs this energy for its processes. Optimal management of the hydropower plants highly depends on the reliability of the inflow forecasts to the reservoirs and also on the reliability of observed streamflow. The latter are not directly measured, but rather deduced from the computation of a water balance. This water balance includes streamflow computation based on rating curves for river sections and upstream reservoirs and a modelling process using CEQUEAU hydrological model (Morin et al., 1981). In addition, mostly during the winter, the model has to account for a transfer of water from Lac Manouane reservoir to Passes-Dangereuses through Bonnard channel. Winter flow though Bonnard channel is controlled by a spillway, and represented in CEQUEAU by a transfer function and a fixed time delay (2 days). However, it is suspected that the evacuation function, as it is currently computed, is inaccurate. The main objective of this work is to reduce predictive uncertainty for Lac Manouane and Passes-Dangereuses catchment, for the one-day ahead horizon. This objective is twofold. First, the uncertainty related to the parameterization of the hydrological model had never been evaluated. It was to be investigated whether it is better to spatialize the calibration of the hydrological model. In its actual form, the calibration of the hydrological model CEQUEAU (Morin et al., 1981) is based exclusively on the downstream outflow. There is, however, intermediate streamflow measurements data available for an intermediate location. Our study shows that calibrating the model using streamflows for both
Analysis of LAC Observations of Clusters of Galaxies and Supernova Remnants
NASA Technical Reports Server (NTRS)
Hughes, J.
1996-01-01
The following publications are included and serve as the final report: The X-ray Spectrum of Abell 665; Clusters of Galaxies; Ginga Observation of an Oxygen-rich Supernova Remnant; Ginga Observations of the Coma Cluster and Studies of the Spatial Distribution of Iron; A Measurement of the Hubble Constant from the X-ray Properties and the Sunyaev-Zel'dovich Effect of Abell 2218; Non-polytropic Model for the Coma Cluster; and Abundance Gradients in Cooling Flow Clusters: Ginga LAC (Large Area Counter) and Einstein SSS (Solid State Spectrometer) Spectra of A496, A1795, A2142, and A2199.
Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.
Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong
2018-04-01
Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.
PKS 2155-304 relativistically beamed synchrotron radiation from BL LAC object
NASA Technical Reports Server (NTRS)
Urry, C. M.; Mushotzky, R. F.
1981-01-01
The newly discovered BL Lacertae object, PKS 2155-304, was observed with the medium and high intensity energy detectors of the HEAO-1 A2 experiment. The variability by a factor of two in less than a day reported by Snyder, et al (1979) is confirmed. Two spectra, obtained a year apart, while the satellite was in scanning mode, are well fit by simple power laws with energy spectral index alpha sub 1 equals approximately 1.4. A third spectrum, of higher statistical quality, obtained while the satellite was pointed at its source, has has two components. An acceptable fit was obtained using a two power law model, with indices alpha sub 1 equals 2.0 (+1.2, -0.6) and alpha sub 2 equals -1.5 (+1.5, -2.3). An interpretation of the overall spectrum from radio through X-rays in terms of a synchrotron self-Compton model gives a good description of the data if allowance is made for relativistic beaming. Thus, from a consideration of the spectrum, combined with an estimate of the size of the source, the presence of jets is inferred without their observation.
Object Recognition and Random Image Structure Evolution
ERIC Educational Resources Information Center
Sadr, Jvid; Sinha, Pawan
2004-01-01
We present a technique called Random Image Structure Evolution (RISE) for use in experimental investigations of high-level visual perception. Potential applications of RISE include the quantitative measurement of perceptual hysteresis and priming, the study of the neural substrates of object perception, and the assessment and detection of subtle…
ERIC Educational Resources Information Center
Volkan, Kevin; Simon, Steven R.; Baker, Harley; Todres, I. David
2004-01-01
Problem Statement and Background: While the psychometric properties of Objective Structured Clinical Examinations (OSCEs) have been studied, their latent structures have not been well characterized. This study examines a factor analytic model of a comprehensive OSCE and addresses implications for measurement of clinical performance. Methods: An…
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Bistable Behavior of the Lac Operon in E. Coli When Induced with a Mixture of Lactose and TMG
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions. PMID:21423364
Discovery of VHE γ -ray emission from the BL Lacertae object B3 2247+381 with the MAGIC telescopes
Aleksić, J.; Alvarez, E. A.; Antonelli, L. A.; ...
2012-03-02
Here, we study the non-thermal jet emission of the BL Lac object B3 2247+381 during a high optical state. The MAGIC telescopes observed the source during 13 nights between September 30th and October 30th 2010, collecting a total of 14.2 h of good quality very high energy (VHE) γ-ray data. Simultaneous multiwavelength data was obtained with X-ray observations by the Swift satellite and optical R-band observations at the KVA-telescope. We also use high energy γ-ray (HE, 0.1-100 GeV) data from the Fermi satellite. We also dedected the BL Lac object B3 2247+381 (z = 0.119) , for the first time,more » at VHE γ-rays at a statistical significance of 5.6σ. A soft VHE spectrum with a photon index of -3.2 ± 0.6 was determined. No significant short term flux variations were found. Finally, we model the spectral energy distribution using a one-zone SSC-model, which can successfully describe our data.« less
Combining 3D structure of real video and synthetic objects
NASA Astrophysics Data System (ADS)
Kim, Man-Bae; Song, Mun-Sup; Kim, Do-Kyoon
1998-04-01
This paper presents a new approach of combining real video and synthetic objects. The purpose of this work is to use the proposed technology in the fields of advanced animation, virtual reality, games, and so forth. Computer graphics has been used in the fields previously mentioned. Recently, some applications have added real video to graphic scenes for the purpose of augmenting the realism that the computer graphics lacks in. This approach called augmented or mixed reality can produce more realistic environment that the entire use of computer graphics. Our approach differs from the virtual reality and augmented reality in the manner that computer- generated graphic objects are combined to 3D structure extracted from monocular image sequences. The extraction of the 3D structure requires the estimation of 3D depth followed by the construction of a height map. Graphic objects are then combined to the height map. The realization of our proposed approach is carried out in the following steps: (1) We derive 3D structure from test image sequences. The extraction of the 3D structure requires the estimation of depth and the construction of a height map. Due to the contents of the test sequence, the height map represents the 3D structure. (2) The height map is modeled by Delaunay triangulation or Bezier surface and each planar surface is texture-mapped. (3) Finally, graphic objects are combined to the height map. Because 3D structure of the height map is already known, Step (3) is easily manipulated. Following this procedure, we produced an animation video demonstrating the combination of the 3D structure and graphic models. Users can navigate the realistic 3D world whose associated image is rendered on the display monitor.
A rudimentary database for three-dimensional objects using structural representation
NASA Technical Reports Server (NTRS)
Sowers, James P.
1987-01-01
A database which enables users to store and share the description of three-dimensional objects in a research environment is presented. The main objective of the design is to make it a compact structure that holds sufficient information to reconstruct the object. The database design is based on an object representation scheme which is information preserving, reasonably efficient, and yet economical in terms of the storage requirement. The determination of the needed data for the reconstruction process is guided by the belief that it is faster to do simple computations to generate needed data/information for construction than to retrieve everything from memory. Some recent techniques of three-dimensional representation that influenced the design of the database are discussed. The schema for the database and the structural definition used to define an object are given. The user manual for the software developed to create and maintain the contents of the database is included.
A gene expression resource generated by genome-wide lacZ profiling in the mouse
Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.
2015-01-01
ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943
Structure and method for controlling the thermal emissivity of a radiating object
DeSteese, John G.; Antoniak, Zenen I.; White, Michael; Peters, Timothy J.
2004-03-30
A structure and method for changing or controlling the thermal emissivity of the surface of an object in situ, and thus, changing or controlling the radiative heat transfer between the object and its environment in situ, is disclosed. Changing or controlling the degree of blackbody behavior of the object is accomplished by changing or controlling certain physical characteristics of a cavity structure on the surface of the object. The cavity structure, defining a plurality of cavities, may be formed by selectively removing material(s) from the surface, selectively adding a material(s) to the surface, or adding an engineered article(s) to the surface to form a new radiative surface. The physical characteristics of the cavity structure that are changed or controlled include cavity area aspect ratio, cavity longitudinal axis orientation, and combinations thereof. Controlling the cavity area aspect ratio may be by controlling the size of the cavity surface area, the size of the cavity aperture area, or a combination thereof. The cavity structure may contain a gas, liquid, or solid that further enhances radiative heat transfer control and/or improves other properties of the object while in service.
Limits of acceptable change and natural resources planning: when is LAC useful, when is it not?
David N. Cole; Stephen F. McCool
1997-01-01
There are ways to improve the LAC process and its implementational procedures. One significant procedural modification is the addition of a new step. This step â which becomes the first step in the process â involves more explicitly defining goals and desired conditions. For other steps in the process, clarifications of concept and terminology are advanced, as are...
Purriños, Laura; Bermúdez, Roberto; Franco, Daniel; Carballo, Javier; Lorenzo, José M
2011-01-01
Volatile compounds were determined throughout the manufacture of dry-cured "lacón," a traditional dry-salted, and ripened meat product made in the north-west of Spain from the foreleg of the pig following a similar process to that of dry-cured ham. Volatiles were extracted by a purge-and-trap method and analyzed by gas chromatographic/mass spectrometry. One hundred and two volatile compounds were identified. In raw material, only 34 volatile compounds were found and at very low levels. The number of volatile compounds increased during processing. The substances identified belonged to several chemical classes: aldehydes (23), alcohols (9), ketones (15), hydrocarbons (37), esters (4), acids (3), furans (4), sulphur compounds (1), chloride compounds (1), and other compounds (4). Results indicated that the most abundant chemical family in flavor at the end of the manufacturing process was aldehydes, followed by hydrocarbons and ketones. Lipids were the most important precursor of flavor compounds of dry-cured "lacón."
Chemical Compositions of RV Tauri Stars and Related Objects
NASA Astrophysics Data System (ADS)
Rao, S. S.; Giridhar, S.
2014-04-01
We have undertaken a comprehensive abundance analysis for a sample of relatively unexplored RV Tauri and RV Tauri like stars to further our understanding of post-Asymptotic Giant Branch (post-AGB) evolution. From our study based on high resolution spectra and a grid of model atmospheres, we find indications of mild s-processing for V820 Cen and IRAS 06165+3158. On the other hand, SU Gem and BT Lac exhibit the effects of mild dust-gas winnowing. We have also compiled the existing abundance data on RV Tauri objects and find that a large fraction of them are afflicted by dust-gas winnowing and aided by the present work, we find a small group of two RV Tauris showing mild s-process enhancement in our Galaxy. With two out of three reported s-process enhanced objects belonging to RV Tauri spectroscopic class C, these intrinsically metal-poor objects appear to be promising candidates to analyse the possible s-processing in RV Tauri stars.
Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.
2017-01-01
M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507
Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons
2017-01-01
M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.
Intelligent Local Avoided Collision (iLAC) MAC Protocol for Very High Speed Wireless Network
NASA Astrophysics Data System (ADS)
Hieu, Dinh Chi; Masuda, Akeo; Rabarijaona, Verotiana Hanitriniala; Shimamoto, Shigeru
Future wireless communication systems aim at very high data rates. As the medium access control (MAC) protocol plays the central role in determining the overall performance of the wireless system, designing a suitable MAC protocol is critical to fully exploit the benefit of high speed transmission that the physical layer (PHY) offers. In the latest 802.11n standard [2], the problem of long overhead has been addressed adequately but the issue of excessive colliding transmissions, especially in congested situation, remains untouched. The procedure of setting the backoff value is the heart of the 802.11 distributed coordination function (DCF) to avoid collision in which each station makes its own decision on how to avoid collision in the next transmission. However, collision avoidance is a problem that can not be solved by a single station. In this paper, we introduce a new MAC protocol called Intelligent Local Avoided Collision (iLAC) that redefines individual rationality in choosing the backoff counter value to avoid a colliding transmission. The distinguishing feature of iLAC is that it fundamentally changes this decision making process from collision avoidance to collaborative collision prevention. As a result, stations can avoid colliding transmissions with much greater precision. Analytical solution confirms the validity of this proposal and simulation results show that the proposed algorithm outperforms the conventional algorithms by a large margin.
Data-Driven Hierarchical Structure Kernel for Multiscale Part-Based Object Recognition
Wang, Botao; Xiong, Hongkai; Jiang, Xiaoqian; Zheng, Yuan F.
2017-01-01
Detecting generic object categories in images and videos are a fundamental issue in computer vision. However, it faces the challenges from inter and intraclass diversity, as well as distortions caused by viewpoints, poses, deformations, and so on. To solve object variations, this paper constructs a structure kernel and proposes a multiscale part-based model incorporating the discriminative power of kernels. The structure kernel would measure the resemblance of part-based objects in three aspects: 1) the global similarity term to measure the resemblance of the global visual appearance of relevant objects; 2) the part similarity term to measure the resemblance of the visual appearance of distinctive parts; and 3) the spatial similarity term to measure the resemblance of the spatial layout of parts. In essence, the deformation of parts in the structure kernel is penalized in a multiscale space with respect to horizontal displacement, vertical displacement, and scale difference. Part similarities are combined with different weights, which are optimized efficiently to maximize the intraclass similarities and minimize the interclass similarities by the normalized stochastic gradient ascent algorithm. In addition, the parameters of the structure kernel are learned during the training process with regard to the distribution of the data in a more discriminative way. With flexible part sizes on scale and displacement, it can be more robust to the intraclass variations, poses, and viewpoints. Theoretical analysis and experimental evaluations demonstrate that the proposed multiscale part-based representation model with structure kernel exhibits accurate and robust performance, and outperforms state-of-the-art object classification approaches. PMID:24808345
Chandrasekaran, E V; Xue, Jun; Xia, Jie; Khaja, Siraj D; Piskorz, Conrad F; Locke, Robert D; Neelamegham, Sriram; Matta, Khushi L
2016-10-01
Plant lectins through their multivalent quaternary structures bind intrinsically flexible oligosaccharides. They recognize fine structural differences in carbohydrates and interact with different sequences in mucin core 2 or complex-type N-glycan chain and also in healthy and malignant tissues. They are used in characterizing cellular and extracellular glycoconjugates modified in pathological processes. We study here, the complex carbohydrate-lectin interactions by determining the effects of substituents in mucin core 2 tetrasaccharide Galβ1-4GlcNAcβ1-6(Galβ1-3)GalNAcα-O-R and fetuin glycopeptides on their binding to agarose-immobilized lectins PNA, RCA-I, SNA-I and WGA. Briefly, in mucin core 2 tetrasaccharide (i) structures modified by α2-3/6-Sialyl LacNAc, LewisX and α1-3-Galactosyl LacNAc resulted in regular binding to PNA whereas compounds with 6-sulfo LacNAc displayed no-binding; (ii) strucures bearing α2-6-sialyl 6-sulfo LacNAc, or 6-sialyl LacdiNAc carbohydrates displayed strong binding to SNA-I; (iii) structures with α2-3/6-sialyl, α1-3Gal LacNAc or LewisX were non-binder to RCA-I and compounds with 6-sulfo LacNAc only displayed weak binding; (iv) structures containing LewisX, 6-Sulfo LewisX, α2-3/6-sialyl LacNAc, α2-3/6-sialyl 6-sulfo LacNAc and GalNAc Lewis-a were non-binding to WGA, those with α1-2Fucosyl, α1-3-Galactosyl LacNAc, α2-3-sialyl T-hapten plus 3'/6'sulfo LacNAc displayed weak binding, and compounds with α2-3-sialyl T-hapten, α2.6-Sialyl LacdiNAc, α2-3-sialyl D-Fucβ1-3 GalNAc and Fucα-1-2 D-Fucβ-1-3GalNAc displaying regular binding and GalNAc LewisX and LacdiNAc plus D-Fuc β-1-3 GalNAcα resulting in tight binding. RCA-I binds Fetuin triantennary asialoglycopeptide 100 % after α-2-3 and 25 % after α-2-6 sialylation, 30 % after α-1-2 and 100 % after α-1-3 fucosylation, and 50 % after α-1-3 galactosylation. WGA binds 3-but not 6-Fucosyl chitobiose core. Thus, information on the influence of complex carbohydrate
Expedite random structure searching using objects from Wyckoff positions
NASA Astrophysics Data System (ADS)
Wang, Shu-Wei; Hsing, Cheng-Rong; Wei, Ching-Ming
2018-02-01
Random structure searching has been proved to be a powerful approach to search and find the global minimum and the metastable structures. A true random sampling is in principle needed yet it would be highly time-consuming and/or practically impossible to find the global minimum for the complicated systems in their high-dimensional configuration space. Thus the implementations of reasonable constraints, such as adopting system symmetries to reduce the independent dimension in structural space and/or imposing chemical information to reach and relax into low-energy regions, are the most essential issues in the approach. In this paper, we propose the concept of "object" which is either an atom or composed of a set of atoms (such as molecules or carbonates) carrying a symmetry defined by one of the Wyckoff positions of space group and through this process it allows the searching of global minimum for a complicated system to be confined in a greatly reduced structural space and becomes accessible in practice. We examined several representative materials, including Cd3As2 crystal, solid methanol, high-pressure carbonates (FeCO3), and Si(111)-7 × 7 reconstructed surface, to demonstrate the power and the advantages of using "object" concept in random structure searching.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-17
... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R3-R-2012-N259; FXRS1265030000-134-FF03R06000] Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive... significant impact (FONSI) for the environmental assessment (EA) for Big Stone National Wildlife Refuge...
Objective, Structured Proforma to Score the Merit of Scientific Presentations.
Agarwal, Nayan; Thawani, Rajat; Gupta, Setu; Sharma, Arun; Dhaliwal, Upreet
2015-12-01
Around 100,000 medical conferences are organized all over the world and hence, they form an integral part of a medical professional's life. Oral presentations, especially award sessions, are judged by a panel of faculty judges who score individual presentations on various aspects including content, delivery and submission. Our objective was to compare the scores given by student-judges and faculty-judges for scientific presentations using the standardized score sheet. An objective, structured score-sheet was designed using existing literature. Five presentations, all made using PowerPoint, were judged using the structured score-sheet by seven student-judges and two-faculty judges. The mean score of all the score-sheets (n = 45) was 38.5 + 5.4 (out of a maximum score of 50). There was no statistical difference between mean scores assigned by students or faculty (p = 0.2). Thus, an objective, structured score sheet like ours, when used to judge scientific presentations, gave uniform results even when judges hailed from different levels of the medical hierarchy.
Method for preventing micromechanical structures from adhering to another object
Smith, James H.; Ricco, Antonio J.
1998-01-01
A method for preventing micromechanical structures from adhering to another object includes the step of immersing a micromechanical structure and its associated substrate in a chemical species that does not stick to itself. The method can be employed during the manufacture of micromechanical structures to prevent micromechanical parts from sticking or adhering to one another and their associated substrate surface.
Method for preventing micromechanical structures from adhering to another object
Smith, J.H.; Ricco, A.J.
1998-06-16
A method for preventing micromechanical structures from adhering to another object includes the step of immersing a micromechanical structure and its associated substrate in a chemical species that does not stick to itself. The method can be employed during the manufacture of micromechanical structures to prevent micromechanical parts from sticking or adhering to one another and their associated substrate surface. 3 figs.
Systems and methods for estimating the structure and motion of an object
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dani, Ashwin P; Dixon, Warren
2015-11-03
In one embodiment, the structure and motion of a stationary object are determined using two images and a linear velocity and linear acceleration of a camera. In another embodiment, the structure and motion of a stationary or moving object are determined using an image and linear and angular velocities of a camera.
NASA Technical Reports Server (NTRS)
Madejski, Greg
1994-01-01
We report the soft X-ray spectrum of BL Lac object AO 0235+164, observed with the Einstein Observatory Imaging Proportional Counter (IPC). This object (z = 0.94) has an intervening galaxy (or a protogalactic disk) at z = 0.524 present in the line of sight, producing both radio and optical absorption lines in the background BL Lac continuum. The X-ray spectrum exhibits a substantial soft X-ray cutoff, corresponding to several times that expected from our own Galaxy; we interpret that excess cutoff as due to the intervening galaxy. The comparison of the hydrogen column density inferred from the 21 cm radio data and the X-ray absorption allows, in principle, the determination of the elemental abundances in the intervening galaxy. However, the uncertainties in both the H I spin temperature and X-ray spectral parameters only loosely restrict these abundances to be 2 +/- 1 solar, which even at the lower limit appears higher than that inferred from studies of samples of optical absoprtion-line systems.
Item Dependency in an Objective Structured Clinical Examination
ERIC Educational Resources Information Center
Iramaneerat, Cherdsak; Myford, Carol M.; Yudkowsky, Rachel
2006-01-01
An Objective Structured Clinical Examination (OSCE) is an assessment approach employed in medical education, in which residents rotate through multiple stations of standardized clinical tasks to evaluate their clinical competence. Because items used to evaluate residents' performance in each OSCE station are linked to the same task and are rated…
Significance of Objective Structured Clinical Examinations to Plastic Surgery Residency Training.
Simmons, Brian J; Zoghbi, Yasmina; Askari, Morad; Birnbach, David J; Shekhter, Ilya; Thaller, Seth R
2017-09-01
Objective structured clinical examinations (OSCEs) have proven to be a powerful tool. They possess more than a 30-year track record in assessing the competency of medical students, residents, and fellows. Objective structured clinical examinations have been used successfully in a variety of medical specialties, including surgery. They have recently found their way into the subspecialty of plastic surgery. This article uses a systematic review of the available literature on OSCEs and their recent use in plastic surgery. It incorporates survey results assessing program directors' views on the use of OSCEs. Approximately 40% of programs surveyed use OSCEs to assess the Accreditation Council for Graduate Medical Education core competencies. We found that 40% use OSCEs to evaluate specific plastic surgery milestones. Objective structured clinical examinations are usually performed annually. They cost anywhere between $100 and more than $1000 per resident. Four milestones giving residents the most difficulties on OSCEs were congenital anomalies, noncancer breast surgery, breast reconstruction, and practice-based learning and improvement. It was determined that challenges with milestones were due to lack of adequate general knowledge and surgical ward patient care, as well as deficits in professionalism and system-based problems. Programs were able to remediate weakness found by OSCEs using a variety of methods. Objective structured clinical examinations offer a unique tool to objectively assess the proficiency of residents in key areas of the Accreditation Council for Graduate Medical Education core competencies. In addition, they can be used to assess the specific milestones that plastic surgery residents must meet. This allows programs to identify and improve identified areas of weakness.
Structured Kernel Dictionary Learning with Correlation Constraint for Object Recognition.
Wang, Zhengjue; Wang, Yinghua; Liu, Hongwei; Zhang, Hao
2017-06-21
In this paper, we propose a new discriminative non-linear dictionary learning approach, called correlation constrained structured kernel KSVD, for object recognition. The objective function for dictionary learning contains a reconstructive term and a discriminative term. In the reconstructive term, signals are implicitly non-linearly mapped into a space, where a structured kernel dictionary, each sub-dictionary of which lies in the span of the mapped signals from the corresponding class, is established. In the discriminative term, by analyzing the classification mechanism, the correlation constraint is proposed in kernel form, constraining the correlations between different discriminative codes, and restricting the coefficient vectors to be transformed into a feature space, where the features are highly correlated inner-class and nearly independent between-classes. The objective function is optimized by the proposed structured kernel KSVD. During the classification stage, the specific form of the discriminative feature is needless to be known, while the inner product of the discriminative feature with kernel matrix embedded is available, and is suitable for a linear SVM classifier. Experimental results demonstrate that the proposed approach outperforms many state-of-the-art dictionary learning approaches for face, scene and synthetic aperture radar (SAR) vehicle target recognition.
Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T
2011-06-01
Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.
Lorenzo, José M; Franco, Daniel; Carballo, Javier
2014-01-01
The effect of the finishing diet on the volatile compounds throughout the manufacture of dry-cured "lacón" (a Spanish traditional meat product), from the Celta pig breed was studied. Thirty-six pigs were separated into three groups according to the type of feeding during the finish-fattening period of three months (concentrate, mixed diet and chestnut). From the pigs of each diet, four batches of dry-cured "lacón" were manufactured. From each batch, samples of fresh meat, meat after salting, after post-salting, and after 14, 28, 56 and 84 days of drying-ripening were taken. Volatiles were extracted by a purge-and-trap method and analyzed by gas chromatographic/mass spectrometry (GC/MS). Seventy-six volatile compounds were identified and quantified from dry-cured "lacón" samples in pigs finished with chestnut, eighty-two for concentrate fed pigs and eighty in pigs fed with the mixed diet. The number of identified volatile compounds increased during the manufacturing process; at 84 days of drying-ripening, in the dry-cured "lacón" samples from pigs finished with concentrate, mixed diet and chestnut, 54, 58 and 62 volatile compounds were detected, respectively. The most abundant group of flavour compounds at the end of the manufacturing process was hydrocarbons in the three feeding systems, followed by aldehydes, ketones and alcohols. Discriminant analysis selected six variables (dodecane, butadienol, pentenol, 2-pentenal, decen-3-ona and pyridine-2-methyl) and calculated two discriminating functions which allowed verification of chestnut in the finishing diet. © 2013.
Balani, Prashant N; Ng, Wai Kiong; Tan, Reginald B H; Chan, Sui Yung
2010-05-01
The feasibility of using excipients to suppress the amorphization or structural disorder of crystalline salbutamol sulphate (SS) during milling was investigated. SS was subjected to ball-milling in the presence of alpha-lactose monohydrate (LAC), adipic acid (AA), magnesium stearate (MgSt), or polyvinyl pyrrolidone (PVP). X-ray powder diffraction, dynamic vapor sorption (DVS), high sensitivity differential scanning calorimetry (HSDSC) were used to analyze the crystallinity of the milled mixtures. Comilling with crystalline excipients, LAC, AA, and MgSt proved effective in reducing the amorphization of SS. LAC, AA, or MgSt acting as seed crystals to induce recrystallization of amorphous SS formed by milling. During comilling, both SS and LAC turned predominantly amorphous after 45 min but transformed back to a highly crystalline state after 60 min. Amorphous content was below the detection limits of DVS (0.5%) and HSDSC (5%). Comilled and physical mixtures of SS and ALM were stored under normal and elevated humidity conditions. This was found to prevent subsequent changes in crystallinity and morphology of comilled SS:LAC as compared to significant changes in milled SS and physical mixture. These results demonstrate a promising application of comilling with crystalline excipients in mitigating milling induced amorphization of pharmaceutical actives.
Object-Based Dense Matching Method for Maintaining Structure Characteristics of Linear Buildings
Yan, Yiming; Qiu, Mingjie; Zhao, Chunhui; Wang, Liguo
2018-01-01
In this paper, we proposed a novel object-based dense matching method specially for the high-precision disparity map of building objects in urban areas, which can maintain accurate object structure characteristics. The proposed framework mainly includes three stages. Firstly, an improved edge line extraction method is proposed for the edge segments to fit closely to building outlines. Secondly, a fusion method is proposed for the outlines under the constraint of straight lines, which can maintain the building structural attribute with parallel or vertical edges, which is very useful for the dense matching method. Finally, we proposed an edge constraint and outline compensation (ECAOC) dense matching method to maintain building object structural characteristics in the disparity map. In the proposed method, the improved edge lines are used to optimize matching search scope and matching template window, and the high-precision building outlines are used to compensate the shape feature of building objects. Our method can greatly increase the matching accuracy of building objects in urban areas, especially at building edges. For the outline extraction experiments, our fusion method verifies the superiority and robustness on panchromatic images of different satellites and different resolutions. For the dense matching experiments, our ECOAC method shows great advantages for matching accuracy of building objects in urban areas compared with three other methods. PMID:29596393
Structural damage detection-oriented multi-type sensor placement with multi-objective optimization
NASA Astrophysics Data System (ADS)
Lin, Jian-Fu; Xu, You-Lin; Law, Siu-Seong
2018-05-01
A structural damage detection-oriented multi-type sensor placement method with multi-objective optimization is developed in this study. The multi-type response covariance sensitivity-based damage detection method is first introduced. Two objective functions for optimal sensor placement are then introduced in terms of the response covariance sensitivity and the response independence. The multi-objective optimization problem is formed by using the two objective functions, and the non-dominated sorting genetic algorithm (NSGA)-II is adopted to find the solution for the optimal multi-type sensor placement to achieve the best structural damage detection. The proposed method is finally applied to a nine-bay three-dimensional frame structure. Numerical results show that the optimal multi-type sensor placement determined by the proposed method can avoid redundant sensors and provide satisfactory results for structural damage detection. The restriction on the number of each type of sensors in the optimization can reduce the searching space in the optimization to make the proposed method more effective. Moreover, how to select a most optimal sensor placement from the Pareto solutions via the utility function and the knee point method is demonstrated in the case study.
48 CFR 1815.404-471 - NASA structured approach for profit or fee objective.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false NASA structured approach for profit or fee objective. 1815.404-471 Section 1815.404-471 Federal Acquisition Regulations System... NEGOTIATION Contract Pricing 1815.404-471 NASA structured approach for profit or fee objective. ...
48 CFR 1815.404-471 - NASA structured approach for profit or fee objective.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false NASA structured approach for profit or fee objective. 1815.404-471 Section 1815.404-471 Federal Acquisition Regulations System... NEGOTIATION Contract Pricing 1815.404-471 NASA structured approach for profit or fee objective. ...
30 CFR 77.403 - Mobile equipment; falling object protective structures (FOPS).
Code of Federal Regulations, 2012 CFR
2012-07-01
... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Mobile equipment; falling object protective... AREAS OF UNDERGROUND COAL MINES Safeguards for Mechanical Equipment § 77.403 Mobile equipment; falling... underground coal mines shall be provided with substantial falling object protective structures (FOPS). FOPS...
30 CFR 77.403 - Mobile equipment; falling object protective structures (FOPS).
Code of Federal Regulations, 2014 CFR
2014-07-01
... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Mobile equipment; falling object protective... AREAS OF UNDERGROUND COAL MINES Safeguards for Mechanical Equipment § 77.403 Mobile equipment; falling... underground coal mines shall be provided with substantial falling object protective structures (FOPS). FOPS...
30 CFR 77.403 - Mobile equipment; falling object protective structures (FOPS).
Code of Federal Regulations, 2013 CFR
2013-07-01
... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Mobile equipment; falling object protective... AREAS OF UNDERGROUND COAL MINES Safeguards for Mechanical Equipment § 77.403 Mobile equipment; falling... underground coal mines shall be provided with substantial falling object protective structures (FOPS). FOPS...
Lemieux, M Joanne
2007-01-01
The major facilitator superfamily (MFS) of transporters represents the largest family of secondary active transporters and has a diverse range of substrates. With structural information for four MFS transporters, we can see a strong structural commonality suggesting, as predicted, a common architecture for MFS transporters. The rate for crystal structure determination of MFS transporters is slow, making modeling of both prokaryotic and eukaryotic transporters more enticing. In this review, models of eukaryotic transporters Glut1, G6PT, OCT1, OCT2 and Pho84, based on the crystal structures of the prokaryotic GlpT, based on the crystal structure of LacY are discussed. The techniques used to generate the different models are compared. In addition, the validity of these models and the strategy of using prokaryotic crystal structures to model eukaryotic proteins are discussed. For comparison, E. coli GlpT was modeled based on the E. coli LacY structure and compared to the crystal structure of GlpT demonstrating that experimental evidence is essential for accurate modeling of membrane proteins.
48 CFR 353.370-674 - Form HHS 674, Structured Approach Profit/Fee Objective.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Form HHS 674, Structured Approach Profit/Fee Objective. 353.370-674 Section 353.370-674 Federal Acquisition Regulations System..., Structured Approach Profit/Fee Objective. This form is available from local cost advisory personnel or PSC...
Response Interference between Functional and Structural Actions Linked to the Same Familiar Object
ERIC Educational Resources Information Center
Jax, Steven A.; Buxbaum, Laurel J.
2010-01-01
Viewing objects with the intention to act upon them may activate task-irrelevant motor responses. Many manufactured objects are associated with two action classes: grasping in accordance with object structure and skillful use consistent with object function. We studied the potential for within-object competition during action selection by…
Komori, Hirofumi; Miyazaki, Kentaro; Higuchi, Yoshiki
2009-04-02
A multi-copper protein with two cupredoxin-like domains was identified from our in-house metagenomic database. The recombinant protein, mgLAC, contained four copper ions/subunits, oxidized various phenolic and non-phenolic substrates, and had spectroscopic properties similar to common laccases. X-ray structure analysis revealed a homotrimeric architecture for this enzyme, which resembles nitrite reductase (NIR). However, a difference in copper coordination was found at the domain interface. mgLAC contains a T2/T3 tri-nuclear copper cluster at this site, whereas a mononuclear T2 copper occupies this position in NIR. The trimer is thus an essential part of the architecture of two-domain multi-copper proteins, and mgLAC may be an evolutionary precursor of NIR.
Objective identification of residue ranges for the superposition of protein structures
2011-01-01
Background The automation of objectively selecting amino acid residue ranges for structure superpositions is important for meaningful and consistent protein structure analyses. So far there is no widely-used standard for choosing these residue ranges for experimentally determined protein structures, where the manual selection of residue ranges or the use of suboptimal criteria remain commonplace. Results We present an automated and objective method for finding amino acid residue ranges for the superposition and analysis of protein structures, in particular for structure bundles resulting from NMR structure calculations. The method is implemented in an algorithm, CYRANGE, that yields, without protein-specific parameter adjustment, appropriate residue ranges in most commonly occurring situations, including low-precision structure bundles, multi-domain proteins, symmetric multimers, and protein complexes. Residue ranges are chosen to comprise as many residues of a protein domain that increasing their number would lead to a steep rise in the RMSD value. Residue ranges are determined by first clustering residues into domains based on the distance variance matrix, and then refining for each domain the initial choice of residues by excluding residues one by one until the relative decrease of the RMSD value becomes insignificant. A penalty for the opening of gaps favours contiguous residue ranges in order to obtain a result that is as simple as possible, but not simpler. Results are given for a set of 37 proteins and compared with those of commonly used protein structure validation packages. We also provide residue ranges for 6351 NMR structures in the Protein Data Bank. Conclusions The CYRANGE method is capable of automatically determining residue ranges for the superposition of protein structure bundles for a large variety of protein structures. The method correctly identifies ordered regions. Global structure superpositions based on the CYRANGE residue ranges allow a
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdel-Kareem, O.; Eltokhy, A.; Harith, M. A.
2011-09-22
This study aims to evaluate the use of Laser Fluorescent as a non-destructive technique for identification of natural dyes on archaeological textile objects. In this study wool textile samples were dyed with 10 natural dyes such as cochineal, cutch, henna, indigo, Lac, madder, safflower, saffron, sumac and turmeric. These dyes common present on archaeological textile objects to be used as standard dyed textile samples. These selected natural dyes will be used as known references that can be used a guide to identify unknown archaeological dyes. The dyed textile samples were investigated with laser radiation in different wavelengths to detect themore » best wavelengths for identification each dye. This study confirms that Laser Florescent is very useful and a rapid technique can be used as a non-destructive technique for identification of natural dyes on archaeological textile objects. The results obtained with this study can be a guide for all conservators in identification of natural organic dyes on archaeological textile objects.« less
NASA Astrophysics Data System (ADS)
Abdel-Kareem, O.; Eltokhy, A.; Harith, M. A.
2011-09-01
This study aims to evaluate the use of Laser Fluorescent as a non-destructive technique for identification of natural dyes on archaeological textile objects. In this study wool textile samples were dyed with 10 natural dyes such as cochineal, cutch, henna, indigo, Lac, madder, safflower, saffron, sumac and turmeric. These dyes common present on archaeological textile objects to be used as standard dyed textile samples. These selected natural dyes will be used as known references that can be used a guide to identify unknown archaeological dyes. The dyed textile samples were investigated with laser radiation in different wavelengths to detect the best wavelengths for identification each dye. This study confirms that Laser Florescent is very useful and a rapid technique can be used as a non-destructive technique for identification of natural dyes on archaeological textile objects. The results obtained with this study can be a guide for all conservators in identification of natural organic dyes on archaeological textile objects.
