Structural dynamics of the lac repressor-DNA complex revealed by a multiscale simulation.

PubMed

Villa, Elizabeth; Balaeff, Alexander; Schulten, Klaus

2005-05-10

A multiscale simulation of a complex between the lac repressor protein (LacI) and a 107-bp-long DNA segment is reported. The complex between the repressor and two operator DNA segments is described by all-atom molecular dynamics; the size of the simulated system comprises either 226,000 or 314,000 atoms. The DNA loop connecting the operators is modeled as a continuous elastic ribbon, described mathematically by the nonlinear Kirchhoff differential equations with boundary conditions obtained from the coordinates of the terminal base pairs of each operator. The forces stemming from the looped DNA are included in the molecular dynamics simulations; the loop structure and the forces are continuously recomputed because the protein motions during the simulations shift the operators and the presumed termini of the loop. The simulations reveal the structural dynamics of the LacI-DNA complex in unprecedented detail. The multiple domains of LacI exhibit remarkable structural stability during the simulation, moving much like rigid bodies. LacI is shown to absorb the strain from the looped DNA mainly through its mobile DNA-binding head groups. Even with large fluctuating forces applied, the head groups tilt strongly and keep their grip on the operator DNA, while the remainder of the protein retains its V-shaped structure. A simulated opening of the cleft of LacI by 500-pN forces revealed the interactions responsible for locking LacI in the V-conformation.

Microbial β-Galactosidase of Pediococcus pentosaceus ID-7: Isolation, Cloning, and Molecular Characterization.

PubMed

Lee, Ji-Yeong; Kwak, Mi-Sun; Roh, Jong-Bok; Kim, Kwang; Sung, Moon-Hee

2017-03-28

Pediococcus pentosaceus ID-7 was isolated from kimchi, a Korean fermented food, and it showed high activity for lactose hydrolysis. The β-galactosidase of P. pentosaceus ID-7 belongs to the GH2 group, which is composed of two distinct proteins. The heterodimeric LacLM type of β-galactosidase found in P. pentosaceus ID-7 consists of two genes partially overlapped, lacL and lacM encoding LacL (72.2 kDa) and LacM (35.4 kDa). In this study, Escherichia coli MM294 was used for the production of LacL, LacM, and LacLM. These three types of recombinant proteins were expressed, purified, and characterized. The specific activities of LacLM and LacL were 339 and 31 U/mg, respectively. However, activity was not detected with LacM alone. The optimal pH of LacLM and LacL was pH 7.5 and pH 7.0, and the optimal temperature of LacLM and LacL was 40°C and 50°C, respectively. The optimal temperature changes indicate that LacLM is able to achieve higher activity at a relatively lower temperature. LacLM was strongly activated by Mg 2+ , Mn 2+ , and Zn 2+ , which was not true for LacL. Consistent with this, EDTA strongly inactivated LacLM and LacL, but the presence of reducing agents did not dramatically alter the activity. Taken together, multiple alignment of amino acid sequences and phylogenetic analysis results of LacL and LacM of P. pentosaceus ID-7 suggest the evolution of LacL into LacLM and that the use of divalent metal ions results in higher activity.

NMR studies on the structure and dynamics of lac operator DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.C.

Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Lactose metabolism by Staphylococcus aureus: characterization of lacABCD, the structural genes of the tagatose 6-phosphate pathway.

PubMed Central

Rosey, E L; Oskouian, B; Stewart, G C

1991-01-01

The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose 6-phosphate pathway enzymes utilizing galactose 6-phosphate or fructose phosphate analogs as substrate, is described. Expression of both lacA and lacB was required for galactose 6-phosphate isomerase activity. LacC (34 kDa) demonstrated tagatose 6-phosphate kinase activity and was found to share significant homology with LacC from Lactococcus lactis and with both the minor 6-phosphofructokinase (PfkB) and 1-phosphofructokinase (FruK) from E. coli. Detection of tagatose 1,6-bisphosphate aldolase activity was dependent on expression of the 36-kDa protein specified by lacD. The LacD protein is highly homologous with LacD of L. lactis. Thus, the lacABCD genes comprise the tagatose 6-phosphate pathway and are cotranscribed with genes lacFEG, which specify proteins for transport and cleavage of lactose in S. aureus. PMID:1655695

A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability.

PubMed

Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong

2011-02-01

Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.

Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes

PubMed Central

Zhao, J.; Kwan, H. S.

1999-01-01

The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

Transcriptional and functional analysis of galactooligosaccharide uptake by lacS in Lactobacillus acidophilus

PubMed Central

Andersen, Joakim M.; Barrangou, Rodolphe; Abou Hachem, Maher; Lahtinen, Sampo; Goh, Yong Jun; Svensson, Birte; Klaenhammer, Todd R.

2011-01-01

Probiotic microbes rely on their ability to survive in the gastrointestinal tract, adhere to mucosal surfaces, and metabolize available energy sources from dietary compounds, including prebiotics. Genome sequencing projects have proposed models for understanding prebiotic catabolism, but mechanisms remain to be elucidated for many prebiotic substrates. Although β-galactooligosaccharides (GOS) are documented prebiotic compounds, little is known about their utilization by lactobacilli. This study aimed to identify genetic loci in Lactobacillus acidophilus NCFM responsible for the transport and catabolism of GOS. Whole-genome oligonucleotide microarrays were used to survey the differential global transcriptome during logarithmic growth of L. acidophilus NCFM using GOS or glucose as a sole source of carbohydrate. Within the 16.6-kbp gal-lac gene cluster, lacS, a galactoside-pentose-hexuronide permease-encoding gene, was up-regulated 5.1-fold in the presence of GOS. In addition, two β-galactosidases, LacA and LacLM, and enzymes in the Leloir pathway were also encoded by genes within this locus and up-regulated by GOS stimulation. Generation of a lacS-deficient mutant enabled phenotypic confirmation of the functional LacS permease not only for the utilization of lactose and GOS but also lactitol, suggesting a prominent role of LacS in the metabolism of a broad range of prebiotic β-galactosides, known to selectively modulate the beneficial gut microbiota. PMID:22006318

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

PubMed

Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

2012-10-23

Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L(-1) in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation.

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

PubMed Central

2012-01-01

Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L-1 in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation. PMID:23092193

Beware of your Cre-Ation: lacZ expression impairs neuronal integrity and hippocampus-dependent memory.

PubMed

Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T

2016-10-01

Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Functional metagenomics reveals novel β-galactosidases not predictable from gene sequences.

PubMed

Cheng, Jiujun; Romantsov, Tatyana; Engel, Katja; Doxey, Andrew C; Rose, David R; Neufeld, Josh D; Charles, Trevor C

2017-01-01

The techniques of metagenomics have allowed researchers to access the genomic potential of uncultivated microbes, but there remain significant barriers to determination of gene function based on DNA sequence alone. Functional metagenomics, in which DNA is cloned and expressed in surrogate hosts, can overcome these barriers, and make important contributions to the discovery of novel enzymes. In this study, a soil metagenomic library carried in an IncP cosmid was used for functional complementation for β-galactosidase activity in both Sinorhizobium meliloti (α-Proteobacteria) and Escherichia coli (γ-Proteobacteria) backgrounds. One β-galactosidase, encoded by six overlapping clones that were selected in both hosts, was identified as a member of glycoside hydrolase family 2. We could not identify ORFs obviously encoding possible β-galactosidases in 19 other sequenced clones that were only able to complement S. meliloti. Based on low sequence identity to other known glycoside hydrolases, yet not β-galactosidases, three of these ORFs were examined further. Biochemical analysis confirmed that all three encoded β-galactosidase activity. Lac36W_ORF11 and Lac161_ORF7 had conserved domains, but lacked similarities to known glycoside hydrolases. Lac161_ORF10 had neither conserved domains nor similarity to known glycoside hydrolases. Bioinformatic and structural modeling implied that Lac161_ORF10 protein represented a novel enzyme family with a five-bladed propeller glycoside hydrolase domain. By discovering founding members of three novel β-galactosidase families, we have reinforced the value of functional metagenomics for isolating novel genes that could not have been predicted from DNA sequence analysis alone.

Systematic Analysis of the Pleurotus ostreatus Laccase Gene (PoLac) Family and Functional Characterization of PoLac2 Involved in the Degradation of Cotton-Straw Lignin.

PubMed

Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping

2018-04-11

Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .

Plasticity of laccase generated by homeologous recombination in yeast.

PubMed

Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry

2009-10-01

Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.

The first catalog of active galactic nuclei detected by the FERMI large area telescope

DOE PAGES

Abdo, A. A.; Ackermann, M.; Ajello, M.; ...

