The Discovery of Low-Luminosity BL Lacs

NASA Astrophysics Data System (ADS)

Rector, Travis A.; Stocke, John T.

1995-12-01

Many of the properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis whereby BL Lacs are ``highly beamed'' FR-I radio galaxies (i.e. our line of sight to these objects is nearly along the jet axis). Further, radio-selected BL Lacs (RBLs) are believed to be seen nearly ``on-axis'' (the line-of-sight angle theta ~ 8deg ) while X-ray selected BL Lacs (XBLs) are seen at larger angles (theta ~ 30deg ; the X-ray emitting jet is believed to be less collimated). However, a major problem with this model was that a transition population between beamed BL Lacs and unbeamed FR-Is had not been detected. Low-luminosity BL Lacs may be such a transition population, and were predicted to exist by Browne and Marcha (1993). We present ROSAT HRI images, VLA radio maps and optical spectra which confirm the existence of low-luminosity BL Lacs, objects which were previously mis-identified in the EMSS catalog as clusters of galaxies. Thus our results strengthen the relativistic beaming hypothesis.

NMR studies on the structure and dynamics of lac operator DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.C.

Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less

Lysines 72, 80 and 213 and aspartic acid 210 of the Lactococcus lactis LacR repressor are involved in the response to the inducer tagatose-6-phosphate leading to induction of lac operon expression.

PubMed

van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M

1993-02-01

Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.

Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

PubMed

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

2014-06-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

PubMed Central

O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

2014-01-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

Indian Americans at Mille Lacs.

ERIC Educational Resources Information Center

Holbert, Victoria L.; And Others

The Training Center for Community Programs prepared a report on the Mille Lacs (Chippewa) Reservation in Minnesota. Data for the report were from 2 separate sources: a survey conducted by the Training Center with the assistance of the Mille Lacs community action program (1967) and an attitudinal survey conducted by Victoria Holbert during 1969.…

UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.

UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less

Evidence that selected amplification of a bacterial lac frameshift allele stimulates Lac(+) reversion (adaptive mutation) with or without general hypermutability.

PubMed Central

Slechta, E Susan; Liu, Jing; Andersson, Dan I; Roth, John R

2002-01-01

In the genetic system of Cairns and Foster, a nongrowing population of an E. coli lac frameshift mutant appears to specifically accumulate Lac(+) revertants when starved on medium including lactose (adaptive mutation). This behavior has been attributed to stress-induced general mutagenesis in a subpopulation of starved cells (the hypermutable state model). We have suggested that, on the contrary, stress has no direct effect on mutability but favors only growth of cells that amplify their leaky mutant lac region (the amplification mutagenesis model). Selection enhances reversion primarily by increasing the mutant lac copy number within each developing clone on the selection plate. The observed general mutagenesis is attributed to a side effect of growth with an amplification-induction of SOS by DNA fragments released from a tandem array of lac copies. Here we show that the S. enterica version of the Cairns system shows SOS-dependent general mutagenesis and behaves in every way like the original E. coli system. In both systems, lac revertants are mutagenized during selection. Eliminating the 35-fold increase in mutation rate reduces revertant number only 2- to 4-fold. This discrepancy is due to continued growth of amplification cells until some clones manage to revert without mutagenesis solely by increasing their lac copy number. Reversion in the absence of mutagenesis is still dependent on RecA function, as expected if it depends on lac amplification (a recombination-dependent process). These observations support the amplification mutagenesis model. PMID:12136002

Arabidopsis CER8 encodes LONG-CHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis.

PubMed

Lü, Shiyou; Song, Tao; Kosma, Dylan K; Parsons, Eugene P; Rowland, Owen; Jenks, Matthew A

2009-08-01

Plant cuticle is an extracellular lipid-based matrix of cutin and waxes, which covers aerial organs and protects them from many forms of environmental stress. We report here the characterization of CER8/LACS1, one of nine Arabidopsis long-chain acyl-CoA synthetases thought to activate acyl chains. Mutations in LACS1 reduced the amount of wax in all chemical classes on the stem and leaf, except in the very long-chain fatty acid (VLCFA) class wherein acids longer than 24 carbons (C(24)) were elevated more than 155%. The C(16) cutin monomers on lacs1 were reduced by 37% and 22%, whereas the C(18) monomers were increased by 28% and 20% on stem and leaf, respectively. Amounts of wax and cutin on a lacs1-1 lacs2-3 double mutant were much lower than on either parent, and lacs1-1 lacs2-3 had much higher cuticular permeability than either parent. These additive effects indicate that LACS1 and LACS2 have overlapping functions in both wax and cutin synthesis. We demonstrated that LACS1 has synthetase activity for VLCFAs C(20)-C(30), with highest activity for C(30) acids. LACS1 thus appears to function as a very long-chain acyl-CoA synthetase in wax metabolism. Since C(16) but not C(18) cutin monomers are reduced in lacs1, and C(16) acids are the next most preferred acid (behind C(30)) by LACS1 in our assays, LACS1 also appears to be important for the incorporation of C(16) monomers into cutin polyester. As such, LACS1 defines a functionally novel acyl-CoA synthetase that preferentially modifies both VLCFAs for wax synthesis and long-chain (C(16)) fatty acids for cutin synthesis.

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

Late Holocene dinosterol hydrogen isotope variability in Lac Lalolalo and Lac Lanutavake on Wallis Island

NASA Astrophysics Data System (ADS)

Maloney, A. E.; Hing, S. N.; Richey, J. N.; Nelson, D. B.; Sachs, J. P.

2017-12-01

The South Pacific Convergence Zone (SPCZ) is the Southern Hemisphere's largest precipitation feature, yet little is known about the region's rainfall prior to the instrumental record. In the tropics, hydrogen isotopes of precipitation are controlled by the "amount effect" where higher mean annual rainfall rates result in 2H-depleted rain. In turn, hydrogen isotopes in tropical lakes are influenced by both rain water isotopes and evaporative enrichment. Molecular fossils preserved in lake sediments offer a promising tool for improving our understanding of the past SPCZ by tracking changes in lake water isotopes. Hydrogen isotope compositions (δ2H) of the algal lipid biomarker dinosterol were measured in duplicate sediment cores from lakes 2.75km apart on Wallis Island. The modern lakes differ in physical and chemical conditions but are both freshwater in the photic zone and experience identical climate conditions. They are an ideal setting to investigate the fidelity to which δ2Hdinosterol records climate. Duplicate records from Lac Lanutavake are in excellent agreement and reveal little change in during the past 1700 years with minor δ2Hdinosterol fluctuations between -280‰ and -290‰. Duplicate records from Lac Lalolalo also agree extremely well during the past 2,000 years. However, contrary to its neighbor, Lac Lalolalo has a highly variable δ2Hdinosterol history with 2H-depleted values of -300‰ during the youngest part of the record climbing to 2H-enriched values of -230‰ around 1000-2000 years ago. The large shift in Lac Lalolalo δ2Hdinosterol may be due to changes in lake biogeochemistry that impact growth conditions or shifts in dinoflagellate species composition. Alternatively, if the Lac Lalolalo record actually reflects changes in hydrology, large limnological changes must have occurred in Lac Lanutavke to mute the climate signal. This work emphasizes the importance of redundancy and duplication when investigating changes in past climate using

Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)

The business of refractive laser assisted cataract surgery (ReLACS).

PubMed

Berdahl, John P; Jensen, Matthew P

2014-01-01

Refractive Laser Assisted Cataract Surgery (ReLACS) combines the femtosecond laser with other noncovered tests and services in an attempt to reduce spectacle dependence in combination with cataract surgery. Significant interest is present among ophthalmologists who are considering adopting this technology, however significant capital outlays and continuing expenses can make the decision to adopt ReLACS foreboding. We review the financial considerations of ReLACS and review the trends seen in early adopters of this technology. Recent findings have shown that ReLACS is a growing segment of cataract surgery. Most practices who have implemented the technology have broken even and have a positive outlook on the financial return of implementing the ReLACS program. The average break-even analysis point for practices is around 230 cases a year. ReLACS is growing and appears to be a financial viable approach for many practices.

Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

PubMed Central

Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

2013-01-01

β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

Mutational spectra of the lacI transgene isolated from Big Blue{reg_sign} mice exposed to three carcinogenic aromatic amines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Staedtler, F.; Locher, F.; Sreenan, G.

1997-10-01

In order to evaluate the in vivo genotoxic potential of three putative genotoxic mouse liver carcinogens, high doses of 4-chloro-o-phenylenediamine, 2-nitro-p-phenylenediamine and 2, 4-diaminotoluene were tested short term in the Big Blue{reg_sign} transgenic mouse mutation assay. Small statistically significant increases in the lacI mutant frequencies in the liver by factors 1.7 to 2.0 were found. A representative number of 347 lacI mutants isolated from liver tissue of male and female animals were analyses by DNA sequencing. The mutational spectra were examined with the Adams-Skopek algorithm. The spontaneous mutational spectra from untreated male and female animals were similar and consistent withmore » spectral Big Blue{reg_sign} control data stored in the lacI database. Most of the background mutations were located in the 5{prime} portion of the coding region of the lacI gene. Single base substitutions were most prominent. G:C to A:T transitions and G:C to T:A transversions occurred predominatly and were preferentially located at CpG sites. Despite the increases observed in the mutant frequencies of the treated animals, the corresponding mutational spectra did not differ from the controls. However, it is possible that certain classes of point mutations were substantially increased but not detected due to the limited number of sequenced mutants. In two animals treated with 2, 4- diaminotoluene unusually high mutant frequencies and the multiple occurrence of certain mutations in the liver was observed. From one of these animals six lacI mutants isolated from colon tissue were all different. Since 2, 4-diaminotoluene was shown to induce liver cell proliferation these results may reflect clonal expansion of single mutated liver cells.« less

Using the Markov chain Monte Carlo method to study the physical properties of GeV-TeV BL Lac objects

NASA Astrophysics Data System (ADS)

Qin, Longhua; Wang, Jiancheng; Yang, Chuyuan; Yuan, Zunli; Mao, Jirong; Kang, Shiju

2018-01-01

We fit the spectral energy distributions (SEDs) of 46 GeV-TeV BL Lac objects in the frame of leptonic one-zone synchrotron self-Compton (SSC) model and investigate the physical properties of these objects. We use the Markov chain Monte Carlo (MCMC) method to obtain the basic parameters, such as magnetic field (B), the break energy of the relativistic electron distribution (γ ^' }b), and the electron energy spectral index. Based on the modeling results, we support the following scenarios for GeV-TeV BL Lac objects. (1) Some sources have large Doppler factors, implying other radiation mechanism should be considered. (2) Compared with flat spectrum quasars (FSRQs), GeV-TeV BL Lac objects have weaker magnetic fields and larger Doppler factors, which cause the ineffective cooling and shift the SEDs to higher bands. Their jet powers are around 4.0 × 1045 erg s-1, compared with radiation power, 5.0 × 1042 erg s-1, indicating that only a small fraction of jet power is transformed into the emission power. (3) For some BL Lacs with large Doppler factors, their jet components could have two substructures, e.g., the fast core and the slow sheath. For most GeV-TeV BL Lacs, Kelvin-Helmholtz instabilities are suppressed by their higher magnetic fields, leading to micro-variability or intro-day variability in the optical bands. (4) Combined with a sample of FSRQs, an anti-correlation between the peak luminosity, Lpk, and the peak frequency, νpk, is obtained, favoring the blazar sequence scenario. In addition, an anti-correlation between the jet power, Pjet, and the break Lorentz factor, γb, also supports the blazar sequence.

Are some BL Lacs artefacts of gravitational lensing?

PubMed

Ostriker, J P; Vietri, M

1990-03-01

WE suggested in 1985 that a significant fraction of BL Lacertae objects, a kind of lineless quasar, seen in nearby galaxies are in fact images, gravitationally lensed and substantially amplified by stars in the nearby galaxy, of background objects, optically violent variable (OVV) quasars at redshifts z > 1 (ref. 1). This hypothesis was made on the basis of certain general similarities between BL Lacs and O Ws, but for two recently observed BL Lacs(2,3) a strong case can be made that the accompanying elliptical galaxy is a foreground object. In addition, we argue that the distribution of BL Lac redshifts is hard to understand without gravitational lensing, unless we happen to be at a very local maximum of the spatial cosmic distribution of BL Lacs. Our analysis also indicates that the galaxies whose stars are likely to act as microlenses will be found in two peaks, one nearby, with redshift 0.05-0.10, and the other near the distant quasar.

Evaluation of coloring efficacy of lac dye in comminuted meat product.

PubMed

Divya; Singh, R P; Baboo, B; Prasad, K M

2011-06-01

Effect of incorporation of graded levels (4, 6, 8, 10, 25 ppm) of lac dye on coloring efficacy and possible use of this natural color in processed meat products was studied. Inclusion of lac dye at different concentrations did not affect the pH significantly whereas a linear increase in the Lovibond red color unit of chicken nuggets was noted with raising the level of lac dye from 4 to 10 ppm. The sensory rating for color was highest at addition level of 25 ppm of lac dye and it was comparable to color score of the product containing 200 ppm sodium nitrite. Lac dye inclusion in nuggets at all concentrations studied had better antimicrobial properties as compared to 200 ppm sodium nitrite. It was concluded that lac dye from 10 to 25 ppm could be incorporated in comminuted meat products as a natural colorant with antimicrobial action.

Clustering environments of BL Lac objects

NASA Technical Reports Server (NTRS)

Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.

1993-01-01

We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.

X-Ray Variability of BL Lac Objects

NASA Astrophysics Data System (ADS)

McHardy, Ian

I present an overview of the X-ray temporal and spectral variability of BL Lacs on both short and long timescales. The previously observed behaviour of short (~days) flares superimposed on a relatively steady `quiescent' level is still broadly correct. However, for the brighter BL Lacs, the well sampled lightcurves from the RXTE ASM show that the `quiescent' level also varies considerably on timescales of ~100 days in a manner similar to that seen in Optically Violently Variable Quasars (OVVs) such as 3C279 and 3C273. Possible reasons for this behaviour are discussed. For the large majority of BL Lacs the soft and medium energy X-ray bands are dominated by synchrotron emission and, unlike the case of OVVs, the emission mechanism is not in doubt. Most interest then centres on the structure of the emitting region, and the electron acceleration processes, particularly during outbursts. That structure, and the acceleration processes, can be investigated by consideration of the spectral variability during flares, which is not simple. I review the observations of spectral variability and consider the evidence for and against homogeneous models. I also briefly compare the X-ray spectral variability of BL Lacs with that of OVVs such as 3C273.

Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)

Genotype to Phenotype Mapping of the E. coli lac Promoter

NASA Astrophysics Data System (ADS)

Otwinowski, Jakub; Nemenman, Ilya

2014-03-01

Genotype-to-phenotype maps and the related fitness landscapes that include epistatic interactions are difficult to measure because of their high dimensional structure. Here we construct such a map using the recently collected corpora of high-throughput sequence data from the 75 base pairs long mutagenized E. coli lac promoter region, where each sequence is associated with induced transcriptional activity measured by a fluorescent reporter. We find that the additive (non-epistatic) contributions of individual mutations account for about two-thirds of the explainable phenotype variance, while pairwise epistasis explains about 7% of the variance for the full mutagenized sequence and about 15% for the subsequence associated with protein binding sites. Surprisingly, there is no evidence for third order epistatic contributions, and our inferred fitness landscape is essentially single peaked, with a small amount of antagonistic epistasis. We identify transcription factor (CRP) and RNA polymerase binding sites in the promotor region and their interactions. We conclude with a cautionary note that inferred properties of fitness landscapes may be severely influenced by biases in the sequence data. Funded in part by HFSP and James S. McDonnell Foundation.

Regulation of lac Operon Expression: Reappraisal of the Theory of Catabolite Repression

PubMed Central

Wanner, Barry L.; Kodaira, Ryoji; Neidhardt, Frederick C.

1978-01-01

The physiological state of Escherichia coli with respect to (permanent) catabolite repression was assessed by measuring the steady-state level of β-galactosidase in induced or in constitutive cells under a variety of growth conditions. Four results were obtained. (i) Catabolite repression had a major effect on fully induced or constitutive expression of the lac gene, and the magnitude of this effect was found to be dependent on the promoter structure; cells with a wild-type lac promoter showed an 18-fold variation in lac expression, and cells with the lacP37 (formerly lac-L37) promoter exhibited several hundred-fold variation. (ii) Exogenous adenosine cyclic 3′,5′-monophosphoric acid (cAMP) could not abolish catabolite repression, even though several controls demonstrated that cAMP was entering the cells in significant amounts. (Rapid intracellular degradation of cAMP could not be ruled out.) (iii) Neither the growth rate nor the presence of biosynthetic products altered the degree of catabolite repression; all variation could be related to the catabolites present in the growth medium. (iv) Slowing by imposing an amino acid restriction decreased the differential rate of β-galactosidase synthesis from the wild-type lac promoter when bacteria were cultured in either the absence or presence of cAMP; this decreased lac expression also occurred when the bacteria harbored the catabolite-insensitive lacP5 (formerly lacUV5) promoter mutation. These findings support the idea that (permanent) catabolite repression is set by the catabolites in the growth medium and may not be related to an imbalance between catabolism and anabolism. PMID:214424

Modification of natural matrix lac-bagasse for matrix composite films

NASA Astrophysics Data System (ADS)

Nurhayati, Nanik Dwi; Widjaya, Karna; Triyono

2016-02-01

Material technology continues to be developed in order to a material that is more efficient with composite technology is a combination of two or more materials to obtain the desired material properties. The objective of this research was to modification and characterize the natural matrix lac-bagasse as composite films. The first step, natural matrix lac was changed from solid to liquid using an ethanol as a solvent so the matrix homogenly. Natural matrix lac was modified by adding citric acid with concentration variation. Secondly, the bagasse delignification using acid hydrolysis method. The composite films natural matrix lac-bagasse were prepared with optimum modified the addition citric acid 5% (v/v) and delignification bagasse optimum at 1,5% (v/v) in hot press at 80°C 6 Kg/cm-1. Thirdly, composite films without and with modification were characterized functional group analysis using FTIR spectrophotometer and mechanical properties using Universal Testing Machine. The result of research showed natural matrix lac can be modified by reaction with citric acid. FTIR spectra showed without and with modification had functional groups wide absorption 3448 cm-1 group -OH, C=O ester strong on 1712 cm-1 and the methylene group -CH2 on absorption 1465 cm-1. The mechanical properties showed tensile strength 0,55 MPa and elongation at break of 0,95 %. So that composite films natural matrix lac can be made with reinforcement bagasse for material application.

Evolutionary behaviour of AGN: Investigations on BL Lac objects and Seyfert II galaxies

NASA Astrophysics Data System (ADS)

Beckmann, V.

2000-12-01

The evolution and nature of AGN is still one of the enigmatic questions in astrophysics. While large and complete Quasar samples are available, special classes of AGN, like BL Lac objects and Seyfert II galaxies, are still rare objects. In this work I present two new AGN samples. The first one is the HRX-BL Lac survey, resulting in a sample of X-ray selected BL Lac objects. This sample results from 223 BL Lac candidates based on a correlation of X-ray sources with radio sources. The identification of this sample is 98% complete. 77 objects have been identified as BL Lac objects and form the HRX-BL Lac complete sample, the largest homogeneous sample of BL Lac objects existing today. For this sample, redshifts are now known for 62 objects (81 %). In total I present 101 BL Lac objects in the enlarged HRX-BL Lac survey, for which redshift information is available for 84 objects. During the HRX-BL Lac survey I found several objects of special interest. 1ES 1517+656 turned out to be the brightest known BL Lac object in the universe. 1ES 0927+500 could be the first BL Lac object with a line detected in the X-ray region. RX J1211+2242 is probably the the counterpart of the up to now unidentified gamma-ray source 3EG J1212+2304. Additionally I present seven candidates for ultra high frequency peaked BL Lac objects. RX J1054+3855 and RX J1153+3517 are rare high redshift X-ray bright QSO or accreting binary systems with huge magnetic fields. For the BL Lac objects I suggest an unified scenario in which giant elliptical galaxies, formed by merging events of spiral galaxies at z > 2, start as powerful, radio dominated BL Lacs. As the jet gets less powerful, the BL Lacs start to get more X-ray dominated, showing less total luminosities (for z < 1). This effect is seen in the different evolutionary behavior detected in high and low frequency cut off BL Lac objects (HBL and LBL, respectively). The model of negative evolution is supported by assumptions about the energetic effects

Evidence for an intermediate conformational state of LacY.

PubMed

Jiang, Xiaoxu; Guan, Lan; Zhou, Yonggang; Hong, Wen-Xu; Zhang, Qinghai; Kaback, H Ronald

2012-03-20

LacY mutant Cys154 → Gly exhibits a periplasmic-closed crystal structure identical to the WT, but is periplasmic-open in the membrane. The mutant hardly catalyzes transport, but binds galactosides from either side of the membrane with the same affinity and is resistant to site-directed proteolysis relative to the pseudo-WT. Site-directed alkylation was also applied to 11 single-Cys mutants in Cys154 → Gly LacY in right-side-out membrane vesicles or after solubilization and purification in dodecyl-β-D-maltopyranoside (DDM). Unlike the pseudo-WT, Cys replacements on the periplasmic side of the Cys154 → Gly mutant label rapidly in the membrane without sugar, but labeling decreases markedly after the mutant proteins are purified. Thus, Cys154 → Gly LacY likely favors a higher-energy intermediate periplasmic-open conformation in situ, but collapses to a lower-energy periplasmic-closed conformation in DDM after purification. Notably, branched-chain or neopentyl glycol maltoside detergents stabilize Cys154 → Gly LacY in the membrane-embedded form.

Genome sequences of two closely related strains of Escherichia coli K-12 GM4792.

PubMed

Zhang, Yan-Cong; Zhang, Yan; Zhu, Bi-Ru; Zhang, Bo-Wen; Ni, Chuan; Zhang, Da-Yong; Huang, Ying; Pang, Erli; Lin, Kui

2015-01-01

Escherichia coli lab strains K-12 GM4792 Lac(+) and GM4792 Lac(-) carry opposite lactose markers, which are useful for distinguishing evolved lines as they produce different colored colonies. The two closely related strains are chosen as ancestors for our ongoing studies of experimental evolution. Here, we describe the genome sequences, annotation, and features of GM4792 Lac(+) and GM4792 Lac(-). GM4792 Lac(+) has a 4,622,342-bp long chromosome with 4,061 protein-coding genes and 83 RNA genes. Similarly, the genome of GM4792 Lac(-) consists of a 4,621,656-bp chromosome containing 4,043 protein-coding genes and 74 RNA genes. Genome comparison analysis reveals that the differences between GM4792 Lac(+) and GM4792 Lac(-) are minimal and limited to only the targeted lac region. Moreover, a previous study on competitive experimentation indicates the two strains are identical or nearly identical in survivability except for lactose utilization in a nitrogen-limited environment. Therefore, at both a genetic and a phenotypic level, GM4792 Lac(+) and GM4792 Lac(-), with opposite neutral markers, are ideal systems for future experimental evolution studies.

Water quality and hydrology of the Lac Vieux Desert watershed, Gogebic County, Michigan, and Vilas County, Wisconsin, 2002-04

USGS Publications Warehouse

Weaver, T.L.; Neff, B.P.; Ellis, J.M.

2005-01-01

, could result in considerable degradation in lake-water quality.The estimated water balance includes the following inputs from the surrounding watershed: direct precipitation (35 percent); runoff, composed of streamflow and overland flow (50 percent); and ground-water flow (15 percent). Outputs from Lac Vieux Desert include streamflow into the Wisconsin River (68 percent) and evaporation from the lake surface (32 percent). Seasonal regulation of Lac Vieux Desert outflow results in an artificially high lake stage throughout the year, except from late winter to very early spring, prior to snowmelt and runoff. Regulation of Lac Vieux Desert outflow causes Wisconsin River streamflow to be artificially low during spring and summer and artificially high in fall and winter.Recent studies indicate that lake-level regulation over the past century may have affected wild rice growth and propagation in Lac Vieux Desert. As per licensing agreement between the Federal Energy Regulatory Commission and the Wisconsin Valley Improvement Company (operators of the dam at the outlet), the maximum lake level of Lac Vieux Desert was lowered about 0.8 feet to investigate the relation between lake-level regulation and propagation of wild rice from 2003 through 2012. Recent plantings of wild rice by the Lac Vieux Desert Band have been successful, indicating that suitable habitat and hydrologic regime were present in 2004-05.

Solving a discrete model of the lac operon using Z3

NASA Astrophysics Data System (ADS)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Design of the lac gene circuit revisited

PubMed Central

Savageau, Michael A.

2011-01-01

The lactose (lac) operon of Escherichia coli serves as the paradigm for gene regulation, not only for bacteria, but also for all biological systems from simple phage to humans. The details of the systems may differ, but the key conceptual framework remains, and the original system continues to reveal deeper insights with continued experimental and theoretical study. Nearly as long lasting in impact as the pivotal work of Jacob and Monod is the classic experiment of Novick and Weiner in which they demonstrated all-or-none gene expression in response to an artificial inducer. These results are often cited in claims that normal gene expression is in fact a discontinuous bistable phenomenon. In this paper, I review several levels of analysis of the lac system and introduce another perspective based on the construction of the system design space. These represent variations on a theme, based on a simply stated design principle, that captures the key qualitative features of the system in a largely mechanism-independent fashion. Moreover, this principle can be readily interpreted in terms of specific mechanisms to make predictions regarding monostable vs. bistable behavior. The regions of design space representing bifurcations are compared with the corresponding regions identified through bifurcation analysis. I present evidence based on biological considerations as well as modeling and analysis to suggest that induction of the lac system in its natural setting is a monostable continuously graded phenomenon. Nevertheless, it must be acknowledged that the lac stability question remains unsettled, and it undoubtedly will remain so until there are definitive experimental results. PMID:21414326

LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313

DOE PAGES

Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...

2016-12-21

Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those

Flood Control Project Lac Qui Parle, Emergency Plan

DTIC Science & Technology

1988-10-01

elevation of the breach (924.0 as shown in Table 1), is approximately 22.2 feet. The value of the envelope curve shown on Plate D-10 for a hydraulic...approximately 83% of the computed maximum outflow. Several failure scenarios for Lac qui Parle Dam were studied. The case of failure concurrent with a PKF ...discharge would plot very close to Lac qui Parle in Plate D-10. Plate D-10 shows that the value of the envelope curve for a hydraulic depth of 18.8 feet

Are some BL Lac objects artefacts of gravitational lensing?

NASA Technical Reports Server (NTRS)

Ostriker, J. P.; Vietri, M.

1985-01-01

It is proposed here that a significant fraction of BL Lac objects are optically violently variable quasars whose continuum emission has been greatly amplified, relative to the line emission, by pointlike gravitational lenses in intervening galaxies. Several anomalous physical and statistical properties of BL Lacs can be understood on the basis of this model, which is immediately testable on the basis of absorption line studies and by direct imaging.

Functional metagenomics reveals novel β-galactosidases not predictable from gene sequences.

PubMed

Cheng, Jiujun; Romantsov, Tatyana; Engel, Katja; Doxey, Andrew C; Rose, David R; Neufeld, Josh D; Charles, Trevor C

2017-01-01

The techniques of metagenomics have allowed researchers to access the genomic potential of uncultivated microbes, but there remain significant barriers to determination of gene function based on DNA sequence alone. Functional metagenomics, in which DNA is cloned and expressed in surrogate hosts, can overcome these barriers, and make important contributions to the discovery of novel enzymes. In this study, a soil metagenomic library carried in an IncP cosmid was used for functional complementation for β-galactosidase activity in both Sinorhizobium meliloti (α-Proteobacteria) and Escherichia coli (γ-Proteobacteria) backgrounds. One β-galactosidase, encoded by six overlapping clones that were selected in both hosts, was identified as a member of glycoside hydrolase family 2. We could not identify ORFs obviously encoding possible β-galactosidases in 19 other sequenced clones that were only able to complement S. meliloti. Based on low sequence identity to other known glycoside hydrolases, yet not β-galactosidases, three of these ORFs were examined further. Biochemical analysis confirmed that all three encoded β-galactosidase activity. Lac36W_ORF11 and Lac161_ORF7 had conserved domains, but lacked similarities to known glycoside hydrolases. Lac161_ORF10 had neither conserved domains nor similarity to known glycoside hydrolases. Bioinformatic and structural modeling implied that Lac161_ORF10 protein represented a novel enzyme family with a five-bladed propeller glycoside hydrolase domain. By discovering founding members of three novel β-galactosidase families, we have reinforced the value of functional metagenomics for isolating novel genes that could not have been predicted from DNA sequence analysis alone.

Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27

The REX survey as a Tool to Test the Beaming Model for BL Lacs

NASA Astrophysics Data System (ADS)

Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.

We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.

The Radio-optical Spectra of BL Lacs and Possible Relatives

NASA Astrophysics Data System (ADS)

Dennett-Thorpe, J.

I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?

Otoplasty: sequencing the operation for improved results.

PubMed

Hoehn, James G; Ashruf, Salman

2005-01-01

: After studying this article, the participant should be able to: 1. Understand the anatomy and embryology of the external ear. 2. Understand the anatomic causes of the prominent ear. 3. Understand the operative maneuvers used to shape the external ear. 4. Be able to sequence the otoplasty for consistent results. 5. Understand the possible complications of the otoplasty procedure. Correction of prominent ears is a common plastic surgical procedure. Proper execution of the surgical techniques is dependent on the surgeon's understanding of the surgical procedure. This understanding is best founded on an understanding of the historical bases for the operative steps and the execution of these operative steps in a logical fashion. This article describes the concept of sequencing the operation of otoplasty to produce predictable results combining the technical contributions from many authors. The historical, embryological, and anatomic bases for the operation are also discussed. Finally, the authors' preferred techniques are presented. Sequencing the steps in the preoperative assessment, preoperative planning, patient management, operative technique, and postoperative care will produce reproducible results for the attentive surgeon. Careful attention to the details of the operation of otoplasty will avoid many postoperative problems.

Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events.

PubMed

Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T

2011-06-01

Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.

Radio-weak BL Lac Objects in the Fermi Era

NASA Astrophysics Data System (ADS)

Massaro, F.; Marchesini, E. J.; D'Abrusco, R.; Masetti, N.; Andruchow, I.; Smith, Howard A.

2017-01-01

The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]-[4.6]-[12] μm color-color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.

Preparation of a Ammonia-Treated Lac Dye and Structure Elucidation of Its Main Component.

PubMed

Nishizaki, Yuzo; Ishizuki, Kyoko; Akiyama, Hiroshi; Tada, Atsuko; Sugimoto, Naoki; Sato, Kyoko

2016-01-01

Lac dye and cochineal extract contain laccaic acids and carminic acid as the main pigments, respectively. Both laccaic acids and carminic acid are anthraquinone derivatives. 4-Aminocarminic acid (acid-stable carmine), an illegal colorant, has been detected in several processed foods. 4-Aminocarminic acid is obtained by heating cochineal extract (carminic acid) in ammonia solution. We attempted to prepare ammonia-treated lac dye and to identify the structures of the main pigment components. Ammonia-treated lac dye showed acid stability similar to that of 4-aminocarminic acid. The structures of the main pigments in ammonia-treated lac dye were analyzed using LC/MS. One of the main pigments was isolated and identified as 4-aminolaccaic acid C using various NMR techniques, including 2D-INADEQUATE. These results indicated that ammonia-treatment of lac dye results in the generation of 4-aminolaccaic acids.

Time-dependent inhomogeneous jet models for BL Lac objects

NASA Technical Reports Server (NTRS)

Marlowe, A. T.; Urry, C. M.; George, I. M.

1992-01-01

Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.

Time-dependent inhomogeneous jet models for BL Lac objects

NASA Astrophysics Data System (ADS)

Marlowe, A. T.; Urry, C. M.; George, I. M.

1992-05-01

Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.

Tunable Control of an Escherichia coli Expression System for the Overproduction of Membrane Proteins by Titrated Expression of a Mutant lac Repressor.

PubMed

Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho

2017-09-15

Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.

LAC indicators: an evaluation of progress and list of proposed indicators

Treesearch

Alan E. Watson; David N. Cole

1992-01-01

One of the most critical, and difficult, steps in the Limits of Acceptable Change (LAC) process is the selection of indicators. To help with this step, this paper (I) briefly reviews some desirable characteristics of indicators and (2) lists indicators that have been proposed or adopted in LAC plans. From a comparison of this list of indicators and desirable...

RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massaro, F.; Marchesini, E. J.; D’Abrusco, R.

2017-01-10

The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated bymore » the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.« less

A five-residue sequence near the carboxyl terminus of the polytopic membrane protein lac permease is required for stability within the membrane.

PubMed Central

Roepe, P D; Zbar, R I; Sarkar, H K; Kaback, H R

1989-01-01

The lac permease (lacY gene product) of Escherichia coli contains 417 amino acid residues and is predicted to have a short hydrophilic amino terminus on the inner surface of the cytoplasmic membrane, multiple transmembrane hydrophobic segments in alpha-helical conformation, and a 17-amino acid residue hydrophilic carboxyl-terminal tail on the inner surface of the membrane. To assess the importance of the carboxyl terminus, the properties of several truncation mutants were studied. The mutants were constructed by site-directed mutagenesis such that stop codons were placed at specified positions, and the altered lacY genes were expressed at a relatively low rate from plasmid pACYC184. Permease truncated at position 407 or 401 retains full activity, and a normal complement of molecules is present in the membrane, as judged by immunoblot analyses. Thus, it is apparent that the carboxyl-terminal tail plays no direct role in membrane insertion of the permease, its stability, or in the mechanism of lactose/H+ symport. In marked contrast, when truncations are made at residues 396 (i.e., 4 amino acid residues from the carboxyl terminus of putative helix XII), 389, 372, or 346, the permease is no longer found in the membrane. Remarkably, however, when each of the mutated lacY genes is expressed at a high rate by means of the T7 RNA polymerase system [Tabor, S. & Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1079], all of the truncated permeases are present in the membrane, as indicated by [35S]methionine incorporation studies; however, permease truncated at residue 396, 389, 372, or 346 is defective with respect to lactose/H+ symport. Finally, pulse-chase experiments indicate that wild-type permease or permease truncated at residue 401 is stable, whereas permease truncated at or prior to residue 396 is degraded at a significant rate. The results are consistent with the notion that residues 396-401 in putative helix XII are important for protection against

Experimental identification of specificity determinants in the domain linker of a LacI/GalR protein: bioinformatics-based predictions generate true positives and false negatives.

PubMed

Meinhardt, Sarah; Swint-Kruse, Liskin

2008-12-01

In protein families, conserved residues often contribute to a common general function, such as DNA-binding. However, unique attributes for each homolog (e.g. recognition of alternative DNA sequences) must arise from variation in other functionally-important positions. The locations of these "specificity determinant" positions are obscured amongst the background of varied residues that do not make significant contributions to either structure or function. To isolate specificity determinants, a number of bioinformatics algorithms have been developed. When applied to the LacI/GalR family of transcription regulators, several specificity determinants are predicted in the 18 amino acids that link the DNA-binding and regulatory domains. However, results from alternative algorithms are only in partial agreement with each other. Here, we experimentally evaluate these predictions using an engineered repressor comprising the LacI DNA-binding domain, the LacI linker, and the GalR regulatory domain (LLhG). "Wild-type" LLhG has altered DNA specificity and weaker lacO(1) repression compared to LacI or a similar LacI:PurR chimera. Next, predictions of linker specificity determinants were tested, using amino acid substitution and in vivo repression assays to assess functional change. In LLhG, all predicted sites are specificity determinants, as well as three sites not predicted by any algorithm. Strategies are suggested for diminishing the number of false negative predictions. Finally, individual substitutions at LLhG specificity determinants exhibited a broad range of functional changes that are not predicted by bioinformatics algorithms. Results suggest that some variants have altered affinity for DNA, some have altered allosteric response, and some appear to have changed specificity for alternative DNA ligands.

Population Dynamics of a Lac(-) Strain of Escherichia Coli during Selection for Lactose Utilization

PubMed Central

Foster, P. L.

1994-01-01

During selection for lactose utilization, Lac(+) revertants of FC40, a Lac(-) strain of Escherichia coli, appear at a high rate. Yet, no Lac(+) revertants appear in the absence of lactose, or in its presence if the cells have another, unfulfilled requirement for growth. This study investigates more fully the population dynamics of FC40 when incubated in the absence of a carbon source or when undergoing selection for lactose utilization. In the absence of a carbon source, the viable cell numbers do not change over 6 days. When incubated in liquid lactose medium, Lac(-) cells do not undergo any measurable increase in numbers or in turbidity for at least 2 days. When FC40 is plated on lactose minimum medium in the presence of scavenger cells, the upper limit to the amount of growth of Lac(-) cells during 5 days is one doubling, and there is no evidence for turnover (i.e., a balance between growth and death). The presence of a minority population that could form microcolonies was not detected. The implications of these results, plus the fact that the appearance of Lac(+) revertants during lactose selection is nearly constant with time, are discussed in reference to several models that have been postulated to account for adaptive mutations. PMID:7828809

Complex genomic rearrangement in CCS-LacZ transgenic mice.

PubMed

Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

2007-02-01

The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.

PubMed

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina

2016-08-23

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.

Allochthonous 2.78 Ga oceanic plateau slivers in a 2.72 Ga continental arc sequence: Vizien greenstone belt, northeastern Superior Province, Canada

NASA Astrophysics Data System (ADS)

Skulski, T.; Percival, J. A.

1996-04-01

Embedded within the vast granitoid terrane of the Minto block of northeastern Superior Province are Late Archean greenstone belts of the Goudalie domain that preserve a long-lived record of continent-ocean interaction. The Vizien greenstone belt is one such belt and it contains four fault-bounded structural panels. The 2786 Ma mafic-ultramafic sequence is an allochthonous package of pillowed basaltic andesite, komatiite and volcaniclastic rocks cut by peridotite and gabbro sills. The mafic rocks are LREE-depleted tholeiites which have primitive mantle (PRIM)-normalized abundances of Th < Nb < La, and ɛNd values of +1.5 to + 3.2 reflecting extraction from a depleted mantle source. The 2724 Ma lac Lintelle continental calc-alkaline volcanic sequence consists of massive basalt, plagioclase-porphyritic andesite, dacite, rhyolite, capped by quartz-rich sandstones/conglomerates with 2.97 Ga Nd model ages. Lac Lintelle volcanic rocks are LREE enriched, with low TiO 2 (< 1%) and Zr (< 200 ppm), PRIM-normalized enrichment in Th > La > Nb, and a range of ɛNd values from -0.1 to +1.7. The ~ 2722 Ma lac Serindac bimodal, subaerial tholeiitic volcanic sequence contains andesite (locally with tonalite xenoliths), basalt, gabbro sills, lenses of quartz-rich sedimentary rocks and a thick, upper rhyolite sequence. The lac Serindac tholeiites are LREE-enriched, have PRIM-normalized Th > La > Nb, high Zr (to 300 ppm) and Ti contents, and low ɛNd values from +0.8 in basalt to -1.4 in rhyolite. The < 2718 Ma basement-cover sequence comprises 2.94 Ga tonalitic gneiss unconformably overlain by clastic sediments and a thin upper sequence of 2700 Ma gabbro, siliceous high-Mg basalt (SHMB) and andesite. The SHMB are characterised by LREE depletion and ɛNd values of +2.6, whereas the andesite is LREE-enriched and has ɛNd values of -0.3. The 2786 Ma mafic-ultramafic sequence is interpreted as a sliver of plume-related oceanic plateau crust. The 2724 lac Lintelle sequence represents a

Poly-LacNAc as an Age-Specific Ligand for Rotavirus P[11] in Neonates and Infants

PubMed Central

Liu, Yang; Huang, Pengwei; Jiang, Baoming; Tan, Ming; Morrow, Ardythe L.; Jiang, Xi

2013-01-01

Rotavirus (RV) P[11] is an unique genotype that infects neonates. The mechanism of such age-specific host restriction remains unknown. In this study, we explored host mucosal glycans as a potential age-specific factor for attachment of P[11] RVs. Using in vitro binding assays, we demonstrated that VP8* of a P[11] RV (N155) could bind saliva of infants (60.3%, N = 151) but not of adults (0%, N = 48), with a significantly negative correlation between binding of VP8* and ages of infants (P<0.01). Recognition to the infant saliva did not correlate with the ABO, secretor and Lewis histo-blood group antigens (HBGAs) but with the binding of the lectin Lycopersicon esculentum (LEA) that is known to recognize the oligomers of N-acetyllactosamine (LacNAc), a precursor of human HBGAs. Direct evidence of LacNAc involvement in P[11] binding was obtained from specific binding of VP8* with homopolymers of LacNAc in variable lengths through a glycan array analysis of 611 glycans. These results were confirmed by strong binding of VP8* to the Lec2 cell line that expresses LacNAc oligomers but not to the Lec8 cell line lacking the LacNAc. In addition, N155 VP8* and authentic P[11] RVs (human 116E and bovine B223) hemagglutinated human red blood cells that are known to express poly-LacNAc. The potential role of poly-LacNAc in host attachment and infection of RVs has been obtained by abrogation of 116E replication by the PAA-conjugated poly-LacNAc, human milk, and LEA positive infant saliva. Overall, our results suggested that the poly-LacNAc could serve as an age-specific receptor for P[11] RVs and well explained the epidemiology that P[11] RVs mainly infect neonates and young children. PMID:24244290

Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.

PubMed

Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min

Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.

Program Evaluation of Community College Learning Assistance Centers: What Do LAC Directors Think?

ERIC Educational Resources Information Center

Franklin, Doug; Blankenberger, Bob

2016-01-01

Objective: This study seeks to determine the nature of current program evaluation practices for learning assistance centers (LACs), the practices being used for program evaluation, and whether LAC directors believe their practices are appropriate for evaluating program effectiveness. Method: We conducted a survey (n = 61) of community college LAC…

VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)

NASA Astrophysics Data System (ADS)

Marcha, M. J. M.; Caccianiga, A.

2014-04-01

This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).

Crystal structure of VmoLac, a tentative quorum quenching lactonase from the extremophilic crenarchaeon Vulcanisaeta moutnovskia

PubMed Central

Hiblot, Julien; Bzdrenga, Janek; Champion, Charlotte; Chabriere, Eric; Elias, Mikael

2015-01-01

A new representative of the Phosphotriesterase-Like Lactonases (PLLs) family from the hyperthermophilic crenarchaeon Vulcanisaeta moutnovskia has been characterized and crystallized. VmoLac is a native, proficient lactonase with promiscuous, low phosphotriesterase activity. VmoLac therefore represents an interesting candidate for engineering studies, with the aim of developing an efficient bacterial quorum-quenching agent. Here, we provide an extensive biochemical and kinetic characterization of VmoLac and describe the X-ray structures of the enzyme bound to a fatty acid and to its cognate substrate 3-oxo-C10 AHL (Acyl-Homoserine Lactone). The structures highlight possible structural determinants that may be involved in its extreme thermal stability (Tm = 128°C). Moreover, the structure reveals that the substrate binding mode of VmoLac significantly differs from those of its close homologues, possibly explaining the substrate specificity of the enzyme. Finally, we describe the specific interactions between the enzyme and its substrate, and discuss the possible lactone hydrolysis mechanism of VmoLac. PMID:25670483

Period Variations of the Eclipsing Binary Systems T LMi and VX Lac

NASA Astrophysics Data System (ADS)

Yılmaz, M.; İzci, D. D.; Gümüş, D.; Özavci, İ.; Selam, S. O.

2015-07-01

We present a period analysis of the two Algol-type eclipsing binary systems T LMi and VX Lac using all available times of minimum in the literature, as well as new minima obtained at the Ankara University Kreiken Observatory. The period analysis of T LMi suggests mass transfer between the components and also a third body that is dynamically bound to the binary system. The analysis of VX Lac also suggests mass transfer between the components, and the presence of a third and a fourth body under the assumption of a Light-Time Effect. In addition, the periodic variation of VX Lac was examined under the hypothesis of magnetic activity, and the corresponding parameters were derived. We report here the orbital parameters for both systems, along with the ones related to mass transfer, and those for the third and fourth bodies.

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

PubMed

Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

2012-10-23

Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

Lactosylated Gramicidin-based lipid nanoparticles (Lac-GLN) for targeted delivery of anti-miR-155 to hepatocellular carcinoma

PubMed Central

Zhang, Mengzi; Zhou, Xiaoju; Wang, Bo; Yung, Bryant C.; Lee, Ly J.; Ghoshal, Kalpana; Lee, Robert J.

2013-01-01

Lactosylated gramicidin-containing lipid nanoparticles (Lac-GLN) were developed for delivery of anti-microRNA-155 (anti-miR-155) to hepatocellular carcinoma (HCC) cells. MiR-155 is an oncomiR frequently elevated in HCC. The Lac-GLN formulation contained N-lactobionyl-dioleoyl phosphatidylethanolamine (Lac-DOPE), a ligand for the asialoglycoprotein receptor (ASGR), and an antibiotic peptide gramicidin A. The nanoparticles exhibited a mean particle diameter of 73 nm, zeta potential of +3.5 mV, anti-miR encapsulation efficiency of 88%, and excellent colloidal stability at 4°C. Lac-GLN effectively delivered anti-miR-155 to HCC cells with a 16.1- and 4.1-fold up-regulation of miR-155 targets C/EBPβ and FOXP3 genes, respectively, and exhibited significant greater efficiency over Lipofectamine 2000. In mice, intravenous injection of Lac-GLN containing Cy3-anti-miR-155 led to preferential accumulation of the anti-miR-155 in hepatocytes. Intravenous administration of 1.5 mg/kg anti-miR-155 loaded Lac-GLN resulted in up-regulation of C/EBPβ and FOXP3 by 6.9- and 2.2- fold, respectively. These results suggest potential application of Lac-GLN as a liver-specific delivery vehicle for anti-miR therapy. PMID:23567045

Aflatoxin B1 and M1 Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators

PubMed Central

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C.; Quintieri, Laura; Cimmarusti, Maria T.; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F.; Sanjust, Enrico; Mulè, Giuseppina

2016-01-01

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B1 (AFB1) and M1 (AFM1). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB1 degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2′-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB1 was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM1 was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB1 and, for the first time, AFM1, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB1 and AFM1. PMID:27563923

STRUCTURED JETS IN BL LAC OBJECTS: EFFICIENT PeV NEUTRINO FACTORIES?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tavecchio, Fabrizio; Ghisellini, Gabriele; Guetta, Dafne

2014-09-20

The origin of high-energy neutrinos (0.1–1 PeV range) detected by IceCube remains a mystery. In this work, we explore the possibility that efficient neutrino production can occur in structured jets of BL Lac objects, characterized by a fast inner spine surrounded by a slower layer. This scenario has been widely discussed in the framework of the high-energy emission models for BL Lac objects and radio galaxies. One of the relevant consequences of a velocity structure is the enhancement of the inverse Compton emission caused by the radiative coupling of the two zones. We show that a similar boosting could occurmore » for the neutrino output of the spine through the photo-meson reaction of high-energy protons scattering off the amplified soft target photon field of the layer. Assuming the local density and the cosmological evolution of γ-ray BL Lac object derived from Fermi Large Area Telescope data, we calculate the expected diffuse neutrino intensity, which can match the IceCube data for a reasonable choice of parameters.« less

THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aartsen, M. G.; Abraham, K.; Ackermann, M.

2017-01-20

The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in themore » 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.« less

Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piette, J.; Decuyper-Debergh, D.; Gamper, H.

Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

PubMed Central

2012-01-01

Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra

Spitzer Space Telescope Sequencing Operations Software, Strategies, and Lessons Learned

NASA Technical Reports Server (NTRS)

Bliss, David A.

2006-01-01

The Space Infrared Telescope Facility (SIRTF) was launched in August, 2003, and renamed to the Spitzer Space Telescope in 2004. Two years of observing the universe in the wavelength range from 3 to 180 microns has yielded enormous scientific discoveries. Since this magnificent observatory has a limited lifetime, maximizing science viewing efficiency (ie, maximizing time spent executing activities directly related to science observations) was the key operational objective. The strategy employed for maximizing science viewing efficiency was to optimize spacecraft flexibility, adaptability, and use of observation time. The selected approach involved implementation of a multi-engine sequencing architecture coupled with nondeterministic spacecraft and science execution times. This approach, though effective, added much complexity to uplink operations and sequence development. The Jet Propulsion Laboratory (JPL) manages Spitzer s operations. As part of the uplink process, Spitzer s Mission Sequence Team (MST) was tasked with processing observatory inputs from the Spitzer Science Center (SSC) into efficiently integrated, constraint-checked, and modeled review and command products which accommodated the complexity of non-deterministic spacecraft and science event executions without increasing operations costs. The MST developed processes, scripts, and participated in the adaptation of multi-mission core software to enable rapid processing of complex sequences. The MST was also tasked with developing a Downlink Keyword File (DKF) which could instruct Deep Space Network (DSN) stations on how and when to configure themselves to receive Spitzer science data. As MST and uplink operations developed, important lessons were learned that should be applied to future missions, especially those missions which employ command-intensive operations via a multi-engine sequence architecture.

Wind Resource Assessment Report: Mille Lacs Indian Reservation, Minnesota

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jimenez, Antonio C.; Robichaud, Robi

The U.S. Environmental Protection Agency (EPA) launched the RE-Powering America's Land initiative to encourage development of renewable energy on potentially contaminated land and mine sites. EPA collaborated with the U.S. Department of Energy's (DOE's) National Renewable Energy Laboratory (NREL) and the Mille Lacs Band of Chippewa Indians to evaluate the wind resource and examine the feasibility of a wind project at a contaminated site located on the Mille Lacs Indian Reservation in Minnesota. The wind monitoring effort involved the installation of a 60-m met tower and the collection of 18 months of wind data at multiple heights above the ground.more » This report focuses on the wind resource assessment, the estimated energy production of wind turbines, and an assessment of the economic feasibility of a potential wind project sited this site.« less

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage

PubMed Central

Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage.

PubMed

Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.

Observation sequences and onboard data processing of Planet-C

NASA Astrophysics Data System (ADS)

Suzuki, M.; Imamura, T.; Nakamura, M.; Ishi, N.; Ueno, M.; Hihara, H.; Abe, T.; Yamada, T.