Evaluating an Objective Structured Clinical Examination (OSCE) Adapted for Social Work
ERIC Educational Resources Information Center
Bogo, Marion; Regehr, Cheryl; Katz, Ellen; Logie, Carmen; Tufford, Lea; Litvack, Andrea
2012-01-01
Objectives: To evaluate an objective structured clinical examination (OSCE) adapted for social work in a lab course and examine the degree to which it predicts competence in the practicum. Method: 125 Masters students participated in a one-scenario OSCE and wrote responses to standardized reflection questions. OSCE performance and reflections were…
Identifying and structuring the objectives of terrorists.
Keeney, Gregory L; Von Winterfeldt, Detlof
2010-12-01
The risk of terrorism is of great concern to many countries and significant resources are spent to counter this threat. A better understanding of the motivation of terrorists and their reasons for selecting certain modes and targets of attack can help improve the decisions to allocate resources in the fight against terrorism. The fundamental question addressed in this article is: "What do terrorists want?" We take the view that terrorists' preferences for actions are based on their values and beliefs. An important missing piece in our knowledge of terrorists' preferences is an understanding of their values. This article uses a novel approach to determine these values and state them as objectives, using principles from decision analysis and value-focused thinking. Instead of interviewing decisionmakers and stakeholders, as would be normal in decision analysis, we extract the values of terrorists by examining their own writings and verbal statements. To illustrate the approach, we extract the values of Al-Qaeda and structure them in terms of strategic, fundamental, and means objectives. These objectives are interrelated through a means-ends network. This information is useful for understanding terrorists' motivations, intent, and likely actions, as well as for developing policies to counter terrorism at its root causes. © 2010 Society for Risk Analysis.
NASA Astrophysics Data System (ADS)
Zasche, P.
2016-01-01
The available photometry from the online databases were used for the first light curve analysis of eight eclipsing binary systems EI Aur, XY Dra, BP Dra, DD Her, VX Lac, WX Lib, RZ Lyn, and TY Tri. All these stars are of Algol-type, having the detached components and the orbital periods from 0.92 to 6.8 days. For the systems EI Aur and BP Dra the large amount of the third light was detected during the light curve solution. Moreover, 468 new times of minima for these binaries were derived, trying to identify the period variations. For the systems XY Dra and VX Lac the third bodies were detected with the periods 17.7, and 49.3 years, respectively.
Wegener, Marius; Vogtmann, Kristina; Huber, Madeleine; Laass, Sebastian; Soppa, Jörg
2016-12-01
Reporter genes facilitate the characterization of promoter activities, transcript stabilities, translational efficiencies, or intracellular localization. Various reporter genes for Escherichia coli have been established, however, most of them have drawbacks like transcript instability or the inability to be used in genetic selections. Therefore, the glpD gene encoding glycerol-3-phosphate dehydrogenase was introduced as a novel reporter gene for E. coli. The enzymatic assay was optimized, and it was verified that growth on glycerol strictly depends on the presence of GlpD. The 5'-UTRs of three E. coli genes were chosen and cloned upstream of the new reporter gene glpD as well as the established reporter genes lacZ and gusA. Protein and transcript levels were quantified and translational efficiencies were calculated. The lacZ transcript was very unstable and its level highly depended on its translation, compromising its use as a reporter. The results obtained with gusA and glpD were similar, however, only glpD can be used for genetic selections. Therefore, glpD was found to be a superior novel reporter gene compared to the established reporter genes lacZ and gusA. Copyright © 2016 Elsevier B.V. All rights reserved.
Object Classification in Semi Structured Enviroment Using Forward-Looking Sonar
dos Santos, Matheus; Ribeiro, Pedro Otávio; Núñez, Pedro; Botelho, Silvia
2017-01-01
The submarine exploration using robots has been increasing in recent years. The automation of tasks such as monitoring, inspection, and underwater maintenance requires the understanding of the robot’s environment. The object recognition in the scene is becoming a critical issue for these systems. On this work, an underwater object classification pipeline applied in acoustic images acquired by Forward-Looking Sonar (FLS) are studied. The object segmentation combines thresholding, connected pixels searching and peak of intensity analyzing techniques. The object descriptor extract intensity and geometric features of the detected objects. A comparison between the Support Vector Machine, K-Nearest Neighbors, and Random Trees classifiers are presented. An open-source tool was developed to annotate and classify the objects and evaluate their classification performance. The proposed method efficiently segments and classifies the structures in the scene using a real dataset acquired by an underwater vehicle in a harbor area. Experimental results demonstrate the robustness and accuracy of the method described in this paper. PMID:28961163
Roepe, P D; Zbar, R I; Sarkar, H K; Kaback, H R
1989-01-01
The lac permease (lacY gene product) of Escherichia coli contains 417 amino acid residues and is predicted to have a short hydrophilic amino terminus on the inner surface of the cytoplasmic membrane, multiple transmembrane hydrophobic segments in alpha-helical conformation, and a 17-amino acid residue hydrophilic carboxyl-terminal tail on the inner surface of the membrane. To assess the importance of the carboxyl terminus, the properties of several truncation mutants were studied. The mutants were constructed by site-directed mutagenesis such that stop codons were placed at specified positions, and the altered lacY genes were expressed at a relatively low rate from plasmid pACYC184. Permease truncated at position 407 or 401 retains full activity, and a normal complement of molecules is present in the membrane, as judged by immunoblot analyses. Thus, it is apparent that the carboxyl-terminal tail plays no direct role in membrane insertion of the permease, its stability, or in the mechanism of lactose/H+ symport. In marked contrast, when truncations are made at residues 396 (i.e., 4 amino acid residues from the carboxyl terminus of putative helix XII), 389, 372, or 346, the permease is no longer found in the membrane. Remarkably, however, when each of the mutated lacY genes is expressed at a high rate by means of the T7 RNA polymerase system [Tabor, S. & Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1079], all of the truncated permeases are present in the membrane, as indicated by [35S]methionine incorporation studies; however, permease truncated at residue 396, 389, 372, or 346 is defective with respect to lactose/H+ symport. Finally, pulse-chase experiments indicate that wild-type permease or permease truncated at residue 401 is stable, whereas permease truncated at or prior to residue 396 is degraded at a significant rate. The results are consistent with the notion that residues 396-401 in putative helix XII are important for protection against
Tirado-Ramos, Alfredo; Hu, Jingkun; Lee, K.P.
2002-01-01
Supplement 23 to DICOM (Digital Imaging and Communications for Medicine), Structured Reporting, is a specification that supports a semantically rich representation of image and waveform content, enabling experts to share image and related patient information. DICOM SR supports the representation of textual and coded data linked to images and waveforms. Nevertheless, the medical information technology community needs models that work as bridges between the DICOM relational model and open object-oriented technologies. The authors assert that representations of the DICOM Structured Reporting standard, using object-oriented modeling languages such as the Unified Modeling Language, can provide a high-level reference view of the semantically rich framework of DICOM and its complex structures. They have produced an object-oriented model to represent the DICOM SR standard and have derived XML-exchangeable representations of this model using World Wide Web Consortium specifications. They expect the model to benefit developers and system architects who are interested in developing applications that are compliant with the DICOM SR specification. PMID:11751804
Multi-epoch intranight optical monitoring of eight radio-quiet BL Lac candidates
NASA Astrophysics Data System (ADS)
Kumar, P.; Gopal-Krishna; Stalin, C. S.; Chand, H.; Srianand, R.; Petitjean, P.
2017-10-01
For a new sample of eight weak-line quasars (WLQs) we report a sensitive search in 20 intranight monitoring sessions, for blazar-like optical flux variations on hour-like and longer time-scale (day/month/year-like). The sample consists exclusively of the WLQs that are not radio-loud and either have been classified as 'radio-weak probable BL Lac candidates' and/or are known to have exhibited at least one episode of large, blazar-like optical variability. Whereas only a hint of intranight variability is seen for two of these WLQs, J104833.5+620305.0 (z = 0.219) and J133219.6+622715.9 (z = 3.15), statistically significant internight variability at a few per cent level is detected for three of the sources, including the radio-intermediate WLQ J133219.6+622715.9 (z = 3.15) and the well-known bona fide radio-quiet WLQs J121221.5+534128.0 (z = 3.10) and WLQ J153259.9-003944.1 (z = 4.62). In the rest frame, this variability is intraday and in the far-ultraviolet band. On the time-scale of a decade, we find for three of the WLQs large brightness changes, amounting to 1.655 ± 0.009, 0.163 ± 0.010 and 0.144 ± 0.018 mag, for J104833.5+620305.0, J123743.1+630144.9 and J232428.4+144324.4, respectively. Whereas the latter two are confirmed radio-quiet WLQs, the extragalactic nature of J104833.5+620305.0 remains to be well established, thanks to the absence of any feature(s) in its available optical spectra. This study forms a part of our ongoing campaign of intranight optical monitoring of radio-quiet WLQs, in order to improve the understanding of this enigmatic class of active galactic nuclei and to look among them for a possible tiny, elusive population of radio-quiet BL Lacs.
Accumulation and therapeutic modulation of 6-sulfo LacNAc+ dendritic cells in multiple sclerosis
Thomas, Katja; Dietze, Kristin; Wehner, Rebekka; Metz, Imke; Tumani, Hayrettin; Schultheiß, Thorsten; Günther, Claudia; Schäkel, Knut; Reichmann, Heinz; Brück, Wolfgang; Schmitz, Marc
2014-01-01
Objective: To examine the potential role of 6-sulfo LacNAc+ (slan) dendritic cells (DCs) displaying pronounced proinflammatory properties in the pathogenesis of multiple sclerosis (MS). Methods: We determined the presence of slanDCs in demyelinated brain lesions and CSF samples of patients with MS. In addition, we explored the impact of methylprednisolone, interferon-β, glatiramer acetate, or natalizumab on the frequency of blood-circulating slanDCs in patients with MS. We also evaluated whether interferon-β modulates important proinflammatory capabilities of slanDCs. Results: SlanDCs accumulate in highly inflammatory brain lesions and are present in the majority of CSF samples of patients with MS. Short-term methylprednisolone administration reduces the percentage of slanDCs in blood of patients with MS and the proportion of tumor necrosis factor-α– or CD150-expressing slanDCs. Long-term interferon-β treatment decreases the percentage of blood-circulating slanDCs in contrast to glatiramer acetate or natalizumab. Furthermore, interferon-β inhibits the secretion of proinflammatory cytokines by slanDCs and their capacity to promote proliferation and differentiation of T cells. Conclusion: Accumulation of slanDCs in highly inflammatory brain lesions and their presence in CSF indicate that slanDCs may play an important role in the immunopathogenesis of MS. The reduction of blood-circulating slanDCs and the inhibition of their proinflammatory properties by methylprednisolone and interferon-β may contribute to the therapeutic efficiency of these drugs in patients with MS. PMID:25340085
Allen, Jeremy P; Hathway, Gareth J; Clarke, Neil J; Jowett, Mike I; Topps, Stephanie; Kendrick, Keith M; Humphrey, Patrick P A; Wilkinson, Lawrence S; Emson, Piers C
2003-05-01
The peptide somatostatin can modulate the functional output of the basal ganglia. The exact sites and mechanisms of this action, however, are poorly understood, and the physiological context in which somatostatin acts is unknown. Somatostatin acts as a neuromodulator via a family of five 7-transmembrane G protein-coupled receptors, SSTR1-5, one of which, SSTR2, is known to be functional in the striatum. We have investigated the role of SSTR2 in basal ganglia function using mice in which Sstr2 has been inactivated and replaced by the lacZ reporter gene. Analysis of Sstr2lacZ expression in the brain by beta-galactosidase histochemistry demonstrated a widespread pattern of expression. By comparison to previously published in situ hybridization and immunohistochemical data, Sstr2lacZ expression was shown to accurately recapitulate that of Sstr2 and thus provided a highly sensitive model to investigate cell-type-specific expression of Sstr2. In the striatum, Sstr2 expression was identified in medium spiny projection neurons restricted to the matrix compartment and in cholinergic interneurons. Sstr2 expression was not detected in any other nuclei of the basal ganglia except for a sparse number of nondopaminergic neurons in the substantia nigra. Microdialysis in the striatum showed Sstr2-null mice were selectively refractory to somatostatin-induced dopamine and glutamate release. In behavioural tests, Sstr2-null mice showed normal levels of locomotor activity and normal coordination in undemanding tasks. However, in beam-walking, a test of fine motor control, Sstr2-null mice were severely impaired. Together these data implicate an important neuromodulatory role for SSTR2 in the striatum.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piette, J.; Decuyper-Debergh, D.; Gamper, H.
Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less
Evaluation of critical indicators in the process of acquiring supplies and services LAC-UFPE
NASA Astrophysics Data System (ADS)
Caetano, V. F.; Ferreira, C. V.; dos Santos, M. J.; Honorato, F. A.
2015-01-01
In laboratories linked to public universities and accredited by the NBR ISO/IEC 17025, to meet efficiently item 4.6 (procurement of supplies and services) is a challenge that can be accomplished by programming based on historical purchases and services. In this study, we evaluated the critical procurement items to meet the quality management system of the LAC-UFPE: reagents, certified reference material, of equipment parts, maintenance and calibration of equipment and instruments. It was found that the most critical item is the certified reference material, the purchase or repair of which must be expedited within 125 days prior to the receipt to occur within the desired period.
On Three-dimensional Structures in Relativistic Hydrodynamic Jets
NASA Astrophysics Data System (ADS)
Hardee, Philip E.
2000-04-01
the helical surface mode winds around the jet. Higher order surface modes and first body modes produce less variation. Angular variation in the flow direction associated with the helical mode appears consistent with precessing jet models that have been proposed to explain the variability in 3C 273 and BL Lac object AO 0235+164. In particular, cyclic angular variation in the flow direction produced by the normal modes could produce the activity seen in BL Lac object OJ 287. Jet precession provides a mechanism for triggering the helical modes on multiple length scales, e.g., the galactic superluminal GRO J1655-40.
Optical Spectroscopic Survey of a Sample of Unidentified Fermi Objects
NASA Astrophysics Data System (ADS)
Paiano, Simona; Falomo, Renato; Franceschini, Alberto; Treves, Aldo; Scarpa, Riccardo
2017-12-01
We present optical spectroscopy secured at the 10 m Gran Telescopio Canarias of the counterparts of 20 extragalactic γ-ray sources detected by the Fermi satellite. The observations allow us to investigate the nature of these sources and to determine their redshift. We find that all optical counterparts have a spectrum that is consistent with a BL Lac object nature. We are able to determine the redshift for 11 objects and set spectroscopic redshift limits for five targets. The optical spectrum is found featureless for only four sources. In the latter cases, we can set lower limits on the redshift based on the assumption that they are hosted by a typical massive elliptical galaxy whose spectrum is diluted by the nonthermal continuum. The observations allow us to unveil the nature of these gamma-ray sources and provide a sanity check of a tool to discover the counterparts of γ-ray emitters/blazars based on their multiwavelength emission.
Orientation estimation of anatomical structures in medical images for object recognition
NASA Astrophysics Data System (ADS)
Bağci, Ulaş; Udupa, Jayaram K.; Chen, Xinjian
2011-03-01
Recognition of anatomical structures is an important step in model based medical image segmentation. It provides pose estimation of objects and information about "where" roughly the objects are in the image and distinguishing them from other object-like entities. In,1 we presented a general method of model-based multi-object recognition to assist in segmentation (delineation) tasks. It exploits the pose relationship that can be encoded, via the concept of ball scale (b-scale), between the binary training objects and their associated grey images. The goal was to place the model, in a single shot, close to the right pose (position, orientation, and scale) in a given image so that the model boundaries fall in the close vicinity of object boundaries in the image. Unlike position and scale parameters, we observe that orientation parameters require more attention when estimating the pose of the model as even small differences in orientation parameters can lead to inappropriate recognition. Motivated from the non-Euclidean nature of the pose information, we propose in this paper the use of non-Euclidean metrics to estimate orientation of the anatomical structures for more accurate recognition and segmentation. We statistically analyze and evaluate the following metrics for orientation estimation: Euclidean, Log-Euclidean, Root-Euclidean, Procrustes Size-and-Shape, and mean Hermitian metrics. The results show that mean Hermitian and Cholesky decomposition metrics provide more accurate orientation estimates than other Euclidean and non-Euclidean metrics.
A Deep-Structured Conditional Random Field Model for Object Silhouette Tracking
Shafiee, Mohammad Javad; Azimifar, Zohreh; Wong, Alexander
2015-01-01
In this work, we introduce a deep-structured conditional random field (DS-CRF) model for the purpose of state-based object silhouette tracking. The proposed DS-CRF model consists of a series of state layers, where each state layer spatially characterizes the object silhouette at a particular point in time. The interactions between adjacent state layers are established by inter-layer connectivity dynamically determined based on inter-frame optical flow. By incorporate both spatial and temporal context in a dynamic fashion within such a deep-structured probabilistic graphical model, the proposed DS-CRF model allows us to develop a framework that can accurately and efficiently track object silhouettes that can change greatly over time, as well as under different situations such as occlusion and multiple targets within the scene. Experiment results using video surveillance datasets containing different scenarios such as occlusion and multiple targets showed that the proposed DS-CRF approach provides strong object silhouette tracking performance when compared to baseline methods such as mean-shift tracking, as well as state-of-the-art methods such as context tracking and boosted particle filtering. PMID:26313943
Objective Structured Professional Assessments for Trainee Educational Psychologists: An Evaluation
ERIC Educational Resources Information Center
Dunsmuir, Sandra; Atkinson, Cathy; Lang, Jane; Warhurst, Amy; Wright, Sarah
2017-01-01
Objective Structured Professional Assessments (OSPAs) were developed and evaluated at three universities in the United Kingdom, to supplement supervisor assessments of trainee educational psychologists' placement practice. Participating second year students on three educational psychology doctoral programmes (n = 31) and tutors (n = 12) were…
Twelve Tips for Organizing an Objective Structured Clinical Examination (OSCE).
ERIC Educational Resources Information Center
Harden, R. M.
1991-01-01
Suggestions for organizing the objective structured clinical examination for medical students and physicians address selection of competencies to be evaluated, number, type, and duration of examination stations, use of examiners, clarity of instructions, test administration, resource requirements, interstation signals, and recordkeeping. (MSE)
An object programming based environment for protein secondary structure prediction.
Giacomini, M; Ruggiero, C; Sacile, R
1996-01-01
The most frequently used methods for protein secondary structure prediction are empirical statistical methods and rule based methods. A consensus system based on object-oriented programming is presented, which integrates the two approaches with the aim of improving the prediction quality. This system uses an object-oriented knowledge representation based on the concepts of conformation, residue and protein, where the conformation class is the basis, the residue class derives from it and the protein class derives from the residue class. The system has been tested with satisfactory results on several proteins of the Brookhaven Protein Data Bank. Its results have been compared with the results of the most widely used prediction methods, and they show a higher prediction capability and greater stability. Moreover, the system itself provides an index of the reliability of its current prediction. This system can also be regarded as a basis structure for programs of this kind.
Glaser, Tina; Dickel, Nina; Liersch, Benjamin; Rees, Jonas; Süssenbach, Philipp; Bohner, Gerd
2015-08-01
The authors propose a framework distinguishing two types of lateral attitude change (LAC): (a) generalization effects, where attitude change toward a focal object transfers to related objects, and (b) displacement effects, where only related attitudes change but the focal attitude does not change. They bring together examples of LAC from various domains of research, outline the conditions and underlying processes of each type of LAC, and develop a theoretical framework that enables researchers to study LAC more systematically in the future. Compared with established theories of attitude change, the LAC framework focuses on lateral instead of focal attitude change and encompasses both generalization and displacement. Novel predictions and designs for studying LAC are presented. © 2014 by the Society for Personality and Social Psychology, Inc.
Sousa, Filipa L; Parente, Daniel J; Hessman, Jacob A; Chazelle, Allen; Teichmann, Sarah A; Swint-Kruse, Liskin
2016-09-01
The AlloRep database (www.AlloRep.org) (Sousa et al., 2016) [1] compiles extensive sequence, mutagenesis, and structural information for the LacI/GalR family of transcription regulators. Sequence alignments are presented for >3000 proteins in 45 paralog subfamilies and as a subsampled alignment of the whole family. Phenotypic and biochemical data on almost 6000 mutants have been compiled from an exhaustive search of the literature; citations for these data are included herein. These data include information about oligomerization state, stability, DNA binding and allosteric regulation. Protein structural data for 65 proteins are presented as easily-accessible, residue-contact networks. Finally, this article includes example queries to enable the use of the AlloRep database. See the related article, "AlloRep: a repository of sequence, structural and mutagenesis data for the LacI/GalR transcription regulators" (Sousa et al., 2016) [1].
Determining the 3-D structure and motion of objects using a scanning laser range sensor
NASA Technical Reports Server (NTRS)
Nandhakumar, N.; Smith, Philip W.
1993-01-01
In order for the EVAHR robot to autonomously track and grasp objects, its vision system must be able to determine the 3-D structure and motion of an object from a sequence of sensory images. This task is accomplished by the use of a laser radar range sensor which provides dense range maps of the scene. Unfortunately, the currently available laser radar range cameras use a sequential scanning approach which complicates image analysis. Although many algorithms have been developed for recognizing objects from range images, none are suited for use with single beam, scanning, time-of-flight sensors because all previous algorithms assume instantaneous acquisition of the entire image. This assumption is invalid since the EVAHR robot is equipped with a sequential scanning laser range sensor. If an object is moving while being imaged by the device, the apparent structure of the object can be significantly distorted due to the significant non-zero delay time between sampling each image pixel. If an estimate of the motion of the object can be determined, this distortion can be eliminated; but, this leads to the motion-structure paradox - most existing algorithms for 3-D motion estimation use the structure of objects to parameterize their motions. The goal of this research is to design a rigid-body motion recovery technique which overcomes this limitation. The method being developed is an iterative, linear, feature-based approach which uses the non-zero image acquisition time constraint to accurately recover the motion parameters from the distorted structure of the 3-D range maps. Once the motion parameters are determined, the structural distortion in the range images is corrected.
A plausible energy source and structure for quasi-stellar objects
NASA Technical Reports Server (NTRS)
Daltabuit, E.; Cox, D.
1972-01-01
If a collision of two large, massive, fast gas clouds occurs, their kinetic energy is converted to radiation in a pair of shock fronts at their interface. The resulting structure is described, and the relevance of this as a radiation source for quasi-stellar objects is considered.
A KPC-Scale X-Ray Jet in the BL Lac Source S5 2007+777
NASA Technical Reports Server (NTRS)
Sambruna, Rita M.; Donato, Davide; Cheung, C.C.; Tavecchio, F.; Maraschi, L.
2008-01-01
X-ray jets in AGN are commonly observed in FRII and FRI radiogalaxies, but rarely in BL Lacs, most probably due to their orientation close to the line of sight and the ensuing foreshortening effects. Only three BL Lacs are known so far to contain a kpc-scale X-ray jet. In this paper, we present the evidence for the existence of a fourth extended X-ray jet in the classical radio-selected source S5 2007+777, which for its hybrid FRI/II radio morphology has been classified as a HYMOR (HYbrid MOrphology Radio source). Our Chandra ACISS observations of this source revealed an X-ray counterpart to the 19"-long radio jet. Interestingly, the X-ray properties of the kpc-scale jet in S5 2007+777 are very similar to those observed in FRII jets. First, the X-ray morphology closely mirrors the radio one, with the X-rays being concentrated in the discrete radio knots. Second, the X-ray continuum of the jet/brightest knot is described by a very hard power law, with photon index gamma(sub x) approximately 1. Third, the optical upper limit from archival HST data implies a concave radio-to-X-ray SED. If the X-ray emission is attributed to IC/CMB with equipartition, strong beaming (delta= 13) is required, implying a very large scale (Mpc) jet. The beaming requirement can be somewhat relaxed assuming a magnetic field lower than equipartition. Alternatively, synchrotron emission from a second population of very high-energy electrons is viable. Comparison to other HYMOR jets detected with Chandra is discussed, as well as general implications for the origin of the FRI/II division.
NASA Astrophysics Data System (ADS)
Munoz, R.; Caylor, E.; Yost, C. L.; Drake, C.; Ladwig, J. L.; Myrbo, A.; Howes, T.
2014-12-01
Wild rice (Zizania palustris L.) is an aquatic grass with spiritual and subsistence significance to Native people of the Great Lakes region of North America. Mud Lake (Mashkiigwaagamaag), located on the Fond du Lac Band of Lake Superior Chippewa Reservation in Carlton County, Minnesota, USA, once supported an extensive population of wild rice (manoomin). However, early 20th century attempts to ditch and drain surrounding wetlands for landuse intensification severely altered the natural hydrological system that supports wild rice. Fond du Lac Resource Management (FDLRM) technicians are currently working to increase the wild rice population in Mud Lake. As part of these efforts, this phytolith study was undertaken to better understand how wild rice abundance has fluctuated over the past 400 years, with particular emphasis on the 19th and 20th centuries. Phytoliths are microscopic opal silica plant remains that are incorporated into soils and lake sediments after the plant-parts that contain them decay. Wild rice produces phytolith morphotypes that are unequivocally diagnostic. Mud Lake core MNMN-MUD11-1C-1P-1 (46°43'38.39"N, 92°42'2.45"W) was piston cored by LacCore (National Lacustrine Core Facility) and FDLRM technicians on 24 May 2011. Initial core descriptions, multi-sensor core logging, phytolith sampling and phytolith extractions were completed during the summer of 2014 at LacCore. Wild rice phytolith identification and quantification was conducted on twelve samples using brightfield microscopy at 400x magnification. Wild rice phytolith concentration values ranged from 68 to 2,300 phytoliths/cm3. Wild rice accumulation rates ranged from 9 to 383 phytoliths/ cm2/yr, peaking in 1952 AD. Wild rice abundance in Mud Lake appears to be influenced by a complex set of variables that include anthropogenic disturbance, climatic events and aquatic plant community succession.
System for determining the angle of impact of an object on a structure
NASA Technical Reports Server (NTRS)
Prosser, William H. (Inventor); Gorman, Michael R. (Inventor)
1993-01-01
A method for determining the angle of impact of an object on a thin-walled structure which determines the angle of impact through analysis of the acoustic waves which result when an object impacts a structure is presented. Transducers are placed on and in the surface of the structure which sense the wave caused in the structure by impact. The waves are recorded and saved for analysis. For source motion normal to the surface, the antisymmetric mode has a large amplitude while that of the symmetric mode is very small. As the source angle increases with respect to the surface normal, the symmetric mode amplitude increases while the antisymmetric mode amplitude decreases. Thus, the angle of impact is determined by measuring the relative amplitudes of these two lowest order modes.
Research on connection structure of aluminumbody bus using multi-objective topology optimization
NASA Astrophysics Data System (ADS)
Peng, Q.; Ni, X.; Han, F.; Rhaman, K.; Ulianov, C.; Fang, X.
2018-01-01
For connecting Aluminum Alloy bus body aluminum components often occur the problem of failure, a new aluminum alloy connection structure is designed based on multi-objective topology optimization method. Determining the shape of the outer contour of the connection structure with topography optimization, establishing a topology optimization model of connections based on SIMP density interpolation method, going on multi-objective topology optimization, and improving the design of the connecting piece according to the optimization results. The results show that the quality of the aluminum alloy connector after topology optimization is reduced by 18%, and the first six natural frequencies are improved and the strength performance and stiffness performance are obviously improved.
Learning the 3-D structure of objects from 2-D views depends on shape, not format
Tian, Moqian; Yamins, Daniel; Grill-Spector, Kalanit
2016-01-01
Humans can learn to recognize new objects just from observing example views. However, it is unknown what structural information enables this learning. To address this question, we manipulated the amount of structural information given to subjects during unsupervised learning by varying the format of the trained views. We then tested how format affected participants' ability to discriminate similar objects across views that were rotated 90° apart. We found that, after training, participants' performance increased and generalized to new views in the same format. Surprisingly, the improvement was similar across line drawings, shape from shading, and shape from shading + stereo even though the latter two formats provide richer depth information compared to line drawings. In contrast, participants' improvement was significantly lower when training used silhouettes, suggesting that silhouettes do not have enough information to generate a robust 3-D structure. To test whether the learned object representations were format-specific or format-invariant, we examined if learning novel objects from example views transfers across formats. We found that learning objects from example line drawings transferred to shape from shading and vice versa. These results have important implications for theories of object recognition because they suggest that (a) learning the 3-D structure of objects does not require rich structural cues during training as long as shape information of internal and external features is provided and (b) learning generates shape-based object representations independent of the training format. PMID:27153196
Low-luminosity Blazars in Wise: A Mid-infrared View of Unification
NASA Astrophysics Data System (ADS)
Plotkin, Richard M.; Anderson, S. F.; Brandt, W. N.; Markoff, S.; Shemmer, O.; Wu, J.
2012-01-01
We use the preliminary data release from the Wide-Field Infrared Survey Explorer (WISE) to perform the first statistical study on the mid-infrared (IR) properties of a large number ( 102) of BL Lac objects -- low-luminosity Active Galactic Nuclei (AGN) with a jet beamed toward the Earth. As expected, many BL Lac objects are so highly beamed that their jet synchrotron emission dominates their IR spectral energy distributions (SEDs), and the shape of their SEDs in the IR correlates well with SED peak frequency. In other BL Lac objects, the jet is not strong enough to completely dilute the rest of the AGN, and we do not see observational signatures of the dusty torus from these weakly beamed BL Lac objects. While at odds with simple unification, the missing torus is consistent with recent suggestions that BL Lac objects are fed by radiatively inefficient accretion flows. We discuss implications on the ``nature vs. nurture" debate for FR I and FR II galaxies, and also on the standard orientation-based AGN unification model.
Fast and objective detection and analysis of structures in downhole images
NASA Astrophysics Data System (ADS)
Wedge, Daniel; Holden, Eun-Jung; Dentith, Mike; Spadaccini, Nick
2017-09-01
Downhole acoustic and optical televiewer images, and formation microimager (FMI) logs are important datasets for structural and geotechnical analyses for the mineral and petroleum industries. Within these data, dipping planar structures appear as sinusoids, often in incomplete form and in abundance. Their detection is a labour intensive and hence expensive task and as such is a significant bottleneck in data processing as companies may have hundreds of kilometres of logs to process each year. We present an image analysis system that harnesses the power of automated image analysis and provides an interactive user interface to support the analysis of televiewer images by users with different objectives. Our algorithm rapidly produces repeatable, objective results. We have embedded it in an interactive workflow to complement geologists' intuition and experience in interpreting data to improve efficiency and assist, rather than replace the geologist. The main contributions include a new image quality assessment technique for highlighting image areas most suited to automated structure detection and for detecting boundaries of geological zones, and a novel sinusoid detection algorithm for detecting and selecting sinusoids with given confidence levels. Further tools are provided to perform rapid analysis of and further detection of structures e.g. as limited to specific orientations.
An object-relational model for structured representation of medical knowledge.
Koch, S; Risch, T; Schneider, W; Wagner, I V
2006-07-01
Domain specific knowledge is often not static but continuously evolving. This is especially true for the medical domain. Furthermore, the lack of standardized structures for presenting knowledge makes it difficult or often impossible to assess new knowledge in the context of existing knowledge. Possibilities to compare knowledge easily and directly are often not given. It is therefore of utmost importance to create a model that allows for comparability, consistency and quality assurance of medical knowledge in specific work situations. For this purpose, we have designed on object-relational model based on structured knowledge elements that are dynamically reusable by different multi-media-based tools for case-based documentation, disease course simulation, and decision support. With this model, high-level components, such as patient case reports or simulations of the course of a disease, and low-level components (e.g., diagnoses, symptoms or treatments) as well as the relationships between these components are modeled. The resulting schema has been implemented in AMOS II, on object-relational multi-database system supporting different views with regard to search and analysis depending on different work situations.
Efficient Exact Inference With Loss Augmented Objective in Structured Learning.
Bauer, Alexander; Nakajima, Shinichi; Muller, Klaus-Robert
2016-08-19
Structural support vector machine (SVM) is an elegant approach for building complex and accurate models with structured outputs. However, its applicability relies on the availability of efficient inference algorithms--the state-of-the-art training algorithms repeatedly perform inference to compute a subgradient or to find the most violating configuration. In this paper, we propose an exact inference algorithm for maximizing nondecomposable objectives due to special type of a high-order potential having a decomposable internal structure. As an important application, our method covers the loss augmented inference, which enables the slack and margin scaling formulations of structural SVM with a variety of dissimilarity measures, e.g., Hamming loss, precision and recall, Fβ-loss, intersection over union, and many other functions that can be efficiently computed from the contingency table. We demonstrate the advantages of our approach in natural language parsing and sequence segmentation applications.
Structure of the effector-binding domain of the arabinose repressor AraR from Bacillus subtilis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Procházková, Kateřina; Čermáková, Kateřina; Pachl, Petr
2012-02-01
The crystal structure of the effector-binding domain of the transcriptional repressor AraR from B. subtilis in complex with the effector molecule (l-arabinose) was determined at 2.2 Å resolution. A detailed analysis of the crystal identified a dimer organization that is distinctive from that of other members of the GalR/LacI family. In Bacillus subtilis, the arabinose repressor AraR negatively controls the expression of genes in the metabolic pathway of arabinose-containing polysaccharides. The protein is composed of two domains of different phylogenetic origin and function: an N-terminal DNA-binding domain belonging to the GntR family and a C-terminal effector-binding domain that shows similaritymore » to members of the GalR/LacI family. The crystal structure of the C-terminal effector-binding domain of AraR in complex with the effector l-arabinose has been determined at 2.2 Å resolution. The l-arabinose binding affinity was characterized by isothermal titration calorimetry and differential scanning fluorimetry; the K{sub d} value was 8.4 ± 0.4 µM. The effect of l-arabinose on the protein oligomeric state was investigated in solution and detailed analysis of the crystal identified a dimer organization which is distinctive from that of other members of the GalR/LacI family.« less
An Ap-Structure with Finslerian Flavor II:. Torsion, Curvature and Other Objects
NASA Astrophysics Data System (ADS)
Wanas, M. I.; Kamal, Mona M.
An absolute parallelism (AP-) space having Finslerian properties is called FAP-space. This FAP-structure is wider than both conventional AP and Finsler structures. In the present work, more geometric objects as curvature and torsion tensors are derived in the context of this structure. Also second order tensors, usually needed for physical applications, are derived and studied. Furthermore, the anti-curvature and the W-tensor are defined for the FAP-structure. Relations between Riemannian, AP, Finsler and FAP structures are given. These relations facilitate comparison between results of applications carried out in the framework of these structures. We hope that the use of the FAP-structure, in applications may throw some light on some of the problems facing geometric field theories.