2010-04-29

Here, we present the first catalog of active galactic nuclei (AGNs) detected by the Large Area Telescope (LAT), corresponding to 11 months of data collected in scientific operation mode. The First LAT AGN Catalog (1LAC) includes 671 γ-ray sources located at high Galactic latitudes (|b|>10°) that are detected with a test statistic greater than 25 and associated statistically with AGNs. Some LAT sources are associated with multiple AGNs, and consequently, the catalog includes 709 AGNs, comprising 300 BL Lacertae objects, 296 flat-spectrum radio quasars, 41 AGNs of other types, and 72 AGNs of unknown type. We also classify the blazarsmore » based on their spectral energy distributions as archival radio, optical, and X-ray data permit. In addition to the formal 1LAC sample, we provide AGN associations for 51 low-latitude LAT sources and AGN "affiliations" (unquantified counterpart candidates) for 104 high-latitude LAT sources without AGN associations. The overlap of the 1LAC with existing γ-ray AGN catalogs (LBAS, EGRET, AGILE, Swift, INTEGRAL, TeVCat) is briefly discussed. Various properties—such as γ-ray fluxes and photon power-law spectral indices, redshifts, γ-ray luminosities, variability, and archival radio luminosities—and their correlations are presented and discussed for the different blazar classes. Lastly, we compare the 1LAC results with predictions regarding the γ-ray AGN populations, and we comment on the power of the sample to address the question of the blazar sequence.« less

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Adaptive Evolution of the Streptococcus pyogenes Regulatory Aldolase LacD.1

PubMed Central

Cusumano, Zachary

2013-01-01

In the human-pathogenic bacterium Streptococcus pyogenes, the tagatose bisphosphate aldolase LacD.1 likely originated through a gene duplication event and was adapted to a role as a metabolic sensor for regulation of virulence gene transcription. Although LacD.1 retains enzymatic activity, its ancestral metabolic function resides in the LacD.2 aldolase, which is required for the catabolism of galactose. In this study, we compared these paralogous proteins to identify characteristics correlated with divergence and novel function. Surprisingly, despite the fact that these proteins have identical active sites and 82% similarity in amino acid sequence, LacD.1 was less efficient at cleaving both fructose and tagatose bisphosphates. Analysis of kinetic properties revealed that LacD.1's adaptation was associated with a decrease in kcat and an increase in Km. Construction and analysis of enzyme chimeras indicated that non-active-site residues previously associated with the variable activities of human aldolase isoenzymes modulated LacD.1's affinity for substrate. Mutant LacD.1 proteins engineered to have LacD.2-like levels of enzymatic efficiency lost the ability to function as regulators, suggesting that an alteration in efficiency was required for adaptation. In competition under growth conditions that mimic a deep-tissue environment, LacD.1 conferred a significant gain in fitness that was associated with its regulatory activity. Taken together, these data suggest that LacD.1's adaptation represents a form of neofunctionalization in which duplication facilitated the gain of regulatory function important for growth in tissue and pathogenesis. PMID:23316044

Desulfovibrio zosterae sp. nov., a new sulfate reducer isolated from surface-sterilized roots of the seagrass Zostera marina.

PubMed

Nielsen, J T; Liesack, W; Finster, K

1999-04-01

A sulfate-reducing bacterium, designated strain lacT, was isolated from surface-sterilized roots of the benthic macrophyte Zostera marina. Cells were motile by means of a single polar flagellum. Strain lacT utilized lactate, pyruvate, malate, ethanol, L-alanine, fumarate, choline and fructose with sulfate as electron acceptor. In addition, fumarate, pyruvate and fructose were also degraded without an external electron acceptor. Sulfate could be substituted with thiosulfate, sulfite and elemental sulfur. Optimal growth was observed between 32.5 and 34.5 degrees C, at an NaCl concentration of 0.2 M and in a pH range between 6.8 and 7.3. The G + C content of the DNA was 42.7 +/- 0.2 mol%. Desulfoviridin and catalase were present. Strain lacT contained c-type cytochromes. Comparative 16S rRNA gene sequence analysis and the fatty acid pattern grouped this isolate into the genus Desulfovibrio. However, strain lacT differs from all other described Desulfovibrio species on the bases of its 16S rRNA gene sequence, the G + C content, its cellular lipid pattern and the utilization pattern of substrates. These characteristics establish strain lacT (= DSM 11974T) as a novel species of the genus Desulfovibrio, for which the name Desulfovibrio zosterae sp. nov. is proposed.

Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

PubMed

Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

1989-01-01

A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

Mutational spectra of the lacI transgene isolated from Big Blue{reg_sign} mice exposed to three carcinogenic aromatic amines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Staedtler, F.; Locher, F.; Sreenan, G.

1997-10-01

In order to evaluate the in vivo genotoxic potential of three putative genotoxic mouse liver carcinogens, high doses of 4-chloro-o-phenylenediamine, 2-nitro-p-phenylenediamine and 2, 4-diaminotoluene were tested short term in the Big Blue{reg_sign} transgenic mouse mutation assay. Small statistically significant increases in the lacI mutant frequencies in the liver by factors 1.7 to 2.0 were found. A representative number of 347 lacI mutants isolated from liver tissue of male and female animals were analyses by DNA sequencing. The mutational spectra were examined with the Adams-Skopek algorithm. The spontaneous mutational spectra from untreated male and female animals were similar and consistent withmore » spectral Big Blue{reg_sign} control data stored in the lacI database. Most of the background mutations were located in the 5{prime} portion of the coding region of the lacI gene. Single base substitutions were most prominent. G:C to A:T transitions and G:C to T:A transversions occurred predominatly and were preferentially located at CpG sites. Despite the increases observed in the mutant frequencies of the treated animals, the corresponding mutational spectra did not differ from the controls. However, it is possible that certain classes of point mutations were substantially increased but not detected due to the limited number of sequenced mutants. In two animals treated with 2, 4- diaminotoluene unusually high mutant frequencies and the multiple occurrence of certain mutations in the liver was observed. From one of these animals six lacI mutants isolated from colon tissue were all different. Since 2, 4-diaminotoluene was shown to induce liver cell proliferation these results may reflect clonal expansion of single mutated liver cells.« less

Using the Markov chain Monte Carlo method to study the physical properties of GeV-TeV BL Lac objects

NASA Astrophysics Data System (ADS)

Qin, Longhua; Wang, Jiancheng; Yang, Chuyuan; Yuan, Zunli; Mao, Jirong; Kang, Shiju

2018-01-01

We fit the spectral energy distributions (SEDs) of 46 GeV-TeV BL Lac objects in the frame of leptonic one-zone synchrotron self-Compton (SSC) model and investigate the physical properties of these objects. We use the Markov chain Monte Carlo (MCMC) method to obtain the basic parameters, such as magnetic field (B), the break energy of the relativistic electron distribution (γ ^' }b), and the electron energy spectral index. Based on the modeling results, we support the following scenarios for GeV-TeV BL Lac objects. (1) Some sources have large Doppler factors, implying other radiation mechanism should be considered. (2) Compared with flat spectrum quasars (FSRQs), GeV-TeV BL Lac objects have weaker magnetic fields and larger Doppler factors, which cause the ineffective cooling and shift the SEDs to higher bands. Their jet powers are around 4.0 × 1045 erg s-1, compared with radiation power, 5.0 × 1042 erg s-1, indicating that only a small fraction of jet power is transformed into the emission power. (3) For some BL Lacs with large Doppler factors, their jet components could have two substructures, e.g., the fast core and the slow sheath. For most GeV-TeV BL Lacs, Kelvin-Helmholtz instabilities are suppressed by their higher magnetic fields, leading to micro-variability or intro-day variability in the optical bands. (4) Combined with a sample of FSRQs, an anti-correlation between the peak luminosity, Lpk, and the peak frequency, νpk, is obtained, favoring the blazar sequence scenario. In addition, an anti-correlation between the jet power, Pjet, and the break Lorentz factor, γb, also supports the blazar sequence.

Identification of a Dehydrogenase Required for Lactose Metabolism in Caulobacter crescentus▿ †‡

PubMed Central

Arellano, Benjamin H.; Ortiz, Janett D.; Manzano, Janet; Chen, Joseph C.