Planet-C or VCO Venus Climate Orbiter will carry 5 cameras IR1 IR 1micrometer camera IR2 IR 2micrometer camera UVI UV Imager LIR Long-IR camera and LAC Lightning and Airglow Camera in the UV-IR region to investigate atmospheric dynamics of Venus During 30 hr orbiting designed to quasi-synchronize to the super rotation of the Venus atmosphere 3 groups of scientific observations will be carried out i image acquisition of 4 cameras IR1 IR2 UVI LIR 20 min in 2 hrs ii LAC operation only when VCO is within Venus shadow and iii radio occultation These observation sequences will define the scientific outputs of VCO program but the sequences must be compromised with command telemetry downlink and thermal power conditions For maximizing science data downlink it must be well compressed and the compression efficiency and image quality have the significant scientific importance in the VCO program Images of 4 cameras IR1 2 and UVI 1Kx1K and LIR 240x240 will be compressed using JPEG2000 J2K standard J2K is selected because of a no block noise b efficiency c both reversible and irreversible d patent loyalty free and e already implemented as academic commercial software ICs and ASIC logic designs Data compression efficiencies of J2K are about 0 3 reversible and 0 1 sim 0 01 irreversible The DE Digital Electronics unit which controls 4 cameras and handles onboard data processing compression is under concept design stage It is concluded that the J2K data compression logics circuits using space

Isolating LacZ-expressing cells from mouse inner ear tissues using flow cytometry.

PubMed

Jan, Taha A; Chai, Renjie; Sayyid, Zahra N; Cheng, Alan G

2011-12-23

Isolation of specific cell types allows one to analyze rare cell populations such as stem/progenitor cells. Such an approach to studying inner ear tissues presents a unique challenge because of the paucity of cells of interest and few transgenic reporter mouse models. Here, we describe a protocol using fluorescence-conjugated probes to selectively label LacZ-positive cells from the neonatal cochleae. The most common underlying pathology of sensorineural hearing loss is the irreversible damage and loss of cochlear sensory hair cells, which are required to transduce sound waves to neural impulses. Recent evidence suggests that the murine auditory and vestibular organs harbor stem/progenitor cells that may have regenerative potential. These findings warrant further investigation, including identifying specific cell types with stem/progenitor cell characteristics. The Wnt signaling pathway has been demonstrated to play a critical role in maintaining stem/progenitor cell populations in several organ systems. We have recently identified Wnt-responsive Axin2-expressing cells in the neonatal cochlea, but their function is largely unknown. To better understand the behavior of these Wnt-responsive cells in vitro, we have developed a method of isolating Axin2-expressing cells from cochleae of Axin2-LacZ reporter mice. Using flow cytometry to isolate Axin2-LacZ positive cells from the neonatal cochleae, we could in turn execute a variety of experiments on live cells to interrogate their behavior as stem/progenitor cells. Here, we describe in detail the steps for the microdissection of neonatal cochlea, dissociation of these tissues, labeling of the LacZ-positive cells using a fluorogenic substrate, and cell sorting. Techniques for dissociating cochleae into single cells and isolating cochlear cells via flow cytometry have been described. We have made modifications to these techniques to establish a novel protocol to isolate LacZ-expressing cells from the neonatal cochlea.

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

PubMed

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample

NASA Astrophysics Data System (ADS)

Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.

1994-12-01

The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15Lacs are known and the largest complete samples are also small, with 20-50 objects each. Current data shows a discrepancy between XBL (X-ray selected BL Lac) and RBL (Radio-selected BL Lac) evolution, with = 0.304 +/- 0.062 for XBLs but = 0.60 +/- 0.05 for RBLs. Models of the X-ray luminosity function (XLF) are also poorly constrained. WARPS will allow us to compute an accurate XLF, decreasing the error bars above by over a factor of two. We will also test for low-luminosity BL Lacs, whose non-thermal nuclear sources are dim compared to the host galaxy. Browne and Marcha (1993) claim the EMSS missed most of these objects and is incomplete. If their predictions are correct, 20-40% of the BL Lacs we find will fall in this category, enabling us to probe the evolution and internal workings of BL Lacs at lower luminosities than ever before. By removing likely QSOs before optical spectroscopy, WARPS requires only modest amounts of telescope time. It will extend measurement of the cluster XLF both to higher redshifts (z>0.5) and lower luminosities (LX<1x10(44) erg s(-1) ) than previous measurements, confirming or rejecting the 3sigma detection of negative evolution found in the EMSS, and constraining Cold Dark Matter cosmologies. Faint NELGs are a recently discovered major contributor to the X-ray background. They are a mixture of Sy2s, starbursts and galaxies of unknown type. Detailed classification and evolution of their XLF will be determined for the first time.

Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)

X-Ray Spectral Variability Signatures of Flares in BL Lac Objects

NASA Technical Reports Server (NTRS)

Boettcher, Markus; Chiang, James; White, Nicholas E. (Technical Monitor)

2002-01-01

We are presenting a detailed parameter study of the time-dependent electron injection and kinematics and the self-consistent radiation transport in jets of intermediate and low-frequency peaked BL Lac objects. Using a time-dependent, combined synchrotron-self-Compton and external-Compton jet model, we study the influence of variations of several essential model parameters, such as the electron injection compactness, the relative contribution of synchrotron to external soft photons to the soft photon compactness, the electron- injection spectral index, and the details of the time profiles of the electron injection episodes giving rise to flaring activity. In the analysis of our results, we focus on the expected X-ray spectral variability signatures in a region of parameter space particularly well suited to reproduce the broadband spectral energy distributions of intermediate and low-frequency peaked BL Lac objects. We demonstrate that SSC- and external-Compton dominated models for the gamma-ray emission from blazars are producing significantly different signatures in the X-ray variability, in particular in the soft X-ray light curves and the spectral hysteresis at soft X-ray energies, which can be used as a powerful diagnostic to unveil the nature of the high-energy emission from BL Lac objects.

An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.

PubMed

Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K

2003-01-01

The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.

Light Curve and Orbital Period Analysis of VX Lac

NASA Astrophysics Data System (ADS)

Yılmaz, M.; Nelson, R. H.; Şenavcı, H. V.; İzci, D.; Özavcı, İ.; Gümüş, D.

2017-04-01

In this study, we performed simultaneously light curve and radial velocity, and also period analyses of the eclipsing binary system VX Lac. Four color (BVRI) light curves of the system were analysed using the W-D code. The results imply that VX Lac is a classic Algol-type binary with a mass ratio of q=0.27, of which the less massive secondary component fills its Roche lobe. The orbital period behaviour of the system was analysed by assuming the light time effect (LITE) from a third body. The O-C analysis yielded a mass transfer rate of dM/dt=1.86×10-8M⊙yr-1 and the minimal mass of the third body to be M3=0.31M⊙. The residuals from mass transfer and the third body were also analysed because another cyclic variation is seen in O-C diagram. This periodic variation was examined under the hypotheses of stellar magnetic activity and fourth body.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

New High-z BL Lacs Using the Photometric Method with Swift and SARA

NASA Astrophysics Data System (ADS)

Kaur, A.; Rau, A.; Ajello, M.; Domínguez, A.; Paliya, V. S.; Greiner, J.; Hartmann, D. H.; Schady, P.

2018-06-01

BL Lacertae (BL Lac) objects are prominent members of the third Fermi Large Area Telescope catalog of γ-ray sources. Half of the members of the BL Lac population (∼300) lack redshift measurements, which is due to the absence of lines in their optical spectra, thereby making it difficult to utilize spectroscopic methods. Our photometric dropout technique can be used to establish the redshift for a fraction of these sources. This work employed six filters mounted on the Swift-UVOT and four optical filters on two telescopes, the 0.65 m SARA-CTIO in Chile and 1.0 m SARA-ORM in the Canary Islands, Spain. A sample of 15 sources was extracted from the Swift archival data for which six filter UVOT observations were conducted. By complementing the Swift observations with the SARA ones, we were able to discover two high-redshift sources: 3FGL J1155.4-3417 and 3FGL J1156.7–2250 at z={1.83}-0.13+0.10 and z={1.73}-0.19+0.11, respectively, resulting from the dropouts in the power-law template fits to these data. The discoveries add to the important (26 total) sample of high-redshift BL Lacs. While the sample of high-z BL Lacs is still rather small, these objects do not seem to fit well within known schemes of the blazar population and represent the best probes of the extragalactic background light.

Escherichia coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ.

PubMed

Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo

2002-03-01

Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.

Application of genetic algorithm in integrated setup planning and operation sequencing

NASA Astrophysics Data System (ADS)

Kafashi, Sajad; Shakeri, Mohsen

2011-01-01

Process planning is an essential component for linking design and manufacturing process. Setup planning and operation sequencing is two main tasks in process planning. Many researches solved these two problems separately. Considering the fact that the two functions are complementary, it is necessary to integrate them more tightly so that performance of a manufacturing system can be improved economically and competitively. This paper present a generative system and genetic algorithm (GA) approach to process plan the given part. The proposed approach and optimization methodology analyses the TAD (tool approach direction), tolerance relation between features and feature precedence relations to generate all possible setups and operations using workshop resource database. Based on these technological constraints the GA algorithm approach, which adopts the feature-based representation, optimizes the setup plan and sequence of operations using cost indices. Case study show that the developed system can generate satisfactory results in optimizing the setup planning and operation sequencing simultaneously in feasible condition.

Validation of the LacTek test applied to spiked extracts of tissue samples: determination of performance characteristics.

PubMed

Mitchell, J M; Yee, A J; McNab, W B; Griffiths, M W; McEwen, S A

1999-01-01

LacTek tests are competitive enzyme-linked immunosorbent assays intended for rapid detection of antimicrobial residues in bovine milk. In this study, the LacTek test protocol was modified for use with extracts of bovine tissue to detect beta-lactam, tetracycline, and sulfamethazine residues. Test performance characteristics--precision, accuracy, ruggedness, practicability, and analytical specificity and sensitivity--were investigated. Results suggest that LacTek tests can be easily adapted to detect antimicrobial residues in extracts of lean ground beef. However, positive samples may not contain residues at violative concentrations (i.e., Canadian maximum residue limits), and therefore, additional analysis would be required for final confirmation and quantitation (e.g., chromatography).

Operating characteristics of the implicit learning system supporting serial interception sequence learning.

PubMed

Sanchez, Daniel J; Reber, Paul J

2012-04-01

The memory system that supports implicit perceptual-motor sequence learning relies on brain regions that operate separately from the explicit, medial temporal lobe memory system. The implicit learning system therefore likely has distinct operating characteristics and information processing constraints. To attempt to identify the limits of the implicit sequence learning mechanism, participants performed the serial interception sequence learning (SISL) task with covertly embedded repeating sequences that were much longer than most previous studies: ranging from 30 to 60 (Experiment 1) and 60 to 90 (Experiment 2) items in length. Robust sequence-specific learning was observed for sequences up to 80 items in length, extending the known capacity of implicit sequence learning. In Experiment 3, 12-item repeating sequences were embedded among increasing amounts of irrelevant nonrepeating sequences (from 20 to 80% of training trials). Despite high levels of irrelevant trials, learning occurred across conditions. A comparison of learning rates across all three experiments found a surprising degree of constancy in the rate of learning regardless of sequence length or embedded noise. Sequence learning appears to be constant with the logarithm of the number of sequence repetitions practiced during training. The consistency in learning rate across experiments and conditions implies that the mechanisms supporting implicit sequence learning are not capacity-constrained by very long sequences nor adversely affected by high rates of irrelevant sequences during training.

Bistability of the lac operon during growth of Escherichia coli on lactose and lactose+glucose.

PubMed

Narang, Atul; Pilyugin, Sergei S

2008-05-01

The lac operon of Escherichia coli can exhibit bistability. Early studies showed that bistability occurs during growth on TMG/succinate and lactose+glucose, but not during growth on lactose. More recently, studies with lacGFP-transfected cells show bistability during growth on TMG/succinate, but not during growth on lactose and lactose+glucose. In the literature, these results are invariably attributed to variations in the destabilizing effect of the positive feedback generated by induction. Specifically, during growth on TMG/succinate, lac induction generates strong positive feedback because the permease stimulates the accumulation of intracellular TMG, which in turn, promotes the synthesis of even more permease. This positive feedback is attenuated during growth on lactose because hydrolysis of intracellular lactose by beta-galactosidase suppresses the stimulatory effect of the permease. It is attenuated even more during growth on lactose + glucose because glucose inhibits the uptake of lactose. But it is clear that the stabilizing effect of dilution also changes dramatically as a function of the medium composition. For instance, during growth on TMG/succinate, the dilution rate of lac permease is proportional to its activity, e, because the specific growth rate is independent of e (it is completely determined by the concentration of succinate). However, during growth on lactose, the dilution rate of the permease is proportional to e2 because the specific growth rate is proportional to the specific lactose uptake rate, which in turn, proportional to e. We show that: (a) This dependence on e2 creates such a strong stabilizing effect that bistability is virtually impossible during growth on lactose, even in the face of the intense positive feedback generated by induction. (b) This stabilizing effect is weakened during growth on lactose+glucose because the specific growth rate on glucose is independent of e, so that the dilution rate once again contains a term that

Volatile compounds of Celta dry-cured 'lacón' as affected by cross-breeding with Duroc and Landrace genotypes.

PubMed

Lorenzo, José M; Fonseca, Sonia

2014-11-01

Dry-cured 'lacón' is a traditional cured meat product made in the north-west of Spain from the pigs' foreleg, with similar manufacturing process to that used in dry-cured ham. The aim of this study was to assess the influence of cross-breeding of Celta pig with Landrace or Duroc breeds on the formation of volatile compounds through the manufacture of 'lacón'. 'Lacón' from the crosses with Duroc presented lower final moisture (534 g kg(-1) ) and higher intra-muscular fat content [144 g kg(-1) dry matter (DM)] than 'lacón' from Celta pure breed (587 g kg(-1) and 36 g kg(-1) DM, respectively). Volatile compounds were extracted by solid-phase microextraction and analysed by gas chromatography-mass spectrometry. Volatile compounds from 'lacón' were affected by cross-breeding. The total amount of volatile compounds significantly (P < 0.001) increased during the manufacturing process, this increase being more marked in samples from the Landrace cross-breed. The most abundant group of flavour compounds at the end of the manufacturing process was esters in the three batches, followed by aldehydes, hydrocarbons and alcohols. The most abundant ester at the end of the process was hexanoic acid methyl ester, while the aldehyde found in a higher amount was hexanal. The profile of volatile compounds was affected by cross-breed, especially at the end of the 'lacón' dry-curing process. © 2014 Society of Chemical Industry.

LUNSORT list of lunar orbiter data by LAC area

NASA Technical Reports Server (NTRS)

Hixon, S.

1976-01-01

Lunar orbiter (missions 1-5) photographic data are listed sequentially according to the number (1 to 147) LAC (Lunar Aeronautical Chart) areas by use of a computer program called LUNSORT. This listing, as well as a similar one from Apollo would simplify the task of identifying images of a given Lunar area. Instructions and sample case are included.

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

Influence of salt content and processing time on sensory characteristics of cooked "lacón".

PubMed

Purriños, Laura; Bermúdez, Roberto; Temperán, Sara; Franco, Daniel; Carballo, Javier; Lorenzo, José M

2011-04-01

The influence of salt content and processing time on the sensory properties of cooked "lacón" were determined. "Lacón" is a traditional dry-cured and ripened meat product made in the north-west of Spain from the fore leg of the pig, following a similar process to that of dry-cured ham. Six batches of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)) and ripened during two times (56 and 84 days of dry-ripening). Cured odour in all batches studied, red colour and rancid odour in MS and HS batches, flavour intensity in MS batch and fat yellowness, rancid flavour and hardness in the HS batch were significantly different with respect to the time of processing. Appearance, odour, flavour and texture were not significantly affected by the salt content (P>0.05). However, the saltiness score showed significant differences with respect to the salt levels in all studied batches (56 and 84 days of process). The principal component analysis showed that physicochemical traits were the most important ones concerning the quality of dry-cured "lacón" and offered a good separation of the mean samples according to the dry ripening days and salt level. © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.

Constraining the red shifts of TeV BL Lac objects

NASA Astrophysics Data System (ADS)

Qin, Longhua; Wang, Jiancheng; Yan, Dahai; Yang, Chuyuan; Yuan, Zunli; Zhou, Ming

2018-01-01

We present a model-dependent method to estimate the red shifts of three TeV BL Lac objects (BL Lacs) through fitting their (quasi-)simultaneous multi-waveband spectral energy distributions (SEDs) with a one-zone leptonic synchrotron self-Compton model. Considering the impact of electron energy distributions (EEDs) on the results, we use three types of EEDs to fit the SEDs: a power-law EED with exponential cut-off (PLC), a log-parabola (PLLP) EED and the broken power-law (BPL) EED. We also use a parameter α to describe the uncertainties of the extragalactic background light models, as in Abdo et al. We then use a Markov chain Monte Carlo method to explore the multi-dimensional parameter space and obtain the uncertainties of the model parameters based on the observational data. We apply our method to obtain the red shifts of three TeV BL Lac objects in the marginalized 68 per cent confidence, and find that the PLC EED does not fit the SEDs. For 3C66A, the red shift is 0.14-0.31 and 0.16-0.32 in the BPL and PLLP EEDs. For PKS1424+240, the red shift is 0.55-0.68 and 0.55-0.67 in the BPL and PLLP EEDs. For PG1553+113, the red shift is 0.22-0.48 and 0.22-0.39 in the BPL and PLLP EEDs. We also estimate the red shift of PKS1424+240 in the high stage to be 0.46-0.67 in the PLLP EED, roughly consistent with that in the low stage.

Geology and ground-water resources of Fond du Lac County, Wisconsin

USGS Publications Warehouse

Newport, Thomas G.

1962-01-01

The principal water-bearing rocks underlying Fond du Lac County, Wis., are sandstones of Cambrian and Ordovician age and dolomite of Silurian age. Other aquifers include dolomite of Ordovician age and sand. and gravel of Quaternary age. Crystalline rocks of Precambrian age, which underlie all the water-bearing formations, form a practically impermeable basement complex and yield little or no water to wells. Ground water is the source of all public and most private and industrial water supplies in the county. The municipalities and industries obtain water chiefly from wells that penetrate the sandstones of Cambrian and Ordorician age. The Platteville formation and Galena dolomite of Ordovician age and the Niagara dolomite of Silurian age supply water to most domestic and stock wells and to a few industrial wells. Several buried valleys in the bedrock surface contain water-bearing deposits of sand and gravel. The source of the ground water in Fond du Lac County is local precipitation. Recharge to the water-bearing beds occurs in most of the county but is greatest where the bedrock formations are near the surface. Ground water is discharged by seeps and springs, by evaporation and transpiration, and by wells. Ground-water levels in wells fluctuate in response to recharge and to natural discharge and pumping. In areas not affected by pumping, water levels generally decline through the summer months because of natural discharge and lack of recharge, recover slightly in the fall after the first killing frost, decline during the winter, and recover in the spring when recharge is greatest. In areas of heavy pumping, the water levels are lowest in late summer and highest in late winter. Water levels in wells in the Fond du Lac area were about 5 to 50 feet above the land surface in 1885, but they had declined to as low as 185 feet below the land surface by 1957. Coefficients of transmissibility and storage of the sandstones of Cambrian and Ordovician age were determined by

Stellar Populations in BL Lac type Objects

NASA Astrophysics Data System (ADS)

Serote Roos, Margarida

The relationship between an Active Galactic Nucleus (AGN) and its host galaxy is a crucial question in the study of galaxy evolution. We present an estimate of the stellar contribution in a sample of low luminosity BL Lac type objects. We have performed stellar population synthesis for a sample of 19 objects selected from Marchã et al. (1996, MNRAS 281, 425). The stellar content is quantified using the equivalent widths of all absorption features available throughout the spectrum. The synthesis is done by a variant of the GPG method (Pelat: 1997, MNRAS 284, 365).

Analysis and Remediation of the 2013 LAC-MÉGANTIC Train Derailment

NASA Astrophysics Data System (ADS)

Brunke, Suzanne; Aubé, Guy; Legaré, Serge; Auger, Claude

2016-06-01

On July 6, 2013 a train owned by Montréal, Maine & Atlantic Railway (MMA) Company derailed in Lac-Mégantic, Quebec, Canada triggering the explosion of the tankers carrying crude oil. Several buildings in the downtown core were destroyed. The Sûreté du Québec confirmed the death of 47 people in the disaster. Through the Canadian Space Agency (CSA) Rapid Information Products and Services (RIPS) program, MDA developed value-added products that allowed stakeholders and all levels of government (municipal, provincial and federal) to get an accurate picture of the disaster. The goal of this RIPS Project was to identify the contribution that remote sensing technology can provide to disasters such as the train derailment and explosion at Lac-Mégantic through response and remediation monitoring. Through monitoring and analysis, the Lac-Mégantic train derailment response and remediation demonstrated how Earth observation data can be used for situational awareness in a disaster and in documenting the remediation process. Both high resolution optical and RADARSAT-2 SAR image products were acquired and analyzed over the disaster remediation period as each had a role in monitoring. High resolution optical imagery provided a very clear picture of the current state of remediation efforts, however it can be difficult to acquire due to cloud cover and weather conditions. The RADARSAT-2 SAR images can be acquired in all weather conditions at any time of day making it ideal for mission critical information gathering. MDA's automated change detection processing enabled rapid delivery of advanced information products.

Photometric Redshifts of High-z BL Lacs from 3FGL Catalog

NASA Astrophysics Data System (ADS)

Kaur, A.; Rau, Arne; Ajello, Marco; Paliya, Vaidehi; Hartmann, Dieter; Greiner, Jochen; Bolmer, Jan; Schady, Patricia

2017-08-01

Determining redshifts for BL Lacertae (BL Lac) objects using the traditional spectroscopic method is challenging due to the absence of strong emission lines in their optical spectra. We employ the photometric dropout technique to determine redshifts for this class of blazars using the combined 13 broad-band filters from Swift-UVOT and the multi-channel imager GROND at the MPG 2.2 m telescope at ESO's La Silla Observatory. The wavelength range covered by these 13 filters extends from far ultraviolet to the near-Infrared. We report results on 40 new Fermi detected BL Lacs with the photometric redshifts determinations for 5 sources, with 3FGL J1918.2-4110 being the most distance in our sample at z=2.16. Reliable upper limits are provided for 20 sources in this sample. Using the highest energy photons for these Fermi-LAT sources, we evaluate the consistency with the Gamma-ray horizon due to the extragalactic background light.

Evidence for the pulsational origin of the Long Secondary Periods: The red supergiant star V424 Lac (HD 216946)

NASA Astrophysics Data System (ADS)

Messina, Sergio

2007-10-01

The results of a long-term UBV photometric monitoring of the red supergiant (RSG) star V424 Lac are presented. V424 Lac shows multiperiodic brightness variations which can be attributed to pulsational oscillations. A much longer period ( P = 1601 d), that allows us to classify this star as a long secondary period variable star (LSPV) has been also detected. The B - V and U - B color variations related to the long secondary period (LSP) are similar to those related to the shorter periods, supporting the pulsational nature of LSP. The long period brightness variation of V424 Lac is accompanied by a near-UV (NUV) excess, which was spectroscopically detected in a previous study [Massey, P., Plez, B., Levesque, E.M., et al., 2005. ApJ 634, 1286] and which is now found to be variable from photometry. On the basis of the results found for V424 Lac, the NUV excess recently found in a number of RSGs may be due not solely to circumstellar dust but may also have a contribution from a still undetected LSP variability.

Deposition Mechanism and Microstructure of Laser-Assisted Cold-Sprayed (LACS) Al-12 wt.%Si Coatings: Effects of Laser Power

NASA Astrophysics Data System (ADS)

Olakanmi, E. O.; Tlotleng, M.; Meacock, C.; Pityana, S.; Doyoyo, M.

2013-06-01

Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries, and renewable energy systems. This article highlights some of those potential applications. In the LACS process, a laser beam irradiates the substrate and the particles, thereby softening both of them. Consequently, the particles deform upon impact at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS deposition mechanism and microstructural properties is presented. The deposition efficiency, the microstructure, and the microhardness of the LACS-deposited coatings produced by a 4.4-kW Nd:YAG laser system were evaluated. The outcome of this study shows that pore- and crack-free Al-12 wt.%Si coatings were deposited via softening by laser irradiation and adiabatic shearing phenomena at an optimum laser power of 2.5 kW.

A KPC-scale X-ray jet in the BL LAC Source S5 2007+777

NASA Technical Reports Server (NTRS)

Sambruna, Rita; Maraschi, Laura; Tavecchio, Fabrizio

2008-01-01

The BL Lac S3 2007++777, a classical radio-selected BL Lac from the sample of Stirkel et al. exhibiting an extended (19") radio jet. was observed with Chandra revealing an X-ray jet with simi1ar morphology. The hard X-ray spectrum and broad band SED is consistent with an IC/CMB origin for the X-ray emission, implying a highly relativistic flow at small angle to the line of sight with an unusually large deprojected length, 300 kpc. A structured jet consisting of a fast spine and slow wall is consistent with the observations.

Quantitative approaches to the study of bistability in the lac operon of Escherichia coli.

PubMed

Santillán, Moisés; Mackey, Michael C

2008-08-06

In this paper, the history and importance of the lac operon in the development of molecular and systems biology are briefly reviewed. We start by presenting a description of the regulatory mechanisms in this operon, taking into account the most recent discoveries. Then we offer a survey of the history of the lac operon, including the discovery of its main elements and the subsequent influence on the development of molecular and systems biology. Next the bistable behaviour of the operon is discussed, both with respect to its discovery and its molecular origin. A review of the literature in which this bistable phenomenon has been studied from a mathematical modelling viewpoint is then given. We conclude with some brief remarks.

A source of artifact in the lacZ reversion assay in Escherichia coli.

PubMed

Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I

2015-06-01

The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its

Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)

Extended Full Computation-Tree Logic with Sequence Modal Operator: Representing Hierarchical Tree Structures

NASA Astrophysics Data System (ADS)

Kamide, Norihiro; Kaneiwa, Ken

An extended full computation-tree logic, CTLS*, is introduced as a Kripke semantics with a sequence modal operator. This logic can appropriately represent hierarchical tree structures where sequence modal operators in CTLS* are applied to tree structures. An embedding theorem of CTLS* into CTL* is proved. The validity, satisfiability and model-checking problems of CTLS* are shown to be decidable. An illustrative example of biological taxonomy is presented using CTLS* formulas.

Lac Télé structure, Republic of Congo: Geological setting of a cryptozoological and biodiversity hotspot, and evidence against an impact origin

NASA Astrophysics Data System (ADS)

Master, Sharad

2010-11-01

Lac Télé is a large lake, ˜5.6 km in diameter, with an ovoid shape, situated at 17°10'E, 1°20'N, in the great tropical rain forest region of the Republic of Congo. This lake has attracted widespread attention, mainly because of the legends among the local people that it harbours a strange animal known as the Mokele-Mbembe, but also because it is situated in a region that is a hotbed of biodiversity and conservation efforts with respect to various endangered mammalian species, including gorillas and chimpanzees. Because of its appearance, Lac Télé has been regarded as a possible meteorite impact structure. Various expeditions, studying cryptozoology, conservation ecology, biodiversity, and the impact hypothesis, have visited Lac Télé in the past several decades. The Lac Télé structure is located in the NW part of the intracratonic Congo Basin, in a region dominated by Holocene alluvium, dense tropical rain forest, and swamps which form part of the basin of the Likouala aux Herbes, a multi-branched meandering river flowing over very low gradients into the Sangha river, a major tributary of the Congo river. Previous bathymetric studies have shown that the average depth of Lac Télé is only 4 m, including organic-rich silty sediments. The structure is that of a flat-bottomed dish. Modelling of the Lac Télé as an impact structure indicates a number of features which ought to be present. The absence of any of these features, coupled with the irregular ovoid shape, the palynological record, and the location of the structure at the intersection of major regional lineaments, is regarded as evidence against the impact hypothesis. Lac Télé as an isolated lake ecosystem is not unique in the Congo Basin, and there are several other similar small shallow isolated lakes surrounded by rain forest and marshes, some of which formed by damming of drainage systems by neotectonic faults. It is suggested that the formation of Lac Télé may be related to its location

p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

NASA Technical Reports Server (NTRS)

Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

2001-01-01

Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

Repressor-mediated tissue-specific gene expression in plants

DOEpatents

Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

2009-02-17

Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement

PubMed Central

Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.

2013-01-01

A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700

Fermi LAT detection of a GeV flare from the BL Lac object PKS 2233-148

NASA Astrophysics Data System (ADS)

Ciprini, Stefano

2012-06-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2233-148 (also known as 2FGL J2236.5-1431, Nolan et al. 2012, ApJS, 199, 31, and OY -156) placed at R.A.: 339.1420296 deg, Dec.: -14.5561633 (J2000, Petrov et al. 2008, AJ, 136, 580). No redshift for the source has been measured up to now, demonstrating the BL Lac object character type of this source.

Spectroscopic monitoring of the BL Lac object AO 0235+164

NASA Astrophysics Data System (ADS)

Raiteri, C. M.; Villata, M.; Capetti, A.; Heidt, J.; Arnaboldi, M.; Magazzù, A.

2007-03-01

Aims:Spectroscopic monitoring of BL Lac objects is a difficult task that nonetheless can provide important information on the different components of the active galactic nucleus. Methods: We performed optical spectroscopic monitoring of the BL Lac object AO 0235+164 (z=0.94) with the VLT and TNG telescopes from Aug. 2003 to Dec. 2004, during an extended WEBT campaign. The flux of this source is both contaminated and absorbed by a foreground galactic system at z=0.524, the stars of which can act as gravitational micro-lenses. Results: In this period the object was in an optically faint, though variable state, and a broad Mg II emission line was visible at all epochs. The spectroscopic analysis reveals an overall variation in the Mg II line flux of a factor 1.9, while the corresponding continuum flux density changed by a factor 4.3. Most likely, the photoionising radiation can be identified with the emission component that was earlier recognised to be present as a UV-soft-X-ray bump in the source spectral energy distribution and that is visible in the optical domain only in very faint optical states. We estimate an upper limit to the broad line region (BLR) size of a few light months from the historical minimum brightness level; from this we infer the maximum amplification of the Mg II line predicted by the microlensing scenario. Conclusions: .Unless we have strongly overestimated the size of the BLR, only very massive stars could significantly magnify the broad Mg II emission line, but the time scale of variations due to these (rare) events would be of several years. In contrast, the continuum flux, coming from much smaller emission regions in the jet, could be affected by microlensing from the more plausible MACHO deflectors, with variability time scales of the order of some months. Based on observations collected at the European Southern Observatory, Chile (ESO Programme 71.A-0174), and on observations made with the Italian Telescopio Nazionale Galileo (TNG

DNA sequence and characterization of GcvA, a LysR family regulatory protein for the Escherichia coli glycine cleavage enzyme system.

PubMed Central

Wilson, R L; Stauffer, G V

1994-01-01

The gene encoding GcvA, the trans-acting regulatory protein for the Escherichia coli glycine cleavage enzyme system, has been sequenced. The gcvA locus contains an open reading frame of 930 nucleotides that could encode a protein with a molecular mass of 34.4 kDa, consistent with the results of minicell analysis indicating that GcvA is a polypeptide of approximately 33 kDa. The deduced amino acid sequence of GcvA revealed that this protein shares similarity with the LysR family of activator proteins. The transcription start site was found to be 72 bp upstream of the presumed translation start site. A chromosomal deletion of gcvA resulted in the inability of cells to activate the expression of a gcvT-lacZ gene fusion when grown in the presence of glycine and an inability to repress gcvT-lacZ expression when grown in the presence of inosine. The regulation of gcvA was examined by constructing a gcvA-lacZ gene fusion in which beta-galactosidase synthesis is under the control of the gcvA regulatory region. Although gcvA expression appears to be autogenously regulated over a two- to threefold range, it is neither induced by glycine nor repressed by inosine. Images PMID:8188587

Characteristics of the LacTek test as applied to tissue samples: assessment of performance using incurred field samples.

PubMed

Mitchell, J M; McNab, W B; Yee, A J; Griffiths, M W; McEwen, S A; Spilsbury, L; Boison, J O

1998-08-01

The Lactek test, marketed for antimicrobial residue detection in milk, was validated for the detection of antimicrobial residues in tissues. A previous study found that the LacTek test could confidently identify tissue samples spiked with antimicrobial residues. However, the test could not reliably distinguish violative from nonviolative spiked samples relative to Canadian maximum residue limits (MRLs). The objectives of this study were to assess and compare the performance of the LacTek tests for beta-lactams, tetracyclines, gentamicin, and sulfamethazine on samples containing naturally incurred residues by running the test in parallel with the standard microbial inhibition test (MIT) presently used for the routine testing of tissues at our facility and to assess the agreement with high pressure liquid chromatographic (HPLC) determinative methods. Parallel testing with the official MIT found that the Lactek tests could be confidently used for testing tissue samples containing incurred residues. Among 1,008 MIT-positive samples, the LacTek test found that 90% contained beta-lactams and/or tetracyclines. A further 7.3% of violative residues could not be identified to an antimicrobial class. In addition, 9% of samples testing negative on the MIT were found to contain an antimicrobial residue by the LacTek tests. Comparative testing with HPLC methods found that there was very good agreement between the two tests and that most violations were due to penicillin G and oxytetracycline. Although the LacTek test cannot be used to distinguish violative from nonviolative residue levels, it does offer several advantages over the present MIT. These include speed, ease of use, the ability to identify residues to a specific class, and an improved sensitivity at the MRL level for the most commonly found antimicrobials in tissue.

Formation of DNA adducts and induction of lacI mutations in Big Blue Rat-2 cells treated with temozolomide: implications for the treatment of low-grade adult and pediatric brain tumors.

PubMed

Bodell, William J; Gaikwad, Nilesh W; Miller, Douglas; Berger, Mitchel S

2003-06-01

Temozolomide (TMZ) is a chemotherapeutic agent used in the treatment of high-grade brain tumors. Treatment of patients with alkylating chemotherapeutic agents has been established to increase their risk for acute myelogenous leukemia. The formation of DNA adducts and induction of mutations are likely to play a role in the etiology of therapy-related acute myeloid leukemia. To evaluate this issue for TMZ, we have measured the formation of DNA adducts and induction of lacI mutations in Big Blue Rat-2 cells treated with TMZ. Treatment of Big Blue Rat-2 cells with either 0, 0.5, or 1 mM TMZ resulted in lacI mutant frequencies of 9.1 +/- 2.9 x 10(-5), 48.9 +/- 12 x 10(-5), and 89.7 +/- 40.3 x 10(-5), respectively. Comparison of the mutant frequencies demonstrated that 0.5 and 1 mM TMZ treatments increased the mutant frequencies by 5.3- and 9.8-fold and that this increase was significant (P < 0.001). Sequence analysis of the lacI mutants from the TMZ treatment group demonstrated that they were GC-->AT transitions at non-CpG sites, which is significantly different from the mutation spectrum observed in the control treatment group. Treatment of Big Blue Rat-2 cells with various concentrations of TMZ produced a linear increase in the levels of N7-methylguanine and O(6)-methylguanine. The lacI mutation spectrum induced by TMZ treatment is consistent with these mutations being produced by O(6)-MeG. This study establishes TMZ has significant mutagenic potential and suggests that careful consideration in the use of TMZ for the treatment of low-grade adult and pediatric brain tumors should be given.

Detoxification of diphenyl ether herbicide lactofen by Bacillus sp. Za and enantioselective characteristics of an esterase gene lacE.

PubMed

Zhang, Jing; Lu, Luyao; Chen, Feng; Chen, Lingling; Yin, Jingang; Huang, Xing

2018-01-05

A bacterial strain Za capable of degrading diphenyl ether herbicide lactofen was isolated and identified as Bacillus sp. This strain could degrade 94.8% of 50mgL -1 lactofen after 4days of inoculation in flasks. It was revealed that lactofen was initially hydrolyzed to desethyl lactofen, which was further transformed to acifluorfen, followed by the reduction of the nitro group to yield aminoacifluorfen. The phytotoxicity of the transformed product aminoacifluorfen to maize was decreased significantly compared with the lactofen. A gene lacE, encoding an esterase responsible for lactofen hydrolysis to desethyl lactofen and acifluorfen continuously, was cloned from Bacillus sp. Za. The deduced amino acid belonging to the esterase family VII contained a typical Ser-His-Asp/Glu catalytic triad and the conserved motifs GXSXG. The purified recombinant protein LacE displayed maximal esterase activity at 40°C and pH 7.0. Additionally, LacE had broad substrate specificity and was capable of hydrolyzing p-nitrophenyl esters. The enantioselectivity of LacE during lactofen degradation was further studied, and the results indicated that the (S)-(+)-lactofen was degraded faster than the (R)-(-)-lactofen, which could illustrate the reported phenomenon that (S)-(+)-lactofen was preferentially degraded in soil and sediment. Copyright © 2017 Elsevier B.V. All rights reserved.

Helicobacter pylori β1,3-N-acetylglucosaminyltransferase for versatile synthesis of type 1 and type 2 poly-LacNAcs on N-linked, O-linked and I-antigen glycans

PubMed Central

Peng, Wenjie; Pranskevich, Jennifer; Nycholat, Corwin; Gilbert, Michel; Wakarchuk, Warren; Paulson, James C; Razi, Nahid

2012-01-01

Poly-N-acetyllactosamine extensions on N- and O-linked glycans are increasingly recognized as biologically important structural features, but access to these structures has not been widely available. Here, we report a detailed substrate specificity and catalytic efficiency of the bacterial β3-N-acetylglucosaminyltransferase (β3GlcNAcT) from Helicobacter pylori that can be adapted to the synthesis of a rich diversity of glycans with poly-LacNAc extensions. This glycosyltransferase has surprisingly broad acceptor specificity toward type-1, -2, -3 and -4 galactoside motifs on both linear and branched glycans, found commonly on N-linked, O-linked and I-antigen glycans. This finding enables the production of complex ligands for glycan-binding studies. Although the enzyme shows preferential activity for type 2 (Galβ1-4GlcNAc) acceptors, it is capable of transferring N-acetylglucosamine (GlcNAc) in β1-3 linkage to type-1 (Galβ1-3GlcNAc) or type-3/4 (Galβ1-3GalNAcα/β) sequences. Thus, by alternating the use of the H. pylori β3GlcNAcT with galactosyltransferases that make the β1-4 or β1-3 linkages, various N-linked, O-linked and I-antigen acceptors could be elongated with type-2 and type-1 LacNAc repeats. Finally, one-pot incubation of di-LacNAc biantennary N-glycopeptide with the β3GlcNAcT and GalT-1 in the presence of uridine diphosphate (UDP)-GlcNAc and UDP-Gal, yielded products with 15 additional LacNAc units on the precursor, which was seen as a series of sequential ion peaks representing alternative additions of GlcNAc and Gal residues, on matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis. Overall, our data demonstrate a broader substrate specificity for the H. pylori β3GlcNAcT than previously recognized and demonstrate its ability as a potent resource for preparative chemo-enzymatic synthesis of complex glycans. PMID:22786570

Operating Characteristics of the Implicit Learning System Supporting Serial Interception Sequence Learning

ERIC Educational Resources Information Center

Sanchez, Daniel J.; Reber, Paul J.

2012-01-01

The memory system that supports implicit perceptual-motor sequence learning relies on brain regions that operate separately from the explicit, medial temporal lobe memory system. The implicit learning system therefore likely has distinct operating characteristics and information processing constraints. To attempt to identify the limits of the…

Purified reconstituted lac carrier protein from Escherichia coli is fully functional.

PubMed

Viitanen, P; Garcia, M L; Kaback, H R

1984-03-01

Proteoliposomes reconstituted with lac carrier protein purified from the plasma membrane of Escherichia coli catalyze each of the translocation reactions typical of the beta-galactoside transport system (i.e., active transport, counterflow, facilitated influx and efflux) with turnover numbers and apparent Km values comparable to those observed in right-side-out membrane vesicles. Furthermore, detailed kinetic studies show that the reconstituted system exhibits properties analogous to those observed in membrane vesicles. Imposition of a membrane potential (delta psi, interior negative) causes a marked decrease in apparent Km (by a factor of 7 to 10) with a smaller increase in Vmax (approximately equal to 3-fold). At submaximal values of delta psi, the reconstituted carrier exhibits biphasic kinetics, with one component manifesting the kinetic parameters of active transport and the other exhibiting the characteristics of facilitated diffusion. Finally, at low lactose concentrations, the initial velocity of influx varies linearly with the square of the proton electro-chemical gradient. The results provide quantitative support for the contention that a single polypeptide species, the product of the lac y gene, is responsible for each of the transport reactions typical of the beta-galactoside transport system.

A novel chaotic image encryption scheme using DNA sequence operations

NASA Astrophysics Data System (ADS)

Wang, Xing-Yuan; Zhang, Ying-Qian; Bao, Xue-Mei

2015-10-01

In this paper, we propose a novel image encryption scheme based on DNA (Deoxyribonucleic acid) sequence operations and chaotic system. Firstly, we perform bitwise exclusive OR operation on the pixels of the plain image using the pseudorandom sequences produced by the spatiotemporal chaos system, i.e., CML (coupled map lattice). Secondly, a DNA matrix is obtained by encoding the confused image using a kind of DNA encoding rule. Then we generate the new initial conditions of the CML according to this DNA matrix and the previous initial conditions, which can make the encryption result closely depend on every pixel of the plain image. Thirdly, the rows and columns of the DNA matrix are permuted. Then, the permuted DNA matrix is confused once again. At last, after decoding the confused DNA matrix using a kind of DNA decoding rule, we obtain the ciphered image. Experimental results and theoretical analysis show that the scheme is able to resist various attacks, so it has extraordinarily high security.

Autonomously Generating Operations Sequences for a Mars Rover Using Artificial Intelligence-Based Planning

NASA Astrophysics Data System (ADS)

Sherwood, R.; Mutz, D.; Estlin, T.; Chien, S.; Backes, P.; Norris, J.; Tran, D.; Cooper, B.; Rabideau, G.; Mishkin, A.; Maxwell, S.

2001-07-01

This article discusses a proof-of-concept prototype for ground-based automatic generation of validated rover command sequences from high-level science and engineering activities. This prototype is based on ASPEN, the Automated Scheduling and Planning Environment. This artificial intelligence (AI)-based planning and scheduling system will automatically generate a command sequence that will execute within resource constraints and satisfy flight rules. An automated planning and scheduling system encodes rover design knowledge and uses search and reasoning techniques to automatically generate low-level command sequences while respecting rover operability constraints, science and engineering preferences, environmental predictions, and also adhering to hard temporal constraints. This prototype planning system has been field-tested using the Rocky 7 rover at JPL and will be field-tested on more complex rovers to prove its effectiveness before transferring the technology to flight operations for an upcoming NASA mission. Enabling goal-driven commanding of planetary rovers greatly reduces the requirements for highly skilled rover engineering personnel. This in turn greatly reduces mission operations costs. In addition, goal-driven commanding permits a faster response to changes in rover state (e.g., faults) or science discoveries by removing the time-consuming manual sequence validation process, allowing rapid "what-if" analyses, and thus reducing overall cycle times.

Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.

PubMed

Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco

2013-04-01

Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

The environment of x ray selected BL Lacs: Host galaxies and galaxy clustering

NASA Technical Reports Server (NTRS)

Wurtz, Ron; Stocke, John T.; Ellingson, Erica; Yee, Howard K. C.

1993-01-01

Using the Canada-France-Hawaii Telescope, we have imaged a complete, flux-limited sample of Einstein Medium Sensitivity Survey BL Lacertae objects in order to study the properties of BL Lac host galaxies and to use quantitative methods to determine the richness of their galaxy cluster environments.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Analysis of simulated image sequences from sensors for restricted-visibility operations

NASA Technical Reports Server (NTRS)

Kasturi, Rangachar

1991-01-01

A real time model of the visible output from a 94 GHz sensor, based on a radiometric simulation of the sensor, was developed. A sequence of images as seen from an aircraft as it approaches for landing was simulated using this model. Thirty frames from this sequence of 200 x 200 pixel images were analyzed to identify and track objects in the image using the Cantata image processing package within the visual programming environment provided by the Khoros software system. The image analysis operations are described.

The infinitesimal operator for the semigroup of the Frobenius-Perron operator from image sequence data: vector fields and transport barriers from movies.

PubMed

Santitissadeekorn, N; Bollt, E M

2007-06-01

In this paper, we present an approach to approximate the Frobenius-Perron transfer operator from a sequence of time-ordered images, that is, a movie dataset. Unlike time-series data, successive images do not provide a direct access to a trajectory of a point in a phase space; more precisely, a pixel in an image plane. Therefore, we reconstruct the velocity field from image sequences based on the infinitesimal generator of the Frobenius-Perron operator. Moreover, we relate this problem to the well-known optical flow problem from the computer vision community and we validate the continuity equation derived from the infinitesimal operator as a constraint equation for the optical flow problem. Once the vector field and then a discrete transfer operator are found, then, in addition, we present a graph modularity method as a tool to discover basin structure in the phase space. Together with a tool to reconstruct a velocity field, this graph-based partition method provides us with a way to study transport behavior and other ergodic properties of measurable dynamical systems captured only through image sequences.

A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.

PubMed

Elliott, T

1992-01-01

This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.

Critical analysis of submerged membrane sequencing batch reactor operating conditions.

PubMed

McAdam, Ewan; Judd, Simon J; Gildemeister, René; Drews, Anja; Kraume, Matthias

2005-10-01

To evaluate the Submerged Membrane Sequencing Batch Reactor process, several short-term studies were conducted to define critical flux, membrane aeration and intermittent filtration operation. Critical flux trials indicated that as mixed liquor suspended solids increased in concentration so would the propensity for membrane fouling. Consequently in order to characterise the impact of biomass concentration increase (that develops during permeate withdrawal) upon submerged microfiltration operation, two longer term studies were conducted, one with a falling hydraulic head and another with a continuous hydraulic head (as in membrane bio-reactors). Trans membrane pressure data was used to predict the maximum possible operating periods at 10 and 62 days for the falling hydraulic head and continuous hydraulic head respectively. Further analysis revealed that falling hydraulic head operation would require 21% more aeration to maintain a consistent crossflow velocity than continuous operation and would rely on pumping for full permeate withdrawal 80% earlier. This study concluded that further optimisation would be required to make this technology technically and economically viable.

76 FR 78974 - Wisconsin Central Ltd.-Abandonment Exemption-in Fond Du Lac County, WI

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-20

... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 303 (Sub-No. 38X)] Wisconsin Central Ltd.--Abandonment Exemption--in Fond Du Lac County, WI Wisconsin Central Ltd. (WCL) \\1\\ filed a verified notice of exemption under 49 CFR pt. 1152 subpart F--Exempt Abandonments to abandon...

Comparison between S+L- assay and LacZ marker rescue assay for detecting replication-competent gammaretroviruses.

PubMed

Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T

2015-09-01

To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

An emerging population of BL Lacs with extreme properties: towards a class of EBL and cosmic magnetic field probes?

NASA Astrophysics Data System (ADS)

Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Sbarrato, T.

2015-07-01

High-energy observations of extreme BL Lac objects, such as 1ES 0229+200 or 1ES 0347-121, recently focused interest both for blazar and jet physics and for the implication on the extragalactic background light and intergalactic magnetic field estimate. However, the number of these extreme highly peaked BL Lac objects (EHBL) is still rather small. Aiming at increase their number, we selected a group of EHBL candidates starting from the BL Lac sample of Plotkin et al. (2011), considering those undetected (or only barely detected) by the Large Area Telescope onboard Fermi and characterized by a high X-ray versus radio flux ratio. We assembled the multiwavelength spectral energy distribution of the resulting nine sources, profiting of publicly available archival observations performed by Swift, GALEX, and Fermi satellites, confirming their nature. Through a simple one-zone synchrotron self-Compton model we estimate the expected very high energy flux, finding that in the majority of cases it is within the reach of present generation of Cherenkov arrays or of the forthcoming Cherenkov Telescope Array.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

NPDES Permit – East Lake Sewage Lagoon – Mille Lacs Indian Reservation (Aitkin County, MN)

EPA Pesticide Factsheets

EPA proposes to reissue a NPDES permit for the treated wastewater discharges from the East Lake Sewage Lagoon located within the boundaries of the Mille Lacs Indian Reservation located in East Lake (McGregor), Minnesota (Aitkin County) to be issued by EPA.

The LAC Test: A New Look at Auditory Conceptualization and Literacy Development K-12.

ERIC Educational Resources Information Center

Lindamood, Charles; And Others

The Lindamood Auditory Conceptualization (LAC) Test was constructed with the recognition that the process of decoding involves an integration of the auditory, visual, and motor senses. Requiring the manipulation of colored blocks to indicate conceptualization of test patterns spoken by the examiner, subtest 1 entails coding of identity, number,…

Study of the counts, species and characteristics of the yeast population during the manufacture of dry-cured "lacón". Effect of salt level.

PubMed

Purriños, Laura; García Fontán, María C; Carballo, Javier; Lorenzo, José M

2013-05-01

The aim of this work was to study the yeast population during the manufacture of dry-cured "lacón" (a Spanish traditional meat product) and the effect of the salting time. For this study, six batches of "lacón" were manufactured with three different salting times (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). Yeast counts increased significantly (P < 0.001) during the whole process from 2.60 to 6.37 log cfu/g. An increased length of salting time did not affect yeast counts throughout the manufacture of dry-cured "lacón", although the highest yeast counts were obtained from LS batches. A total of 226 isolates were obtained from dry-cured "lacón" during drying-ripening stage, of which 151 were yeasts and were identified at the species level using molecular techniques. The total of 151 identified yeasts belonged to 4 different genera: Debaryomyces, Candida, Cryptococcus and Rhodotorula. Debaryomyces hansenii was the most abundant species isolated throughout the whole process as much in the interior as in the exterior of the pieces of three salt levels of "lacón" studied, while Candida zeylanoides was only isolated from the interior of MS and HS batches and from the exterior of LS and HS groups, but at lesser proportion than D. hansenii. Copyright © 2012. Published by Elsevier Ltd.

VML 3.0 Reactive Sequencing Objects and Matrix Math Operations for Attitude Profiling

NASA Technical Reports Server (NTRS)

Grasso, Christopher A.; Riedel, Joseph E.