The flaring activity of Markarian 421 during April 2000
NASA Astrophysics Data System (ADS)
Fegan, D. J.; VERITAS Collaboration
2001-08-01
Evidence for correlated TeV γ and X-ray flaring of the extreme blazar Mrk421 during April 2000 is presented and discussed. The remarkably persistent TeV flare of April 30th 2000 (40 σ significance), exhibiting structure over almost six hours of continuous observation, is analysed in detail. 1 Extreme BL Lac objects The most extreme members of the Active Galactic Nucleus (AGN) family are BL Lac objects and optically violently variable (OVV) quasars, collectively known as blazars. These objects are dominated by the presence of relativistic jets. For jets fortuitously aligned with an observers line of sight, emission may exhibit dramatic variability over very short time scales, in turn implying remarkably compact emission regions. For blazars, the Spectral Energy Distribution (SED) is dominated by non-thermal continuum emission, extending from radio to TeV gamma rays. The broadband nature of the blazar emission offers unique insights into energetic physical processes at work in a very compact region, close to the base of the jet and near the underlying central engine, most likely a supermassive black hole. BL Lacs are very effectively characterized on the basis of their SED shape. X-ray and radio flux limited surveys apear to display a bimodal distribution of properties, with LBL (Low-energy peaked, or "Red" BL Lacs) having synchrotron peaks in the IR-optical bands, and HBL (High-energy peaked, or "Blue" BL Lacs) in the UV to soft X-ray band. Recent comprehensive surveys such as DXRBS, REX and RGB have extended, by almost two orders of magnitude, the range of observable synchrotron peak frequencies. For blazar class objects, broadband emission confirms that the synchrotron peak may span the entire IR Xray range, thus accounting for the multi-frequency emission properties of this class of object. Mrk421, Mrk501, 1ES2344 and 1H1426 all exhibit broadband emission properties, high
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chaptal, Vincent; Kwon, Seunghyug; Sawaya, Michael R.
Lactose permease of Escherichia coli (LacY) with a single-Cys residue in place of A122 (helix IV) transports galactopyranosides and is specifically inactivated by methanethiosulfonyl-galactopyranosides (MTS-gal), which behave as unique suicide substrates. In order to study the mechanism of inactivation more precisely, we solved the structure of single-Cys122 LacY in complex with covalently bound MTS-gal. This structure exhibits an inward-facing conformation similar to that observed previously with a slight narrowing of the cytoplasmic cavity. MTS-gal is bound covalently, forming a disulfide bond with C122 and positioned between R144 and W151. E269, a residue essential for binding, coordinates the C-4 hydroxyl ofmore » the galactopyranoside moiety. The location of the sugar is in accord with many biochemical studies.« less
NASA Astrophysics Data System (ADS)
Garambois, Pierre; Besset, Sebastien; Jézéquel, Louis
2015-07-01
This paper presents a methodology for the multi-objective (MO) shape optimization of plate structure under stress criteria, based on a mixed Finite Element Model (FEM) enhanced with a sub-structuring method. The optimization is performed with a classical Genetic Algorithm (GA) method based on Pareto-optimal solutions and considers thickness distributions parameters and antagonist objectives among them stress criteria. We implement a displacement-stress Dynamic Mixed FEM (DM-FEM) for plate structure vibrations analysis. Such a model gives a privileged access to the stress within the plate structure compared to primal classical FEM, and features a linear dependence to the thickness parameters. A sub-structuring reduction method is also computed in order to reduce the size of the mixed FEM and split the given structure into smaller ones with their own thickness parameters. Those methods combined enable a fast and stress-wise efficient structure analysis, and improve the performance of the repetitive GA. A few cases of minimizing the mass and the maximum Von Mises stress within a plate structure under a dynamic load put forward the relevance of our method with promising results. It is able to satisfy multiple damage criteria with different thickness distributions, and use a smaller FEM.
NASA Astrophysics Data System (ADS)
Myrbo, A.
2015-12-01
Climatic and environmental change are a powerful hook to engage students and the public with geoscience. Recent lake sediments often feature visual and compositional evidence of anthropogenic changes, which can pique curiosity and serve as a gateway for interest in more remote past changes. Cores provide an integrative, place-based geoscience education/outreach platform: lake dynamics incorporate principles of chemistry, physics, and biology; lake basin formation and sedimentary signals trace back to numerous geoscience subdisciplines. Lakes reflect local changes, and so are inherently place-based and relevant to both rural and urban populations. The esthetics of lakes in the landscape and sediments under the microscope spark the artistic sensibilities of those who do not consider themselves scientists: lakes are readymade for STEAM education. LacCore has exploited the magic of lake sediment cores in its 15 years as an NSF Facility, and now expands to additional environments as the NSF Continental Scientific Drilling Coordination Office. Part of scaling up is the formalization of major support for the Broader Impacts (BI) activities of Facility users. LacCore/CSDCO now musters its collaborative experiences in site REUs and other undergrad research projects, in-depth training of students, teachers, and faculty, a long list of informal education experiences, and common-good software development, to provide assistance to researchers seeking meaningful broader impacts and educators seeking extra- or co-curricular field and laboratory research experiences for their students. Outreach, diversity, and education support includes dissemination of best practices, as well as coordination, administration, and basic capacity for such activities in collaboration with project PIs and students, through no-cost support, or collaborative proposals or supplements from NSF where necessary for project scale. Community-driven research and broadening participation are central to the
Fallon, James D.; Yaeger, Christine S.
2009-01-01
Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1
NASA Astrophysics Data System (ADS)
Fedortchouk, Y.; Canil, D.; Carlson, J. A.
2002-12-01
Crystallization temperatures (T) and oxygen fugacity (fO2) are not well constrained for kimberlites. Knowledge of these intensive variables of kimberlite melt is important for understanding the origin and evolution of kimberlites and prediction of diamond preservation in the magma. Difficulties in interpreting the equilibrium mineral assemblages in kimberlites and the high degree of secondary alteration usually complicate use of mineral geothermometers and oxygen barometers. Some of Lac de Gras (N.W.T., Canada) kimberlites are extremely fresh and provide opportunity to apply mineral thermobarometers. The presence of numerous chromite inclusions in the rims of olivine phenocrysts allows application of the olivine-spinel thermometer and oxygen barometer to constrain T and fO2 of the melt. We performed T and fO2 calculations on samples from three kimberlite pipes - the Leslie, Aaron and Grizzly. The T obtained from olivine - chromite pairs for crystallization of olivine phenocryst rims are 1050° to 1100°C +/- 50°C (calculated at 1 GPa). Few olivine - chromite pairs from Leslie and Grizzly record higher temperatures of 1250° - 1350°C. The cores of olivine phenocrysts usually lack chromite inclusions and their crystallization T and fO2 could not be estimated. The fO2 recorded by coexisting olivine and chromite are +0.3 to 1.0 +/- 0.4 log units more oxidized than the nickel-nickel oxide (NNO) buffer. The established fO2 of kimberlites would require fO2 in their mantle source to be higher than that of cratonic mantle and oceanic lithosphere producing MORB's but comparable to the source of subduction-related magmas. The T and fO2 for the Lac de Gras kimberlites constrain the path of any mantle material entrained in these magmas in fO2-T-P space and provide limits on diamond destructive processes. Diamonds are not stable in kimberlite magma and are oxidized to CO2 or converted into graphite. The former process is more favorable for their preservation. The results of
New Light Curves and Analysis of the Overcontact Binaries PP Lac and DK Sge
NASA Astrophysics Data System (ADS)
Sanders, S. J.; Hargis, J. R.; Bradstreet, D. H.
2004-12-01
As a by-product of the ongoing work with the Catalog and AtLas of Eclipsing Binaries database (CALEB; Bradstreet et al. 2004), several hundred eclipsing binary systems have been identified that have either unpublished or poor quality light curves. We present new V & Rc light curves for the overcontact systems PP Lac and DK Sge, both chosen because their deep eclipses (peak-to-peak amplitudes of nearly 0.7 mag) help constrain the light curve modelling. Data were obtained using the 41-cm telescope at the Eastern University Observatory equipped with an SBIG ST-10XME CCD. PP Lac (P= 0.40116 d) is a W-type contact binary with only one previously published light curve (Dumont & Maraziti 1990), but the data are sparse and almost non-existent at primary eclipse. Modelling of these data gave varying results; the published mass ratios differ by nearly 0.3. Our data confirms the noted differing eclipse depths but we find the primary eclipse to be total. We present a new light curve solution using Binary Maker 3 (Bradstreet & Steelman 2002) and Wilson-Devinney, finding the mass ratio to be well-constrained by the duration of total eclipse. A period study will be presented using previously existing and newly derived times of minimum light. DK Sge (P=0.62182 d) appears to be an A-type contact binary with no published light curve. The eclipses are partial, with the primary eclipse being deeper by about 0.08 mag. The maxima show evidence of a slight asymmetry, although the light curve appears to be repeatable over the 1 month of observations. We present the first light curve solution using Binary Maker 3 and Wilson-Devinney, but have limited mass ratio constraints due to the absence of radial velocity data. A period study will be presented using previously existing and newly derived times of minimum light.
Invariant 2D object recognition using the wavelet transform and structured neural networks
NASA Astrophysics Data System (ADS)
Khalil, Mahmoud I.; Bayoumi, Mohamed M.
1999-03-01
This paper applies the dyadic wavelet transform and the structured neural networks approach to recognize 2D objects under translation, rotation, and scale transformation. Experimental results are presented and compared with traditional methods. The experimental results showed that this refined technique successfully classified the objects and outperformed some traditional methods especially in the presence of noise.
Bi-objective integer programming for RNA secondary structure prediction with pseudoknots.
Legendre, Audrey; Angel, Eric; Tahi, Fariza
2018-01-15
RNA structure prediction is an important field in bioinformatics, and numerous methods and tools have been proposed. Pseudoknots are specific motifs of RNA secondary structures that are difficult to predict. Almost all existing methods are based on a single model and return one solution, often missing the real structure. An alternative approach would be to combine different models and return a (small) set of solutions, maximizing its quality and diversity in order to increase the probability that it contains the real structure. We propose here an original method for predicting RNA secondary structures with pseudoknots, based on integer programming. We developed a generic bi-objective integer programming algorithm allowing to return optimal and sub-optimal solutions optimizing simultaneously two models. This algorithm was then applied to the combination of two known models of RNA secondary structure prediction, namely MEA and MFE. The resulting tool, called BiokoP, is compared with the other methods in the literature. The results show that the best solution (structure with the highest F 1 -score) is, in most cases, given by BiokoP. Moreover, the results of BiokoP are homogeneous, regardless of the pseudoknot type or the presence or not of pseudoknots. Indeed, the F 1 -scores are always higher than 70% for any number of solutions returned. The results obtained by BiokoP show that combining the MEA and the MFE models, as well as returning several optimal and several sub-optimal solutions, allow to improve the prediction of secondary structures. One perspective of our work is to combine better mono-criterion models, in particular to combine a model based on the comparative approach with the MEA and the MFE models. This leads to develop in the future a new multi-objective algorithm to combine more than two models. BiokoP is available on the EvryRNA platform: https://EvryRNA.ibisc.univ-evry.fr .
AGN jets under the microscope: A divide? Doctoral Thesis Award Lecture 2011
NASA Astrophysics Data System (ADS)
Karouzos, M.; Britzen, S.; Witzel, A.; Zensus, A. J.; Eckart, A.
2012-06-01
A new paradigm for active galactic jet kinematics has emerged through detailed investigations of BL Lac objects using very long baseline radio interferometry. In this new scheme, most, if not all, jet components appear to remain stationary with respect to the core but show significant non-radial motions. This paper presents results from our kinematic investigation of the jets of a statistically complete sample of radio-loud flat-spectrum active galaxies, focusing on the comparison between the jet kinematic properties of BL Lacs and flat-spectrum radio-quasars. It is shown that there is a statistically significant difference between the kinematics of the two AGN classes, with BL Lacs showing more bent jets, that are wider and show slower movement along the jet axis, compared to flat-spectrum radio-quasars. This is interpreted as evidence for helically structured jets.
Zhang, X; Gottlieb, P A
1995-01-01
Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate
Lee, Chia-lin; Middleton, Erica; Mirman, Daniel; Kalénine, Solène; Buxbaum, Laurel J.
2012-01-01
Previous studies suggest that action representations are activated during object processing, even when task-irrelevant. In addition, there is evidence that lexical-semantic context may affect such activation during object processing. Finally, prior work from our laboratory and others indicates that function-based (“use”) and structure-based (“move”) action subtypes may differ in their activation characteristics. Most studies assessing such effects, however, have required manual object-relevant motor responses, thereby plausibly influencing the activation of action representations. The present work utilizes eyetracking and a Visual World Paradigm task without object-relevant actions to assess the time course of activation of action representations, as well as their responsiveness to lexical-semantic context. In two experiments, participants heard a target word and selected its referent from an array of four objects. Gaze fixations on non-target objects signal activation of features shared between targets and non-targets. The experiments assessed activation of structure-based (Experiment 1) or function-based (Experiment 2) distractors, using neutral sentences (“S/he saw the …”) or sentences with a relevant action verb (Experiment 1: “S/he picked up the……”; Experiment 2: “S/he used the….”). We observed task-irrelevant activations of action information in both experiments. In neutral contexts, structure-based activation was relatively faster-rising but more transient than function-based activation. Additionally, action verb contexts reliably modified patterns of activation in both Experiments. These data provide fine-grained information about the dynamics of activation of function-based and structure-based actions in neutral and action-relevant contexts, in support of the “Two Action System” model of object and action processing (e.g., Buxbaum & Kalénine, 2010). PMID:22390294
NASA Astrophysics Data System (ADS)
Noren, A.; Brady, K.; Myrbo, A.; Ito, E.
2007-12-01
Lacustrine sediment cores comprise an integral archive for the determination of continental paleoclimate, for their potentially high temporal resolution and for their ability to resolve spatial variability in climate across vast sections of the globe. Researchers studying these archives now have a large, nationally-funded, public facility dedicated to the support of their efforts. The LRC LacCore Facility, funded by NSF and the University of Minnesota, provides free or low-cost assistance to any portion of research projects, depending on the specific needs of the project. A large collection of field equipment (site survey equipment, coring devices, boats/platforms, water sampling devices) for nearly any lacustrine setting is available for rental, and Livingstone-type corers and drive rods may be purchased. LacCore staff can accompany field expeditions to operate these devices and curate samples, or provide training prior to device rental. The Facility maintains strong connections to experienced shipping agents and customs brokers, which vastly improves transport and importation of samples. In the lab, high-end instrumentation (e.g., multisensor loggers, high-resolution digital linescan cameras) provides a baseline of fundamental analyses before any sample material is consumed. LacCore staff provide support and training in lithological description, including smear-slide, XRD, and SEM analyses. The LRC botanical macrofossil reference collection is a valuable resource for both core description and detailed macrofossil analysis. Dedicated equipment and space for various subsample analyses streamlines these endeavors; subsamples for several analyses may be submitted for preparation or analysis by Facility technicians for a fee (e.g., carbon and sulfur coulometry, grain size, pollen sample preparation and analysis, charcoal, biogenic silica, LOI, freeze drying). The National Lacustrine Core Repository now curates ~9km of sediment cores from expeditions around the world
Bodell, William J; Gaikwad, Nilesh W; Miller, Douglas; Berger, Mitchel S
2003-06-01
Temozolomide (TMZ) is a chemotherapeutic agent used in the treatment of high-grade brain tumors. Treatment of patients with alkylating chemotherapeutic agents has been established to increase their risk for acute myelogenous leukemia. The formation of DNA adducts and induction of mutations are likely to play a role in the etiology of therapy-related acute myeloid leukemia. To evaluate this issue for TMZ, we have measured the formation of DNA adducts and induction of lacI mutations in Big Blue Rat-2 cells treated with TMZ. Treatment of Big Blue Rat-2 cells with either 0, 0.5, or 1 mM TMZ resulted in lacI mutant frequencies of 9.1 +/- 2.9 x 10(-5), 48.9 +/- 12 x 10(-5), and 89.7 +/- 40.3 x 10(-5), respectively. Comparison of the mutant frequencies demonstrated that 0.5 and 1 mM TMZ treatments increased the mutant frequencies by 5.3- and 9.8-fold and that this increase was significant (P < 0.001). Sequence analysis of the lacI mutants from the TMZ treatment group demonstrated that they were GC-->AT transitions at non-CpG sites, which is significantly different from the mutation spectrum observed in the control treatment group. Treatment of Big Blue Rat-2 cells with various concentrations of TMZ produced a linear increase in the levels of N7-methylguanine and O(6)-methylguanine. The lacI mutation spectrum induced by TMZ treatment is consistent with these mutations being produced by O(6)-MeG. This study establishes TMZ has significant mutagenic potential and suggests that careful consideration in the use of TMZ for the treatment of low-grade adult and pediatric brain tumors should be given.
NASA Astrophysics Data System (ADS)
Sycheva, Elena A.; Vasilev, Aleksandr S.; Lashmanov, Oleg U.; Korotaev, Valery V.
2017-06-01
The article is devoted to the optimization of optoelectronic systems of the spatial position of objects. Probabilistic characteristics of the detection of an active structured mark on a random noisy background are investigated. The developed computer model and the results of the study allow us to estimate the probabilistic characteristics of detection of a complex structured mark on a random gradient background, and estimate the error of spatial coordinates. The results of the study make it possible to improve the accuracy of measuring the coordinates of the object. Based on the research recommendations are given on the choice of parameters of the optimal mark structure for use in opticalelectronic systems for monitoring the spatial position of large-sized structures.
NMR studies on the structure and dynamics of lac operator DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, S.C.
Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less
48 CFR 1815.404-471 - NASA structured approach for profit or fee objective.
Code of Federal Regulations, 2010 CFR
2010-10-01
... NATIONAL AERONAUTICS AND SPACE ADMINISTRATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 1815.404-471 NASA structured approach for profit or fee objective. ...
Lorenzo, José M; García Fontán, María C; Cachaldora, Aida; Franco, Inmaculada; Carballo, Javier
2010-04-01
Total aerobic mesophilic microflora (on SPC agar), lactic acid bacteria (on MRS agar) and lactobacilli (on Rogosa agar) were enumerated in samples from the surface and the interior of the pieces throughout the manufacture of six batches of lacón. Three of the batches were made without additives and three with additives (glucose (2 g/kg), sodium nitrite (E(250)) (125 mg/kg), sodium nitrate (E(251)) (175 mg/kg), sodium ascorbate (E(301)) (500 mg/kg), and sodium citrate (E(331)) (100 mg/kg)). The counts decreased throughout the manufacturing process, particularly after the salting stage. The use of additives did not affect the counts or the evolution of the microbial groups, except for the lactobacilli, which were present in higher numbers in the batches with additives. In four batches (two without and two with additives), from MRS agar and from Rogosa agar plates, 10 colonies were randomly taken from each sampling point of each batch (five from the surface sample and five from the interior sample) and from each culture medium; a total of 224 strains from MRS agar, and 176 strains from Rogosa agar that were identified by classical methods. The MRS agar displayed moderate selectivity for the isolation of lactic acid bacteria, and only 59% of the isolated strains belonged to this microbial group. Homofermentative and facultative heterofermentative lactobacilli (particularly Lactobacillus curvatus and Lactobacillus sakei) were the most abundant species isolated on this medium. The selectivity of the Rogosa agar for lactobacilli was extremely high. The species of lactobacilli isolated on this medium at different stages of manufacture of the four batches of lacón were consistent with those isolated from MRS agar. The use of additives in the lacón did not appreciably affect the kinds and proportions of species isolated on either MRS agar or Rogosa agar.
NASA Astrophysics Data System (ADS)
Madala, Srikanth; Satyanarayana, A. N. V.; Srinivas, C. V.; Tyagi, Bhishma
2016-05-01
In the present study, advanced research WRF (ARW) model is employed to simulate convective thunderstorm episodes over Kharagpur (22°30'N, 87°20'E) region of Gangetic West Bengal, India. High-resolution simulations are conducted using 1 × 1 degree NCEP final analysis meteorological fields for initial and boundary conditions for events. The performance of two non-local [Yonsei University (YSU), Asymmetric Convective Model version 2 (ACM2)] and two local turbulence kinetic energy closures [Mellor-Yamada-Janjic (MYJ), Bougeault-Lacarrere (BouLac)] are evaluated in simulating planetary boundary layer (PBL) parameters and thermodynamic structure of the atmosphere. The model-simulated parameters are validated with available in situ meteorological observations obtained from micro-meteorological tower as well has high-resolution DigiCORA radiosonde ascents during STORM-2007 field experiment at the study location and Doppler Weather Radar (DWR) imageries. It has been found that the PBL structure simulated with the TKE closures MYJ and BouLac are in better agreement with observations than the non-local closures. The model simulations with these schemes also captured the reflectivity, surface pressure patterns such as wake-low, meso-high, pre-squall low and the convective updrafts and downdrafts reasonably well. Qualitative and quantitative comparisons reveal that the MYJ followed by BouLac schemes better simulated various features of the thunderstorm events over Kharagpur region. The better performance of MYJ followed by BouLac is evident in the lesser mean bias, mean absolute error, root mean square error and good correlation coefficient for various surface meteorological variables as well as thermo-dynamical structure of the atmosphere relative to other PBL schemes. The better performance of the TKE closures may be attributed to their higher mixing efficiency, larger convective energy and better simulation of humidity promoting moist convection relative to non
Burn care in Los Angeles, California: LAC+USC experience 1994-2004.
Garner, Warren L; Reiss, Matthew
2005-01-01
The LAC+USC Burn Center has admitted 3118 patients for treatment in the last 10 years. A majority of patients were young adults (1868), with the second largest group being small children (543). The ethnicity of the patients reflects the diverse nature of the population of Los Angeles County. Forty-eight percent of injuries were less than 5% TBSA and approximately 2% were greater than 60% TBSA. Eighty-two percent were accidental injuries. Sixty percent of admitted patients underwent skin grafting. Mortality was negligible in the group with burns over less than 10% of their body and very high (15/19), 79% in the most severely burned group. Further, there was a high correlation between age and mortality. Complications during treatment included: deep venous thrombosis 1% per year; pulmonary emboli in 5 patients; endotracheal tube dislodgment early or self-extubation about 1 month (11.3 per year); 4.5 patients per year who developed acute renal failure; abdominal compartment syndrome developed in 4.7 patients each year; heterotopic ossification was seen in 4 patients (0.4%); 4 patients (0.4%) developed stage II-IV pressure sores; hypothermia was present in 0.8% of patients.
Purriños, Laura; Franco, Daniel; Carballo, Javier; Lorenzo, José M
2012-12-01
The effect of the length of salting time on volatile compounds throughout the manufacture of dry-cured "lacón" was studied using a purge-and-trap extraction and GC/MS analysis. For this study, six treatments of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). The total area of volatile compounds increased significantly (P<0.001) as the length of salting time increased. Significant differences were found for the total area of all aldehydes for each salting time at the end of process. Hexanal presented the most relative abundance, showing highest content in HS treatments while LS treatments showed the lowest one at the end of salting, post-salting and drying-ripening stage. The influence of salting time on the content of 3-Octen-2-one was significant on salting stage (P<0.001) and drying-ripening stage (P<0.01). The salting time affected (P<0.001) the relative abundance of esters at the end of salting and at the end of drying-ripening stage. The salting time affected significantly (P<0.001) on alcohols content at the end of drying-ripening process. However, no significant effect of salt level (P>0.05) was detected on total hydrocarbons and total furans at the end of process. Copyright © 2012 Elsevier Ltd. All rights reserved.
Plans of lightning and airglow measurements with LAC/Akatsuki
NASA Astrophysics Data System (ADS)
Takahashi, Yukihiro; Hoshino, Naoya; Sato, Mitsuteru; Yair, Yoav; Galand, Marina; Fukuhara, Tetsuya
Though there are extensive researches on the existence of lightning discharge in Venus over few decades, this issue is still under controversial. Recently it is reported that the magnetometer on board Venus Express detected whistler mode waves whose source could be lightning discharge occurring well below the spacecraft. However, it is too early to determine the origin of these waves. On the other hand, night airglow is expected to provide essential information on the atmospheric circulation in the upper atmosphere of Venus. But the number of consecutive images of airglow obtained by spacecraft is limited and even the variations of most enhanced location is still unknown. In order to identify the discharge phenomena in the atmosphere of Venus separating from noises and to know the daily variation of airglow distribution in night-side disk, we plan to observe the lightning and airglow optical emissions with high-speed and high-sensitivity optical detector with narrow-band filters on board Akatsuki. We are ready to launch the flight model of lightning and airglow detector, LAC (Lightning and Airglow Camera). Main difference from other previous equipments which have provided evidences of lightning existence in Venus is the high-speed sampling rate at 32 us interval for each pixel, enabling us to distinguish the optical lightning flash from other pulsing noises. In this presentation the observation strategies, including ground-based support with optical telescopes, are shown and discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu Jianghua; He Xiangtao; Boettcher, Markus
We present the results of our optical monitoring of the BL Lac object S5 0716+714 over seven nights in 2006 December. The monitoring was carried out simultaneously at three optical wavelengths with a novel photometric system. The object did not show large-amplitude internight variations during this period. Intranight variations were observed on four nights and probably on one more. Strong bluer-when-brighter chromatism was detected on both intranight and internight timescales. The intranight variation amplitude decreases in the wavelength sequence of B', R', and V'. Cross-correlation analyses revealed that the variability at the B' and V' bands leads that at themore » R' band by about 30 minutes on one night.« less
Day, Cristi; Barker, Connie; Bell, Eva; Sefcik, Elizabeth; Flournoy, Deborah
Objective evaluation of distance-based family nurse practitioner (FNP) students can be challenging. One FNP program piloted a teaching innovation, the video-enhanced objective structured clinical examination (VE-OSCE) or "flip" of the traditional face-to-face OSCE, to assess student clinical performance in a controlled online environment using a teleconferencing platform. This project sought to assess the VE-OSCE design, implementation, and ability to identify FNP student learning needs.
Madrazo, Lorenzo; Lee, Claire B; McConnell, Meghan; Khamisa, Karima
2018-06-15
Physicians and medical students are generally poor-self assessors. Research suggests that this inaccuracy in self-assessment differs by gender among medical students whereby females underestimate their performance compared to their male counterparts. However, whether this gender difference in self-assessment is observable in low-stakes scenarios remains unclear. Our study's objective was to determine whether self-assessment differed between male and female medical students when compared to peer-assessment in a low-stakes objective structured clinical examination. Thirty-three (15 males, 18 females) third-year students participated in a 5-station mock objective structured clinical examination. Trained fourth-year student examiners scored their performance on a 6-point Likert-type global rating scale. Examinees also scored themselves using the same scale. To examine gender differences in medical students' self-assessment abilities, mean self-assessment global rating scores were compared with peer-assessment global rating scores using an independent samples t test. Overall, female students' self-assessment scores were significantly lower compared to peer-assessment (p < 0.001), whereas no significant difference was found between self- and peer-assessment scores for male examinees (p = 0.228). This study provides further evidence that underestimation in self-assessment among females is observable even in a low-stakes formative objective structured clinical examination facilitated by fellow medical students.
NASA Astrophysics Data System (ADS)
Limonova, Elena; Tropin, Daniil; Savelyev, Boris; Mamay, Igor; Nikolaev, Dmitry
2018-04-01
In this paper we describe stitching protocol, which allows to obtain high resolution images of long length monochromatic objects with periodic structure. This protocol can be used for long length documents or human-induced objects in satellite images of uninhabitable regions like Arctic regions. The length of such objects can reach notable values, while modern camera sensors have limited resolution and are not able to provide good enough image of the whole object for further processing, e.g. using in OCR system. The idea of the proposed method is to acquire a video stream containing full object in high resolution and use image stitching. We expect the scanned object to have straight boundaries and periodic structure, which allow us to introduce regularization to the stitching problem and adapt algorithm for limited computational power of mobile and embedded CPUs. With the help of detected boundaries and structure we estimate homography between frames and use this information to reduce complexity of stitching. We demonstrate our algorithm on mobile device and show image processing speed of 2 fps on Samsung Exynos 5422 processor
Lanthanum-mediated dehydrogenation of butenes: Spectroscopy and formation of La(C4H6) isomers
NASA Astrophysics Data System (ADS)
Cao, Wenjin; Hewage, Dilrukshi; Yang, Dong-Sheng
2018-01-01
La atom reactions with 1-butene, 2-butene, and isobutene are carried out in a laser-vaporization molecular beam source. The three reactions yield the same La-hydrocarbon products from the dehydrogenation and carbon-carbon bond cleavage and coupling of the butenes. The dehydrogenated species La(C4H6) is the major product, which is characterized with mass-analyzed threshold ionization (MATI) spectroscopy and quantum chemical computations. The MATI spectrum of La(C4H6) produced from the La+1-butene reaction exhibits two band systems, whereas the MATI spectra produced from the La+2-butene and isobutene reactions display only a single band system. Each of these spectra shows a strong origin band and several vibrational progressions. The two band systems from the spectrum of the 1-butene reaction are assigned to the ionization of two isomers: La[C(CH2)3] (Iso A) and La(CH2CHCHCH2) (Iso B), and the single band system from the spectra of the 2-butene and isobutene reactions is attributed to Iso B and Iso A, respectively. The ground electronic states are 2A1 (C3v) for Iso A and 2A' (Cs) for Iso B. The ionization of the doublet state of each isomer removes a La 6s-based electron and leads to the 1A1 ion of Iso A and the 1A' ion of Iso B. The formation of both isomers consists of La addition to the C=C double bond, La insertion into two C(sp3)—H bonds, and H2 elimination. In addition to these steps, the formation of Iso A from the La+1-butene reaction may involve the isomerization of 1-butene to isobutene prior to the C—H bond activation, whereas the formation of Iso B from the La+trans-2-butene reaction may include the trans- to cis-butene isomerization after the C—H bond activation.
The objective structured interview for medical student selection
Powis, D A; Neame, R L B; Bristow, T; Murphy, L B
1988-01-01
An objective structured interview is an integral part of the process of selecting and admitting applicants to study medicine at this university. During the nine years (to the end of 1986) that the interview has been used 1600 candidates were interviewed out of roughly 13 000 applicants, and from these, 584 students were admitted to the course. Analysis of the interview data was carried out based on two aspects of student progress: graduation with honours and failure to complete the course of study. The interview as a whole, and especially some of the subscales, appears to identify students who may fail to complete the course: it may also help to predict which students are likely to graduate with honours. PMID:3126966
A patient safety objective structured clinical examination.
Singh, Ranjit; Singh, Ashok; Fish, Reva; McLean, Don; Anderson, Diana R; Singh, Gurdev
2009-06-01
There are international calls for improving education for health care workers around certain core competencies, of which patient safety and quality are integral and transcendent parts. Although relevant teaching programs have been developed, little is known about how best to assess their effectiveness. The objective of this work was to develop and implement an objective structured clinical examination (OSCE) to evaluate the impact of a patient safety curriculum. The curriculum was implemented in a family medicine residency program with 47 trainees. Two years after commencing the curriculum, a patient safety OSCE was developed and administered at this program and, for comparison purposes, to incoming residents at the same program and to residents at a neighboring residency program. All 47 residents exposed to the training, all 16 incoming residents, and 10 of 12 residents at the neighboring program participated in the OSCE. In a standardized patient case, error detection and error disclosure skills were better among trained residents. In a chart-based case, trained residents showed better performance in identifying deficiencies in care and described more appropriate means of addressing them. Third year residents exposed to a "Systems Approach" course performed better at system analysis and identifying system-based solutions after the course than before. Results suggest increased systems thinking and inculcation of a culture of safety among residents exposed to a patient safety curriculum. The main weaknesses of the study are its small size and suboptimal design. Much further investigation is needed into the effectiveness of patient safety curricula.
NASA Astrophysics Data System (ADS)
Fallah Ramazani, V.; Lindfors, E.; Nilsson, K.
2017-12-01
Aim: We have collected the most complete multi-wavelength (6.0-6.0 × 10-18 cm) dataset of very high energy (VHE) γ-ray emitting (TeV) BL Lacs, which are the most numerous extragalactic VHE sources. Using significant correlations between different bands, we aim to identify the best TeV BL Lac candidates that can be discovered by the current and next generation of imaging air Cherenkov telescopes. Methods: We formed five datasets from lower energy data, i.e. radio, mid-infrared, optical, X-rays, and GeV γ-ray, and five VHE γ-ray datasets to perform a correlation study between different bands and to construct the prediction method. The low energy datasets were averaged for individual sources, while the VHE γ-ray data were divided into subsets according to the flux state of the source. We then looked for significant correlations and determined their best-fit parameters. Using the best-fit parameters we predicted the level of VHE γ-ray flux for a sample of 182 BL Lacs, which have not been detected at TeV energies. We identified the most promising TeV BL Lac candidates based on the predicted VHE γ-ray flux for each source. Results: We found 14 significant correlations between radio, mid-infrared, optical, γ-ray, and VHE γ-ray bands. The correlation between optical and VHE γ-ray luminosity is established for the first time. We attribute this to the more complete sample and more accurate handling of host galaxy flux in our work. We found nine BL Lac candidates whose predicted VHE γ-ray flux is high enough for detection in less than 25 h with current imaging air Cherenkov telescopes. Full Tables A.1 and A.2 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/608/A68
How Category Structure Influences the Perception of Object Similarity: The Atypicality Bias
Tanaka, James William; Kantner, Justin; Bartlett, Marni
2011-01-01
Why do some faces appear more similar than others? Beyond structural factors, we speculate that similarity is governed by the organization of faces located in a multi-dimensional face space. To test this hypothesis, we morphed a typical face with an atypical face. If similarity judgments are guided purely by their physical properties, the morph should be perceived to be equally similar to its typical parent as its atypical parent. However, contrary to the structural prediction, our results showed that the morph face was perceived to be more similar to the atypical face than the typical face. Our empirical studies show that the atypicality bias is not limited to faces, but extends to other object categories (birds) whose members share common shape properties. We also demonstrate atypicality bias is malleable and can change subject to category learning and experience. Collectively, the empirical evidence indicates that perceptions of face and object similarity are affected by the distribution of stimuli in a face or object space. In this framework, atypical stimuli are located in a sparser region of the space where there is less competition for recognition and therefore, these representations capture a broader range of inputs. In contrast, typical stimuli are located in a denser region of category space where there is increased competition for recognition and hence, these representation draw a more restricted range of face inputs. These results suggest that the perceived likeness of an object is influenced by the organization of surrounding exemplars in the category space. PMID:22685441
NASA Technical Reports Server (NTRS)
Peslier, Anne H.; Brandon, Alan D.; Schaffer, Lillian Aurora; O'Reilly, Suzanne Yvette; Griffin, William L.; Morris, Richard V.; Graff, Trevor G.; Agresti, David G.
2014-01-01
The mantle lithosphere beneath the cratonic part of continents is the deepest (> 200 km) and oldest (>2-3 Ga) on Earth, remaining a conundrum as to how these cratonic roots could have resisted delamination by asthenospheric convection over time. Water, or trace H incorporated in mineral defects, could be a key player in the evolution of continental lithosphere because it influences melting and rheology of the mantle. Mantle xenoliths from the Lac de Gras kimberlite in the Slave craton were analyzed by FTIR. The cratonic mantle beneath Lac de Gras is stratified with shallow (<145 km) oxidized ultradepleted peridotites and pyroxenites with evidence for carbonatitic metasomatism, underlain by reduced and less depleted peridotites metasomatized by kimberlite melts. Peridotites analyzed so far have H O contents in ppm weight of 7-100 in their olivines, 58 to 255 in their orthopyroxenes (opx), 11 to 84 in their garnet, and 139 in one clinopyroxene. A pyroxenite contains 58 ppm H2O in opx and 5 ppm H2O in its olivine and garnet. Olivine and garnet from the deep peridotites have a range of water contents extending to higher values than those from the shallow ones. The FTIR spectra of olivines from the shallow samples have more prominent Group II OH bands compared to the olivines from the deep samples, consistent with a more oxidized mantle environment. The range of olivine water content is similar to that observed in Kaapvaal craton peridotites at the same depths (129-184 km) but does not extend to as high values as those from Udachnaya (Siberian craton). The Slave, Kaapvaal and Siberian cratons will be compared in terms of water content distribution, controls and role in cratonic root longevity.
Factor structure of the Spanish version of the Object-Spatial Imagery and Verbal Questionnaire.