2010-01-01

Caulobacter crescentus, which thrives in freshwater environments with low nutrient levels, serves as a model system for studying bacterial cell cycle regulation and organelle development. We examined its ability to utilize lactose (i) to gain insight into the metabolic capacities of oligotrophic bacteria and (ii) to obtain an additional genetic tool for studying this model organism, aiming to eliminate the basal enzymatic activity that hydrolyzes the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal). Using a previously isolated transposon mutant, we identified a gene, lacA, that is required for growth on lactose as the sole carbon source and for turning colonies blue in the presence of X-gal. LacA, which contains a glucose-methanol-choline (GMC) oxidoreductase domain, has homology to the flavin subunit of Pectobacterium cypripedii's gluconate dehydrogenase. Sequence comparisons indicated that two genes near lacA, lacB and lacC, encode the other subunits of the membrane-bound dehydrogenase. In addition to lactose, all three lac genes are involved in the catabolism of three other β-galactosides (lactulose, lactitol, and methyl-β-d-galactoside) and two glucosides (salicin and trehalose). Dehydrogenase assays confirmed that the lac gene products oxidize lactose, salicin, and trehalose. This enzymatic activity is inducible, and increased lac expression in the presence of lactose and salicin likely contributes to the induction. Expression of lacA also depends on the presence of the lac genes, implying that the dehydrogenase participates in induction. The involvement of a dehydrogenase suggests that degradation of lactose and other sugars in C. crescentus may resemble a proposed pathway in Agrobacterium tumefaciens. PMID:20190087

Enhanced expression of cro-beta-galactosidase fusion proteins under the control of the PR promoter of bacteriophage lambda.

PubMed Central

Zabeau, M; Stanley, K K

1982-01-01

Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257

Initiation of a lightning search using the lightning and airglow camera onboard the Venus orbiter Akatsuki

NASA Astrophysics Data System (ADS)

Takahashi, Yukihiro; Sato, Mitsuteru; Imai, Masataka; Lorenz, Ralph; Yair, Yoav; Aplin, Karen; Fischer, Georg; Nakamura, Masato; Ishii, Nobuaki; Abe, Takumi; Satoh, Takehiko; Imamura, Takeshi; Hirose, Chikako; Suzuki, Makoto; Hashimoto, George L.; Hirata, Naru; Yamazaki, Atsushi; Sato, Takao M.; Yamada, Manabu; Murakami, Shin-ya; Yamamoto, Yukio; Fukuhara, Tetsuya; Ogohara, Kazunori; Ando, Hiroki; Sugiyama, Ko-ichiro; Kashimura, Hiroki; Ohtsuki, Shoko

2018-05-01

The existence of lightning discharges in the Venus atmosphere has been controversial for more than 30 years, with many positive and negative reports published. The lightning and airglow camera (LAC) onboard the Venus orbiter, Akatsuki, was designed to observe the light curve of possible flashes at a sufficiently high sampling rate to discriminate lightning from other sources and can thereby perform a more definitive search for optical emissions. Akatsuki arrived at Venus during December 2016, 5 years following its launch. The initial operations of LAC through November 2016 have included a progressive increase in the high voltage applied to the avalanche photodiode detector. LAC began lightning survey observations in December 2016. It was confirmed that the operational high voltage was achieved and that the triggering system functions correctly. LAC lightning search observations are planned to continue for several years.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27

Polarimetry of optically selected BL Lacertae candidates from the SDSS

NASA Astrophysics Data System (ADS)

Heidt, J.; Nilsson, K.

2011-05-01

We present and discuss polarimetric observations of 182 targets drawn from an optically selected sample of 240 probable BL Lac candidates out of the SDSS compiled by Collinge et al. (2005, AJ, 129, 2542). In contrast to most other BL Lac candidate samples extracted from the SDSS, its radio- and/or X-ray properties have not been taken into account for its derivation. Thus, because its selection is based on optical properties alone, it may be less prone to selection effects inherent in other samples derived at different frequencies, so it offers a unique opportunity to extract the first unbiased BL Lac luminosity function that is suitably large in size. We found 124 out of 182 targets (68%) to be polarized, 95 of the polarized targets (77%) to be highly polarized (>4%). The low-frequency peaked BL Lac candidates in the sample are on average only slightly more polarized than the high-frequency peaked ones. Compared to earlier studies, we found a high duty cycle in high polarization (˜ 66+2-14% to be >4% polarized) in high-frequency peaked BL Lac candidates. This may come from our polarization analysis, which minimizes the contamination by host galaxy light. No evidence of radio-quiet BL Lac objects in the sample was found. Our observations show that the probable sample of BL Lac candidates of Collinge et al. (2005) indeed contains a large number of bona fide BL Lac objects. High S/N spectroscopy and deep X-ray observations are required to construct the first luminosity function of optically selected BL Lac objects and to test more stringently for any radio-quiet BL Lac objects in the sample. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory in the course of the observing proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Andalucia (CSIC).Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway, and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.Table 1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/529/A162

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

PubMed Central

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with K m and k cat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

PubMed Central

Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

2008-01-01

Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer

PubMed Central

Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk

2014-01-01

Purpose Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). Methods This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. Results A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. Conclusion LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes. PMID:24761404

Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer.

PubMed

Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Baik, Seung Hyuk; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk

2014-01-01

Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iyer, Sukanya; Karig, David K; Norred, Sarah E

Engineered gene circuits offer an opportunity to harness biological systems for biotechnological and biomedical applications. However, reliance on host E. coli promoters for the construction of circuit elements, such as logic gates, makes implementation of predictable, independently functioning circuits difficult. In contrast, T7 promoters offer a simple orthogonal expression system for use in a variety of cellular backgrounds and even in cell free systems. Here we develop a T7 promoter system that can be regulated by two different transcriptional repressors for the construction of a logic gate that functions in cells and in cell free systems. We first present LacImore » repressible T7lacO promoters that are regulated from a distal lac operator site for repression. We next explore the positioning of a tet operator site within the T7lacO framework to create T7 promoters that respond to tet and lac repressors and realize an IMPLIES gate. Finally, we demonstrate that these dual input sensitive promoters function in a commercially available E. coli cell-free protein expression system. Together, our results contribute to the first demonstration of multi-input regulation of T7 promoters and expand the utility of T7 promoters in cell based as well as cell-free gene circuits.« less

Bio Computing and Information Systems: A Quest

DTIC Science & Technology

2003-06-01

on Security and Privacy, 1996 4) Dawkins , R. The Selfish Gene . Oxford University Press, 1989 5) Dumpert, K. The Social Biology of Ants...mechanisms of genetic control, which switch genes on and off. The archetypal example of genetic regulation in bacteria is the lac operon of E. coli...first studied in the 1950s by Jacques Monod and François Jacob. The lac operon is a set of genes and regulatory sequences involved in the metabolism of

Lysines 72, 80 and 213 and aspartic acid 210 of the Lactococcus lactis LacR repressor are involved in the response to the inducer tagatose-6-phosphate leading to induction of lac operon expression.

PubMed

van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M

1993-02-01

Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.

Sunflower (Helianthus annuus) long-chain acyl-coenzyme A synthetases expressed at high levels in developing seeds.

PubMed

Aznar-Moreno, Jose A; Venegas Calerón, Mónica; Martínez-Force, Enrique; Garcés, Rafael; Mullen, Robert; Gidda, Satinder K; Salas, Joaquín J

2014-03-01

Long chain fatty acid synthetases (LACSs) activate the fatty acid chains produced by plastidial de novo biosynthesis to generate acyl-CoA derivatives, important intermediates in lipid metabolism. Oilseeds, like sunflower, accumulate high levels of triacylglycerols (TAGs) in their seeds to nourish the embryo during germination. This requires that sunflower seed endosperm supports very active glycerolipid synthesis during development. Sunflower seed plastids produce large amounts of fatty acids, which must be activated through the action of LACSs, in order to be incorporated into TAGs. We cloned two different LACS genes from developing sunflower endosperm, HaLACS1 and HaLACS2, which displayed sequence homology with Arabidopsis LACS9 and LACS8 genes, respectively. These genes were expressed at high levels in developing seeds and exhibited distinct subcellular distributions. We generated constructs in which these proteins were fused to green fluorescent protein and performed transient expression experiments in tobacco cells. The HaLACS1 protein associated with the external envelope of tobacco chloroplasts, whereas HaLACS2 was strongly bound to the endoplasmic reticulum. Finally, both proteins were overexpressed in Escherichia coli and recovered as active enzymes in the bacterial membranes. Both enzymes displayed similar substrate specificities, with a very high preference for oleic acid and weaker activity toward stearic acid. On the basis of our findings, we discuss the role of these enzymes in sunflower oil synthesis. © 2013 Scandinavian Plant Physiology Society.

The Origin of Mutants Under Selection: How Natural Selection Mimics Mutagenesis (Adaptive Mutation)

PubMed Central

Maisnier-Patin, Sophie; Roth, John R.