2012-01-01

VML (Virtual Machine Language) has been used as the sequencing flight software on over a dozen JPL deep-space missions, most recently flying on GRAIL and JUNO. In conjunction with the NASA SBIR entitled "Reactive Rendezvous and Docking Sequencer", VML version 3.0 has been enhanced to include object-oriented element organization, built-in queuing operations, and sophisticated matrix / vector operations. These improvements allow VML scripts to easily perform much of the work that formerly would have required a great deal of expensive flight software development to realize. Autonomous turning and tracking makes considerable use of new VML features. Profiles generated by flight software are managed using object-oriented VML data constructs executed in discrete time by the VML flight software. VML vector and matrix operations provide the ability to calculate and supply quaternions to the attitude controller flight software which produces torque requests. Using VML-based attitude planning components eliminates flight software development effort, and reduces corresponding costs. In addition, the direct management of the quaternions allows turning and tracking to be tied in with sophisticated high-level VML state machines. These state machines provide autonomous management of spacecraft operations during critical tasks like a hypothetic Mars sample return rendezvous and docking. State machines created for autonomous science observations can also use this sort of attitude planning system, allowing heightened autonomy levels to reduce operations costs. VML state machines cannot be considered merely sequences - they are reactive logic constructs capable of autonomous decision making within a well-defined domain. The state machine approach enabled by VML 3.0 is progressing toward flight capability with a wide array of applicable mission activities.

Temporal Variation of HCO+ 1_0 Galactic Absorption Lines Toward NRAO 150 and BL Lac

NASA Astrophysics Data System (ADS)

Han, Junghwan; Yun, Youngjoo; Park, Yong-Sun

2017-12-01

We present observations of HCO^+ 1-0 absorption lines toward two extragalactic compact radio sources, NRAO 150 and BL Lac with the Korean VLBI Network in order to investigate their time variation over 20 years by Galactic foreground clouds. It is found that the line shape of -17 km s^{-1} component changed marginally during 1993-1998 period and has remained unaltered thereafter for NRAO 150. Its behavior is different from that of H_2CO 1_{10}-1_{11}, suggesting chemical differentiation on ˜ 20 AU scale, the smallest ever seen. On the other hand, BL Lac exhibits little temporal variation for the HCO^+ and H_2CO lines. Our observation also suggests that Korea VLBI Network performs reliably in the spectrum mode in that the shapes of the new HCO^+ 1-0 spectra are in good agreement with the previous ones to an accuracy of a few percent except the time varying component toward NRAO 150.

Lac-L-TTA, a novel lactose-based amino acid-sugar conjugate for anti-metastatic applications.

PubMed

Roviello, Giovanni N; Iannitti, Roberta; Palumbo, Rosanna; Simonyan, Hayarpi; Vicidomini, Caterina; Roviello, Valentina

2017-08-01

Here we describe the synthesis, chromatographic purification, MS and NMR characterization of a new lactosyl-derivative, i.e. a lactosyl thiophenyl-substituted triazolyl-thione L-alanine (Lac-L-TTA). This amino acid-sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore, we investigated the inhibition of PC-3 prostate cancer cell colony formation by this lactose derivative in comparison with the less polar fructose-based derivative, Fru-L-TTA. This let us to compare the properties of the artificial derivative, object of the present work, with the monosaccharide-based counterpart and to obtain a preliminary information on the influence of polarity on such biological activity. A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose.

Olsenella umbonata sp. nov., a microaerotolerant anaerobic lactic acid bacterium from the sheep rumen and pig jejunum, and emended descriptions of Olsenella, Olsenella uli and Olsenella profusa.

PubMed

Kraatz, Mareike; Wallace, R John; Svensson, Liselott

2011-04-01

Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of 'Olsenella (basonym Atopobium) oviles'. Three phenotypically similar bacterial strains (lac15, lac16 and lac31(T)) were isolated in concert with Veillonella magna lac18(T) from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31(T) formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella-Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31(T) were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA-DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31(T) represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31(T) ( = CCUG 58604(T)  = DSM 22620(T)  = JCM 16156(T)) as the type strain and A2 ( = CCUG 58212 �

Automatic sequencing and control of Space Station airlock operations

NASA Technical Reports Server (NTRS)

Himel, Victor; Abeles, Fred J.; Auman, James; Tqi, Terry O.

1989-01-01

Procedures that have been developed as part of the NASA JSC-sponsored pre-prototype Checkout, Servicing and Maintenance (COSM) program for pre- and post-EVA airlock operations are described. This paper addresses the accompanying pressure changes in the airlock and in the Advanced Extravehicular Mobility Unit (EMU). Additionally, the paper focuses on the components that are checked out, and includes the step-by-step sequences to be followed by the crew, the required screen displays and prompts that accompany each step, and a description of the automated processes that occur.

77 FR 2774 - Notice of Intent To Prepare a Supplemental Environmental Impact Statement: Fond du Lac...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-19

... Fredrichs, Assistant Division Administrator, Federal Highway Administration, Madison, Wisconsin. [FR Doc... capacity improvements to Wisconsin Highway 23 from U.S. Highway 151 to County Highway P in Fond du Lac and Sheboygan Counties, Wisconsin. FOR FURTHER INFORMATION CONTACT: Bethaney Bacher-Gresock, Environmental...

DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

PubMed Central

Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

2014-01-01

As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252

Very high energy observations of the BL Lac objects 3C 66A and OJ 287

NASA Astrophysics Data System (ADS)

Lindner, T.; Hanna, D. S.; Kildea, J.; Ball, J.; Bramel, D. A.; Carson, J.; Covault, C. E.; Driscoll, D.; Fortin, P.; Gingrich, D. M.; Jarvis, A.; Mueller, C.; Mukherjee, R.; Ong, R. A.; Ragan, K.; Scalzo, R. A.; Williams, D. A.; Zweerink, J.

2007-11-01

Using the Solar Tower Atmospheric Cherenkov Effect Experiment (STACEE), we have observed the BL Lac objects 3C 66A and OJ 287. These are members of the class of low-frequency-peaked BL Lac objects (LBLs) and are two of the three LBLs predicted by Costamante and Ghisellini [L. Costamante, G. Ghisellini, Astron. Astrophys. 384 (2002) 56] to be potential sources of very high energy (>100 GeV) gamma-ray emission. The third candidate, BL Lacertae, has recently been detected by the MAGIC collaboration [J. Albert et al., arXiv:astro-ph/0703084v1 (2007)]. Our observations have not produced detections; we calculate a 99% CL upper limit of flux from 3C 66A of 0.15 Crab flux units and from OJ 287 our limit is 0.52 Crab. These limits assume a Crab-like energy spectrum with an effective energy threshold of 185 GeV.

Gains in efficiency and scientific potential of continental climate reconstruction provided by the LRC LacCore Facility, University of Minnesota

NASA Astrophysics Data System (ADS)

Noren, A.; Brady, K.; Myrbo, A.; Ito, E.

2007-12-01

Lacustrine sediment cores comprise an integral archive for the determination of continental paleoclimate, for their potentially high temporal resolution and for their ability to resolve spatial variability in climate across vast sections of the globe. Researchers studying these archives now have a large, nationally-funded, public facility dedicated to the support of their efforts. The LRC LacCore Facility, funded by NSF and the University of Minnesota, provides free or low-cost assistance to any portion of research projects, depending on the specific needs of the project. A large collection of field equipment (site survey equipment, coring devices, boats/platforms, water sampling devices) for nearly any lacustrine setting is available for rental, and Livingstone-type corers and drive rods may be purchased. LacCore staff can accompany field expeditions to operate these devices and curate samples, or provide training prior to device rental. The Facility maintains strong connections to experienced shipping agents and customs brokers, which vastly improves transport and importation of samples. In the lab, high-end instrumentation (e.g., multisensor loggers, high-resolution digital linescan cameras) provides a baseline of fundamental analyses before any sample material is consumed. LacCore staff provide support and training in lithological description, including smear-slide, XRD, and SEM analyses. The LRC botanical macrofossil reference collection is a valuable resource for both core description and detailed macrofossil analysis. Dedicated equipment and space for various subsample analyses streamlines these endeavors; subsamples for several analyses may be submitted for preparation or analysis by Facility technicians for a fee (e.g., carbon and sulfur coulometry, grain size, pollen sample preparation and analysis, charcoal, biogenic silica, LOI, freeze drying). The National Lacustrine Core Repository now curates ~9km of sediment cores from expeditions around the world

The NuSTAR view on Hard-TeV BL Lacs

NASA Astrophysics Data System (ADS)

Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.

2018-05-01

Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of 5 objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of i) extreme electron energies with very low radiative efficiency, ii) conditions heavily out of equipartition (by 3 to 5 orders of magnitude), and iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not "see" the UV or lower-energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the VHE spectrum.

The NuSTAR view on hard-TeV BL Lacs

NASA Astrophysics Data System (ADS)

Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.

2018-07-01

Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of five objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of (i) extreme electron energies with very low radiative efficiency, (ii) conditions heavily out of equipartition (by three to five orders of magnitude), and (iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not `see' the UV or lower energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the very high energies spectrum.

An MSC2 Promoter-lacZ Fusion Gene Reveals Zinc-Responsive Changes in Sites of Transcription Initiation That Occur across the Yeast Genome

PubMed Central

Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.

2016-01-01

The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924

Tamoxifen mutagenesis and carcinogenesis in livers of lambda/lacI transgenic rats: selective influence of phenobarbital promotion.

PubMed

Styles, J A; Davies, R; Fenwick, S; Walker, J; White, I N; Smith, L L

2001-01-10

Administration of tamoxifen (TAM) (20 mg/kg per day p.o.) for 6 weeks to female lambda/lacI transgenic rats caused a 4-fold increase in mutation frequency (MF) at the lacI gene locus in the livers of dosed animals compared with controls. After cessation of dosing, the MF showed a further increase with time at 2, 12 and 24 weeks, respectively. Phenobarbital promotion of similarly treated animals resulted in no increase in mutation frequency compared with TAM alone. Treatment with phenobarbital or TAM+phenobarbital resulted in time-dependent increases in liver weight compared with the corresponding controls. There was an increase in cell proliferation in the phenobarbital and TAM+phenobarbital groups, and at 24 weeks in the TAM dosed animals compared with controls. There was also a progressive increase in the number of GST-P expressing foci in the livers of TAM and TAM + phenobarbital rats compared with controls. The induction of cell proliferation and GSTP foci in the rat liver by phenobarbital is consistent with its ability to promote tamoxifen-initiated liver tumours in the rat. If the lacI gene is regarded as being representative of the rat genome in general (albeit that the gene is bacterial) the above observations suggest that promotion by tamoxifen confers selective advantage on mutated genes at loci that contribute to the tumour phenotype and that promotion of rat liver tumours by tamoxifen is not dependent simply upon the enhancement of cellular proliferation.

Genome-Wide Identification and Characterization of Novel Laccase Genes in the White-Rot Fungus Flammulina velutipes

PubMed Central

Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo

2014-01-01

The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003

A diverse range of bacterial and eukaryotic chitinases hydrolyzes the LacNAc (Galβ1-4GlcNAc) and LacdiNAc (GalNAcβ1-4GlcNAc) motifs found on vertebrate and insect cells.

PubMed

Frederiksen, Rikki F; Yoshimura, Yayoi; Storgaard, Birgit G; Paspaliari, Dafni K; Petersen, Bent O; Chen, Kowa; Larsen, Tanja; Duus, Jens Ø; Ingmer, Hanne; Bovin, Nicolai V; Westerlind, Ulrika; Blixt, Ola; Palcic, Monica M; Leisner, Jørgen J

2015-02-27

There is emerging evidence that chitinases have additional functions beyond degrading environmental chitin, such as involvement in innate and acquired immune responses, tissue remodeling, fibrosis, and serving as virulence factors of bacterial pathogens. We have recently shown that both the human chitotriosidase and a chitinase from Salmonella enterica serovar Typhimurium hydrolyze LacNAc from Galβ1-4GlcNAcβ-tetramethylrhodamine (LacNAc-TMR (Galβ1-4GlcNAcβ(CH2)8CONH(CH2)2NHCO-TMR)), a fluorescently labeled model substrate for glycans found in mammals. In this study we have examined the binding affinities of the Salmonella chitinase by carbohydrate microarray screening and found that it binds to a range of compounds, including five that contain LacNAc structures. We have further examined the hydrolytic specificity of this enzyme and chitinases from Sodalis glossinidius and Polysphondylium pallidum, which are phylogenetically related to the Salmonella chitinase, as well as unrelated chitinases from Listeria monocytogenes using the fluorescently labeled substrate analogs LacdiNAc-TMR (GalNAcβ1-4GlcNAcβ-TMR), LacNAc-TMR, and LacNAcβ1-6LacNAcβ-TMR. We found that all chitinases examined hydrolyzed LacdiNAc from the TMR aglycone to various degrees, whereas they were less active toward LacNAc-TMR conjugates. LacdiNAc is found in the mammalian glycome and is a common motif in invertebrate glycans. This substrate specificity was evident for chitinases of different phylogenetic origins. Three of the chitinases also hydrolyzed the β1-6 bond in LacNAcβ1-6LacNAcβ-TMR, an activity that is of potential importance in relation to mammalian glycans. The enzymatic affinities for these mammalian-like structures suggest additional functional roles of chitinases beyond chitin hydrolysis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Heterogeneous Suppression of Sequential Effects in Random Sequence Generation, but Not in Operant Learning.

PubMed

Shteingart, Hanan; Loewenstein, Yonatan

2016-01-01

There is a long history of experiments in which participants are instructed to generate a long sequence of binary random numbers. The scope of this line of research has shifted over the years from identifying the basic psychological principles and/or the heuristics that lead to deviations from randomness, to one of predicting future choices. In this paper, we used generalized linear regression and the framework of Reinforcement Learning in order to address both points. In particular, we used logistic regression analysis in order to characterize the temporal sequence of participants' choices. Surprisingly, a population analysis indicated that the contribution of the most recent trial has only a weak effect on behavior, compared to more preceding trials, a result that seems irreconcilable with standard sequential effects that decay monotonously with the delay. However, when considering each participant separately, we found that the magnitudes of the sequential effect are a monotonous decreasing function of the delay, yet these individual sequential effects are largely averaged out in a population analysis because of heterogeneity. The substantial behavioral heterogeneity in this task is further demonstrated quantitatively by considering the predictive power of the model. We show that a heterogeneous model of sequential dependencies captures the structure available in random sequence generation. Finally, we show that the results of the logistic regression analysis can be interpreted in the framework of reinforcement learning, allowing us to compare the sequential effects in the random sequence generation task to those in an operant learning task. We show that in contrast to the random sequence generation task, sequential effects in operant learning are far more homogenous across the population. These results suggest that in the random sequence generation task, different participants adopt different cognitive strategies to suppress sequential dependencies when

Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface.

PubMed

Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J

2011-08-09

The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society

Formation of Archean batholith-hosted gold veins at the Lac Herbin deposit, Val-d'Or district, Canada: Mineralogical and fluid inclusion constraints

NASA Astrophysics Data System (ADS)

Rezeau, Hervé; Moritz, Robert; Beaudoin, Georges

2017-03-01

The Lac Herbin deposit consists of a network of mineralized, parallel steep-reverse faults within the synvolcanic Bourlamaque granodiorite batholith at Val-d'Or in the Archean Abitibi greenstone belt. There are two related quartz-tourmaline-carbonate fault-fill vein sets in the faults, which consist of subvertical fault-fill veins associated with subhorizontal veins. The paragenetic sequence is characterized by a main vein filling ore stage including quartz, tourmaline, carbonate, and pyrite-hosted gold, chalcopyrite, tellurides, pyrrhotite, and cubanite inclusions. Most of the gold is located in fractures in deformed pyrite and quartz in equilibrium with chalcopyrite and carbonates, with local pyrrhotite, sphalerite, galena, cobaltite, pyrite, or tellurides. Petrography and microthermometry on quartz from the main vein filling ore stage reveal the presence of three unrelated fluid inclusion types: (1) gold-bearing aqueous-carbonic inclusions arranged in three-dimensional intragranular clusters in quartz crystals responsible for the main vein filling stage, (2) barren high-temperature, aqueous, moderately saline inclusions observed in healed fractures, postdating the aqueous-carbonic inclusions, and considered as a remobilizing agent of earlier precipitated gold in late fractures, and (3) barren low-temperature, aqueous, high saline inclusions in healed fractures, similar to the crustal brines reported throughout the Canadian Shield and considered to be unrelated to the gold mineralization. At the Lac Herbin deposit, the aqueous-carbonic inclusions are interpreted to have formed first and to represent the gold-bearing fluid, which were generated contemporaneous with regional greenschist facies metamorphism. In contrast, the high-temperature aqueous fluid dissolved gold from the main vein filling ore stage transported and reprecipitated it in late fractures during a subsequent local thermal event.

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

GLAST answers about high-energy peaked BL Lacs: double-humped {gamma}-ray peak and extreme accelerators?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costamante, L.; Aharonian, F.; Khangulyan, D.

2007-07-12

An often overlooked fact is that the MeV-GeV emission from High-energy peaked BL Lacs (HBL) is basically unknown: there are only 3 objects of this type among all EGRET identified blazars with measured spectra. GLAST will be able to measure the spectrum for many of them, in particular TeV-blazars, and surprises are expected. GLAST will tell if the {gamma}-ray peak in some HBL is actually a ''double peak'', as suggested by the comparison of EGRET and HESS data in PKS 2155-304, We also remind and argue that a new class of BL Lacs could exist, where particles are shock-accelerated nearmore » the maximum possible rate, characterized by the synchrotron emission peaking in the GLAST band (100 MeV - few GeV). Such objects could easily have escaped detection or identification so far, and could now be unveiled by GLAST.« less

A hadronic origin for ultra-high-frequency-peaked BL Lac objects

NASA Astrophysics Data System (ADS)

Cerruti, M.; Zech, A.; Boisson, C.; Inoue, S.

2015-03-01

Current Cherenkov telescopes have identified a population of ultra-high-frequency peaked BL Lac objects (UHBLs), also known as extreme blazars, that exhibit exceptionally hard TeV spectra, including 1ES 0229+200, 1ES 0347-121, RGB J0710+591, 1ES 1101-232, and 1ES 1218+304. Although one-zone synchrotron-self-Compton (SSC) models have been generally successful in interpreting the high-energy emission observed in other BL Lac objects, they are problematic for UHBLs, necessitating very large Doppler factors and/or extremely high minimum Lorentz factors of the emitting leptonic population. In this context, we have investigated alternative scenarios where hadronic emission processes are important, using a newly developed (lepto-)hadronic numerical code to systematically explore the physical parameters of the emission region that reproduces the observed spectra while avoiding the extreme values encountered in pure SSC models. Assuming a fixed Doppler factor δ = 30, two principal parameter regimes are identified, where the high-energy emission is due to: (1) proton-synchrotron radiation, with magnetic fields B ˜ 1-100 G and maximum proton energies Ep; max ≲ 1019 eV; and (2) synchrotron emission from p-γ-induced cascades as well as SSC emission from primary leptons, with B ˜ 0.1-1 G and Ep; max ≲ 1017 eV. This can be realized with plausible, sub-Eddington values for the total (kinetic plus magnetic) power of the emitting plasma, in contrast to hadronic interpretations for other blazar classes that often warrant highly super-Eddington values.

The Cassini Solstice Mission: Streamlining Operations by Sequencing with PIEs

NASA Technical Reports Server (NTRS)

Vandermey, Nancy; Alonge, Eleanor K.; Magee, Kari; Heventhal, William

2014-01-01

The Cassini Solstice Mission (CSM) is the second extended mission phase of the highly successful Cassini/Huygens mission to Saturn. Conducted at a much-reduced funding level, operations for the CSM have been streamlined and simplified significantly. Integration of the science timeline, which involves allocating observation time in a balanced manner to each of the five different science disciplines (with representatives from the twelve different science instruments), has long been a labor-intensive endeavor. Lessons learned from the prime mission (2004-2008) and first extended mission (Equinox mission, 2008-2010) were utilized to design a new process involving PIEs (Pre-Integrated Events) to ensure the highest priority observations for each discipline could be accomplished despite reduced work force and overall simplification of processes. Discipline-level PIE lists were managed by the Science Planning team and graphically mapped to aid timeline deconfliction meetings prior to assigning discrete segments of time to the various disciplines. Periapse segments are generally discipline-focused, with the exception of a handful of PIEs. In addition to all PIEs being documented in a spreadsheet, allocated out-of-discipline PIEs were entered into the Cassini Information Management System (CIMS) well in advance of timeline integration. The disciplines were then free to work the rest of the timeline internally, without the need for frequent interaction, debate, and negotiation with representatives from other disciplines. As a result, the number of integration meetings has been cut back extensively, freeing up workforce. The sequence implementation process was streamlined as well, combining two previous processes (and teams) into one. The new Sequence Implementation Process (SIP) schedules 22 weeks to build each 10-week-long sequence, and only 3 sequence processes overlap. This differs significantly from prime mission during which 5-week-long sequences were built in 24 weeks

Analysis of LAC Observations of Clusters of Galaxies and Supernova Remnants

NASA Technical Reports Server (NTRS)

Hughes, J.

1996-01-01

The following publications are included and serve as the final report: The X-ray Spectrum of Abell 665; Clusters of Galaxies; Ginga Observation of an Oxygen-rich Supernova Remnant; Ginga Observations of the Coma Cluster and Studies of the Spatial Distribution of Iron; A Measurement of the Hubble Constant from the X-ray Properties and the Sunyaev-Zel'dovich Effect of Abell 2218; Non-polytropic Model for the Coma Cluster; and Abundance Gradients in Cooling Flow Clusters: Ginga LAC (Large Area Counter) and Einstein SSS (Solid State Spectrometer) Spectra of A496, A1795, A2142, and A2199.

Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

PubMed Central

Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

2002-01-01

Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

An acid-stable bacterial laccase identified from the endophyte Pantoea ananatis Sd-1 genome exhibiting lignin degradation and dye decolorization abilities.

PubMed

Shi, Xiaowei; Liu, Qian; Ma, Jiangshan; Liao, Hongdong; Xiong, Xianqiu; Zhang, Keke; Wang, Tengfei; Liu, Xuanmin; Xu, Ting; Yuan, Shanshan; Zhang, Xin; Zhu, Yonghua

2015-11-01

Isolation and identification of a novel laccase (namely Lac4) with various industrial applications potentials from an endophytical bacterium. Endophyte Sd-1 cultured in rice straw showed intra- and extra-cellular laccase activities. Genomic analysis of Sd-1 identified four putative laccases, Lac1 to Lac4. However, only Lac4 contains the complete signature sequence of laccase and shares at most 64 % sequence identity with other characterized bacterial multi-copper oxidases. Recombinant Lac4 can oxidize non-phenolic and phenolic compounds under acidic conditions and at 30-50 °C; Km values of Lac4 for ABTS at pH 2.5 and for guaiacol at pH 4.5 were 1 ± 0.15 and 6.1 ± 1.7 mM, respectively. The activity of Lac4 was stimulated by 0.8 mM Cu(2+) and 5 mM Fe(2+). In addition, Lac4 could decolorize various synthetic dyes and exhibit the degradation rate of 38 % for lignin. The data suggest that Lac4 possesses promising biotechnological potentials.

Pilot Performance on New ATM Operations: Maintaining In-Trail Separation and Arrival Sequencing

NASA Technical Reports Server (NTRS)

Pritchett, Amy R.; Yankosky, L. J.; Johnson, Walter (Technical Monitor)

1999-01-01

Cockpit Display of Traffic Information (CDTI) may enable new Air Traffic Management (ATM) operations. However, CDTI is not the only source of traffic information in the cockpit; ATM procedures may provide information, implicitly and explicitly, about other aircraft. An experiment investigated pilot ability to perform two new ATM operations - maintaining in-trail separation from another aircraft and sequencing into an arrival stream. In the experiment, pilots were provided different amounts of information from displays and procedures. The results are described.

Structure of LacY with an α-substituted galactoside: Connecting the binding site to the protonation site

PubMed Central

Kumar, Hemant; Finer-Moore, Janet S.; Kaback, H. Ronald; Stroud, Robert M.

2015-01-01

The X-ray crystal structure of a conformationally constrained mutant of the Escherichia coli lactose permease (the LacY double-Trp mutant Gly-46→Trp/Gly-262→Trp) with bound p-nitrophenyl-α-d-galactopyranoside (α-NPG), a high-affinity lactose analog, is described. With the exception of Glu-126 (helix IV), side chains Trp-151 (helix V), Glu-269 (helix VIII), Arg-144 (helix V), His-322 (helix X), and Asn-272 (helix VIII) interact directly with the galactopyranosyl ring of α-NPG to provide specificity, as indicated by biochemical studies and shown directly by X-ray crystallography. In contrast, Phe-20, Met-23, and Phe-27 (helix I) are within van der Waals distance of the benzyl moiety of the analog and thereby increase binding affinity nonspecifically. Thus, the specificity of LacY for sugar is determined solely by side-chain interactions with the galactopyranosyl ring, whereas affinity is increased by nonspecific hydrophobic interactions with the anomeric substituent. PMID:26157133

Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†

PubMed Central

Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald

2009-01-01

A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129

An Analysis of Periodic Components in BL Lac Object S5 0716 +714 with MUSIC Method

NASA Astrophysics Data System (ADS)

Tang, J.

2012-01-01

Multiple signal classification (MUSIC) algorithms are introduced to the estimation of the period of variation of BL Lac objects.The principle of MUSIC spectral analysis method and theoretical analysis of the resolution of frequency spectrum using analog signals are included. From a lot of literatures, we have collected a lot of effective observation data of BL Lac object S5 0716 + 714 in V, R, I bands from 1994 to 2008. The light variation periods of S5 0716 +714 are obtained by means of the MUSIC spectral analysis method and periodogram spectral analysis method. There exist two major periods: (3.33±0.08) years and (1.24±0.01) years for all bands. The estimation of the period of variation of the algorithm based on the MUSIC spectral analysis method is compared with that of the algorithm based on the periodogram spectral analysis method. It is a super-resolution algorithm with small data length, and could be used to detect the period of variation of weak signals.

Anisotropy of magnetic susceptibility versus lattice- and shape-preferred orientation in the Lac Tio hemo-ilmenite ore body (Grenville province, Quebec)

NASA Astrophysics Data System (ADS)

Bolle, Olivier; Charlier, Bernard; Bascou, Jérôme; Diot, Hervé; McEnroe, Suzanne A.

2014-08-01

The Lac Tio hemo-ilmenite ore body crops out in the outer portion of the 1.06 Ga Lac Allard anorthosite, a member of the Havre-Saint-Pierre anorthosite suite from the Grenville province of North America. It is made up of ilmenitite (commonly with more than 95% hemo-ilmenite) associated with noritic lithologies and anorthosite. The present study compares the magnetic fabric of the ore body, as deduced from anisotropy of magnetic susceptibility (AMS) measurements, with the crystallographic and shape fabrics, obtained from lattice-preferred orientation (LPO) and shape-preferred orientation (SPO) measurements made using electron backscattered diffraction (EBSD) and 3D image analysis, respectively. Room-temperature hysteresis measurements, thermomagnetic curves and values of the bulk magnetic susceptibility reveal a magnetic mineralogy dominated by a mixed contribution of hemo-ilmenite and magnetite. The hemo-ilmenite grains display a LPO characterized by a strong preferred orientation of the basal (0001) plane of ilmenite along which hematite was exsolved. This LPO and the magnetic fabric fit well (angle between the crystallographic c-axis and the axis of minimum susceptibility ≤ ca. 15° for most samples), and the latter is thus strongly influenced by the hemo-ilmenite magneto-crystalline anisotropy. A magnetite SPO, concordant with the hemo-ilmenite LPO, may also influence and even dominate the magnetic fabric. The rock shape fabric is coaxial with the magnetic fabric that can thus be used to perform detailed structural mapping. Interpretation of the magnetic fabric and field structural data suggests that the Lac Tio ore body would be a sag point at the margin of the Lac Allard anorthosite, deformed by ballooning during the final stage of diapiric emplacement of the anorthosite body.

Genomic region operation kit for flexible processing of deep sequencing data.

PubMed

Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa

2013-01-01

Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

PubMed

Díaz-Hernández, Orlando; Santillán, Moisés

2010-01-01

In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Bistable Behavior of the Lac Operon in E. Coli When Induced with a Mixture of Lactose and TMG

PubMed Central

Díaz-Hernández, Orlando; Santillán, Moisés

2010-01-01

In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions. PMID:21423364

Extraordinary Activity in the BL Lac Object OJ 287

NASA Astrophysics Data System (ADS)

Hughes, P. A.; Aller, H. D.; Aller, M. F.

We present the results of a wavelet transform analysis of data for the BL Lac object OJ 287 acquired as part of the UMRAO variability program. We find clear evidence for a persistent modulation of the total flux and polarization with period 1.66 years, and for another signal that dominates activity in the 1980s with period 1.12 years. It appears that the longer time scale periodicity is associated with an otherwise quiescent jet, and the shorter time scale activity is associated with the passage of a shock, or shocks. The periodic behavior in polarization exhibits excursions in U which correspond to a direction 45circ from the VLBI jet axis. This behavior suggests a small amplitude, cyclic variation in the flow direction in that part of the flow that dominates cm-wavelength emission.

Characterisation and discrimination of various types of lac resin using gas chromatography mass spectrometry techniques with quaternary ammonium reagents.

PubMed

Sutherland, K; del Río, J C

2014-04-18

A variety of lac resin samples obtained from artists' suppliers, industrial manufacturers, and museum collections were analysed using gas chromatography mass spectrometry (GCMS) and reactive pyrolysis GCMS with quaternary ammonium reagents. These techniques allowed a detailed chemical characterisation of microgram-sized samples, based on the detection and identification of derivatives of the hydroxy aliphatic and cyclic (sesquiterpene) acids that compose the resin. Differences in composition could be related to the nature of the resin, e.g. wax-containing (unrefined), bleached, or aged samples. Furthermore, differences in the relative abundances of aliphatic hydroxyacids appear to be associated with the biological source of the resin. The diagnostic value of newly characterised lac components, including 8-hydroxyacids, is discussed here for the first time. Identification of derivatised components was aided by AMDIS deconvolution software, and discrimination of samples was enhanced by statistical evaluation of data using principal component analysis. The robustness of the analyses, together with the minimal sample size required, make these very powerful approaches for the characterisation of lac resin in museum objects. The value of such analyses for enhancing the understanding of museum collections is illustrated by two case studies of objects in the collection of the Philadelphia Museum of Art: a restorer's varnish on a painting by Luca Signorelli, and a pictorial inlay in an early nineteenth-century High Chest by George Dyer. Copyright © 2014 Elsevier B.V. All rights reserved.

Network Analysis of Sequence-Function Relationships and Exploration of Sequence Space of TEM β-Lactamases.

PubMed

Zeil, Catharina; Widmann, Michael; Fademrecht, Silvia; Vogel, Constantin; Pleiss, Jürgen

2016-05-01

The Lactamase Engineering Database (www.LacED.uni-stuttgart.de) was developed to facilitate the classification and analysis of TEM β-lactamases. The current version contains 474 TEM variants. Two hundred fifty-nine variants form a large scale-free network of highly connected point mutants. The network was divided into three subnetworks which were enriched by single phenotypes: one network with predominantly 2be and two networks with 2br phenotypes. Fifteen positions were found to be highly variable, contributing to the majority of the observed variants. Since it is expected that a considerable fraction of the theoretical sequence space is functional, the currently sequenced 474 variants represent only the tip of the iceberg of functional TEM β-lactamase variants which form a huge natural reservoir of highly interconnected variants. Almost 50% of the variants are part of a quartet. Thus, two single mutations that result in functional enzymes can be combined into a functional protein. Most of these quartets consist of the same phenotype, or the mutations are additive with respect to the phenotype. By predicting quartets from triplets, 3,916 unknown variants were constructed. Eighty-seven variants complement multiple quartets and therefore have a high probability of being functional. The construction of a TEM β-lactamase network and subsequent analyses by clustering and quartet prediction are valuable tools to gain new insights into the viable sequence space of TEM β-lactamases and to predict their phenotype. The highly connected sequence space of TEM β-lactamases is ideally suited to network analysis and demonstrates the strengths of network analysis over tree reconstruction methods. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Limits of acceptable change and natural resources planning: when is LAC useful, when is it not?

Treesearch

David N. Cole; Stephen F. McCool

1997-01-01

There are ways to improve the LAC process and its implementational procedures. One significant procedural modification is the addition of a new step. This step — which becomes the first step in the process — involves more explicitly defining goals and desired conditions. For other steps in the process, clarifications of concept and terminology are advanced, as are...

Development of volatile compounds during the manufacture of dry-cured "lacón," a Spanish traditional meat product.

PubMed

Purriños, Laura; Bermúdez, Roberto; Franco, Daniel; Carballo, Javier; Lorenzo, José M

2011-01-01

Volatile compounds were determined throughout the manufacture of dry-cured "lacón," a traditional dry-salted, and ripened meat product made in the north-west of Spain from the foreleg of the pig following a similar process to that of dry-cured ham. Volatiles were extracted by a purge-and-trap method and analyzed by gas chromatographic/mass spectrometry. One hundred and two volatile compounds were identified. In raw material, only 34 volatile compounds were found and at very low levels. The number of volatile compounds increased during processing. The substances identified belonged to several chemical classes: aldehydes (23), alcohols (9), ketones (15), hydrocarbons (37), esters (4), acids (3), furans (4), sulphur compounds (1), chloride compounds (1), and other compounds (4). Results indicated that the most abundant chemical family in flavor at the end of the manufacturing process was aldehydes, followed by hydrocarbons and ketones. Lipids were the most important precursor of flavor compounds of dry-cured "lacón."

Identification of Cryptosporidium Species in Fish from Lake Geneva (Lac Léman) in France.

PubMed

Certad, Gabriela; Dupouy-Camet, Jean; Gantois, Nausicaa; Hammouma-Ghelboun, Ourida; Pottier, Muriel; Guyot, Karine; Benamrouz, Sadia; Osman, Marwan; Delaire, Baptiste; Creusy, Colette; Viscogliosi, Eric; Dei-Cas, Eduardo; Aliouat-Denis, Cecile Marie; Follet, Jérôme

2015-01-01

Cryptosporidium, a protozoan parasite that can cause severe diarrhea in a wide range of vertebrates including humans, is increasingly recognized as a parasite of a diverse range of wildlife species. However, little data are available regarding the identification of Cryptosporidium species and genotypes in wild aquatic environments, and more particularly in edible freshwater fish. To evaluate the prevalence of Cryptosporidiumspp. in fish from Lake Geneva (Lac Léman) in France, 41 entire fish and 100 fillets (cuts of fish flesh) were collected from fishery suppliers around the lake. Nested PCR using degenerate primers followed by sequence analysis was used. Five fish species were identified as potential hosts of Cryptosporidium: Salvelinus alpinus, Esox lucius, Coregonus lavaretus, Perca fluviatilis, and Rutilus rutilus. The presence of Cryptosporidium spp. was found in 15 out of 41 fish (37%), distributed as follows: 13 (87%) C. parvum, 1 (7%) C. molnari, and 1 (7%) mixed infection (C. parvum and C. molnari). C. molnari was identified in the stomach, while C. parvum was found in the stomach and intestine. C. molnari was also detected in 1 out of 100 analyzed fillets. In order to identify Cryptosporidium subtypes, sequencing of the highly polymorphic 60-kDa glycoprotein (gp60) was performed. Among the C. parvum positive samples, three gp60 subtypes were identified: IIaA15G2R1, IIaA16G2R1, and IIaA17G2R1. Histological examination confirmed the presence of potential developmental stages of C. parvum within digestive epithelial cells. These observations suggest that C. parvum is infecting fish, rather than being passively carried. Since C. parvum is a zoonotic species, fish potentially contaminated by the same subtypes found in terrestrial mammals would be an additional source of infection for humans and animals, and may also contribute to the contamination of the environment with this parasite. Moreover, the risk of human transmission is strengthened by the

Identification of Cryptosporidium Species in Fish from Lake Geneva (Lac Léman) in France

PubMed Central

Certad, Gabriela; Dupouy-Camet, Jean; Gantois, Nausicaa; Hammouma-Ghelboun, Ourida; Pottier, Muriel; Guyot, Karine; Benamrouz, Sadia; Osman, Marwan; Delaire, Baptiste; Creusy, Colette; Viscogliosi, Eric; Aliouat-Denis, Cecile Marie; Follet, Jérôme

2015-01-01

Cryptosporidium, a protozoan parasite that can cause severe diarrhea in a wide range of vertebrates including humans, is increasingly recognized as a parasite of a diverse range of wildlife species. However, little data are available regarding the identification of Cryptosporidium species and genotypes in wild aquatic environments, and more particularly in edible freshwater fish. To evaluate the prevalence of Cryptosporidiumspp. in fish from Lake Geneva (Lac Léman) in France, 41 entire fish and 100 fillets (cuts of fish flesh) were collected from fishery suppliers around the lake. Nested PCR using degenerate primers followed by sequence analysis was used. Five fish species were identified as potential hosts of Cryptosporidium: Salvelinus alpinus, Esox lucius, Coregonus lavaretus, Perca fluviatilis, and Rutilus rutilus. The presence of Cryptosporidium spp. was found in 15 out of 41 fish (37%), distributed as follows: 13 (87%) C. parvum, 1 (7%) C. molnari, and 1 (7%) mixed infection (C. parvum and C. molnari). C. molnari was identified in the stomach, while C. parvum was found in the stomach and intestine. C. molnari was also detected in 1 out of 100 analyzed fillets. In order to identify Cryptosporidium subtypes, sequencing of the highly polymorphic 60-kDa glycoprotein (gp60) was performed. Among the C. parvum positive samples, three gp60 subtypes were identified: IIaA15G2R1, IIaA16G2R1, and IIaA17G2R1. Histological examination confirmed the presence of potential developmental stages of C. parvum within digestive epithelial cells. These observations suggest that C. parvum is infecting fish, rather than being passively carried. Since C. parvum is a zoonotic species, fish potentially contaminated by the same subtypes found in terrestrial mammals would be an additional source of infection for humans and animals, and may also contribute to the contamination of the environment with this parasite. Moreover, the risk of human transmission is strengthened by the

Intelligent Local Avoided Collision (iLAC) MAC Protocol for Very High Speed Wireless Network

NASA Astrophysics Data System (ADS)

Hieu, Dinh Chi; Masuda, Akeo; Rabarijaona, Verotiana Hanitriniala; Shimamoto, Shigeru

Future wireless communication systems aim at very high data rates. As the medium access control (MAC) protocol plays the central role in determining the overall performance of the wireless system, designing a suitable MAC protocol is critical to fully exploit the benefit of high speed transmission that the physical layer (PHY) offers. In the latest 802.11n standard [2], the problem of long overhead has been addressed adequately but the issue of excessive colliding transmissions, especially in congested situation, remains untouched. The procedure of setting the backoff value is the heart of the 802.11 distributed coordination function (DCF) to avoid collision in which each station makes its own decision on how to avoid collision in the next transmission. However, collision avoidance is a problem that can not be solved by a single station. In this paper, we introduce a new MAC protocol called Intelligent Local Avoided Collision (iLAC) that redefines individual rationality in choosing the backoff counter value to avoid a colliding transmission. The distinguishing feature of iLAC is that it fundamentally changes this decision making process from collision avoidance to collaborative collision prevention. As a result, stations can avoid colliding transmissions with much greater precision. Analytical solution confirms the validity of this proposal and simulation results show that the proposed algorithm outperforms the conventional algorithms by a large margin.

POWERFUL HIGH-ENERGY EMISSION OF THE REMARKABLE BL Lac OBJECT S5 0716+714

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vittorini, V.; Chen, A. W.; Ferrari, A.

BL Lac objects of the intermediate subclass (IBLs) are known to emit a substantial fraction of their power in the energy range 0.1-10 GeV. Detecting gamma-ray emission from such sources provides therefore a direct probe of the emission mechanisms and of the underlying powerhouse. The gamma-ray satellite, AGILE, detected the remarkable IBL S5 0716+714 (z approx = 0.3) during a high state in the period from 2007 September-October, marked by two very intense flares reaching peak fluxes of 200 x 10{sup -8} photons cm{sup -2} s{sup -1} above 100 MeV, with simultaneous optical and X-ray observations. We present here amore » theoretical model for the two major flares and discuss the overall energetics of the source. We conclude that 0716+714 is among the brightest BL Lac's ever detected at gamma-ray energies. Because of its high power and lack of signs for ongoing accretion or surrounding gas, the source is an ideal candidate to test the maximal power extractable from a rotating supermassive black hole via the pure Blandford-Znajek (BZ) mechanism. We find that during the 2007 gamma-ray flares 0716+714 approached or just exceeded the upper limit set by BZ for a black hole of mass 10{sup 9} M{sub sun}.« less

An Analysis of Light Periods of BL Lac Object S5 0716+714 with the MUSIC Algorithm

NASA Astrophysics Data System (ADS)

Tang, Jie

2012-07-01

The multiple signal classification (MUSIC) algorithm is introduced to the estimation of light periods of BL Lac objects. The principle of the MUSIC algorithm is given, together with a testing on its spectral resolution by using a simulative signal. From a lot of literature, we have collected a large number of effective observational data of the BL Lac object S5 0716+714 in the three optical wavebands V, R, and I from 1994 to 2008. The light periods of S5 0716+714 are obtained by means of the MUSIC algorithm and average periodogram algorithm, respectively. It is found that there exist two major periodic components, one is the period of (3.33±0.08) yr, another is the period of (1.24±0.01) yr. The comparison of the performances of periodicity analysis of two algorithms indicates that the MUSIC algorithm has a smaller requirement on the sample length, as well as a good spectral resolution and anti-noise ability, to improve the accuracy of periodicity analysis in the case of short sample length.

Pulse sequences for suppressing leakage in single-qubit gate operations

NASA Astrophysics Data System (ADS)

Ghosh, Joydip; Coppersmith, S. N.; Friesen, Mark

2017-06-01

Many realizations of solid-state qubits involve couplings to leakage states lying outside the computational subspace, posing a threat to high-fidelity quantum gate operations. Mitigating leakage errors is especially challenging when the coupling strength is unknown, e.g., when it is caused by noise. Here we show that simple pulse sequences can be used to strongly suppress leakage errors for a qubit embedded in a three-level system. As an example, we apply our scheme to the recently proposed charge quadrupole (CQ) qubit for quantum dots. These results provide a solution to a key challenge for fault-tolerant quantum computing with solid-state elements.

X-ray and TeV Gamma-Ray Emission from Parallel Electron-Positron or Electron-Proton Beams in BL Lac Objects

NASA Astrophysics Data System (ADS)

Krawczynski, Henric

2007-04-01

In this contribution we discuss models of the X-rays and TeV gamma-ray emission from BL Lac objects based on parallel electron-positron or electron-proton beams that form close to the central black hole owing to the strong electric fields generated by the accretion disk and possibly also by the black hole itself. Fitting the energy spectrum of the BL Lac object Mrk 501, we obtain tight constrains on the beam properties. Launching a sufficiently energetic beam requires rather strong magnetic fields close to the black hole 100-1000 G. However, the model fits imply that the magnetic field in the emission region is only 0.02 G. Thus, the particles are accelerated close to the black hole and propagate a considerable distance before instabilities trigger the dissipation of energy through synchrotron and self-Compton emission. We discuss various approaches to generate enough power to drive the jet and, at the same time, to accelerate particles to 20 TeV energies. Although the parallel beam model has its own problems, it explains some of the long-standing problems that plague models based on Fermi type particle acceleration, like the presence of a very high minimum Lorentz factor of accelerated particles. We conclude with a brief discussion of the implications of the model for the difference between the processes of jet formation in BL Lac type objects and in quasars.

Next-generation sequencing and clinical outcomes of patients with lung adenocarcinoma treated with stereotactic body radiotherapy.

PubMed

Cassidy, Richard J; Zhang, Xinyan; Patel, Pretesh R; Shelton, Joseph W; Escott, Chase E; Sica, Gabriel L; Rossi, Michael R; Hill, Charles E; Steuer, Conor E; Pillai, Rathi N; Ramalingam, Suresh S; Owonikoko, Taofeek K; Behera, Madhusmita; Force, Seth D; Fernandez, Felix G; Curran, Walter J; Higgins, Kristin A

2017-10-01

Genetic aberrations are well characterized in lung adenocarcinomas (LACs) and clinical outcomes have been influenced by targeted therapies in the advanced setting. Stereotactic body radiotherapy (SBRT) is the standard-of-care therapy for patients with nonoperable, early-stage LAC, but to the authors' knowledge, no information is available regarding the impact of genomic changes in these patients. The current study sought to determine the frequency and clinical impact of genetic aberrations in this population. Under an Institutional Review Board-approved protocol, the records of 242 consecutive patients with early-stage lung cancers were reviewed; inclusion criteria included LAC histology with an adequate tumor sample for the successful use of next-generation sequencing and fluorescence in situ hybridization testing. Univariate analysis was performed to identify factors associated with clinical outcomes. LAC samples from 98 of the 242 patients were reviewed (40.5%), of whom 45 patients (46.0%) had genetic testing. The following mutations were noted: KRAS in 20.0% of samples, BRAF in 2.2% of samples, SMAD family member 4 (SMAD4) in 4.4% of samples, epidermal growth factor receptor (EGFR) in 15.6% of samples, STK1 in 2.2% of samples, tumor protein 53 (TP53) in 15.6% of samples, and phosphatase and tensin homolog (PTEN) in 2.2% of samples. The following gene rearrangements were observed: anaplastic lymphoma kinase (ALK) in 8.9% of samples, RET in 2.2% of samples, and MET amplification in 17.8% of samples. The median total delivered SBRT dose was 50 grays (range, 48-60 grays) over a median of 5 fractions (range, 3-8 fractions). The KRAS mutation was associated with worse local control (odds ratio [OR], 3.64; P<.05). MET amplification was associated with worse regional (OR, 4.64; P<.05) and distant (OR, 3.73; P<.05) disease control. To the authors' knowledge, the current series is the first to quantify genetic mutations and their association with clinical outcomes in

78 FR 3911 - Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-17

... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R3-R-2012-N259; FXRS1265030000-134-FF03R06000] Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive... significant impact (FONSI) for the environmental assessment (EA) for Big Stone National Wildlife Refuge...

The cosmic evolution of Fermi BL lacertae objects

DOE PAGES

Ajello, M.; Romani, R. W.; Gasparrini, D.; ...

2013-12-13

Fermi has provided the largest sample of γ-ray-selected blazars to date. We use a uniformly selected set of 211 BL Lacertae (BL Lac) objects detected by Fermi during its first year of operation. We obtained redshift constraints for 206 out of the 211 BL Lac objects in our sample, making it the largest and most complete sample of BL Lac objects available in the literature. We use this sample to determine the luminosity function of BL Lac objects and its evolution with cosmic time. Here, we find that for most BL Lac classes the evolution is positive, with a space density peaking at modest redshift (z ≈ 1.2). Low-luminosity, high-synchrotron-peaked (HSP) BL Lac objects are an exception, showing strong negative evolution, with number density increasing for z lesssim 0.5. Since this rise corresponds to a drop-off in the density of flat-spectrum radio quasars (FSRQs), a possible interpretation is that these HSPs represent an accretion-starved end state of an earlier merger-driven gas-rich phase. Additionally, we find that the known BL Lac correlation between luminosity and photon spectral index persists after correction for the substantial observational selection effects with implications for the so-called "blazar sequence." Finally, by estimating the beaming corrections to the luminosity function, we find that BL Lac objects have an average Lorentz factor ofmore » $$\\gamma =6.1^{+1.1}_{-0.8}$$, and that most are seen within 10° of the jet axis.« less

Laser-Assisted Cold-Sprayed Corrosion- and Wear-Resistant Coatings: A Review

NASA Astrophysics Data System (ADS)

Olakanmi, E. O.; Doyoyo, M.

2014-06-01

Laser-assisted cold spray (LACS) process will be increasingly employed for depositing coatings because of its unique advantages: solid-state deposition of dense, homogeneous, and pore-free coatings onto a range of substrates; and high build rate at reduced operating costs without the use of expensive heating and process inert gases. Depositing coatings with excellent performance indicators via LACS demands an accurate knowledge and control of processing and materials' variables. By varying the LACS process parameters and their interactions, the functional properties of coatings can be manipulated. Moreover, thermal effect due to laser irradiation and microstructural evolution complicate the interpretation of LACS mechanical deformation mechanism which is essential for elucidating its physical phenomena. In order to provide a basis for follow-on-research that leads to the development of high-productivity LACS processing of coatings, this review focuses on the latest developments in depositing corrosion- and wear-resistant coatings with the emphasis on the composition, structure, and mechanical and functional properties. Historical developments and fundamentals of LACS are addressed in an attempt to describe the physics behind the process. Typical technological applications of LACS coatings are also identified. The investigations of all process sequences, from laser irradiation of the powder-laden gas stream and the substrate, to the impingement of thermally softened particles on the deposition site, and subsequent further processes, are described. Existing gaps in the literature relating to LACS-dependent microstructural evolution, mechanical deformation mechanisms, correlation between functional properties and process parameters, processing challenges, and industrial applications have been identified in order to provide insights for further investigations and innovation in LACS deposition of wear- and corrosion-resistant coatings.

Sequence analysis of laci mutations obtained from lung cells of radon-exposed big blue{trademark} transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Layton, A.D.; Cross, F.T.; Steigler, G.L.

1994-12-31

We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less

Effect of the inclusion of chestnut in the finishing diet on volatile compounds during the manufacture of dry-cured "Lacón" from Celta pig breed.

PubMed

Lorenzo, José M; Franco, Daniel; Carballo, Javier

2014-01-01

The effect of the finishing diet on the volatile compounds throughout the manufacture of dry-cured "lacón" (a Spanish traditional meat product), from the Celta pig breed was studied. Thirty-six pigs were separated into three groups according to the type of feeding during the finish-fattening period of three months (concentrate, mixed diet and chestnut). From the pigs of each diet, four batches of dry-cured "lacón" were manufactured. From each batch, samples of fresh meat, meat after salting, after post-salting, and after 14, 28, 56 and 84 days of drying-ripening were taken. Volatiles were extracted by a purge-and-trap method and analyzed by gas chromatographic/mass spectrometry (GC/MS). Seventy-six volatile compounds were identified and quantified from dry-cured "lacón" samples in pigs finished with chestnut, eighty-two for concentrate fed pigs and eighty in pigs fed with the mixed diet. The number of identified volatile compounds increased during the manufacturing process; at 84 days of drying-ripening, in the dry-cured "lacón" samples from pigs finished with concentrate, mixed diet and chestnut, 54, 58 and 62 volatile compounds were detected, respectively. The most abundant group of flavour compounds at the end of the manufacturing process was hydrocarbons in the three feeding systems, followed by aldehydes, ketones and alcohols. Discriminant analysis selected six variables (dodecane, butadienol, pentenol, 2-pentenal, decen-3-ona and pyridine-2-methyl) and calculated two discriminating functions which allowed verification of chestnut in the finishing diet. © 2013.