Campos, Alfredo; Pérez-Fabello, María José
2011-04-01
The reliability and factor structure of the Spanish version of the Object-Spatial Imagery and Verbal Questionnaire (OSIVQ) were assessed in a sample of 213 Spanish university graduates. The questionnaire measures three types of processing preferences (verbal, object imagery, and spatial imagery). Principal components analysis with varimax rotation identified three factors, corresponding to the three scales proposed in the original version, explaining 33.1% of the overall variance. Cronbach's alphas were .72, .77, and .81 for the verbal, object imagery, and spatial imagery scales, respectively.
ERIC Educational Resources Information Center
Lee, Chia-lin; Middleton, Erica; Mirman, Daniel; Kalenine, Solene; Buxbaum, Laurel J.
2013-01-01
Previous studies suggest that action representations are activated during object processing, even when task-irrelevant. In addition, there is evidence that lexical-semantic context may affect such activation during object processing. Finally, prior work from our laboratory and others indicates that function-based ("use") and structure-based…
AlHoqail, Ibrahim A.; Badr, Fouad M.
2010-01-01
The fact that faculty tutors do have different backgrounds and specialty has been a concern as a factor that contributes to disparity in the delivery of brainstorming session outcomes. This paper aims to introduce a road map in the form of a set of focused objective structured questions (OSBQs) for tutors to follow in brainstorming. Methods Objectively structured questions were generated by the block planning committees. A pilot study was conducted from February 2008 – March 2009 and included groups (44 students) of second and third year undergraduate students of the Faculty of Medicine, King Fahad Medical City. Four indicators were considered to check the validity of the proposed OSBQs; (i) feed back on the perception of medical students experiencing different types of tutorial sessions, (ii) learning objectives achieved under both systems, (iii) student’s performance under the OSBQs and the unguided tutorials and (iv) proper utilization of the time allocated to brainstorming sessions. Results The student’s perception of their satisfaction of implementation of OSBQs was unanimous. Student’s performances were much better in blocks implementing OSBQs. The time allocated for brainstorming sessions was efficiently utilized with the introduction of OSBQs. Conclusion Implementation of OSBQs leads to standardization of tutorial sessions and allows more interaction between students to achieve their learning objectives and score better in their exams. Concern over the role of tutors will diminish. PMID:21475549
Alhoqail, Ibrahim A; Badr, Fouad M
2010-11-01
The fact that faculty tutors do have different backgrounds and specialty has been a concern as a factor that contributes to disparity in the delivery of brainstorming session outcomes. This paper aims to introduce a road map in the form of a set of focused objective structured questions (OSBQs) for tutors to follow in brainstorming. Objectively structured questions were generated by the block planning committees. A pilot study was conducted from February 2008 - March 2009 and included groups (44 students) of second and third year undergraduate students of the Faculty of Medicine, King Fahad Medical City. Four indicators were considered to check the validity of the proposed OSBQs; (i) feed back on the perception of medical students experiencing different types of tutorial sessions, (ii) learning objectives achieved under both systems, (iii) student's performance under the OSBQs and the unguided tutorials and (iv) proper utilization of the time allocated to brainstorming sessions. The student's perception of their satisfaction of implementation of OSBQs was unanimous. Student's performances were much better in blocks implementing OSBQs. The time allocated for brainstorming sessions was efficiently utilized with the introduction of OSBQs. Implementation of OSBQs leads to standardization of tutorial sessions and allows more interaction between students to achieve their learning objectives and score better in their exams. Concern over the role of tutors will diminish.
Bias effects in the possible/impossible object decision test with matching objects.
Soldan, Anja; Hilton, H John; Stern, Yaakov
2009-03-01
In the possible/impossible object decision test, priming has consistently been found for structurally possible, but not impossible, objects, leading Schacter, Cooper, and Delaney (1990) to suggest that priming relies on a system that represents the global 3-D structure of objects. Using a modified design with matching objects to control for the influence of episodic memory, Ratcliff and McKoon (1995) and Williams and Tarr (1997) found negative priming for impossible objects (i.e., lower performance for old than for new items). Both teams argued that priming derives from (1) episodic memory for object features and (2) bias to respond "possible" to encoded objects or their possible parts. The present study applied the matched-objects design to the original Schacter and Cooper stimuli-same possible objects and matching impossible figures-with minimal procedural variation. The data from Experiment 1 only partially supported the bias models and suggested that priming was mediated by both local and global structural descriptions. Experiment 2 showed that negative priming for impossible objects derived from the structural properties of these objects, not from the influence of episodic memory on task performance. Supplemental materials for this study may be downloaded from mc.psychonomic-journals.org/content/supplemental.
Surface radiant flux densities inferred from LAC and GAC AVHRR data
NASA Astrophysics Data System (ADS)
Berger, F.; Klaes, D.
To infer surface radiant flux densities from current (NOAA-AVHRR, ERS-1/2 ATSR) and future meteorological (Envisat AATSR, MSG, METOP) satellite data, the complex, modular analysis scheme SESAT (Strahlungs- und Energieflüsse aus Satellitendaten) could be developed (Berger, 2001). This scheme allows the determination of cloud types, optical and microphysical cloud properties as well as surface and TOA radiant flux densities. After testing of SESAT in Central Europe and the Baltic Sea catchment (more than 400scenes U including a detailed validation with various surface measurements) it could be applied to a large number of NOAA-16 AVHRR overpasses covering the globe.For the analysis, two different spatial resolutions U local area coverage (LAC) andwere considered. Therefore, all inferred results, like global area coverage (GAC) U cloud cover, cloud properties and radiant properties, could be intercompared. Specific emphasis could be made to the surface radiant flux densities (all radiative balance compoments), where results for different regions, like Southern America, Southern Africa, Northern America, Europe, and Indonesia, will be presented. Applying SESAT, energy flux densities, like latent and sensible heat flux densities could also be determined additionally. A statistical analysis of all results including a detailed discussion for the two spatial resolutions will close this study.
Soft X-ray observations of two BL Lacertae objects - Markarian 421 and 501
NASA Technical Reports Server (NTRS)
Singh, K. P.; Garmire, G. P.
1985-01-01
This paper reports on the soft X-ray (0.15-2.8 keV) observations of two BL Lacertae-type objects, viz., Mrk 421 and Mrk 501. The observations were made with the low-energy detectors on the HEAO 1 satellite during the period 1977 August-1978 December. Steep, soft X-ray power-law spectra with photon index Gamma = 3 are found for both Mrk 421 and Mrk 501. The power-law models are found to give a significantly better fit than the thermal models to the observed pulse-height spectra of Mrk 421 and Mrk 501. Day-to-day soft X-ray (0.25 keV band) intensity variations are observed only in Mrk 501. No significant change is found in Gamma from both the BL Lac objects during the period of observations. However, the sum of all the X-ray observations from 1976 until 1980 can be understood in terms of two spectral components of variable intensity to account for the X-ray emission observed between 0.15 and 20 keV from Mrk 421 and Mrk 501.
A structural model for the osmosensor, transporter, and osmoregulator ProP of Escherichia coli.
Wood, Janet M; Culham, Doreen E; Hillar, Alexander; Vernikovska, Yaroslava I; Liu, Feng; Boggs, Joan M; Keates, Robert A B
2005-04-19
Transporter ProP of Escherichia coli, a member of the major facilitator superfamily (MFS), acts as an osmosensor and an osmoregulator in cells and after purification and reconstitution in proteoliposomes. H(+)-osmoprotectant symport via ProP is activated when medium osmolality is elevated with membrane impermeant osmolytes. The three-dimensional structure of ProP was modeled with the crystal structure of MFS member GlpT as a template. This GlpT structure represents the inward (or cytoplasm)-facing conformation predicted by the alternating access model for transport. LacZ-PhoA fusion analysis and site-directed fluorescence labeling substantiated the membrane topology and orientation predicted by this model and most hydropathy analyses. The model predicts the presence of a proton pathway within the N-terminal six-helix bundle of ProP (as opposed to the corresponding pathway found within the C-terminal helix bundle of its paralogue, LacY). Replacement of residues within the N-terminal helix bundle impaired the osmotic activation of ProP, providing the first indication that residues outside the C-terminal domain are involved in osmosensing. Some residues that were accessible from the periplasmic side, as predicted by the structural model, were more susceptible to covalent labeling in permeabilized membrane fractions than in intact bacteria. These residues may be accessible from the cytoplasmic side in structures not represented by our current model, or their limited exposure in vivo may reflect constraints on transporter structure that are related to its osmosensory mechanism.
ERIC Educational Resources Information Center
Lakshmipathy, K.
2015-01-01
The objectives of the present study were to 1) assess student attitudes to physiology, 2) evaluate student opinions about the influence of an objective structured practical examination (OSPE) on competence, and 3) assess the validity and reliability of an indigenously designed feedback questionnaire. A structured questionnaire containing 16 item…
Structural correlates of subjective and objective memory performance in multiple sclerosis.
Pardini, Matteo; Bergamino, Maurizio; Bommarito, Giulia; Bonzano, Laura; Luigi Mancardi, Gian; Roccatagliata, Luca
2014-04-01
Subjective and objective memory deficits represent a frequent and ill-understood aspect of multiple sclerosis (MS), and a significant cause of disability and quality of life reduction. The aim of the study is to verify the role of hippocampal and temporal associative fibers' damage in MS-related memory complaints. To reach this aim, 25 patients with low disability relapsing-remitting MS and 19 healthy controls were included in the study. All subjects underwent 3D T1 structural imaging and Diffusion Tensor Imaging. Additionally, MS patients underwent neuropsychological evaluation of objective (Selective Reminding Test and Spatial Recall Test) and of subjective (Perceived Deficit Questionnaire, Retrospective and Prospective Memory Subscales) memory deficits. Normalized hippocampal volume (NHV) and mean Fractional Anisotropy (FA) for the uncinate fasciculus (UF) and for the ventral division of the cingulum bundle (VCB) were calculated for all subjects. We showed that, compared to controls, MS subjects presented with reduced right NHV and with reduced mean FA bilaterally in the UF and the VCB. In the MS group, verbal memory scores correlated with left NHV, spatial memory scores correlated with right NHV, while perceived retrospective and prospective memory deficits correlated with left VCB and left UF mean FA respectively. Our data confirm an early involvement of memory-related brain structures in MS patients. Our data suggest that verbal and nonverbal memory as well as perceived retrospective and prospective memory deficits are related to alterations of discrete anatomical structures in the low-disability phase of MS. Copyright © 2013 Wiley Periodicals, Inc.
Alves, Anderson Luis; de Borba, Rafael Splendore; Oliveira, Claudio; Mauro Nirchio; Granado, Angel; Foresti, Fausto
2012-01-01
Abstract The family Loricariidae with 813 nominal species is one of the largest fish families of the world. Hypostominae, its more complex subfamily, was recently divided into five tribes. The tribe Hypostomini is composed of a single genus, Hypostomus Lacépède, 1803, which exhibits the largest karyotypic diversity in the family Loricariidae. With the main objective of contributing to a better understanding of the relationship and the patterns of evolution among the karyotypes of Hypostomus species, cytogenetic studies were conducted in six species of the genus from Brazil and Venezuela. The results show a great chromosome variety with diploid numbers ranging from 2n=68 to 2n=76, with a clear predominance of acrocentric chromosomes. The Ag-NORs are located in terminal position in all species analyzed. Three species have single Ag-NORs (Hypostomus albopunctatus (Regan, 1908), Hypostomus prope plecostomus (Linnaeus, 1758), and Hypostomus prope paulinus (Ihering, 1905)) and three have multiple Ag-NORs (Hypostomus ancistroides (Ihering, 1911), Hypostomus prope iheringi (Regan, 1908), and Hypostomus strigaticeps (Regan, 1908)). In the process of karyotype evolution of the group, the main type of chromosome rearrangements was possibly centric fissions, which may have been facilitated by the putative tetraploid origin of Hypostomus species. The relationship between the karyotype changes and the evolution in the genus is discussed. PMID:24260683
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bouchard, A.R.; Gagnon, M.J.
1987-01-01
The lowbush blueberry (Vaccinium angustifolium Ait.) is an important commercial crop of the Lac-Saint-Jean area (Quebec, Canada). The major blueberry fields are located on sandy soils relatively poor in available mineral nutrients. The nutrients originate from a thin organic layer found on the top of these sandy soils. The leaf mineral contents (N, P, K, Mg, Ca, Mn, Fe, Cu, Zn and B) were measured in five blueberry fields during 1984 and 1985. Soil pH and soil available P, K, and Mg were also assessed. The results show that the leaf mineral contents are generally adequate. However, K and Znmore » might be occasionally deficient when compared to the actual established standards. The available Mg in soil was significantly correlated with the leaf Mg concentration. The data also suggest that the influence of the pH following the burn pruning seems to influence the nutrition of this species.« less
The physical properties and orbital parameters of the triple system V402 Lac
NASA Astrophysics Data System (ADS)
Hoyman, B.; Kalomeni, B.; Yakut, K.
2018-04-01
We present first ground-based multi-colors photometric study of an eccentric, double-lined eclipsing binary system V402 Lac. Analyzing the data obtained in this study together with earlier studies in the literature we derived the orbital and physical parameters of this detached binary system of considerable interest. Derived physical parameters of the components are as follows; M1 = 2.95 ± 0.06M⊙ , M2 = 2.86 ± 0.06M⊙ , R1 = 2.61 ± 0.04R⊙ , R2 = 2.16 ± 0.03R⊙ , L1 = 98 ± 5L⊙ and L2 = 69 ± 3L⊙ . Using the newly obtained parameters the distance of the binary is determined to be 262 ± 33 pc. In addition, the system show apsidal motion whose period is determined to be 213 years. A possible third star (M3 sin i = 1.9M⊙) orbiting the binary system in an eccentric orbit (e = 0.23) with an orbital period of 20.5 years has been detected in this study with LTT.
Osadchuk, L V; Gutorova, N V; Kleshchev, M A
2014-04-01
Social dominance can alter testicular testosterone production, although there is pronounced variability in the relationship between social status and pattern of the testosterone response. The study designed to investigate how a long-term period of stable social hierarchy effects on testicular testosterone production in male mice of inbred strains PT and CBA/Lac. Paired males of different genotypes were housed together for 32 days beginning 38 day of age. Dyadic interactions of males generated dominance-subordination relationships during the first day after a social group has been produced and the social rank of each opponent was assessed by asymmetry in agonistic behaviour. Serum level of testosterone and its testicular content were evaluated in male mice of both inbred strains at 70 day of age after pair housing. Control animals were age- and genotype-matched single males that were housed in conventional cages. After a long-term period of pair housing, the serum testosterone level and its testicular content in males of both PT and CBA/Lac strains were not significantly different from the control. There were no significant differences in androgenic parameters between social ranks in male mice of both strains. The results indicate that in laboratory mice the pattern of testicular testosterone response to social hierarchy determined by a social situation, for example, a stability of social interactions, when the importance of aggressive competition for rank is minimal.
ERIC Educational Resources Information Center
Bagri, Anita S.; Zaw, Khin M.; Milanez, Marcos N.; Palacios, Juan J.; Qadri, Syeda S.; Bliss, Linda A.; Roos, Bernard A.; Ruiz, Jorge G.
2009-01-01
A total of 8 geriatric medicine fellows participated in an objective structured clinical examination (OSCE) assessing communication skills and clinical reasoning in common geriatric syndromes. To determine their perceptions about the experience, we conducted surveys and semistructured interviews. We analyzed the survey data using descriptive…
Student assessment by objective structured examination in a neurology clerkship
Adesoye, Taiwo; Smith, Sandy; Blood, Angela; Brorson, James R.
2012-01-01
Objectives: We evaluated the reliability and predictive ability of an objective structured clinical examination (OSCE) in the assessment of medical students at the completion of a neurology clerkship. Methods: We analyzed data from 195 third-year medical students who took the OSCE. For each student, the OSCE consisted of 2 standardized patient encounters. The scores obtained from each encounter were compared. Faculty clinical evaluations of each student for 2 clinical inpatient rotations were also compared. Hierarchical regression analysis was applied to test the ability of the averaged OSCE scores to predict standardized written examination scores and composite clinical scores. Results: Students' OSCE scores from the 2 standardized patient encounters were significantly correlated with each other (r = 0.347, p < 0.001), and the scores for all students were normally distributed. In contrast, students' faculty clinical evaluation scores from 2 different clinical inpatient rotations were uncorrelated, and scores were skewed toward the highest ratings. After accounting for clerkship order, better OSCE scores were predictive of better National Board of Medical Examiners standardized examination scores (R2Δ = 0.131, p < 0.001) and of better faculty clinical scores (R2Δ = 0.078, p < 0.001). Conclusions: Student assessment by an OSCE provides a reliable and predictive objective assessment of clinical performance in a neurology clerkship. PMID:22855865
NASA Astrophysics Data System (ADS)
Tappe, Sebastian; Graham Pearson, D.; Kjarsgaard, Bruce A.; Nowell, Geoff; Dowall, David
2013-06-01
Late Cretaceous-Eocene kimberlites from the Lac de Gras area, central Slave craton, show the most extreme Nd-Hf isotope decoupling observed for kimberlites worldwide. They are characterized by a narrow range of moderately enriched Nd isotope compositions (ɛNd(i)=-0.4 to -3.5) that contrasts strongly with their moderately depleted to highly enriched ɛHf(i) values (+3.9 to -9.9). Although digestion of cratonic mantle material in proto-kimberlite melt can theoretically produce steep arrays in Nd-Hf isotope space, the amount of contaminant required to explain the Lac de Gras data is unrealistic. Instead, it is more plausible that mixing of compositionally discrete melt components within an isotopically variable source region is responsible for the steep Nd-Hf isotope array. As development of strongly negative ΔɛHf requires isotopic aging of a precursor material with Sm/Nd≫Lu/Hf for billion-year timescales, a number of models have been proposed where ancient MORB crust trapped in the mantle transition zone is the ultimate source of the extreme Hf isotope signature. However, we provide a conceptual modification and demonstrate that OIB-type domains within ancient subducted oceanic lithosphere can produce much stronger negative ΔɛHf during long-term isolation. Provided that these OIB-type domains have lower melting points compared with associated MORB crust, they are among the first material to melt within the transition zone during thermal perturbations. The resulting hydrous alkali silicate melts react strongly with depleted peridotite at the top of the transition zone and transfer negative ΔɛHf signatures to less dense materials, which can be more easily entrained within upward flowing mantle. Once these entrained refertilized domains rise above 300 km depth, they may become involved in CO2- and H2O-fluxed redox melting of upper mantle peridotite beneath a thick cratonic lid. We argue that incorporation of ancient transition zone material, which includes
2013-01-01
Background Synthesized arylidene derivatives of rhodanine and 2,4-thiazolidiendione have potent pharmacological activities, and these are also key substrates for the preparation of clinically used antidiabetics. Findings Some 1,1,3,3-tetramethylguanidine-based task-specific ionic liquids (TSILs) 1a-1e were prepared and employed to the catalyzed solvent-free Knoevenagel condensation of 2,4-thiazolidinedione 3a and rhodanine 3b with a variety of aldehydes. Conclusions Best results were obtained with 1,1,3,3-tetramethylguanidine lactate ([TMG][Lac]) 1c. The TSIL used can be easily recovered and recycled, yielding products 4–5 in excellent yields under ultrasonic environment without the formation of any side products or toxic waste. PMID:23458122
Suresh; Sandhu, Jagir Singh
2013-03-03
Synthesized arylidene derivatives of rhodanine and 2,4-thiazolidiendione have potent pharmacological activities, and these are also key substrates for the preparation of clinically used antidiabetics. Some 1,1,3,3-tetramethylguanidine-based task-specific ionic liquids (TSILs) 1a-1e were prepared and employed to the catalyzed solvent-free Knoevenagel condensation of 2,4-thiazolidinedione 3a and rhodanine 3b with a variety of aldehydes. Best results were obtained with 1,1,3,3-tetramethylguanidine lactate ([TMG][Lac]) 1c. The TSIL used can be easily recovered and recycled, yielding products 4-5 in excellent yields under ultrasonic environment without the formation of any side products or toxic waste.
Active galaxies observed during the Extreme Ultraviolet Explorer all-sky survey
NASA Technical Reports Server (NTRS)
Marshall, H. L.; Fruscione, A.; Carone, T. E.
1995-01-01
We present observations of active galactic nuclei (AGNs) obtained with the Extreme Ultraviolet Explorer (EUVE) during the all-sky survey. A total of 13 sources were detected at a significance of 2.5 sigma or better: seven Seyfert galaxies, five BL Lac objects, and one quasar. The fraction of BL Lac objects is higher in our sample than in hard X-ray surveys but is consistent with the soft X-ray Einstein Slew Survey, indicating that the main reason for the large number of BL Lac objects in the extreme ulktraviolet (EUV) and soft X-ray bands is their steeper X-ray spectra. We show that the number of AGNs observed in both the EUVE and ROSAT Wide Field Camera surveys can readily be explained by modelling the EUV spectra with a simple power law in the case of BL Lac objects and with an additional EUV excess in the case of Seyferts and quasars. Allowing for cold matter absorption in Seyfert galaxy hosts drive up the inferred average continuum slope to 2.0 +/- 0.5 (at 90% confidence), compared to a slope of 1.0 usually found from soft X-ray data. If Seyfert galaxies without EUV excesses form a significant fraction of the population, then the average spectrum of those with bumps should be even steeper. We place a conservative limit on neutral gas in BL Lac objects: N(sub H) less than 10(exp 20)/sq cm.
NASA Astrophysics Data System (ADS)
Ito, E.; Myrbo, A.; Dalbotten, D. M.; Pellerin, H.; Greensky, L.; Howes, T.; Wold, A.; McEathron, M. A.; Shanker, V.
2010-12-01
The manoomin project is a collaboration between Fond du Lac Tribal and Community College (Cloquet, MN), the Reservation’s Resource Management Division, and the University of Minnesota funded by the NSF GEO-OEDG Program. It builds on a successful seven-year history of collaboration between these parties, including regular science camps (gidaakiimanaanimigawig, Our Earth Lodge) for students of a wide range of ages. We are working as a team with Native students to study the history of wild rice (manoomin; Zizania palustris), a culturally important resource, growing on Reservation lakes. The joint project takes two main approaches: study of sediment core samples collected from Reservation lakes; and the collection of traditional knowledge about wild rice from the Elders. Science campers collect lake cores during winter with the assistance of the U of MN’s LacCore (National Lacustrine Core Facility) and Resource Management and visit LacCore to log, split and describe cores soon thereafter. Academic mentors with a range of specialties (phytoliths, pollen, plant macrofossils, sedimentology, geochemistry, magnetics) spend 1-2 weeks during the summer with small groups of college-age (>18, many nontraditional) student interns working on a particular paleoenvironmental proxy from the sediment cores. Younger students (middle and high school) also work in small teams in half day units with the same mentors. All campers become comfortable in an academic setting, gain experience working in research labs learning and practicing techniques, and jointly interpret collective results. The continuation of the project over five years (2009-2014) will allow these students to develop relationships with scientists and to receive mentoring beyond the laboratory as they make transitions into 2- and 4-year colleges and into graduate school. Their research provides historical and environmental information that is relevant to their own land that will be used by Resource Management which is
Learning to explore the structure of kinematic objects in a virtual environment
Buckmann, Marcus; Gaschler, Robert; Höfer, Sebastian; Loeben, Dennis; Frensch, Peter A.; Brock, Oliver
2015-01-01
The current study tested the quantity and quality of human exploration learning in a virtual environment. Given the everyday experience of humans with physical object exploration, we document substantial practice gains in the time, force, and number of actions needed to classify the structure of virtual chains, marking the joints as revolute, prismatic, or rigid. In line with current work on skill acquisition, participants could generalize the new and efficient psychomotor patterns of object exploration to novel objects. On the one hand, practice gains in exploration performance could be captured by a negative exponential practice function. On the other hand, they could be linked to strategies and strategy change. After quantifying how much was learned in object exploration and identifying the time course of practice-related gains in exploration efficiency (speed), we identified what was learned. First, we identified strategy components that were associated with efficient (fast) exploration performance: sequential processing, simultaneous use of both hands, low use of pulling rather than pushing, and low use of force. Only the latter was beneficial irrespective of the characteristics of the other strategy components. Second, we therefore characterized efficient exploration behavior by strategies that simultaneously take into account the abovementioned strategy components. We observed that participants maintained a high level of flexibility, sampling from a pool of exploration strategies trading the level of psycho-motoric challenges with exploration speed. We discuss the findings pursuing the aim of advancing intelligent object exploration by combining analytic (object exploration in humans) and synthetic work (object exploration in robots) in the same virtual environment. PMID:25904878
ERIC Educational Resources Information Center
Zahid, Muhammad Ajmal; Al-Zayed, Adel; Ohaeri, Jude; Varghese, Ramani
2011-01-01
Objective: The Objective Structured Clinical Examination (OSCE) was introduced in undergraduate psychiatry clerkship in 2008. The authors studied the effect of OSCE on the students' performance. Methods: The "short case" (SC) and "oral examination" (OE), two of the five components of the previous assessment format, were…
Neurology objective structured clinical examination reliability using generalizability theory
Park, Yoon Soo; Lukas, Rimas V.; Brorson, James R.
2015-01-01
Objectives: This study examines factors affecting reliability, or consistency of assessment scores, from an objective structured clinical examination (OSCE) in neurology through generalizability theory (G theory). Methods: Data include assessments from a multistation OSCE taken by 194 medical students at the completion of a neurology clerkship. Facets evaluated in this study include cases, domains, and items. Domains refer to areas of skill (or constructs) that the OSCE measures. G theory is used to estimate variance components associated with each facet, derive reliability, and project the number of cases required to obtain a reliable (consistent, precise) score. Results: Reliability using G theory is moderate (Φ coefficient = 0.61, G coefficient = 0.64). Performance is similar across cases but differs by the particular domain, such that the majority of variance is attributed to the domain. Projections in reliability estimates reveal that students need to participate in 3 OSCE cases in order to increase reliability beyond the 0.70 threshold. Conclusions: This novel use of G theory in evaluating an OSCE in neurology provides meaningful measurement characteristics of the assessment. Differing from prior work in other medical specialties, the cases students were randomly assigned did not influence their OSCE score; rather, scores varied in expected fashion by domain assessed. PMID:26432851
ERIC Educational Resources Information Center
Bogo, Marion; Regehr, Cheryl; Logie, Carmen; Katz, Ellen; Mylopoulos, Maria; Regehr, Glenn
2011-01-01
The development of standardized, valid, and reliable methods for assessment of students' practice competence continues to be a challenge for social work educators. In this study, the Objective Structured Clinical Examination (OSCE), originally used in medicine to assess performance through simulated interviews, was adapted for social work to…
Stellar structure and compact objects before 1940: Towards relativistic astrophysics
NASA Astrophysics Data System (ADS)
Bonolis, Luisa
2017-06-01
Since the mid-1920s, different strands of research used stars as "physics laboratories" for investigating the nature of matter under extreme densities and pressures, impossible to realize on Earth. To trace this process this paper is following the evolution of the concept of a dense core in stars, which was important both for an understanding of stellar evolution and as a testing ground for the fast-evolving field of nuclear physics. In spite of the divide between physicists and astrophysicists, some key actors working in the cross-fertilized soil of overlapping but different scientific cultures formulated models and tentative theories that gradually evolved into more realistic and structured astrophysical objects. These investigations culminated in the first contact with general relativity in 1939, when J. Robert Oppenheimer and his students George Volkoff and Hartland Snyder systematically applied the theory to the dense core of a collapsing neutron star. This pioneering application of Einstein's theory to an astrophysical compact object can be regarded as a milestone in the path eventually leading to the emergence of relativistic astrophysics in the early 1960s.
Use of an Objective Structured Clinical Examination in Clinical Nurse Specialist Education.
Cuevas, Heather E; Timmerman, Gayle M
2016-01-01
Helping patients maximize their potential using expert coaching to facilitate lifestyle change is an important practice area for clinical nurse specialists (CNSs). The purpose is to determine the usefulness of objective structured clinical examinations (OSCEs) for evaluating CNS students' coaching competencies in the context of facilitating lifestyle change. Despite the use of OSCEs to assess competencies in clinical skills (eg, performance of procedures, decision making), its potential for evaluating coaching competencies for lifestyle change has not been demonstrated. We developed 4 OSCEs dealing with coaching patients in exercise, weight loss, stress reduction, or nonpharmacologic management of hyperlipidemia. Evaluation criteria included (1) approach to the patient, (2) information gathering, (3) motivational interviewing, and (4) management (medical and behavioral strategies). Student performance ranged from highly organized with proficient coaching skills to disorganized and focused solely on clinical management and prescriptive communication. Student responses were positive. Objective structured clinical examinations were highly useful for evaluating CNS students' coaching competencies for lifestyle change. Using OSCEs early in the semester to provide students feedback on their performance and again at the end to determine improvement optimizes use of this teaching strategy.
ERIC Educational Resources Information Center
Miller, John K.
2010-01-01
The field of marriage and family therapy (MFT) has recently engaged in the process of defining core competencies for the profession. Many MFT training programs are adapting their curriculum to develop more competency-based training strategies. The Objective Structured Clinical "Examination" (OSCE) is widely used in the medical profession to assess…
Peterson, M A; de Gelder, B; Rapcsak, S Z; Gerhardstein, P C; Bachoud-Lévi, A
2000-01-01
In three experiments we investigated whether conscious object recognition is necessary or sufficient for effects of object memories on figure assignment. In experiment 1, we examined a brain-damaged participant, AD, whose conscious object recognition is severely impaired. AD's responses about figure assignment do reveal effects from memories of object structure, indicating that conscious object recognition is not necessary for these effects, and identifying the figure-ground test employed here as a new implicit test of access to memories of object structure. In experiments 2 and 3, we tested a second brain-damaged participant, WG, for whom conscious object recognition was relatively spared. Nevertheless, effects from memories of object structure on figure assignment were not evident in WG's responses about figure assignment in experiment 2, indicating that conscious object recognition is not sufficient for effects of object memories on figure assignment. WG's performance sheds light on AD's performance, and has implications for the theoretical understanding of object memory effects on figure assignment.
NASA Astrophysics Data System (ADS)
Schön, Peter; Prokop, Alexander; Naaim-Bouvet, Florence; Nishimura, Kouichi; Vionnet, Vincent; Guyomarc'h, Gilbert
2014-05-01
Wind and the associated snow drift are dominating factors determining the snow distribution and accumulation in alpine areas, resulting in a high spatial variability of snow depth that is difficult to evaluate and quantify. The terrain-based parameter Sx characterizes the degree of shelter or exposure of a grid point provided by the upwind terrain, without the computational complexity of numerical wind field models. The parameter has shown to qualitatively predict snow redistribution with good reproduction of spatial patterns, but has failed to quantitatively describe the snow redistribution, and correlations with measured snow heights were poor. The objective of our research was to a) identify the sources of poor correlations between predicted and measured snow re-distribution and b) improve the parameters ability to qualitatively and quantitatively describe snow redistribution in our research area, the Col du Lac Blanc in the French Alps. The area is at an elevation of 2700 m and particularly suited for our study due to its constant wind direction and the availability of data from a meteorological station. Our work focused on areas with terrain edges of approximately 10 m height, and we worked with 1-2 m resolution digital terrain and snow surface data. We first compared the results of the terrain-based parameter calculations to measured snow-depths, obtained by high-accuracy terrestrial laser scan measurements. The results were similar to previous studies: The parameter was able to reproduce observed patterns in snow distribution, but regression analyses showed poor correlations between terrain-based parameter and measured snow-depths. We demonstrate how the correlations between measured and calculated snow heights improve if the parameter is calculated based on a snow surface model instead of a digital terrain model. We show how changing the parameter's search distance and how raster re-sampling and raster smoothing improve the results. To improve the parameter
a Point Cloud Classification Approach Based on Vertical Structures of Ground Objects
NASA Astrophysics Data System (ADS)
Zhao, Y.; Hu, Q.; Hu, W.
2018-04-01
This paper proposes a novel method for point cloud classification using vertical structural characteristics of ground objects. Since urbanization develops rapidly nowadays, urban ground objects also change frequently. Conventional photogrammetric methods cannot satisfy the requirements of updating the ground objects' information efficiently, so LiDAR (Light Detection and Ranging) technology is employed to accomplish this task. LiDAR data, namely point cloud data, can obtain detailed three-dimensional coordinates of ground objects, but this kind of data is discrete and unorganized. To accomplish ground objects classification with point cloud, we first construct horizontal grids and vertical layers to organize point cloud data, and then calculate vertical characteristics, including density and measures of dispersion, and form characteristic curves for each grids. With the help of PCA processing and K-means algorithm, we analyze the similarities and differences of characteristic curves. Curves that have similar features will be classified into the same class and point cloud correspond to these curves will be classified as well. The whole process is simple but effective, and this approach does not need assistance of other data sources. In this study, point cloud data are classified into three classes, which are vegetation, buildings, and roads. When horizontal grid spacing and vertical layer spacing are 3 m and 1 m respectively, vertical characteristic is set as density, and the number of dimensions after PCA processing is 11, the overall precision of classification result is about 86.31 %. The result can help us quickly understand the distribution of various ground objects.
Wikander, Lolita; Bouchoucha, Stéphane L
2018-01-01
Adapting a course from face to face to blended delivery necessitates that assessments are modified accordingly. In Australia the Objective Structured Clinical Assessment tool, as a derivative from the Objective Structured Clinical Examination, has been used in the face-to-face delivery mode as a formative or summative assessment tool in medicine and nursing since 1990. The Objective Structured Clinical Assessment has been used at Charles Darwin University to assess nursing students' simulated clinical skills prior to the commencement of their clinical placements since 2008. Although the majority of the course is delivered online, students attend a one-week intensive clinical simulation block yearly, prior to attending clinical placements. Initially, the Objective Structured Clinical Assessment was introduced as a lecturer assessed summative assessment, over time it was adapted to better suit the blended learning environment. The modification of the tool from an academic to peer assessed assessment tool, was based on the empirical literature, student feedback and a cross-sectional, qualitative study exploring academics' perceptions of the Objective Structured Clinical Assessment (Bouchoucha et al., 2013a, b). This paper presents an overview of the process leading to the successful adaptation of the Objective Structured Clinical Assessment to suit the requirements of a preregistration nursing course delivered through blended learning. This is significant as many universities are moving their curriculum to fully online or blended delivery, yet little attention has been paid to adapting the assessment of simulated clinical skills. The aim is to identify the benefits and drawbacks of using the peer assessed Objective Structured Clinical Assessment and share recommendations for successful implementation. Copyright © 2017 Elsevier Ltd. All rights reserved.
{gamma}-RAY AND PARSEC-SCALE JET PROPERTIES OF A COMPLETE SAMPLE OF BLAZARS FROM THE MOJAVE PROGRAM
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lister, M. L.; Hovatta, T.; Aller, M.