2015-01-01

Selection detects mutants but does not cause mutations. Contrary to this dictum, Cairns and Foster plated a leaky lac mutant of Escherichia coli on lactose medium and saw revertant (Lac+) colonies accumulate with time above a nongrowing lawn. This result suggested that bacteria might mutagenize their own genome when growth is blocked. However, this conclusion is suspect in the light of recent evidence that revertant colonies are initiated by preexisting cells with multiple copies the conjugative F′lac plasmid, which carries the lac mutation. Some plated cells have multiple copies of the simple F′lac plasmid. This provides sufficient LacZ activity to support plasmid replication but not cell division. In nongrowing cells, repeated plasmid replication increases the likelihood of a reversion event. Reversion to lac+ triggers exponential cell growth leading to a stable Lac+ revertant colony. In 10% of these plated cells, the high-copy plasmid includes an internal tandem lac duplication, which provides even more LacZ activity—sufficient to support slow growth and formation of an unstable Lac+ colony. Cells with multiple copies of the F′lac plasmid have an increased mutation rate, because the plasmid encodes the error-prone (mutagenic) DNA polymerase, DinB. Without DinB, unstable and stable Lac+ revertant types form in equal numbers and both types arise with no mutagenesis. Amplification and selection are central to behavior of the Cairns–Foster system, whereas mutagenesis is a system-specific side effect or artifact caused by coamplification of dinB with lac. Study of this system has revealed several broadly applicable principles. In all populations, gene duplications are frequent stable genetic polymorphisms, common near-neutral mutant alleles can gain a positive phenotype when amplified under selection, and natural selection can operate without cell division when variability is generated by overreplication of local genome subregions. PMID:26134316

De novo generation of plant centromeres at tandem repeats.

PubMed

Teo, Chee How; Lermontova, Inna; Houben, Andreas; Mette, Michael Florian; Schubert, Ingo

2013-06-01

Artificial minichromosomes are highly desirable tools for basic research, breeding, and biotechnology purposes. We present an option to generate plant artificial minichromosomes via de novo engineering of plant centromeres in Arabidopsis thaliana by targeting kinetochore proteins to tandem repeat arrays at non-centromeric positions. We employed the bacterial lactose repressor/lactose operator system to guide derivatives of the centromeric histone H3 variant cenH3 to LacO operator sequences. Tethering of cenH3 to non-centromeric loci led to de novo assembly of kinetochore proteins and to dicentric carrier chromosomes which potentially form anaphase bridges. This approach will be further developed and may contribute to generating minichromosomes from preselected genomic regions, potentially even in a diploid background.

Observation sequences and onboard data processing of Planet-C

NASA Astrophysics Data System (ADS)

Suzuki, M.; Imamura, T.; Nakamura, M.; Ishi, N.; Ueno, M.; Hihara, H.; Abe, T.; Yamada, T.

Planet-C or VCO Venus Climate Orbiter will carry 5 cameras IR1 IR 1micrometer camera IR2 IR 2micrometer camera UVI UV Imager LIR Long-IR camera and LAC Lightning and Airglow Camera in the UV-IR region to investigate atmospheric dynamics of Venus During 30 hr orbiting designed to quasi-synchronize to the super rotation of the Venus atmosphere 3 groups of scientific observations will be carried out i image acquisition of 4 cameras IR1 IR2 UVI LIR 20 min in 2 hrs ii LAC operation only when VCO is within Venus shadow and iii radio occultation These observation sequences will define the scientific outputs of VCO program but the sequences must be compromised with command telemetry downlink and thermal power conditions For maximizing science data downlink it must be well compressed and the compression efficiency and image quality have the significant scientific importance in the VCO program Images of 4 cameras IR1 2 and UVI 1Kx1K and LIR 240x240 will be compressed using JPEG2000 J2K standard J2K is selected because of a no block noise b efficiency c both reversible and irreversible d patent loyalty free and e already implemented as academic commercial software ICs and ASIC logic designs Data compression efficiencies of J2K are about 0 3 reversible and 0 1 sim 0 01 irreversible The DE Digital Electronics unit which controls 4 cameras and handles onboard data processing compression is under concept design stage It is concluded that the J2K data compression logics circuits using space

Data on publications, structural analyses, and queries used to build and utilize the AlloRep database.

PubMed

Sousa, Filipa L; Parente, Daniel J; Hessman, Jacob A; Chazelle, Allen; Teichmann, Sarah A; Swint-Kruse, Liskin

2016-09-01

The AlloRep database (www.AlloRep.org) (Sousa et al., 2016) [1] compiles extensive sequence, mutagenesis, and structural information for the LacI/GalR family of transcription regulators. Sequence alignments are presented for >3000 proteins in 45 paralog subfamilies and as a subsampled alignment of the whole family. Phenotypic and biochemical data on almost 6000 mutants have been compiled from an exhaustive search of the literature; citations for these data are included herein. These data include information about oligomerization state, stability, DNA binding and allosteric regulation. Protein structural data for 65 proteins are presented as easily-accessible, residue-contact networks. Finally, this article includes example queries to enable the use of the AlloRep database. See the related article, "AlloRep: a repository of sequence, structural and mutagenesis data for the LacI/GalR transcription regulators" (Sousa et al., 2016) [1].

Structures of Staphylococcus aureus D-tagatose-6-phosphate kinase implicate domain motions in specificity and mechanism.

PubMed

Miallau, Linda; Hunter, William N; McSweeney, Sean M; Leonard, Gordon A

2007-07-06

High resolution structures of Staphylococcus aureus d-tagatose-6-phosphate kinase (LacC) in two crystal forms are herein reported. The structures define LacC in apoform, in binary complexes with ADP or the co-factor analogue AMP-PNP, and in a ternary complex with AMP-PNP and D-tagatose-6-phosphate. The tertiary structure of the LacC monomer, which is closely related to other members of the pfkB subfamily of carbohydrate kinases, is composed of a large alpha/beta core domain and a smaller, largely beta "lid." Four extended polypeptide segments connect these two domains. Dimerization of LacC occurs via interactions between lid domains, which come together to form a beta-clasp structure. Residues from both subunits contribute to substrate binding. LacC adopts a closed structure required for phosphoryl transfer only when both substrate and co-factor are bound. A reaction mechanism similar to that used by other phosphoryl transferases is proposed, although unusually, when both substrate and co-factor are bound to the enzyme two Mg(2+) ions are observed in the active site. A new motif of amino acid sequence conservation common to the pfkB subfamily of carbohydrate kinases is identified.

Comparative genome analysis of Streptococcus infantarius subsp. infantarius CJ18, an African fermented camel milk isolate with adaptations to dairy environment.

PubMed

Jans, Christoph; Follador, Rainer; Hochstrasser, Mira; Lacroix, Christophe; Meile, Leo; Stevens, Marc J A

2013-03-22

Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC.We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ.Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations.

Comparative genome analysis of Streptococcus infantarius subsp. infantarius CJ18, an African fermented camel milk isolate with adaptations to dairy environment

PubMed Central

2013-01-01

Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. Conclusions The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations. PMID:23521820

DNA sequence and characterization of GcvA, a LysR family regulatory protein for the Escherichia coli glycine cleavage enzyme system.

PubMed Central

Wilson, R L; Stauffer, G V

1994-01-01

The gene encoding GcvA, the trans-acting regulatory protein for the Escherichia coli glycine cleavage enzyme system, has been sequenced. The gcvA locus contains an open reading frame of 930 nucleotides that could encode a protein with a molecular mass of 34.4 kDa, consistent with the results of minicell analysis indicating that GcvA is a polypeptide of approximately 33 kDa. The deduced amino acid sequence of GcvA revealed that this protein shares similarity with the LysR family of activator proteins. The transcription start site was found to be 72 bp upstream of the presumed translation start site. A chromosomal deletion of gcvA resulted in the inability of cells to activate the expression of a gcvT-lacZ gene fusion when grown in the presence of glycine and an inability to repress gcvT-lacZ expression when grown in the presence of inosine. The regulation of gcvA was examined by constructing a gcvA-lacZ gene fusion in which beta-galactosidase synthesis is under the control of the gcvA regulatory region. Although gcvA expression appears to be autogenously regulated over a two- to threefold range, it is neither induced by glycine nor repressed by inosine. Images PMID:8188587

Genotype to Phenotype Mapping of the E. coli lac Promoter

NASA Astrophysics Data System (ADS)

Otwinowski, Jakub; Nemenman, Ilya

2014-03-01

Genotype-to-phenotype maps and the related fitness landscapes that include epistatic interactions are difficult to measure because of their high dimensional structure. Here we construct such a map using the recently collected corpora of high-throughput sequence data from the 75 base pairs long mutagenized E. coli lac promoter region, where each sequence is associated with induced transcriptional activity measured by a fluorescent reporter. We find that the additive (non-epistatic) contributions of individual mutations account for about two-thirds of the explainable phenotype variance, while pairwise epistasis explains about 7% of the variance for the full mutagenized sequence and about 15% for the subsequence associated with protein binding sites. Surprisingly, there is no evidence for third order epistatic contributions, and our inferred fitness landscape is essentially single peaked, with a small amount of antagonistic epistasis. We identify transcription factor (CRP) and RNA polymerase binding sites in the promotor region and their interactions. We conclude with a cautionary note that inferred properties of fitness landscapes may be severely influenced by biases in the sequence data. Funded in part by HFSP and James S. McDonnell Foundation.