Pesticides in surface water, bed sediment, and ground water adjacent to commercial cranberry bogs, Lac du Flambeau Reservation, Vilas County, Wisconsin

USGS Publications Warehouse

Saad, David A.

2005-01-01

In samples from the Trout River, which is used as a source of water to maintain lake levels in the Corn Lakes, the only pesticides detected were the non-targeted compounds atrazine and deethyl atrazine, indicating it was not a source of targeted compounds detected in the Corn Lakes. Only two pesticides (chlorpyrifos and metolachlor) were detected in bed-sediment samples collected from the lakes; chlorpyrifos from Little Trout Lake and metolachlor from the Corn Lakes. Four pesticides (the targeted compounds napropamide and norflurazon and the non-targeted compounds atrazine and deethyl atrazine) were detected in ground-water samples from two of four sampled monitor wells. The highest ground-water concentrations (up to 0.14 ?g/L napropamide and 0.56 ?g/L norflurazon) were measured in samples from the monitoring well located directly downgradient from the Corn Lakes and commercial cranberry operations. No pesticides were detected in samples from the reference well located upgradient from the Corn Lakes and cranberry operations. Further study is needed to identify additional pesticides as well as chronic effects on aquatic organisms to determine whether cranberry-related pesticides affect the lake ecosystems of the Lac du Flambeau Reservation.

HESS J1943+213: A Non-classical High-frequency-peaked BL Lac Object

NASA Astrophysics Data System (ADS)

Straal, S. M.; Gabányi, K. É.; van Leeuwen, J.; Clarke, T. E.; Dubner, G.; Frey, S.; Giacani, E.; Paragi, Z.

2016-05-01

HESS J1943+213 is an unidentified TeV source that is likely a high-frequency-peaked BL Lac (HBL) object, but that is also compatible with a pulsar wind nebula (PWN) nature. Each of these enormously different astronomical interpretations is supported by some of the observed unusual characteristics. In order to finally classify and understand this object, we took a three-pronged approach, through time-domain, high angular resolution, and multi-frequency radio studies. First, our deep time-domain observations with the Arecibo telescope failed to uncover the putative pulsar powering the proposed PWN. We conclude with ˜70% certainty that HESS J1943+213 does not host a pulsar. Second, long-baseline interferometry of the source with e-MERLIN at 1.5 and 5 GHz shows only a core, that is, a point source at ˜ 1-100 mas resolution. Its 2013 flux density is about one-third lower than that detected in the 2011 observations with similar resolution. This radio variability of the core strengthens the HBL object hypothesis. Third, additional evidence against the PWN scenario comes from the radio spectrum we compiled. The extended structure follows a power-law behavior with spectral index α \\=\\-0.54+/- 0.04 while the core component displays a flat spectrum (α \\=\\-0.03+/- 0.03). In contrast, the radio synchrotron emission of PWNe predicts a single power-law distribution. Overall, we rule out the PWN hypothesis and conclude that the source is a BL Lac object. The consistently high fraction (70%) of the flux density from the extended structure then leads us to conclude that HESS J1943+213 must be a non-classical HBL object.

A Simple Method for Visualization of Locus-Specific H4K20me1 Modifications in Living Caenorhabditis elegans Single Cells.

PubMed

Shinkai, Yoichi; Kuramochi, Masahiro; Doi, Motomichi

2018-05-03

Recently, advances in next-generation sequencing technologies have enabled genome-wide analyses of epigenetic modifications; however, it remains difficult to analyze the states of histone modifications at a single-cell resolution in living multicellular organisms because of the heterogeneity within cellular populations. Here we describe a simple method to visualize histone modifications on the specific sequence of target locus at a single-cell resolution in living Caenorhabditis elegans , by combining the LacO/LacI system and a genetically-encoded H4K20me1-specific probe, "mintbody". We demonstrate that Venus-labeled mintbody and mTurquoise2-labeled LacI can co-localize on an artificial chromosome carrying both the target locus and LacO sequences, where H4K20me1 marks the target locus. We demonstrate that our visualization method can precisely detect H4K20me1 depositions on the her-1 gene sequences on the artificial chromosome, to which the dosage compensation complex binds to regulate sex determination. The degree of H4K20me1 deposition on the her-1 sequences on the artificial chromosome correlated strongly with sex, suggesting that, using the artificial chromosome, this method can reflect context-dependent changes of H4K20me1 on endogenous genomes. Furthermore, we demonstrate live imaging of H4K20me1 depositions on the artificial chromosome. Combined with ChIP assays, this mintbody-LacO/LacI visualization method will enable analysis of developmental and context-dependent alterations of locus-specific histone modifications in specific cells and elucidation of the underlying molecular mechanisms. Copyright © 2018, G3: Genes, Genomes, Genetics.

The Luminosity Function of the Host Galaxies of QSOs and BL Lac Objects

NASA Astrophysics Data System (ADS)

Carangelo, Nicoletta; Falomo, Renato; Treves, Aldo

A clear insight of the galaxies hosting active galactic nuclei is of fundamental importance for understanding the processes of galaxies and nuclei formation and their cosmic evolution. A good characterization of the host galaxies properties requires images of excellent quality in order to disentangle the light of the galaxy from that of the bright nucleus. To this aim HST has provided a major improvement of data on QSOs (Disney et al. 1995; Bahcall et al. 1996,1997; Boyce et al. 1998; McLure et al. 1999; Hamilton et al. 2000; Kukula et al. 2001) and BL Lacs (Scarpa et al. 2000, Urry et al. 2000).

A novel chaos-based image encryption algorithm using DNA sequence operations

NASA Astrophysics Data System (ADS)

Chai, Xiuli; Chen, Yiran; Broyde, Lucie

2017-01-01

An image encryption algorithm based on chaotic system and deoxyribonucleic acid (DNA) sequence operations is proposed in this paper. First, the plain image is encoded into a DNA matrix, and then a new wave-based permutation scheme is performed on it. The chaotic sequences produced by 2D Logistic chaotic map are employed for row circular permutation (RCP) and column circular permutation (CCP). Initial values and parameters of the chaotic system are calculated by the SHA 256 hash of the plain image and the given values. Then, a row-by-row image diffusion method at DNA level is applied. A key matrix generated from the chaotic map is used to fuse the confused DNA matrix; also the initial values and system parameters of the chaotic system are renewed by the hamming distance of the plain image. Finally, after decoding the diffused DNA matrix, we obtain the cipher image. The DNA encoding/decoding rules of the plain image and the key matrix are determined by the plain image. Experimental results and security analyses both confirm that the proposed algorithm has not only an excellent encryption result but also resists various typical attacks.

Quasi-simultaneous observations of the BL Lac object MK 501 in X-ray, UV, visible, IR and radio frequencies

NASA Technical Reports Server (NTRS)

Kondo, D. M.; Worrall, D. M.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. H.; Oke, J. B.; Yee, H.; Neugebauer, G.; Matthews, K.; Feldman, P. A.

1980-01-01

Quasi-simultaneous observations of the BL Lacertae (Lac) objects MK 501 were performed for the first time at X-ray, ultraviolet, visible, infrared, and radio frequencies. The observed spectral slope from the X-ray to UV regions is positive and continuous, but that from the mid UV to visible light region becomes gradually flat and possibly turns down toward lower frequencies; the optical radio emission can not be accounted for by a single power law. Several theoretical models were considered for the emission mechanism. A quantitative comparison was performed with the synchrotron-self-Compton model; the total spectrum is found consistent with this model. The spectrum from visible light to X-ray is consistent with synchrotron radiation or with inverse-Compton scattering by a hot thermal cloud of electrons. The continuity of the spectral slope from X-ray to UV implied by the current data suggests that the previous estimates of the total luminosity of this BL Lac object is underestimated by a factor of about three or four.

Redshift determination of the BL Lac object 3C 66A by the detection of its host galaxy cluster at z = 0.340

NASA Astrophysics Data System (ADS)

Torres-Zafra, Juanita; Cellone, Sergio A.; Buzzoni, Alberto; Andruchow, Ileana; Portilla, José G.

2018-03-01

The BL Lac object 3C 66A is one of the most luminous extragalactic sources at TeV γ-rays (very high energy, i.e. E > 100 GeV). Since TeV γ-ray radiation is absorbed by the extragalactic background light (EBL), it is crucial to know the redshift of the source in order to reconstruct its original spectral energy distribution, as well as to constrain EBL models. However, the optical spectrum of this BL Lac is almost featureless, so a direct measurement of z is very difficult; in fact, the published redshift value for this source (z = 0.444) has been strongly questioned. Based on EBL absorption arguments, several constraints to its redshift, in the range 0.096 < z < 0.5, were proposed. Since these active galactic nuclei (AGNs) are hosted, typically, in early-type galaxies that are members of groups or clusters, we have analysed spectro-photometrically the environment of 3C 66A, with the goal of finding the galaxy group hosting this blazar. This study was made using optical images of a 5.5 × 5.5 arcmin2 field centred on the blazar, and spectra of 24 sources obtained with Gemini/GMOS-N multi-object spectroscopy. We found spectroscopic evidence of two galaxy groups along the blazar's line of sight: one at z ≃ 0.020 and the second one at z ≃ 0.340. The first one is consistent with a known foreground structure, while the second group presented here has six spectroscopically confirmed members. Their location along a red sequence in the colour-magnitude diagram allows us to identify 34 additional candidate members of the more distant group. The blazar's spectrum shows broad absorption features that we identify as arising in the intergalactic medium, thus allowing us to tentatively set a redshift lower limit at z_3C66A ≳ 0.33. As a consequence, we propose that 3C 66A is hosted in a galaxy that belongs to a cluster at z = 0.340.

Proteins mediating DNA loops effectively block transcription.

PubMed

Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David

2017-07-01

Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

First analysis of eight Algol-type binaries: EI Aur, XY Dra, BP Dra, DD Her, VX Lac, WX Lib, RZ Lyn, and TY Tri

NASA Astrophysics Data System (ADS)

Zasche, P.

2016-01-01

The available photometry from the online databases were used for the first light curve analysis of eight eclipsing binary systems EI Aur, XY Dra, BP Dra, DD Her, VX Lac, WX Lib, RZ Lyn, and TY Tri. All these stars are of Algol-type, having the detached components and the orbital periods from 0.92 to 6.8 days. For the systems EI Aur and BP Dra the large amount of the third light was detected during the light curve solution. Moreover, 468 new times of minima for these binaries were derived, trying to identify the period variations. For the systems XY Dra and VX Lac the third bodies were detected with the periods 17.7, and 49.3 years, respectively.

76 FR 10894 - Notice of Issuance of Prevention of Significant Deterioration and Federal Operating Permits to...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-28

... (EPA). ACTION: Notice. SUMMARY: This notice announces that, on December 30, 2010, pursuant to title V of the Clean Air Act, EPA issued a title V Permit to Operate (title V permit) to the Mille Lacs Band... permits, which ended April 5, 2010, EPA received comments on the draft title V permit, and revised the...

Error Analysis of Deep Sequencing of Phage Libraries: Peptides Censored in Sequencing

PubMed Central

Matochko, Wadim L.; Derda, Ratmir

2013-01-01

Next-generation sequencing techniques empower selection of ligands from phage-display libraries because they can detect low abundant clones and quantify changes in the copy numbers of clones without excessive selection rounds. Identification of errors in deep sequencing data is the most critical step in this process because these techniques have error rates >1%. Mechanisms that yield errors in Illumina and other techniques have been proposed, but no reports to date describe error analysis in phage libraries. Our paper focuses on error analysis of 7-mer peptide libraries sequenced by Illumina method. Low theoretical complexity of this phage library, as compared to complexity of long genetic reads and genomes, allowed us to describe this library using convenient linear vector and operator framework. We describe a phage library as N × 1 frequency vector n = ||ni||, where ni is the copy number of the ith sequence and N is the theoretical diversity, that is, the total number of all possible sequences. Any manipulation to the library is an operator acting on n. Selection, amplification, or sequencing could be described as a product of a N × N matrix and a stochastic sampling operator (S a). The latter is a random diagonal matrix that describes sampling of a library. In this paper, we focus on the properties of S a and use them to define the sequencing operator (S e q). Sequencing without any bias and errors is S e q = S a IN, where IN is a N × N unity matrix. Any bias in sequencing changes IN to a nonunity matrix. We identified a diagonal censorship matrix (C E N), which describes elimination or statistically significant downsampling, of specific reads during the sequencing process. PMID:24416071

Fermi LAT detection of a GeV flare from the BL Lac object Mrk 421

NASA Astrophysics Data System (ADS)

D'Ammando, F.; Orienti, M.

2012-07-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object Mrk 421 (also known as 2FGL J1104.4+3812, Nolan et al. 2012, ApJS, 199, 31; R.A.= 11h04m27.3139s, Dec.= +38d12m31.799s, J2000.0, Fey et al. 2004, AJ, 127, 3587) at redshift z=0.03 (De Vaucouleurs et al.

VLBA Observations of Low Luminosity Flat Spectrum Radio Galaxies and BL Lac Objects: Polarisation Properties

NASA Astrophysics Data System (ADS)

Bondi, M.; Dallacasa, D.; Stanghellini, C.; Marchã, M. J. M.

We obtained two-epoch VLBA observations at 5 GHz of a list of radio galaxies drawn from the 200 mJy sample (Marcha et al. 1996). The objects selected for milli-arcsecond scale observations are classified, on the basis of their optical spectroscopic and polarimetric properties, as BL Lac objects, normal weak line radio galaxies, broad line radio galaxies, and transition objects (those with intermediate properties). We present preliminary results on the radio polarization properties, on the milli-arcsecond scale, of objects with different optical properties and discuss structural variations detected from the two epochs.

The glpD gene is a novel reporter gene for E. coli that is superior to established reporter genes like lacZ and gusA.

PubMed

Wegener, Marius; Vogtmann, Kristina; Huber, Madeleine; Laass, Sebastian; Soppa, Jörg

2016-12-01

Reporter genes facilitate the characterization of promoter activities, transcript stabilities, translational efficiencies, or intracellular localization. Various reporter genes for Escherichia coli have been established, however, most of them have drawbacks like transcript instability or the inability to be used in genetic selections. Therefore, the glpD gene encoding glycerol-3-phosphate dehydrogenase was introduced as a novel reporter gene for E. coli. The enzymatic assay was optimized, and it was verified that growth on glycerol strictly depends on the presence of GlpD. The 5'-UTRs of three E. coli genes were chosen and cloned upstream of the new reporter gene glpD as well as the established reporter genes lacZ and gusA. Protein and transcript levels were quantified and translational efficiencies were calculated. The lacZ transcript was very unstable and its level highly depended on its translation, compromising its use as a reporter. The results obtained with gusA and glpD were similar, however, only glpD can be used for genetic selections. Therefore, glpD was found to be a superior novel reporter gene compared to the established reporter genes lacZ and gusA. Copyright © 2016 Elsevier B.V. All rights reserved.

Interplay of protein and DNA structure revealed in simulations of the lac operon.

PubMed

Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

2013-01-01

The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

Science sequence design

NASA Technical Reports Server (NTRS)

Koskela, P. E.; Bollman, W. E.; Freeman, J. E.; Helton, M. R.; Reichert, R. J.; Travers, E. S.; Zawacki, S. J.

1973-01-01

The activities of the following members of the Navigation Team are recorded: the Science Sequence Design Group, responsible for preparing the final science sequence designs; the Advanced Sequence Planning Group, responsible for sequence planning; and the Science Recommendation Team (SRT) representatives, responsible for conducting the necessary sequence design interfaces with the teams during the mission. The interface task included science support in both advance planning and daily operations. Science sequences designed during the mission are also discussed.

Rover Sequencing and Visualization Program

NASA Technical Reports Server (NTRS)

Cooper, Brian; Hartman, Frank; Maxwell, Scott; Yen, Jeng; Wright, John; Balacuit, Carlos

2005-01-01

The Rover Sequencing and Visualization Program (RSVP) is the software tool for use in the Mars Exploration Rover (MER) mission for planning rover operations and generating command sequences for accomplishing those operations. RSVP combines three-dimensional (3D) visualization for immersive exploration of the operations area, stereoscopic image display for high-resolution examination of the downlinked imagery, and a sophisticated command-sequence editing tool for analysis and completion of the sequences. RSVP is linked with actual flight-code modules for operations rehearsal to provide feedback on the expected behavior of the rover prior to committing to a particular sequence. Playback tools allow for review of both rehearsed rover behavior and downlinked results of actual rover operations. These can be displayed simultaneously for comparison of rehearsed and actual activities for verification. The primary inputs to RSVP are downlink data products from the Operations Storage Server (OSS) and activity plans generated by the science team. The activity plans are high-level goals for the next day s activities. The downlink data products include imagery, terrain models, and telemetered engineering data on rover activities and state. The Rover Sequence Editor (RoSE) component of RSVP performs activity expansion to command sequences, command creation and editing with setting of command parameters, and viewing and management of rover resources. The HyperDrive component of RSVP performs 2D and 3D visualization of the rover s environment, graphical and animated review of rover-predicted and telemetered state, and creation and editing of command sequences related to mobility and Instrument Deployment Device (IDD) operations. Additionally, RoSE and HyperDrive together evaluate command sequences for potential violations of flight and safety rules. The products of RSVP include command sequences for uplink that are stored in the Distributed Object Manager (DOM) and predicted rover

Multi-epoch intranight optical monitoring of eight radio-quiet BL Lac candidates

NASA Astrophysics Data System (ADS)

Kumar, P.; Gopal-Krishna; Stalin, C. S.; Chand, H.; Srianand, R.; Petitjean, P.

2017-10-01

For a new sample of eight weak-line quasars (WLQs) we report a sensitive search in 20 intranight monitoring sessions, for blazar-like optical flux variations on hour-like and longer time-scale (day/month/year-like). The sample consists exclusively of the WLQs that are not radio-loud and either have been classified as 'radio-weak probable BL Lac candidates' and/or are known to have exhibited at least one episode of large, blazar-like optical variability. Whereas only a hint of intranight variability is seen for two of these WLQs, J104833.5+620305.0 (z = 0.219) and J133219.6+622715.9 (z = 3.15), statistically significant internight variability at a few per cent level is detected for three of the sources, including the radio-intermediate WLQ J133219.6+622715.9 (z = 3.15) and the well-known bona fide radio-quiet WLQs J121221.5+534128.0 (z = 3.10) and WLQ J153259.9-003944.1 (z = 4.62). In the rest frame, this variability is intraday and in the far-ultraviolet band. On the time-scale of a decade, we find for three of the WLQs large brightness changes, amounting to 1.655 ± 0.009, 0.163 ± 0.010 and 0.144 ± 0.018 mag, for J104833.5+620305.0, J123743.1+630144.9 and J232428.4+144324.4, respectively. Whereas the latter two are confirmed radio-quiet WLQs, the extragalactic nature of J104833.5+620305.0 remains to be well established, thanks to the absence of any feature(s) in its available optical spectra. This study forms a part of our ongoing campaign of intranight optical monitoring of radio-quiet WLQs, in order to improve the understanding of this enigmatic class of active galactic nuclei and to look among them for a possible tiny, elusive population of radio-quiet BL Lacs.

Somatostatin receptor 2 knockout/lacZ knockin mice show impaired motor coordination and reveal sites of somatostatin action within the striatum.

PubMed

Allen, Jeremy P; Hathway, Gareth J; Clarke, Neil J; Jowett, Mike I; Topps, Stephanie; Kendrick, Keith M; Humphrey, Patrick P A; Wilkinson, Lawrence S; Emson, Piers C

2003-05-01

The peptide somatostatin can modulate the functional output of the basal ganglia. The exact sites and mechanisms of this action, however, are poorly understood, and the physiological context in which somatostatin acts is unknown. Somatostatin acts as a neuromodulator via a family of five 7-transmembrane G protein-coupled receptors, SSTR1-5, one of which, SSTR2, is known to be functional in the striatum. We have investigated the role of SSTR2 in basal ganglia function using mice in which Sstr2 has been inactivated and replaced by the lacZ reporter gene. Analysis of Sstr2lacZ expression in the brain by beta-galactosidase histochemistry demonstrated a widespread pattern of expression. By comparison to previously published in situ hybridization and immunohistochemical data, Sstr2lacZ expression was shown to accurately recapitulate that of Sstr2 and thus provided a highly sensitive model to investigate cell-type-specific expression of Sstr2. In the striatum, Sstr2 expression was identified in medium spiny projection neurons restricted to the matrix compartment and in cholinergic interneurons. Sstr2 expression was not detected in any other nuclei of the basal ganglia except for a sparse number of nondopaminergic neurons in the substantia nigra. Microdialysis in the striatum showed Sstr2-null mice were selectively refractory to somatostatin-induced dopamine and glutamate release. In behavioural tests, Sstr2-null mice showed normal levels of locomotor activity and normal coordination in undemanding tasks. However, in beam-walking, a test of fine motor control, Sstr2-null mice were severely impaired. Together these data implicate an important neuromodulatory role for SSTR2 in the striatum.

Sequencing Operations: The Critical Path of Operational Art,

DTIC Science & Technology

1987-05-01

while at the same time covering the withdrawal of the Army Group A forces from the Caucasus.55 In effect , Manstein had to balance the desired...the utility of the operational pause is as a method for balancing ends and means in a controlled relationship to one’s culminating point.79 This again... effects and ordering them in time and space to produce conditions that contribute to Operational success. This study approaches this investigation from

Spectroscopy of 10 γ -Ray BL Lac Objects at High Redshift

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paiano, Simona; Falomo, Renato; Landoni, Marco

2017-08-01

We present optical spectra with high signal-to-noise ratio of 10 BL Lac objects detected at GeV energies by the Fermi satellite (3FGL catalog), which previous observations suggested are at relatively high redshift. The new observations, obtained at the 10 m Gran Telescopio Canarias, allowed us to find the redshift for J0814.5+2943 ( z = 0.703), and we can set a spectroscopic lower limit for J0008.0+4713 ( z > 1.659) and J1107.7+0222 ( z > 1.0735) on the basis of Mg ii intervening absorption features. In addition we confirm the redshifts for J0505.5+0416 ( z = 0.423) and J1450+5200 ( zmore » > 2.470). Finally we contradict the previous z estimates for five objects (J0049.7+0237, J0243.5+7119, J0802.0+1005, J1109.4+2411, and J2116.1+3339).« less

Evaluation of critical indicators in the process of acquiring supplies and services LAC-UFPE

NASA Astrophysics Data System (ADS)

Caetano, V. F.; Ferreira, C. V.; dos Santos, M. J.; Honorato, F. A.

2015-01-01

In laboratories linked to public universities and accredited by the NBR ISO/IEC 17025, to meet efficiently item 4.6 (procurement of supplies and services) is a challenge that can be accomplished by programming based on historical purchases and services. In this study, we evaluated the critical procurement items to meet the quality management system of the LAC-UFPE: reagents, certified reference material, of equipment parts, maintenance and calibration of equipment and instruments. It was found that the most critical item is the certified reference material, the purchase or repair of which must be expedited within 125 days prior to the receipt to occur within the desired period.

Environmental assessment for the proposed construction and operation of a Genome Sequencing Facility in Building 64 at Lawrence Berkeley Laboratory, Berkeley, California

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1995-04-01

This document is an Environmental Assessment (EA) for a proposed project to modify 14,900 square feet of an existing building (Building 64) at Lawrence Berkeley Laboratory (LBL) to operate as a Genome Sequencing Facility. This EA addresses the potential environmental impacts from the proposed modifications to Building 64 and operation of the Genome Sequencing Facility. The proposed action is to modify Building 64 to provide space and equipment allowing LBL to demonstrate that the Directed DNA Sequencing Strategy can be scaled up from the current level of 750,000 base pairs per year to a facility that produces over 6,000,000 basemore » pairs per year, while still retaining its efficiency.« less

Stress levels for well-fitting implant superstructures as a function of tightening force levels, tightening sequence, and different operators.

PubMed

Nissan, J; Gross, M; Shifman, A; Assif, D

2001-07-01

Unfavorable stress distribution and occlusal overload have been reported to result in failures ranging from screw loosening to loss of osseointegration. The purpose of this study was to assess the effect of different tightening forces and sequences, with different operators, on stresses generated on an accurately fitting implant superstructure on multiple working casts made with a splinted impression technique. The effects of different tightening forces (10 and 20 Ncm) were assessed with the use of 30 stone casts made from a metal master model with a splinted impression technique. Stresses generated were recorded by 4 strain gauges attached to the superior surface of the master framework. A multiple analysis of variance with repeated measures was performed to test for significant differences among the groups. Tightening force values at 10 Ncm ranged from 150.43 to 256 Ncm. At 20 Ncm, microstrain values ranged from 149.43 to 284.37 Ncm. Microstrain values related to the sequence of tightening ranged from 150.8 to 308.43 Ncm (left to right) and 154.63 to 274.80 Ncm (right to left). For the different operators, microstrain values ranged from 100.13 to 206.07 Ncm. No statistically significant differences among the variables of tightening force, tightening sequence, and operators were found ( P >.05). The interaction between groups and strain gauges was also found to be nonsignificant (P >.05). The potential of variable tightening force and tightening sequence to generate unfavorable preload stresses can be minimized through use of the splinted impression technique, which ensures an accurately fitting superstructure.

Automatic Command Sequence Generation

NASA Technical Reports Server (NTRS)

Fisher, Forest; Gladded, Roy; Khanampompan, Teerapat

2007-01-01

Automatic Sequence Generator (Autogen) Version 3.0 software automatically generates command sequences for the Mars Reconnaissance Orbiter (MRO) and several other JPL spacecraft operated by the multi-mission support team. Autogen uses standard JPL sequencing tools like APGEN, ASP, SEQGEN, and the DOM database to automate the generation of uplink command products, Spacecraft Command Message Format (SCMF) files, and the corresponding ground command products, DSN Keywords Files (DKF). Autogen supports all the major multi-mission mission phases including the cruise, aerobraking, mapping/science, and relay mission phases. Autogen is a Perl script, which functions within the mission operations UNIX environment. It consists of two parts: a set of model files and the autogen Perl script. Autogen encodes the behaviors of the system into a model and encodes algorithms for context sensitive customizations of the modeled behaviors. The model includes knowledge of different mission phases and how the resultant command products must differ for these phases. The executable software portion of Autogen, automates the setup and use of APGEN for constructing a spacecraft activity sequence file (SASF). The setup includes file retrieval through the DOM (Distributed Object Manager), an object database used to store project files. This step retrieves all the needed input files for generating the command products. Depending on the mission phase, Autogen also uses the ASP (Automated Sequence Processor) and SEQGEN to generate the command product sent to the spacecraft. Autogen also provides the means for customizing sequences through the use of configuration files. By automating the majority of the sequencing generation process, Autogen eliminates many sequence generation errors commonly introduced by manually constructing spacecraft command sequences. Through the layering of commands into the sequence by a series of scheduling algorithms, users are able to rapidly and reliably construct the

Optical and X-ray observations of the two BL Lac objects OJ 287 and MS 1458+22

NASA Astrophysics Data System (ADS)

Massaro, E.; Giommi, P.; Perri, M.; Tagliaferri, G.; Nesci, R.; Tosti, G.; Ciprini, S.; Montagni, F.; Ravasio, M.; Ghisellini, G.; Frasca, A.; Marilli, E.; Valentini, G.; Kurtanidze, O. M.; Nikolashvili, M. G.

2003-02-01

We present the results of recent BeppoSAX observations of the two BL Lac objects OJ 287 and MS 1458+22 in bright optical states and of simultaneous photometric measurements in the bandpasses from I to U. OJ 287 was observed in November 2001 and MS 1458+22 in February of the same year. The X-ray flux of OJ 287 was rather low, F(2-10 keV) = (1.35+/-0.15)x 10-12 erg cm-2 s-1 and its spectrum is well described by a single power law with an energy index 0.45+/-0.08, flatter than that measured in the optical, equal to 1.53+/-0.03. The X-ray emission of MS 1458+22 was characterized by a low flux level of F(2-10 keV) = (7.5+/-0.6)x 10-13 erg cm-2 s-1, with a steeper spectral index of 1.71+/-0.15, while in the optical it was 0.99+/-0.06. We show that the broad-band SEDs of these two sources can be well represented by log-parabolic spectral laws and evaluate their parameters. This law, already observed for the synchrotron components of other BL Lac sources, can be explained if the emitting particles are accelerated by some statistical mechanism having a probability of energy gain that is a decreasing function of the energy itself.

Contemporaneous broadband observations of three high-redshift BL Lac objects

DOE PAGES

Ackerman, M.

2016-03-20

We have collected broadband spectral energy distributions (SEDs) of three BL Lac objects, 3FGL J0022.1-1855 (z=0.689), 3FGL J0630.9-2406 (z > ~1.239), and 3FGL J0811.2-7529 (z=0.774), detected by Fermi with relatively flat GeV spectra. By observing simultaneously in the near-IR to hard X-ray band, we can well characterize the high end of the synchrotron component of the SED. Thus, fitting the SEDs to synchro-Compton models of the dominant emission from the relativistic jet, we can constrain the underlying particle properties and predict the shape of the GeV Compton component. Standard extragalactic background light (EBL) models explain the high-energy absorption well, withmore » poorer fits for high UV models. The fits show clear evidence for EBL absorption in the Fermi spectrum of our highest redshift source 3FGL J0630.9-2406. While synchrotron self-Compton models adequately describe the SEDs, the situation may be complicated by possible external Compton components.« less

Prediction of glycolipid-binding domains from the amino acid sequence of lipid raft-associated proteins: application to HpaA, a protein involved in the adhesion of Helicobacter pylori to gastrointestinal cells.

PubMed

Fantini, Jacques; Garmy, Nicolas; Yahi, Nouara

2006-09-12

Protein-glycolipid interactions mediate the attachment of various pathogens to the host cell surface as well as the association of numerous cellular proteins with lipid rafts. Thus, it is of primary importance to identify the protein domains involved in glycolipid recognition. Using structure similarity searches, we could identify a common glycolipid-binding domain in the three-dimensional structure of several proteins known to interact with lipid rafts. Yet the three-dimensional structure of most raft-targeted proteins is still unknown. In the present study, we have identified a glycolipid-binding domain in the amino acid sequence of a bacterial adhesin (Helicobacter pylori adhesin A, HpaA). The prediction was based on the major properties of the glycolipid-binding domains previously characterized by structural searches. A short (15-mer) synthetic peptide corresponding to this putative glycolipid-binding domain was synthesized, and we studied its interaction with glycolipid monolayers at the air-water interface. The synthetic HpaA peptide recognized LacCer but not Gb3. This glycolipid specificity was in line with that of the whole bacterium. Molecular modeling studies gave some insights into this high selectivity of interaction. It also suggested that Phe147 in HpaA played a key role in LacCer recognition, through sugar-aromatic CH-pi stacking interactions with the hydrophobic side of the galactose ring of LacCer. Correspondingly, the replacement of Phe147 with Ala strongly affected LacCer recognition, whereas substitution with Trp did not. Our method could be used to identify glycolipid-binding domains in microbial and cellular proteins interacting with lipid shells, rafts, and other specialized membrane microdomains.

The Gamma-Ray Bright BL Lac Object RX J1211+2242

NASA Technical Reports Server (NTRS)

Beckmann, V.; Favre, P.; Tavecchio, F.; Bussien, T.; Fliri, J.; Wolter, A.

2004-01-01

RX J1211+2242 is an optically faint (B approximately equal to 19.2mag) but X-ray bright (f2-10kev = 5 x l0(exp -12)erg per square centimeter per second) AGN, which has been shown to be a BL Lac object at redshift z = 0.455. The ROSAT X-ray, Calar Alto optical, and NVSS radio data suggest that the peak of the synchrotron emission of this object is at energies as high as several keV. BeppoSAX observations have been carried out simultaneously with optical observations in order to extend the coverage to higher energies. The new data indeed indicate a turn-over in the 2 - 10keV energy region. We propose that RX J1211+2242 is the counterpart of the unidentified EGRET source 3EG J1212+2304, making it a gamma-ray emitter with properties similar to, for example, Markarian 501 in its bright state, though being at a much larger distance.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

PubMed

Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

1996-07-01

A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene.

Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

PubMed Central

Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

1996-01-01

A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene. PMID:8763940

A KPC-Scale X-Ray Jet in the BL Lac Source S5 2007+777

NASA Technical Reports Server (NTRS)

Sambruna, Rita M.; Donato, Davide; Cheung, C.C.; Tavecchio, F.; Maraschi, L.

2008-01-01

X-ray jets in AGN are commonly observed in FRII and FRI radiogalaxies, but rarely in BL Lacs, most probably due to their orientation close to the line of sight and the ensuing foreshortening effects. Only three BL Lacs are known so far to contain a kpc-scale X-ray jet. In this paper, we present the evidence for the existence of a fourth extended X-ray jet in the classical radio-selected source S5 2007+777, which for its hybrid FRI/II radio morphology has been classified as a HYMOR (HYbrid MOrphology Radio source). Our Chandra ACISS observations of this source revealed an X-ray counterpart to the 19"-long radio jet. Interestingly, the X-ray properties of the kpc-scale jet in S5 2007+777 are very similar to those observed in FRII jets. First, the X-ray morphology closely mirrors the radio one, with the X-rays being concentrated in the discrete radio knots. Second, the X-ray continuum of the jet/brightest knot is described by a very hard power law, with photon index gamma(sub x) approximately 1. Third, the optical upper limit from archival HST data implies a concave radio-to-X-ray SED. If the X-ray emission is attributed to IC/CMB with equipartition, strong beaming (delta= 13) is required, implying a very large scale (Mpc) jet. The beaming requirement can be somewhat relaxed assuming a magnetic field lower than equipartition. Alternatively, synchrotron emission from a second population of very high-energy electrons is viable. Comparison to other HYMOR jets detected with Chandra is discussed, as well as general implications for the origin of the FRI/II division.

Rapid, synchronous, and stable induction of type 1 piliation in Escherichia coli by using a chromosomal lacUV5 promoter.

PubMed Central

Woodall, L D; Russell, P W; Harris, S L; Orndorff, P E

1993-01-01

Type 1 pili are filamentous proteinaceous appendages produced by certain members of the family Enterobacteriaceae. In Escherichia coli, the adhesive properties of these pili are due to the binding of at least one minor pilus component to mannose, a sugar common to cell surface molecules of many eukaryotic cells. The study of pilus assembly may be benefited by a rapid way of inducing pilus synthesis de novo. We describe herein the construction and characterization of a strain in which piliation can be rapidly induced by the addition of lactose or its analog isopropyl-beta-D-thiogalactopyranoside. This was accomplished by placing the chromosomal fimA gene (encoding the major structural subunit of pili) under lacUV5 promoter control. Further experiments suggested that transcription of genes downstream of fimA, whose products are required for normal pilus assembly and function, may also be controlled by the lacUV5 promoter. The construction described herein may have a variety of applications apart from aiding the study of pilus assembly since its adhesive properties can be rapidly and easily turned on and off. Images PMID:8097517

A 400-year phytolith-based reconstruction of wild rice (Zizania palustris) abundance from Mud Lake core sediments, Fond du Lac Band of Lake Superior Chippewa Reservation, Minnesota, USA.

NASA Astrophysics Data System (ADS)

Munoz, R.; Caylor, E.; Yost, C. L.; Drake, C.; Ladwig, J. L.; Myrbo, A.; Howes, T.

2014-12-01

Wild rice (Zizania palustris L.) is an aquatic grass with spiritual and subsistence significance to Native people of the Great Lakes region of North America. Mud Lake (Mashkiigwaagamaag), located on the Fond du Lac Band of Lake Superior Chippewa Reservation in Carlton County, Minnesota, USA, once supported an extensive population of wild rice (manoomin). However, early 20th century attempts to ditch and drain surrounding wetlands for landuse intensification severely altered the natural hydrological system that supports wild rice. Fond du Lac Resource Management (FDLRM) technicians are currently working to increase the wild rice population in Mud Lake. As part of these efforts, this phytolith study was undertaken to better understand how wild rice abundance has fluctuated over the past 400 years, with particular emphasis on the 19th and 20th centuries. Phytoliths are microscopic opal silica plant remains that are incorporated into soils and lake sediments after the plant-parts that contain them decay. Wild rice produces phytolith morphotypes that are unequivocally diagnostic. Mud Lake core MNMN-MUD11-1C-1P-1 (46°43'38.39"N, 92°42'2.45"W) was piston cored by LacCore (National Lacustrine Core Facility) and FDLRM technicians on 24 May 2011. Initial core descriptions, multi-sensor core logging, phytolith sampling and phytolith extractions were completed during the summer of 2014 at LacCore. Wild rice phytolith identification and quantification was conducted on twelve samples using brightfield microscopy at 400x magnification. Wild rice phytolith concentration values ranged from 68 to 2,300 phytoliths/cm3. Wild rice accumulation rates ranged from 9 to 383 phytoliths/ cm2/yr, peaking in 1952 AD. Wild rice abundance in Mud Lake appears to be influenced by a complex set of variables that include anthropogenic disturbance, climatic events and aquatic plant community succession.

Microbial β-Galactosidase of Pediococcus pentosaceus ID-7: Isolation, Cloning, and Molecular Characterization.

PubMed

Lee, Ji-Yeong; Kwak, Mi-Sun; Roh, Jong-Bok; Kim, Kwang; Sung, Moon-Hee

2017-03-28

Pediococcus pentosaceus ID-7 was isolated from kimchi, a Korean fermented food, and it showed high activity for lactose hydrolysis. The β-galactosidase of P. pentosaceus ID-7 belongs to the GH2 group, which is composed of two distinct proteins. The heterodimeric LacLM type of β-galactosidase found in P. pentosaceus ID-7 consists of two genes partially overlapped, lacL and lacM encoding LacL (72.2 kDa) and LacM (35.4 kDa). In this study, Escherichia coli MM294 was used for the production of LacL, LacM, and LacLM. These three types of recombinant proteins were expressed, purified, and characterized. The specific activities of LacLM and LacL were 339 and 31 U/mg, respectively. However, activity was not detected with LacM alone. The optimal pH of LacLM and LacL was pH 7.5 and pH 7.0, and the optimal temperature of LacLM and LacL was 40°C and 50°C, respectively. The optimal temperature changes indicate that LacLM is able to achieve higher activity at a relatively lower temperature. LacLM was strongly activated by Mg 2+ , Mn 2+ , and Zn 2+ , which was not true for LacL. Consistent with this, EDTA strongly inactivated LacLM and LacL, but the presence of reducing agents did not dramatically alter the activity. Taken together, multiple alignment of amino acid sequences and phylogenetic analysis results of LacL and LacM of P. pentosaceus ID-7 suggest the evolution of LacL into LacLM and that the use of divalent metal ions results in higher activity.

Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes

PubMed Central

Zhao, J.; Kwan, H. S.

1999-01-01

The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

Multimodal sequence learning.

PubMed

Kemény, Ferenc; Meier, Beat

2016-02-01

While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

Fermi LAT detection of a GeV flare from the high redshift BL Lac object PKS 2131-021

NASA Astrophysics Data System (ADS)

Ciprini, Stefano

2012-08-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2131-021 (also known as 2FGL J2133.8-0154, Nolan et al. 2012, ApJS, 199, 31, and 4C -02.81) placed at radio coordinates R.A.: 323.5429567 deg, Dec.: -1.8881217 deg (J2000, Johnston et al. 1995, AJ, 110, 880).

Update on Rover Sequencing and Visualization Program

NASA Technical Reports Server (NTRS)

Cooper, Brian; Hartman, Frank; Maxwell, Scott; Yen, Jeng; Wright, John; Balacuit, Carlos

2005-01-01

The Rover Sequencing and Visualization Program (RSVP) has been updated. RSVP was reported in Rover Sequencing and Visualization Program (NPO-30845), NASA Tech Briefs, Vol. 29, No. 4 (April 2005), page 38. To recapitulate: The Rover Sequencing and Visualization Program (RSVP) is the software tool to be used in the Mars Exploration Rover (MER) mission for planning rover operations and generating command sequences for accomplishing those operations. RSVP combines three-dimensional (3D) visualization for immersive exploration of the operations area, stereoscopic image display for high-resolution examination of the downlinked imagery, and a sophisticated command-sequence editing tool for analysis and completion of the sequences. RSVP is linked with actual flight code modules for operations rehearsal to provide feedback on the expected behavior of the rover prior to committing to a particular sequence. Playback tools allow for review of both rehearsed rover behavior and downlinked results of actual rover operations. These can be displayed simultaneously for comparison of rehearsed and actual activities for verification. The primary inputs to RSVP are downlink data products from the Operations Storage Server (OSS) and activity plans generated by the science team. The activity plans are high-level goals for the next day s activities. The downlink data products include imagery, terrain models, and telemetered engineering data on rover activities and state. The Rover Sequence Editor (RoSE) component of RSVP performs activity expansion to command sequences, command creation and editing with setting of command parameters, and viewing and management of rover resources. The HyperDrive component of RSVP performs 2D and 3D visualization of the rover s environment, graphical and animated review of rover predicted and telemetered state, and creation and editing of command sequences related to mobility and Instrument Deployment Device (robotic arm) operations. Additionally, RoSE and

5’-Terminal AUGs in Escherichia coli mRNAs with Shine-Dalgarno Sequences: Identification and Analysis of Their Roles in Non-Canonical Translation Initiation

PubMed Central

Beck, Heather J.; Fleming, Ian M. C.

2016-01-01

Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758

Multiple Ant Species Tending Lac Insect Kerria yunnanensis (Hemiptera: Kerriidae) Provide Asymmetric Protection against Parasitoids

PubMed Central

Li, Qiao; Hoffmann, Benjamin D.; Zhang, Wei

2014-01-01

This study investigated the effects of ant attendance on the parasitoid community and parasitism of lac insect Kerria yunnanensis aggregations in Yunnan province, China. We manipulated ant attendance to establish three treatments: (1) ant exclusion; (2) low ant attendance by several ant species; and (3) high ant attendance by Crematogaster macaoensis. Five parasitoid species were collected, with two species contributing 82.7 and 13.2% of total abundance respectively. Total parasitoid abundance was lowest in the February sample when K. yunnanensis was in its younger life stage, being significantly lower in the ant exclusion treatment. In April, all three treatments had significantly different parasitoid abundances, being highest in the ant exclusion treatment and the lowest in the high ant attendance treatment. When ants were present, there were strong negative relationships between total parasitoid abundance and ant abundance, with the relationships being dependent upon the ant species composition and abundance. The patterns of total parasitoid abundance were driven by the two most abundant parasitoid species. Parasitoid species richness did not differ among treatments or between sample times, however, multivariate analysis confirmed that overall parasitoid community structure differed significantly among treatments and between sample times, with the high ant attendance treatment differing most from the other two treatments. Interestingly the absence of ants did not result in increased parasitism from four of the five parasitoids. Ants in lac insect farming systems have a clear role for agricultural pest management. A full understanding of the asymmetric abilities of ants to influence parasitoid communities, and affect parasitism of hosts will require further experimental manipulation to assess the relative roles of 1) the abundance of each individual ant species on parasitoid access to hosts, 2) competition among parasitoids, and 3) the interaction between the

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Representation of the quantum Fourier transform on multilevel basic elements by a sequence of selective rotation operators

NASA Astrophysics Data System (ADS)

Ermilov, A. S.; Zobov, V. E.

2007-12-01

To experimentally realize quantum computations on d-level basic elements (qudits) at d > 2, it is necessary to develop schemes for the technical realization of elementary logical operators. We have found sequences of selective rotation operators that represent the operators of the quantum Fourier transform (Walsh-Hadamard matrices) for d = 3-10. For the prime numbers 3, 5, and 7, the well-known method of linear algebra is applied, whereas, for the factorable numbers 6, 9, and 10, the representation of virtual spins is used (which we previously applied for d = 4, 8). Selective rotations can be realized, for example, by means of pulses of an RF magnetic field for systems of quadrupole nuclei or laser pulses for atoms and ions in traps.

Reduce costs with multimission sequencing and a multimission operations system

NASA Technical Reports Server (NTRS)

Bliss, D. A.; Morales, L. C.

2003-01-01

The paper will then propose extending this multi-mission philosophy to skeleton timeline development, science sequencing, and spacecraft sequencing. Finally, the paper will investigate a multi-mission approach to MOS development.

Outreach, Diversity, and Education Supported by NSF Facilities LacCore and the Continental Scientific Drilling Coordination Office (CSDCO), University of Minnesota

NASA Astrophysics Data System (ADS)

Myrbo, A.

2015-12-01

Climatic and environmental change are a powerful hook to engage students and the public with geoscience. Recent lake sediments often feature visual and compositional evidence of anthropogenic changes, which can pique curiosity and serve as a gateway for interest in more remote past changes. Cores provide an integrative, place-based geoscience education/outreach platform: lake dynamics incorporate principles of chemistry, physics, and biology; lake basin formation and sedimentary signals trace back to numerous geoscience subdisciplines. Lakes reflect local changes, and so are inherently place-based and relevant to both rural and urban populations. The esthetics of lakes in the landscape and sediments under the microscope spark the artistic sensibilities of those who do not consider themselves scientists: lakes are readymade for STEAM education. LacCore has exploited the magic of lake sediment cores in its 15 years as an NSF Facility, and now expands to additional environments as the NSF Continental Scientific Drilling Coordination Office. Part of scaling up is the formalization of major support for the Broader Impacts (BI) activities of Facility users. LacCore/CSDCO now musters its collaborative experiences in site REUs and other undergrad research projects, in-depth training of students, teachers, and faculty, a long list of informal education experiences, and common-good software development, to provide assistance to researchers seeking meaningful broader impacts and educators seeking extra- or co-curricular field and laboratory research experiences for their students. Outreach, diversity, and education support includes dissemination of best practices, as well as coordination, administration, and basic capacity for such activities in collaboration with project PIs and students, through no-cost support, or collaborative proposals or supplements from NSF where necessary for project scale. Community-driven research and broadening participation are central to the

Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

USGS Publications Warehouse

Fallon, James D.; Yaeger, Christine S.

2009-01-01

Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1

Intensive Variables in Primary Kimberlite Magmas (Lac de Gras, N.W.T., Canada) and Application for Diamond Preservation

NASA Astrophysics Data System (ADS)

Fedortchouk, Y.; Canil, D.; Carlson, J. A.

2002-12-01

Crystallization temperatures (T) and oxygen fugacity (fO2) are not well constrained for kimberlites. Knowledge of these intensive variables of kimberlite melt is important for understanding the origin and evolution of kimberlites and prediction of diamond preservation in the magma. Difficulties in interpreting the equilibrium mineral assemblages in kimberlites and the high degree of secondary alteration usually complicate use of mineral geothermometers and oxygen barometers. Some of Lac de Gras (N.W.T., Canada) kimberlites are extremely fresh and provide opportunity to apply mineral thermobarometers. The presence of numerous chromite inclusions in the rims of olivine phenocrysts allows application of the olivine-spinel thermometer and oxygen barometer to constrain T and fO2 of the melt. We performed T and fO2 calculations on samples from three kimberlite pipes - the Leslie, Aaron and Grizzly. The T obtained from olivine - chromite pairs for crystallization of olivine phenocryst rims are 1050° to 1100°C +/- 50°C (calculated at 1 GPa). Few olivine - chromite pairs from Leslie and Grizzly record higher temperatures of 1250° - 1350°C. The cores of olivine phenocrysts usually lack chromite inclusions and their crystallization T and fO2 could not be estimated. The fO2 recorded by coexisting olivine and chromite are +0.3 to 1.0 +/- 0.4 log units more oxidized than the nickel-nickel oxide (NNO) buffer. The established fO2 of kimberlites would require fO2 in their mantle source to be higher than that of cratonic mantle and oceanic lithosphere producing MORB's but comparable to the source of subduction-related magmas. The T and fO2 for the Lac de Gras kimberlites constrain the path of any mantle material entrained in these magmas in fO2-T-P space and provide limits on diamond destructive processes. Diamonds are not stable in kimberlite magma and are oxidized to CO2 or converted into graphite. The former process is more favorable for their preservation. The results of

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

III digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest

New Light Curves and Analysis of the Overcontact Binaries PP Lac and DK Sge

NASA Astrophysics Data System (ADS)

Sanders, S. J.; Hargis, J. R.; Bradstreet, D. H.

2004-12-01

As a by-product of the ongoing work with the Catalog and AtLas of Eclipsing Binaries database (CALEB; Bradstreet et al. 2004), several hundred eclipsing binary systems have been identified that have either unpublished or poor quality light curves. We present new V & Rc light curves for the overcontact systems PP Lac and DK Sge, both chosen because their deep eclipses (peak-to-peak amplitudes of nearly 0.7 mag) help constrain the light curve modelling. Data were obtained using the 41-cm telescope at the Eastern University Observatory equipped with an SBIG ST-10XME CCD. PP Lac (P= 0.40116 d) is a W-type contact binary with only one previously published light curve (Dumont & Maraziti 1990), but the data are sparse and almost non-existent at primary eclipse. Modelling of these data gave varying results; the published mass ratios differ by nearly 0.3. Our data confirms the noted differing eclipse depths but we find the primary eclipse to be total. We present a new light curve solution using Binary Maker 3 (Bradstreet & Steelman 2002) and Wilson-Devinney, finding the mass ratio to be well-constrained by the duration of total eclipse. A period study will be presented using previously existing and newly derived times of minimum light. DK Sge (P=0.62182 d) appears to be an A-type contact binary with no published light curve. The eclipses are partial, with the primary eclipse being deeper by about 0.08 mag. The maxima show evidence of a slight asymmetry, although the light curve appears to be repeatable over the 1 month of observations. We present the first light curve solution using Binary Maker 3 and Wilson-Devinney, but have limited mass ratio constraints due to the absence of radial velocity data. A period study will be presented using previously existing and newly derived times of minimum light.

Fermi-LAT detection of a GeV flare from the BL Lac object 1ES 2322-409

NASA Astrophysics Data System (ADS)

Ciprini, Stefano

2013-10-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed an increasing gamma-ray flux from a source positionally consistent with the BL Lac object 1ES 2322-409 (also know as 2FGL J2324.7-4042, Nolan et al. 2012, ApJS, 199, 31, and as 1FHL J2324.6-4041, Ackermann et al., ApJS, submitted, arXiv:1306.6772), with 2MASS counterpart coordinates, (J2000.0), R.A.: 351.18612 deg, Dec: -40.68036 deg (Mao 2011, New Ast., 16, 503).

A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability.