We investigate the Fermi Large Area Telescope {gamma}-ray and 15 GHz Very Long Baseline Array radio properties of a joint {gamma}-ray and radio-selected sample of active galactic nuclei (AGNs) obtained during the first 11 months of the Fermi mission (2008 August 4-2009 July 5). Our sample contains the brightest 173 AGNs in these bands above declination -30 Degree-Sign during this period, and thus probes the full range of {gamma}-ray loudness ({gamma}-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least 4 orders of magnitude, reflecting a wide range of spectral energy distribution (SED)more » parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing {gamma}-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the {gamma}-ray emission in these BL Lac objects over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED-peak-{gamma}-ray-loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQs) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lac objects have generally lower Doppler factors than the lower-synchrotron peaked BL Lac objects or FSRQs in our sample.« less
γ-Ray and Parsec-scale Jet Properties of a Complete Sample of Blazars From the MOJAVE Program
NASA Astrophysics Data System (ADS)
Lister, M. L.; Aller, M.; Aller, H.; Hovatta, T.; Kellermann, K. I.; Kovalev, Y. Y.; Meyer, E. T.; Pushkarev, A. B.; Ros, E.; MOJAVE Collaboration; Ackermann, M.; Antolini, E.; Baldini, L.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bechtol, K.; Bellazzini, R.; Berenji, B.; Blandford, R. D.; Bloom, E. D.; Boeck, M.; Bonamente, E.; Borgland, A. W.; Bregeon, J.; Brigida, M.; Bruel, P.; Buehler, R.; Buson, S.; Caliandro, G. A.; Cameron, R. A.; Caraveo, P. A.; Casandjian, J. M.; Cavazzuti, E.; Cecchi, C.; Chang, C. S.; Charles, E.; Chekhtman, A.; Cheung, C. C.; Chiang, J.; Ciprini, S.; Claus, R.; Cohen-Tanugi, J.; Conrad, J.; Cutini, S.; de Palma, F.; Dermer, C. D.; Silva, E. do Couto e.; Drell, P. S.; Drlica-Wagner, A.; Favuzzi, C.; Fegan, S. J.; Ferrara, E. C.; Finke, J.; Focke, W. B.; Fortin, P.; Fukazawa, Y.; Fusco, P.; Gargano, F.; Gasparrini, D.; Gehrels, N.; Germani, S.; Giglietto, N.; Giordano, F.; Giroletti, M.; Glanzman, T.; Godfrey, G.; Grenier, I. A.; Guiriec, S.; Hadasch, D.; Hayashida, M.; Hays, E.; Horan, D.; Hughes, R. E.; Jóhannesson, G.; Johnson, A. S.; Kadler, M.; Katagiri, H.; Kataoka, J.; Knödlseder, J.; Kuss, M.; Lande, J.; Longo, F.; Loparco, F.; Lott, B.; Lovellette, M. N.; Lubrano, P.; Madejski, G. M.; Mazziotta, M. N.; McConville, W.; McEnery, J. E.; Mehault, J.; Michelson, P. F.; Mizuno, T.; Monte, C.; Monzani, M. E.; Morselli, A.; Moskalenko, I. V.; Murgia, S.; Naumann-Godo, M.; Nishino, S.; Nolan, P. L.; Norris, J. P.; Nuss, E.; Ohno, M.; Ohsugi, T.; Okumura, A.; Omodei, N.; Orlando, E.; Ozaki, M.; Paneque, D.; Parent, D.; Pesce-Rollins, M.; Pierbattista, M.; Piron, F.; Pivato, G.; Rainò, S.; Readhead, A.; Reimer, A.; Reimer, O.; Richards, J. L.; Ritz, S.; Sadrozinski, H. F.-W.; Sgrò, C.; Shaw, M. S.; Siskind, E. J.; Spandre, G.; Spinelli, P.; Takahashi, H.; Tanaka, T.; Thayer, J. G.; Thayer, J. B.; Thompson, D. J.; Tosti, G.; Tramacere, A.; Troja, E.; Usher, T. L.; Vandenbroucke, J.; Vasileiou, V.; Vianello, G.; Vitale, V.; Waite, A. P.; Wang, P.; Winer, B. L.; Wood, K. S.; Zimmer, S.; Fermi LAT Collaboration
2011-11-01
We investigate the Fermi Large Area Telescope γ-ray and 15 GHz Very Long Baseline Array radio properties of a joint γ-ray and radio-selected sample of active galactic nuclei (AGNs) obtained during the first 11 months of the Fermi mission (2008 August 4-2009 July 5). Our sample contains the brightest 173 AGNs in these bands above declination -30° during this period, and thus probes the full range of γ-ray loudness (γ-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least 4 orders of magnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing γ-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the γ-ray emission in these BL Lac objects over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED-peak-γ-ray-loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQs) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lac objects have generally lower Doppler factors than the lower-synchrotron peaked BL Lac objects or FSRQs in our sample.
Parallel checksumming of data chunks of a shared data object using a log-structured file system
Bent, John M.; Faibish, Sorin; Grider, Gary
2016-09-06
Checksum values are generated and used to verify the data integrity. A client executing in a parallel computing system stores a data chunk to a shared data object on a storage node in the parallel computing system. The client determines a checksum value for the data chunk; and provides the checksum value with the data chunk to the storage node that stores the shared object. The data chunk can be stored on the storage node with the corresponding checksum value as part of the shared object. The storage node may be part of a Parallel Log-Structured File System (PLFS), and the client may comprise, for example, a Log-Structured File System client on a compute node or burst buffer. The checksum value can be evaluated when the data chunk is read from the storage node to verify the integrity of the data that is read.
Polarimetry of optically selected BL Lacertae candidates from the SDSS
NASA Astrophysics Data System (ADS)
Heidt, J.; Nilsson, K.
2011-05-01
We present and discuss polarimetric observations of 182 targets drawn from an optically selected sample of 240 probable BL Lac candidates out of the SDSS compiled by Collinge et al. (2005, AJ, 129, 2542). In contrast to most other BL Lac candidate samples extracted from the SDSS, its radio- and/or X-ray properties have not been taken into account for its derivation. Thus, because its selection is based on optical properties alone, it may be less prone to selection effects inherent in other samples derived at different frequencies, so it offers a unique opportunity to extract the first unbiased BL Lac luminosity function that is suitably large in size. We found 124 out of 182 targets (68%) to be polarized, 95 of the polarized targets (77%) to be highly polarized (>4%). The low-frequency peaked BL Lac candidates in the sample are on average only slightly more polarized than the high-frequency peaked ones. Compared to earlier studies, we found a high duty cycle in high polarization (˜ 66+2-14% to be >4% polarized) in high-frequency peaked BL Lac candidates. This may come from our polarization analysis, which minimizes the contamination by host galaxy light. No evidence of radio-quiet BL Lac objects in the sample was found. Our observations show that the probable sample of BL Lac candidates of Collinge et al. (2005) indeed contains a large number of bona fide BL Lac objects. High S/N spectroscopy and deep X-ray observations are required to construct the first luminosity function of optically selected BL Lac objects and to test more stringently for any radio-quiet BL Lac objects in the sample. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory in the course of the observing proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Andalucia (CSIC).Based on observations
ERRATIC FLARING OF BL LAC IN 2012–2013: MULTIWAVELENGTH OBSERVATIONS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wehrle, Ann E.; Grupe, Dirk; Jorstad, Svetlana G.
2016-01-10
BL Lac, the eponymous blazar, flared to historically high levels at millimeter, infrared, X-ray, and gamma-ray wavelengths in 2012. We present observations made with Herschel, Swift, NuSTAR, Fermi, the Submillimeter Array, CARMA, and the VLBA in 2012–2013, including three months with nearly daily sampling at several wavebands. We have also conducted an intensive campaign of 30 hr with every-orbit observations by Swift and NuSTAR, accompanied by Herschel, and Fermi observations. The source was highly variable at all bands. Time lags, correlations between bands, and the changing shapes of the spectral energy distributions can be explained by synchrotron radiation and inversemore » Compton emission from nonthermal seed photons originating from within the jet. The passage of four new superluminal very long baseline interferometry knots through the core and two stationary knots about 4 pc downstream accompanied the high flaring in 2012–2013. The seed photons for inverse Compton scattering may arise from the stationary knots and from a Mach disk near the core where relatively slow-moving plasma generates intense nonthermal radiation. The 95 spectral energy distributions obtained on consecutive days form the most densely sampled, broad wavelength coverage for any blazar. The observed spectral energy distributions and multi-waveband light curves are similar to simulated spectral energy distributions and light curves generated with a model in which turbulent plasma crosses a conical shock with a Mach disk.« less
NASA Astrophysics Data System (ADS)
Mueller, Wulf; Chown, E. H.; Potvin, Robin
1994-05-01
Volcaniclastic deposits of the 2.3-km-thick Archean Lac des Vents volcanic complex are an integral part of major submarine volcanic construction. The volcanic edifice, which formed on a subaqueous basalt plain, is comparable to modern seamounts resting on the ocean floor. The initial 770 m of the mafic-felsic edifice, subject of this study, is composed of massive, brecciated and pillowed basalts, massive to brecciated felsic lava flows and abundant felsic fragmental rocks of hydroclastic origin. Four distinct volcaniclastic lithofacies constitute the latter: (1) the pumice lapilli-tuff lithofacies; (2) the lapilli-tuff breccia lithofacies characterized by two sublithofacies; (3) the turbidite tuff and tuff-breccia lithofacies; and (4) the volcanic sandstone and breccia lithofacies. These four volcaniclastic lithofacies are considered to be the result of explosive and non-explosive hydrovolcanic fragmentation processes operating at depths below storm wave base (> 200 m). Primary deposition or limited remobilization of unconsolidated hydroclastic debris is shown by the preservation of delicate clasts and volcanic textures, and heat retention structures. The principal transport agents are high-concentration sediment gravity flows occurring under laminar and turbulent flow conditions. High- and low-density turbiditic tuffs and fine-grained tuff fallout deposits, are related to either the dissipating stages of volcanic eruptions or slumping of syneruptive volcanic debris on the flanks of a subaqueous volcanic edifice. Ubiquitous interstratification of volcaniclastic turbidites, shale, and pillowed basalt flows with the felsic lava flows and fragmental debris favours subaqueous deposition. These features combined with the absence of wave-induced sedimentary structures, imply deposition in water depths in excess of 200 m. Viscous feldspar-phyric massive and brecciated felsic flows, and associated volcaniclastics cross cut by felsic dykes, suggest vent proximity. The
Urteaga, Elizabeth M; Attridge, Rebecca L; Tovar, John M; Witte, Amy P
2015-10-25
Objective. To evaluate how effectively pharmacy students and practicing pharmacists communicate and apply knowledge to simulations of commonly encountered patient scenarios using an objective structured clinical examination (OSCE). Design. Second-, third-, and fourth-year pharmacy students completed an OSCE as part of their required courses in 2012 and 2013. All students in both years completed identical OSCE cases. Licensed pharmacists were recruited to complete the OSCE and serve as controls in 2012. A survey assessed student perception and acceptance of the OSCE as well as student confidence in performance. Assessment. Licensed pharmacists had significantly higher clinical and communication skills scores than did pharmacy students. Student progression in communication and clinical skills improved significantly over time. Survey results indicated that students felt the OSCE was well-structured and assessed clinical skills taught in pharmacy school; 86% of students felt confident they could provide these skills. Conclusion. Objective structured clinical examinations can evaluate clinical competence and communication skills among professional students. Implementation of OSCEs may be an effective tool for assessment of the Center for the Advancement of Pharmacy Education domains.
Khatri, Indu; Sharma, Shailza; Ramya, T N C; Subramanian, Srikrishna
2016-01-01
Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions.
Johnson, Lane B; Kipfmueller, Kurt F
2016-06-01
We reconstructed fire occurrence near a fur-trade era canoe travel corridor (used ca. 1780-1802) in the Quetico-Superior region west of Lake Superior to explore the possibility of human influence on pre-fire suppression rates of fire occurrence. Our research objectives were to (1) examine the spatial and temporal patterns of fire in the study area, (2) test fires' strength of association with regional drought, and (3) assess whether reconstructed fire frequencies could be explained by observed rates of lightning fire ignition over the modern period of record. We developed a 420-year fire history for the eastern portion of Lac La Croix in the Boundary Waters Canoe Area Wilderness (BWCAW). Seventy-one fire-scarred samples were collected from remnant Pinus resinosa Ait. (red pine) stumps and logs from thirteen distinct island and three mainland forest stands. Collectively these samples contained records of 255 individual fire scars representing 79 fire events from 1636 to 1933 (study area mean fire intervals [MFI] 3.8 yr). Reconstructed fires were spatially and temporally asynchronous and not strongly associated with regional drought (P > 0.05). When compared to the conservative, tree-ring reconstructed estimate of historical fire occurrence and modern lightning-caused fires (1929-2012), a noticeable change in the distribution and frequency of fires within the study area was evident with only two lightning-ignited island fires since 1934 in the study area. Our results suggest a high likelihood that indigenous land use contributed to surface fire ignitions within our study area and highlights the importance of examining the potential effects of past indigenous land use when determining modern approaches to fire and wilderness management in fire-adapted ecosystems.
ERIC Educational Resources Information Center
Reiter, Harold I.; Rosenfeld, Jack; Nandagopal, Kiruthiga; Eva, Kevin W.
2004-01-01
Context: Various research studies have examined the question of whether expert or non-expert raters, faculty or students, evaluators or standardized patients, give more reliable and valid summative assessments of performance on Objective Structured Clinical Examinations (OSCEs). Less studied has been the question of whether or not non-faculty…
NASA Astrophysics Data System (ADS)
Ren, Wenjie; Li, Hongnan; Song, Gangbing; Huo, Linsheng
2009-03-01
The problem of optimizing an absorber system for three-dimensional seismic structures is addressed. The objective is to determine the number and position of absorbers to minimize the coupling effects of translation-torsion of structures at minimum cost. A procedure for a multi-objective optimization problem is developed by integrating a dominance-based selection operator and a dominance-based penalty function method. Based on the two-branch tournament genetic algorithm, the selection operator is constructed by evaluating individuals according to their dominance in one run. The technique guarantees the better performing individual winning its competition, provides a slight selection pressure toward individuals and maintains diversity in the population. Moreover, due to the evaluation for individuals in each generation being finished in one run, less computational effort is taken. Penalty function methods are generally used to transform a constrained optimization problem into an unconstrained one. The dominance-based penalty function contains necessary information on non-dominated character and infeasible position of an individual, essential for success in seeking a Pareto optimal set. The proposed approach is used to obtain a set of non-dominated designs for a six-storey three-dimensional building with shape memory alloy dampers subjected to earthquake.
ERIC Educational Resources Information Center
Woodburn, Jim; Sutcliffe, Nick
1996-01-01
The Objective Structured Clinical Examination (OSCE), initially developed for undergraduate medical education, has been adapted for assessment of clinical skills in podiatry students. A 12-month pilot study found the test had relatively low levels of reliability, high construct and criterion validity, and good stability of performance over time.…
Rosselli, Federica B.; Alemi, Alireza; Ansuini, Alessio; Zoccolan, Davide
2015-01-01
In recent years, a number of studies have explored the possible use of rats as models of high-level visual functions. One central question at the root of such an investigation is to understand whether rat object vision relies on the processing of visual shape features or, rather, on lower-order image properties (e.g., overall brightness). In a recent study, we have shown that rats are capable of extracting multiple features of an object that are diagnostic of its identity, at least when those features are, structure-wise, distinct enough to be parsed by the rat visual system. In the present study, we have assessed the impact of object structure on rat perceptual strategy. We trained rats to discriminate between two structurally similar objects, and compared their recognition strategies with those reported in our previous study. We found that, under conditions of lower stimulus discriminability, rat visual discrimination strategy becomes more view-dependent and subject-dependent. Rats were still able to recognize the target objects, in a way that was largely tolerant (i.e., invariant) to object transformation; however, the larger structural and pixel-wise similarity affected the way objects were processed. Compared to the findings of our previous study, the patterns of diagnostic features were: (i) smaller and more scattered; (ii) only partially preserved across object views; and (iii) only partially reproducible across rats. On the other hand, rats were still found to adopt a multi-featural processing strategy and to make use of part of the optimal discriminatory information afforded by the two objects. Our findings suggest that, as in humans, rat invariant recognition can flexibly rely on either view-invariant representations of distinctive object features or view-specific object representations, acquired through learning. PMID:25814936
ERIC Educational Resources Information Center
Sampson, McClain; Parrish, Danielle E.; Washburn, Micki
2018-01-01
Within the last decade, there has been a significant shift in the field of social work toward competency-based education. This article details the use of the Objective Structured Clinical Examination (OSCE) Adapted for Social Work Performance Rating Scale. We used the measure to evaluate specific practice competencies among students (n = 33)…
Objective structured practical examination (OSPE) in Forensic Medicine: students' point of view.
Menezes, Ritesh G; Nayak, Vinod C; Binu, V S; Kanchan, Tanuj; Rao, P P Jagadish; Baral, Prakash; Lobo, Stany W
2011-11-01
The purpose of this study was to assess the attitudes of undergraduate medical students towards the objective structured practical examination (OSPE) in Forensic Medicine, in a medical college in Nepal. Participants included 59 undergraduate medical students of the 7th semester. Findings indicated that the OSPE was an acceptable tool considering the conduct of practical examination in Forensic Medicine at the undergraduate level. The overall mean attitude score was towards the favourable side. Students strongly agreed that the OSPE tested a wide range of skills. They also strongly agreed that it was a good form of examination as well as a learning experience. The introduction of the OSPE replacing the conventional method of practical examination in Forensic Medicine is a step in the right direction taken to objectively assess undergraduate medical students. Copyright © 2011 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Wass, Val; Roberts, Celia; Hoogenboom, Ron; Jones, Roger; Van der Vleuten, Cees
2003-01-01
Objective To assess the effect of ethnicity on student performance in stations assessing communication skills within an objective structured clinical examination. Design Quantitative and qualitative study. Setting A final UK clinical examination consisting of a two day objective structured clinical examination with 22 stations. Participants 82 students from ethnic minorities and 97 white students. Main outcome measures Mean scores for stations (quantitative) and observations made using discourse analysis on selected communication stations (qualitative). Results Mean performance of students from ethnic minorities was significantly lower than that of white students for stations assessing communication skills on days 1 (67.0% (SD 6.8%) and 72.3% (7.6%); P=0.001) and 2 (65.2% (6.6%) and 69.5% (6.3%); P=0.003). No examples of overt discrimination were found in 309 video recordings. Transcriptions showed subtle differences in communication styles in some students from ethnic minorities who performed poorly. Examiners' assumptions about what is good communication may have contributed to differences in grading. Conclusions There was no evidence of explicit discrimination between students from ethnic minorities and white students in the objective structured clinical examination. A small group of male students from ethnic minorities used particularly poorly rated communicative styles, and some subtle problems in assessing communication skills may have introduced bias. Tests need to reflect issues of diversity to ensure that students from ethnic minorities are not disadvantaged. What is already known on this topicUK medical schools are concerned that students from ethnic minorities may perform less well than white students in examinationsIt is important to understand whether our examination system disadvantages themWhat this study addsMean performance of students from ethnic minorities was significantly lower than that of white students in a final year objective structured
Beltrán-Velasco, Ana Isabel; Bellido-Esteban, Alberto; Ruisoto-Palomera, Pablo; Clemente-Suárez, Vicente Javier
2018-01-12
The aim of the present study was to explore changes in the autonomic stress response of Psychology students in a Psychology Objective Structured Clinical Examination (OSCE) and their relationship with OSCE performance. Variables of autonomic modulation by the analysis of heart rate variability in temporal, frequency and non-linear domains, subjective perception of distress strait and academic performance were measured before and after the two different evaluations that composed the OSCE. A psychology objective structured clinical examination composed by two different evaluation scenarios produced a large anxiety anticipatory response, a habituation response in the first of the evaluation scenarios and a in the entire evaluation, and a no habituation response in the second evaluation scenario. Autonomic modulation parameters do not correlate with academic performance of students.
Characterization of the Interior Density Structure of Near Earth Objects with Muons
NASA Astrophysics Data System (ADS)
Prettyman, T. H.; Sykes, M. V.; Miller, R. S.; Pinsky, L. S.; Empl, A.; Nolan, M. C.; Koontz, S. L.; Lawrence, D. J.; Mittlefehldt, D. W.; Reddell, B. D.
2015-12-01
Near Earth Objects (NEOs) are a diverse population of short-lived asteroids originating from the main belt and Jupiter family comets. Some have orbits that are easy to access from Earth, making them attractive as targets for science and exploration as well as a potential resource. Some pose a potential impact threat. NEOs have undergone extensive collisional processing, fragmenting and re-accreting to form rubble piles, which may be compositionally heterogeneous (e.g., like 2008 TC3, the precursor to Almahata Sitta). At present, little is known about their interior structure or how these objects are held together. The wide range of inferred NEO macroporosities hint at complex interiors. Information about their density structure would aid in understanding their formation and collisional histories, the risks they pose to human interactions with their surfaces, the constraints on industrial processing of NEO resources, and the selection of hazard mitigation strategies (e.g., kinetic impactor vs nuclear burst). Several methods have been proposed to characterize asteroid interiors, including radar imaging, seismic tomography, and muon imaging (muon radiography and tomography). Of these, only muon imaging has the potential to determine interior density structure, including the relative density of constituent fragments. Muons are produced by galactic cosmic ray showers within the top meter of asteroid surfaces. High-energy muons can traverse large distances through rock with little deflection. Muons transmitted through an Itokawa-sized asteroid can be imaged using a compact hodoscope placed on or near the surface. Challenges include background rejection and correction for variations in muon production with surface density. The former is being addressed by hodoscope design. Surface density variations can be determined via radar or muon limb imaging. The performance of muon imaging is evaluated for prospective NEO interior-mapping missions.
Ramya, T. N. C.; Subramanian, Srikrishna
2016-01-01
Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions. PMID:27258038
NASA Astrophysics Data System (ADS)
Schön, Peter; Prokop, Alexander; Naaim-Bouvet, Florence; Vionnet, Vincent; Guyomarc'h, Gilbert; Heiser, Micha; Nishimura, Kouichi
2015-04-01
Wind and the associated snow drift are dominating factors determining the snow distribution and accumulation in alpine areas, resulting in a high spatial variability of snow depth that is difficult to evaluate and quantify. The terrain-based parameter Sx characterizes the degree of shelter or exposure of a grid point provided by the upwind terrain, without the computational complexity of numerical wind field models. The parameter has shown to qualitatively predict snow redistribution with good reproduction of spatial patterns. It does not, however, provide a quantitative estimate of changes in snow depths. The objective of our research was to introduce a new parameter to quantify changes in snow depths in our research area, the Col du Lac Blanc in the French Alps. The area is at an elevation of 2700 m and particularly suited for our study due to its consistently bi-modal wind directions. Our work focused on two pronounced, approximately 10 m high terrain breaks, and we worked with 1 m resolution digital snow surface models (DSM). The DSM and measured changes in snow depths were obtained with high-accuracy terrestrial laser scan (TLS) measurements. First we calculated the terrain-based parameter Sx on a digital snow surface model and correlated Sx with measured changes in snow-depths (Δ SH). Results showed that Δ SH can be approximated by Δ SHestimated = α * Sx, where α is a newly introduced parameter. The parameter α has shown to be linked to the amount of snow deposited influenced by blowing snow flux. At the Col du Lac Blanc test side, blowing snow flux is recorded with snow particle counters (SPC). Snow flux is the number of drifting snow particles per time and area. Hence, the SPC provide data about the duration and intensity of drifting snow events, two important factors not accounted for by the terrain parameter Sx. We analyse how the SPC snow flux data can be used to estimate the magnitude of the new variable parameter α . To simulate the development
Quantum origins of objectivity
NASA Astrophysics Data System (ADS)
Horodecki, R.; Korbicz, J. K.; Horodecki, P.
2015-03-01
In spite of all of its successes, quantum mechanics leaves us with a central problem: How does nature create a bridge from fragile quanta to the objective world of everyday experience? Here we find that a basic structure within quantum mechanics that leads to the perceived objectivity is a so-called spectrum broadcast structure. We uncover this based on minimal assumptions, without referring to any dynamical details or a concrete model. More specifically, working formally within the decoherence theory setting with multiple environments (called quantum Darwinism), we show how a crucial for quantum mechanics notion of nondisturbance due to Bohr [N. Bohr, Phys. Rev. 48, 696 (1935), 10.1103/PhysRev.48.696] and a natural definition of objectivity lead to a canonical structure of a quantum system-environment state, reflecting objective information records about the system stored in the environment.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe
2014-06-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.
O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert
2014-01-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323
NASA Astrophysics Data System (ADS)
Koziel, Slawomir; Bekasiewicz, Adrian
2016-10-01
Multi-objective optimization of antenna structures is a challenging task owing to the high computational cost of evaluating the design objectives as well as the large number of adjustable parameters. Design speed-up can be achieved by means of surrogate-based optimization techniques. In particular, a combination of variable-fidelity electromagnetic (EM) simulations, design space reduction techniques, response surface approximation models and design refinement methods permits identification of the Pareto-optimal set of designs within a reasonable timeframe. Here, a study concerning the scalability of surrogate-assisted multi-objective antenna design is carried out based on a set of benchmark problems, with the dimensionality of the design space ranging from six to 24 and a CPU cost of the EM antenna model from 10 to 20 min per simulation. Numerical results indicate that the computational overhead of the design process increases more or less quadratically with the number of adjustable geometric parameters of the antenna structure at hand, which is a promising result from the point of view of handling even more complex problems.
ERIC Educational Resources Information Center
Graham, Roseanna
2010-01-01
This study evaluated the reliability, validity, and educational usefulness of a comprehensive, multidisciplinary Objective Structured Clinical Examination (OSCE) in dental education. The OSCE was administered to dental students at the Columbia University College of Dental Medicine (CDM) before they entered clinical training. Participants in this…
Incremental Structured Dictionary Learning for Video Sensor-Based Object Tracking
Xue, Ming; Yang, Hua; Zheng, Shibao; Zhou, Yi; Yu, Zhenghua
2014-01-01
To tackle robust object tracking for video sensor-based applications, an online discriminative algorithm based on incremental discriminative structured dictionary learning (IDSDL-VT) is presented. In our framework, a discriminative dictionary combining both positive, negative and trivial patches is designed to sparsely represent the overlapped target patches. Then, a local update (LU) strategy is proposed for sparse coefficient learning. To formulate the training and classification process, a multiple linear classifier group based on a K-combined voting (KCV) function is proposed. As the dictionary evolves, the models are also trained to timely adapt the target appearance variation. Qualitative and quantitative evaluations on challenging image sequences compared with state-of-the-art algorithms demonstrate that the proposed tracking algorithm achieves a more favorable performance. We also illustrate its relay application in visual sensor networks. PMID:24549252
THE SECOND CATALOG OF ACTIVE GALACTIC NUCLEI DETECTED BY THE FERMI LARGE AREA TELESCOPE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ackermann, M.; Ajello, M.; Allafort, A.
The second catalog of active galactic nuclei (AGNs) detected by the Fermi Large Area Telescope (LAT) in two years of scientific operation is presented. The second LAT AGN catalog (2LAC) includes 1017 {gamma}-ray sources located at high Galactic latitudes (|b| > 10 Degree-Sign ) that are detected with a test statistic (TS) greater than 25 and associated statistically with AGNs. However, some of these are affected by analysis issues and some are associated with multiple AGNs. Consequently, we define a Clean Sample which includes 886 AGNs, comprising 395 BL Lacertae objects (BL Lac objects), 310 flat-spectrum radio quasars (FSRQs), 157more » candidate blazars of unknown type (i.e., with broadband blazar characteristics but with no optical spectral measurement yet), 8 misaligned AGNs, 4 narrow-line Seyfert 1 (NLS1s), 10 AGNs of other types, and 2 starburst galaxies. Where possible, the blazars have been further classified based on their spectral energy distributions (SEDs) as archival radio, optical, and X-ray data permit. While almost all FSRQs have a synchrotron-peak frequency <10{sup 14} Hz, about half of the BL Lac objects have a synchrotron-peak frequency >10{sup 15} Hz. The 2LAC represents a significant improvement relative to the first LAT AGN catalog (1LAC), with 52% more associated sources. The full characterization of the newly detected sources will require more broadband data. Various properties, such as {gamma}-ray fluxes and photon power-law spectral indices, redshifts, {gamma}-ray luminosities, variability, and archival radio luminosities and their correlations are presented and discussed for the different blazar classes. The general trends observed in 1LAC are confirmed.« less
NASA Astrophysics Data System (ADS)
Buendía, M.; Salvador, R.; Cibrián, R.; Laguia, M.; Sotoca, J. M.
1999-01-01
The projection of structured light is a technique frequently used to determine the surface shape of an object. In this paper, a new procedure is described that efficiently resolves the correspondence between the knots of the projected grid and those obtained on the object when the projection is made. The method is based on the use of three images of the projected grid. In two of them the grid is projected over a flat surface placed, respectively, before and behind the object; both images are used for calibration. In the third image the grid is projected over the object. It is not reliant on accurate determination of the camera and projector pair relative to the grid and object. Once the method is calibrated, we can obtain the surface function by just analysing the projected grid on the object. The procedure is especially suitable for the study of objects without discontinuities or large depth gradients. It can be employed for determining, in a non-invasive way, the patient's back surface function. Symmetry differences permit a quantitative diagnosis of spinal deformities such as scoliosis.
Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27
Object-based warping: an illusory distortion of space within objects.
Vickery, Timothy J; Chun, Marvin M
2010-12-01
Visual objects are high-level primitives that are fundamental to numerous perceptual functions, such as guidance of attention. We report that objects warp visual perception of space in such a way that spatial distances within objects appear to be larger than spatial distances in ground regions. When two dots were placed inside a rectangular object, they appeared farther apart from one another than two dots with identical spacing outside of the object. To investigate whether this effect was object based, we measured the distortion while manipulating the structure surrounding the dots. Object displays were constructed with a single object, multiple objects, a partially occluded object, and an illusory object. Nonobject displays were constructed to be comparable to object displays in low-level visual attributes. In all cases, the object displays resulted in a more powerful distortion of spatial perception than comparable non-object-based displays. These results suggest that perception of space within objects is warped.
Liu, Zhenhua; Ciappio, Eric D.; Crott, Jimmy W.; Brooks, Ryan S.; Nesvet, Jared; Smith, Donald E.; Choi, Sang-Woon; Mason, Joel B.
2011-01-01
The Wnt pathway is a pivotal signaling cascade in colorectal carcinogenesis. The purpose of this work is to determine whether depletion of folate and other metabolically related B vitamins induces in vivo activation of intestinal Wnt signaling and whether this occurs in parallel with increased tumorigenesis. A hybrid mouse was created by crossing a Wnt-reporter animal (BAT-LacZ) with a model of colorectal cancer (Apc1638N). A mild depletion of folate and vitamins B2, B6, and B12 was induced over 16 wk, and the control animals in each instance were pair fed a diet containing the basal requirement of these nutrients. The multiplicity of macroscopic tumors and aberrant crypt foci both increased by ∼50% in the hybrid mice fed the depletion diet (P<0.05). A 4-fold elevation in Wnt signaling was produced by the depletion diet (P<0.05) and was accompanied by significant changes in the expression of a number of Wnt-related genes in a pattern consistent with its activation. Proliferation and apoptosis of the colonic mucosa both changed in a protransformational direction (P<0.05). In summary, mild depletion of multiple B vitamins produces in vivo activation of colonic Wnt signaling, implicating it as a key pathway by which B-vitamin inadequacies enhance intestinal tumorigenesis.—Liu, Z., Ciappio, E. D., Crott, J. W., Brooks, R. S., Nesvet, J., Smith, D. E., Choi, S.-W., Mason, J. B. Combined inadequacies of multiple B vitamins amplify colonic Wnt signaling and promote intestinal tumorigenesis in BAT-LacZ×Apc1638N mice. PMID:21646397
NASA Astrophysics Data System (ADS)
Rezeau, Hervé; Moritz, Robert; Beaudoin, Georges
2017-03-01
The Lac Herbin deposit consists of a network of mineralized, parallel steep-reverse faults within the synvolcanic Bourlamaque granodiorite batholith at Val-d'Or in the Archean Abitibi greenstone belt. There are two related quartz-tourmaline-carbonate fault-fill vein sets in the faults, which consist of subvertical fault-fill veins associated with subhorizontal veins. The paragenetic sequence is characterized by a main vein filling ore stage including quartz, tourmaline, carbonate, and pyrite-hosted gold, chalcopyrite, tellurides, pyrrhotite, and cubanite inclusions. Most of the gold is located in fractures in deformed pyrite and quartz in equilibrium with chalcopyrite and carbonates, with local pyrrhotite, sphalerite, galena, cobaltite, pyrite, or tellurides. Petrography and microthermometry on quartz from the main vein filling ore stage reveal the presence of three unrelated fluid inclusion types: (1) gold-bearing aqueous-carbonic inclusions arranged in three-dimensional intragranular clusters in quartz crystals responsible for the main vein filling stage, (2) barren high-temperature, aqueous, moderately saline inclusions observed in healed fractures, postdating the aqueous-carbonic inclusions, and considered as a remobilizing agent of earlier precipitated gold in late fractures, and (3) barren low-temperature, aqueous, high saline inclusions in healed fractures, similar to the crustal brines reported throughout the Canadian Shield and considered to be unrelated to the gold mineralization. At the Lac Herbin deposit, the aqueous-carbonic inclusions are interpreted to have formed first and to represent the gold-bearing fluid, which were generated contemporaneous with regional greenschist facies metamorphism. In contrast, the high-temperature aqueous fluid dissolved gold from the main vein filling ore stage transported and reprecipitated it in late fractures during a subsequent local thermal event.
Parallel compression of data chunks of a shared data object using a log-structured file system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bent, John M.; Faibish, Sorin; Grider, Gary
2016-10-25
Techniques are provided for parallel compression of data chunks being written to a shared object. A client executing on a compute node or a burst buffer node in a parallel computing system stores a data chunk generated by the parallel computing system to a shared data object on a storage node by compressing the data chunk; and providing the data compressed data chunk to the storage node that stores the shared object. The client and storage node may employ Log-Structured File techniques. The compressed data chunk can be de-compressed by the client when the data chunk is read. A storagemore » node stores a data chunk as part of a shared object by receiving a compressed version of the data chunk from a compute node; and storing the compressed version of the data chunk to the shared data object on the storage node.« less
Hubble Space Telescope Images and Spectra of Objects Around an Optically Violent Variable QSO
NASA Astrophysics Data System (ADS)
Burbidge, E. M.; Beaver, E. A.; Cohen, R. D.; Hamann, F.; Junkkarinen, V. T.; Lyons, R. W.; Zuo, L.
1995-12-01
The Arecibo Occultation radio source AO 0235+164 is a rapidly and violently variable QSO with ze = 0.94. It was originally designated as a BL Lac object since no emission lines were detected in its spectrum; two absorption redshifts at 0.524 and 0.851 were measured some years before weak emission lines at z = 0.94 were detected by Cohen et al. (ApJ,318,577,1987). A point-like companion (Smith et al., ApJ,218,611,1977) was found 2 arc sec south with an emission line redshift at 0.524. It was designated object A by Yanny et al. (ApJ,338,735,1989). This object has sometimes been called a ``normal'' galaxy, presumably giving rise to the absorption at 0.524 in the QSO. Recent observations of the surrounding field, using the post-repair WFPC 2 on the Hubble Space Telescope, have been analyzed and the nature of the companion object 2 arc sec south, and of a second companion 1.3 arc sec east of AO, have been studied. Spectra of companion object A have been obtained with the Faint Object Spectrograph with gratings G160L and G270H, and 1.0 arc sec aperture, and these show that it is an AGN or QSO with BAL-type broad absorption lines shortward of CIVlambda 1549, SiIVlambda 1397, and NVlambda 1240, also broad CIII]lambda 1909 emission. The second object, A1, 1.3 arc sec east of the QSO, originally identified by Yanny et al. (1989) and shown to have [0II]lambda 3727 at z=0.524, is slightly extended. The physical properties and nature of this remarkable configuration will be discussed. This research has been supported in part by NASA NAS5-29293 and NAG5-1630.
A calorimetric investigation of the interaction of the lac repressor with inducer.