Experimental identification of specificity determinants in the domain linker of a LacI/GalR protein: bioinformatics-based predictions generate true positives and false negatives.

PubMed

Meinhardt, Sarah; Swint-Kruse, Liskin

2008-12-01

In protein families, conserved residues often contribute to a common general function, such as DNA-binding. However, unique attributes for each homolog (e.g. recognition of alternative DNA sequences) must arise from variation in other functionally-important positions. The locations of these "specificity determinant" positions are obscured amongst the background of varied residues that do not make significant contributions to either structure or function. To isolate specificity determinants, a number of bioinformatics algorithms have been developed. When applied to the LacI/GalR family of transcription regulators, several specificity determinants are predicted in the 18 amino acids that link the DNA-binding and regulatory domains. However, results from alternative algorithms are only in partial agreement with each other. Here, we experimentally evaluate these predictions using an engineered repressor comprising the LacI DNA-binding domain, the LacI linker, and the GalR regulatory domain (LLhG). "Wild-type" LLhG has altered DNA specificity and weaker lacO(1) repression compared to LacI or a similar LacI:PurR chimera. Next, predictions of linker specificity determinants were tested, using amino acid substitution and in vivo repression assays to assess functional change. In LLhG, all predicted sites are specificity determinants, as well as three sites not predicted by any algorithm. Strategies are suggested for diminishing the number of false negative predictions. Finally, individual substitutions at LLhG specificity determinants exhibited a broad range of functional changes that are not predicted by bioinformatics algorithms. Results suggest that some variants have altered affinity for DNA, some have altered allosteric response, and some appear to have changed specificity for alternative DNA ligands.

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2003-02-01

The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

76 FR 80331 - Foreign-Trade Subzone 41H Application for Expansion; Mercury Marine (Marine Propulsion Products...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-23

... Application for Expansion; Mercury Marine (Marine Propulsion Products), Fond du Lac and Oshkosh, WI An... of FTZ 41, on behalf of Mercury Marine, operator of Subzone 41H at Mercury Marine's marine propulsion... manufacturing of marine propulsion products at Mercury Marine's facilities located in Fond du Lac and Oshkosh...

Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events.

PubMed

Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T

2011-06-01

Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Properties of optically selected BL Lacertae candidates from the SDSS

NASA Astrophysics Data System (ADS)

Kügler, S. D.; Nilsson, K.; Heidt, J.; Esser, J.; Schultz, T.

2014-09-01

Context. Deep optical surveys open the avenue for finding large numbers of BL Lac objects that are hard to identify because they lack the unique properties classifying them as such. While radio or X-ray surveys typically reveal dozens of sources, recent compilations based on optical criteria alone have increased the number of BL Lac candidates considerably. However, these compilations are subject to biases and may contain a substantial number of contaminating sources. Aims: In this paper we extend our analysis of 182 optically selected BL Lac object candidates from the SDSS with respect to an earlier study. The main goal is to determine the number of bona fide BL Lac objects in this sample. Methods: We examine their variability characteristics, determine their broad-band radio-UV spectral energy distributions (SEDs), and search for the presence of a host galaxy. In addition we present new optical spectra for 27 targets with improved signal-to-noise ratio with respect to the SDSS spectra. Results: At least 59% of our targets have shown variability between SDSS DR2 and our observations by more than 0.1-0.27 mag depending on the telescope used. A host galaxy was detected in 36% of our targets. The host galaxy type and luminosities are consistent with earlier studies of BL Lac host galaxies. Simple fits to broad-band SEDs for 104 targets of our sample derived synchrotron peak frequencies between 13.5 ≤ log 10(νpeak) ≤ 16 with a peak at log 10 ~ 14.5. Our new optical spectra do not reveal any new redshift for any of our objects. Thus the sample contains a large number of bona fide BL Lac objects and seems to contain a substantial fraction of intermediate-frequency peaked BL Lacs. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory under proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Canarias.Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway, and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.

Illumina microRNA profiles reveal the involvement of miR397a in Citrus adaptation to long-term boron toxicity via modulating secondary cell-wall biosynthesis.

PubMed

Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song

2016-03-10

The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5'-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis.

Illumina microRNA profiles reveal the involvement of miR397a in Citrus adaptation to long-term boron toxicity via modulating secondary cell-wall biosynthesis

PubMed Central

Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song

2016-01-01

The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5′-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis. PMID:26962011

The evaluation of acute physiology and chronic health evaluation II score, poisoning severity score, sequential organ failure assessment score combine with lactate to assess the prognosis of the patients with acute organophosphate pesticide poisoning.

PubMed

Yuan, Shaoxin; Gao, Yusong; Ji, Wenqing; Song, Junshuai; Mei, Xue

2018-05-01

The aim of this study was to assess the ability of acute physiology and chronic health evaluation II (APACHE II) score, poisoning severity score (PSS) as well as sequential organ failure assessment (SOFA) score combining with lactate (Lac) to predict mortality in the Emergency Department (ED) patients who were poisoned with organophosphate.A retrospective review of 59 stands-compliant patients was carried out. Receiver operating characteristic (ROC) curves were constructed based on the APACHE II score, PSS, SOFA score with or without Lac, respectively, and the areas under the ROC curve (AUCs) were determined to assess predictive value. According to SOFA-Lac (a combination of SOFA and Lac) classification standard, acute organophosphate pesticide poisoning (AOPP) patients were divided into low-risk and high-risk groups. Then mortality rates were compared between risk levels.Between survivors and non-survivors, there were significant differences in the APACHE II score, PSS, SOFA score, and Lac (all P < .05). The AUCs of the APACHE II score, PSS, and SOFA score were 0.876, 0.811, and 0.837, respectively. However, after combining with Lac, the AUCs were 0.922, 0.878, and 0.956, respectively. According to SOFA-Lac, the mortality of high-risk group was significantly higher than low-risk group (P < .05) and the patients of the non-survival group were all at high risk.These data suggest the APACHE II score, PSS, SOFA score can all predict the prognosis of AOPP patients. For its simplicity and objectivity, the SOFA score is a superior predictor. Lac significantly improved the predictive abilities of the 3 scoring systems, especially for the SOFA score. The SOFA-Lac system effectively distinguished the high-risk group from the low-risk group. Therefore, the SOFA-Lac system is significantly better at predicting mortality in AOPP patients.

Genetic Requirements for the Single-Strand Annealing Pathway of Double-Strand Break Repair in Saccharomyces Cerevisiae

PubMed Central

Ivanov, E. L.; Sugawara, N.; Fishman-Lobell, J.; Haber, J. E.

1996-01-01

HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. PMID:8849880

[Retrospective analysis of the value of arterial blood lactate level and its clearance rate on the prognosis of septic shock patients].