PubMed

Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong

2011-02-01

Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.

Attachment to place in advanced age: A study of the LiLACS NZ cohort.

PubMed

Wiles, Janine L; Rolleston, Anna; Pillai, Avinesh; Broad, Joanna; Teh, Ruth; Gott, Merryn; Kerse, Ngaire

2017-07-01

An extensive body of research theorises that attachment to place is positively associated with health, particularly for older people. Building on this, we measure how indicators of attachment to place are associated with health for in people of advanced age in New Zealand. We use data from a cohort study (LiLACS NZ), which includes an indigenous Māori cohort aged 80-90 years and a non-Māori cohort aged 85 years from a mixed urban/rural region in New Zealand. Each cohort undertook a comprehensive interview and health assessment (n = 267 Māori and n = 404 non-Māori). Using multivariate regression analyses, we explore participants' feelings for and connectedness with their home, community and neighbourhood; nature and the outdoors; expectations about and enthusiasm for residential mobility; and how all these are associated with measures of health (e.g., SF-12 physical and mental health related quality of life) and functional status (e.g., NEADL). We demonstrate that people in advanced age hold strong feelings of attachment to place. We also establish some positive associations between attachment to place and health in advanced age, and show how these differ for the indigenous and non-indigenous cohorts. For older Māori there were strong associations between various health measures and the importance of nature and the outdoors, and connectedness to neighbourhood and community. For older non-Māori, there were strong associations between health and liking home and neighbourhood, and feeling connected to their community and neighbourhood. Place attachment, and particularly its relationship to health, operates in different ways for different groups. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sequence analysis of the phs operon in Salmonella typhimurium and the contribution of thiosulfate reduction to anaerobic energy metabolism.

PubMed Central

Heinzinger, N K; Fujimoto, S Y; Clark, M A; Moreno, M S; Barrett, E L

1995-01-01

The phs chromosomal locus of Salmonella typhimurium is essential for the dissimilatory anaerobic reduction of thiosulfate to hydrogen sulfide. Sequence analysis of the phs region revealed a functional operon with three open reading frames, designated phsA, phsB, and phsC, which encode peptides of 82.7, 21.3, and 28.5 kDa, respectively. The predicted products of phsA and phsB exhibited significant homology with the catalytic and electron transfer subunits of several other anaerobic molybdoprotein oxidoreductases, including Escherichia coli dimethyl sulfoxide reductase, nitrate reductase, and formate dehydrogenase. Simultaneous comparison of PhsA to seven homologous molybdoproteins revealed numerous similarities among all eight throughout the entire frame, hence, significant amino acid conservation among molybdoprotein oxidoreductases. Comparison of PhsB to six other homologous sequences revealed four highly conserved iron-sulfur clusters. The predicted phsC product was highly hydrophobic and similar in size to the hydrophobic subunits of the molybdoprotein oxidoreductases containing subunits homologous to phsA and phsB. Thus, phsABC appears to encode thiosulfate reductase. Single-copy phs-lac translational fusions required both anaerobiosis and thiosulfate for full expression, whereas multicopy phs-lac translational fusions responded to either thiosulfate or anaerobiosis, suggesting that oxygen and thiosulfate control of phs involves negative regulation. A possible role for thiosulfate reduction in anaerobic respiration was examined. Thiosulfate did not significantly augment the final densities of anaerobic cultures grown on any of the 18 carbon sources tested. on the other hand, washed stationary-phase cells depleted of ATP were shown to synthesize small amounts of ATP on the addition of the formate and thiosulfate, suggesting that the thiosulfate reduction plays a unique role in anaerobic energy conservation by S typhimurium. PMID:7751291

Pairwise Sequence Alignment Library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeff Daily, PNNL

2015-05-20

Vector extensions, such as SSE, have been part of the x86 CPU since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. The trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based on striped data layouts. Therefore, amore » novel SIMD implementation of a parallel scan-based sequence alignment algorithm that can better exploit wider SIMD units was implemented as part of the Parallel Sequence Alignment Library (parasail). Parasail features: Reference implementations of all known vectorized sequence alignment approaches. Implementations of Smith Waterman (SW), semi-global (SG), and Needleman Wunsch (NW) sequence alignment algorithms. Implementations across all modern CPU instruction sets including AVX2 and KNC. Language interfaces for C/C++ and Python.« less

Study of the lactic acid bacteria throughout the manufacture of dry-cured lacón (a Spanish traditional meat product). Effect of some additives.

PubMed

Lorenzo, José M; García Fontán, María C; Cachaldora, Aida; Franco, Inmaculada; Carballo, Javier

2010-04-01

Total aerobic mesophilic microflora (on SPC agar), lactic acid bacteria (on MRS agar) and lactobacilli (on Rogosa agar) were enumerated in samples from the surface and the interior of the pieces throughout the manufacture of six batches of lacón. Three of the batches were made without additives and three with additives (glucose (2 g/kg), sodium nitrite (E(250)) (125 mg/kg), sodium nitrate (E(251)) (175 mg/kg), sodium ascorbate (E(301)) (500 mg/kg), and sodium citrate (E(331)) (100 mg/kg)). The counts decreased throughout the manufacturing process, particularly after the salting stage. The use of additives did not affect the counts or the evolution of the microbial groups, except for the lactobacilli, which were present in higher numbers in the batches with additives. In four batches (two without and two with additives), from MRS agar and from Rogosa agar plates, 10 colonies were randomly taken from each sampling point of each batch (five from the surface sample and five from the interior sample) and from each culture medium; a total of 224 strains from MRS agar, and 176 strains from Rogosa agar that were identified by classical methods. The MRS agar displayed moderate selectivity for the isolation of lactic acid bacteria, and only 59% of the isolated strains belonged to this microbial group. Homofermentative and facultative heterofermentative lactobacilli (particularly Lactobacillus curvatus and Lactobacillus sakei) were the most abundant species isolated on this medium. The selectivity of the Rogosa agar for lactobacilli was extremely high. The species of lactobacilli isolated on this medium at different stages of manufacture of the four batches of lacón were consistent with those isolated from MRS agar. The use of additives in the lacón did not appreciably affect the kinds and proportions of species isolated on either MRS agar or Rogosa agar.

Burn care in Los Angeles, California: LAC+USC experience 1994-2004.

PubMed

Garner, Warren L; Reiss, Matthew

2005-01-01

The LAC+USC Burn Center has admitted 3118 patients for treatment in the last 10 years. A majority of patients were young adults (1868), with the second largest group being small children (543). The ethnicity of the patients reflects the diverse nature of the population of Los Angeles County. Forty-eight percent of injuries were less than 5% TBSA and approximately 2% were greater than 60% TBSA. Eighty-two percent were accidental injuries. Sixty percent of admitted patients underwent skin grafting. Mortality was negligible in the group with burns over less than 10% of their body and very high (15/19), 79% in the most severely burned group. Further, there was a high correlation between age and mortality. Complications during treatment included: deep venous thrombosis 1% per year; pulmonary emboli in 5 patients; endotracheal tube dislodgment early or self-extubation about 1 month (11.3 per year); 4.5 patients per year who developed acute renal failure; abdominal compartment syndrome developed in 4.7 patients each year; heterotopic ossification was seen in 4 patients (0.4%); 4 patients (0.4%) developed stage II-IV pressure sores; hypothermia was present in 0.8% of patients.

Influence of the salting time on volatile compounds during the manufacture of dry-cured pork shoulder "lacón".

PubMed

Purriños, Laura; Franco, Daniel; Carballo, Javier; Lorenzo, José M

2012-12-01

The effect of the length of salting time on volatile compounds throughout the manufacture of dry-cured "lacón" was studied using a purge-and-trap extraction and GC/MS analysis. For this study, six treatments of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). The total area of volatile compounds increased significantly (P<0.001) as the length of salting time increased. Significant differences were found for the total area of all aldehydes for each salting time at the end of process. Hexanal presented the most relative abundance, showing highest content in HS treatments while LS treatments showed the lowest one at the end of salting, post-salting and drying-ripening stage. The influence of salting time on the content of 3-Octen-2-one was significant on salting stage (P<0.001) and drying-ripening stage (P<0.01). The salting time affected (P<0.001) the relative abundance of esters at the end of salting and at the end of drying-ripening stage. The salting time affected significantly (P<0.001) on alcohols content at the end of drying-ripening process. However, no significant effect of salt level (P>0.05) was detected on total hydrocarbons and total furans at the end of process. Copyright © 2012 Elsevier Ltd. All rights reserved.

Plans of lightning and airglow measurements with LAC/Akatsuki

NASA Astrophysics Data System (ADS)

Takahashi, Yukihiro; Hoshino, Naoya; Sato, Mitsuteru; Yair, Yoav; Galand, Marina; Fukuhara, Tetsuya

Though there are extensive researches on the existence of lightning discharge in Venus over few decades, this issue is still under controversial. Recently it is reported that the magnetometer on board Venus Express detected whistler mode waves whose source could be lightning discharge occurring well below the spacecraft. However, it is too early to determine the origin of these waves. On the other hand, night airglow is expected to provide essential information on the atmospheric circulation in the upper atmosphere of Venus. But the number of consecutive images of airglow obtained by spacecraft is limited and even the variations of most enhanced location is still unknown. In order to identify the discharge phenomena in the atmosphere of Venus separating from noises and to know the daily variation of airglow distribution in night-side disk, we plan to observe the lightning and airglow optical emissions with high-speed and high-sensitivity optical detector with narrow-band filters on board Akatsuki. We are ready to launch the flight model of lightning and airglow detector, LAC (Lightning and Airglow Camera). Main difference from other previous equipments which have provided evidences of lightning existence in Venus is the high-speed sampling rate at 32 us interval for each pixel, enabling us to distinguish the optical lightning flash from other pulsing noises. In this presentation the observation strategies, including ground-based support with optical telescopes, are shown and discussed.

Desulfovibrio zosterae sp. nov., a new sulfate reducer isolated from surface-sterilized roots of the seagrass Zostera marina.

PubMed

Nielsen, J T; Liesack, W; Finster, K

1999-04-01

A sulfate-reducing bacterium, designated strain lacT, was isolated from surface-sterilized roots of the benthic macrophyte Zostera marina. Cells were motile by means of a single polar flagellum. Strain lacT utilized lactate, pyruvate, malate, ethanol, L-alanine, fumarate, choline and fructose with sulfate as electron acceptor. In addition, fumarate, pyruvate and fructose were also degraded without an external electron acceptor. Sulfate could be substituted with thiosulfate, sulfite and elemental sulfur. Optimal growth was observed between 32.5 and 34.5 degrees C, at an NaCl concentration of 0.2 M and in a pH range between 6.8 and 7.3. The G + C content of the DNA was 42.7 +/- 0.2 mol%. Desulfoviridin and catalase were present. Strain lacT contained c-type cytochromes. Comparative 16S rRNA gene sequence analysis and the fatty acid pattern grouped this isolate into the genus Desulfovibrio. However, strain lacT differs from all other described Desulfovibrio species on the bases of its 16S rRNA gene sequence, the G + C content, its cellular lipid pattern and the utilization pattern of substrates. These characteristics establish strain lacT (= DSM 11974T) as a novel species of the genus Desulfovibrio, for which the name Desulfovibrio zosterae sp. nov. is proposed.

Selection of a platinum-binding sequence in a loop of a four-helix bundle protein.

PubMed

Yagi, Sota; Akanuma, Satoshi; Kaji, Asumi; Niiro, Hiroya; Akiyama, Hayato; Uchida, Tatsuya; Yamagishi, Akihiko

2018-02-01

Protein-metal hybrids are functional materials with various industrial applications. For example, a redox enzyme immobilized on a platinum electrode is a key component of some biofuel cells and biosensors. To create these hybrid materials, protein molecules are bound to metal surfaces. Here, we report the selection of a novel platinum-binding sequence in a loop of a four-helix bundle protein, the Lac repressor four-helix protein (LARFH), an artificial protein in which four identical α-helices are connected via three identical loops. We created a genetic library in which the Ser-Gly-Gln-Gly-Gly-Ser sequence within the first inter-helical loop of LARFH was semi-randomly mutated. The library was then subjected to selection for platinum-binding affinity by using the T7 phage display method. The majority of the selected variants contained the Tyr-Lys-Arg-Gly-Tyr-Lys (YKRGYK) sequence in their randomized segment. We characterized the platinum-binding properties of mutant LARFH by using quartz crystal microbalance analysis. Mutant LARFH seemed to interact with platinum through its loop containing the YKRGYK sequence, as judged by the estimated exclusive area occupied by a single molecule. Furthermore, a 10-residue peptide containing the YKRGYK sequence bound to platinum with reasonably high affinity and basic side chains in the peptide were crucial in mediating this interaction. In conclusion, we have identified an amino acid sequence, YKRGYK, in the loop of a helix-loop-helix motif that shows high platinum-binding affinity. This sequence could be grafted into loops of other polypeptides as an approach to immobilize proteins on platinum electrodes for use as biosensors among other applications. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells

PubMed Central

Chaikind, Brian; Bessen, Jeffrey L.; Thompson, David B.; Hu, Johnny H.; Liu, David R.

2016-01-01

We describe the development of ‘recCas9’, an RNA-programmed small serine recombinase that functions in mammalian cells. We fused a catalytically inactive dCas9 to the catalytic domain of Gin recombinase using an optimized fusion architecture. The resulting recCas9 system recombines DNA sites containing a minimal recombinase core site flanked by guide RNA-specified sequences. We show that these recombinases can operate on DNA sites in mammalian cells identical to genomic loci naturally found in the human genome in a manner that is dependent on the guide RNA sequences. DNA sequencing reveals that recCas9 catalyzes guide RNA-dependent recombination in human cells with an efficiency as high as 32% on plasmid substrates. Finally, we demonstrate that recCas9 expressed in human cells can catalyze in situ deletion between two genomic sites. Because recCas9 directly catalyzes recombination, it generates virtually no detectable indels or other stochastic DNA modification products. This work represents a step toward programmable, scarless genome editing in unmodified cells that is independent of endogenous cellular machinery or cell state. Current and future generations of recCas9 may facilitate targeted agricultural breeding, or the study and treatment of human genetic diseases. PMID:27515511

Lanthanum-mediated dehydrogenation of butenes: Spectroscopy and formation of La(C4H6) isomers

NASA Astrophysics Data System (ADS)

Cao, Wenjin; Hewage, Dilrukshi; Yang, Dong-Sheng

2018-01-01

La atom reactions with 1-butene, 2-butene, and isobutene are carried out in a laser-vaporization molecular beam source. The three reactions yield the same La-hydrocarbon products from the dehydrogenation and carbon-carbon bond cleavage and coupling of the butenes. The dehydrogenated species La(C4H6) is the major product, which is characterized with mass-analyzed threshold ionization (MATI) spectroscopy and quantum chemical computations. The MATI spectrum of La(C4H6) produced from the La+1-butene reaction exhibits two band systems, whereas the MATI spectra produced from the La+2-butene and isobutene reactions display only a single band system. Each of these spectra shows a strong origin band and several vibrational progressions. The two band systems from the spectrum of the 1-butene reaction are assigned to the ionization of two isomers: La[C(CH2)3] (Iso A) and La(CH2CHCHCH2) (Iso B), and the single band system from the spectra of the 2-butene and isobutene reactions is attributed to Iso B and Iso A, respectively. The ground electronic states are 2A1 (C3v) for Iso A and 2A' (Cs) for Iso B. The ionization of the doublet state of each isomer removes a La 6s-based electron and leads to the 1A1 ion of Iso A and the 1A' ion of Iso B. The formation of both isomers consists of La addition to the C=C double bond, La insertion into two C(sp3)—H bonds, and H2 elimination. In addition to these steps, the formation of Iso A from the La+1-butene reaction may involve the isomerization of 1-butene to isobutene prior to the C—H bond activation, whereas the formation of Iso B from the La+trans-2-butene reaction may include the trans- to cis-butene isomerization after the C—H bond activation.

Automated Sequence Generation Process and Software

NASA Technical Reports Server (NTRS)

Gladden, Roy

2007-01-01

"Automated sequence generation" (autogen) signifies both a process and software used to automatically generate sequences of commands to operate various spacecraft. The autogen software comprises the autogen script plus the Activity Plan Generator (APGEN) program. APGEN can be used for planning missions and command sequences.

Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

PubMed

Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

1998-01-01

The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences.

PubMed

Links, Matthew G; Chaban, Bonnie; Hemmingsen, Sean M; Muirhead, Kevin; Hill, Janet E

2013-08-15

Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly.

Water in the Cratonic Mantle: Insights from FTIR Data on Lac De Gras Xenoliths (Slave Craton, Canada)

NASA Technical Reports Server (NTRS)

Peslier, Anne H.; Brandon, Alan D.; Schaffer, Lillian Aurora; O'Reilly, Suzanne Yvette; Griffin, William L.; Morris, Richard V.; Graff, Trevor G.; Agresti, David G.

2014-01-01

The mantle lithosphere beneath the cratonic part of continents is the deepest (> 200 km) and oldest (>2-3 Ga) on Earth, remaining a conundrum as to how these cratonic roots could have resisted delamination by asthenospheric convection over time. Water, or trace H incorporated in mineral defects, could be a key player in the evolution of continental lithosphere because it influences melting and rheology of the mantle. Mantle xenoliths from the Lac de Gras kimberlite in the Slave craton were analyzed by FTIR. The cratonic mantle beneath Lac de Gras is stratified with shallow (<145 km) oxidized ultradepleted peridotites and pyroxenites with evidence for carbonatitic metasomatism, underlain by reduced and less depleted peridotites metasomatized by kimberlite melts. Peridotites analyzed so far have H O contents in ppm weight of 7-100 in their olivines, 58 to 255 in their orthopyroxenes (opx), 11 to 84 in their garnet, and 139 in one clinopyroxene. A pyroxenite contains 58 ppm H2O in opx and 5 ppm H2O in its olivine and garnet. Olivine and garnet from the deep peridotites have a range of water contents extending to higher values than those from the shallow ones. The FTIR spectra of olivines from the shallow samples have more prominent Group II OH bands compared to the olivines from the deep samples, consistent with a more oxidized mantle environment. The range of olivine water content is similar to that observed in Kaapvaal craton peridotites at the same depths (129-184 km) but does not extend to as high values as those from Udachnaya (Siberian craton). The Slave, Kaapvaal and Siberian cratons will be compared in terms of water content distribution, controls and role in cratonic root longevity.

THE RHIC SEQUENCER.

DOE Office of Scientific and Technical Information (OSTI.GOV)

VAN ZEIJTS,J.; DOTTAVIO,T.; FRAK,B.

The Relativistic Heavy Ion Collider (RHIC) has a high level asynchronous time-line driven by a controlling program called the ''Sequencer''. Most high-level magnet and beam related issues are orchestrated by this system. The system also plays an important task in coordinated data acquisition and saving. We present the program, operator interface, operational impact and experience.

Real time simulation of computer-assisted sequencing of terminal area operations

NASA Technical Reports Server (NTRS)

Dear, R. G.

1981-01-01

A simulation was developed to investigate the utilization of computer assisted decision making for the task of sequencing and scheduling aircraft in a high density terminal area. The simulation incorporates a decision methodology termed Constrained Position Shifting. This methodology accounts for aircraft velocity profiles, routes, and weight classes in dynamically sequencing and scheduling arriving aircraft. A sample demonstration of Constrained Position Shifting is presented where six aircraft types (including both light and heavy aircraft) are sequenced to land at Denver's Stapleton International Airport. A graphical display is utilized and Constrained Position Shifting with a maximum shift of four positions (rearward or forward) is compared to first come, first serve with respect to arrival at the runway. The implementation of computer assisted sequencing and scheduling methodologies is investigated. A time based control concept will be required and design considerations for such a system are discussed.

The first catalog of active galactic nuclei detected by the FERMI large area telescope

DOE PAGES

Abdo, A. A.; Ackermann, M.; Ajello, M.; ...

2010-04-29

Here, we present the first catalog of active galactic nuclei (AGNs) detected by the Large Area Telescope (LAT), corresponding to 11 months of data collected in scientific operation mode. The First LAT AGN Catalog (1LAC) includes 671 γ-ray sources located at high Galactic latitudes (|b|>10°) that are detected with a test statistic greater than 25 and associated statistically with AGNs. Some LAT sources are associated with multiple AGNs, and consequently, the catalog includes 709 AGNs, comprising 300 BL Lacertae objects, 296 flat-spectrum radio quasars, 41 AGNs of other types, and 72 AGNs of unknown type. We also classify the blazarsmore » based on their spectral energy distributions as archival radio, optical, and X-ray data permit. In addition to the formal 1LAC sample, we provide AGN associations for 51 low-latitude LAT sources and AGN "affiliations" (unquantified counterpart candidates) for 104 high-latitude LAT sources without AGN associations. The overlap of the 1LAC with existing γ-ray AGN catalogs (LBAS, EGRET, AGILE, Swift, INTEGRAL, TeVCat) is briefly discussed. Various properties—such as γ-ray fluxes and photon power-law spectral indices, redshifts, γ-ray luminosities, variability, and archival radio luminosities—and their correlations are presented and discussed for the different blazar classes. Lastly, we compare the 1LAC results with predictions regarding the γ-ray AGN populations, and we comment on the power of the sample to address the question of the blazar sequence.« less

Surface radiant flux densities inferred from LAC and GAC AVHRR data

NASA Astrophysics Data System (ADS)

Berger, F.; Klaes, D.

To infer surface radiant flux densities from current (NOAA-AVHRR, ERS-1/2 ATSR) and future meteorological (Envisat AATSR, MSG, METOP) satellite data, the complex, modular analysis scheme SESAT (Strahlungs- und Energieflüsse aus Satellitendaten) could be developed (Berger, 2001). This scheme allows the determination of cloud types, optical and microphysical cloud properties as well as surface and TOA radiant flux densities. After testing of SESAT in Central Europe and the Baltic Sea catchment (more than 400scenes U including a detailed validation with various surface measurements) it could be applied to a large number of NOAA-16 AVHRR overpasses covering the globe.For the analysis, two different spatial resolutions U local area coverage (LAC) andwere considered. Therefore, all inferred results, like global area coverage (GAC) U cloud cover, cloud properties and radiant properties, could be intercompared. Specific emphasis could be made to the surface radiant flux densities (all radiative balance compoments), where results for different regions, like Southern America, Southern Africa, Northern America, Europe, and Indonesia, will be presented. Applying SESAT, energy flux densities, like latent and sensible heat flux densities could also be determined additionally. A statistical analysis of all results including a detailed discussion for the two spatial resolutions will close this study.

Discovery of Very High Energy Gamma-Ray Emission from BL Lac object H1722+119 by the MAGIC Telescopes

NASA Astrophysics Data System (ADS)

Cortina, Juan

2013-05-01

H1722+119 is a BL Lac object, that was listed as candidate TeV blazar in Costamante & Ghisellini (2002) based on its X-ray and radio properties. Its redshift is uncertain; Sbarufatti et al. 2006 give z>0.17. The source has been detected by Fermi-LAT, in the Second Fermi Catalog with F(>1 GeV) (3.7+-0.3)e-09 cm^-2 s^-1 and with spectral index 1.92+-0.06. H1722+119 was observed for five nights by the MAGIC telescopes starting May 17th 2013 and collecting 11 hours of good quality data.

The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

PubMed Central

Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

2008-01-01

Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are

SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly

PubMed Central

Wala, Jeremiah; Beroukhim, Rameen

2017-01-01

Abstract We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. Availability and Implementation: SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. Contact: jwala@broadinstitue.org; rameen@broadinstitute.org PMID:28011768

Real-Time DNA Sequencing in the Antarctic Dry Valleys Using the Oxford Nanopore Sequencer

PubMed Central

Johnson, Sarah S.; Zaikova, Elena; Goerlitz, David S.; Bai, Yu; Tighe, Scott W.

2017-01-01

The ability to sequence DNA outside of the laboratory setting has enabled novel research questions to be addressed in the field in diverse areas, ranging from environmental microbiology to viral epidemics. Here, we demonstrate the application of offline DNA sequencing of environmental samples using a hand-held nanopore sequencer in a remote field location: the McMurdo Dry Valleys, Antarctica. Sequencing was performed using a MK1B MinION sequencer from Oxford Nanopore Technologies (ONT; Oxford, United Kingdom) that was equipped with software to operate without internet connectivity. One-direction (1D) genomic libraries were prepared using portable field techniques on DNA isolated from desiccated microbial mats. By adequately insulating the sequencer and laptop, it was possible to run the sequencing protocol for up to 2½ h under arduous conditions. PMID:28337073

Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

PubMed

Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

1989-01-01

A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

Nutrient status of the lowbush blueberry, Lac-Saint-Jean area, Quebec, Canada. [Vaccinium angustifolium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouchard, A.R.; Gagnon, M.J.

1987-01-01

The lowbush blueberry (Vaccinium angustifolium Ait.) is an important commercial crop of the Lac-Saint-Jean area (Quebec, Canada). The major blueberry fields are located on sandy soils relatively poor in available mineral nutrients. The nutrients originate from a thin organic layer found on the top of these sandy soils. The leaf mineral contents (N, P, K, Mg, Ca, Mn, Fe, Cu, Zn and B) were measured in five blueberry fields during 1984 and 1985. Soil pH and soil available P, K, and Mg were also assessed. The results show that the leaf mineral contents are generally adequate. However, K and Znmore » might be occasionally deficient when compared to the actual established standards. The available Mg in soil was significantly correlated with the leaf Mg concentration. The data also suggest that the influence of the pH following the burn pruning seems to influence the nutrition of this species.« less

MSLICE Sequencing

NASA Technical Reports Server (NTRS)

Crockett, Thomas M.; Joswig, Joseph C.; Shams, Khawaja S.; Norris, Jeffrey S.; Morris, John R.

2011-01-01

MSLICE Sequencing is a graphical tool for writing sequences and integrating them into RML files, as well as for producing SCMF files for uplink. When operated in a testbed environment, it also supports uplinking these SCMF files to the testbed via Chill. This software features a free-form textural sequence editor featuring syntax coloring, automatic content assistance (including command and argument completion proposals), complete with types, value ranges, unites, and descriptions from the command dictionary that appear as they are typed. The sequence editor also has a "field mode" that allows tabbing between arguments and displays type/range/units/description for each argument as it is edited. Color-coded error and warning annotations on problematic tokens are included, as well as indications of problems that are not visible in the current scroll range. "Quick Fix" suggestions are made for resolving problems, and all the features afforded by modern source editors are also included such as copy/cut/paste, undo/redo, and a sophisticated find-and-replace system optionally using regular expressions. The software offers a full XML editor for RML files, which features syntax coloring, content assistance and problem annotations as above. There is a form-based, "detail view" that allows structured editing of command arguments and sequence parameters when preferred. The "project view" shows the user s "workspace" as a tree of "resources" (projects, folders, and files) that can subsequently be opened in editors by double-clicking. Files can be added, deleted, dragged-dropped/copied-pasted between folders or projects, and these operations are undoable and redoable. A "problems view" contains a tabular list of all problems in the current workspace. Double-clicking on any row in the table opens an editor for the appropriate sequence, scrolling to the specific line with the problem, and highlighting the problematic characters. From there, one can invoke "quick fix" as described

Plasticity of laccase generated by homeologous recombination in yeast.

PubMed

Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry

2009-10-01

Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.

Rapid Diagnostics of Onboard Sequences

NASA Technical Reports Server (NTRS)

Starbird, Thomas W.; Morris, John R.; Shams, Khawaja S.; Maimone, Mark W.

2012-01-01

Keeping track of sequences onboard a spacecraft is challenging. When reviewing Event Verification Records (EVRs) of sequence executions on the Mars Exploration Rover (MER), operators often found themselves wondering which version of a named sequence the EVR corresponded to. The lack of this information drastically impacts the operators diagnostic capabilities as well as their situational awareness with respect to the commands the spacecraft has executed, since the EVRs do not provide argument values or explanatory comments. Having this information immediately available can be instrumental in diagnosing critical events and can significantly enhance the overall safety of the spacecraft. This software provides auditing capability that can eliminate that uncertainty while diagnosing critical conditions. Furthermore, the Restful interface provides a simple way for sequencing tools to automatically retrieve binary compiled sequence SCMFs (Space Command Message Files) on demand. It also enables developers to change the underlying database, while maintaining the same interface to the existing applications. The logging capabilities are also beneficial to operators when they are trying to recall how they solved a similar problem many days ago: this software enables automatic recovery of SCMF and RML (Robot Markup Language) sequence files directly from the command EVRs, eliminating the need for people to find and validate the corresponding sequences. To address the lack of auditing capability for sequences onboard a spacecraft during earlier missions, extensive logging support was added on the Mars Science Laboratory (MSL) sequencing server. This server is responsible for generating all MSL binary SCMFs from RML input sequences. The sequencing server logs every SCMF it generates into a MySQL database, as well as the high-level RML file and dictionary name inputs used to create the SCMF. The SCMF is then indexed by a hash value that is automatically included in all command

The physical properties and orbital parameters of the triple system V402 Lac

NASA Astrophysics Data System (ADS)

Hoyman, B.; Kalomeni, B.; Yakut, K.

2018-04-01

We present first ground-based multi-colors photometric study of an eccentric, double-lined eclipsing binary system V402 Lac. Analyzing the data obtained in this study together with earlier studies in the literature we derived the orbital and physical parameters of this detached binary system of considerable interest. Derived physical parameters of the components are as follows; M1 = 2.95 ± 0.06M⊙ , M2 = 2.86 ± 0.06M⊙ , R1 = 2.61 ± 0.04R⊙ , R2 = 2.16 ± 0.03R⊙ , L1 = 98 ± 5L⊙ and L2 = 69 ± 3L⊙ . Using the newly obtained parameters the distance of the binary is determined to be 262 ± 33 pc. In addition, the system show apsidal motion whose period is determined to be 213 years. A possible third star (M3 sin i = 1.9M⊙) orbiting the binary system in an eccentric orbit (e = 0.23) with an orbital period of 20.5 years has been detected in this study with LTT.

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

Recognizing surgeon's actions during suture operations from video sequences

NASA Astrophysics Data System (ADS)

Li, Ye; Ohya, Jun; Chiba, Toshio; Xu, Rong; Yamashita, Hiromasa

2014-03-01

Because of the shortage of nurses in the world, the realization of a robotic nurse that can support surgeries autonomously is very important. More specifically, the robotic nurse should be able to autonomously recognize different situations of surgeries so that the robotic nurse can pass necessary surgical tools to the medical doctors in a timely manner. This paper proposes and explores methods that can classify suture and tying actions during suture operations from the video sequence that observes the surgery scene that includes the surgeon's hands. First, the proposed method uses skin pixel detection and foreground extraction to detect the hand area. Then, interest points are randomly chosen from the hand area so that their 3D SIFT descriptors are computed. A word vocabulary is built by applying hierarchical K-means to these descriptors, and the words' frequency histogram, which corresponds to the feature space, is computed. Finally, to classify the actions, either SVM (Support Vector Machine), Nearest Neighbor rule (NN) for the feature space or a method that combines "sliding window" with NN is performed. We collect 53 suture videos and 53 tying videos to build the training set and to test the proposed method experimentally. It turns out that the NN gives higher than 90% accuracies, which are better recognition than SVM. Negative actions, which are different from either suture or tying action, are recognized with quite good accuracies, while "Sliding window" did not show significant improvements for suture and tying and cannot recognize negative actions.

[Testicular testosterone production in male mice of inbred strains PT and CBA/Lac after a long-term period of stable social hierarchy].

PubMed

Osadchuk, L V; Gutorova, N V; Kleshchev, M A

2014-04-01

Social dominance can alter testicular testosterone production, although there is pronounced variability in the relationship between social status and pattern of the testosterone response. The study designed to investigate how a long-term period of stable social hierarchy effects on testicular testosterone production in male mice of inbred strains PT and CBA/Lac. Paired males of different genotypes were housed together for 32 days beginning 38 day of age. Dyadic interactions of males generated dominance-subordination relationships during the first day after a social group has been produced and the social rank of each opponent was assessed by asymmetry in agonistic behaviour. Serum level of testosterone and its testicular content were evaluated in male mice of both inbred strains at 70 day of age after pair housing. Control animals were age- and genotype-matched single males that were housed in conventional cages. After a long-term period of pair housing, the serum testosterone level and its testicular content in males of both PT and CBA/Lac strains were not significantly different from the control. There were no significant differences in androgenic parameters between social ranks in male mice of both strains. The results indicate that in laboratory mice the pattern of testicular testosterone response to social hierarchy determined by a social situation, for example, a stability of social interactions, when the importance of aggressive competition for rank is minimal.

Mantle transition zone input to kimberlite magmatism near a subduction zone: Origin of anomalous Nd-Hf isotope systematics at Lac de Gras, Canada

NASA Astrophysics Data System (ADS)

Tappe, Sebastian; Graham Pearson, D.; Kjarsgaard, Bruce A.; Nowell, Geoff; Dowall, David

2013-06-01

Late Cretaceous-Eocene kimberlites from the Lac de Gras area, central Slave craton, show the most extreme Nd-Hf isotope decoupling observed for kimberlites worldwide. They are characterized by a narrow range of moderately enriched Nd isotope compositions (ɛNd(i)=-0.4 to -3.5) that contrasts strongly with their moderately depleted to highly enriched ɛHf(i) values (+3.9 to -9.9). Although digestion of cratonic mantle material in proto-kimberlite melt can theoretically produce steep arrays in Nd-Hf isotope space, the amount of contaminant required to explain the Lac de Gras data is unrealistic. Instead, it is more plausible that mixing of compositionally discrete melt components within an isotopically variable source region is responsible for the steep Nd-Hf isotope array. As development of strongly negative ΔɛHf requires isotopic aging of a precursor material with Sm/Nd≫Lu/Hf for billion-year timescales, a number of models have been proposed where ancient MORB crust trapped in the mantle transition zone is the ultimate source of the extreme Hf isotope signature. However, we provide a conceptual modification and demonstrate that OIB-type domains within ancient subducted oceanic lithosphere can produce much stronger negative ΔɛHf during long-term isolation. Provided that these OIB-type domains have lower melting points compared with associated MORB crust, they are among the first material to melt within the transition zone during thermal perturbations. The resulting hydrous alkali silicate melts react strongly with depleted peridotite at the top of the transition zone and transfer negative ΔɛHf signatures to less dense materials, which can be more easily entrained within upward flowing mantle. Once these entrained refertilized domains rise above 300 km depth, they may become involved in CO2- and H2O-fluxed redox melting of upper mantle peridotite beneath a thick cratonic lid. We argue that incorporation of ancient transition zone material, which includes

Ultrasound-assisted synthesis of 2,4-thiazolidinedione and rhodanine derivatives catalyzed by task-specific ionic liquid: [TMG][Lac

PubMed Central

2013-01-01

Background Synthesized arylidene derivatives of rhodanine and 2,4-thiazolidiendione have potent pharmacological activities, and these are also key substrates for the preparation of clinically used antidiabetics. Findings Some 1,1,3,3-tetramethylguanidine-based task-specific ionic liquids (TSILs) 1a-1e were prepared and employed to the catalyzed solvent-free Knoevenagel condensation of 2,4-thiazolidinedione 3a and rhodanine 3b with a variety of aldehydes. Conclusions Best results were obtained with 1,1,3,3-tetramethylguanidine lactate ([TMG][Lac]) 1c. The TSIL used can be easily recovered and recycled, yielding products 4–5 in excellent yields under ultrasonic environment without the formation of any side products or toxic waste. PMID:23458122

Ultrasound-assisted synthesis of 2,4-thiazolidinedione and rhodanine derivatives catalyzed by task-specific ionic liquid: [TMG][Lac].

PubMed

Suresh; Sandhu, Jagir Singh

2013-03-03

Synthesized arylidene derivatives of rhodanine and 2,4-thiazolidiendione have potent pharmacological activities, and these are also key substrates for the preparation of clinically used antidiabetics. Some 1,1,3,3-tetramethylguanidine-based task-specific ionic liquids (TSILs) 1a-1e were prepared and employed to the catalyzed solvent-free Knoevenagel condensation of 2,4-thiazolidinedione 3a and rhodanine 3b with a variety of aldehydes. Best results were obtained with 1,1,3,3-tetramethylguanidine lactate ([TMG][Lac]) 1c. The TSIL used can be easily recovered and recycled, yielding products 4-5 in excellent yields under ultrasonic environment without the formation of any side products or toxic waste.

Manoomin: place-based research with Native American students on wild rice lakes on the Fond du Lac Band of Lake Superior Chippewa Reservation, northern Minnesota

NASA Astrophysics Data System (ADS)

Ito, E.; Myrbo, A.; Dalbotten, D. M.; Pellerin, H.; Greensky, L.; Howes, T.; Wold, A.; McEathron, M. A.; Shanker, V.

2010-12-01

The manoomin project is a collaboration between Fond du Lac Tribal and Community College (Cloquet, MN), the Reservation’s Resource Management Division, and the University of Minnesota funded by the NSF GEO-OEDG Program. It builds on a successful seven-year history of collaboration between these parties, including regular science camps (gidaakiimanaanimigawig, Our Earth Lodge) for students of a wide range of ages. We are working as a team with Native students to study the history of wild rice (manoomin; Zizania palustris), a culturally important resource, growing on Reservation lakes. The joint project takes two main approaches: study of sediment core samples collected from Reservation lakes; and the collection of traditional knowledge about wild rice from the Elders. Science campers collect lake cores during winter with the assistance of the U of MN’s LacCore (National Lacustrine Core Facility) and Resource Management and visit LacCore to log, split and describe cores soon thereafter. Academic mentors with a range of specialties (phytoliths, pollen, plant macrofossils, sedimentology, geochemistry, magnetics) spend 1-2 weeks during the summer with small groups of college-age (>18, many nontraditional) student interns working on a particular paleoenvironmental proxy from the sediment cores. Younger students (middle and high school) also work in small teams in half day units with the same mentors. All campers become comfortable in an academic setting, gain experience working in research labs learning and practicing techniques, and jointly interpret collective results. The continuation of the project over five years (2009-2014) will allow these students to develop relationships with scientists and to receive mentoring beyond the laboratory as they make transitions into 2- and 4-year colleges and into graduate school. Their research provides historical and environmental information that is relevant to their own land that will be used by Resource Management which is

SeqLib: a C ++ API for rapid BAM manipulation, sequence alignment and sequence assembly.

PubMed

Wala, Jeremiah; Beroukhim, Rameen

2017-03-01

We present SeqLib, a C ++ API and command line tool that provides a rapid and user-friendly interface to BAM/SAM/CRAM files, global sequence alignment operations and sequence assembly. Four C libraries perform core operations in SeqLib: HTSlib for BAM access, BWA-MEM and BLAT for sequence alignment and Fermi for error correction and sequence assembly. Benchmarking indicates that SeqLib has lower CPU and memory requirements than leading C ++ sequence analysis APIs. We demonstrate an example of how minimal SeqLib code can extract, error-correct and assemble reads from a CRAM file and then align with BWA-MEM. SeqLib also provides additional capabilities, including chromosome-aware interval queries and read plotting. Command line tools are available for performing integrated error correction, micro-assemblies and alignment. SeqLib is available on Linux and OSX for the C ++98 standard and later at github.com/walaj/SeqLib. SeqLib is released under the Apache2 license. Additional capabilities for BLAT alignment are available under the BLAT license. jwala@broadinstitue.org ; rameen@broadinstitute.org. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Sequence modelling and an extensible data model for genomic database

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Peter Wei-Der

1992-01-01

The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS's do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data modelmore » that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the Extensible Object Model'', to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.« less

Sequence modelling and an extensible data model for genomic database

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Peter Wei-Der

1992-01-01

The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS`s do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data modelmore » that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the ``Extensible Object Model``, to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.« less

Reduction of forecast uncertainty in the context of hydropower production: a case study for two catchment in Lac-St-Jean, Canada

NASA Astrophysics Data System (ADS)

Brisson, Cathy; Boucher, Marie-Amélie; Latraverse, Marco

2014-05-01

This research focuses on the improvement of streamflow forecasts for two subcatchments in the Lac-St-Jean area, a northern part of the province of Quebec in Canada. Those two subcatchments, named Manouane and Passes-Dangereuses, are part of a bigger system, which comprises many reservoirs and six hydropower plants. This system is managed by Rio Tinto Alcan, an aluminium producer who needs this energy for its processes. Optimal management of the hydropower plants highly depends on the reliability of the inflow forecasts to the reservoirs and also on the reliability of observed streamflow. The latter are not directly measured, but rather deduced from the computation of a water balance. This water balance includes streamflow computation based on rating curves for river sections and upstream reservoirs and a modelling process using CEQUEAU hydrological model (Morin et al., 1981). In addition, mostly during the winter, the model has to account for a transfer of water from Lac Manouane reservoir to Passes-Dangereuses through Bonnard channel. Winter flow though Bonnard channel is controlled by a spillway, and represented in CEQUEAU by a transfer function and a fixed time delay (2 days). However, it is suspected that the evacuation function, as it is currently computed, is inaccurate. The main objective of this work is to reduce predictive uncertainty for Lac Manouane and Passes-Dangereuses catchment, for the one-day ahead horizon. This objective is twofold. First, the uncertainty related to the parameterization of the hydrological model had never been evaluated. It was to be investigated whether it is better to spatialize the calibration of the hydrological model. In its actual form, the calibration of the hydrological model CEQUEAU (Morin et al., 1981) is based exclusively on the downstream outflow. There is, however, intermediate streamflow measurements data available for an intermediate location. Our study shows that calibrating the model using streamflows for both

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Robust temporal alignment of multimodal cardiac sequences

NASA Astrophysics Data System (ADS)

Perissinotto, Andrea; Queirós, Sandro; Morais, Pedro; Baptista, Maria J.; Monaghan, Mark; Rodrigues, Nuno F.; D'hooge, Jan; Vilaça, João. L.; Barbosa, Daniel

2015-03-01

Given the dynamic nature of cardiac function, correct temporal alignment of pre-operative models and intraoperative images is crucial for augmented reality in cardiac image-guided interventions. As such, the current study focuses on the development of an image-based strategy for temporal alignment of multimodal cardiac imaging sequences, such as cine Magnetic Resonance Imaging (MRI) or 3D Ultrasound (US). First, we derive a robust, modality-independent signal from the image sequences, estimated by computing the normalized cross-correlation between each frame in the temporal sequence and the end-diastolic frame. This signal is a resembler for the left-ventricle (LV) volume curve over time, whose variation indicates different temporal landmarks of the cardiac cycle. We then perform the temporal alignment of these surrogate signals derived from MRI and US sequences of the same patient through Dynamic Time Warping (DTW), allowing to synchronize both sequences. The proposed framework was evaluated in 98 patients, which have undergone both 3D+t MRI and US scans. The end-systolic frame could be accurately estimated as the minimum of the image-derived surrogate signal, presenting a relative error of 1.6 +/- 1.9% and 4.0 +/- 4.2% for the MRI and US sequences, respectively, thus supporting its association with key temporal instants of the cardiac cycle. The use of DTW reduces the desynchronization of the cardiac events in MRI and US sequences, allowing to temporally align multimodal cardiac imaging sequences. Overall, a generic, fast and accurate method for temporal synchronization of MRI and US sequences of the same patient was introduced. This approach could be straightforwardly used for the correct temporal alignment of pre-operative MRI information and intra-operative US images.

Project Report: Automatic Sequence Processor Software Analysis

NASA Technical Reports Server (NTRS)

Benjamin, Brandon

2011-01-01

The Mission Planning and Sequencing (MPS) element of Multi-Mission Ground System and Services (MGSS) provides space missions with multi-purpose software to plan spacecraft activities, sequence spacecraft commands, and then integrate these products and execute them on spacecraft. Jet Propulsion Laboratory (JPL) is currently is flying many missions. The processes for building, integrating, and testing the multi-mission uplink software need to be improved to meet the needs of the missions and the operations teams that command the spacecraft. The Multi-Mission Sequencing Team is responsible for collecting and processing the observations, experiments and engineering activities that are to be performed on a selected spacecraft. The collection of these activities is called a sequence and ultimately a sequence becomes a sequence of spacecraft commands. The operations teams check the sequence to make sure that no constraints are violated. The workflow process involves sending a program start command, which activates the Automatic Sequence Processor (ASP). The ASP is currently a file-based system that is comprised of scripts written in perl, c-shell and awk. Once this start process is complete, the system checks for errors and aborts if there are any; otherwise the system converts the commands to binary, and then sends the resultant information to be radiated to the spacecraft.

On the Redshift of TeV BL Lac Objects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paiano, Simona; Falomo, Renato; Landoni, Marco

2017-03-10

We report results of a spectroscopic campaign carried out at the 10 m Gran Telescopio Canarias for a sample of 22 BL Lac objects detected (or candidates) at TeV energies, aiming to determine or constrain their redshift. This is of fundamental importance for the interpretation of their emission models and for population studies and is also mandatory for studying the interaction of high-energy photons with the extragalactic background light using TeV sources. Optical spectra with high signal-to-noise ratios in the range 4250–10000 Å were obtained to search for faint emission or absorption lines from both the host galaxy and themore » nucleus. We determine a new redshift for PKS 1424+240 ( z = 0.604) and a tentative one for 1ES 0033+595 ( z = 0.467). We are able to set new spectroscopic redshift lower limits for three other sources on the basis of Mg ii and Ca ii intervening absorption features: BZB J1243+3627 ( z > 0.483), BZB J1540+8155 ( z > 0.672), and BZB 0J2323+4210 ( z > 0.267). We confirm previous redshift estimates for four blazars: S3 0218+357 ( z = 0.944), 1ES 1215+303 ( z = 0.129), W Comae ( z = 0.102), and MS 1221.8+2452 ( z = 0.218). For the remaining targets, in seven cases (S2 0109+22, 3C 66A, VER J0521+211, S4 0954+65, BZB J1120+4214, S3 1227+25, BZB J2323+4210), we do not validate the proposed redshift. Finally, for all sources of still-unknown redshift, we set a lower limit based on the minimum equivalent width of absorption features expected from the host galaxy.« less

Aerospace Ground Equipment for model 4080 sequence programmer. A standard computer terminal is adapted to provide convenient operator to device interface

NASA Technical Reports Server (NTRS)

Nissley, L. E.

1979-01-01

The Aerospace Ground Equipment (AGE) provides an interface between a human operator and a complete spaceborne sequence timing device with a memory storage program. The AGE provides a means for composing, editing, syntax checking, and storing timing device programs. The AGE is implemented with a standard Hewlett-Packard 2649A terminal system and a minimum of special hardware. The terminal's dual tape interface is used to store timing device programs and to read in special AGE operating system software. To compose a new program for the timing device the keyboard is used to fill in a form displayed on the screen.

Identification of a Dehydrogenase Required for Lactose Metabolism in Caulobacter crescentus▿ †‡

PubMed Central

Arellano, Benjamin H.; Ortiz, Janett D.; Manzano, Janet; Chen, Joseph C.

2010-01-01

Caulobacter crescentus, which thrives in freshwater environments with low nutrient levels, serves as a model system for studying bacterial cell cycle regulation and organelle development. We examined its ability to utilize lactose (i) to gain insight into the metabolic capacities of oligotrophic bacteria and (ii) to obtain an additional genetic tool for studying this model organism, aiming to eliminate the basal enzymatic activity that hydrolyzes the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal). Using a previously isolated transposon mutant, we identified a gene, lacA, that is required for growth on lactose as the sole carbon source and for turning colonies blue in the presence of X-gal. LacA, which contains a glucose-methanol-choline (GMC) oxidoreductase domain, has homology to the flavin subunit of Pectobacterium cypripedii's gluconate dehydrogenase. Sequence comparisons indicated that two genes near lacA, lacB and lacC, encode the other subunits of the membrane-bound dehydrogenase. In addition to lactose, all three lac genes are involved in the catabolism of three other β-galactosides (lactulose, lactitol, and methyl-β-d-galactoside) and two glucosides (salicin and trehalose). Dehydrogenase assays confirmed that the lac gene products oxidize lactose, salicin, and trehalose. This enzymatic activity is inducible, and increased lac expression in the presence of lactose and salicin likely contributes to the induction. Expression of lacA also depends on the presence of the lac genes, implying that the dehydrogenase participates in induction. The involvement of a dehydrogenase suggests that degradation of lactose and other sugars in C. crescentus may resemble a proposed pathway in Agrobacterium tumefaciens. PMID:20190087

Enhanced expression of cro-beta-galactosidase fusion proteins under the control of the PR promoter of bacteriophage lambda.

PubMed Central

Zabeau, M; Stanley, K K

1982-01-01

Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257

Enhanced learning of natural visual sequences in newborn chicks.

PubMed

Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W

2016-07-01

To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input.

Operation and model description of a sequencing batch reactor treating reject water for biological nitrogen removal via nitrite.

PubMed

Dosta, J; Galí, A; Benabdallah El-Hadj, T; Macé, S; Mata-Alvarez, J

2007-08-01

The aim of this study was the operation and model description of a sequencing batch reactor (SBR) for biological nitrogen removal (BNR) from a reject water (800-900 mg NH(4)(+)-NL(-1)) from a municipal wastewater treatment plant (WWTP). The SBR was operated with three cycles per day, temperature 30 degrees C, SRT 11 days and HRT 1 day. During the operational cycle, three alternating oxic/anoxic periods were performed to avoid alkalinity restrictions. Oxygen supply and working pH range were controlled to achieve the BNR via nitrite, which makes the process more economical. Under steady state conditions, a total nitrogen removal of 0.87 kg N (m(3)day)(-1) was reached. A four-step nitrogen removal model was developed to describe the process. This model enlarges the IWA activated sludge models for a more detailed description of the nitrogen elimination processes and their inhibitions. A closed intermittent-flow respirometer was set up for the estimation of the most relevant model parameters. Once calibrated, model predictions reproduced experimental data accurately.