Donnér, J; Caruthers, M H; Gill, S J
1982-12-25
A calorimetric study has been made of the interaction between the lac repressor and isopropyl-1-thio-beta-D-galactopyranoside (IPTG). The buffer-corrected enthalpy of reaction at 25 degrees C was found to be -15.6, -24.7, -4.6 kJ/mol of bound IPTG at pH 7.0, pH 8.1, and pH 9.0, respectively. This large range of enthalpy values is in contrast to a maximum difference in the free energy of the reaction of only 1.5 kJ/mol of bound IPTG between these pH values. The reaction was found by calorimetric measurements in different buffers to be accompanied by an uptake of 0.29 mol of protons/mol of bound IPTG at pH 8.1. The pH dependency of the reaction enthalpy suggests differences in the extent of protonation of the binding site and the involvement of H bonding with IPTG. The lack of strong hydrophobic contributions in the IPTG binding process is revealed by the absence of any determinable heat capacity change for the reaction at pH 7.0. The presence of phosphate buffer significantly alters the enthalpy of IPTG binding at higher pH values, but has little effect upon the binding constant. This implies that highly negative phosphate species change the nature of the IPTG binding site without any displacement of phosphate upon IPTG binding.
Fitzpatrick, Faith A.; Garrison, Paul J.; Fitzgerald, Sharon A.; Elder, John F.
2003-01-01
Sediment cores were collected from Musky Bay, Lac Courte Oreilles, and from surrounding areas in 1999 and 2001 to determine whether the water quality of Musky Bay has declined during the last 100 years or more as a result of human activity, specifically cottage development and cranberry farming. Selected cores were analyzed for sedimentation rates, nutrients, minor and trace elements, biogenic silica, diatom assemblages, and pollen over the past several decades. Two cranberry bogs constructed along Musky Bay in 1939 and the early 1950s were substantially expanded between 1950?62 and between 1980?98. Cottage development on Musky Bay has occurred at a steady rate since about 1930, although currently housing density on Musky Bay is one-third to one-half the housing density surrounding three other Lac Courte Oreilles bays. Sedimentation rates were reconstructed for a core from Musky Bay by use of three lead radioisotope models and the cesium-137 profile. The historical average mass and linear sedimentation rates for Musky Bay are 0.023 grams per square centimeter per year and 0.84 centimeters per year, respectively, for the period of about 1936?90. There is also limited evidence that sedimentation rates may have increased after the mid-1990s. Historical changes in input of organic carbon, nitrogen, phosphorus, and sulfur to Musky Bay could not be directly identified from concentration profiles of these elements because of the potential for postdepositional migration and recycling. Minor- and trace-element profiles from the Musky Bay core possibly reflect historical changes in the input of clastic material over time, as well as potential changes in atmospheric deposition inputs. The input of clastic material to the bay increased slightly after European settlement and possibly in the 1930s through 1950s. Concentrations of copper in the Musky Bay core increased steadily through the early to mid-1900s until about 1980 and appear to reflect inputs from atmospheric
Enhanced phenol removal in an innovative lignite activated coke-assisted biological process.
Zhang, Chen; Li, Jianfeng; Cheng, Fangqin; Liu, Yu
2018-07-01
In this study, a lignite activated coke (LAC)-assisted activated sludge (AS) process was developed for enhancing biodegradation of phenol, while the effects of LAC on sludge properties and microbial community structure were investigated. It was found that more than 90% of phenol was removed within 1 h in the LAC/AS, which was 3 times higher than the conventional AS process. Moreover, the floc size and settleability were also significantly improved in the LAC/AS. These results suggested that LAC could serve as the nucleating agent to promote the formation of compact floc, which was beneficial for toxicity mitigation and system stability. The microbial community analysis by 16S high-throughput pyrosequencing technology further revealed a more abundant bacterial richness and diversity in the LAC/AS process loaded with phenol, while some phenol degraders, such as Propionibacteriaceae were enriched. Engineering implications further suggests the LAC-assisted AS process is technically sound and economically viable. Copyright © 2018 Elsevier Ltd. All rights reserved.
Haba-Rubio, José; Marques-Vidal, Pedro; Andries, Daniela; Tobback, Nadia; Preisig, Martin; Vollenweider, Peter; Waeber, Gérard; Luca, Gianina; Tafti, Mehdi; Heinzer, Raphaël
2015-01-01
Study Objectives: To evaluate the association between objective sleep measures and metabolic syndrome (MS), hypertension, diabetes, and obesity. Design: Cross-sectional study. Setting: General population sample. Participants: There were 2,162 patients (51.2% women, mean age 58.4 ± 11.1). Interventions: Patients were evaluated for hypertension, diabetes, overweight/obesity, and MS, and underwent a full polysomnography (PSG). Measurements and Results: PSG measured variables included: total sleep time (TST), percentage and time spent in slow wave sleep (SWS) and in rapid eye movement (REM) sleep, sleep efficiency and arousal index (ArI). In univariate analyses, MS was associated with decreased TST, SWS, REM sleep, and sleep efficiency, and increased ArI. After adjustment for age, sex, smoking, alcohol, physical activity, drugs that affect sleep and depression, the ArI remained significantly higher, but the difference disappeared in patients without significant sleep disordered breathing (SDB). Differences in sleep structure were also found according to the presence or absence of hypertension, diabetes, and overweight/obesity in univariate analysis. However, these differences were attenuated after multivariate adjustment and after excluding subjects with significant SDB. Conclusions: In this population-based sample we found significant associations between sleep structure and metabolic syndrome (MS), hypertension, diabetes, and obesity. However, these associations were cancelled after multivariate adjustment. We conclude that normal variations in sleep contribute little if any to MS and associated disorders. Citation: Haba-Rubio J, Marques-Vidal P, Andries D, Tobback N, Preisig M, Vollenweider P, Waeber G, Luca G, Tafti M, Heinzer R. Objective sleep structure and cardiovascular risk factors in the general population: the HypnoLaus study. SLEEP 2015;38(3):391–400. PMID:25325467
ERIC Educational Resources Information Center
Smith, Mark Joseph
2016-01-01
Debriefing was added to the design of an objective structured clinical examination (OSCE) after second-year pharmacy students performed poorly at considering patient disability in planning for patient care. This mixed-methods study examines secondary data to explore whether and how the addition of a debriefing to an OSCE impacted pharmacy…
Properties of optically selected BL Lacertae candidates from the SDSS
NASA Astrophysics Data System (ADS)
Kügler, S. D.; Nilsson, K.; Heidt, J.; Esser, J.; Schultz, T.
2014-09-01
Context. Deep optical surveys open the avenue for finding large numbers of BL Lac objects that are hard to identify because they lack the unique properties classifying them as such. While radio or X-ray surveys typically reveal dozens of sources, recent compilations based on optical criteria alone have increased the number of BL Lac candidates considerably. However, these compilations are subject to biases and may contain a substantial number of contaminating sources. Aims: In this paper we extend our analysis of 182 optically selected BL Lac object candidates from the SDSS with respect to an earlier study. The main goal is to determine the number of bona fide BL Lac objects in this sample. Methods: We examine their variability characteristics, determine their broad-band radio-UV spectral energy distributions (SEDs), and search for the presence of a host galaxy. In addition we present new optical spectra for 27 targets with improved signal-to-noise ratio with respect to the SDSS spectra. Results: At least 59% of our targets have shown variability between SDSS DR2 and our observations by more than 0.1-0.27 mag depending on the telescope used. A host galaxy was detected in 36% of our targets. The host galaxy type and luminosities are consistent with earlier studies of BL Lac host galaxies. Simple fits to broad-band SEDs for 104 targets of our sample derived synchrotron peak frequencies between 13.5 ≤ log 10(νpeak) ≤ 16 with a peak at log 10 ~ 14.5. Our new optical spectra do not reveal any new redshift for any of our objects. Thus the sample contains a large number of bona fide BL Lac objects and seems to contain a substantial fraction of intermediate-frequency peaked BL Lacs. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory under proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the
Gordeev, Evgeniy G; Galushko, Alexey S; Ananikov, Valentine P
2018-01-01
Additive manufacturing with fused deposition modeling (FDM) is currently optimized for a wide range of research and commercial applications. The major disadvantage of FDM-created products is their low quality and structural defects (porosity), which impose an obstacle to utilizing them in functional prototyping and direct digital manufacturing of objects intended to contact with gases and liquids. This article describes a simple and efficient approach for assessing the quality of 3D printed objects. Using this approach it was shown that the wall permeability of a printed object depends on its geometric shape and is gradually reduced in a following series: cylinder > cube > pyramid > sphere > cone. Filament feed rate, wall geometry and G-code-defined wall structure were found as primary parameters that influence the quality of 3D-printed products. Optimization of these parameters led to an overall increase in quality and improvement of sealing properties. It was demonstrated that high quality of 3D printed objects can be achieved using routinely available printers and standard filaments.
Beckman, Sarah A.; Chen, William C.W.; Tang, Ying; Proto, Jonathan D.; Mlakar, Logan; Wang, Bing; Huard, Johnny
2016-01-01
Objective We previously reported that mechanical stimulation increased the effectiveness of muscle-derived stem cells (MDSCs) for tissue repair. The objective of this study was to determine the importance of vascular endothelial growth factor (VEGF) on mechanically stimulated MDSCs in a murine model of muscle regeneration. Approach and Results MDSCs were transduced with retroviral vectors encoding the LacZ reporter gene (lacZ-MDSCs), the soluble VEGF receptor Flt1 (sFlt1-MDSCs), or a short hairpin RNA (shRNA) targeting messenger RNA of VEGF (shRNA_VEGF MDSCs). Cells were subjected to 24 hours of mechanical cyclic strain and immediately transplanted into the gastrocnemius muscles of mdx/scid mice. Two weeks after transplantation, angiogenesis, fibrosis, and regeneration were analyzed. There was an increase in angiogenesis in the muscles transplanted with mechanically stimulated lacZMDSCs compared with nonstimulated lacZ-MDSCs, sFlt1-MDSCs, and shRNA _VEGF MDSCs. Dystrophin-positive myofiber regeneration was significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. In vitro proliferation of MDSCs was not decreased by inhibition of VEGF; however, differentiation into myotubes and adhesion to collagen were significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. Conclusions The beneficial effects of mechanical stimulation on MDSC-mediated muscle repair are lost by inhibiting VEGF. PMID:23723372
VizieR Online Data Catalog: Swift and NuSTAR obs. of the BL Lac Mrk 421 (Kapanadze+, 2016)
NASA Astrophysics Data System (ADS)
Kapanadze, B.; Dorner, D.; Vercellone, S.; Romano, P.; Aller, H.; Aller, M.; Hughes, P.; Reynolds, M.; Kapanadze, S.; Tabagari, L.
2017-01-01
We retrieved the Swift-XRT data from the publicly available archive, maintained by HEASARC. We present the results of X-ray observations of the high-energy peaked BL Lac (HBL) source Mrk421 performed by Swift-XRT and NuSTAR during 2013 January-June. Along with the 0.3-10keV and 3-79keV data obtained with the Swift-XRT and NuSTAR instruments, we have processed and analyzed those obtained with the Ultraviolet-Optical Telescope (UVOT) and Large Area Telescope (LAT) onboard Fermi. We have also used the publicly available light curves from the observations performed with the Burst Alert Telescope (BAT) onboard Swift, Monitor of All Sky X-ray Image (MAXI), MAGIC, First G-APD Cherenkov Telescope (FACT), and the OVRO 40m telescope during the 2013 January-June period to draw conclusions about the interband correlations. (8 data files).
Kundu, Dipankar; Das, H N; Sen, Gargi; Osta, Manish; Mandal, T; Gautam, Divyendu
2013-01-01
Undergraduate medical examination is undergoing extensive re evaluation with new core educational objectives being defined. Consequently, new exam systems have also been designed to test the objectives. Objective structured practical examination (OSPE) is one of them. To introduce OSPE as a method of assessment of practical skills and learning and to determine student satisfaction regarding the OSPE. Furthermore, to explore the faculty perception of OSPE as a learning and assessment tool. The first M.B.B.S students of 2011 12 batch of Medical College, Kolkata, were the subjects for the study. OSPE was organized and conducted on "Identification of Unknown Abnormal Constituents in Urine." Coefficient of reliability of questions administered was done by calculating Cronbach's alpha. A questionnaire on various components of the OSPE was administered to get the feedback. 16 students failed to achieve an average of 50% or above in the assessment. However, 49 students on an average achieved >75%, 52 students achieved between 65% and 75%, and 29 students scored between 50% and 65%. Cronbach's alpha of the questions administered showed to be having high internal consistency with a score of 0.80. Ninety nine percent of students believed that OSPE helps them to improve and 81% felt that this type of assessment fits in as both learning and evaluation tools. Faculty feedback reflected that such assessment tested objectivity, measured practical skills better, and eliminated examiner bias to a greater extent. OSPE tests different desired components of competence better and eliminated examiner bias. Student feedback reflects that such assessment helps them to improve as it is effective both as teaching and evaluation tools.
NASA Technical Reports Server (NTRS)
Lung, Shun-fat; Pak, Chan-gi
2008-01-01
Updating the finite element model using measured data is a challenging problem in the area of structural dynamics. The model updating process requires not only satisfactory correlations between analytical and experimental results, but also the retention of dynamic properties of structures. Accurate rigid body dynamics are important for flight control system design and aeroelastic trim analysis. Minimizing the difference between analytical and experimental results is a type of optimization problem. In this research, a multidisciplinary design, analysis, and optimization (MDAO) tool is introduced to optimize the objective function and constraints such that the mass properties, the natural frequencies, and the mode shapes are matched to the target data as well as the mass matrix being orthogonalized.
NASA Technical Reports Server (NTRS)
Lung, Shun-fat; Pak, Chan-gi
2008-01-01
Updating the finite element model using measured data is a challenging problem in the area of structural dynamics. The model updating process requires not only satisfactory correlations between analytical and experimental results, but also the retention of dynamic properties of structures. Accurate rigid body dynamics are important for flight control system design and aeroelastic trim analysis. Minimizing the difference between analytical and experimental results is a type of optimization problem. In this research, a multidisciplinary design, analysis, and optimization [MDAO] tool is introduced to optimize the objective function and constraints such that the mass properties, the natural frequencies, and the mode shapes are matched to the target data as well as the mass matrix being orthogonalized.
Kharmanda, G
2016-11-01
A new strategy of multi-objective structural optimization is integrated into Austin-Moore prosthesis in order to improve its performance. The new resulting model is so-called Improved Austin-Moore. The topology optimization is considered as a conceptual design stage to sketch several kinds of hollow stems according to the daily loading cases. The shape optimization presents the detailed design stage considering several objectives. Here, A new multiplicative formulation is proposed as a performance scale in order to define the best compromise between several requirements. Numerical applications on 2D and 3D problems are carried out to show the advantages of the proposed model.
TRENCADIS--a WSRF grid MiddleWare for managing DICOM structured reporting objects.
Blanquer, Ignacio; Hernandez, Vicente; Segrelles, Damià
2006-01-01
The adoption of the digital processing of medical data, especially on radiology, has leaded to the availability of millions of records (images and reports). However, this information is mainly used at patient level, being the extraction of information, organised according to administrative criteria, which make the extraction of knowledge difficult. Moreover, legal constraints make the direct integration of information systems complex or even impossible. On the other side, the widespread of the DICOM format has leaded to the inclusion of other information different from just radiological images. The possibility of coding radiology reports in a structured form, adding semantic information about the data contained in the DICOM objects, eases the process of structuring images according to content. DICOM Structured Reporting (DICOM-SR) is a specification of tags and sections to code and integrate radiology reports, with seamless references to findings and regions of interests of the associated images, movies, waveforms, signals, etc. The work presented in this paper aims at developing of a framework to efficiently and securely share medical images and radiology reports, as well as to provide high throughput processing services. This system is based on a previously developed architecture in the framework of the TRENCADIS project, and uses other components such as the security system and the Grid processing service developed in previous activities. The work presented here introduces a semantic structuring and an ontology framework, to organise medical images considering standard terminology and disease coding formats (SNOMED, ICD9, LOINC..).
Structure and Evolution of Kuiper Belt Objects and Dwarf Planets
NASA Astrophysics Data System (ADS)
McKinnon, W. B.; Prialnik, D.; Stern, S. A.; Coradini, A.
Kuiper belt objects (KBOs) accreted from a mélange of volatile ices, carbonaceous matter, and rock of mixed interstellar and solar nebular provenance. The transneptunian region, where this accretion took place, was likely more radially compact than today. This and the influence of gas drag during the solar nebula epoch argue for more rapid KBO accretion than usually considered. Early evolution of KBOs was largely the result of heating due to radioactive decay, the most important potential source being 26Al, whereas long-term evolution of large bodies is controlled by the decay of U, Th, and 40K. Several studies are reviewed dealing with the evolution of KBO models, calculated by means of one-dimensional numerical codes that solve the heat and mass balance equations. It is shown that, depending on parameters (principally rock content and porous conductivity), KBO interiors may have reached relatively high temperatures. The models suggest that KBOs likely lost ices of very volatile species during early evolution, whereas ices of less-volatile species should be retained in cold, less-altered subsurface layers. Initially amorphous ice may have crystallized in KBO interiors, releasing volatiles trapped in the amorphous ice, and some objects may have lost part of these volatiles as well. Generally, the outer layers are far less affected by internal evolution than the inner part, which in the absence of other effects (such as collisions) predicts a stratified composition and altered porosity distribution. Kuiper belt objects are thus unlikely to be "the most pristine objects in the solar system," but they do contain key information as to how the early solar system accreted and dynamically evolved. For large (dwarf planet) KBOs, long-term radiogenic heating alone may lead to differentiated structures -- rock cores, ice mantles, volatile-ice-rich "crusts," and even oceans. Persistence of oceans and (potential) volcanism to the present day depends strongly on body size and
Characteristics of Gamma-Ray Loud Blazars in the VLBA Imaging and Polarimetry Survey
NASA Technical Reports Server (NTRS)
Linford, J. D.; Taylor, G. B.; Romani, R. W.; Healey, S. E.; Helmboldt, J. F.; Readhead, A. C.; Reeves, R.; Richards, J. L.; Cotter, G.
2010-01-01
The radio properties of blazars detected by the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope have been observed as part of the VLBA Imaging and Polarimetry Survey. This large, flux-limited sample of active galactic nuclei (AGNs) provides insights into the mechanism that produces strong gamma-ray emission. At lower flux levels, radio flux density does not directly correlate with gamma-ray flux. We find that the LAT-detected BL Lac objects tend to be similar to the non-LAT BL Lac objects, but that the LAT-detected FSRQs are often significantly different from the non-LAT FSRQs. The differences between the gamma-ray loud and quiet FSRQS can be explained by Doppler boosting; these objects appear to require larger Doppler factors than those of the BL Lac objects. It is possible that the gamma-ray loud FSRQs are fundamentally different from the gamma-ray quiet FSRQs. Strong polarization at the base of the jet appears to be a signature for gamma-ray loud AGNs.
Institutional barriers and opportunities in application of the limits of acceptable change
George H. Stankey
1997-01-01
Although the Limits of Acceptable Change (LAC) process has been in use since the mid-1980âs and has contributed to improved wilderness management, significant barriers and challenges remain. Formal and informal institutional barriers are the principal constraint to more effective implementation. Although grounded in a traditional management-by-objectives model, the LAC...
Tirado-Ramos, Alfredo; Hu, Jingkun; Lee, K P
2002-01-01
Supplement 23 to DICOM (Digital Imaging and Communications for Medicine), Structured Reporting, is a specification that supports a semantically rich representation of image and waveform content, enabling experts to share image and related patient information. DICOM SR supports the representation of textual and coded data linked to images and waveforms. Nevertheless, the medical information technology community needs models that work as bridges between the DICOM relational model and open object-oriented technologies. The authors assert that representations of the DICOM Structured Reporting standard, using object-oriented modeling languages such as the Unified Modeling Language, can provide a high-level reference view of the semantically rich framework of DICOM and its complex structures. They have produced an object-oriented model to represent the DICOM SR standard and have derived XML-exchangeable representations of this model using World Wide Web Consortium specifications. They expect the model to benefit developers and system architects who are interested in developing applications that are compliant with the DICOM SR specification.
Louisiana SIP: LAC 33:III Ch 2132. Stage II Vapor Recovery Systems for Control of Vehicle Refuelling Emissions at Gasoline Dispensing Facilities; SIP effective 2011-08-04 (LAd34) and 2016-02-29 (LAd47) to 2017-09-27
ERIC Educational Resources Information Center
Abraham, Reem Rachel; Raghavendra, Rao; Surekha, Kamath; Asha, Kamath
2009-01-01
A single examination does not fulfill all the functions of assessment. The present study was undertaken to determine the reliability and student satisfaction regarding the objective structured practical examination (OSPE) as a method of assessment of laboratory exercises in physiology before implementing it in the forthcoming university…
γ-Ray And Parsec-Scale Jet Properties Of A Complete Sample Of Blazars From The Mojave Program
Lister, M. L.
2011-11-02
We investigate the Fermi LAT -ray and 15 GHz VLBA radio properties of a joint -ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -30° during this period, and thus probes the full range of -ray loudness ( -ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders ofmagnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. Themore » BL Lac objects, however, display a linear correlation of increasing -ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the -ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - -ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.« less
Gamma-Ray and Parsec-Scale Jet Properties of a Complete Sample of Blazars from the MOJAVE Program
NASA Technical Reports Server (NTRS)
Lister, M.L.; Aller, M.; Aller, H.; Hovatta, T.; Kellermann, K. I.; Kovalev, Y. Y.; Meyer, E. T.; Pushkarev, A. B.; Ros, E.; Ackermann, M.;
2011-01-01
We investigate the Fermi LAT gamma-ray and 15 GHz VLBA radio properties of a joint gamma-ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -300 during this period, and thus probes the full range of gamma-ray loudness (gamma-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders of magnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing gamma-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the gamma-ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - gamma-ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.
NASA Astrophysics Data System (ADS)
Ye, Zhou; Nain, Amrinder S.; Behkam, Bahareh
2016-06-01
Fabrication of micro/nano-structures on irregularly shaped substrates and three-dimensional (3D) objects is of significant interest in diverse technological fields. However, it remains a formidable challenge thwarted by limited adaptability of the state-of-the-art nanolithography techniques for nanofabrication on non-planar surfaces. In this work, we introduce Spun-Wrapped Aligned Nanofiber (SWAN) lithography, a versatile, scalable, and cost-effective technique for fabrication of multiscale (nano to microscale) structures on 3D objects without restriction on substrate material and geometry. SWAN lithography combines precise deposition of polymeric nanofiber masks, in aligned single or multilayer configurations, with well-controlled solvent vapor treatment and etching processes to enable high throughput (>10-7 m2 s-1) and large-area fabrication of sub-50 nm to several micron features with high pattern fidelity. Using this technique, we demonstrate whole-surface nanopatterning of bulk and thin film surfaces of cubes, cylinders, and hyperbola-shaped objects that would be difficult, if not impossible to achieve with existing methods. We demonstrate that the fabricated feature size (b) scales with the fiber mask diameter (D) as b1.5 ~ D. This scaling law is in excellent agreement with theoretical predictions using the Johnson, Kendall, and Roberts (JKR) contact theory, thus providing a rational design framework for fabrication of systems and devices that require precisely designed multiscale features.Fabrication of micro/nano-structures on irregularly shaped substrates and three-dimensional (3D) objects is of significant interest in diverse technological fields. However, it remains a formidable challenge thwarted by limited adaptability of the state-of-the-art nanolithography techniques for nanofabrication on non-planar surfaces. In this work, we introduce Spun-Wrapped Aligned Nanofiber (SWAN) lithography, a versatile, scalable, and cost-effective technique for
Ptak, Radek; Lazeyras, François; Di Pietro, Marie; Schnider, Armin; Simon, Stéphane R
2014-07-01
Patients with visual object agnosia fail to recognize the identity of visually presented objects despite preserved semantic knowledge. Object agnosia may result from damage to visual cortex lying close to or overlapping with the lateral occipital complex (LOC), a brain region that exhibits selectivity to the shape of visually presented objects. Despite this anatomical overlap the relationship between shape processing in the LOC and shape representations in object agnosia is unknown. We studied a patient with object agnosia following isolated damage to the left occipito-temporal cortex overlapping with the LOC. The patient showed intact processing of object structure, yet often made identification errors that were mainly based on the global visual similarity between objects. Using functional Magnetic Resonance Imaging (fMRI) we found that the damaged as well as the contralateral, structurally intact right LOC failed to show any object-selective fMRI activity, though the latter retained selectivity for faces. Thus, unilateral damage to the left LOC led to a bilateral breakdown of neural responses to a specific stimulus class (objects and artefacts) while preserving the response to a different stimulus class (faces). These findings indicate that representations of structure necessary for the identification of objects crucially rely on bilateral, distributed coding of shape features. Copyright © 2014 Elsevier Ltd. All rights reserved.
Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun
2016-08-01
Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC-MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. © 2016 The Author(s).
Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun
2016-01-01
Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC–MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. PMID:27354563
Davis, Drew; Lee, Gordon
2011-07-01
As of 2006, the Accreditation Council for Graduate Medical Education had defined six "core competencies" of residency education: interpersonal communication skills, medical knowledge, patient care, professionalism, practice-based learning and improvement, and systems-based practice. Objective structured clinical examinations using standardized patients are becoming effective educational tools, and the authors developed a novel use of the examinations in plastic surgery residency education that assesses all six competencies. Six plastic surgery residents, two each from postgraduate years 4, 5, and 6, participated in the plastic surgery-specific objective structured clinical examination that focused on melanoma. The examination included a 30-minute videotaped encounter with a standardized patient actor and a postencounter written exercise. The residents were scored on their performance in all six core competencies by the standardized patients and faculty experts on a three-point scale (1 = novice, 2 = moderately skilled, and 3 = proficient). Resident performance was averaged for each postgraduate year, stratified according to core competency, and scored from a total of 100 percent. Residents overall scored well in interpersonal communications skills (84 percent), patient care (83 percent), professionalism (86 percent), and practice-based learning (84 percent). Scores in medical knowledge showed a positive correlation with level of training (86 percent). All residents scored comparatively lower in systems-based practice (65 percent). The residents reported unanimously that the objective structured clinical examination was realistic and educational. The objective structured clinical examination provided comprehensive and meaningful feedback and identified areas of strengths and weakness for the residents and for the teaching program. The examination is an effective assessment tool for the core competencies and a valuable adjunct to residency training.
Depreter, Barbara; Devreese, Katrien M J
2016-09-01
Lupus anticoagulant (LAC) testing includes a screening, mixing and confirmation step. Although recently published guidelines on LAC testing are a useful step towards standardization, a lack of consensus remains whether to express mixing tests in clotting time (CT) or index of circulating anticoagulant (ICA). The influence of anticoagulant therapy, e.g. vitamin K antagonists (VKA) or direct oral anticoagulants (DOAC) on both methods of interpretation remains to be investigated. The objective of this study was to contribute to a simplification and standardization of the LAC three-step interpretation on the level of the mixing test. Samples from 148 consecutive patients with LAC request and prolonged screening step, and 77 samples from patients non-suspicious for LAC treated with VKA (n=37) or DOAC (n=30) were retrospectively evaluated. An activated partial thromboplastin time (aPTT) and dilute Russell's viper venom time (dRVVT) were used for routine LAC testing. The supplemental anticoagulant samples were tested with dRVVT only. We focused on the interpretation differences for mixing tests expressed as CT or ICA and compared the final LAC conclusion within each distinct group of concordant and discordant mixing test results. Mixing test interpretation by CT resulted in 10 (dRVVT) and 16 (aPTT) more LAC positive patients compared to interpretation with ICA. Isolated prolonged dRVVT screen mix ICA results were exclusively observed in samples from VKA-treated patients without suspicion for LAC. We recommend using CT in respect to the 99th percentile cut-off for interpretation of mixing steps in order to reach the highest sensitivity and specificity in LAC detection.
ERIC Educational Resources Information Center
Augustine, Jill
2016-01-01
The purpose of this study was to design, develop, and administer an Objective, Structured Management Exam (OSME) on management skills for pharmacy students. Pharmacy preceptors for the University of Arizona College of Pharmacy participated in focus groups that identified business, management, and human resource skills needed by pharmacy graduates.…
NASA Astrophysics Data System (ADS)
Zhang, Changjiang; Dai, Lijie; Ma, Leiming; Qian, Jinfang; Yang, Bo
2017-10-01
An objective technique is presented for estimating tropical cyclone (TC) innercore two-dimensional (2-D) surface wind field structure using infrared satellite imagery and machine learning. For a TC with eye, the eye contour is first segmented by a geodesic active contour model, based on which the eye circumference is obtained as the TC eye size. A mathematical model is then established between the eye size and the radius of maximum wind obtained from the past official TC report to derive the 2-D surface wind field within the TC eye. Meanwhile, the composite information about the latitude of TC center, surface maximum wind speed, TC age, and critical wind radii of 34- and 50-kt winds can be combined to build another mathematical model for deriving the innercore wind structure. After that, least squares support vector machine (LSSVM), radial basis function neural network (RBFNN), and linear regression are introduced, respectively, in the two mathematical models, which are then tested with sensitivity experiments on real TC cases. Verification shows that the innercore 2-D surface wind field structure estimated by LSSVM is better than that of RBFNN and linear regression.
Abdul Ghaffar Al-Shaibani, Tarik A; Sachs-Robertson, Annette; Al Shazali, Hafiz O; Sequeira, Reginald P; Hamdy, Hosam; Al-Roomi, Khaldoon
2003-07-01
A problem-based learning strategy is used for curriculum planning and implementation at the Arabian Gulf University, Bahrain. Problems are constructed in a way that faculty-set objectives are expected to be identified by students during tutorials. Students in small groups, along with a tutor functioning as a facilitator, identify learning issues and define their learning objectives. We compared objectives identified by student groups with faculty-set objectives to determine extent of congruence, and identified factors that influenced students' ability at identifying faculty-set objectives. Male and female students were segregated and randomly grouped. A faculty tutor was allocated for each group. This study was based on 13 problems given to entry-level medical students. Pooled objectives of these problems were classified into four categories: structural, functional, clinical and psychosocial. Univariate analysis of variance was used for comparison, and a p > 0.05 was considered significant. The mean of overall objectives generated by the students was 54.2%, for each problem. Students identified psychosocial learning objectives more readily than structural ones. Female students identified more psychosocial objectives, whereas male students identified more of structural objectives. Tutor characteristics such as medical/non-medical background, and the years of teaching were correlated with categories of learning issues identified. Students identify part of the faculty-set learning objectives during tutorials with a faculty tutor acting as a facilitator. Students' gender influences types of learning issues identified. Content expertise of tutors does not influence identification of learning needs by students.
Louisiana SIP: LAC 33:III Ch. 14 Subchap B, 1431 to 1434--Conformity to State or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed, Funded, or Approved Under Title 23 U.S.C. or the Federal Transit Laws
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
III digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest
Daud-Gallotti, Renata Mahfuz; Morinaga, Christian Valle; Arlindo-Rodrigues, Marcelo; Velasco, Irineu Tadeu; Arruda Martins, Milton; Tiberio, Iolanda Calvo
2011-01-01
INTRODUCTION: Patient safety is seldom assessed using objective evaluations during undergraduate medical education. OBJECTIVE: To evaluate the performance of fifth-year medical students using an objective structured clinical examination focused on patient safety after implementation of an interactive program based on adverse events recognition and disclosure. METHODS: In 2007, a patient safety program was implemented in the internal medicine clerkship of our hospital. The program focused on human error theory, epidemiology of incidents, adverse events, and disclosure. Upon completion of the program, students completed an objective structured clinical examination with five stations and standardized patients. One station focused on patient safety issues, including medical error recognition/disclosure, the patient-physician relationship and humanism issues. A standardized checklist was completed by each standardized patient to assess the performance of each student. The student's global performance at each station and performance in the domains of medical error, the patient-physician relationship and humanism were determined. The correlations between the student performances in these three domains were calculated. RESULTS: A total of 95 students participated in the objective structured clinical examination. The mean global score at the patient safety station was 87.59±1.24 points. Students' performance in the medical error domain was significantly lower than their performance on patient-physician relationship and humanistic issues. Less than 60% of students (n = 54) offered the simulated patient an apology after a medical error occurred. A significant correlation was found between scores obtained in the medical error domains and scores related to both the patient-physician relationship and humanistic domains. CONCLUSIONS: An objective structured clinical examination is a useful tool to evaluate patient safety competencies during the medical student clerkship
ERIC Educational Resources Information Center
Park, Robin S.; Chibnall, John T.; Blaskiewicz, Robert J.; Furman, Gail E.; Powell, Jill K.; Mohr, Clinton J.
2004-01-01
Objective: The construct validity of checklist and global process scores for an objective structured clinical examination (OSCE) in psychiatry was assessed. Multiple regression analysis was used to predict psychiatry OSCE scores from the clinical skills examination, an obstetrics/gynecology (OB/GYN) OSCE, and the National Board of Medical…
Fischer, Markus A; Kennedy, Kieran M; Durning, Steven; Schijven, Marlies P; Ker, Jean; O'Connor, Paul; Doherty, Eva; Kropmans, Thomas J B
2017-12-21
Medical students may not be able to identify the essential elements of situational awareness (SA) necessary for clinical reasoning. Recent studies suggest that students have little insight into cognitive processing and SA in clinical scenarios. Objective Structured Clinical Examinations (OSCEs) could be used to assess certain elements of situational awareness. The purpose of this paper is to review the literature with a view to identifying whether levels of SA based on Endsley's model can be assessed utilising OSCEs during undergraduate medical training. A systematic search was performed pertaining to SA and OSCEs, to identify studies published between January 1975 (first paper describing an OSCE) and February 2017, in peer reviewed international journals published in English. PUBMED, EMBASE, PsycINFO Ovid and SCOPUS were searched for papers that described the assessment of SA using OSCEs among undergraduate medical students. Key search terms included "objective structured clinical examination", "objective structured clinical assessment" or "OSCE" and "non-technical skills", "sense-making", "clinical reasoning", "perception", "comprehension", "projection", "situation awareness", "situational awareness" and "situation assessment". Boolean operators (AND, OR) were used as conjunctions to narrow the search strategy, resulting in the limitation of papers relevant to the research interest. Areas of interest were elements of SA that can be assessed by these examinations. The initial search of the literature retrieved 1127 publications. Upon removal of duplicates and papers relating to nursing, paramedical disciplines, pharmacy and veterinary education by title, abstract or full text, 11 articles were eligible for inclusion as related to the assessment of elements of SA in undergraduate medical students. Review of the literature suggests that whole-task OSCEs enable the evaluation of SA associated with clinical reasoning skills. If they address the levels of SA, these
24 CFR 3280.305 - Structural design requirements.
Code of Federal Regulations, 2010 CFR
2010-04-01
... Kandiyohi Carver Blue Earth Cass Meeker Dakota Martin Crow Wing Wright Goodhue Watonwan Aitkin Lac qui Parle... Charlevoix Benzie Marquette Menominee Montmorency Grand Traverse Alger Delta Alpena Kalkaska Luce Schoolcraft...
24 CFR 3280.305 - Structural design requirements.
Code of Federal Regulations, 2011 CFR
2011-04-01
... Kandiyohi Carver Blue Earth Cass Meeker Dakota Martin Crow Wing Wright Goodhue Watonwan Aitkin Lac qui Parle... Charlevoix Benzie Marquette Menominee Montmorency Grand Traverse Alger Delta Alpena Kalkaska Luce Schoolcraft...
NASA Astrophysics Data System (ADS)
Kranich, D.
1999-08-01
The BL Lac Object Mkn 501 was in a state of high activity in the TeV range in 1997. During this time Mkn 501 was observed by all Cherenkov-Telescopes of the HEGRA-Collaboration. Part of the data were also taken during moonshine thus providing a nearly continuous coverage for this object in the TeV-range. We have carried out a QPO analysis and found evidence for a 23 day periodicity. We applied the same analysis on the 'data by dwell' x-ray lightcurve from the RXTE/ASM database and found also evidence for the 23 day periodicity. The combined probability was -.