PubMed

Bao, Lei; Zhang, Min; Yan, Peixia; Wu, Xiaoyan; Shao, Jun; Zheng, Ruiqiang

2015-01-01

To explore the prognostic value of arterial blood lactate ( Lac ) levels and lactate clearance rate ( LCR ) in the patients with septic shock. A retrospective study was conducted. Clinical data of 94 septic patients admitted in the Department of Critical Care Medicine in Subei People's Hospital from January 2011 to June 2014 were analyzed. The arterial blood Lac levels at the moment of diagnosis of septic shock ( incipient value, 0 hour ) and early-stage after treatment ( 3, 6 and 24 hours ) were reviewed, and individual LCR was calculated at 3, 6, 24 hours for each patient. According to the outcome in intensive care unit ( ICU ), patients were divided into survival group ( n = 48 ) and death group ( n = 46 ). The Lac and LCR at different time points in two groups were analyzed, and the relationships between them and outcome were analyzed. The receiver-operating characteristic ( ROC ) curve was plotted to assess the value of Lac and LCR at different time points for predicting the outcome. Lac level after treatment in survival group was significantly lower than incipient value, but there was no obvious change in death group. Compared with death group, early Lac levels ( mmol/L ) in survival group were significantly reduced ( 0 hour: 3.80±2.14 vs. 5.75±3.21, 3 hours: 2.05±1.04 vs. 5.03±2.53, 6 hours: 1.80±0.77 vs. 4.40±2.02, 24 hours: 1.35±0.43 vs. 4.90±2.72, P<0.05 or P<0.01 ), the LCR was significantly increased [ 3 hours: 50.00 ( 72.35 )% vs. 13.51 ( 20.67 )%, 6 hours: 41.43 ( 58.42 )% vs. 22.00 ( 22.31 )%, 24 hours: 58.73 ( 29.94 )% vs. 18.92 ( 47.28 )%, P<0.05 or P<0.01 ]. The Lac levels at all time points were positively correlated with the outcome, and 6-hour and 24-hour LCR were negatively correlated with the outcome. According to the incipient Lac level, patients were divided into low Lac group ( Lac<2 mmol/L ), mild Lac group ( Lac 2-3 mmol/L ) and high Lac group ( Lac ≥ 4 mmol/L ). The mortality in low Lac group, mild Lac group, high Lac group was gradually increased [ 23.07% ( 6/26 ), 50.00% ( 8/16 ), 61.54% ( 32/52 ), χ(2) = 10.270, P = 0.006 ]. ROC curves demonstrated that the area under ROC curve ( AUC ) of 24-hour Lac was the largest, 0.944, and it was more sensitive and specific in the prognosis evaluation ( 100% and 78.3%, respectively ). According to the cut-off value of 24-hour Lac as 2.35 mmol/L, patients were divided into high Lac and low Lac groups, and mortality rate in high Lac group was significantly higher than that in low Lac group [ 100.0% ( 36/36 ) vs. 17.24% ( 10/58 ), χ(2) = 30.441,P = 0.000 ]. The AUC of 24-hour LCR was the largest, 0.865, and it was more sensitive and specific for the prognosis evaluation ( 83.3% and 91.3%, respectively ). According to the cut-off value of 24-hour LCR as 36.8%, patients were divided into high LCR group and low LCR group, and mortality rate in low LCR group was significantly higher than that in high LCR group [ 84.00% ( 42/50 ) vs. 9.09% ( 4/44 ), χ(2) = 26.278, P = 0.000 ]. Early high Lac in patients with septic shock prompts a poor prognosis, and 24-hour Lac levels and LCR are indicators of assessment of clinical therapeutic effect and prognosis of patients with septic shock.

Tunable Control of an Escherichia coli Expression System for the Overproduction of Membrane Proteins by Titrated Expression of a Mutant lac Repressor.

PubMed

Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho

2017-09-15

Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.

UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.

UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less

Prediction of glycolipid-binding domains from the amino acid sequence of lipid raft-associated proteins: application to HpaA, a protein involved in the adhesion of Helicobacter pylori to gastrointestinal cells.

PubMed

Fantini, Jacques; Garmy, Nicolas; Yahi, Nouara

2006-09-12

Protein-glycolipid interactions mediate the attachment of various pathogens to the host cell surface as well as the association of numerous cellular proteins with lipid rafts. Thus, it is of primary importance to identify the protein domains involved in glycolipid recognition. Using structure similarity searches, we could identify a common glycolipid-binding domain in the three-dimensional structure of several proteins known to interact with lipid rafts. Yet the three-dimensional structure of most raft-targeted proteins is still unknown. In the present study, we have identified a glycolipid-binding domain in the amino acid sequence of a bacterial adhesin (Helicobacter pylori adhesin A, HpaA). The prediction was based on the major properties of the glycolipid-binding domains previously characterized by structural searches. A short (15-mer) synthetic peptide corresponding to this putative glycolipid-binding domain was synthesized, and we studied its interaction with glycolipid monolayers at the air-water interface. The synthetic HpaA peptide recognized LacCer but not Gb3. This glycolipid specificity was in line with that of the whole bacterium. Molecular modeling studies gave some insights into this high selectivity of interaction. It also suggested that Phe147 in HpaA played a key role in LacCer recognition, through sugar-aromatic CH-pi stacking interactions with the hydrophobic side of the galactose ring of LacCer. Correspondingly, the replacement of Phe147 with Ala strongly affected LacCer recognition, whereas substitution with Trp did not. Our method could be used to identify glycolipid-binding domains in microbial and cellular proteins interacting with lipid shells, rafts, and other specialized membrane microdomains.

The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

PubMed

Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

1998-06-01

We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

Water quality and hydrology of the Lac Vieux Desert watershed, Gogebic County, Michigan, and Vilas County, Wisconsin, 2002-04

USGS Publications Warehouse

Weaver, T.L.; Neff, B.P.; Ellis, J.M.

2005-01-01

Lac Vieux Desert is a prominent 6.6 square-mile lake that straddles the Michigan-Wisconsin border and forms the headwaters of the Wisconsin River. For generations, the Lac Vieux Desert Band of Lake Superior Chippewa Indians have used Lac Vieux Desert and the surrounding area for growing and harvesting wild rice, and hunting and fishing. The Lac Vieux Desert Band is concerned about the impact of lake-stage regulation on hydrology and ecology, and the impact on water quality of development along and near the shore, and recreational watercraft use and sport fishing. In 2005, the U.S. Geological Survey completed a water-resources investigation of the Lac Vieux Desert watershed in cooperation with the Lac Vieux Desert Band of Lake Superior Chippewa Indians.Water quality of Lac Vieux Desert is typical of many lakes in the northern United States. Trophic State Index calculations classify Lac Vieux Desert as a highly productive eutrophic lake. The pH of water in Lac Vieux Desert ranged from 6.5 to 9.5, and specific conductance ranged from 62 to 114 µs/cm. Chloride concentration was less than 1.5 mg/L, indicating little effect from septic-tank or road-salt input. Results indicate that the water can be classified as soft, with hardness concentrations reported as calcium carbonate ranging from 29 to 49 mg/L. Concentrations of calcium, magnesium, chloride, and other dissolved solids ranged from 47 to 77 mg/L. Alkalinity of Lac Vieux Desert ranged from 27 to 38 mg/L.Pervasive aquatic blooms, including a bloom noted during the September 2003 sampling, are apparently common in late summer. Biological productivity at Lac Vieux Desert does not appear to have changed appreciably between 1973 and 2004. In the current study, total phosphorus concentrations ranged from 0.01 to 0.064 mg/L and dissolved nitrite plus nitrate nitrogen concentrations ranged from at, or below detection limit to 0.052 mg/L. Overabundance of nutrients in Lac Vieux Desert, particularly nitrogen and phosphorus, could result in considerable degradation in lake-water quality.The estimated water balance includes the following inputs from the surrounding watershed: direct precipitation (35 percent); runoff, composed of streamflow and overland flow (50 percent); and ground-water flow (15 percent). Outputs from Lac Vieux Desert include streamflow into the Wisconsin River (68 percent) and evaporation from the lake surface (32 percent). Seasonal regulation of Lac Vieux Desert outflow results in an artificially high lake stage throughout the year, except from late winter to very early spring, prior to snowmelt and runoff. Regulation of Lac Vieux Desert outflow causes Wisconsin River streamflow to be artificially low during spring and summer and artificially high in fall and winter.Recent studies indicate that lake-level regulation over the past century may have affected wild rice growth and propagation in Lac Vieux Desert. As per licensing agreement between the Federal Energy Regulatory Commission and the Wisconsin Valley Improvement Company (operators of the dam at the outlet), the maximum lake level of Lac Vieux Desert was lowered about 0.8 feet to investigate the relation between lake-level regulation and propagation of wild rice from 2003 through 2012. Recent plantings of wild rice by the Lac Vieux Desert Band have been successful, indicating that suitable habitat and hydrologic regime were present in 2004-05.

hsa_circ_0013958: a circular RNA and potential novel biomarker for lung adenocarcinoma.

PubMed

Zhu, Xiaoli; Wang, Xiyong; Wei, Shuzhen; Chen, Yan; Chen, Yang; Fan, Xiaobo; Han, Shuhua; Wu, Guoqiu

2017-07-01

Circular RNAs (circRNAs) are associated with cancer progression and metastasis, although little is known about their role in lung adenocarcinoma (LAC). In the present study, microarrays were first used to screen for tumour-specific circRNA candidates in LAC tissue. Thirty-nine circRNAs were found to be up-regulated and 20 were down-regulated (fold change > 2.0). Among them, hsa_circ_0013958 was further confirmed to be up-regulated in all of the LAC tissues, cells and plasma. In addition, hsa_circ_0013958 levels were associated with TNM stage (P = 0.009) and lymphatic metastasis (P = 0.006). The area under the receiver operating characteristic curve was 0.815 (95% confidence interval = 0.727-0.903; P < 0.001). In addition, to further illustrate the bioactivities of hsa_circ_0013958 in LAC, siRNA-mediated inhibition of hsa_circ_0013958 was performed in vitro. The results showed that hsa_circ_0013958 promoted cell proliferation and invasion and inhibited cell apoptosis in LAC. Moreover, hsa_circ_0013958 was identified as a sponge of miR-134, and thus it up-regulated oncogenic cyclin D1, which plays a pivotal role in the development of non-small cell lung cancer. In conclusion, our results suggested that hsa_circ_0013958 could be used as a potential non-invasive biomarker for the early detection and screening of LAC. © 2017 Federation of European Biochemical Societies.