Initiation of a lightning search using the lightning and airglow camera onboard the Venus orbiter Akatsuki

NASA Astrophysics Data System (ADS)

Takahashi, Yukihiro; Sato, Mitsuteru; Imai, Masataka; Lorenz, Ralph; Yair, Yoav; Aplin, Karen; Fischer, Georg; Nakamura, Masato; Ishii, Nobuaki; Abe, Takumi; Satoh, Takehiko; Imamura, Takeshi; Hirose, Chikako; Suzuki, Makoto; Hashimoto, George L.; Hirata, Naru; Yamazaki, Atsushi; Sato, Takao M.; Yamada, Manabu; Murakami, Shin-ya; Yamamoto, Yukio; Fukuhara, Tetsuya; Ogohara, Kazunori; Ando, Hiroki; Sugiyama, Ko-ichiro; Kashimura, Hiroki; Ohtsuki, Shoko

2018-05-01

The existence of lightning discharges in the Venus atmosphere has been controversial for more than 30 years, with many positive and negative reports published. The lightning and airglow camera (LAC) onboard the Venus orbiter, Akatsuki, was designed to observe the light curve of possible flashes at a sufficiently high sampling rate to discriminate lightning from other sources and can thereby perform a more definitive search for optical emissions. Akatsuki arrived at Venus during December 2016, 5 years following its launch. The initial operations of LAC through November 2016 have included a progressive increase in the high voltage applied to the avalanche photodiode detector. LAC began lightning survey observations in December 2016. It was confirmed that the operational high voltage was achieved and that the triggering system functions correctly. LAC lightning search observations are planned to continue for several years.

Design of Mariner 9 Science Sequences using Interactive Graphics Software

NASA Technical Reports Server (NTRS)

Freeman, J. E.; Sturms, F. M, Jr.; Webb, W. A.

1973-01-01

This paper discusses the analyst/computer system used to design the daily science sequences required to carry out the desired Mariner 9 science plan. The Mariner 9 computer environment, the development and capabilities of the science sequence design software, and the techniques followed in the daily mission operations are discussed. Included is a discussion of the overall mission operations organization and the individual components which played an essential role in the sequence design process. A summary of actual sequences processed, a discussion of problems encountered, and recommendations for future applications are given.

Contributions from associative and explicit sequence knowledge to the execution of discrete keying sequences.

PubMed

Verwey, Willem B

2015-05-01

Research has provided many indications that highly practiced 6-key sequences are carried out in a chunking mode in which key-specific stimuli past the first are largely ignored. When in such sequences a deviating stimulus occasionally occurs at an unpredictable location, participants fall back to responding to individual stimuli (Verwey & Abrahamse, 2012). The observation that in such a situation execution still benefits from prior practice has been attributed to the possibility to operate in an associative mode. To better understand the contribution to the execution of keying sequences of motor chunks, associative sequence knowledge and also of explicit sequence knowledge, the present study tested three alternative accounts for the earlier finding of an execution rate increase at the end of 6-key sequences performed in the associative mode. The results provide evidence that the earlier observed execution rate increase can be attributed to the use of explicit sequence knowledge. In the present experiment this benefit was limited to sequences that are executed at the moderately fast rates of the associative mode, and occurred at both the earlier and final elements of the sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

Time-resolved photometry of the nova remnants DM Gem, CP Lac, GI Mon, V400 Per, CT Ser and XX Tau

NASA Astrophysics Data System (ADS)

Rodríguez-Gil, P.; Torres, M. A. P.

2005-02-01

We present the first results of a photometric survey of poorly studied nova remnants in the Northern Hemisphere. The main results are as follows: DM Gem shows a modulation at 0.123 d (probably linked to the orbit) and rapid variations at ˜ 22 min. A moderate resolution spectrum taken at the time of the photometric observations shows intense He II 4686 and Bowen emission, characteristic of an intermediate polar or a SW Sex star. Variability at 0.127 d and intense flickering (or quasi-periodic oscillations) are the main features of the light curve of CP Lac. A 0.1-mag dip lasting for ˜ 45 min is observed in GI Mon, which could be an eclipse. A clear modulation (probably related to the orbital motion) either at 0.179 d or 0.152 d is observed in the B-band light curve of V400 Per. The results for CT Ser point to an orbital period close to 0.16 d. Intense flickering is also characteristic of this old nova. Finally, XX Tau shows a possible periodic signal near 0.14 d and displays fast variability at ˜ 24 min. Its brightness seems to be modulated at ˜ 5 d. We relate this long periodicity to the motion of an eccentric/tilted accretion disc in the binary. Based in part on observations made with the Jacobus Kapteyn Telescope, which was operated on the island of La Palma by the Isaac Newton Group in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofísica de Canarias (IAC), and on observations made with the IAC80 telescope, operated on the island of Tenerife by the IAC in the Spanish Observatorio del Teide of the IAC. Observations were also obtained at the FLWO Observatory, a facility of the Smithsonian Institution.

Draft genome sequence of chloride-tolerant Leptospirillum ferriphilum Sp-Cl from industrial bioleaching operations in northern Chile.

PubMed

Issotta, Francisco; Galleguillos, Pedro A; Moya-Beltrán, Ana; Davis-Belmar, Carol S; Rautenbach, George; Covarrubias, Paulo C; Acosta, Mauricio; Ossandon, Francisco J; Contador, Yasna; Holmes, David S; Marín-Eliantonio, Sabrina; Quatrini, Raquel; Demergasso, Cecilia

2016-01-01

Leptospirillum ferriphilum Sp-Cl is a Gram negative, thermotolerant, curved, rod-shaped bacterium, isolated from an industrial bioleaching operation in northern Chile, where chalcocite is the major copper mineral and copper hydroxychloride atacamite is present in variable proportions in the ore. This strain has unique features as compared to the other members of the species, namely resistance to elevated concentrations of chloride, sulfate and metals. Basic microbiological features and genomic properties of this biotechnologically relevant strain are described in this work. The 2,475,669 bp draft genome is arranged into 74 scaffolds of 74 contigs. A total of 48 RNA genes and 2,834 protein coding genes were predicted from its annotation; 55 % of these were assigned a putative function. Release of the genome sequence of this strain will provide further understanding of the mechanisms used by acidophilic bacteria to endure high osmotic stress and high chloride levels and of the role of chloride-tolerant iron-oxidizers in industrial bioleaching operations.

ERRATIC FLARING OF BL LAC IN 2012–2013: MULTIWAVELENGTH OBSERVATIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wehrle, Ann E.; Grupe, Dirk; Jorstad, Svetlana G.

2016-01-10

BL Lac, the eponymous blazar, flared to historically high levels at millimeter, infrared, X-ray, and gamma-ray wavelengths in 2012. We present observations made with Herschel, Swift, NuSTAR, Fermi, the Submillimeter Array, CARMA, and the VLBA in 2012–2013, including three months with nearly daily sampling at several wavebands. We have also conducted an intensive campaign of 30 hr with every-orbit observations by Swift and NuSTAR, accompanied by Herschel, and Fermi observations. The source was highly variable at all bands. Time lags, correlations between bands, and the changing shapes of the spectral energy distributions can be explained by synchrotron radiation and inversemore » Compton emission from nonthermal seed photons originating from within the jet. The passage of four new superluminal very long baseline interferometry knots through the core and two stationary knots about 4 pc downstream accompanied the high flaring in 2012–2013. The seed photons for inverse Compton scattering may arise from the stationary knots and from a Mach disk near the core where relatively slow-moving plasma generates intense nonthermal radiation. The 95 spectral energy distributions obtained on consecutive days form the most densely sampled, broad wavelength coverage for any blazar. The observed spectral energy distributions and multi-waveband light curves are similar to simulated spectral energy distributions and light curves generated with a model in which turbulent plasma crosses a conical shock with a Mach disk.« less

Unified Deep Learning Architecture for Modeling Biology Sequence.

PubMed

Wu, Hongjie; Cao, Chengyuan; Xia, Xiaoyan; Lu, Qiang

2017-10-09

Prediction of the spatial structure or function of biological macromolecules based on their sequence remains an important challenge in bioinformatics. When modeling biological sequences using traditional sequencing models, characteristics, such as long-range interactions between basic units, the complicated and variable output of labeled structures, and the variable length of biological sequences, usually lead to different solutions on a case-by-case basis. This study proposed the use of bidirectional recurrent neural networks based on long short-term memory or a gated recurrent unit to capture long-range interactions by designing the optional reshape operator to adapt to the diversity of the output labels and implementing a training algorithm to support the training of sequence models capable of processing variable-length sequences. Additionally, the merge and pooling operators enhanced the ability to capture short-range interactions between basic units of biological sequences. The proposed deep-learning model and its training algorithm might be capable of solving currently known biological sequence-modeling problems through the use of a unified framework. We validated our model on one of the most difficult biological sequence-modeling problems currently known, with our results indicating the ability of the model to obtain predictions of protein residue interactions that exceeded the accuracy of current popular approaches by 10% based on multiple benchmarks.

Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics.

PubMed

Khatri, Indu; Sharma, Shailza; Ramya, T N C; Subramanian, Srikrishna

2016-01-01

Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions.

Using Mach threads to control DSN operational sequences

NASA Technical Reports Server (NTRS)

Urista, Juan

1993-01-01

The Link Monitor and Control Operator Assistant prototype (LMCOA) is a state-of-the-art, semiautomated monitor and control system based on an object-oriented design. The purpose of the LMCOA prototyping effort is to both investigate new technology (such as artificial intelligence) to support automation and to evaluate advances in information systems toward developing systems that take advantage of the technology. The emergence of object-oriented design methodology has enabled a major change in how software is designed and developed. This paper describes how the object-oriented approach was used to design and implement the LMCOA and the results of operational testing. The LMCOA is implemented on a NeXT workstation using the Mach operating system and the Objective-C programming language.

Autonomously generating operations sequences for a Mars Rover using AI-based planning

NASA Technical Reports Server (NTRS)

Sherwood, Rob; Mishkin, Andrew; Estlin, Tara; Chien, Steve; Backes, Paul; Cooper, Brian; Maxwell, Scott; Rabideau, Gregg

2001-01-01

This paper discusses a proof-of-concept prototype for ground-based automatic generation of validated rover command sequences from highlevel science and engineering activities. This prototype is based on ASPEN, the Automated Scheduling and Planning Environment. This Artificial Intelligence (AI) based planning and scheduling system will automatically generate a command sequence that will execute within resource constraints and satisfy flight rules.

Kepler Observations of Rapid Optical Variability in the BL Lac Object W2r192+42

NASA Technical Reports Server (NTRS)

R.Edelson; Mushotzky, R.; Vaughn, S.; Scargle, J.; Gandhi, P.; Malkan, M.; Baumgartner, W.

2013-01-01

We present the first Kepler monitoring of a strongly variable BL Lac, W2R1926+42. The light curve covers 181 days with approx. 0.2% errors, 30 minute sampling and >90% duty cycle, showing numerous delta-I/I > 25% flares over timescales as short as a day. The flux distribution is highly skewed and non-Gaussian. The variability shows a strong rms-flux correlation with the clearest evidence to date for non-linearity in this relation. We introduce a method to measure periodograms from the discrete autocorrelation function, an approach that may be well-suited to a wide range of Kepler data. The periodogram is not consistent with a simple power-law, but shows a flattening at frequencies below 7x10(exp -5) Hz. Simple models of the power spectrum, such as a broken power law, do not produce acceptable fits, indicating that the Kepler blazar light curve requires more sophisticated mathematical and physical descriptions than currently in use.

Bio Computing and Information Systems: A Quest

DTIC Science & Technology

2003-06-01

on Security and Privacy, 1996 4) Dawkins , R. The Selfish Gene . Oxford University Press, 1989 5) Dumpert, K. The Social Biology of Ants...mechanisms of genetic control, which switch genes on and off. The archetypal example of genetic regulation in bacteria is the lac operon of E. coli...first studied in the 1950s by Jacques Monod and François Jacob. The lac operon is a set of genes and regulatory sequences involved in the metabolism of

The instant sequencing task: Toward constraint-checking a complex spacecraft command sequence interactively

NASA Technical Reports Server (NTRS)

Horvath, Joan C.; Alkalaj, Leon J.; Schneider, Karl M.; Amador, Arthur V.; Spitale, Joseph N.

1993-01-01

Robotic spacecraft are controlled by sets of commands called 'sequences.' These sequences must be checked against mission constraints. Making our existing constraint checking program faster would enable new capabilities in our uplink process. Therefore, we are rewriting this program to run on a parallel computer. To do so, we had to determine how to run constraint-checking algorithms in parallel and create a new method of specifying spacecraft models and constraints. This new specification gives us a means of representing flight systems and their predicted response to commands which could be used in a variety of applications throughout the command process, particularly during anomaly or high-activity operations. This commonality could reduce operations cost and risk for future complex missions. Lessons learned in applying some parts of this system to the TOPEX/Poseidon mission will be described.

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

PubMed Central

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with K m and k cat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics

PubMed Central

Ramya, T. N. C.; Subramanian, Srikrishna

2016-01-01

Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions. PMID:27258038

First NuSTAR observations of the BL Lac - type blazar PKS 2155-304: constraints on the jet content and distribution of radiating particles

NASA Astrophysics Data System (ADS)

Madejski, Grzegorz; Nalewajko, Krzysztof; Madsen, Kristin; Chiang, James; Balokovic, Mislav; Paneque, David; Furniss, Amy; NuSTAR Team

2017-01-01

Current scenarios for emission mechanisms operating in relativistic jets in AGN involve synchrotron emission for the radio through UV spectrum, and inverse Compton for hard X-rays through γ-rays, but the particle content of relativistic jets - whether they are dominated by proton-electron, or e +/e- plasma - has not been established. Our first hard X-ray observations with NuSTAR of the BL Lac type blazar PKS 2155-304, augmented by XMM-Newton data, reveal the 0.5-60 keV spectrum as best-described by a soft power law component dominating below 10 keV (photon index of 3 at 2 keV), and a hard power-law tail (index 2), dominating in the 20-60 keV range. The hard X-ray tail can be smoothly joined to the quasi-simultaneous Fermi/LAT γ-ray spectrum by a synchrotron self-Compton component produced by an electron distribution with index p =2.2. The jet content needs to (globally) obey charge neutrality; assuming that the power-law electron distribution extends down to the Lorentz factor of 1, and one proton per electron, yields an unrealistically high total jet power of 1047 erg/s. This can be reduced by two orders of magnitude by considering a significant presence of e +/e- pairs with lepton-to-proton ratio of at least 30.

Occupational Sequences: Auto Engines 1. AT 121.

ERIC Educational Resources Information Center

Korb, A. W.; And Others

In an attempt to individualize an automotive course, the Vocational-Technical Division of Northern Montana College has developed Occupational Sequences for an engine rebuilding course. Occupational Sequences, a learning or teaching aid, is an analysis of numbered operations involved in engine rebuilding. Job sheets, included in the book, provide a…

The Origin of Mutants Under Selection: How Natural Selection Mimics Mutagenesis (Adaptive Mutation)

PubMed Central

Maisnier-Patin, Sophie; Roth, John R.

2015-01-01

Selection detects mutants but does not cause mutations. Contrary to this dictum, Cairns and Foster plated a leaky lac mutant of Escherichia coli on lactose medium and saw revertant (Lac+) colonies accumulate with time above a nongrowing lawn. This result suggested that bacteria might mutagenize their own genome when growth is blocked. However, this conclusion is suspect in the light of recent evidence that revertant colonies are initiated by preexisting cells with multiple copies the conjugative F′lac plasmid, which carries the lac mutation. Some plated cells have multiple copies of the simple F′lac plasmid. This provides sufficient LacZ activity to support plasmid replication but not cell division. In nongrowing cells, repeated plasmid replication increases the likelihood of a reversion event. Reversion to lac+ triggers exponential cell growth leading to a stable Lac+ revertant colony. In 10% of these plated cells, the high-copy plasmid includes an internal tandem lac duplication, which provides even more LacZ activity—sufficient to support slow growth and formation of an unstable Lac+ colony. Cells with multiple copies of the F′lac plasmid have an increased mutation rate, because the plasmid encodes the error-prone (mutagenic) DNA polymerase, DinB. Without DinB, unstable and stable Lac+ revertant types form in equal numbers and both types arise with no mutagenesis. Amplification and selection are central to behavior of the Cairns–Foster system, whereas mutagenesis is a system-specific side effect or artifact caused by coamplification of dinB with lac. Study of this system has revealed several broadly applicable principles. In all populations, gene duplications are frequent stable genetic polymorphisms, common near-neutral mutant alleles can gain a positive phenotype when amplified under selection, and natural selection can operate without cell division when variability is generated by overreplication of local genome subregions. PMID:26134316

VERITAS Observations of the BL Lac Object PG 1553+113

NASA Astrophysics Data System (ADS)

Aliu, E.; Archer, A.; Aune, T.; Barnacka, A.; Behera, B.; Beilicke, M.; Benbow, W.; Berger, K.; Bird, R.; Buckley, J. H.; Bugaev, V.; Byrum, K.; Cardenzana, J. V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dickinson, H. J.; Dumm, J.; Eisch, J. D.; Errando, M.; Falcone, A.; Federici, S.; Feng, Q.; Finley, J. P.; Fortin, P.; Fortson, L.; Furniss, A.; Galante, N.; Gillanders, G. H.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Håkansson, N.; Hanna, D.; Holder, J.; Hughes, G.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krawczynski, H.; Krennrich, F.; Kumar, S.; Lang, M. J.; Madhavan, A.; McArthur, S.; McCann, A.; Meagher, K.; Millis, J.; Moriarty, P.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Orr, M.; Otte, A. N.; Park, N.; Perkins, J. S.; Pohl, M.; Popkow, A.; Prokoph, H.; Pueschel, E.; Quinn, J.; Ragan, K.; Rajotte, J.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Sembroski, G. H.; Shahinyan, K.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Varlotta, A.; Vassiliev, V. V.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.

2015-01-01

We present results from VERITAS observations of the BL Lac object PG 1553+113 spanning the years 2010, 2011, and 2012. The time-averaged spectrum, measured between 160 and 560 GeV, is well described by a power law with a spectral index of 4.33 ± 0.09. The time-averaged integral flux above 200 GeV measured for this period was (1.69 ± 0.06) × 10-11 photons cm-2 s-1, corresponding to 6.9% of the Crab Nebula flux. We also present the combined γ-ray spectrum from the Fermi Large Area Telescope and VERITAS covering an energy range from 100 MeV to 560 GeV. The data are well fit by a power law with an exponential cutoff at 101.9 ± 3.2 GeV. The origin of the cutoff could be intrinsic to PG 1553+113 or be due to the γ-ray opacity of our universe through pair production off the extragalactic background light (EBL). Given lower limits to the redshift of z > 0.395 based on optical/UV observations of PG 1553+113, the cutoff would be dominated by EBL absorption. Conversely, the small statistical uncertainties of the VERITAS energy spectrum have allowed us to provide a robust upper limit on the redshift of PG 1553+113 of z <= 0.62. A strongly elevated mean flux of (2.50 ± 0.14) × 10-11 photons cm-2 s-1 (10.3% of the Crab Nebula flux) was observed during 2012, with the daily flux reaching as high as (4.44 +/- 0.71) × 10-11 {photons} {cm}-2 {s}-1 (18.3% of the Crab Nebula flux) on MJD 56048. The light curve measured during the 2012 observing season is marginally inconsistent with a steady flux, giving a χ2 probability for a steady flux of 0.03%.

Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer.

PubMed

Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Baik, Seung Hyuk; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk

2014-01-01

Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes.

Combined inadequacies of multiple B vitamins amplify colonic Wnt signaling and promote intestinal tumorigenesis in BAT-LacZ×Apc1638N mice

PubMed Central

Liu, Zhenhua; Ciappio, Eric D.; Crott, Jimmy W.; Brooks, Ryan S.; Nesvet, Jared; Smith, Donald E.; Choi, Sang-Woon; Mason, Joel B.

2011-01-01

The Wnt pathway is a pivotal signaling cascade in colorectal carcinogenesis. The purpose of this work is to determine whether depletion of folate and other metabolically related B vitamins induces in vivo activation of intestinal Wnt signaling and whether this occurs in parallel with increased tumorigenesis. A hybrid mouse was created by crossing a Wnt-reporter animal (BAT-LacZ) with a model of colorectal cancer (Apc1638N). A mild depletion of folate and vitamins B2, B6, and B12 was induced over 16 wk, and the control animals in each instance were pair fed a diet containing the basal requirement of these nutrients. The multiplicity of macroscopic tumors and aberrant crypt foci both increased by ∼50% in the hybrid mice fed the depletion diet (P<0.05). A 4-fold elevation in Wnt signaling was produced by the depletion diet (P<0.05) and was accompanied by significant changes in the expression of a number of Wnt-related genes in a pattern consistent with its activation. Proliferation and apoptosis of the colonic mucosa both changed in a protransformational direction (P<0.05). In summary, mild depletion of multiple B vitamins produces in vivo activation of colonic Wnt signaling, implicating it as a key pathway by which B-vitamin inadequacies enhance intestinal tumorigenesis.—Liu, Z., Ciappio, E. D., Crott, J. W., Brooks, R. S., Nesvet, J., Smith, D. E., Choi, S.-W., Mason, J. B. Combined inadequacies of multiple B vitamins amplify colonic Wnt signaling and promote intestinal tumorigenesis in BAT-LacZ×Apc1638N mice. PMID:21646397

Sunflower (Helianthus annuus) long-chain acyl-coenzyme A synthetases expressed at high levels in developing seeds.

PubMed

Aznar-Moreno, Jose A; Venegas Calerón, Mónica; Martínez-Force, Enrique; Garcés, Rafael; Mullen, Robert; Gidda, Satinder K; Salas, Joaquín J

2014-03-01

Long chain fatty acid synthetases (LACSs) activate the fatty acid chains produced by plastidial de novo biosynthesis to generate acyl-CoA derivatives, important intermediates in lipid metabolism. Oilseeds, like sunflower, accumulate high levels of triacylglycerols (TAGs) in their seeds to nourish the embryo during germination. This requires that sunflower seed endosperm supports very active glycerolipid synthesis during development. Sunflower seed plastids produce large amounts of fatty acids, which must be activated through the action of LACSs, in order to be incorporated into TAGs. We cloned two different LACS genes from developing sunflower endosperm, HaLACS1 and HaLACS2, which displayed sequence homology with Arabidopsis LACS9 and LACS8 genes, respectively. These genes were expressed at high levels in developing seeds and exhibited distinct subcellular distributions. We generated constructs in which these proteins were fused to green fluorescent protein and performed transient expression experiments in tobacco cells. The HaLACS1 protein associated with the external envelope of tobacco chloroplasts, whereas HaLACS2 was strongly bound to the endoplasmic reticulum. Finally, both proteins were overexpressed in Escherichia coli and recovered as active enzymes in the bacterial membranes. Both enzymes displayed similar substrate specificities, with a very high preference for oleic acid and weaker activity toward stearic acid. On the basis of our findings, we discuss the role of these enzymes in sunflower oil synthesis. © 2013 Scandinavian Plant Physiology Society.

Development of a new fluorescent reporter:operator system: location of AraC regulated genes in Escherichia coli K-12.

PubMed

Sellars, Laura E; Bryant, Jack A; Sánchez-Romero, María-Antonia; Sánchez-Morán, Eugenio; Busby, Stephen J W; Lee, David J

2017-08-03

In bacteria, many transcription activator and repressor proteins regulate multiple transcription units that are often distally distributed on the bacterial genome. To investigate the subcellular location of DNA bound proteins in the folded bacterial nucleoid, fluorescent reporters have been developed which can be targeted to specific DNA operator sites. Such Fluorescent Reporter-Operator System (FROS) probes consist of a fluorescent protein fused to a DNA binding protein, which binds to an array of DNA operator sites located within the genome. Here we have developed a new FROS probe using the Escherichia coli MalI transcription factor, fused to mCherry fluorescent protein. We have used this in combination with a LacI repressor::GFP protein based FROS probe to assess the cellular location of commonly regulated transcription units that are distal on the Escherichia coli genome. We developed a new DNA binding fluorescent reporter, consisting of the Escherichia coli MalI protein fused to the mCherry fluorescent protein. This was used in combination with a Lac repressor:green fluorescent protein fusion to examine the spatial positioning and possible co-localisation of target genes, regulated by the Escherichia coli AraC protein. We report that induction of gene expression with arabinose does not result in co-localisation of AraC-regulated transcription units. However, measurable repositioning was observed when gene expression was induced at the AraC-regulated promoter controlling expression of the araFGH genes, located close to the DNA replication terminus on the chromosome. Moreover, in dividing cells, arabinose-induced expression at the araFGH locus enhanced chromosome segregation after replication. Regions of the chromosome regulated by AraC do not colocalise, but transcription events can induce movement of chromosome loci in bacteria and our observations suggest a role for gene expression in chromosome segregation.

A calorimetric investigation of the interaction of the lac repressor with inducer.

PubMed

Donnér, J; Caruthers, M H; Gill, S J

1982-12-25

A calorimetric study has been made of the interaction between the lac repressor and isopropyl-1-thio-beta-D-galactopyranoside (IPTG). The buffer-corrected enthalpy of reaction at 25 degrees C was found to be -15.6, -24.7, -4.6 kJ/mol of bound IPTG at pH 7.0, pH 8.1, and pH 9.0, respectively. This large range of enthalpy values is in contrast to a maximum difference in the free energy of the reaction of only 1.5 kJ/mol of bound IPTG between these pH values. The reaction was found by calorimetric measurements in different buffers to be accompanied by an uptake of 0.29 mol of protons/mol of bound IPTG at pH 8.1. The pH dependency of the reaction enthalpy suggests differences in the extent of protonation of the binding site and the involvement of H bonding with IPTG. The lack of strong hydrophobic contributions in the IPTG binding process is revealed by the absence of any determinable heat capacity change for the reaction at pH 7.0. The presence of phosphate buffer significantly alters the enthalpy of IPTG binding at higher pH values, but has little effect upon the binding constant. This implies that highly negative phosphate species change the nature of the IPTG binding site without any displacement of phosphate upon IPTG binding.

Nutrient, trace-element, and ecological history of Musky Bay, Lac Courte Oreilles, Wisconsin, as inferred from sediment cores

USGS Publications Warehouse

Fitzpatrick, Faith A.; Garrison, Paul J.; Fitzgerald, Sharon A.; Elder, John F.

2003-01-01

Sediment cores were collected from Musky Bay, Lac Courte Oreilles, and from surrounding areas in 1999 and 2001 to determine whether the water quality of Musky Bay has declined during the last 100 years or more as a result of human activity, specifically cottage development and cranberry farming. Selected cores were analyzed for sedimentation rates, nutrients, minor and trace elements, biogenic silica, diatom assemblages, and pollen over the past several decades. Two cranberry bogs constructed along Musky Bay in 1939 and the early 1950s were substantially expanded between 1950?62 and between 1980?98. Cottage development on Musky Bay has occurred at a steady rate since about 1930, although currently housing density on Musky Bay is one-third to one-half the housing density surrounding three other Lac Courte Oreilles bays. Sedimentation rates were reconstructed for a core from Musky Bay by use of three lead radioisotope models and the cesium-137 profile. The historical average mass and linear sedimentation rates for Musky Bay are 0.023 grams per square centimeter per year and 0.84 centimeters per year, respectively, for the period of about 1936?90. There is also limited evidence that sedimentation rates may have increased after the mid-1990s. Historical changes in input of organic carbon, nitrogen, phosphorus, and sulfur to Musky Bay could not be directly identified from concentration profiles of these elements because of the potential for postdepositional migration and recycling. Minor- and trace-element profiles from the Musky Bay core possibly reflect historical changes in the input of clastic material over time, as well as potential changes in atmospheric deposition inputs. The input of clastic material to the bay increased slightly after European settlement and possibly in the 1930s through 1950s. Concentrations of copper in the Musky Bay core increased steadily through the early to mid-1900s until about 1980 and appear to reflect inputs from atmospheric

76 FR 80331 - Foreign-Trade Subzone 41H Application for Expansion; Mercury Marine (Marine Propulsion Products...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-23

... Application for Expansion; Mercury Marine (Marine Propulsion Products), Fond du Lac and Oshkosh, WI An... of FTZ 41, on behalf of Mercury Marine, operator of Subzone 41H at Mercury Marine's marine propulsion... manufacturing of marine propulsion products at Mercury Marine's facilities located in Fond du Lac and Oshkosh...

De novo generation of plant centromeres at tandem repeats.

PubMed

Teo, Chee How; Lermontova, Inna; Houben, Andreas; Mette, Michael Florian; Schubert, Ingo

2013-06-01

Artificial minichromosomes are highly desirable tools for basic research, breeding, and biotechnology purposes. We present an option to generate plant artificial minichromosomes via de novo engineering of plant centromeres in Arabidopsis thaliana by targeting kinetochore proteins to tandem repeat arrays at non-centromeric positions. We employed the bacterial lactose repressor/lactose operator system to guide derivatives of the centromeric histone H3 variant cenH3 to LacO operator sequences. Tethering of cenH3 to non-centromeric loci led to de novo assembly of kinetochore proteins and to dicentric carrier chromosomes which potentially form anaphase bridges. This approach will be further developed and may contribute to generating minichromosomes from preselected genomic regions, potentially even in a diploid background.

Structures of Staphylococcus aureus D-tagatose-6-phosphate kinase implicate domain motions in specificity and mechanism.

PubMed

Miallau, Linda; Hunter, William N; McSweeney, Sean M; Leonard, Gordon A

2007-07-06

High resolution structures of Staphylococcus aureus d-tagatose-6-phosphate kinase (LacC) in two crystal forms are herein reported. The structures define LacC in apoform, in binary complexes with ADP or the co-factor analogue AMP-PNP, and in a ternary complex with AMP-PNP and D-tagatose-6-phosphate. The tertiary structure of the LacC monomer, which is closely related to other members of the pfkB subfamily of carbohydrate kinases, is composed of a large alpha/beta core domain and a smaller, largely beta "lid." Four extended polypeptide segments connect these two domains. Dimerization of LacC occurs via interactions between lid domains, which come together to form a beta-clasp structure. Residues from both subunits contribute to substrate binding. LacC adopts a closed structure required for phosphoryl transfer only when both substrate and co-factor are bound. A reaction mechanism similar to that used by other phosphoryl transferases is proposed, although unusually, when both substrate and co-factor are bound to the enzyme two Mg(2+) ions are observed in the active site. A new motif of amino acid sequence conservation common to the pfkB subfamily of carbohydrate kinases is identified.

Mars Surface Operations via Low-Latency Telerobotics from Phobos

NASA Technical Reports Server (NTRS)

Wright, Michael; Lupisella, Mark

2016-01-01

To help assess the feasibility and timing of Low-Latency Telerobotics (LLT) operations on Mars via a Phobos telecommand base, operations concepts (ops cons) and timelines for several representative sequences for Mars surface operations have been developed. A summary of these LLT sequences and timelines will be presented, along with associated assumptions, operational considerations, and challenges.

Comparison of MR imaging sequences for liver and head and neck interventions: is there a single optimal sequence for all purposes?

PubMed

Boll, Daniel T; Lewin, Jonathan S; Duerk, Jeffrey L; Aschoff, Andrik J; Merkle, Elmar M

2004-05-01

To compare the appropriate pulse sequences for interventional device guidance during magnetic resonance (MR) imaging at 0.2 T and to evaluate the dependence of sequence selection on the anatomic region of the procedure. Using a C-arm 0.2 T system, four interventional MR sequences were applied in 23 liver cases and during MR-guided neck interventions in 13 patients. The imaging protocol consisted of: multislice turbo spin echo (TSE) T2w, sequential-slice fast imaging with steady precession (FISP), a time-reversed version of FISP (PSIF), and FISP with balanced gradients in all spatial directions (True-FISP) sequences. Vessel conspicuity was rated and contrast-to-noise ratio (CNR) was calculated for each sequence and a differential receiver operating characteristic was performed. Liver findings were detected in 96% using the TSE sequence. PSIF, FISP, and True-FISP imaging showed lesions in 91%, 61%, and 65%, respectively. The TSE sequence offered the best CNR, followed by PSIF imaging. Differential receiver operating characteristic analysis also rated TSE and PSIF to be the superior sequences. Lesions in the head and neck were detected in all cases by TSE and FISP, in 92% using True-FISP, and in 84% using PSIF. True-FISP offered the best CNR, followed by TSE imaging. Vessels appeared bright on FISP and True-FISP imaging and dark on the other sequences. In interventional MR imaging, no single sequence fits all purposes. Image guidance for interventional MR during liver procedures is best achieved by PSIF or TSE, whereas biopsies in the head and neck are best performed using FISP or True-FISP sequences.

Data on publications, structural analyses, and queries used to build and utilize the AlloRep database.

PubMed

Sousa, Filipa L; Parente, Daniel J; Hessman, Jacob A; Chazelle, Allen; Teichmann, Sarah A; Swint-Kruse, Liskin

2016-09-01

The AlloRep database (www.AlloRep.org) (Sousa et al., 2016) [1] compiles extensive sequence, mutagenesis, and structural information for the LacI/GalR family of transcription regulators. Sequence alignments are presented for >3000 proteins in 45 paralog subfamilies and as a subsampled alignment of the whole family. Phenotypic and biochemical data on almost 6000 mutants have been compiled from an exhaustive search of the literature; citations for these data are included herein. These data include information about oligomerization state, stability, DNA binding and allosteric regulation. Protein structural data for 65 proteins are presented as easily-accessible, residue-contact networks. Finally, this article includes example queries to enable the use of the AlloRep database. See the related article, "AlloRep: a repository of sequence, structural and mutagenesis data for the LacI/GalR transcription regulators" (Sousa et al., 2016) [1].

Mariner 9 mapping science sequence design.

NASA Technical Reports Server (NTRS)

Goldman, A. M., Jr.

1973-01-01

The primary mission of Mariner 9 was to map the Martian surface. This paper discusses in detail the design of the mapping science sequences which were executed by the spacecraft in sixty days and during which over eighty percent of the surface was photographed. The sequence design was influenced by many factors: experimenter scientific objectives, instrument capabilities, spacecraft capabilities, orbit characteristics, and data return rates, which are illustrated graphically. Typical orbits are depicted for each of the three different mapping phases lasting twenty days. Examples of typical orbital sequence plans prepared daily during mission operations are given.

Lageos assembly operation plan

NASA Technical Reports Server (NTRS)

Brueger, J.

1975-01-01

Guidelines and constraints procedures for LAGEOS assembly, operation, and design performance are given. Special attention was given to thermal, optical, and dynamic analysis and testing. The operation procedures illustrate the interrelation and sequence of tasks in a flow diagram. The diagram also includes quality assurance functions for verification of operation tasks.

FASH: A web application for nucleotides sequence search.

PubMed

Veksler-Lublinksy, Isana; Barash, Danny; Avisar, Chai; Troim, Einav; Chew, Paul; Kedem, Klara

2008-05-27

: FASH (Fourier Alignment Sequence Heuristics) is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome), FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. FASH can be accessed athttps://fash.bgu.ac.il:8443/fash/default.jsp (secured website).

VizieR Online Data Catalog: Swift and NuSTAR obs. of the BL Lac Mrk 421 (Kapanadze+, 2016)

NASA Astrophysics Data System (ADS)

Kapanadze, B.; Dorner, D.; Vercellone, S.; Romano, P.; Aller, H.; Aller, M.; Hughes, P.; Reynolds, M.; Kapanadze, S.; Tabagari, L.

2017-01-01

We retrieved the Swift-XRT data from the publicly available archive, maintained by HEASARC. We present the results of X-ray observations of the high-energy peaked BL Lac (HBL) source Mrk421 performed by Swift-XRT and NuSTAR during 2013 January-June. Along with the 0.3-10keV and 3-79keV data obtained with the Swift-XRT and NuSTAR instruments, we have processed and analyzed those obtained with the Ultraviolet-Optical Telescope (UVOT) and Large Area Telescope (LAT) onboard Fermi. We have also used the publicly available light curves from the observations performed with the Burst Alert Telescope (BAT) onboard Swift, Monitor of All Sky X-ray Image (MAXI), MAGIC, First G-APD Cherenkov Telescope (FACT), and the OVRO 40m telescope during the 2013 January-June period to draw conclusions about the interband correlations. (8 data files).

Polarimetry of optically selected BL Lacertae candidates from the SDSS

NASA Astrophysics Data System (ADS)

Heidt, J.; Nilsson, K.

2011-05-01

We present and discuss polarimetric observations of 182 targets drawn from an optically selected sample of 240 probable BL Lac candidates out of the SDSS compiled by Collinge et al. (2005, AJ, 129, 2542). In contrast to most other BL Lac candidate samples extracted from the SDSS, its radio- and/or X-ray properties have not been taken into account for its derivation. Thus, because its selection is based on optical properties alone, it may be less prone to selection effects inherent in other samples derived at different frequencies, so it offers a unique opportunity to extract the first unbiased BL Lac luminosity function that is suitably large in size. We found 124 out of 182 targets (68%) to be polarized, 95 of the polarized targets (77%) to be highly polarized (>4%). The low-frequency peaked BL Lac candidates in the sample are on average only slightly more polarized than the high-frequency peaked ones. Compared to earlier studies, we found a high duty cycle in high polarization (˜ 66+2-14% to be >4% polarized) in high-frequency peaked BL Lac candidates. This may come from our polarization analysis, which minimizes the contamination by host galaxy light. No evidence of radio-quiet BL Lac objects in the sample was found. Our observations show that the probable sample of BL Lac candidates of Collinge et al. (2005) indeed contains a large number of bona fide BL Lac objects. High S/N spectroscopy and deep X-ray observations are required to construct the first luminosity function of optically selected BL Lac objects and to test more stringently for any radio-quiet BL Lac objects in the sample. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory in the course of the observing proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Andalucia (CSIC).Based on observations

Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer

PubMed Central

Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk

2014-01-01

Purpose Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). Methods This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. Results A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. Conclusion LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes. PMID:24761404

Driving on the surface of Mars with the rover sequencing and visualization program

NASA Technical Reports Server (NTRS)

Wright, J.; Hartman, F.; Cooper, B.; Maxwell, S.; Yen, J.; Morrison, J.

2005-01-01

Operating a rover on Mars is not possible using teleoperations due to the distance involved and the bandwith limitations. To operate these rovers requires sophisticated tools to make operators knowledgeable of the terrain, hazards, features of interest, and rover state and limitations, and to support building command sequences and rehearsing expected operations. This paper discusses how the Rover Sequencing and Visualization program and a small set of associated tools support this requirement.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iyer, Sukanya; Karig, David K; Norred, Sarah E

Engineered gene circuits offer an opportunity to harness biological systems for biotechnological and biomedical applications. However, reliance on host E. coli promoters for the construction of circuit elements, such as logic gates, makes implementation of predictable, independently functioning circuits difficult. In contrast, T7 promoters offer a simple orthogonal expression system for use in a variety of cellular backgrounds and even in cell free systems. Here we develop a T7 promoter system that can be regulated by two different transcriptional repressors for the construction of a logic gate that functions in cells and in cell free systems. We first present LacImore » repressible T7lacO promoters that are regulated from a distal lac operator site for repression. We next explore the positioning of a tet operator site within the T7lacO framework to create T7 promoters that respond to tet and lac repressors and realize an IMPLIES gate. Finally, we demonstrate that these dual input sensitive promoters function in a commercially available E. coli cell-free protein expression system. Together, our results contribute to the first demonstration of multi-input regulation of T7 promoters and expand the utility of T7 promoters in cell based as well as cell-free gene circuits.« less

VERITAS Detection of γ-Ray Flaring Activity From the BL Lac Object 1ES 1727+502 During Bright Moonlight Observations

NASA Astrophysics Data System (ADS)

Archambault, S.; Archer, A.; Beilicke, M.; Benbow, W.; Bird, R.; Biteau, J.; Bouvier, A.; Bugaev, V.; Cardenzana, J. V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dickinson, H. J.; Dumm, J.; Eisch, J. D.; Errando, M.; Falcone, A.; Feng, Q.; Finley, J. P.; Fleischhack, H.; Fortin, P.; Fortson, L.; Furniss, A.; Gillanders, G. H.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Håkansson, N.; Hanna, D.; Holder, J.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krause, M.; Krennrich, F.; Kumar, S.; Lang, M. J.; Maier, G.; McArthur, S.; McCann, A.; Meagher, K.; Millis, J.; Moriarty, P.; Mukherjee, R.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Otte, A. N.; Park, N.; Pohl, M.; Popkow, A.; Prokoph, H.; Pueschel, E.; Quinn, J.; Ragan, K.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Santander, M.; Sembroski, G. H.; Shahinyan, K.; Smith, A. W.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Varlotta, A.; Vincent, S.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.; Veritas Collaboration; Hughes, Z. D.

2015-08-01

During moonlit nights, observations with ground-based Cherenkov telescopes at very high energies (VHEs, E\\gt 100 GeV) are constrained since the photomultiplier tubes (PMTs) in the telescope camera are extremely sensitive to the background moonlight. Observations with the VERITAS telescopes in the standard configuration are performed only with a moon illumination less than 35% of full moon. Since 2012, the VERITAS collaboration has implemented a new observing mode under bright moonlight, by either reducing the voltage applied to the PMTs (reduced-high-voltage; RHV configuration), or by utilizing UV-transparent filters. While these operating modes result in lower sensitivity and increased energy thresholds, the extension of the available observing time is useful for monitoring variable sources such as blazars and sources requiring spectral measurements at the highest energies. In this paper we report the detection of γ-ray flaring activity from the BL Lac object 1ES 1727+502 during RHV observations. This detection represents the first evidence of VHE variability from this blazar. The integral flux is (1.1+/- 0.2)× {10}-11 {{cm}}-2 {{{s}}}-1 above 250 GeV, which is about five times higher than the low-flux state. The detection triggered additional VERITAS observations during standard dark-time. Multiwavelength observations with the FLWO 48″ telescope, and the Swift and Fermi satellites are presented and used to produce the first spectral energy distribution (SED) of this object during γ-ray flaring activity. The SED is then fitted with a standard synchrotron-self-Compton model, placing constraints on the properties of the emitting region and of the acceleration mechanism at the origin of the relativistic particle population in the jet.

JVM: Java Visual Mapping tool for next generation sequencing read.

PubMed

Yang, Ye; Liu, Juan

2015-01-01

We developed a program JVM (Java Visual Mapping) for mapping next generation sequencing read to reference sequence. The program is implemented in Java and is designed to deal with millions of short read generated by sequence alignment using the Illumina sequencing technology. It employs seed index strategy and octal encoding operations for sequence alignments. JVM is useful for DNA-Seq, RNA-Seq when dealing with single-end resequencing. JVM is a desktop application, which supports reads capacity from 1 MB to 10 GB.

Louisiana SIP: LAC 33:III Ch 2132. Stage II Vapor Recovery Systems for Control of Vehicle Refuelling Emissions at Gasoline Dispensing Facilities; SIP effective 2011-08-04 (LAd34) and 2016-02-29 (LAd47) to 2017-09-27

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 2132. Stage II Vapor Recovery Systems for Control of Vehicle Refuelling Emissions at Gasoline Dispensing Facilities; SIP effective 2011-08-04 (LAd34) and 2016-02-29 (LAd47) to 2017-09-27

The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2003-02-01

The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

Small scale sequence automation pays big dividends

NASA Technical Reports Server (NTRS)

Nelson, Bill

1994-01-01

Galileo sequence design and integration are supported by a suite of formal software tools. Sequence review, however, is largely a manual process with reviewers scanning hundreds of pages of cryptic computer printouts to verify sequence correctness. Beginning in 1990, a series of small, PC based sequence review tools evolved. Each tool performs a specific task but all have a common 'look and feel'. The narrow focus of each tool means simpler operation, and easier creation, testing, and maintenance. Benefits from these tools are (1) decreased review time by factors of 5 to 20 or more with a concomitant reduction in staffing, (2) increased review accuracy, and (3) excellent returns on time invested.

Nanopore sequencing in microgravity

PubMed Central

McIntyre, Alexa B R; Rizzardi, Lindsay; Yu, Angela M; Alexander, Noah; Rosen, Gail L; Botkin, Douglas J; Stahl, Sarah E; John, Kristen K; Castro-Wallace, Sarah L; McGrath, Ken; Burton, Aaron S; Feinberg, Andrew P; Mason, Christopher E

2016-01-01

Rapid DNA sequencing and analysis has been a long-sought goal in remote research and point-of-care medicine. In microgravity, DNA sequencing can facilitate novel astrobiological research and close monitoring of crew health, but spaceflight places stringent restrictions on the mass and volume of instruments, crew operation time, and instrument functionality. The recent emergence of portable, nanopore-based tools with streamlined sample preparation protocols finally enables DNA sequencing on missions in microgravity. As a first step toward sequencing in space and aboard the International Space Station (ISS), we tested the Oxford Nanopore Technologies MinION during a parabolic flight to understand the effects of variable gravity on the instrument and data. In a successful proof-of-principle experiment, we found that the instrument generated DNA reads over the course of the flight, including the first ever sequenced in microgravity, and additional reads measured after the flight concluded its parabolas. Here we detail modifications to the sample-loading procedures to facilitate nanopore sequencing aboard the ISS and in other microgravity environments. We also evaluate existing analysis methods and outline two new approaches, the first based on a wave-fingerprint method and the second on entropy signal mapping. Computationally light analysis methods offer the potential for in situ species identification, but are limited by the error profiles (stays, skips, and mismatches) of older nanopore data. Higher accuracies attainable with modified sample processing methods and the latest version of flow cells will further enable the use of nanopore sequencers for diagnostics and research in space. PMID:28725742

Substorm wave base felsic hydroclastic deposits in the Archean Lac des Vents volcanic complex, Abitibi belt, Canada

NASA Astrophysics Data System (ADS)

Mueller, Wulf; Chown, E. H.; Potvin, Robin

1994-05-01

Volcaniclastic deposits of the 2.3-km-thick Archean Lac des Vents volcanic complex are an integral part of major submarine volcanic construction. The volcanic edifice, which formed on a subaqueous basalt plain, is comparable to modern seamounts resting on the ocean floor. The initial 770 m of the mafic-felsic edifice, subject of this study, is composed of massive, brecciated and pillowed basalts, massive to brecciated felsic lava flows and abundant felsic fragmental rocks of hydroclastic origin. Four distinct volcaniclastic lithofacies constitute the latter: (1) the pumice lapilli-tuff lithofacies; (2) the lapilli-tuff breccia lithofacies characterized by two sublithofacies; (3) the turbidite tuff and tuff-breccia lithofacies; and (4) the volcanic sandstone and breccia lithofacies. These four volcaniclastic lithofacies are considered to be the result of explosive and non-explosive hydrovolcanic fragmentation processes operating at depths below storm wave base (> 200 m). Primary deposition or limited remobilization of unconsolidated hydroclastic debris is shown by the preservation of delicate clasts and volcanic textures, and heat retention structures. The principal transport agents are high-concentration sediment gravity flows occurring under laminar and turbulent flow conditions. High- and low-density turbiditic tuffs and fine-grained tuff fallout deposits, are related to either the dissipating stages of volcanic eruptions or slumping of syneruptive volcanic debris on the flanks of a subaqueous volcanic edifice. Ubiquitous interstratification of volcaniclastic turbidites, shale, and pillowed basalt flows with the felsic lava flows and fragmental debris favours subaqueous deposition. These features combined with the absence of wave-induced sedimentary structures, imply deposition in water depths in excess of 200 m. Viscous feldspar-phyric massive and brecciated felsic flows, and associated volcaniclastics cross cut by felsic dykes, suggest vent proximity. The

Space shuttle operations integration plan

NASA Technical Reports Server (NTRS)

1975-01-01

The Operations Integration Plan is presented, which is to provide functional definition of the activities necessary to develop and integrate shuttle operating plans and facilities to support flight, flight control, and operations. It identifies the major tasks, the organizations responsible, their interrelationships, the sequence of activities and interfaces, and the resultant products related to operations integration.

VERITAS OBSERVATIONS OF THE BL LAC OBJECT PG 1553+113

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aliu, E.; Archer, A.; Beilicke, M.

2015-01-20

We present results from VERITAS observations of the BL Lac object PG 1553+113 spanning the years 2010, 2011, and 2012. The time-averaged spectrum, measured between 160 and 560 GeV, is well described by a power law with a spectral index of 4.33 ± 0.09. The time-averaged integral flux above 200 GeV measured for this period was (1.69 ± 0.06) × 10{sup –11} photons cm{sup –2} s{sup –1}, corresponding to 6.9% of the Crab Nebula flux. We also present the combined γ-ray spectrum from the Fermi Large Area Telescope and VERITAS covering an energy range from 100 MeV to 560 GeV.more » The data are well fit by a power law with an exponential cutoff at 101.9 ± 3.2 GeV. The origin of the cutoff could be intrinsic to PG 1553+113 or be due to the γ-ray opacity of our universe through pair production off the extragalactic background light (EBL). Given lower limits to the redshift of z > 0.395 based on optical/UV observations of PG 1553+113, the cutoff would be dominated by EBL absorption. Conversely, the small statistical uncertainties of the VERITAS energy spectrum have allowed us to provide a robust upper limit on the redshift of PG 1553+113 of z ≤ 0.62. A strongly elevated mean flux of (2.50 ± 0.14) × 10{sup –11} photons cm{sup –2} s{sup –1} (10.3% of the Crab Nebula flux) was observed during 2012, with the daily flux reaching as high as (4.44±0.71)×10{sup −11} photons cm{sup −2} s{sup −1} (18.3% of the Crab Nebula flux) on MJD 56048. The light curve measured during the 2012 observing season is marginally inconsistent with a steady flux, giving a χ{sup 2} probability for a steady flux of 0.03%.« less

Cloning, sequencing, and expression of the Pseudomonas testosteroni gene encoding 3-oxosteroid delta 1-dehydrogenase.

PubMed Central

Plesiat, P; Grandguillot, M; Harayama, S; Vragar, S; Michel-Briand, Y

1991-01-01

Pseudomonas testosteroni ATCC 17410 is able to grow on testosterone. This strain was mutagenized by Tn5, and 41 mutants defective in the utilization of testosterone were isolated. One of them, called mutant 06, expressed 3-oxosteroid delta 1- and 3-oxosteroid delta 4-5 alpha-dehydrogenases only at low levels. The DNA region around the Tn5 insertion in mutant 06 was cloned into pUC19, and the 1-kbp EcoRI-BamHI segment neighbor to the Tn5 insertion was used to probe DNA from the wild-type strain. The probe hybridized to a 7.8-kbp SalI fragment. Plasmid pTES5, which is a pUC19 derivative containing this 7.8-kbp SalI fragment, was isolated after the screening by the 1-kbp EcoRI-BamHI probe. This plasmid expressed delta 1-dehydrogenase in Escherichia coli cells. The 2.2-kbp KpnI-KpnI segment of pTES5 was subcloned into pUC18, and pTEK21 was constructed. In E. coli containing the lacIq plasmid pRG1 and pTEK21, the expression of delta 1-dehydrogenase was induced by isopropyl-beta-D-thiogalactopyranoside (IPTG). The induced level was about 40 times higher than the induced level in P. testosteroni. Delta 1-Dehydrogenase synthesized in E. coli was localized in the inner membrane fraction. The minicell experiments showed that a 59-kDa polypeptide was synthesized from pTEK21, and this polypeptide was located in the inner membrane fraction. The complete nucleotide sequence of the 2.2-kbp KpnI-KpnI segment of pTEK21 was determined. An open reading frame which encodes a 62.4-kDa polypeptide and which is preceded by a Shine-Dalgarno-like sequence was identified. The first 44 amino acids of the putative product exhibited significant sequence similarity to the N-terminal sequences of lipoamide dehydrogenases. Images FIG. 4 PMID:1657885

FAST - FREEDOM ASSEMBLY SEQUENCING TOOL PROTOTYPE

NASA Technical Reports Server (NTRS)

Borden, C. S.