Coarse-grained Simulations of Sugar Transport and Conformational Changes of Lactose Permease
NASA Astrophysics Data System (ADS)
Liu, Jin; Jewel, S. M. Yead; Dutta, Prashanta
2016-11-01
Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves sugar translocation, H+ transfer, as well as large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear due to the complexity and multiscale nature of the process. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the transport of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule across a wild-type LacY during lactose/H+ symport process. Results show that the local interactions between TDG and LacY at the binding pocket are consistent with the X-ray experiment. Protonation of Glu325 stabilizes the TDG and inward-facing conformation of LacY. Protonation of Glu269 induces a dramatic protein structural reorganization and causes the expulsion of TDG from LacY to both sides of the membrane. The structural changes occur primarily in the N-terminal domain of LacY. This work is supported by NSF Grants: CBET-1250107 and CBET -1604211.
Nowparast Rostami, Hadiseh; Sommer, Werner; Zhou, Changsong; Wilhelm, Oliver; Hildebrandt, Andrea
2017-10-01
The enhanced N1 component in event-related potentials (ERP) to face stimuli, termed N170, is considered to indicate the structural encoding of faces. Previously, individual differences in the latency of the N170 have been related to face and object cognition abilities. By orthogonally manipulating content domain (faces vs objects) and task demands (easy/speed vs difficult/accuracy) in both psychometric and EEG tasks, we investigated the uniqueness of the processes underlying face cognition as compared with object cognition and the extent to which the N1/N170 component can explain individual differences in face and object cognition abilities. Data were recorded from N = 198 healthy young adults. Structural equation modeling (SEM) confirmed that the accuracies of face perception (FP) and memory are specific abilities above general object cognition; in contrast, the speed of face processing was not differentiable from the speed of object cognition. Although there was considerable domain-general variance in the N170 shared with the N1, there was significant face-specific variance in the N170. The brain-behavior relationship showed that faster face-specific processes for structural encoding of faces are associated with higher accuracy in both perceiving and memorizing faces. Moreover, in difficult task conditions, qualitatively different processes are additionally needed for recognizing face and object stimuli as compared with easy tasks. The difficulty-dependent variance components in the N170 amplitude were related with both face and object memory (OM) performance. We discuss implications for understanding individual differences in face cognition. Copyright © 2017 Elsevier Ltd. All rights reserved.
Standardized emergency management system and response to a smallpox emergency.
Kim-Farley, Robert J; Celentano, John T; Gunter, Carol; Jones, Jessica W; Stone, Rogelio A; Aller, Raymond D; Mascola, Laurene; Grigsby, Sharon F; Fielding, Jonathan E
2003-01-01
The smallpox virus is a high-priority, Category-A agent that poses a global, terrorism security risk because it: (1) easily can be disseminated and transmitted from person to person; (2) results in high mortality rates and has the potential for a major public health impact; (3) might cause public panic and social disruption; and (4) requires special action for public health preparedness. In recognition of this risk, the Los Angeles County Department of Health Services (LAC-DHS) developed the Smallpox Preparedness, Response, and Recovery Plan for LAC to prepare for the possibility of an outbreak of smallpox. A unique feature of the LAC-DHS plan is its explicit use of the Standardized Emergency Management System (SEMS) framework for detailing the functions needed to respond to a smallpox emergency. The SEMS includes the Incident Command System (ICS) structure (management, operations, planning/intelligence, logistics, and finance/administration), the mutual-aid system, and the multi/interagency coordination required during a smallpox emergency. Management for incident command includes setting objectives and priorities, information (risk communications), safety, and liaison. Operations includes control and containment of a smallpox outbreak including ring vaccination, mass vaccination, adverse events monitoring and assessment, management of confirmed and suspected smallpox cases, contact tracing, active surveillance teams and enhanced hospital-based surveillance, and decontamination. Planning/intelligence functions include developing the incident action plan, epidemiological investigation and analysis of smallpox cases, and epidemiological assessment of the vaccination coverage status of populations at risk. Logistics functions include receiving, handling, inventorying, and distributing smallpox vaccine and vaccination clinic supplies; personnel; transportation; communications; and health care of personnel. Finally, finance/administration functions include monitoring
Neurology objective structured clinical examination reliability using generalizability theory.
Blood, Angela D; Park, Yoon Soo; Lukas, Rimas V; Brorson, James R
2015-11-03
This study examines factors affecting reliability, or consistency of assessment scores, from an objective structured clinical examination (OSCE) in neurology through generalizability theory (G theory). Data include assessments from a multistation OSCE taken by 194 medical students at the completion of a neurology clerkship. Facets evaluated in this study include cases, domains, and items. Domains refer to areas of skill (or constructs) that the OSCE measures. G theory is used to estimate variance components associated with each facet, derive reliability, and project the number of cases required to obtain a reliable (consistent, precise) score. Reliability using G theory is moderate (Φ coefficient = 0.61, G coefficient = 0.64). Performance is similar across cases but differs by the particular domain, such that the majority of variance is attributed to the domain. Projections in reliability estimates reveal that students need to participate in 3 OSCE cases in order to increase reliability beyond the 0.70 threshold. This novel use of G theory in evaluating an OSCE in neurology provides meaningful measurement characteristics of the assessment. Differing from prior work in other medical specialties, the cases students were randomly assigned did not influence their OSCE score; rather, scores varied in expected fashion by domain assessed. © 2015 American Academy of Neurology.
Quist, M.C.; Stephen, J.L.; Guy, C.S.; Schultz, R.D.
2004-01-01
Age structure, total annual mortality, and mortality caps (maximum mortality thresholds established by managers) were investigated for walleye Sander vitreus (formerly Stizostedion vitreum) populations sampled from eight Kansas reservoirs during 1991-1999. We assessed age structure by examining the relative frequency of different ages in the population; total annual mortality of age-2 and older walleyes was estimated by use of a weighted catch curve. To evaluate the utility of mortality caps, we modeled threshold values of mortality by varying growth rates and management objectives. Estimated mortality thresholds were then compared with observed growth and mortality rates. The maximum age of walleyes varied from 5 to 11 years across reservoirs. Age structure was dominated (???72%) by walleyes age 3 and younger in all reservoirs, corresponding to ages that were not yet vulnerable to harvest. Total annual mortality rates varied from 40.7% to 59.5% across reservoirs and averaged 51.1% overall (SE = 2.3). Analysis of mortality caps indicated that a management objective of 500 mm for the mean length of walleyes harvested by anglers was realistic for all reservoirs with a 457-mm minimum length limit but not for those with a 381-mm minimum length limit. For a 500-mm mean length objective to be realized for reservoirs with a 381-mm length limit, managers must either reduce mortality rates (e.g., through restrictive harvest regulations) or increase growth of walleyes. When the assumed objective was to maintain the mean length of harvested walleyes at current levels, the observed annual mortality rates were below the mortality cap for all reservoirs except one. Mortality caps also provided insight on management objectives expressed in terms of proportional stock density (PSD). Results indicated that a PSD objective of 20-40 was realistic for most reservoirs. This study provides important walleye mortality information that can be used for monitoring or for inclusion into
He, Xi; Han, Ning; Wang, Yan-Ping
2016-01-01
Lactobacillus kefiranofaciens ZW3 was obtained from kefir grains, which have high lactose hydrolytic activity. In this study, a heterodimeric LacLM-type β-galactosidase gene (lacLM) from ZW3 was isolated, which was composed of two overlapping genes, lacL (1,884 bp) and lacM (960 bp) encoding large and small subunits with calculated molecular masses of 73,620 and 35,682 Da, respectively. LacLM, LacL, and LacM were expressed in Escherichia coli BL21(DE3) and these recombinant proteins were purified and characterized. The results showed that, compared with the recombinant holoenzyme, the recombinant large subunit exhibits obviously lower thermostability and hydrolytic activity. Moreover, the optimal temperature and pH of the holoenzyme and large subunit are 60°C and 7.0, and 50°C and 8.0, respectively. However, the recombinant small subunit alone has no activity. Interestingly, the activity and thermostability of the large subunit were greatly improved after mixing it with the recombinant small subunit. Therefore, the results suggest that the small subunit might play an important role in maintaining the stability of the structure of the catalytic center located in the large subunit.
Yuan, Shaoxin; Gao, Yusong; Ji, Wenqing; Song, Junshuai; Mei, Xue
2018-05-01
The aim of this study was to assess the ability of acute physiology and chronic health evaluation II (APACHE II) score, poisoning severity score (PSS) as well as sequential organ failure assessment (SOFA) score combining with lactate (Lac) to predict mortality in the Emergency Department (ED) patients who were poisoned with organophosphate.A retrospective review of 59 stands-compliant patients was carried out. Receiver operating characteristic (ROC) curves were constructed based on the APACHE II score, PSS, SOFA score with or without Lac, respectively, and the areas under the ROC curve (AUCs) were determined to assess predictive value. According to SOFA-Lac (a combination of SOFA and Lac) classification standard, acute organophosphate pesticide poisoning (AOPP) patients were divided into low-risk and high-risk groups. Then mortality rates were compared between risk levels.Between survivors and non-survivors, there were significant differences in the APACHE II score, PSS, SOFA score, and Lac (all P < .05). The AUCs of the APACHE II score, PSS, and SOFA score were 0.876, 0.811, and 0.837, respectively. However, after combining with Lac, the AUCs were 0.922, 0.878, and 0.956, respectively. According to SOFA-Lac, the mortality of high-risk group was significantly higher than low-risk group (P < .05) and the patients of the non-survival group were all at high risk.These data suggest the APACHE II score, PSS, SOFA score can all predict the prognosis of AOPP patients. For its simplicity and objectivity, the SOFA score is a superior predictor. Lac significantly improved the predictive abilities of the 3 scoring systems, especially for the SOFA score. The SOFA-Lac system effectively distinguished the high-risk group from the low-risk group. Therefore, the SOFA-Lac system is significantly better at predicting mortality in AOPP patients.
ERIC Educational Resources Information Center
Obizoba, Cordelia O.
2014-01-01
The purpose of this phenomenological study was to gain an understanding of nursing faculty members' lived experiences of Objective Structured Clinical Examination (OSCE) in undergraduate nursing education. As owners of their programs' curriculum, nursing faculties are charged with the responsibility of providing needed knowledge, skills, and…
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
ERIC Educational Resources Information Center
Du, Yihua; Yu, Ke; Li, Xiaohong; Wang, Feng; Wang, Tingting
2011-01-01
This article gives a brief introduction to the Objective Structured Clinical Examination (OSCE) and analyzes developmental progress of OSCE at both home and abroad and standardized patients' application in OSCE. Also, this article expounds application of OSCE in graduation exam of clinical medical students. Finally, this article summarizes…
NASA Astrophysics Data System (ADS)
Tret'yakov, Evgeniy V.; Shuvalov, Vladimir V.; Shutov, I. V.
2002-11-01
An approximate algorithm is tested for solving the problem of diffusion optical tomography in experiments on the visualisation of details of the inner structure of strongly scattering model objects containing scattering and semitransparent inclusions, as well as absorbing inclusions located inside other optical inhomogeneities. The stability of the algorithm to errors is demonstrated, which allows its use for a rapid (2 — 3 min) image reconstruction of the details of objects with a complicated inner structure.
NASA Astrophysics Data System (ADS)
Liu, Jin; Jewel, Yead; Dutta, Prashanta
2017-11-01
Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the binding of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule to a wild-type LacY. Transitions from inward-facing to outward-facing conformations upon TDG binding and protonation of Glu269 have been achieved from microsecond simulations. Both the opening of the periplasmic side and closure of the cytoplasmic side of LacY are consistent with experiments. Our analysis suggest that the conformational changes of LacY are a cumulative consequence of inter-domain H-bonds breaking at the periplasmic side, inter-domain salt-bridge formation at the cytoplasmic side, as well as the TDG orientational changes during the transition. This work is supported by US National Science Foundation under Grant No. CBET-1604211.
THE OPTICAL MICROVARIABILITY AND SPECTRAL CHANGES OF THE BL LACERTAE OBJECT S5 0716+714
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poon, H.; Fu, J. N.; Fan, J. H.
We monitored the BL Lac object S5 0716+714 in the optical band during 2008 October and December and 2009 February with a best temporal resolution of about 5 minutes in the BVRI bands. Four fast flares were observed with amplitudes ranging from 0.3 to 0.75 mag. The source remained active during the whole monitoring campaign, showing microvariability in all days except for one. The overall variability amplitudes are {delta}B {approx} 0fm89, {delta}V {approx} 0fm80, {delta}R {approx} 0fm73, and {delta}I{approx} 0fm51. Typical timescales of microvariability range from 2 to 8 hr. The overall V - R color index ranges from 0.37more » to 0.59. Strong bluer-when-brighter chromatism was found on internight timescales. However, a different spectral behavior was found on intranight timescales. A possible time lag of {approx}11 minutes between B and I bands was found on one night. The shock-in-jet model and geometric effects can be applied to explain the source's intranight behavior.« less
Accumulation and therapeutic modulation of 6-sulfo LacNAc(+) dendritic cells in multiple sclerosis.
Thomas, Katja; Dietze, Kristin; Wehner, Rebekka; Metz, Imke; Tumani, Hayrettin; Schultheiß, Thorsten; Günther, Claudia; Schäkel, Knut; Reichmann, Heinz; Brück, Wolfgang; Schmitz, Marc; Ziemssen, Tjalf
2014-10-01
To examine the potential role of 6-sulfo LacNAc(+) (slan) dendritic cells (DCs) displaying pronounced proinflammatory properties in the pathogenesis of multiple sclerosis (MS). We determined the presence of slanDCs in demyelinated brain lesions and CSF samples of patients with MS. In addition, we explored the impact of methylprednisolone, interferon-β, glatiramer acetate, or natalizumab on the frequency of blood-circulating slanDCs in patients with MS. We also evaluated whether interferon-β modulates important proinflammatory capabilities of slanDCs. SlanDCs accumulate in highly inflammatory brain lesions and are present in the majority of CSF samples of patients with MS. Short-term methylprednisolone administration reduces the percentage of slanDCs in blood of patients with MS and the proportion of tumor necrosis factor-α- or CD150-expressing slanDCs. Long-term interferon-β treatment decreases the percentage of blood-circulating slanDCs in contrast to glatiramer acetate or natalizumab. Furthermore, interferon-β inhibits the secretion of proinflammatory cytokines by slanDCs and their capacity to promote proliferation and differentiation of T cells. Accumulation of slanDCs in highly inflammatory brain lesions and their presence in CSF indicate that slanDCs may play an important role in the immunopathogenesis of MS. The reduction of blood-circulating slanDCs and the inhibition of their proinflammatory properties by methylprednisolone and interferon-β may contribute to the therapeutic efficiency of these drugs in patients with MS.
Lupus anticoagulant: a multicenter study for a standardized and harmonized reporting.
Poz, Alessandra; Pradella, Paola; Azzarini, Gabriella; Santarossa, Liliana; Bardin, Cristina; Zardo, Lorena; Giacomello, Roberta
2016-03-01
Laboratory assessment of Lupus anticoagulant (LAC) is very challenging because of inter and intralaboratory variability, which makes it difficult to standardize and harmonize results expression. Five hospital laboratories in North-eastern Italy shared their efforts and their experience in a cross-laboratory study, conducting the diagnostic process as homogeneously as possible and providing a better interpretation for LAC positivity. Hundred normal samples from healthy subjects (20 from each center) were processed to confirm negative upper limits and calculate positivity cutoffs of LAC integrated assays, that is dilute Russell's viper venom time (dRVVT) and silica clotting time (SCT). Moreover, 311 samples previously diagnosed by the laboratories as positive for LAC were analyzed to characterize different positivity levels for each assay. As far as the analysis of healthy subjects is concerned, negative upper limits are set at 1.17 and 1.19 for dRVVT and SCT screen ratio, respectively. Positivity cutoffs are set at 1.20 for dRVVT and 1.23 for SCT, expressed as Test Ratio calculated on screen and confirm integrated tests. Positive results for each integrated assay are subsequently divided into three subgroups: weak, moderate and strong; the results obtained are presented as a score proposal that can provide LAC interpretation. The combined use of both dRVVT and SCT assays and the definition of different positivity levels may lead to clearer, more objective LAC reporting. An interpretative table for LAC-proposed score provides LAC-positive results and it is now adopted by all centers involved in the study.
De Grasset, Jehanne; Audetat, Marie-Claude; Bajwa, Nadia; Jastrow, Nicole; Richard-Lepouriel, Hélène; Nendaz, Mathieu; Junod Perron, Noelle
2018-04-22
Medical students develop professional identity through structured activities and impromptu interactions in various settings. We explored if contributing to an Objective Structured Teaching Exercise (OSTE) influenced students' professional identity development. University clinical faculty members participated in a faculty development program on clinical supervision. Medical students who participated in OSTEs as simulated residents were interviewed in focus groups about what they learnt from the experience and how the experience influenced their vision of learning and teaching. Transcripts were analyzed using the Goldie's personality and social structure perspective model. Twenty-five medical students out of 32 students involved in OSTEs participated. On an institutional level, students developed a feeling of belonging to the institution. At an interactional level, students realized they could influence the teaching interaction by actively seeking or giving feedback. On the personal level, students realized that errors could become sources of learning and felt better prepared to receive faculty feedback. Taking part in OSTEs as a simulated resident has a positive impact on students' vision regarding the institution as a learning environment and their own role by actively seeking or giving feedback. OSTEs support their professional identity development regarding learning and teaching while sustaining faculty development.
Mobbs, Charles V; Mastaitis, Jason W; Zhang, Minhua; Isoda, Fumiko; Cheng, Hui; Yen, Kelvin
2007-01-01
Elevated blood glucose associated with diabetes produces progressive and apparently irreversible damage to many cell types. Conversely, reduction of glucose extends life span in yeast, and dietary restriction reduces blood glucose. Therefore it has been hypothesized that cumulative toxic effects of glucose drive at least some aspects of the aging process and, conversely, that protective effects of dietary restriction are mediated by a reduction in exposure to glucose. The mechanisms mediating cumulative toxic effects of glucose are suggested by two general principles of metabolic processes, illustrated by the lac operon but also observed with glucose-induced gene expression. First, metabolites induce the machinery of their own metabolism. Second, induction of gene expression by metabolites can entail a form of molecular memory called hysteresis. When applied to glucose-regulated gene expression, these two principles suggest a mechanism whereby repetitive exposure to postprandial excursions of glucose leads to an age-related increase in glycolytic capacity (and reduction in beta-oxidation of free fatty acids), which in turn leads to an increased generation of oxidative damage and a decreased capacity to respond to oxidative damage, independent of metabolic rate. According to this mechanism, dietary restriction increases life span and reduces pathology by reducing exposure to glucose and therefore delaying the development of glucose-induced glycolytic capacity.
Object classification for obstacle avoidance
NASA Astrophysics Data System (ADS)
Regensburger, Uwe; Graefe, Volker
1991-03-01
Object recognition is necessary for any mobile robot operating autonomously in the real world. This paper discusses an object classifier based on a 2-D object model. Obstacle candidates are tracked and analyzed false alarms generated by the object detector are recognized and rejected. The methods have been implemented on a multi-processor system and tested in real-world experiments. They work reliably under favorable conditions but sometimes problems occur e. g. when objects contain many features (edges) or move in front of structured background.
Assessment for learning with Objectively Structured Practical Examination in Biochemistry
Jaswal, Shivani; Chattwal, Jugesh; Kaur, Jasbinder; Gupta, Seema; Singh, Tejinder
2015-01-01
Context: Despite a radical shift in assessment methodologies over the last decade, the majority of medical colleges still follow the Traditional Practical Examination (TPE). TPE raises concerns about examiner variability, standardization, and uniformity of assessment. To address these issues and in line with the notion of assessments as motivating what and how students learn, Objectively Structured Practical Examination (OSPE) was introduced, as an assessment modality. Despite its usefulness, awareness and motivation to use the same, still needs to be probed. Aims: To implement OSPE in the assessment of practical skills in biochemistry, and to know student and faculty perspectives regarding OSPE. Settings and Design: OSPE was introduced at the stage of formative assessment of practical skills, for 94 year one MBBS students. Subjects and Methods: Students were divided into two groups; the first group was evaluated by the traditional method and the second by OSPE. Students were crossed over on a second examination. The mean score obtained by both the methods was compared statistically. Students and faculty perspectives regarding OSPE were obtained by a questionnaire. Student performance was compared using “Bland–Altman technique,” and Student's t-test. Results: The mean scores of students was found to be significantly higher (P < 0.0001) when assessed with OSPE as compared to TPE. Number of students achieving >70% marks was also significantly higher with OSPE. Validity was supported by a significant correlation coefficient of comparison of marks by the two methods. Feedback from students and faculty indicated that they endorsed OSPE. Conclusions: This evaluation demonstrated the need for a structured approach to assessment. Going in line with the notion that assessment drives learning, introducing OSPE would help tailoring teaching-learning to optimize student satisfaction and learning. PMID:26380217
NASA Astrophysics Data System (ADS)
Noble, P. J.; Van de Vijver, B.; Verleyen, E.; Prygiel, J.; Ivanovsky, A.; Lesven, L.; Billon, G.
2016-12-01
Diatom analysis was conducted on lake sediments in la Chaîne des Lacs (CDL), a shallow eutrophic urban park and storm control system in Villeneuve d'Ascq, France, to address both the present day water quality, and the evolution of this urban system over its 40 year history. The main lake, Lac du Héron (LDH), received recent attention because of water quality problems, including eutrophication, harmful algal blooms, and invasion by the macrophyte Elodea in 2012. A total of 17 sites were collected in CDL, 11 of which were in LDH, to document spatial variability, and a 26cm long core addresses historical changes. The bulk of the diatom assemblage in LDH can be classified as both eutrophic and moderately metal tolerant, using modern national diatom indices developed and used by the French regional water agencies. Surface sediment samples within LDH show large spatial variations in %Cocconeis placentula whose habitat is epiphytic growth on Elodea. Other variation is reflected in the phytoplankton composition both spatially, and interannually. Aulacoseira muzzanensis and Cyclostephanos dubius showed greater abundance in the open water habitats in LDH, whereas sites in CDL outside of LDH had greater Cyclotella meneghiniana. Temporally, Stephanodicsus (largely S. hantzschii), the dominant diatom in early spring, were present in greater abundances in the 2016 surface sediment samples than in any of the 2015 samples. One possible explanation is that the 2016 samples, taken March 30th, preferentially preserved the early spring Stephanodiscus bloom, in contrast to the 2015 samples, which were taken in January. The sediment core provides an historical record, where the uppermost 4cm plot with the bulk of the LDH surface samples and contain abundant Cocconeis, 4 -14cm is phytoplankton-rich, largely Cyclostephanos dubius and Aulacoseira muzzanensis, and represents a less weed-choked environment prior to the 2012 Elodea invasion. The base of the core is dominated by Amphora and
Photodithazine photodynamic effect on viability of 9L/lacZ gliosarcoma cell line.
Fontana, Leticia C; Pinto, Juliana G; Pereira, André H C; Soares, Cristina P; Raniero, Leandro J; Ferreira-Strixino, Juliana
2017-08-01
Even with the advances of conventional treatment techniques, the nervous system cancer prognosis is still not favorable to the patient which makes alternative therapies needed to be studied. Photodynamic therapy (PDT) is presented as a promising therapy, which employs a photosensitive (PS) agent, light wavelength suitable for the PS agent, and molecular oxygen, producing reactive oxygen species in order to induce cell death. The aim of this study is to observe the PDT action in gliosarcoma cell using a chlorin (Photodithazine, PDZ). The experiments were done with 9L/lacZ lineage cells, grown in a DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution and put in a culture chamber at 37 °C with an atmosphere of 5% CO 2 . The PS agent used was the PDZ to an LED light source device (Biopdi/IRRAD-LED 660) in the 660-nm region. The location of the PS agent was analyzed by fluorescence microscopy, and cell viability was analyzed by MTT assay (mitochondrial activity), exclusion by trypan blue (cell viability), and morphological examination through an optical microscope (Leica MD 2500). In the analysis of the experiments with PDZ, there was 100% cell death at different concentrations and clear morphological differences in groups with and without treatment. Furthermore, it was observed that the photodithazine has been focused on all nuclear and cytoplasmic extension; however, it cannot be said for sure whether the location is in the inside core region or on the plasma membrane. In general, the PDZ showed a promising photosensitive agent in PDT for the use of gliosarcoma.
Cosmological surveys with multi-object spectrographs
NASA Astrophysics Data System (ADS)
Colless, Matthew
2016-08-01
Multi-object spectroscopy has been a key technique contributing to the current era of `precision cosmology.' From the first exploratory surveys of the large-scale structure and evolution of the universe to the current generation of superbly detailed maps spanning a wide range of redshifts, multi-object spectroscopy has been a fundamentally important tool for mapping the rich structure of the cosmic web and extracting cosmological information of increasing variety and precision. This will continue to be true for the foreseeable future, as we seek to map the evolving geometry and structure of the universe over the full extent of cosmic history in order to obtain the most precise and comprehensive measurements of cosmological parameters. Here I briefly summarize the contributions that multi-object spectroscopy has made to cosmology so far, then review the major surveys and instruments currently in play and their prospects for pushing back the cosmological frontier. Finally, I examine some of the next generation of instruments and surveys to explore how the field will develop in coming years, with a particular focus on specialised multi-object spectrographs for cosmology and the capabilities of multi-object spectrographs on the new generation of extremely large telescopes.
Long term monitoring of Gamma-Ray emission from the BL Lacertae object (1ES 2200+420)
NASA Astrophysics Data System (ADS)
Gunawardhana, Isuru; VERITAS Collaboration
2016-03-01
Blazars are a class of Active Galactic Nuclei (AGN) that have relativistic jets pointing along the observer line of sight. Blazars exhibit variable emission extending from radio to TeV energies. The variability timescale of the TeV flux is a key component of understanding the location of the very high energy emission zones. Deep observations of the quiescent state measurements are also required to disentangle the flaring state emission from quiescent state emission, a prerequisite for understanding the origin of blazar spectral variability. BL Lacertae (also known as 1ES 2200+420), as the namesake for all BL Lac objects, is a prime example of one such blazar. The VERITAS Observatory, an Imaging Atmospheric Cherenkov Telescope (IACT) array sensitive to gamma rays in the range from 85 GeV to 30 TeV, dedicates approximately 110 hours per year on deep observations of known gamma-ray blazars. In this talk, I will describe the TeV photon flux variability of BL Lacertae measured by VERITAS from 2013 to 2015.
Mezey, Gillian; Meyer, Deborah; Robinson, Fiona; Bonell, Chris; Campbell, Rona; Gillard, Steve; Jordan, Peter; Mantovani, Nadia; Wellings, Kaye; White, Sarah
2015-01-01
BACKGROUND: Looked-after children (LAC) are at greater risk of teenage pregnancy than non-LAC, which is associated with adverse health and social consequences. Existing interventions have failed to reduce rates of teenage pregnancy in LAC. Peer mentoring is proposed as a means of addressing many of the factors associated with the increased risk of teenage pregnancy in this group. OBJECTIVE: To develop a peer mentoring intervention to reduce teenage pregnancy in LAC. DESIGN: Phase I and II randomised controlled trial of a peer mentoring intervention for LAC; scoping exercise and literature search; national surveys of social care professionals and LAC; and focus groups and interviews with social care professionals, mentors and mentees. SETTING: Three local authorities (LAs) in England. PARTICIPANTS: LAC aged 14-18 years (mentees/care as usual) and 19-25 years (mentors). INTERVENTION: Recruitment and training of mentors; randomisation and matching of mentors to mentees; and 1-year individual peer mentoring. MAIN OUTCOME MEASURES: PRIMARY OUTCOME: pregnancy in LAC aged 14-18 years. SECONDARY OUTCOMES: sexual attitudes, behaviour and knowledge; psychological health; help-seeking behaviour; locus of control; and attachment style. A health economic evaluation was also carried out. RESULTS: In total, 54% of target recruitment was reached for the exploratory trial and 13 out of 20 mentors (65%) and 19 out of 30 LAC aged 14-18 years (63%) (recruited during Phases I and II) were retained in the research. The training programme was acceptable and could be manualised and replicated. Recruitment and retention difficulties were attributed to systemic problems and LA lack of research infrastructure and lack of additional funding to support and sustain such an intervention. Mentees appeared to value the intervention but had difficulty in meeting weekly as required. Only one in four of the relationships continued for the full year. A future Phase III trial would require the
NASA Astrophysics Data System (ADS)
Urry, C. Megan
1997-01-01
This grant was awarded to Dr. C. Megan Urry of the Space Telescope Science Institute in response to two successful ADP proposals to use archival Ginga and Rosat X-ray data for 'Testing the Pairs-Reflection model with X-Ray Spectral Variability' (in collaboration with Paola Grandi, now at the University of Rome) and 'X-Ray Properties of Complete Samples of Radio-Selected BL Lacertae Objects' (in collaboration with then-graduate student Rita Sambruna, now a post-doc at Goddard Space Flight Center). In addition, post-docs Joseph Pesce and Elena Pian, and graduate student Matthew O'Dowd, have worked on several aspects of these projects. The grant was originally awarded on 3/01/94; this report covers the full period, through May 1997. We have completed our project on the X-ray properties of radio-selected BL Lacs.
Continuum radiation from active galactic nuclei: A statistical study
NASA Technical Reports Server (NTRS)
Isobe, T.; Feigelson, E. D.; Singh, K. P.; Kembhavi, A.
1986-01-01
The physics of the continuum spectrum of active galactic nuclei (AGNs) was examined using a large data set and rigorous statistical methods. A data base was constructed for 469 objects which include radio selected quasars, optically selected quasars, X-ray selected AGNs, BL Lac objects, and optically unidentified compact radio sources. Each object has measurements of its radio, optical, X-ray core continuum luminosity, though many of them are upper limits. Since many radio sources have extended components, the core component were carefully selected out from the total radio luminosity. With survival analysis statistical methods, which can treat upper limits correctly, these data can yield better statistical results than those previously obtained. A variety of statistical tests are performed, such as the comparison of the luminosity functions in different subsamples, and linear regressions of luminosities in different bands. Interpretation of the results leads to the following tentative conclusions: the main emission mechanism of optically selected quasars and X-ray selected AGNs is thermal, while that of BL Lac objects is synchrotron; radio selected quasars may have two different emission mechanisms in the X-ray band; BL Lac objects appear to be special cases of the radio selected quasars; some compact radio sources show the possibility of synchrotron self-Compton (SSC) in the optical band; and the spectral index between the optical and the X-ray bands depends on the optical luminosity.
NASA Astrophysics Data System (ADS)
Tomov, N. A.; Tomova, M. T.; Bisikalo, D. V.
2017-12-01
The eclipsing symbiotic binary BF Cyg has had five orbital minima during its last optical outburst after 2006. The second minimum is much shallower than the first one and after that the minimum get deeper again. We determined the parameters of the accretion structure surrounding the compact object in two minima and traced its evolution until 2014. Moreover, we analysed the continuum of the system in the region of the UBVRCIC photometric bands to derive the parameters of its components at two times orbital maximum and calculated the mass-loss rate of the compact object. The results obtained allow us to conclude about the mechanism of fading of the optical light of the system until 2014. These results show that the optical flux of the outbursted compact object decreases because of "contraction" of its observed photosphere (pseudophotosphere) which, on its side, is due to increase of the velocity of its stellar wind, and the optical flux of the circumbinary nebula decreases mainly because of reduction of its mean density, which, on its side, is due to destruction of the accretion structure.
Luminance gradient at object borders communicates object location to the human oculomotor system.
Kilpeläinen, Markku; Georgeson, Mark A
2018-01-25
The locations of objects in our environment constitute arguably the most important piece of information our visual system must convey to facilitate successful visually guided behaviour. However, the relevant objects are usually not point-like and do not have one unique location attribute. Relatively little is known about how the visual system represents the location of such large objects as visual processing is, both on neural and perceptual level, highly edge dominated. In this study, human observers made saccades to the centres of luminance defined squares (width 4 deg), which appeared at random locations (8 deg eccentricity). The phase structure of the square was manipulated such that the points of maximum luminance gradient at the square's edges shifted from trial to trial. The average saccade endpoints of all subjects followed those shifts in remarkable quantitative agreement. Further experiments showed that the shifts were caused by the edge manipulations, not by changes in luminance structure near the centre of the square or outside the square. We conclude that the human visual system programs saccades to large luminance defined square objects based on edge locations derived from the points of maximum luminance gradients at the square's edges.
Lipopolysaccharide Structure and Biosynthesis in Helicobacter pylori.
Li, Hong; Liao, Tingting; Debowski, Aleksandra W; Tang, Hong; Nilsson, Hans-Olof; Stubbs, Keith A; Marshall, Barry J; Benghezal, Mohammed
2016-12-01
This review covers the current knowledge and gaps in Helicobacter pylori lipopolysaccharide (LPS) structure and biosynthesis. H. pylori is a Gram-negative bacterium which colonizes the luminal surface of the human gastric epithelium. Both a constitutive alteration of the lipid A preventing TLR4 elicitation and host mimicry of the Lewis antigen decorated O-antigen of H. pylori LPS promote immune escape and chronic infection. To date, the complete structure of H. pylori LPS is not available, and the proposed model is a linear arrangement composed of the inner core defined as the hexa-saccharide (Kdo-LD-Hep-LD-Hep-DD-Hep-Gal-Glc), the outer core composed of a conserved trisaccharide (-GlcNAc-Fuc-DD-Hep-) linked to the third heptose of the inner core, the glucan, the heptan and a variable O-antigen, generally consisting of a poly-LacNAc decorated with Lewis antigens. Although the glycosyltransferases (GTs) responsible for the biosynthesis of the H. pylori O-antigen chains have been identified and characterized, there are many gaps in regard to the biosynthesis of the core LPS. These limitations warrant additional mutagenesis and structural studies to obtain the complete LPS structure and corresponding biosynthetic pathway of this important gastric bacterium. © 2016 John Wiley & Sons Ltd.