Translational regulation of sigma 32 synthesis: requirement for an internal control element.

PubMed Central

Kamath-Loeb, A S; Gross, C A

1991-01-01

We have investigated the sequence requirements for the translational regulation of sigma 32 by examining the behavior of a new rpoH-lacZ protein fusion containing a short N-terminal fragment of sigma 32 fused to beta-galactosidase. Although the fusion retains rpoH translational initiation signals, it lacks translational regulation, implicating coding sequences within rpoH in this regulatory process. Images PMID:2050641

Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

PubMed

Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

1998-01-01

The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

The mechanism and high-free-energy transition state of lac repressor–lac operator interaction

PubMed Central

Sengupta, Rituparna; Capp, Michael W.; Shkel, Irina A.

2017-01-01

Abstract Significant, otherwise-unavailable information about mechanisms and transition states (TS) of protein folding and binding is obtained from solute effects on rate constants. Here we characterize TS for lac repressor(R)–lac operator(O) binding by analyzing effects of RO-stabilizing and RO-destabilizing solutes on association (ka) and dissociation (kd) rate constants. RO-destabilizing solutes (urea, KCl) reduce ka comparably (urea) or more than (KCl) they increase kd, demonstrating that they destabilize TS relative to reactants and RO, and that TS exhibits most of the Coulombic interactions between R and O. Strikingly, three solutes which stabilize RO by favoring burial/dehydration of amide oxygens and anionic phosphate oxygens all reduce kd without affecting ka significantly. The lack of stabilization of TS by these solutes indicates that O phosphates remain hydrated in TS and that TS preferentially buries aromatic carbons and amide nitrogens while leaving amide oxygens exposed. In our proposed mechanism, DNA-binding-domains (DBD) of R insert in major grooves of O pre-TS, forming most Coulombic interactions of RO and burying aromatic carbons. Nucleation of hinge helices creates TS, burying sidechain amide nitrogens. Post-TS, hinge helices assemble and the DBD-hinge helix-O-DNA module docks on core repressor, partially dehydrating phosphate oxygens and tightening all interfaces to form RO. PMID:29036376

Preoperative cow-side lactatemia measurement predicts negative outcome in Holstein dairy cattle with right abomasal disorders.

PubMed

Boulay, G; Francoz, D; Doré, E; Dufour, S; Veillette, M; Badillo, M; Bélanger, A-M; Buczinski, S

2014-01-01

The objectives of the current study were (1) to determine the gain in prognostic accuracy of preoperative l-lactate concentration (LAC) measured on farm on cows with right displaced abomasum (RDA) or abomasal volvulus (AV) for predicting negative outcome; and (2) to suggest clinically relevant thresholds for such use. A cohort of 102 cows with on-farm surgical diagnostic of RDA or AV was obtained from June 2009 through December 2011. Blood was drawn from coccygeal vessels before surgery and plasma LAC was immediately measured by using a portable clinical analyzer. Dairy producers were interviewed by phone 30 d following surgery and the outcome was determined: a positive outcome if the owner was satisfied of the overall evolution 30 d postoperatively, and a negative outcome if the cow was culled, died, or if the owner reported being unsatisfied 30 d postoperatively. The area under the curve of the receiver operating characteristic curve for LAC was 0.92 and was significantly greater than the area under the curve of the receiver operating characteristic curve of heart rate (HR; 0.77), indicating that LAC, in general, performed better than HR to predict a negative outcome. Furthermore, the ability to predict a negative outcome was significantly improved when LAC measurement was considered in addition to the already available HR data (area under the curve: 0.93 and 95% confidence interval: 0.87, 0.99). Important inflection points of the misclassification cost term function were noted at thresholds of 2 and 6 mmol/L, suggesting the potential utility of these cut-points. The 2 and 6 mmol/L thresholds had a sensitivity, specificity, positive predictive value, and negative predictive value for predicting a negative outcome of 76.2, 82.7, 53.3, and 93.1%, and of 28.6, 97.5, 75, and 84%, respectively. In terms of clinical interpretation, LAC ≤2 mmol/L appeared to be a good indicator of positive outcome and could be used to support a surgical treatment decision. The treatment decision for cows with LAC between 2 and 6 mmol/L, however, would depend on the economic context and the owner's attitude to risk in regard to potential return on its investment. Finally, performing a surgical correction on commercial cows with RDA or AV and a LAC ≥6 mmol/L appeared to be unjustified and these animals should be culled based on their high probability of negative outcome. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Novel interactions of complex carbohydrates with peanut (PNA), Ricinus communis (RCA-I), Sambucus nigra (SNA-I) and wheat germ (WGA) agglutinins as revealed by the binding specificities of these lectins towards mucin core-2 O-linked and N-linked glycans and related structures.

PubMed

Chandrasekaran, E V; Xue, Jun; Xia, Jie; Khaja, Siraj D; Piskorz, Conrad F; Locke, Robert D; Neelamegham, Sriram; Matta, Khushi L

2016-10-01

Plant lectins through their multivalent quaternary structures bind intrinsically flexible oligosaccharides. They recognize fine structural differences in carbohydrates and interact with different sequences in mucin core 2 or complex-type N-glycan chain and also in healthy and malignant tissues. They are used in characterizing cellular and extracellular glycoconjugates modified in pathological processes. We study here, the complex carbohydrate-lectin interactions by determining the effects of substituents in mucin core 2 tetrasaccharide Galβ1-4GlcNAcβ1-6(Galβ1-3)GalNAcα-O-R and fetuin glycopeptides on their binding to agarose-immobilized lectins PNA, RCA-I, SNA-I and WGA. Briefly, in mucin core 2 tetrasaccharide (i) structures modified by α2-3/6-Sialyl LacNAc, LewisX and α1-3-Galactosyl LacNAc resulted in regular binding to PNA whereas compounds with 6-sulfo LacNAc displayed no-binding; (ii) strucures bearing α2-6-sialyl 6-sulfo LacNAc, or 6-sialyl LacdiNAc carbohydrates displayed strong binding to SNA-I; (iii) structures with α2-3/6-sialyl, α1-3Gal LacNAc or LewisX were non-binder to RCA-I and compounds with 6-sulfo LacNAc only displayed weak binding; (iv) structures containing LewisX, 6-Sulfo LewisX, α2-3/6-sialyl LacNAc, α2-3/6-sialyl 6-sulfo LacNAc and GalNAc Lewis-a were non-binding to WGA, those with α1-2Fucosyl, α1-3-Galactosyl LacNAc, α2-3-sialyl T-hapten plus 3'/6'sulfo LacNAc displayed weak binding, and compounds with α2-3-sialyl T-hapten, α2.6-Sialyl LacdiNAc, α2-3-sialyl D-Fucβ1-3 GalNAc and Fucα-1-2 D-Fucβ-1-3GalNAc displaying regular binding and GalNAc LewisX and LacdiNAc plus D-Fuc β-1-3 GalNAcα resulting in tight binding. RCA-I binds Fetuin triantennary asialoglycopeptide 100 % after α-2-3 and 25 % after α-2-6 sialylation, 30 % after α-1-2 and 100 % after α-1-3 fucosylation, and 50 % after α-1-3 galactosylation. WGA binds 3-but not 6-Fucosyl chitobiose core. Thus, information on the influence of complex carbohydrate chain constituents on lectin binding is apparently essential for the potential application of lectins in glycoconjugate research.

LacR Is a Repressor of lacABCD and LacT Is an Activator of lacTFEG, Constituting the lac Gene Cluster in Streptococcus pneumoniae

PubMed Central

Afzal, Muhammad; Shafeeq, Sulman

2014-01-01

Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into two operons, i.e., lac operon I (lacABCD) and lac operon II (lacTFEG). Deletion of the DeoR family transcriptional regulator lacR that is present downstream of the lac gene cluster revealed elevated expression of lac operon I even in the absence of lactose. This suggests a function of LacR as a transcriptional repressor of lac operon I, which encodes enzymes involved in the phosphorylated tagatose pathway in the absence of lactose or galactose. Deletion of lacR did not affect the expression of lac operon II, which encodes a lactose-specific phosphotransferase. This finding was further confirmed by β-galactosidase assays with PlacA-lacZ and PlacT-lacZ in the presence of either lactose or glucose as the sole carbon source in the medium. This suggests the involvement of another transcriptional regulator in the regulation of lac operon II, which is the BglG-family transcriptional antiterminator LacT. We demonstrate the role of LacT as a transcriptional activator of lac operon II in the presence of lactose and CcpA-independent regulation of the lac gene cluster in S. pneumoniae. PMID:24951784

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Next-generation sequencing and clinical outcomes of patients with lung adenocarcinoma treated with stereotactic body radiotherapy.