1994-01-01

FAST is a project management tool designed to optimize the assembly sequence of Space Station Freedom. An appropriate assembly sequence coordinates engineering, design, utilization, transportation availability, and operations requirements. Since complex designs tend to change frequently, FAST assesses the system level effects of detailed changes and produces output metrics that identify preferred assembly sequences. FAST incorporates Space Shuttle integration, Space Station hardware, on-orbit operations, and programmatic drivers as either precedence relations or numerical data. Hardware sequencing information can either be input directly and evaluated via the "specified" mode of operation or evaluated from the input precedence relations in the "flexible" mode. In the specified mode, FAST takes as its input a list of the cargo elements assigned to each flight. The program determines positions for the cargo elements that maximize the center of gravity (c.g.) margin. These positions are restricted by the geometry of the cargo elements and the location of attachment fittings both in the orbiter and on the cargo elements. FAST calculates every permutation of cargo element location according to its height, trunnion fitting locations, and required intercargo element spacing. Each cargo element is tested in both its normal and reversed orientation (rotated 180 degrees). The best solution is that which maximizes the c.g. margin for each flight. In the flexible mode, FAST begins with the first flight and determines all feasible combinations of cargo elements according to mass, volume, EVA, and precedence relation constraints. The program generates an assembly sequence that meets mass, volume, position, EVA, and precedence constraints while minimizing the total number of Shuttle flights required. Issues associated with ground operations, spacecraft performance, logistics requirements and user requirements will be addressed in future versions of the model. FAST is written in C

Louisiana SIP: LAC 33:III Ch. 14 Subchap B, 1431 to 1434--Conformity to State or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed, Funded, or Approved Under Title 23 U.S.C. or the Federal Transit Laws

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 14 Subchap B, 1431 to 1434--Conformity to State or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed, Funded, or Approved Under Title 23 U.S.C. or the Federal Transit Laws

Illumina microRNA profiles reveal the involvement of miR397a in Citrus adaptation to long-term boron toxicity via modulating secondary cell-wall biosynthesis.

PubMed

Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song

2016-03-10

The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5'-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis.

Illumina microRNA profiles reveal the involvement of miR397a in Citrus adaptation to long-term boron toxicity via modulating secondary cell-wall biosynthesis

PubMed Central

Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song

2016-01-01

The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5′-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis. PMID:26962011

Comparative genome analysis of Streptococcus infantarius subsp. infantarius CJ18, an African fermented camel milk isolate with adaptations to dairy environment.

PubMed

Jans, Christoph; Follador, Rainer; Hochstrasser, Mira; Lacroix, Christophe; Meile, Leo; Stevens, Marc J A

2013-03-22

Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC.We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ.Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the

Comparative genome analysis of Streptococcus infantarius subsp. infantarius CJ18, an African fermented camel milk isolate with adaptations to dairy environment

PubMed Central

2013-01-01

Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and

Flight Experiment Investigation of General Aviation Self-Separation and Sequencing Tasks

NASA Technical Reports Server (NTRS)

Murdoch, Jennifer L.; Ramiscal, Ermin R.; McNabb, Jennifer L.; Bussink, Frank J. L.

2005-01-01

A new flight operations concept called Small Aircraft Transportation System (SATS) Higher Volume Operations (HVO) was developed to increase capacity during Instrument Meteorological Conditions (IMC) at non-towered, non-radar airports by enabling concurrent operations of multiple aircraft. One aspect of this concept involves having pilots safely self-separate from other aircraft during approaches into these airports using appropriate SATS HVO procedures. A flight experiment was conducted to determine if instrument-rated general aviation (GA) pilots could self-separate and sequence their ownship aircraft, while following a simulated aircraft, into a non-towered, non-radar airport during simulated IMC. Six GA pilots' workload levels and abilities to perform self-separation and sequencing procedures while flying a global positioning system (GPS) instrument approach procedure were examined. The results showed that the evaluation pilots maintained at least the minimum specified separation between their ownship aircraft and simulated traffic and maintained their assigned landing sequence 100-percent of the time. Neither flight path deviations nor subjective workload assessments were negatively impacted by the additional tasks of self-separating and sequencing during these instrument approaches.

Deep sequencing-based analysis of the anaerobic stimulon in Neisseria gonorrhoeae

PubMed Central

2011-01-01

Background Maintenance of an anaerobic denitrification system in the obligate human pathogen, Neisseria gonorrhoeae, suggests that an anaerobic lifestyle may be important during the course of infection. Furthermore, mounting evidence suggests that reduction of host-produced nitric oxide has several immunomodulary effects on the host. However, at this point there have been no studies analyzing the complete gonococcal transcriptome response to anaerobiosis. Here we performed deep sequencing to compare the gonococcal transcriptomes of aerobically and anaerobically grown cells. Using the information derived from this sequencing, we discuss the implications of the robust transcriptional response to anaerobic growth. Results We determined that 198 chromosomal genes were differentially expressed (~10% of the genome) in response to anaerobic conditions. We also observed a large induction of genes encoded within the cryptic plasmid, pJD1. Validation of RNA-seq data using translational-lacZ fusions or RT-PCR demonstrated the RNA-seq results to be very reproducible. Surprisingly, many genes of prophage origin were induced anaerobically, as well as several transcriptional regulators previously unknown to be involved in anaerobic growth. We also confirmed expression and regulation of a small RNA, likely a functional equivalent of fnrS in the Enterobacteriaceae family. We also determined that many genes found to be responsive to anaerobiosis have also been shown to be responsive to iron and/or oxidative stress. Conclusions Gonococci will be subject to many forms of environmental stress, including oxygen-limitation, during the course of infection. Here we determined that the anaerobic stimulon in gonococci was larger than previous studies would suggest. Many new targets for future research have been uncovered, and the results derived from this study may have helped to elucidate factors or mechanisms of virulence that may have otherwise been overlooked. PMID:21251255

Illumina Production Sequencing at the DOE Joint Genome Institute - Workflow and Optimizations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tarver, Angela; Fern, Alison; Diego, Matthew San

2010-06-18

The U.S. Department of Energy (DOE) Joint Genome Institute?s (JGI) Production Sequencing group is committed to the generation of high-quality genomic DNA sequence to support the DOE mission areas of renewable energy generation, global carbon management, and environmental characterization and clean-up. Within the JGI?s Production Sequencing group, the Illumina Genome Analyzer pipeline has been established as one of three sequencing platforms, along with Roche/454 and ABI/Sanger. Optimization of the Illumina pipeline has been ongoing with the aim of continual process improvement of the laboratory workflow. These process improvement projects are being led by the JGI?s Process Optimization, Sequencing Technologies, Instrumentation&more » Engineering, and the New Technology Production groups. Primary focus has been on improving the procedural ergonomics and the technicians? operating environment, reducing manually intensive technician operations with different tools, reducing associated production costs, and improving the overall process and generated sequence quality. The U.S. DOE JGI was established in 1997 in Walnut Creek, CA, to unite the expertise and resources of five national laboratories? Lawrence Berkeley, Lawrence Livermore, Los Alamos, Oak Ridge, and Pacific Northwest ? along with HudsonAlpha Institute for Biotechnology. JGI is operated by the University of California for the U.S. DOE.« less

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Analysing the performance of personal computers based on Intel microprocessors for sequence aligning bioinformatics applications.

PubMed

Nair, Pradeep S; John, Eugene B

2007-01-01

Aligning specific sequences against a very large number of other sequences is a central aspect of bioinformatics. With the widespread availability of personal computers in biology laboratories, sequence alignment is now often performed locally. This makes it necessary to analyse the performance of personal computers for sequence aligning bioinformatics benchmarks. In this paper, we analyse the performance of a personal computer for the popular BLAST and FASTA sequence alignment suites. Results indicate that these benchmarks have a large number of recurring operations and use memory operations extensively. It seems that the performance can be improved with a bigger L1-cache.

High-throughput sequencing: a failure mode analysis.

PubMed

Yang, George S; Stott, Jeffery M; Smailus, Duane; Barber, Sarah A; Balasundaram, Miruna; Marra, Marco A; Holt, Robert A

2005-01-04

Basic manufacturing principles are becoming increasingly important in high-throughput sequencing facilities where there is a constant drive to increase quality, increase efficiency, and decrease operating costs. While high-throughput centres report failure rates typically on the order of 10%, the causes of sporadic sequencing failures are seldom analyzed in detail and have not, in the past, been formally reported. Here we report the results of a failure mode analysis of our production sequencing facility based on detailed evaluation of 9,216 ESTs generated from two cDNA libraries. Two categories of failures are described; process-related failures (failures due to equipment or sample handling) and template-related failures (failures that are revealed by close inspection of electropherograms and are likely due to properties of the template DNA sequence itself). Preventative action based on a detailed understanding of failure modes is likely to improve the performance of other production sequencing pipelines.

Software for Analyzing Sequences of Flow-Related Images

NASA Technical Reports Server (NTRS)

Klimek, Robert; Wright, Ted

2004-01-01

Spotlight is a computer program for analysis of sequences of images generated in combustion and fluid physics experiments. Spotlight can perform analysis of a single image in an interactive mode or a sequence of images in an automated fashion. The primary type of analysis is tracking of positions of objects over sequences of frames. Features and objects that are typically tracked include flame fronts, particles, droplets, and fluid interfaces. Spotlight automates the analysis of object parameters, such as centroid position, velocity, acceleration, size, shape, intensity, and color. Images can be processed to enhance them before statistical and measurement operations are performed. An unlimited number of objects can be analyzed simultaneously. Spotlight saves results of analyses in a text file that can be exported to other programs for graphing or further analysis. Spotlight is a graphical-user-interface-based program that at present can be executed on Microsoft Windows and Linux operating systems. A version that runs on Macintosh computers is being considered.

Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis

PubMed Central

Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro

2016-01-01

Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073

Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b: cloning, sequencing, and expression of the tyrosinase gene mepA.

PubMed Central

Mercado-Blanco, J; García, F; Fernández-López, M; Olivares, J

1993-01-01

Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b (140 MDa). Transfer of this plasmid to GR4-cured derivatives or to Agrobacterium tumefaciens enables these bacteria to produce melanin. Sequence analysis of a 3.5-kb PstI fragment of plasmid pRmeGR4b has revealed the presence of a open reading frame 1,481-bp that codes for a protein whose sequence shows strong homology to two conserved regions involved in copper binding in tyrosinases and hemocyanins. In vitro-coupled transcription-translation experiments showed that this open reading frame codes for a 55-kDa polypeptide. Melanin production in GR4 is not under the control of the RpoN-NifA regulatory system, unlike that in R. leguminosarum bv. phaseoli 8002. The GR4 tyrosinase gene could be expressed in Escherichia coli under the control of the lacZ promoter. For avoiding confusion with mel genes (for melibiose), a change of the name of the previously reported mel genes of R. leguminosarum bv. phaseoli and other organisms to mep genes (for melanin production) is proposed. Images PMID:8366027

The sequence of sequencers: The history of sequencing DNA

PubMed Central

Heather, James M.; Chain, Benjamin

2016-01-01

Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. PMID:26554401

Apollo Operations Handbook Lunar Module (LM 11 and Subsequent) Vol. 2 Operational Procedures

NASA Technical Reports Server (NTRS)

1971-01-01

The Apollo Operations Handbook (AOH) is the primary means of documenting LM descriptions and procedures. The AOH is published in two separately bound volumes. This information is useful in support of program management, engineering, test, flight simulation, and real time flight support efforts. This volume contains crew operational procedures: normal, backup, abort, malfunction, and emergency. These procedures define the sequence of actions necessary for safe and efficient subsystem operation.

Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.

PubMed

Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong

2018-04-01

Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.

Computer program for the IBM personal computer which searches for approximate matches to short oligonucleotide sequences in long target DNA sequences.

PubMed Central

Myers, E W; Mount, D W

1986-01-01

We describe a program which may be used to find approximate matches to a short predefined DNA sequence in a larger target DNA sequence. The program predicts the usefulness of specific DNA probes and sequencing primers and finds nearly identical sequences that might represent the same regulatory signal. The program is written in the C programming language and will run on virtually any computer system with a C compiler, such as the IBM/PC and other computers running under the MS/DOS and UNIX operating systems. The program has been integrated into an existing software package for the IBM personal computer (see article by Mount and Conrad, this volume). Some examples of its use are given. PMID:3753785

Visual pattern image sequence coding

NASA Technical Reports Server (NTRS)

Silsbee, Peter; Bovik, Alan C.; Chen, Dapang

1990-01-01

The visual pattern image coding (VPIC) configurable digital image-coding process is capable of coding with visual fidelity comparable to the best available techniques, at compressions which (at 30-40:1) exceed all other technologies. These capabilities are associated with unprecedented coding efficiencies; coding and decoding operations are entirely linear with respect to image size and entail a complexity that is 1-2 orders of magnitude faster than any previous high-compression technique. The visual pattern image sequence coding to which attention is presently given exploits all the advantages of the static VPIC in the reduction of information from an additional, temporal dimension, to achieve unprecedented image sequence coding performance.

2008 Stability, Security, Transition and Reconstruction Operations Conference

DTIC Science & Technology

2008-09-04

Facilitator Power of Public-Private Partnerships • Health Professional Education • Greater Access to Care China Diabetes Education Program Dominican Republic...Argentina Canada Chile Colombia Ecuador Peru Uruguay Interagency, multinational, inter-institutional partnerships State Department Homeland Security...Disaster Preparedness Disaster Response Regional Response Capacity OFDA-LAC / MDROs Regional Security System (RSS) UNCLASSIFIED ECUADOR / KY PERU / WV

The sequence of sequencers: The history of sequencing DNA.

PubMed

Heather, James M; Chain, Benjamin

2016-01-01

Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

The evaluation of acute physiology and chronic health evaluation II score, poisoning severity score, sequential organ failure assessment score combine with lactate to assess the prognosis of the patients with acute organophosphate pesticide poisoning.

PubMed

Yuan, Shaoxin; Gao, Yusong; Ji, Wenqing; Song, Junshuai; Mei, Xue

2018-05-01

The aim of this study was to assess the ability of acute physiology and chronic health evaluation II (APACHE II) score, poisoning severity score (PSS) as well as sequential organ failure assessment (SOFA) score combining with lactate (Lac) to predict mortality in the Emergency Department (ED) patients who were poisoned with organophosphate.A retrospective review of 59 stands-compliant patients was carried out. Receiver operating characteristic (ROC) curves were constructed based on the APACHE II score, PSS, SOFA score with or without Lac, respectively, and the areas under the ROC curve (AUCs) were determined to assess predictive value. According to SOFA-Lac (a combination of SOFA and Lac) classification standard, acute organophosphate pesticide poisoning (AOPP) patients were divided into low-risk and high-risk groups. Then mortality rates were compared between risk levels.Between survivors and non-survivors, there were significant differences in the APACHE II score, PSS, SOFA score, and Lac (all P < .05). The AUCs of the APACHE II score, PSS, and SOFA score were 0.876, 0.811, and 0.837, respectively. However, after combining with Lac, the AUCs were 0.922, 0.878, and 0.956, respectively. According to SOFA-Lac, the mortality of high-risk group was significantly higher than low-risk group (P < .05) and the patients of the non-survival group were all at high risk.These data suggest the APACHE II score, PSS, SOFA score can all predict the prognosis of AOPP patients. For its simplicity and objectivity, the SOFA score is a superior predictor. Lac significantly improved the predictive abilities of the 3 scoring systems, especially for the SOFA score. The SOFA-Lac system effectively distinguished the high-risk group from the low-risk group. Therefore, the SOFA-Lac system is significantly better at predicting mortality in AOPP patients.

Genetic Requirements for the Single-Strand Annealing Pathway of Double-Strand Break Repair in Saccharomyces Cerevisiae

PubMed Central

Ivanov, E. L.; Sugawara, N.; Fishman-Lobell, J.; Haber, J. E.

1996-01-01

HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. PMID:8849880

Operation optimization of a photo-sequencing batch reactor for wastewater treatment: Study on influencing factors and impact on symbiotic microbial ecology.

PubMed

Ye, Jianfeng; Liang, Junyu; Wang, Liang; Markou, Giorgos; Jia, Qilong

2018-03-01

Wastewater treatment technology with better energy efficiency and recyclability is in urgent demand. Photo-Sequencing batch reactor (SBR), which introduces microalgae into conventional SBR, is considered to have more potential for resource recycling. In this study, a photo-SBR was evaluated through the manipulation of several key operational parameters, i.e., aeration strength, light supply intensity and time per cycle, and solid retention time (SRT). The algal-bacterial symbiotic system had the potential of removing COD, NH 4 + -N and TN with limited aeration, representing the advantage of energy-saving by low aeration requirement. Maintaining appropriate proportion of microalgae in the symbiotic system is critical for good system performance. Introducing microalgae into conventional SBR has obvious impact on the original microbial ecology. When the concentration of microalgae is too high (>4.60 mg Chl/L), the inhibition on certain phyla of bacteria, e.g., Bacteroidetes and Actinobacteria, would become prominent and not conducive to the stable operation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Accumulation and therapeutic modulation of 6-sulfo LacNAc(+) dendritic cells in multiple sclerosis.

PubMed

Thomas, Katja; Dietze, Kristin; Wehner, Rebekka; Metz, Imke; Tumani, Hayrettin; Schultheiß, Thorsten; Günther, Claudia; Schäkel, Knut; Reichmann, Heinz; Brück, Wolfgang; Schmitz, Marc; Ziemssen, Tjalf

2014-10-01

To examine the potential role of 6-sulfo LacNAc(+) (slan) dendritic cells (DCs) displaying pronounced proinflammatory properties in the pathogenesis of multiple sclerosis (MS). We determined the presence of slanDCs in demyelinated brain lesions and CSF samples of patients with MS. In addition, we explored the impact of methylprednisolone, interferon-β, glatiramer acetate, or natalizumab on the frequency of blood-circulating slanDCs in patients with MS. We also evaluated whether interferon-β modulates important proinflammatory capabilities of slanDCs. SlanDCs accumulate in highly inflammatory brain lesions and are present in the majority of CSF samples of patients with MS. Short-term methylprednisolone administration reduces the percentage of slanDCs in blood of patients with MS and the proportion of tumor necrosis factor-α- or CD150-expressing slanDCs. Long-term interferon-β treatment decreases the percentage of blood-circulating slanDCs in contrast to glatiramer acetate or natalizumab. Furthermore, interferon-β inhibits the secretion of proinflammatory cytokines by slanDCs and their capacity to promote proliferation and differentiation of T cells. Accumulation of slanDCs in highly inflammatory brain lesions and their presence in CSF indicate that slanDCs may play an important role in the immunopathogenesis of MS. The reduction of blood-circulating slanDCs and the inhibition of their proinflammatory properties by methylprednisolone and interferon-β may contribute to the therapeutic efficiency of these drugs in patients with MS.

Accumulation and therapeutic modulation of 6-sulfo LacNAc+ dendritic cells in multiple sclerosis

PubMed Central

Thomas, Katja; Dietze, Kristin; Wehner, Rebekka; Metz, Imke; Tumani, Hayrettin; Schultheiß, Thorsten; Günther, Claudia; Schäkel, Knut; Reichmann, Heinz; Brück, Wolfgang; Schmitz, Marc

2014-01-01

Objective: To examine the potential role of 6-sulfo LacNAc+ (slan) dendritic cells (DCs) displaying pronounced proinflammatory properties in the pathogenesis of multiple sclerosis (MS). Methods: We determined the presence of slanDCs in demyelinated brain lesions and CSF samples of patients with MS. In addition, we explored the impact of methylprednisolone, interferon-β, glatiramer acetate, or natalizumab on the frequency of blood-circulating slanDCs in patients with MS. We also evaluated whether interferon-β modulates important proinflammatory capabilities of slanDCs. Results: SlanDCs accumulate in highly inflammatory brain lesions and are present in the majority of CSF samples of patients with MS. Short-term methylprednisolone administration reduces the percentage of slanDCs in blood of patients with MS and the proportion of tumor necrosis factor-α– or CD150-expressing slanDCs. Long-term interferon-β treatment decreases the percentage of blood-circulating slanDCs in contrast to glatiramer acetate or natalizumab. Furthermore, interferon-β inhibits the secretion of proinflammatory cytokines by slanDCs and their capacity to promote proliferation and differentiation of T cells. Conclusion: Accumulation of slanDCs in highly inflammatory brain lesions and their presence in CSF indicate that slanDCs may play an important role in the immunopathogenesis of MS. The reduction of blood-circulating slanDCs and the inhibition of their proinflammatory properties by methylprednisolone and interferon-β may contribute to the therapeutic efficiency of these drugs in patients with MS. PMID:25340085

Hypothesis testing in students: Sequences, stages, and instructional strategies

NASA Astrophysics Data System (ADS)

Moshman, David; Thompson, Pat A.

Six sequences in the development of hypothesis-testing conceptions are proposed, involving (a) interpretation of the hypothesis; (b) the distinction between using theories and testing theories; (c) the consideration of multiple possibilities; (d) the relation of theory and data; (e) the nature of verification and falsification; and (f) the relation of truth and falsity. An alternative account is then provided involving three global stages: concrete operations, formal operations, and a postformal metaconstructivestage. Relative advantages and difficulties of the stage and sequence conceptualizations are discussed. Finally, three families of teaching strategy are distinguished, which emphasize, respectively: (a) social transmission of knowledge; (b) carefully sequenced empirical experience by the student; and (c) self-regulated cognitive activity of the student. It is argued on the basis of Piaget's theory that the last of these plays a crucial role in the construction of such logical reasoning strategies as those involved in testing hypotheses.

Spatiotemporal attention operator using isotropic contrast and regional homogeneity

NASA Astrophysics Data System (ADS)

Palenichka, Roman; Lakhssassi, Ahmed; Zaremba, Marek

2011-04-01

A multiscale operator for spatiotemporal isotropic attention is proposed to reliably extract attention points during image sequence analysis. Its consecutive local maxima indicate attention points as the centers of image fragments of variable size with high intensity contrast, region homogeneity, regional shape saliency, and temporal change presence. The scale-adaptive estimation of temporal change (motion) and its aggregation with the regional shape saliency contribute to the accurate determination of attention points in image sequences. Multilocation descriptors of an image sequence are extracted at the attention points in the form of a set of multidimensional descriptor vectors. A fast recursive implementation is also proposed to make the operator's computational complexity independent from the spatial scale size, which is the window size in the spatial averaging filter. Experiments on the accuracy of attention-point detection have proved the operator consistency and its high potential for multiscale feature extraction from image sequences.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Operational Dynamic Configuration Analysis

NASA Technical Reports Server (NTRS)

Lai, Chok Fung; Zelinski, Shannon

2010-01-01

Sectors may combine or split within areas of specialization in response to changing traffic patterns. This method of managing capacity and controller workload could be made more flexible by dynamically modifying sector boundaries. Much work has been done on methods for dynamically creating new sector boundaries [1-5]. Many assessments of dynamic configuration methods assume the current day baseline configuration remains fixed [6-7]. A challenging question is how to select a dynamic configuration baseline to assess potential benefits of proposed dynamic configuration concepts. Bloem used operational sector reconfigurations as a baseline [8]. The main difficulty is that operational reconfiguration data is noisy. Reconfigurations often occur frequently to accommodate staff training or breaks, or to complete a more complicated reconfiguration through a rapid sequence of simpler reconfigurations. Gupta quantified a few aspects of airspace boundary changes from this data [9]. Most of these metrics are unique to sector combining operations and not applicable to more flexible dynamic configuration concepts. To better understand what sort of reconfigurations are acceptable or beneficial, more configuration change metrics should be developed and their distribution in current practice should be computed. This paper proposes a method to select a simple sequence of configurations among operational configurations to serve as a dynamic configuration baseline for future dynamic configuration concept assessments. New configuration change metrics are applied to the operational data to establish current day thresholds for these metrics. These thresholds are then corroborated, refined, or dismissed based on airspace practitioner feedback. The dynamic configuration baseline selection method uses a k-means clustering algorithm to select the sequence of configurations and trigger times from a given day of operational sector combination data. The clustering algorithm selects a simplified

Curriculum Guidelines for Operative Dentistry.

ERIC Educational Resources Information Center

Journal of Dental Education, 1984

1984-01-01

The American Association of Dental Schools' guidelines for operative dentistry curricula include an overview of the scope and objectives of operative dentistry, notes on the interrelationship of the discipline and the total curriculum, and an outline of primary educational goals, core content, specific behavioral objectives, sequencing, faculty,…

Secrets of the lac operon. Glucose hysteresis as a mechanism in dietary restriction, aging and disease.

PubMed

Mobbs, Charles V; Mastaitis, Jason W; Zhang, Minhua; Isoda, Fumiko; Cheng, Hui; Yen, Kelvin

2007-01-01

Elevated blood glucose associated with diabetes produces progressive and apparently irreversible damage to many cell types. Conversely, reduction of glucose extends life span in yeast, and dietary restriction reduces blood glucose. Therefore it has been hypothesized that cumulative toxic effects of glucose drive at least some aspects of the aging process and, conversely, that protective effects of dietary restriction are mediated by a reduction in exposure to glucose. The mechanisms mediating cumulative toxic effects of glucose are suggested by two general principles of metabolic processes, illustrated by the lac operon but also observed with glucose-induced gene expression. First, metabolites induce the machinery of their own metabolism. Second, induction of gene expression by metabolites can entail a form of molecular memory called hysteresis. When applied to glucose-regulated gene expression, these two principles suggest a mechanism whereby repetitive exposure to postprandial excursions of glucose leads to an age-related increase in glycolytic capacity (and reduction in beta-oxidation of free fatty acids), which in turn leads to an increased generation of oxidative damage and a decreased capacity to respond to oxidative damage, independent of metabolic rate. According to this mechanism, dietary restriction increases life span and reduces pathology by reducing exposure to glucose and therefore delaying the development of glucose-induced glycolytic capacity.

Translational regulation of sigma 32 synthesis: requirement for an internal control element.

PubMed Central

Kamath-Loeb, A S; Gross, C A

1991-01-01

We have investigated the sequence requirements for the translational regulation of sigma 32 by examining the behavior of a new rpoH-lacZ protein fusion containing a short N-terminal fragment of sigma 32 fused to beta-galactosidase. Although the fusion retains rpoH translational initiation signals, it lacks translational regulation, implicating coding sequences within rpoH in this regulatory process. Images PMID:2050641

Simultaneous Cognitive Operations in Working Memory After Dual-Task Practice

ERIC Educational Resources Information Center

Oberauer, Klaus; Kliegl, Reinhold

2004-01-01

The authors tested the hypothesis that with adequate practice, people can execute 2 cognitive operations in working memory simultaneously. In Experiment 1, 6 students practiced updating 2 items in working memory through 2 sequences of operations (1 numerical, 1 spatial). In different blocks, imperative stimuli for the 2 sequences of operations…

Method and Apparatus for Evaluating the Visual Quality of Processed Digital Video Sequences

NASA Technical Reports Server (NTRS)

Watson, Andrew B. (Inventor)

2002-01-01

A Digital Video Quality (DVQ) apparatus and method that incorporate a model of human visual sensitivity to predict the visibility of artifacts. The DVQ method and apparatus are used for the evaluation of the visual quality of processed digital video sequences and for adaptively controlling the bit rate of the processed digital video sequences without compromising the visual quality. The DVQ apparatus minimizes the required amount of memory and computation. The input to the DVQ apparatus is a pair of color image sequences: an original (R) non-compressed sequence, and a processed (T) sequence. Both sequences (R) and (T) are sampled, cropped, and subjected to color transformations. The sequences are then subjected to blocking and discrete cosine transformation, and the results are transformed to local contrast. The next step is a time filtering operation which implements the human sensitivity to different time frequencies. The results are converted to threshold units by dividing each discrete cosine transform coefficient by its respective visual threshold. At the next stage the two sequences are subtracted to produce an error sequence. The error sequence is subjected to a contrast masking operation, which also depends upon the reference sequence (R). The masked errors can be pooled in various ways to illustrate the perceptual error over various dimensions, and the pooled error can be converted to a visual quality measure.

Implementing Distributed Operations: A Comparison of Two Deep Space Missions

NASA Technical Reports Server (NTRS)

Mishkin, Andrew; Larsen, Barbara

2006-01-01

Two very different deep space exploration missions--Mars Exploration Rover and Cassini--have made use of distributed operations for their science teams. In the case of MER, the distributed operations capability was implemented only after the prime mission was completed, as the rovers continued to operate well in excess of their expected mission lifetimes; Cassini, designed for a mission of more than ten years, had planned for distributed operations from its inception. The rapid command turnaround timeline of MER, as well as many of the operations features implemented to support it, have proven to be conducive to distributed operations. These features include: a single science team leader during the tactical operations timeline, highly integrated science and engineering teams, processes and file structures designed to permit multiple team members to work in parallel to deliver sequencing products, web-based spacecraft status and planning reports for team-wide access, and near-elimination of paper products from the operations process. Additionally, MER has benefited from the initial co-location of its entire operations team, and from having a single Principal Investigator, while Cassini operations have had to reconcile multiple science teams distributed from before launch. Cassini has faced greater challenges in implementing effective distributed operations. Because extensive early planning is required to capture science opportunities on its tour and because sequence development takes significantly longer than sequence execution, multiple teams are contributing to multiple sequences concurrently. The complexity of integrating inputs from multiple teams is exacerbated by spacecraft operability issues and resource contention among the teams, each of which has their own Principal Investigator. Finally, much of the technology that MER has exploited to facilitate distributed operations was not available when the Cassini ground system was designed, although later adoption

Spatial and Temporal Variations in Diatoms from la Chaine des Lacs Urban Watershed, Nord-Pas France, in Relation to Water Quality

NASA Astrophysics Data System (ADS)

Noble, P. J.; Van de Vijver, B.; Verleyen, E.; Prygiel, J.; Ivanovsky, A.; Lesven, L.; Billon, G.

2016-12-01

Diatom analysis was conducted on lake sediments in la Chaîne des Lacs (CDL), a shallow eutrophic urban park and storm control system in Villeneuve d'Ascq, France, to address both the present day water quality, and the evolution of this urban system over its 40 year history. The main lake, Lac du Héron (LDH), received recent attention because of water quality problems, including eutrophication, harmful algal blooms, and invasion by the macrophyte Elodea in 2012. A total of 17 sites were collected in CDL, 11 of which were in LDH, to document spatial variability, and a 26cm long core addresses historical changes. The bulk of the diatom assemblage in LDH can be classified as both eutrophic and moderately metal tolerant, using modern national diatom indices developed and used by the French regional water agencies. Surface sediment samples within LDH show large spatial variations in %Cocconeis placentula whose habitat is epiphytic growth on Elodea. Other variation is reflected in the phytoplankton composition both spatially, and interannually. Aulacoseira muzzanensis and Cyclostephanos dubius showed greater abundance in the open water habitats in LDH, whereas sites in CDL outside of LDH had greater Cyclotella meneghiniana. Temporally, Stephanodicsus (largely S. hantzschii), the dominant diatom in early spring, were present in greater abundances in the 2016 surface sediment samples than in any of the 2015 samples. One possible explanation is that the 2016 samples, taken March 30th, preferentially preserved the early spring Stephanodiscus bloom, in contrast to the 2015 samples, which were taken in January. The sediment core provides an historical record, where the uppermost 4cm plot with the bulk of the LDH surface samples and contain abundant Cocconeis, 4 -14cm is phytoplankton-rich, largely Cyclostephanos dubius and Aulacoseira muzzanensis, and represents a less weed-choked environment prior to the 2012 Elodea invasion. The base of the core is dominated by Amphora and

Neocortical malformation as consequence of nonadaptive regulation of neuronogenetic sequence

NASA Technical Reports Server (NTRS)

Caviness, V. S. Jr; Takahashi, T.; Nowakowski, R. S.

2000-01-01

Variations in the structure of the neocortex induced by single gene mutations may be extreme or subtle. They differ from variations in neocortical structure encountered across and within species in that these "normal" structural variations are adaptive (both structurally and behaviorally), whereas those associated with disorders of development are not. Here we propose that they also differ in principle in that they represent disruptions of molecular mechanisms that are not normally regulatory to variations in the histogenetic sequence. We propose an algorithm for the operation of the neuronogenetic sequence in relation to the overall neocortical histogenetic sequence and highlight the restriction point of the G1 phase of the cell cycle as the master regulatory control point for normal coordinate structural variation across species and importantly within species. From considerations based on the anatomic evidence from neocortical malformation in humans, we illustrate in principle how this overall sequence appears to be disrupted by molecular biological linkages operating principally outside the control mechanisms responsible for the normal structural variation of the neocortex. MRDD Research Reviews 6:22-33, 2000. Copyright 2000 Wiley-Liss, Inc.

Photodithazine photodynamic effect on viability of 9L/lacZ gliosarcoma cell line.

PubMed

Fontana, Leticia C; Pinto, Juliana G; Pereira, André H C; Soares, Cristina P; Raniero, Leandro J; Ferreira-Strixino, Juliana

2017-08-01

Even with the advances of conventional treatment techniques, the nervous system cancer prognosis is still not favorable to the patient which makes alternative therapies needed to be studied. Photodynamic therapy (PDT) is presented as a promising therapy, which employs a photosensitive (PS) agent, light wavelength suitable for the PS agent, and molecular oxygen, producing reactive oxygen species in order to induce cell death. The aim of this study is to observe the PDT action in gliosarcoma cell using a chlorin (Photodithazine, PDZ). The experiments were done with 9L/lacZ lineage cells, grown in a DMEM medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution and put in a culture chamber at 37 °C with an atmosphere of 5% CO 2 . The PS agent used was the PDZ to an LED light source device (Biopdi/IRRAD-LED 660) in the 660-nm region. The location of the PS agent was analyzed by fluorescence microscopy, and cell viability was analyzed by MTT assay (mitochondrial activity), exclusion by trypan blue (cell viability), and morphological examination through an optical microscope (Leica MD 2500). In the analysis of the experiments with PDZ, there was 100% cell death at different concentrations and clear morphological differences in groups with and without treatment. Furthermore, it was observed that the photodithazine has been focused on all nuclear and cytoplasmic extension; however, it cannot be said for sure whether the location is in the inside core region or on the plasma membrane. In general, the PDZ showed a promising photosensitive agent in PDT for the use of gliosarcoma.

Hidden Markov models of biological primary sequence information.

PubMed Central

Baldi, P; Chauvin, Y; Hunkapiller, T; McClure, M A

1994-01-01

Hidden Markov model (HMM) techniques are used to model families of biological sequences. A smooth and convergent algorithm is introduced to iteratively adapt the transition and emission parameters of the models from the examples in a given family. The HMM approach is applied to three protein families: globins, immunoglobulins, and kinases. In all cases, the models derived capture the important statistical characteristics of the family and can be used for a number of tasks, including multiple alignments, motif detection, and classification. For K sequences of average length N, this approach yields an effective multiple-alignment algorithm which requires O(KN2) operations, linear in the number of sequences. PMID:8302831

Single shot FASTBUS sequencer

NASA Astrophysics Data System (ADS)

Ikeda, H.

1989-10-01

A description is given of a single-shot sequencer, a FASTBUS master module that can execute only a predetermined FASTBUS WRITE operation. The execution cycle is directly activated by an external signal. The module is a single-width auxiliary card mounted on a rear slot adjacent to the crate ancillary card. The application of the module to the TOPAZ data acquisition system of TRISTAN is discussed, and the circuit itself is described.

Sequence information gain based motif analysis.

PubMed

Maynou, Joan; Pairó, Erola; Marco, Santiago; Perera, Alexandre

2015-11-09

The detection of regulatory regions in candidate sequences is essential for the understanding of the regulation of a particular gene and the mechanisms involved. This paper proposes a novel methodology based on information theoretic metrics for finding regulatory sequences in promoter regions. This methodology (SIGMA) has been tested on genomic sequence data for Homo sapiens and Mus musculus. SIGMA has been compared with different publicly available alternatives for motif detection, such as MEME/MAST, Biostrings (Bioconductor package), MotifRegressor, and previous work such Qresiduals projections or information theoretic based detectors. Comparative results, in the form of Receiver Operating Characteristic curves, show how, in 70% of the studied Transcription Factor Binding Sites, the SIGMA detector has a better performance and behaves more robustly than the methods compared, while having a similar computational time. The performance of SIGMA can be explained by its parametric simplicity in the modelling of the non-linear co-variability in the binding motif positions. Sequence Information Gain based Motif Analysis is a generalisation of a non-linear model of the cis-regulatory sequences detection based on Information Theory. This generalisation allows us to detect transcription factor binding sites with maximum performance disregarding the covariability observed in the positions of the training set of sequences. SIGMA is freely available to the public at http://b2slab.upc.edu.

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

An experimental phylogeny to benchmark ancestral sequence reconstruction

PubMed Central

Randall, Ryan N.; Radford, Caelan E.; Roof, Kelsey A.; Natarajan, Divya K.; Gaucher, Eric A.

2016-01-01

Ancestral sequence reconstruction (ASR) is a still-burgeoning method that has revealed many key mechanisms of molecular evolution. One criticism of the approach is an inability to validate its algorithms within a biological context as opposed to a computer simulation. Here we build an experimental phylogeny using the gene of a single red fluorescent protein to address this criticism. The evolved phylogeny consists of 19 operational taxonomic units (leaves) and 17 ancestral bifurcations (nodes) that display a wide variety of fluorescent phenotypes. The 19 leaves then serve as ‘modern' sequences that we subject to ASR analyses using various algorithms and to benchmark against the known ancestral genotypes and ancestral phenotypes. We confirm computer simulations that show all algorithms infer ancient sequences with high accuracy, yet we also reveal wide variation in the phenotypes encoded by incorrectly inferred sequences. Specifically, Bayesian methods incorporating rate variation significantly outperform the maximum parsimony criterion in phenotypic accuracy. Subsampling of extant sequences had minor effect on the inference of ancestral sequences. PMID:27628687

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

SBLOCA outside containment at Browns Ferry Unit One: accident sequence analysis. [Small break

DOE Office of Scientific and Technical Information (OSTI.GOV)

Condon, W.A.; Harrington, R.M.; Greene, S.R.

1982-11-01

This study describes the predicted response of Unit 1 at the Browns Ferry Nuclear Plant to a postulated small-break loss-of-coolant accident outside of the primary containment. The break has been assumed to occur in the scram discharge volume piping immediately following a reactor scram that cannot be reset. The events before core uncovering are discussed for both the worst-case accident sequence without operator action and for the more likely sequences with operator action. Without operator action, the events after core uncovering would include core meltdown and subsequent containment failure, and this event sequence has been determined through use of themore » MARCH code. An estimate of the magnitude and timing of the concomitant release of the noble gas, cesium, and iodine-based fission products to the environment is provided in Volume 2 of this report.« less

Memetic algorithms for de novo motif-finding in biomedical sequences.

PubMed

Bi, Chengpeng

2012-09-01

The objectives of this study are to design and implement a new memetic algorithm for de novo motif discovery, which is then applied to detect important signals hidden in various biomedical molecular sequences. In this paper, memetic algorithms are developed and tested in de novo motif-finding problems. Several strategies in the algorithm design are employed that are to not only efficiently explore the multiple sequence local alignment space, but also effectively uncover the molecular signals. As a result, there are a number of key features in the implementation of the memetic motif-finding algorithm (MaMotif), including a chromosome replacement operator, a chromosome alteration-aware local search operator, a truncated local search strategy, and a stochastic operation of local search imposed on individual learning. To test the new algorithm, we compare MaMotif with a few of other similar algorithms using simulated and experimental data including genomic DNA, primary microRNA sequences (let-7 family), and transmembrane protein sequences. The new memetic motif-finding algorithm is successfully implemented in C++, and exhaustively tested with various simulated and real biological sequences. In the simulation, it shows that MaMotif is the most time-efficient algorithm compared with others, that is, it runs 2 times faster than the expectation maximization (EM) method and 16 times faster than the genetic algorithm-based EM hybrid. In both simulated and experimental testing, results show that the new algorithm is compared favorably or superior to other algorithms. Notably, MaMotif is able to successfully discover the transcription factors' binding sites in the chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-Seq) data, correctly uncover the RNA splicing signals in gene expression, and precisely find the highly conserved helix motif in the transmembrane protein sequences, as well as rightly detect the palindromic segments in the primary micro

From the Blazar Sequence to the Blazar Envelope: Revisiting the Relativistic Jet Dichotomy in Radio-Loud AGN

NASA Technical Reports Server (NTRS)

Meyer, Eileen T.; Fossati, Giovanini; Georganopoulos, Markos; Lister, Matthew L.

2012-01-01

We revisit the concept of a blazar sequence that relates the synchrotron peak frequency (Vpeak) in blazars with synchrotron peak luminosity (Lpeak, in vLv) using a large sample of radio-loud AGN. We present observational evidence that the blazar sequence is formed from two populations in the synchrotron Vpeak - Lpeak plane, each forming an upper edge to an envelope of progressively misaligned blazars, and connecting to an adjacent group of radio galaxies having jets viewed at much larger angles to the line of sight. When binned by jet kinetic power (Lkin; as measured through a scaling relationship with extended radio power), we find that radio core dominance decreases with decreasing synchrotron Lpeak, revealing that sources in the envelope are generally more misaligned. We find population-based evidence of velocity gradients in jets at low kinetic powers (approximately 10(exp 42) - 10(exp 44.5) erg s(exp -1)), corresponding to FR I radio galaxies and most BL Lacs. These low jet power 'weak jet' sources, thought to exhibit radiatively inefficient accretion, are distinguished from the population of non-decelerating, low synchrotron-peaking (LSP) blazars and FR II radio galaxies ('strong' jets) which are thought to exhibit radiatively efficient accretion. The two-population interpretation explains the apparent contradiction of the existence of highly core-dominated, low-power blazars at both low and high synchrotron peak frequencies, and further implies that most intermediate synchrotron peak (ISP) sources are not intermediate in intrinsic jet power between LSP and high synchrotron-peaking (HSP) sources, but are more misaligned versions of HSP sources with similar jet powers.

IMM estimator with out-of-sequence measurements

NASA Astrophysics Data System (ADS)

Bar-Shalom, Yaakov; Chen, Huimin

2004-08-01

In multisensor tracking systems that operate in a centralized information processing architecture, measurements from the same target obtained by different sensors can arrive at the processing center out of sequence. In order to avoid either a delay in the output or the need for reordering and reprocessing an entire sequence of measurements, such measurements have to be processed as out-of-sequence measurements (OOSM). Recent work developed procedures for incorporating OOSMs into a Kalman filter (KF). Since the state of the art tracker for real (maneuvering) targets is the Interacting Multiple Model (IMM) estimator, this paper presents the algorithm for incorporating OOSMs into an IMM estimator. Both data association and estimation are considered. Simulation results are presented for two realistic problems using measurements from two airborne GMTI sensors. It is shown that the proposed algorithm for incorporating OOSMs into an IMM estimator yields practically the same performance as the reordering and in-sequence reprocessing of the measurements.

COMOC 2: Two-dimensional aerodynamics sequence, computer program user's guide

NASA Technical Reports Server (NTRS)

Manhardt, P. D.; Orzechowski, J. A.; Baker, A. J.

1977-01-01

The COMOC finite element fluid mechanics computer program system is applicable to diverse problem classes. The two dimensional aerodynamics sequence was established for solution of the potential and/or viscous and turbulent flowfields associated with subsonic flight of elementary two dimensional isolated airfoils. The sequence is constituted of three specific flowfield options in COMOC for two dimensional flows. These include the potential flow option, the boundary layer option, and the parabolic Navier-Stokes option. By sequencing through these options, it is possible to computationally construct a weak-interaction model of the aerodynamic flowfield. This report is the user's guide to operation of COMOC for the aerodynamics sequence.

Novel interactions of complex carbohydrates with peanut (PNA), Ricinus communis (RCA-I), Sambucus nigra (SNA-I) and wheat germ (WGA) agglutinins as revealed by the binding specificities of these lectins towards mucin core-2 O-linked and N-linked glycans and related structures.

PubMed

Chandrasekaran, E V; Xue, Jun; Xia, Jie; Khaja, Siraj D; Piskorz, Conrad F; Locke, Robert D; Neelamegham, Sriram; Matta, Khushi L

2016-10-01

Plant lectins through their multivalent quaternary structures bind intrinsically flexible oligosaccharides. They recognize fine structural differences in carbohydrates and interact with different sequences in mucin core 2 or complex-type N-glycan chain and also in healthy and malignant tissues. They are used in characterizing cellular and extracellular glycoconjugates modified in pathological processes. We study here, the complex carbohydrate-lectin interactions by determining the effects of substituents in mucin core 2 tetrasaccharide Galβ1-4GlcNAcβ1-6(Galβ1-3)GalNAcα-O-R and fetuin glycopeptides on their binding to agarose-immobilized lectins PNA, RCA-I, SNA-I and WGA. Briefly, in mucin core 2 tetrasaccharide (i) structures modified by α2-3/6-Sialyl LacNAc, LewisX and α1-3-Galactosyl LacNAc resulted in regular binding to PNA whereas compounds with 6-sulfo LacNAc displayed no-binding; (ii) strucures bearing α2-6-sialyl 6-sulfo LacNAc, or 6-sialyl LacdiNAc carbohydrates displayed strong binding to SNA-I; (iii) structures with α2-3/6-sialyl, α1-3Gal LacNAc or LewisX were non-binder to RCA-I and compounds with 6-sulfo LacNAc only displayed weak binding; (iv) structures containing LewisX, 6-Sulfo LewisX, α2-3/6-sialyl LacNAc, α2-3/6-sialyl 6-sulfo LacNAc and GalNAc Lewis-a were non-binding to WGA, those with α1-2Fucosyl, α1-3-Galactosyl LacNAc, α2-3-sialyl T-hapten plus 3'/6'sulfo LacNAc displayed weak binding, and compounds with α2-3-sialyl T-hapten, α2.6-Sialyl LacdiNAc, α2-3-sialyl D-Fucβ1-3 GalNAc and Fucα-1-2 D-Fucβ-1-3GalNAc displaying regular binding and GalNAc LewisX and LacdiNAc plus D-Fuc β-1-3 GalNAcα resulting in tight binding. RCA-I binds Fetuin triantennary asialoglycopeptide 100 % after α-2-3 and 25 % after α-2-6 sialylation, 30 % after α-1-2 and 100 % after α-1-3 fucosylation, and 50 % after α-1-3 galactosylation. WGA binds 3-but not 6-Fucosyl chitobiose core. Thus, information on the influence of complex carbohydrate

Robot Sequencing and Visualization Program (RSVP)

NASA Technical Reports Server (NTRS)

Cooper, Brian K.; Maxwell,Scott A.; Hartman, Frank R.; Wright, John R.; Yen, Jeng; Toole, Nicholas T.; Gorjian, Zareh; Morrison, Jack C

2013-01-01

The Robot Sequencing and Visualization Program (RSVP) is being used in the Mars Science Laboratory (MSL) mission for downlink data visualization and command sequence generation. RSVP reads and writes downlink data products from the operations data server (ODS) and writes uplink data products to the ODS. The primary users of RSVP are members of the Rover Planner team (part of the Integrated Planning and Execution Team (IPE)), who use it to perform traversability/articulation analyses, take activity plan input from the Science and Mission Planning teams, and create a set of rover sequences to be sent to the rover every sol. The primary inputs to RSVP are downlink data products and activity plans in the ODS database. The primary outputs are command sequences to be placed in the ODS for further processing prior to uplink to each rover. RSVP is composed of two main subsystems. The first, called the Robot Sequence Editor (RoSE), understands the MSL activity and command dictionaries and takes care of converting incoming activity level inputs into command sequences. The Rover Planners use the RoSE component of RSVP to put together command sequences and to view and manage command level resources like time, power, temperature, etc. (via a transparent realtime connection to SEQGEN). The second component of RSVP is called HyperDrive, a set of high-fidelity computer graphics displays of the Martian surface in 3D and in stereo. The Rover Planners can explore the environment around the rover, create commands related to motion of all kinds, and see the simulated result of those commands via its underlying tight coupling with flight navigation, motor, and arm software. This software is the evolutionary replacement for the Rover Sequencing and Visualization software used to create command sequences (and visualize the Martian surface) for the Mars Exploration Rover mission.

AlignMe—a membrane protein sequence alignment web server

PubMed Central

Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.

2014-01-01

We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425

Designing of deployment sequence for braking and drift systems in atmosphere of Mars and Venus

NASA Astrophysics Data System (ADS)

Vorontsov, Victor

2006-07-01

Analysis of project development and space research using contact method, namely, by means of automatic descent modules and balloons shows that designing formation of entry, descent and landing (EDL) sequence and operation in the atmosphere are of great importance. This process starts at the very beginning of designing, has undergone a lot of iterations and influences processing of normal operation results. Along with designing of descent module systems, including systems of braking in the atmosphere, designing of flight operation sequence and trajectories of motion in the atmosphere is performed. As the entire operation sequence and transfer from one phase to another was correctly chosen, the probability of experiment success on the whole and efficiency of application of various systems vary. By now the most extensive experience of Russian specialists in research of terrestrial planets has been gained with the help of automatic interplanetary stations “Mars”, “Venera”, “Vega” which had descent modules and drifting in the atmosphere balloons. Particular interest and complicity of formation of EDL and drift sequence in the atmosphere of these planets arise from radically different operation conditions, in particular, strongly rarefied atmosphere of the one planet and extremely dense atmosphere of another. Consequently, this determines the choice of braking systems and their parameters and method of EDL consequence formation. At the same time there are general fundamental methods and designed research techniques that allowed taking general technical approach to designing of EDL and drift sequence in the atmosphere.