Graves, Lisa; Lalla, Leonora; Young, Meredith
2017-01-01
Abstract Objective To examine the relationship between objective assessment of performance and self-rated competence immediately before and after participation in a required summative family medicine clerkship objective structured clinical examination (OSCE). Design Learners rated their competence (on a 7-point Likert scale) before and after an OSCE along 3 dimensions: general, specific, and professional competencies relevant to family medicine. Setting McGill University in Montreal, Que. Participants All 168 third-year clinical clerks completing their mandatory family medicine rotation in 2010 to 2011 were invited to participate. Main outcome measures Self-ratings of competence and objective performance scores were compared, and were examined to determine if OSCEs could be a “corrective” tool for self-rating perceived competence (ie, if the experience of undergoing an assessment might assist learners in recalibrating their understanding of their own performance). Results A total of 140 (83%) of the third-year clinical clerks participated. Participating in an OSCE decreased learners’ ratings of perceived competence (pre-OSCE score = 4.9, post-OSCE score = 4.7; F1,3192 = 4.2; P < .05). Learners’ mean self-rated competence for all categories of behaviour (before and after) showed no relationship to OSCE performance (r < 0.12 and P > .08 for all), nor did ratings of station-relevant competence (before and after) (r < 0.19 and P > .09 for all). Ratings of competence before and after the OSCE were correlated for individual students (r > 0.40 and P < .001 for all). Conclusion After the OSCE, students’ self-ratings of perceived competence had decreased, and these ratings had little relationship to actual performance, regardless of the specificity of the rated competency. Discordance between perceived and actual competence is neither novel nor unique to family medicine. However, this discordance is an important consideration for the development of competency
ERIC Educational Resources Information Center
Nestel, Debra; Kneebone, Roger; Nolan, Carmel; Akhtar, Kash; Darzi, Ara
2011-01-01
Assessment of clinical skills is a critical element of undergraduate medical education. We compare a traditional approach to procedural skills assessment--the Objective Structured Clinical Examination (OSCE) with the Integrated Performance Procedural Instrument (IPPI). In both approaches, students work through "stations" or…
Arami, Sanam; Mahdavi, Majid; Rashidi, Mohammad-Reza; Yekta, Reza; Rahnamay, Mohammad; Molavi, Leila; Hejazi, Mohammad-Saeid; Samadi, Nasser
2017-08-05
Delivery of small interfering RNAs (siRNAs) into cells still remains a challenge in gene delivery studies. Here, we investigated the ability of synthesized Fe 3 O 4 -PEG-LAC-chitosan-PEI nanoparticles for siRNA delivery of survivin as the model gene into cells. The cellular uptake of survivin siRNA carried by synthesized nanoparticles into MCF-7 breast cancer cell line was evaluated by florescent microscopy and flowcytometry, both proving the efficacy of nanoparticles in delivery of up to 64.7% in comparison with lipofectamine 2000. Furthermore, the delivery of survivin siRNA by the nanoparticles (nanoplex) induced apoptosis that was assessed through DAPI staining and Annexin V/PI assays. In addition, we evaluated the efficacy of treatment with nanoplexes in the presence of mitoxantrone, as a chemotherapeutic agent. Our data indicated that inhibition of survivin expression increased the cell sensitivity to mitoxantrone. Real-time PCR and western blotting analysis revealed a significant reduction in mRNA and protein levels of survivin upon delivery of siRNA. Molecular docking studies showed that nanoparticles can bind to centeral BIR domain of survivin, exactly above zinc ion location with high affinity (ΔG: -10.3Kcal/mol). Also, thermodynamic studies proved the experimental results theoretically, revealing that the siRNA-loaded nanoparticles have a suppressing effect on survivin mRNA. Therefore, delivery of survivin siRNA into MCF-7 cells using Fe 3 O 4 -PEG-LAC-chitosan-PEI nanoparticles as a carrier enhances the cell death. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Ge, Jun; Chan, Heang-Ping; Sahiner, Berkman; Zhang, Yiheng; Wei, Jun; Hadjiiski, Lubomir M.; Zhou, Chuan
2007-03-01
We are developing a computerized technique to reduce intra- and interplane ghosting artifacts caused by high-contrast objects such as dense microcalcifications (MCs) or metal markers on the reconstructed slices of digital tomosynthesis mammography (DTM). In this study, we designed a constrained iterative artifact reduction method based on a priori 3D information of individual MCs. We first segmented individual MCs on projection views (PVs) using an automated MC detection system. The centroid and the contrast profile of the individual MCs in the 3D breast volume were estimated from the backprojection of the segmented individual MCs on high-resolution (0.1 mm isotropic voxel size) reconstructed DTM slices. An isolated volume of interest (VOI) containing one or a few MCs is then modeled as a high-contrast object embedded in a local homogeneous background. A shift-variant 3D impulse response matrix (IRM) of the projection-reconstruction (PR) system for the extracted VOI was calculated using the DTM geometry and the reconstruction algorithm. The PR system for this VOI is characterized by a system of linear equations. A constrained iterative method was used to solve these equations for the effective linear attenuation coefficients (eLACs) within the isolated VOI. Spatial constraint and positivity constraint were used in this method. Finally, the intra- and interplane artifacts on the whole breast volume resulting from the MC were calculated using the corresponding impulse responses and subsequently subtracted from the original reconstructed slices. The performance of our artifact-reduction method was evaluated using a computer-simulated MC phantom, as well as phantom images and patient DTMs obtained with IRB approval. A GE prototype DTM system that acquires 21 PVs in 3º increments over a +/-30º range was used for image acquisition in this study. For the computer-simulated MC phantom, the eLACs can be estimated accurately, thus the interplane artifacts were
Very high energy gamma-ray emission detected from PKS 1440-389 with H.E.S.S.
NASA Astrophysics Data System (ADS)
Hofmann, W.
2012-04-01
The BL Lac object PKS 1440-389, located at a tentative redshift of z=0.065 (6dF Galaxy Survey, Jones, D.H. et al. MNRAS 355, 747-763, 2004), has been reported as a hard (G=1.75+/-0.05), bright, and steady extragalactic source at GeV energies in the Fermi-LAT catalogue (2FGL J1443.9-3908, P.L. Nolan et al., 2012, ApJS, 199, 31). The extrapolation of the Fermi-LAT spectrum to very high energies (VHE; E> 100 GeV), together with its brightness in the radio and X-ray bands, makes this BL Lac object a good candidate for VHE emission.
The reinvigoration of public health nursing: methods and innovations.
Avila, Margaret; Smith, Kathleen
2003-01-01
Los Angeles County (LAC) restructured and reinvigorated public health in response to nationwide concern over the adequacy of all public health infrastructures and functions. LAC's reorganization into geographically defined service planning areas (SPAs) has facilitated the integration of core public health functions into local practice. Public health nurses practicing as generalists within their SPA identified three initial objectives to address in population-based care: (1) expanding practice beyond disease control to a more holistic approach, (2) providing consultation using the Ask-the-Nurse innovation, and (3) developing a community assessment database for interdisciplinary SPA health planning. Additional innovative objectives are planned for the future.
Role of protein kinase C-η in cigarette smoke extract-induced apoptosis in MRC-5-cells.
Son, E S; Kyung, S Y; Lee, S P; Jeong, S H; Shin, J Y; Ohba, M; Yeo, E J; Park, J W
2015-09-01
Cigarette smoke (CS) is a major risk factor for emphysema, which causes cell death in structural cells of the lung by mechanisms that are still not completely understood. We demonstrated previously that CS extract (CSE) induces caspase activation in MRC-5 human lung fibroblasts, activated protein kinase C-η (PKC-η), and translocated PKC-η from the cytosol to the membrane. The objective of this study was to investigate the involvement of PKC-η activation in a CSE-induced extrinsic apoptotic pathway. We determined that CSE increases expression of caspase 3 and 8 cleavage in MRC-5 cells and overexpression of PKC-η significantly increased expression of caspase 3 and 8 cleavage compared with control LacZ-infected cells. In contrast, dominant negative (dn) PKC-η inhibited apoptosis in MRC-5 cells exposed to CSE and decreased expression of caspase 3 and 8 compared with control cells. Exposure to 10% CSE for >8 h significantly increased lactate dehydrogenase release in PKC-η-infected cells compared with LacZ-infected cells. Additionally, PKC-η-infected cells had an increased number of Hoechst 33342 stained nuclei compared with LacZ-infected cells, while dn PKC-η-infected cells exhibited fewer morphological changes than LacZ-infected cells under phase-contrast microscopy. In conclusion, PKC-η activation plays a pro-apoptotic role in CSE-induced extrinsic apoptotic pathway in MRC-5 cells. These results suggest that modulation of PKC-η may be a useful tool for regulating the extrinsic apoptosis of MRC-5 cells by CSE and may have therapeutic potential in the treatment of CS-induced lung injury. © The Author(s) 2014.
Dissecting the long-term emission behaviour of the BL Lac object Mrk 421
NASA Astrophysics Data System (ADS)
Carnerero, M. I.; Raiteri, C. M.; Villata, M.; Acosta-Pulido, J. A.; Larionov, V. M.; Smith, P. S.; D'Ammando, F.; Agudo, I.; Arévalo, M. J.; Bachev, R.; Barnes, J.; Boeva, S.; Bozhilov, V.; Carosati, D.; Casadio, C.; Chen, W. P.; Damljanovic, G.; Eswaraiah, E.; Forné, E.; Gantchev, G.; Gómez, J. L.; González-Morales, P. A.; Griñón-Marín, A. B.; Grishina, T. S.; Holden, M.; Ibryamov, S.; Joner, M. D.; Jordan, B.; Jorstad, S. G.; Joshi, M.; Kopatskaya, E. N.; Koptelova, E.; Kurtanidze, O. M.; Kurtanidze, S. O.; Larionova, E. G.; Larionova, L. V.; Latev, G.; Lázaro, C.; Ligustri, R.; Lin, H. C.; Marscher, A. P.; Martínez-Lombilla, C.; McBreen, B.; Mihov, B.; Molina, S. N.; Moody, J. W.; Morozova, D. A.; Nikolashvili, M. G.; Nilsson, K.; Ovcharov, E.; Pace, C.; Panwar, N.; Pastor Yabar, A.; Pearson, R. L.; Pinna, F.; Protasio, C.; Rizzi, N.; Redondo-Lorenzo, F. J.; Rodríguez-Coira, G.; Ros, J. A.; Sadun, A. C.; Savchenko, S. S.; Semkov, E.; Slavcheva-Mihova, L.; Smith, N.; Strigachev, A.; Troitskaya, Yu. V.; Troitsky, I. S.; Vasilyev, A. A.; Vince, O.
2017-12-01
We report on long-term multiwavelength monitoring of blazar Mrk 421 by the GLAST-AGILE Support Program of the Whole Earth Blazar Telescope (GASP-WEBT) collaboration and Steward Observatory, and by the Swift and Fermi satellites. We study the source behaviour in the period 2007-2015, characterized by several extreme flares. The ratio between the optical, X-ray and γ-ray fluxes is very variable. The γ-ray flux variations show a fair correlation with the optical ones starting from 2012. We analyse spectropolarimetric data and find wavelength-dependence of the polarization degree (P), which is compatible with the presence of the host galaxy, and no wavelength dependence of the electric vector polarization angle (EVPA). Optical polarimetry shows a lack of simple correlation between P and flux and wide rotations of the EVPA. We build broad-band spectral energy distributions with simultaneous near-infrared and optical data from the GASP-WEBT and ultraviolet and X-ray data from the Swift satellite. They show strong variability in both flux and X-ray spectral shape and suggest a shift of the synchrotron peak up to a factor of ∼50 in frequency. The interpretation of the flux and spectral variability is compatible with jet models including at least two emitting regions that can change their orientation with respect to the line of sight.
Model-based occluded object recognition using Petri nets
NASA Astrophysics Data System (ADS)
Zhou, Chuan; Hura, Gurdeep S.
1998-09-01
This paper discusses the use of Petri nets to model the process of the object matching between an image and a model under different 2D geometric transformations. This transformation finds its applications in sensor-based robot control, flexible manufacturing system and industrial inspection, etc. A description approach for object structure is presented by its topological structure relation called Point-Line Relation Structure (PLRS). It has been shown how Petri nets can be used to model the matching process, and an optimal or near optimal matching can be obtained by tracking the reachability graph of the net. The experiment result shows that object can be successfully identified and located under 2D transformation such as translations, rotations, scale changes and distortions due to object occluded partially.
Laser-Assisted Cold-Sprayed Corrosion- and Wear-Resistant Coatings: A Review
NASA Astrophysics Data System (ADS)
Olakanmi, E. O.; Doyoyo, M.
2014-06-01
Laser-assisted cold spray (LACS) process will be increasingly employed for depositing coatings because of its unique advantages: solid-state deposition of dense, homogeneous, and pore-free coatings onto a range of substrates; and high build rate at reduced operating costs without the use of expensive heating and process inert gases. Depositing coatings with excellent performance indicators via LACS demands an accurate knowledge and control of processing and materials' variables. By varying the LACS process parameters and their interactions, the functional properties of coatings can be manipulated. Moreover, thermal effect due to laser irradiation and microstructural evolution complicate the interpretation of LACS mechanical deformation mechanism which is essential for elucidating its physical phenomena. In order to provide a basis for follow-on-research that leads to the development of high-productivity LACS processing of coatings, this review focuses on the latest developments in depositing corrosion- and wear-resistant coatings with the emphasis on the composition, structure, and mechanical and functional properties. Historical developments and fundamentals of LACS are addressed in an attempt to describe the physics behind the process. Typical technological applications of LACS coatings are also identified. The investigations of all process sequences, from laser irradiation of the powder-laden gas stream and the substrate, to the impingement of thermally softened particles on the deposition site, and subsequent further processes, are described. Existing gaps in the literature relating to LACS-dependent microstructural evolution, mechanical deformation mechanisms, correlation between functional properties and process parameters, processing challenges, and industrial applications have been identified in order to provide insights for further investigations and innovation in LACS deposition of wear- and corrosion-resistant coatings.
End of life care preferences among people of advanced age: LiLACS NZ.
Gott, Merryn; Frey, Rosemary; Wiles, Janine; Rolleston, Anna; Teh, Ruth; Moeke-Maxwell, Tess; Kerse, Ngaire
2017-12-19
Understanding end of life preferences amongst the oldest old is crucial to informing appropriate palliative and end of life care internationally. However, little has been reported in the academic literature about the end of life preferences of people in advanced age, particularly the preferences of indigenous older people, including New Zealand Māori. Data on end of life preferences were gathered from 147 Māori (aged >80 years) and 291 non- Māori aged (>85 years), during three waves of Te Puawaitangi O Nga Tapuwae Kia Ora Tonu, Life and Living in Advanced Age (LiLACs NZ). An interviewer-led questionnaire using standardised tools and including Māori specific subsections was used. The top priority for both Māori and non-Māori participants at end of life was 'not being a burden to my family'. Interestingly, a home death was not a high priority for either group. End of life preferences differed by gender, however these differences were culturally contingent. More female Māori participants wanted spiritual practices at end of life than male Māori participants. More male non-Māori participants wanted to be resuscitated than female non- Māori participants. That a home death was not in the top three end of life priorities for our participants is not consistent with palliative care policy in most developed countries where place of death, and particularly home death, is a central concern. Conversely our participants' top concern - namely not being a burden - has received little research or policy attention. Our results also indicate a need to pay attention to diversity in end of life preferences amongst people of advanced age, as well as the socio-cultural context within which preferences are formulated.
Nie, Mengyun; Demeaux, Julien; Young, Benjamin T.; ...
2015-07-23
Binder free (BF) graphite electrodes were utilized to investigate the effect of electrolyte additives fluoroethylene carbonate (FEC) and vinylene carbonate (VC) on the structure of the solid electrolyte interface (SEI). The structure of the SEI has been investigated via ex-situ surface analysis including X-ray Photoelectron spectroscopy (XPS), Hard XPS (HAXPES), Infrared spectroscopy (IR) and transmission electron microscopy (TEM). The components of the SEI have been further investigated via nuclear magnetic resonance (NMR) spectroscopy of D2O extractions. The SEI generated on the BF-graphite anode with a standard electrolyte (1.2 M LiPF6 in ethylene carbonate (EC) / ethyl methyl carbonate (EMC), 3/7more » (v/v)) is composed primarily of lithium alkyl carbonates (LAC) and LiF. Incorporation of VC (3% wt) results in the generation of a thinner SEI composed of Li2CO3, poly(VC), LAC, and LiF. Incorporation of VC inhibits the generation of LAC and LiF. Incorporation of FEC (3% wt) also results in the generation of a thinner SEI composed of Li2CO3, poly(FEC), LAC, and LiF. The concentration of poly(FEC) is lower than the concentration of poly(VC) and the generation of LAC is inhibited in the presence of FEC. The SEI appears to be a homogeneous film for all electrolytes investigated.« less
Si, Jian-min; Luo, A-li; Wu, Fu-zhao; Wu, Yi-hong
2015-03-01
There are many valuable rare and unusual objects in spectra dataset of Sloan Digital Sky Survey (SDSS) Data Release eight (DR8), such as special white dwarfs (DZ, DQ, DC), carbon stars, white dwarf main-sequence binaries (WDMS), cataclysmic variable (CV) stars and so on, so it is extremely significant to search for rare and unusual celestial objects from massive spectra dataset. A novel algorithm based on Kernel dense estimation and K-nearest neighborhoods (KNN) has been presented, and applied to search for rare and unusual celestial objects from 546 383 stellar spectra of SDSS DR8. Their densities are estimated using Gaussian kernel density estimation, the top 5 000 spectra in descend order by their densities are selected as rare objects, and the top 300 000 spectra in ascend order by their densities are selected as normal objects. Then, KNN were used to classify the rest objects, and simultaneously K nearest neighbors of the 5 000 rare spectra are also selected as rare objects. As a result, there are totally 21 193 spectra selected as initial rare spectra, which include error spectra caused by deletion, redden, bad calibration, spectra consisting of different physically irrelevant components, planetary nebulas, QSOs, special white dwarfs (DZ, DQ, DC), carbon stars, white dwarf main-sequence binaries (WDMS), cataclysmic variable (CV) stars and so on. By cross identification with SIMBAD, NED, ADS and major literature, it is found that three DZ white dwarfs, one WDMS, two CVs with company of G-type star, three CVs candidates, six DC white dwarfs, one DC white dwarf candidate and one BL Lacertae (BL lac) candidate are our new findings. We also have found one special DA white dwarf with emission lines of Ca II triple and Mg I, and one unknown object whose spectrum looks like a late M star with emission lines and its image looks like a galaxy or nebula.
NAGAMINE, Kanetada
2016-01-01
Cosmic-ray muons (CRM) arriving from the sky on the surface of the earth are now known to be used as radiography purposes to explore the inner-structure of large-scale objects and landforms, ranging in thickness from meter to kilometers scale, such as volcanic mountains, blast furnaces, nuclear reactors etc. At the same time, by using muons produced by compact accelerators (CAM), advanced radiography can be realized for objects with a thickness in the sub-millimeter to meter range, with additional exploration capability such as element identification and bio-chemical analysis. In the present report, principles, methods and specific research examples of CRM transmission radiography are summarized after which, principles, methods and perspective views of the future CAM radiography are described. PMID:27725469
Nagamine, Kanetada
2016-01-01
Cosmic-ray muons (CRM) arriving from the sky on the surface of the earth are now known to be used as radiography purposes to explore the inner-structure of large-scale objects and landforms, ranging in thickness from meter to kilometers scale, such as volcanic mountains, blast furnaces, nuclear reactors etc. At the same time, by using muons produced by compact accelerators (CAM), advanced radiography can be realized for objects with a thickness in the sub-millimeter to meter range, with additional exploration capability such as element identification and bio-chemical analysis. In the present report, principles, methods and specific research examples of CRM transmission radiography are summarized after which, principles, methods and perspective views of the future CAM radiography are described.
Buerkle, Bernd; Pueth, Julia; Hefler, Lukas A; Tempfer-Bentz, Eva-Katrin; Tempfer, Clemens B
2012-10-01
To compare the skills of performing a shoulder dystocia management algorithm after hands-on training compared with demonstration. We randomized medical students to a 30-minute hands-on (group 1) and a 30-minute demonstration (group 2) training session teaching a standardized shoulder dystocia management scheme on a pelvic training model. Participants were tested with a 22-item Objective Structured Assessment of Technical Skills scoring system after training and 72 hours thereafter. Objective Structured Assessment of Technical Skills scores were the primary outcome. Performance time, self-assessment, confidence, and global rating scale were the secondary outcomes. Statistics were performed using Mann-Whitney U test, χ test, and multiple linear regression analysis. Two hundred three participants were randomized. Objective Structured Assessment of Technical Skills scores were significantly higher in group 1 (n=103) compared with group 2 (n=100) (17.95±3.14 compared with 15.67±3.18, respectively; P<.001). The secondary outcomes global rating scale (GRS; 10.94±2.71 compared with 8.57±2.61, respectively; P<.001), self-assessment (3.15±0.94 compared with 2.72±1.01; P=.002), and confidence (3.72±0.98 compared with 3.34±0.90, respectively; P=.005), but not performance time (3:19±0:48 minutes compared with 3:31±1:05 minutes; P=.1), were also significantly different, favoring group 1. After 72 hours, Objective Structured Assessment of Technical Skills scores were still significantly higher in group 1 (n=67) compared with group 2 (n=60) (18.17±2.76 compared with 14.98±3.03, respectively; P<.001) as were GRS (10.80±2.62 compared with 8.15±2.59; P<.001) and self assessment (SA; 3.44±0.87 compared with 2.95±0.94; P=.003). In a multiple linear regression analysis, group assignment (group 1 compared with 2; P<.001) and sex (P=.002) independently influenced Objective Structured Assessment of Technical Skills scores. Hands-on training helps to achieve a significant
Compare Human-Made Objects with Natural Objects. Grades 3-5.
ERIC Educational Resources Information Center
Rushton, Erik; Ryan, Emily; Swift, Charles
In this activity, students experiment and observe the similarities and differences between human-made objects and nature in small groups. Students compare the function and structure of hollow bones with drinking straws, bird beaks and tool pliers, and bat wings and airplane wings. A classroom discussion can be held to discuss similarities and…
Validity and reliability of the robotic objective structured assessment of technical skills
Siddiqui, Nazema Y.; Galloway, Michael L.; Geller, Elizabeth J.; Green, Isabel C.; Hur, Hye-Chun; Langston, Kyle; Pitter, Michael C.; Tarr, Megan E.; Martino, Martin A.
2015-01-01
Objective Objective structured assessments of technical skills (OSATS) have been developed to measure the skill of surgical trainees. Our aim was to develop an OSATS specifically for trainees learning robotic surgery. Study Design This is a multi-institutional study in eight academic training programs. We created an assessment form to evaluate robotic surgical skill through five inanimate exercises. Obstetrics/gynecology, general surgery, and urology residents, fellows, and faculty completed five robotic exercises on a standard training model. Study sessions were recorded and randomly assigned to three blinded judges who scored performance using the assessment form. Construct validity was evaluated by comparing scores between participants with different levels of surgical experience; inter- and intra-rater reliability were also assessed. Results We evaluated 83 residents, 9 fellows, and 13 faculty, totaling 105 participants; 88 (84%) were from obstetrics/gynecology. Our assessment form demonstrated construct validity, with faculty and fellows performing significantly better than residents (mean scores: 89 ± 8 faculty; 74 ± 17 fellows; 59 ± 22 residents, p<0.01). In addition, participants with more robotic console experience scored significantly higher than those with fewer prior console surgeries (p<0.01). R-OSATS demonstrated good inter-rater reliability across all five drills (mean Cronbach's α: 0.79 ± 0.02). Intra-rater reliability was also high (mean Spearman's correlation: 0.91 ± 0.11). Conclusions We developed an assessment form for robotic surgical skill that demonstrates construct validity, inter- and intra-rater reliability. When paired with standardized robotic skill drills this form may be useful to distinguish between levels of trainee performance. PMID:24807319
Methods and strategies of object localization
NASA Technical Reports Server (NTRS)
Shao, Lejun; Volz, Richard A.
1989-01-01
An important property of an intelligent robot is to be able to determine the location of an object in 3-D space. A general object localization system structure is proposed, some important issues on localization discussed, and an overview given for current available object localization algorithms and systems. The algorithms reviewed are characterized by their feature extracting and matching strategies; the range finding methods; the types of locatable objects; and the mathematical formulating methods.
Indexing and retrieving point and region objects
NASA Astrophysics Data System (ADS)
Ibrahim, Azzam T.; Fotouhi, Farshad A.
1996-03-01
R-tree and its variants are examples of spatial data structures for paged-secondary memory. To process a query, these structures require multiple path traversals. In this paper, we present a new image access method, SB+-tree which requires a single path traversal to process a query. Also, SB+-tree will allow commercial databases an access method for spatial objects without a major change, since most commercial databases already support B+-tree as an access method for text data. The SB+-tree can be used for zero and non-zero size data objects. Non-zero size objects are approximated by their minimum bounding rectangles (MBRs). The number of SB+-trees generated is dependent upon the number of dimensions of the approximation of the object. The structure supports efficient spatial operations such as regions-overlap, distance and direction. In this paper, we experimentally and analytically demonstrate the superiority of SB+-tree over R-tree.
Lac Courte Oreilles Hydro Dam Assessment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weaver, Jason; Meyers, Amy
The main objective of this project was to investigate upgrading the existing hydro power generating system at the Winter Dam. The tribe would like to produce more energy and receive a fair market power purchase agreement so the dam is no longer a drain on our budget but a contributor to our economy. We contracted Kiser Hydro, LLC Engineering for this project and received an engineering report that includes options for producing more energy with cost effective upgrades to the existing turbines. Included in this project was a negotiation of energy price sales negotiations.
On the Indirect Object in English.
ERIC Educational Resources Information Center
DeArmond, Richard C.
The aim of this paper is to determine whether the first predicate noun (NP) after the verb in sentences such as "Kelly gave Rose a piano" is the direct object or the indirect object in the surface structure of English. An analysis reveals that the direct object in English is not marked by its position immediately after a (transitive)…
Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J
2011-08-09
The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society
Harder, H; Khol-Parisini, A; Metzler-Zebeli, B U; Klevenhusen, F; Zebeli, Q
2015-11-01
Recent data indicate positive effects of treating grain with citric (CAc) or lactic acid (LAc) on the hydrolysis of phytate phosphorus (P) and fermentation products of the grain. This study used a semicontinuous rumen simulation technique to evaluate the effects of processing of barley with 50.25 g/L (wt/vol) CAc or 76.25 g/L LAc on microbial composition, metabolic fermentation profile, and nutrient degradation at low or high dietary P supply. The low P diet [3.1g of P per kg of dry matter (DM) of dietary P sources only] was not supplemented with inorganic P, whereas the high P diet was supplemented with 0.5 g of inorganic P per kg of DM through mineral premix and 870 mg of inorganic P/d per incubation fermenter via artificial saliva. Target microbes were determined using quantitative PCR. Data showed depression of total bacteria but not of total protozoa or short-chain fatty acid (SCFA) concentration with the low P diet. In addition, the low P diet lowered the relative abundance of Ruminococcus albus and decreased neutral detergent fiber (NDF) degradation and acetate proportion, but increased the abundance of several predominantly noncellulolytic bacterial species and anaerobic fungi. Treatment of grain with LAc increased the abundance of total bacteria in the low P diet only, and this effect was associated with a greater concentration of SCFA in the ruminal fluid. Interestingly, in the low P diet, CAc treatment of barley increased the most prevalent bacterial group, the genus Prevotella, in ruminal fluid and increased NDF degradation to the same extent as did inorganic P supplementation in the high P diet. Treatment with either CAc or LAc lowered the abundance of Megasphaera elsdenii but only in the low P diet. On the other hand, CAc treatment increased the proportion of acetate in the low P diet, whereas LAc treatment decreased this variable at both dietary P levels. The propionate proportion was significantly increased by LAc at both P levels, whereas butyrate
Mitchell, John D; Amir, Rabia; Montealegre-Gallegos, Mario; Mahmood, Feroze; Shnider, Marc; Mashari, Azad; Yeh, Lu; Bose, Ruma; Wong, Vanessa; Hess, Philip; Amador, Yannis; Jeganathan, Jelliffe; Jones, Stephanie B; Matyal, Robina
2018-06-01
While standardized examinations and data from simulators and phantom models can assess knowledge and manual skills for ultrasound, an Objective Structured Clinical Examination (OSCE) could assess workflow understanding. We recruited 8 experts to develop an OSCE to assess workflow understanding in perioperative ultrasound. The experts used a binary grading system to score 19 graduating anesthesia residents at 6 stations. Overall average performance was 86.2%, and 3 stations had an acceptable internal reliability (Kuder-Richardson formula 20 coefficient >0.5). After refinement, this OSCE can be combined with standardized examinations and data from simulators and phantom models to assess proficiency in ultrasound.
Attachment to place in advanced age: A study of the LiLACS NZ cohort.
Wiles, Janine L; Rolleston, Anna; Pillai, Avinesh; Broad, Joanna; Teh, Ruth; Gott, Merryn; Kerse, Ngaire
2017-07-01
An extensive body of research theorises that attachment to place is positively associated with health, particularly for older people. Building on this, we measure how indicators of attachment to place are associated with health for in people of advanced age in New Zealand. We use data from a cohort study (LiLACS NZ), which includes an indigenous Māori cohort aged 80-90 years and a non-Māori cohort aged 85 years from a mixed urban/rural region in New Zealand. Each cohort undertook a comprehensive interview and health assessment (n = 267 Māori and n = 404 non-Māori). Using multivariate regression analyses, we explore participants' feelings for and connectedness with their home, community and neighbourhood; nature and the outdoors; expectations about and enthusiasm for residential mobility; and how all these are associated with measures of health (e.g., SF-12 physical and mental health related quality of life) and functional status (e.g., NEADL). We demonstrate that people in advanced age hold strong feelings of attachment to place. We also establish some positive associations between attachment to place and health in advanced age, and show how these differ for the indigenous and non-indigenous cohorts. For older Māori there were strong associations between various health measures and the importance of nature and the outdoors, and connectedness to neighbourhood and community. For older non-Māori, there were strong associations between health and liking home and neighbourhood, and feeling connected to their community and neighbourhood. Place attachment, and particularly its relationship to health, operates in different ways for different groups. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Sibeck, D. G.; Angelopoulos, V.; Brain, D. A.; Delory, G. T.; Eastwood, J. P.; Farrell, W. M.; Grimm, R. E.; Halekas, J. S.; Hasegawa, H.; Hellinger, P.;
2011-01-01
NASA's two spacecraft ARTEMIS mission will address both heliospheric and planetary research questions, first while in orbit about the Earth with the Moon and subsequently while in orbit about the Moon. Heliospheric topics include the structure of the Earth's magnetotail; reconnection, particle acceleration, and turbulence in the Earth's magnetosphere, at the bow shock, and in the solar wind; and the formation and structure of the lunar wake. Planetary topics include the lunar exosphere and its relationship to the composition of the lunar surface, the effects of electric fields on dust in the exosphere, internal structure of the Moon, and the lunar crustal magnetic field. This paper describes the expected contributions of ARTEMIS to these baseline scientific objectives.
Galactose transport in Kluyveromyces lactis: major role of the glucose permease Hgt1.
Baruffini, Enrico; Goffrini, Paola; Donnini, Claudia; Lodi, Tiziana
2006-12-01
In Kluyveromyces lactis, galactose transport has been thought to be mediated by the lactose permease encoded by LAC12. In fact, a lac12 mutant unable to grow on lactose did not grow on galactose either and showed low and uninducible galactose uptake activity. The existence of other galactose transport systems, at low and at high affinity, had, however, been hypothesized on the basis of galactose uptake kinetics studies. Here we confirmed the existence of a second galactose transporter and we isolated its structural gene. It turned out to be HGT1, previously identified as encoding the high-affinity glucose carrier. Analysis of galactose transporter mutants, hgt1 and lac12, and the double mutant hgt1lac12, suggested that Hgt1 was the high-affinity and Lac12 was the low-affinity galactose transporter. HGT1 expression was strongly induced by galactose and insensitive to glucose repression. This could explain the rapid adaptation to galactose observed in K. lactis after a shift from glucose to galactose medium.
NASA Astrophysics Data System (ADS)
Dupuy, Stéphane; Lainé, Gérard; Tassin, Jacques; Sarrailh, Jean-Michel
2013-12-01
This article's goal is to explore the benefits of using Digital Surface Model (DSM) and Digital Terrain Model (DTM) derived from LiDAR acquisitions for characterizing the horizontal structure of different facies in forested areas (primary forests vs. secondary forests) within the framework of an object-oriented classification. The area under study is the island of Mayotte in the western Indian Ocean. The LiDAR data were the data originally acquired by an airborne small-footprint discrete-return LiDAR for the "Litto3D" coastline mapping project. They were used to create a Digital Elevation Model (DEM) at a spatial resolution of 1 m and a Digital Canopy Model (DCM) using median filtering. The use of two successive segmentations at different scales allowed us to adjust the segmentation parameters to the local structure of the landscape and of the cover. Working in object-oriented mode with LiDAR allowed us to discriminate six vegetation classes based on canopy height and horizontal heterogeneity. This heterogeneity was assessed using a texture index calculated from the height-transition co-occurrence matrix. Overall accuracy exceeds 90%. The resulting product is the first vegetation map of Mayotte which emphasizes the structure over the composition.
The prior statistics of object colors.
Koenderink, Jan J
2010-02-01
The prior statistics of object colors is of much interest because extensive statistical investigations of reflectance spectra reveal highly non-uniform structure in color space common to several very different databases. This common structure is due to the visual system rather than to the statistics of environmental structure. Analysis involves an investigation of the proper sample space of spectral reflectance factors and of the statistical consequences of the projection of spectral reflectances on the color solid. Even in the case of reflectance statistics that are translationally invariant with respect to the wavelength dimension, the statistics of object colors is highly non-uniform. The qualitative nature of this non-uniformity is due to trichromacy.
ERIC Educational Resources Information Center
Hatala, Rose; Cook, David A.; Brydges, Ryan; Hawkins, Richard
2015-01-01
In order to construct and evaluate the validity argument for the Objective Structured Assessment of Technical Skills (OSATS), based on Kane's framework, we conducted a systematic review. We searched MEDLINE, EMBASE, CINAHL, PsycINFO, ERIC, Web of Science, Scopus, and selected reference lists through February 2013. Working in duplicate, we selected…
Spectroscopic and polarimetric study of radio-quiet weak emission line quasars
NASA Astrophysics Data System (ADS)
Kumar, Parveen; Chand, Hum; Gopal-Krishna; Srianand, Raghunathan; Stalin, Chelliah Subramonian; Petitjean, Patrick
2018-04-01
A small subset of optically selected radio-quiet QSOs with weak or no emission lines may turn out to be the elusive radio-quiet BL Lac objects, or simply be radio-quiet QSOs with an infant/shielded broad line region (BLR). High polarisation (p > 3-4%), a hallmark of BL Lacs, can be used to test whether some optically selected ‘radio-quiet weak emission line QSOs’ (RQWLQs) show a fractional polarisation high enough to qualify as radio-quiet analogues of BL Lac objects. To check this possibility, we have made optical spectral and polarisation measurements of a sample of 19 RQWLQs. Out of these, only 9 sources show a non-significant proper motion (hence very likely extragalactic) and only two of them are found to have p > 1%. For these two RQWLQs, namely J142505.59+035336.2 and J154515.77+003235.2, we found the highest polarization to be 1.59±0.53%, which is again too low to classify them as (radio-quiet) BL Lacs, although one may recall that even genuine BL Lacs sometimes appear weakly polarised. We also present a statistical comparison of the optical spectral index, for a sample of 45 RQWLQs with redshift-luminosity matched control samples of 900 QSOs and an equivalent sample of 120 blazars, assembled from the literature. The spectral index distribution of RQWLQs is found to differ, at a high significance level, from that of blazars. This, too, is consistent with the common view that the mechanism of the central engine in RQWLQs, as a population, is close to that operating in normal QSOs and the primary difference between them is related to the BLR.
30 CFR 56.14106 - Falling object protection.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Falling object protection. 56.14106 Section 56... Equipment Safety Devices and Maintenance Requirements § 56.14106 Falling object protection. (a) Fork-lift trucks, front-end loaders, and bulldozers shall be provided with falling object protective structures if...
30 CFR 57.14106 - Falling object protection.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Falling object protection. 57.14106 Section 57... Equipment Safety Devices and Maintenance Requirements § 57.14106 Falling object protection. (a) Fork-lift trucks, front-end loaders, and bulldozers shall be provided with falling object protective structures if...
30 CFR 56.14106 - Falling object protection.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Falling object protection. 56.14106 Section 56... Equipment Safety Devices and Maintenance Requirements § 56.14106 Falling object protection. (a) Fork-lift trucks, front-end loaders, and bulldozers shall be provided with falling object protective structures if...
30 CFR 57.14106 - Falling object protection.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Falling object protection. 57.14106 Section 57... Equipment Safety Devices and Maintenance Requirements § 57.14106 Falling object protection. (a) Fork-lift trucks, front-end loaders, and bulldozers shall be provided with falling object protective structures if...
30 CFR 56.14106 - Falling object protection.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Falling object protection. 56.14106 Section 56... Equipment Safety Devices and Maintenance Requirements § 56.14106 Falling object protection. (a) Fork-lift trucks, front-end loaders, and bulldozers shall be provided with falling object protective structures if...