The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

PubMed

Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

1998-06-01

We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

RIKEN Integrated Sequence Analysis (RISA) System—384-Format Sequencing Pipeline with 384 Multicapillary Sequencer

PubMed Central

Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Nagaoka, Sumiharu; Sasaki, Nobuya; Carninci, Piero; Konno, Hideaki; Akiyama, Junichi; Nishi, Katsuo; Kitsunai, Tokuji; Tashiro, Hideo; Itoh, Mari; Sumi, Noriko; Ishii, Yoshiyuki; Nakamura, Shin; Hazama, Makoto; Nishine, Tsutomu; Harada, Akira; Yamamoto, Rintaro; Matsumoto, Hiroyuki; Sakaguchi, Sumito; Ikegami, Takashi; Kashiwagi, Katsuya; Fujiwake, Syuji; Inoue, Kouji; Togawa, Yoshiyuki; Izawa, Masaki; Ohara, Eiji; Watahiki, Masanori; Yoneda, Yuko; Ishikawa, Tomokazu; Ozawa, Kaori; Tanaka, Takumi; Matsuura, Shuji; Kawai, Jun; Okazaki, Yasushi; Muramatsu, Masami; Inoue, Yorinao; Kira, Akira; Hayashizaki, Yoshihide

2000-01-01

The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3′ end and 5′ end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can

The Biomolecule Sequencer Project: Nanopore Sequencing as a Dual-Use Tool for Crew Health and Astrobiology Investigations

NASA Technical Reports Server (NTRS)

John, K. K.; Botkin, D. S.; Burton, A. S.; Castro-Wallace, S. L.; Chaput, J. D.; Dworkin, J. P.; Lehman, N.; Lupisella, M. L.; Mason, C. E.; Smith, D. J.;

Apoptosis induction activity and molecular docking studies of survivin siRNA carried by Fe3O4-PEG-LAC-chitosan-PEI nanoparticles in MCF-7 human breast cancer cells.

PubMed

Arami, Sanam; Mahdavi, Majid; Rashidi, Mohammad-Reza; Yekta, Reza; Rahnamay, Mohammad; Molavi, Leila; Hejazi, Mohammad-Saeid; Samadi, Nasser

2017-08-05

Delivery of small interfering RNAs (siRNAs) into cells still remains a challenge in gene delivery studies. Here, we investigated the ability of synthesized Fe 3 O 4 -PEG-LAC-chitosan-PEI nanoparticles for siRNA delivery of survivin as the model gene into cells. The cellular uptake of survivin siRNA carried by synthesized nanoparticles into MCF-7 breast cancer cell line was evaluated by florescent microscopy and flowcytometry, both proving the efficacy of nanoparticles in delivery of up to 64.7% in comparison with lipofectamine 2000. Furthermore, the delivery of survivin siRNA by the nanoparticles (nanoplex) induced apoptosis that was assessed through DAPI staining and Annexin V/PI assays. In addition, we evaluated the efficacy of treatment with nanoplexes in the presence of mitoxantrone, as a chemotherapeutic agent. Our data indicated that inhibition of survivin expression increased the cell sensitivity to mitoxantrone. Real-time PCR and western blotting analysis revealed a significant reduction in mRNA and protein levels of survivin upon delivery of siRNA. Molecular docking studies showed that nanoparticles can bind to centeral BIR domain of survivin, exactly above zinc ion location with high affinity (ΔG: -10.3Kcal/mol). Also, thermodynamic studies proved the experimental results theoretically, revealing that the siRNA-loaded nanoparticles have a suppressing effect on survivin mRNA. Therefore, delivery of survivin siRNA into MCF-7 cells using Fe 3 O 4 -PEG-LAC-chitosan-PEI nanoparticles as a carrier enhances the cell death. Copyright © 2017 Elsevier B.V. All rights reserved.

Cost, capability, and risk for planetary operations

NASA Technical Reports Server (NTRS)

Mclaughlin, William I.; Deutsch, Marie J.; Miller, Lanny J.; Wolff, Donna M.; Zawacki, Steven J.

1992-01-01

The three key factors for flight projects - cost, capability, and risk - are examined with respect to their interplay, the uplink process, cost drivers, and risk factors. Scientific objectives are translated into a computer program during the uplink process, and examples are given relating to the Voyager Interstellar Mission, Galileo, and the Comet Rendezvous Asteroid Flyby. The development of a multimission sequence system based on these uplinks is described with reference to specific subsystems such as the pointer and the sequence generator. Operational cost drivers include mission, flight-system, and ground-system complexity, uplink traffic, and work force. Operational risks are listed in terms of the mission operations, the environment, and the mission facilities. The uplink process can be analyzed in terms of software development, and spacecraft operability is shown to be an important factor from the initial stages of spacecraft development.

Protected quantum computing: interleaving gate operations with dynamical decoupling sequences.

PubMed

Zhang, Jingfu; Souza, Alexandre M; Brandao, Frederico Dias; Suter, Dieter

2014-02-07

Implementing precise operations on quantum systems is one of the biggest challenges for building quantum devices in a noisy environment. Dynamical decoupling attenuates the destructive effect of the environmental noise, but so far, it has been used primarily in the context of quantum memories. Here, we experimentally demonstrate a general scheme for combining dynamical decoupling with quantum logical gate operations using the example of an electron-spin qubit of a single nitrogen-vacancy center in diamond. We achieve process fidelities >98% for gate times that are 2 orders of magnitude longer than the unprotected dephasing time T2.

Properties of optically selected BL Lacertae candidates from the SDSS

NASA Astrophysics Data System (ADS)

Kügler, S. D.; Nilsson, K.; Heidt, J.; Esser, J.; Schultz, T.

2014-09-01

Context. Deep optical surveys open the avenue for finding large numbers of BL Lac objects that are hard to identify because they lack the unique properties classifying them as such. While radio or X-ray surveys typically reveal dozens of sources, recent compilations based on optical criteria alone have increased the number of BL Lac candidates considerably. However, these compilations are subject to biases and may contain a substantial number of contaminating sources. Aims: In this paper we extend our analysis of 182 optically selected BL Lac object candidates from the SDSS with respect to an earlier study. The main goal is to determine the number of bona fide BL Lac objects in this sample. Methods: We examine their variability characteristics, determine their broad-band radio-UV spectral energy distributions (SEDs), and search for the presence of a host galaxy. In addition we present new optical spectra for 27 targets with improved signal-to-noise ratio with respect to the SDSS spectra. Results: At least 59% of our targets have shown variability between SDSS DR2 and our observations by more than 0.1-0.27 mag depending on the telescope used. A host galaxy was detected in 36% of our targets. The host galaxy type and luminosities are consistent with earlier studies of BL Lac host galaxies. Simple fits to broad-band SEDs for 104 targets of our sample derived synchrotron peak frequencies between 13.5 ≤ log 10(νpeak) ≤ 16 with a peak at log 10 ~ 14.5. Our new optical spectra do not reveal any new redshift for any of our objects. Thus the sample contains a large number of bona fide BL Lac objects and seems to contain a substantial fraction of intermediate-frequency peaked BL Lacs. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory under proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the

Phylogenetically Structured Differences in rRNA Gene Sequence Variation among Species of Arbuscular Mycorrhizal Fungi and Their Implications for Sequence Clustering

PubMed Central

Ekanayake, Saliya; Ruan, Yang; Schütte, Ursel M. E.; Kaonongbua, Wittaya; Fox, Geoffrey; Ye, Yuzhen; Bever, James D.

2016-01-01

ABSTRACT Arbuscular mycorrhizal (AM) fungi form mutualisms with plant roots that increase plant growth and shape plant communities. Each AM fungal cell contains a large amount of genetic diversity, but it is unclear if this diversity varies across evolutionary lineages. We found that sequence variation in the nuclear large-subunit (LSU) rRNA gene from 29 isolates representing 21 AM fungal species generally assorted into genus- and species-level clades, with the exception of species of the genera Claroideoglomus and Entrophospora. However, there were significant differences in the levels of sequence variation across the phylogeny and between genera, indicating that it is an evolutionarily constrained trait in AM fungi. These consistent patterns of sequence variation across both phylogenetic and taxonomic groups pose challenges to interpreting operational taxonomic units (OTUs) as approximations of species-level groups of AM fungi. We demonstrate that the OTUs produced by five sequence clustering methods using 97% or equivalent sequence similarity thresholds failed to match the expected species of AM fungi, although OTUs from AbundantOTU, CD-HIT-OTU, and CROP corresponded better to species than did OTUs from mothur or UPARSE. This lack of OTU-to-species correspondence resulted both from sequences of one species being split into multiple OTUs and from sequences of multiple species being lumped into the same OTU. The OTU richness therefore will not reliably correspond to the AM fungal species richness in environmental samples. Conservatively, this error can overestimate species richness by 4-fold or underestimate richness by one-half, and the direction of this error will depend on the genera represented in the sample. IMPORTANCE Arbuscular mycorrhizal (AM) fungi form important mutualisms with the roots of most plant species. Individual AM fungi are genetically diverse, but it is unclear whether the level of this diversity differs among evolutionary lineages. We found

[Retrospective analysis of the value of arterial blood lactate level and its clearance rate on the prognosis of septic shock patients].

PubMed

Bao, Lei; Zhang, Min; Yan, Peixia; Wu, Xiaoyan; Shao, Jun; Zheng, Ruiqiang

2015-01-01

To explore the prognostic value of arterial blood lactate ( Lac ) levels and lactate clearance rate ( LCR ) in the patients with septic shock. A retrospective study was conducted. Clinical data of 94 septic patients admitted in the Department of Critical Care Medicine in Subei People's Hospital from January 2011 to June 2014 were analyzed. The arterial blood Lac levels at the moment of diagnosis of septic shock ( incipient value, 0 hour ) and early-stage after treatment ( 3, 6 and 24 hours ) were reviewed, and individual LCR was calculated at 3, 6, 24 hours for each patient. According to the outcome in intensive care unit ( ICU ), patients were divided into survival group ( n = 48 ) and death group ( n = 46 ). The Lac and LCR at different time points in two groups were analyzed, and the relationships between them and outcome were analyzed. The receiver-operating characteristic ( ROC ) curve was plotted to assess the value of Lac and LCR at different time points for predicting the outcome. Lac level after treatment in survival group was significantly lower than incipient value, but there was no obvious change in death group. Compared with death group, early Lac levels ( mmol/L ) in survival group were significantly reduced ( 0 hour: 3.80±2.14 vs. 5.75±3.21, 3 hours: 2.05±1.04 vs. 5.03±2.53, 6 hours: 1.80±0.77 vs. 4.40±2.02, 24 hours: 1.35±0.43 vs. 4.90±2.72, P<0.05 or P<0.01 ), the LCR was significantly increased [ 3 hours: 50.00 ( 72.35 )% vs. 13.51 ( 20.67 )%, 6 hours: 41.43 ( 58.42 )% vs. 22.00 ( 22.31 )%, 24 hours: 58.73 ( 29.94 )% vs. 18.92 ( 47.28 )%, P<0.05 or P<0.01 ]. The Lac levels at all time points were positively correlated with the outcome, and 6-hour and 24-hour LCR were negatively correlated with the outcome. According to the incipient Lac level, patients were divided into low Lac group ( Lac<2 mmol/L ), mild Lac group ( Lac 2-3 mmol/L ) and high Lac group ( Lac ≥ 4 mmol/L ). The mortality in low Lac group, mild Lac group, high Lac group

The BL LAC phenomenon: X-ray observations of transition objects and determination of the x-ray spectrum of a complete sample of flat-spectrum radio sources

NASA Technical Reports Server (NTRS)

Worrall, Diana M.

1994-01-01

This report summarizes the activities related to two ROSAT investigations: (1) x-ray properties of radio galaxies thought to contain BL Lac type nuclei; and (2) x-ray spectra of a complete sample of flat-spectrum radio sources. The following papers describing the research are provided as attachments: Multiple X-ray Emission Components in Low Power Radio Galaxies; New X-ray Results on Radio Galaxies; Analysis Techniques for a Multiwavelength Study of Radio Galaxies; Separation of X-ray Emission Components in Radio Galaxies; X-ray Emission in Powerful Radio Galaxies and Quasars; Extended and Compact X-ray Emission in Powerful Radio Galaxies; and X-ray Spectra of a Complete Sample of Extragalactic Core-dominated Radio Sources.

Conditions for the invertibility of the nonlinear difference operator (\\mathscr Rx)(n)=H(x(n),x(n+1)), n\\in\\mathbb Z, in the space of bounded number sequences

NASA Astrophysics Data System (ADS)

Slyusarchuk, Vasilii E.

2009-02-01

Necessary and sufficient conditions are found for the invertibility of the nonlinear difference operator \\displaystyle (\\mathscr Rx)(n)=H(x(n),x(n+1)),\\qquad n\\in\\mathbb Z, in the space of bounded two-sided number sequences. Here H\\colon \\mathbb R^2\\to \\mathbb R is a continuous function. Bibliography: 29 titles.

Microbial community structure in a full-scale anaerobic treatment plant during start-up and first year of operation revealed by high-throughput 16S rRNA gene amplicon sequencing.

PubMed

Fykse, Else Marie; Aarskaug, Tone; Madslien, Elisabeth H; Dybwad, Marius

2016-12-01

High-throughput amplicon sequencing of six biomass samples from a full-scale anaerobic reactor at a Norwegian wood and pulp factory using Biothane Biobed Expanded Granular Sludge Bed (EGSB) technology during start-up and first year of operation was performed. A total of 106,166 16S rRNA gene sequences (V3-V5 region) were obtained. The number of operational taxonomic units (OTUs) ranged from 595 to 2472, and a total of 38 different phyla and 143 families were observed. The predominant phyla were Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Spirochaetes. A more diverse microbial community was observed in the inoculum biomass coming from an Upflow Anaerobic Sludge Blanket (USAB) reactor, reflecting an adaptation of the inoculum diversity to the specific conditions of the new reactor. In addition, no taxa classified as obligate pathogens were identified and potentially opportunistic pathogens were absent or observed in low abundances. No Legionella bacteria were identified by traditional culture-based and molecular methods. Copyright © 2016 Elsevier Ltd. All rights reserved.

End of life care preferences among people of advanced age: LiLACS NZ.

PubMed

Gott, Merryn; Frey, Rosemary; Wiles, Janine; Rolleston, Anna; Teh, Ruth; Moeke-Maxwell, Tess; Kerse, Ngaire

2017-12-19

Understanding end of life preferences amongst the oldest old is crucial to informing appropriate palliative and end of life care internationally. However, little has been reported in the academic literature about the end of life preferences of people in advanced age, particularly the preferences of indigenous older people, including New Zealand Māori. Data on end of life preferences were gathered from 147 Māori (aged >80 years) and 291 non- Māori aged (>85 years), during three waves of Te Puawaitangi O Nga Tapuwae Kia Ora Tonu, Life and Living in Advanced Age (LiLACs NZ). An interviewer-led questionnaire using standardised tools and including Māori specific subsections was used. The top priority for both Māori and non-Māori participants at end of life was 'not being a burden to my family'. Interestingly, a home death was not a high priority for either group. End of life preferences differed by gender, however these differences were culturally contingent. More female Māori participants wanted spiritual practices at end of life than male Māori participants. More male non-Māori participants wanted to be resuscitated than female non- Māori participants. That a home death was not in the top three end of life priorities for our participants is not consistent with palliative care policy in most developed countries where place of death, and particularly home death, is a central concern. Conversely our participants' top concern - namely not being a burden - has received little research or policy attention. Our results also indicate a need to pay attention to diversity in end of life preferences amongst people of advanced age, as well as the socio-cultural context within which preferences are formulated.

Loss of DHR sequences at Browns Ferry Unit One - accident-sequence analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, D.H.; Grene, S.R.; Harrington, R.M.

1983-05-01

This study describes the predicted response of Unit One at the Browns Ferry Nuclear Plant to a postulated loss of decay heat removal (DHR) capability following scram from full power with the power conversion system unavailable. In accident sequences without DHR capability, the residual heat removal (RHR) system functions of pressure suppression pool cooling and reactor vessel shutdown cooling are unavailable. Consequently, all decay heat energy is stored in the pressure suppression pool with a concomitant increase in pool temperature and primary containment pressure. With the assumption that DHR capability is not regained during the lengthy course of this accidentmore » sequence, the containment ultimately fails by overpressurization. Although unlikely, this catastrophic failure might lead to loss of the ability to inject cooling water into the reactor vessel, causing subsequent core uncovery and meltdown. The timing of these events and the effective mitigating actions that might be taken by the operator are discussed in this report.« less

Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

PubMed

Galián, José A; Rosato, Marcela; Rosselló, Josep A

2014-03-01

Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

Supplementary motor area as key structure for domain-general sequence processing: A unified account.

PubMed

Cona, Giorgia; Semenza, Carlo

2017-01-01

The Supplementary Motor Area (SMA) is considered as an anatomically and functionally heterogeneous region and is implicated in several functions. We propose that SMA plays a crucial role in domain-general sequence processes, contributing to the integration of sequential elements into higher-order representations regardless of the nature of such elements (e.g., motor, temporal, spatial, numerical, linguistic, etc.). This review emphasizes the domain-general involvement of the SMA, as this region has been found to support sequence operations in a variety of cognitive domains that, albeit different, share an inherent sequence processing. These include action, time and spatial processing, numerical cognition, music and language processing, and working memory. In this light, we reviewed and synthesized recent neuroimaging, stimulation and electrophysiological studies in order to compare and reconcile the distinct sources of data by proposing a unifying account for the role of the SMA. We also discussed the differential contribution of the pre-SMA and SMA-proper in sequence operations, and possible neural mechanisms by which such operations are executed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Parallel algorithms for large-scale biological sequence alignment on Xeon-Phi based clusters.

PubMed

Lan, Haidong; Chan, Yuandong; Xu, Kai; Schmidt, Bertil; Peng, Shaoliang; Liu, Weiguo

2016-07-19

Computing alignments between two or more sequences are common operations frequently performed in computational molecular biology. The continuing growth of biological sequence databases establishes the need for their efficient parallel implementation on modern accelerators. This paper presents new approaches to high performance biological sequence database scanning with the Smith-Waterman algorithm and the first stage of progressive multiple sequence alignment based on the ClustalW heuristic on a Xeon Phi-based compute cluster. Our approach uses a three-level parallelization scheme to take full advantage of the compute power available on this type of architecture; i.e. cluster-level data parallelism, thread-level coarse-grained parallelism, and vector-level fine-grained parallelism. Furthermore, we re-organize the sequence datasets and use Xeon Phi shuffle operations to improve I/O efficiency. Evaluations show that our method achieves a peak overall performance up to 220 GCUPS for scanning real protein sequence databanks on a single node consisting of two Intel E5-2620 CPUs and two Intel Xeon Phi 7110P cards. It also exhibits good scalability in terms of sequence length and size, and number of compute nodes for both database scanning and multiple sequence alignment. Furthermore, the achieved performance is highly competitive in comparison to optimized Xeon Phi and GPU implementations. Our implementation is available at https://github.com/turbo0628/LSDBS-mpi .

1994 Accident sequence precursor program results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belles, R.J.; Cletcher, J.W.; Copinger, D.A.

1996-01-01

The Accident Sequence Precursor (ASP) Program involves the systematic review and evaluation of operational events that have occurred at light-water reactors to identify and categorize precursors to potential severe core damage accident sequences. The results of the ASP Program are published in an annual report. The most recent report, which contains the analyses of the precursors for 1994, is NUREG/CR-4674, Vols. 21 and 22, Precursors to Potential Severe Core Damage Accidents: 1994, A Status Report, published in December 1995. This article provides an overview of the ASP review and evaluation process and a summary of the results for 1994. 12more » refs., 2 figs., 4 tabs.« less

Spreadsheet-based program for alignment of overlapping DNA sequences.

PubMed

Anbazhagan, R; Gabrielson, E

1999-06-01

Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.

Matrix Transformations between Certain Sequence Spaces over the Non-Newtonian Complex Field

PubMed Central

Efe, Hakan

2014-01-01

In some cases, the most general linear operator between two sequence spaces is given by an infinite matrix. So the theory of matrix transformations has always been of great interest in the study of sequence spaces. In the present paper, we introduce the matrix transformations in sequence spaces over the field ℂ* and characterize some classes of infinite matrices with respect to the non-Newtonian calculus. Also we give the necessary and sufficient conditions on an infinite matrix transforming one of the classical sets over ℂ* to another one. Furthermore, the concept for sequence-to-sequence and series-to-series methods of summability is given with some illustrated examples. PMID:25110740

Loss of control air at Browns Ferry Unit One: accident sequence analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harrington, R.M.; Hodge, S.A.

1986-04-01

This study describes the predicted response of the Browns Ferry Nuclear Plant to a postulated complete failure of plant control air. The failure of plant control air cascades to include the loss of drywell control air at Units 1 and 2. Nevertheless, this is a benign accident unless compounded by simultaneous failures in the turbine-driven high pressure injection systems. Accident sequence calculations are presented for Loss of Control Air sequences with assumed failure upon demand of the Reactor Core Isolation Cooling (RCIC) and the High Pressure Coolant Injection (HPCI) at Unit 1. Sequences with and without operator action are considered.more » Results show that the operators can prevent core uncovery if they take action to utilize the Control Rod Drive Hydraulic System as a backup high pressure injection system.« less

Quiet aircraft design and operational characteristics

NASA Technical Reports Server (NTRS)

Hodge, Charles G.

1991-01-01

The application of aircraft noise technology to the design and operation of aircraft is discussed. Areas of discussion include the setting of target airplane noise levels, operational considerations and their effect on noise, and the sequencing and timing of the design and development process. Primary emphasis is placed on commercial transport aircraft of the type operated by major airlines. Additionally, noise control engineering of other types of aircraft is briefly discussed.

Immunoreactivity of polyclonal antibodies generated against the carboxy terminus of the predicted amino acid sequence of the Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alkatib, G.; Graham, R.; Pelmear-Telenius, A.

1994-09-01

A cDNA fragment spanning the 3{prime}-end of the Huntington disease gene (from 8052 to 9252) was cloned into a prokaryotic expression vector containing the E. Coli lac promoter and a portion of the coding sequence for {beta}-galactosidase. The truncated {beta}-galactosidase gene was cleaved with BamHl and fused in frame to the BamHl fragment of the Huntington disease gene 3{prime}-end. Expression analysis of proteins made in E. Coli revealed that 20-30% of the total cellular proteins was represented by the {beta}-galactosidase-huntingtin fusion protein. The identity of the Huntington disease protein amino acid sequences was confirmed by protein sequence analysis. Affinity chromatographymore » was used to purify large quantities of the fusion protein from bacterial cell lysates. Affinity-purified proteins were used to immunize New Zealand white rabbits for antibody production. The generated polyclonal antibodies were used to immunoprecipitate the Huntington disease gene product expressed in a neuroblastoma cell line. In this cell line the antibodies precipitated two protein bands of apparent gel migrations of 200 and 150 kd which together, correspond to the calculated molecular weight of the Huntington disease gene product (350 kd). Immunoblotting experiments revealed the presence of a large precursor protein in the range of 350-750 kd which is in agreement with the predicted molecular weight of the protein without post-translational modifications. These results indicate that the huntingtin protein is cleaved into two subunits in this neuroblastoma cell line and implicate that cleavage of a large precursor protein may contribute to its biological activity. Experiments are ongoing to determine the precursor-product relationship and to examine the synthesis of the huntingtin protein in freshly isolated rat brains, and to determine cellular and subcellular distribution of the gene product.« less

A gene expression resource generated by genome-wide lacZ profiling in the mouse

PubMed Central

Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.

2015-01-01

ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943

Discriminative prediction of mammalian enhancers from DNA sequence

PubMed Central

Lee, Dongwon; Karchin, Rachel; Beer, Michael A.

2011-01-01

Accurately predicting regulatory sequences and enhancers in entire genomes is an important but difficult problem, especially in large vertebrate genomes. With the advent of ChIP-seq technology, experimental detection of genome-wide EP300/CREBBP bound regions provides a powerful platform to develop predictive tools for regulatory sequences and to study their sequence properties. Here, we develop a support vector machine (SVM) framework which can accurately identify EP300-bound enhancers using only genomic sequence and an unbiased set of general sequence features. Moreover, we find that the predictive sequence features identified by the SVM classifier reveal biologically relevant sequence elements enriched in the enhancers, but we also identify other features that are significantly depleted in enhancers. The predictive sequence features are evolutionarily conserved and spatially clustered, providing further support of their functional significance. Although our SVM is trained on experimental data, we also predict novel enhancers and show that these putative enhancers are significantly enriched in both ChIP-seq signal and DNase I hypersensitivity signal in the mouse brain and are located near relevant genes. Finally, we present results of comparisons between other EP300/CREBBP data sets using our SVM and uncover sequence elements enriched and/or depleted in the different classes of enhancers. Many of these sequence features play a role in specifying tissue-specific or developmental-stage-specific enhancer activity, but our results indicate that some features operate in a general or tissue-independent manner. In addition to providing a high confidence list of enhancer targets for subsequent experimental investigation, these results contribute to our understanding of the general sequence structure of vertebrate enhancers. PMID:21875935

Self-Organizing Hidden Markov Model Map (SOHMMM): Biological Sequence Clustering and Cluster Visualization.

PubMed

Ferles, Christos; Beaufort, William-Scott; Ferle, Vanessa

2017-01-01

The present study devises mapping methodologies and projection techniques that visualize and demonstrate biological sequence data clustering results. The Sequence Data Density Display (SDDD) and Sequence Likelihood Projection (SLP) visualizations represent the input symbolical sequences in a lower-dimensional space in such a way that the clusters and relations of data elements are depicted graphically. Both operate in combination/synergy with the Self-Organizing Hidden Markov Model Map (SOHMMM). The resulting unified framework is in position to analyze automatically and directly raw sequence data. This analysis is carried out with little, or even complete absence of, prior information/domain knowledge.

3D GIS spatial operation based on extended Euler operators

NASA Astrophysics Data System (ADS)

Xu, Hongbo; Lu, Guonian; Sheng, Yehua; Zhou, Liangchen; Guo, Fei; Shang, Zuoyan; Wang, Jing

2008-10-01

The implementation of 3 dimensions spatial operations, based on certain data structure, has a lack of universality and is not able to treat with non-manifold cases, at present. ISO/DIS 19107 standard just presents the definition of Boolean operators and set operators for topological relationship query, and OGC GeoXACML gives formal definitions for several set functions without implementation detail. Aiming at these problems, based mathematical foundation on cell complex theory, supported by non-manifold data structure and using relevant research in the field of non-manifold geometry modeling for reference, firstly, this paper according to non-manifold Euler-Poincaré formula constructs 6 extended Euler operators and inverse operators to carry out creating, updating and deleting 3D spatial elements, as well as several pairs of supplementary Euler operators to convenient for implementing advanced functions. Secondly, we change topological element operation sequence of Boolean operation and set operation as well as set functions defined in GeoXACML into combination of extended Euler operators, which separates the upper functions and lower data structure. Lastly, we develop underground 3D GIS prototype system, in which practicability and credibility of extended Euler operators faced to 3D GIS presented by this paper are validated.

Cloning, sequence analysis, and expression in Escherichia coli of a gene coding for a. beta. -mannanase from the extremely thermophilic bacterium Caldocellum saccharolyticum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luethi, E.; Jasmat, N.B.; Grayling, R.A.

1991-03-01

A {lambda} recombinant phage expressing {beta}-mannanase activity in Escherichia coli has been isolated from a genomic library of the extremely thermophilic anaerobe Caldocellum saccharolyticum. The gene was cloned into pBR322 on a 5-kb BamHI fragment, and its location was obtained by deletion analysis. The sequence of a 2.1-kb fragment containing the mannanase gene has been determined. One open reading frame was found which could code for a protein of M{sub r} 38,904. The mannanase gene (manA) was overexpressed in E. coli by cloning the gene downstream from the lacZ promoter of pUC18. The enzyme was most active at pH 6more » and 80 C and degraded locust bean gum, guar gum, Pinus radiata glucomannan, and konjak glucomannan. The noncoding region downstream from the mannanase gene showed strong homology to celB, a gene coding for a cellulase from the same organism, suggesting that the manA gene might have been inserted into its present position on the C. saccharolyticum genome by homologous recombination.« less

Diseases of captive yellow seahorse Hippocampus kuda Bleeker, pot-bellied seahorse Hippocampus abdominalis Lesson and weedy seadragon Phyllopteryx taeniolatus (Lacépède).

PubMed

LePage, V; Young, J; Dutton, C J; Crawshaw, G; Paré, J A; Kummrow, M; McLelland, D J; Huber, P; Young, K; Russell, S; Al-Hussinee, L; Lumsden, J S

2015-05-01

Seahorses, pipefish and seadragons are fish of the Family Syngnathidae. From 1998 to 2010, 172 syngnathid cases from the Toronto Zoo were submitted for post-mortem diagnostics and retrospectively examined. Among the submitted species were yellow seahorses Hippocampus kuda Bleeker (n=133), pot-bellied seahorses Hippocampus abdominalis Lesson (n=35) and weedy seadragons Phyllopteryx taeniolatus (Lacépède; n=4). The three most common causes of morbidity and mortality in this population were bacterial dermatitis, bilaterally symmetrical myopathy and mycobacteriosis, accounting for 24%, 17% and 15% of cases, respectively. Inflammatory processes were the most common diagnoses, present in 117 cases. Seven neoplasms were diagnosed, environmental aetiologies were identified in 46 cases, and two congenital defects were identified. © 2014 John Wiley & Sons Ltd.

Spot the difference: Operational event sequence diagrams as a formal method for work allocation in the development of single-pilot operations for commercial aircraft.

PubMed

Harris, Don; Stanton, Neville A; Starr, Alison

2015-01-01

Function Allocation methods are important for the appropriate allocation of tasks between humans and automated systems. It is proposed that Operational Event Sequence Diagrams (OESDs) provide a simple yet rigorous basis upon which allocation of work can be assessed. This is illustrated with respect to a design concept for a passenger aircraft flown by just a single pilot where the objective is to replace or supplement functions normally undertaken by the second pilot with advanced automation. A scenario-based analysis (take off) was used in which there would normally be considerable demands and interactions with the second pilot. The OESD analyses indicate those tasks that would be suitable for allocation to automated assistance on the flight deck and those tasks that are now redundant in this new configuration (something that other formal Function Allocation approaches cannot identify). Furthermore, OESDs are demonstrated to be an easy to apply and flexible approach to the allocation of function in prospective systems. OESDs provide a simple yet rigorous basis upon which allocation of work can be assessed. The technique can deal with the flexible, dynamic allocation of work and the deletion of functions no longer required. This is illustrated using a novel design concept for a single-crew commercial aircraft.

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable

Analysis of loss of decay-heat-removal sequences at Browns Ferry Unit One

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harrington, R.M.

1983-01-01

This paper summarizes the Oak Ridge National Laboratory (ORNL) report Loss of DHR Sequences at Browns Ferry Unit One - Accident Sequence Analysis (NUREG/CR-2973). The Loss of DHR investigation is the third in a series of accident studies concerning the BWR 4 - MK I containment plant design. These studies, sponsored by the Nuclear Regulatory Commission Severe Accident Sequence Analysis (SASA) program, have been conducted at ORNL with the full cooperation of the Tennessee Valley Authority (TVA). The purpose of the SASA studies is to predetermine the probable course of postulated severe accidents so as to establish the timing andmore » the sequence of events. The SASA studies also produce recommendations concerning the implementation of better system design and better emergency operating instructions and operator training. The ORNL studies also include a detailed, best-estimate calculation of the release and transport of radioactive fission products following postulated severe accidents.« less

A computational genomics pipeline for prokaryotic sequencing projects.

PubMed

Kislyuk, Andrey O; Katz, Lee S; Agrawal, Sonia; Hagen, Matthew S; Conley, Andrew B; Jayaraman, Pushkala; Nelakuditi, Viswateja; Humphrey, Jay C; Sammons, Scott A; Govil, Dhwani; Mair, Raydel D; Tatti, Kathleen M; Tondella, Maria L; Harcourt, Brian H; Mayer, Leonard W; Jordan, I King

2010-08-01

New sequencing technologies have accelerated research on prokaryotic genomes and have made genome sequencing operations outside major genome sequencing centers routine. However, no off-the-shelf solution exists for the combined assembly, gene prediction, genome annotation and data presentation necessary to interpret sequencing data. The resulting requirement to invest significant resources into custom informatics support for genome sequencing projects remains a major impediment to the accessibility of high-throughput sequence data. We present a self-contained, automated high-throughput open source genome sequencing and computational genomics pipeline suitable for prokaryotic sequencing projects. The pipeline has been used at the Georgia Institute of Technology and the Centers for Disease Control and Prevention for the analysis of Neisseria meningitidis and Bordetella bronchiseptica genomes. The pipeline is capable of enhanced or manually assisted reference-based assembly using multiple assemblers and modes; gene predictor combining; and functional annotation of genes and gene products. Because every component of the pipeline is executed on a local machine with no need to access resources over the Internet, the pipeline is suitable for projects of a sensitive nature. Annotation of virulence-related features makes the pipeline particularly useful for projects working with pathogenic prokaryotes. The pipeline is licensed under the open-source GNU General Public License and available at the Georgia Tech Neisseria Base (http://nbase.biology.gatech.edu/). The pipeline is implemented with a combination of Perl, Bourne Shell and MySQL and is compatible with Linux and other Unix systems.

Improving the Terrain-Based Parameter for the Assessment of Snow Redistribution in the Col du Lac Blanc Area and Comparisons with TLS Snow Depth Data

NASA Astrophysics Data System (ADS)

Schön, Peter; Prokop, Alexander; Naaim-Bouvet, Florence; Nishimura, Kouichi; Vionnet, Vincent; Guyomarc'h, Gilbert

2014-05-01

Wind and the associated snow drift are dominating factors determining the snow distribution and accumulation in alpine areas, resulting in a high spatial variability of snow depth that is difficult to evaluate and quantify. The terrain-based parameter Sx characterizes the degree of shelter or exposure of a grid point provided by the upwind terrain, without the computational complexity of numerical wind field models. The parameter has shown to qualitatively predict snow redistribution with good reproduction of spatial patterns, but has failed to quantitatively describe the snow redistribution, and correlations with measured snow heights were poor. The objective of our research was to a) identify the sources of poor correlations between predicted and measured snow re-distribution and b) improve the parameters ability to qualitatively and quantitatively describe snow redistribution in our research area, the Col du Lac Blanc in the French Alps. The area is at an elevation of 2700 m and particularly suited for our study due to its constant wind direction and the availability of data from a meteorological station. Our work focused on areas with terrain edges of approximately 10 m height, and we worked with 1-2 m resolution digital terrain and snow surface data. We first compared the results of the terrain-based parameter calculations to measured snow-depths, obtained by high-accuracy terrestrial laser scan measurements. The results were similar to previous studies: The parameter was able to reproduce observed patterns in snow distribution, but regression analyses showed poor correlations between terrain-based parameter and measured snow-depths. We demonstrate how the correlations between measured and calculated snow heights improve if the parameter is calculated based on a snow surface model instead of a digital terrain model. We show how changing the parameter's search distance and how raster re-sampling and raster smoothing improve the results. To improve the parameter

Multilocus sequence type system for the plant pathogen Xylella fastidiosa and relative contributions of recombination and point mutation to clonal diversity.

PubMed

Scally, Mark; Schuenzel, Erin L; Stouthamer, Richard; Nunney, Leonard

2005-12-01

Multilocus sequence typing (MLST) identifies and groups bacterial strains based on DNA sequence data from (typically) seven housekeeping genes. MLST has also been employed to estimate the relative contributions of recombination and point mutation to clonal divergence. We applied MLST to the plant pathogen Xylella fastidiosa using an initial set of sequences for 10 loci (9.3 kb) of 25 strains from five different host plants, grapevine (PD strains), oleander (OLS strains), oak (OAK strains), almond (ALS strains), and peach (PP strains). An eBURST analysis identified six clonal complexes using the grouping criterion that each member must be identical to at least one other member at 7 or more of the 10 loci. These clonal complexes corresponded to previously identified phylogenetic clades; clonal complex 1 (CC1) (all PD strains plus two ALS strains) and CC2 (OLS strains) defined the X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. sandyi clades, while CC3 (ALS strains), CC4 (OAK strains), and CC5 (PP strains) were subclades of X. fastidiosa subsp. multiplex. CC6 (ALS strains) identified an X. fastidiosa subsp. multiplex-like group characterized by a high frequency of intersubspecific recombination. Compared to the recombination rate in other bacterial species, the recombination rate in X. fastidiosa is relatively low. Recombination between different alleles was estimated to give rise to 76% of the nucleotide changes and 31% of the allelic changes observed. The housekeeping loci holC, nuoL, leuA, gltT, cysG, petC, and lacF were chosen to form the basis of a public database for typing X. fastidiosa (www.mlst.net). These loci identified the same six clonal complexes using the strain grouping criterion of identity at five or more loci with at least one other member.

Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst

DOE PAGES

Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj; ...

2015-08-17

We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less

Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj

We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less

MULTI-WAVELENGTH STUDY OF FLARING ACTIVITY IN BL Lac OBJECT S5 0716+714 DURING THE 2015 OUTBURST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, Sunil; Kushwaha, Pankaj; Singh, K. P.

We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. The rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less

Quasi-simultaneous observations of BL Lac object Mrk 501 in X-ray, UV, visible, IR, and radio frequencies

NASA Technical Reports Server (NTRS)

Kondo, Y.; Worrall, D. M.; Oke, J. B.; Yee, H. K. C.; Neugebauer, G.; Matthews, K.; Feldman, P. A.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. R. H.

1981-01-01

Observations in the X-ray, UV, visible, IR and radio regions of the BL Lac object Mrk 501 made over the course of two months are reported. The measurements were made with the A2 experiment on HEAO 1 (X-ray), the SWP and LWR cameras on IUE (UV), the 5-m Hale telescope (visible), the 2.5-m telescope at Mount Wilson (IR), the NRAO 92-m radio telescope at Green Bank (4750 MHz) and the 46-m radio telescope at the Algonquin Observatory (10275 and 10650 MHz). The quasi-simultaneously observed spectral slope is found to be positive and continuous from the X-ray to the UV, but to gradually flatten and possibly turn down from the mid-UV to the visible; the optical-radio emission cannot be accounted for by a single power law. The total spectrum is shown to be compatible with a synchrotron self-Compton emission mechanism, while the spectrum from the visible to the X-ray is consistent with synchrotron radiation or inverse-Compton scattering by a hot thermal electron cloud. The continuity of the spectrum from the UV to the X-ray is noted to imply a total luminosity greater than previous estimates by a factor of 3-4.

A modified operational sequence methodology for zoo exhibit design and renovation: conceptualizing animals, staff, and visitors as interdependent coworkers.

PubMed

Kelling, Nicholas J; Gaalema, Diann E; Kelling, Angela S

2014-01-01

Human factors analyses have been used to improve efficiency and safety in various work environments. Although generally limited to humans, the universality of these analyses allows for their formal application to a much broader domain. This paper outlines a model for the use of human factors to enhance zoo exhibits and optimize spaces for all user groups; zoo animals, zoo visitors, and zoo staff members. Zoo exhibits are multi-faceted and each user group has a distinct set of requirements that can clash or complement each other. Careful analysis and a reframing of the three groups as interdependent coworkers can enhance safety, efficiency, and experience for all user groups. This paper details a general creation and specific examples of the use of the modified human factors tools of function allocation, operational sequence diagram and needs assessment. These tools allow for adaptability and ease of understanding in the design or renovation of exhibits. © 2014 Wiley Periodicals, Inc.

On the Impact of Widening Vector Registers on Sequence Alignment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daily, Jeffrey A.; Kalyanaraman, Anantharaman; Krishnamoorthy, Sriram

2016-09-22

Vector extensions, such as SSE, have been part of the x86 since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. In this paper, we demonstrate that the trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based onmore » striped data layouts. We present a practically efficient SIMD implementation of a parallel scan based sequence alignment algorithm that can better exploit wider SIMD units. We conduct comprehensive workload and use case analyses to characterize the relative behavior of the striped and scan approaches and identify the best choice of algorithm based on input length and SIMD width.« less

Task sequence planning in a robot workcell using AND/OR nets

NASA Technical Reports Server (NTRS)

Cao, Tiehua; Sanderson, Arthur C.

1991-01-01

An approach to task sequence planning for a generalized robotic manufacturing or material handling workcell is described. Given the descriptions of the objects in this system and all feasible geometric relationships among these objects, an AND/OR net which describes the relationships of all feasible geometric states and associated feasibility criteria for net transitions is generated. This AND/OR net is mapped into a Petri net which incorporates all feasible sequences of operations. The resulting Petri net is shown to be bounded and have guaranteed properties of liveness, safeness, and reversibility. Sequences are found from the reachability tree of the Petri net. Feasibility criteria for net transitions may be used to generate an extended Petri net representation of lower level command sequences. The resulting Petri net representation may be used for on-line scheduling and control of the system of feasible sequences. A simulation example of the sequences is described.

33 CFR 385.30 - Master Implementation Sequencing Plan.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Incorporating New Information Into the Plan § 385.30 Master Implementation Sequencing Plan. (a) Not later than... projects of the Plan, including pilot projects and operational elements, based on the best scientific, technical, funding, contracting, and other information available. The Corps of Engineers and the South...

Fundamental Bounds for Sequence Reconstruction from Nanopore Sequencers.

PubMed

Magner, Abram; Duda, Jarosław; Szpankowski, Wojciech; Grama, Ananth

2016-06-01

Nanopore sequencers are emerging as promising new platforms for high-throughput sequencing. As with other technologies, sequencer errors pose a major challenge for their effective use. In this paper, we present a novel information theoretic analysis of the impact of insertion-deletion (indel) errors in nanopore sequencers. In particular, we consider the following problems: (i) for given indel error characteristics and rate, what is the probability of accurate reconstruction as a function of sequence length; (ii) using replicated extrusion (the process of passing a DNA strand through the nanopore), what is the number of replicas needed to accurately reconstruct the true sequence with high probability? Our results provide a number of important insights: (i) the probability of accurate reconstruction of a sequence from a single sample in the presence of indel errors tends quickly (i.e., exponentially) to zero as the length of the sequence increases; and (ii) replicated extrusion is an effective technique for accurate reconstruction. We show that for typical distributions of indel errors, the required number of replicas is a slow function (polylogarithmic) of sequence length - implying that through replicated extrusion, we can sequence large reads using nanopore sequencers. Moreover, we show that in certain cases, the required number of replicas can be related to information-theoretic parameters of the indel error distributions.

hsa_circ_0013958: a circular RNA and potential novel biomarker for lung adenocarcinoma.

PubMed

Zhu, Xiaoli; Wang, Xiyong; Wei, Shuzhen; Chen, Yan; Chen, Yang; Fan, Xiaobo; Han, Shuhua; Wu, Guoqiu

2017-07-01

Circular RNAs (circRNAs) are associated with cancer progression and metastasis, although little is known about their role in lung adenocarcinoma (LAC). In the present study, microarrays were first used to screen for tumour-specific circRNA candidates in LAC tissue. Thirty-nine circRNAs were found to be up-regulated and 20 were down-regulated (fold change > 2.0). Among them, hsa_circ_0013958 was further confirmed to be up-regulated in all of the LAC tissues, cells and plasma. In addition, hsa_circ_0013958 levels were associated with TNM stage (P = 0.009) and lymphatic metastasis (P = 0.006). The area under the receiver operating characteristic curve was 0.815 (95% confidence interval = 0.727-0.903; P < 0.001). In addition, to further illustrate the bioactivities of hsa_circ_0013958 in LAC, siRNA-mediated inhibition of hsa_circ_0013958 was performed in vitro. The results showed that hsa_circ_0013958 promoted cell proliferation and invasion and inhibited cell apoptosis in LAC. Moreover, hsa_circ_0013958 was identified as a sponge of miR-134, and thus it up-regulated oncogenic cyclin D1, which plays a pivotal role in the development of non-small cell lung cancer. In conclusion, our results suggested that hsa_circ_0013958 could be used as a potential non-invasive biomarker for the early detection and screening of LAC. © 2017 Federation of European Biochemical Societies.

Universal sequence map (USM) of arbitrary discrete sequences

PubMed Central

2002-01-01

Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM), is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR). The latter enables the representation of 4 unit type sequences (like DNA) as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules. PMID:11895567

SSR_pipeline--computer software for the identification of microsatellite sequences from paired-end Illumina high-throughput DNA sequence data

USGS Publications Warehouse

Miller, Mark P.; Knaus, Brian J.; Mullins, Thomas D.; Haig, Susan M.

2013-01-01

SSR_pipeline is a flexible set of programs designed to efficiently identify simple sequence repeats (SSRs; for example, microsatellites) from paired-end high-throughput Illumina DNA sequencing data. The program suite contains three analysis modules along with a fourth control module that can be used to automate analyses of large volumes of data. The modules are used to (1) identify the subset of paired-end sequences that pass quality standards, (2) align paired-end reads into a single composite DNA sequence, and (3) identify sequences that possess microsatellites conforming to user specified parameters. Each of the three separate analysis modules also can be used independently to provide greater flexibility or to work with FASTQ or FASTA files generated from other sequencing platforms (Roche 454, Ion Torrent, etc). All modules are implemented in the Python programming language and can therefore be used from nearly any computer operating system (Linux, Macintosh, Windows). The program suite relies on a compiled Python extension module to perform paired-end alignments. Instructions for compiling the extension from source code are provided in the documentation. Users who do not have Python installed on their computers or who do not have the ability to compile software also may choose to download packaged executable files. These files include all Python scripts, a copy of the compiled extension module, and a minimal installation of Python in a single binary executable. See program documentation for more information.

Sequence System Building Blocks: Using a Component Architecture for Sequencing Software

NASA Technical Reports Server (NTRS)

Streiffert, Barbara A.; O'Reilly, Taifun

2005-01-01

Over the last few years software engineering has made significant strides in making more flexible architectures and designs possible. However, at the same time, spacecraft have become more complex and flight software has become more sophisticated. Typically spacecraft are often one-of-a-kind entities that have different hardware designs, different capabilities, different instruments, etc. Ground software has become more complex and operations teams have had to learn a myriad of tools that all have different user interfaces and represent data in different ways. At Jet Propulsion Laboratory (JPL) these themes have collided to require an new approach to producing ground system software. Two different groups have been looking at tackling this particular problem. One group is working for the JPL Mars Technology Program in the Mars Science Laboratory (MSL) Focused Technology area. The other group is the JPL Multi-Mission Planning and Sequencing Group . The major concept driving these two approaches on a similar path is to provide software that can be a more cohesive flexible system that provides a act of planning and sequencing system of services. This paper describes the efforts that have been made to date to create a unified approach from these disparate groups.

Sequencing System Building Blocks: Using a Component Architecture for Sequencing Software

NASA Technical Reports Server (NTRS)

Streiffert, Barbara A.; O'Reilly, Taifun

2006-01-01

Over the last few years software engineering has made significant strides in making more flexible architectures and designs possible. However, at the same time, spacecraft have become more complex and flight software has become more sophisticated. Typically spacecraft are often one-of-a-kind entities that have different hardware designs, different capabilities, different instruments, etc. Ground software has become more complex and operations teams have had to learn a myriad of tools that all have different user interfaces and represent data in different ways. At Jet Propulsion Laboratory (JPL) these themes have collided to require a new approach to producing ground system software. Two different groups have been looking at tackling this particular problem. One group is working for the JPL Mars Technology Program in the Mars Science Laboratory (MSL) Focused Technology area. The other group is the JPL Multi-Mission Planning and Sequencing Group. The major concept driving these two approaches on a similar path is to provide software that can be a more cohesive flexible system that provides a set of planning and sequencing system of services. This paper describes the efforts that have been made to date to create a unified approach from these disparate groups.

Is sequence awareness mandatory for perceptual sequence learning: An assessment using a pure perceptual sequence learning design.

PubMed

Deroost, Natacha; Coomans, Daphné

2018-02-01

We examined the role of sequence awareness in a pure perceptual sequence learning design. Participants had to react to the target's colour that changed according to a perceptual sequence. By varying the mapping of the target's colour onto the response keys, motor responses changed randomly. The effect of sequence awareness on perceptual sequence learning was determined by manipulating the learning instructions (explicit versus implicit) and assessing the amount of sequence awareness after the experiment. In the explicit instruction condition (n = 15), participants were instructed to intentionally search for the colour sequence, whereas in the implicit instruction condition (n = 15), they were left uninformed about the sequenced nature of the task. Sequence awareness after the sequence learning task was tested by means of a questionnaire and the process-dissociation-procedure. The results showed that the instruction manipulation had no effect on the amount of perceptual sequence learning. Based on their report to have actively applied their sequence knowledge during the experiment, participants were subsequently regrouped in a sequence strategy group (n = 14, of which 4 participants from the implicit instruction condition and 10 participants from the explicit instruction condition) and a no-sequence strategy group (n = 16, of which 11 participants from the implicit instruction condition and 5 participants from the explicit instruction condition). Only participants of the sequence strategy group showed reliable perceptual sequence learning and sequence awareness. These results indicate that perceptual sequence learning depends upon the continuous employment of strategic cognitive control processes on sequence knowledge. Sequence awareness is suggested to be a necessary but not sufficient condition for perceptual learning to take place. Copyright © 2018 Elsevier B.V. All rights reserved.

Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

PubMed Central

Mandal, Bijoy Kumar; Kim, Tai-hoon

2013-01-01

We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321

Gfi1-Cre knock-in mouse line: A tool for inner ear hair cell-specific gene deletion

PubMed Central

Yang, Hua; Gan, Jean; Xie, Xiaoling; Deng, Min; Feng, Liang; Chen, Xiaowei; Gao, Zhiqiang; Gan, Lin

2010-01-01

Summary Gfi1encodes a zinc-finger transcription factor essential for the development and maintenance of haematopoiesis and the inner ear. In mouse inner ear, Gfi1 expression is confined to hair cells during development and in adulthood. To construct a genetic tool for inner ear hair cell-specific gene deletion, we generated a Gfi1-Cre mouse line by knocking-in Cre coding sequences into the Gfi1 locus and inactivating the endogenous Gfi1. The specificity and efficiency of Gfi1-Cre recombinase-mediated recombination in the developing inner ear was revealed through the expression of the conditional R26R-lacZ reporter gene. The onset of lacZ expression in the Gfi1Cre/+ inner ear was first detected at E13.5 in the vestibule and at E15.5 in the cochlea, coinciding with the generation of hair cells. Throughout inner ear development, lacZ expression was detected only in hair cells. Thus, Gfi1-Cre knock-in mouse line provides a useful tool for gene manipulations specifically in inner ear hair cells. PMID:20533399