PubMed

Cassidy, Richard J; Zhang, Xinyan; Patel, Pretesh R; Shelton, Joseph W; Escott, Chase E; Sica, Gabriel L; Rossi, Michael R; Hill, Charles E; Steuer, Conor E; Pillai, Rathi N; Ramalingam, Suresh S; Owonikoko, Taofeek K; Behera, Madhusmita; Force, Seth D; Fernandez, Felix G; Curran, Walter J; Higgins, Kristin A

2017-10-01

Genetic aberrations are well characterized in lung adenocarcinomas (LACs) and clinical outcomes have been influenced by targeted therapies in the advanced setting. Stereotactic body radiotherapy (SBRT) is the standard-of-care therapy for patients with nonoperable, early-stage LAC, but to the authors' knowledge, no information is available regarding the impact of genomic changes in these patients. The current study sought to determine the frequency and clinical impact of genetic aberrations in this population. Under an Institutional Review Board-approved protocol, the records of 242 consecutive patients with early-stage lung cancers were reviewed; inclusion criteria included LAC histology with an adequate tumor sample for the successful use of next-generation sequencing and fluorescence in situ hybridization testing. Univariate analysis was performed to identify factors associated with clinical outcomes. LAC samples from 98 of the 242 patients were reviewed (40.5%), of whom 45 patients (46.0%) had genetic testing. The following mutations were noted: KRAS in 20.0% of samples, BRAF in 2.2% of samples, SMAD family member 4 (SMAD4) in 4.4% of samples, epidermal growth factor receptor (EGFR) in 15.6% of samples, STK1 in 2.2% of samples, tumor protein 53 (TP53) in 15.6% of samples, and phosphatase and tensin homolog (PTEN) in 2.2% of samples. The following gene rearrangements were observed: anaplastic lymphoma kinase (ALK) in 8.9% of samples, RET in 2.2% of samples, and MET amplification in 17.8% of samples. The median total delivered SBRT dose was 50 grays (range, 48-60 grays) over a median of 5 fractions (range, 3-8 fractions). The KRAS mutation was associated with worse local control (odds ratio [OR], 3.64; P<.05). MET amplification was associated with worse regional (OR, 4.64; P<.05) and distant (OR, 3.73; P<.05) disease control. To the authors' knowledge, the current series is the first to quantify genetic mutations and their association with clinical outcomes in patients with early-stage LAC treated with SBRT. KRAS mutations were associated with worse local control and MET amplification was associated with worse regional and distant disease control, findings that need to be validated in a prospective setting. Cancer 2017;123:3681-3690. © 2017 American Cancer Society. © 2017 American Cancer Society.

Gfi1-Cre knock-in mouse line: A tool for inner ear hair cell-specific gene deletion

PubMed Central

Yang, Hua; Gan, Jean; Xie, Xiaoling; Deng, Min; Feng, Liang; Chen, Xiaowei; Gao, Zhiqiang; Gan, Lin

2010-01-01

Summary Gfi1encodes a zinc-finger transcription factor essential for the development and maintenance of haematopoiesis and the inner ear. In mouse inner ear, Gfi1 expression is confined to hair cells during development and in adulthood. To construct a genetic tool for inner ear hair cell-specific gene deletion, we generated a Gfi1-Cre mouse line by knocking-in Cre coding sequences into the Gfi1 locus and inactivating the endogenous Gfi1. The specificity and efficiency of Gfi1-Cre recombinase-mediated recombination in the developing inner ear was revealed through the expression of the conditional R26R-lacZ reporter gene. The onset of lacZ expression in the Gfi1Cre/+ inner ear was first detected at E13.5 in the vestibule and at E15.5 in the cochlea, coinciding with the generation of hair cells. Throughout inner ear development, lacZ expression was detected only in hair cells. Thus, Gfi1-Cre knock-in mouse line provides a useful tool for gene manipulations specifically in inner ear hair cells. PMID:20533399

Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piette, J.; Decuyper-Debergh, D.; Gamper, H.

Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less

Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes

PubMed Central

Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.

2016-01-01

DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167

MicroRNA528 Affects Lodging Resistance of Maize by Regulating Lignin Biosynthesis under Nitrogen-Luxury Conditions.

PubMed

Sun, Qing; Liu, Xiaogang; Yang, Juan; Liu, Wenwen; Du, Qingguo; Wang, Hongqiu; Fu, Chunxiang; Li, Wen-Xue

2018-06-04

Lodging under nitrogen (N)-luxury conditions substantially reduces crop yield and seed quality. However, the molecular mechanisms of plant lodging resistance remain largely unclear, especially in maize. We report here that the expression of ZmmiR528, a monocot-specific microRNA, is induced by N luxury but reduced by N deficiency. We show by the thioacidolysis and acetyl bromide analysis that N luxury significantly reduces the generation of H, G, and S monomers of the lignin as well as its total content in maize shoots. We further demonstrate that ZmLACCASE3 (ZmLAC3) and ZmLACCASE5 (ZmLAC5), which encode the copper-containing laccases, are the targets of ZmmiR528. In situ hybridization showed that ZmmiR528 is mainly expressed in maize vascular tissues. Knockdown of ZmmiR528 or overexpression of ZmLAC3 significantly increased the lignin content and rind penetrometer resistance of maize stems. In contrast, transgenic maize plants overexpressing ZmmiR528 had reduced lignin content and rind penetrometer resistance and were prone to lodging under N-luxury conditions. RNA-sequencing analysis revealed that ZmPAL7 and ZmPAL8 are upregulated in transgenic maize lines downregulating ZmmiR528. Under N-luxury conditions, the expression levels of ZmPALs were much higher in ZmmiR528-knockdown lines than in the wild type and transgenic maize lines overexpressing ZmmiR528. Taken together, these results indicate that, by regulating the expression of ZmLAC3 and ZmLAC5, ZmmiR528 affects maize lodging resistance under N-luxury conditions. Copyright © 2018 The Author. Published by Elsevier Inc. All rights reserved.

Disruption of the mouse Jhy gene causes abnormal ciliary microtubule patterning and juvenile hydrocephalus

PubMed Central

Appelbe, Oliver K.; Bollman, Bryan; Attarwala, Ali; Triebes, Lindy A.; Muniz-Talavera, Hilmarie; Curry, Daniel J.; Schmidt, Jennifer V.

2013-01-01

SUMMARY Congenital hydrocephalus, the accumulation of excess cerebrospinal fluid (CSF) in the ventricles of the brain, affects one of every 1,000 children born today, making it one of the most common human developmental disorders. Genetic causes of hydrocephalus are poorly understood in humans, but animal models suggest a broad genetic program underlying the regulation of CSF balance. In this study, the random integration of a transgene into the mouse genome led to the development of an early onset and rapidly progressive hydrocephalus. Juvenile hydrocephalus transgenic mice (JhylacZ) inherit communicating hydrocephalus in an autosomal recessive fashion with dilation of the lateral ventricles observed as early as postnatal day 1.5. Ventricular dilation increases in severity over time, becoming fatal at 4-8 weeks of age. The ependymal cilia lining the lateral ventricles are morphologically abnormal and reduced in number in JhylacZ/lacZ brains, and ultrastructural analysis revealed disorganization of the expected 9+2 microtubule pattern. Rather, the majority of JhylacZ/lacZ cilia develop axonemes with 9+0 or 8+2 microtubule structures. Disruption of an unstudied gene, 4931429I11Rik (now named Jhy) appears to underlie the hydrocephalus of JhylacZ/lacZ mice, and the Jhy transcript and protein are decreased in JhylacZ/lacZ mice. Partial phenotypic rescue was achieved in JhylacZ/lacZ mice by the introduction of a bacterial artificial chromosome (BAC) carrying 60-70% of the JHY protein coding sequence. Jhy is evolutionarily conserved from humans to basal vertebrates, but the predicted JHY protein lacks identifiable functional domains. Ongoing studies are directed at uncovering the physiological function of JHY and its role in CSF homeostasis. PMID:23906841

Louisiana SIP: LAC 33:III Ch. 5 Section 509. Prevention of Significant Deterioration; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) and 1991-07-01 (LAc57) and 1996-12-16 (LAc69) to 2011-08-17 (LAd36 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 5 Section 509. Prevention of Significant Deterioration; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) and 1991-07-01 (LAc57) and 1996-12-16 (LAc69) to 2011-08-17 (LAd36 - Revised)

Disruption of LACCASE4 and 17 Results in Tissue-Specific Alterations to Lignification of Arabidopsis thaliana Stems[W

PubMed Central

Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise

2011-01-01

Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792

Investigating Self-Perceptions and Resilience in Looked after Children

ERIC Educational Resources Information Center

Honey, Kyla L.; Rees, Paul; Griffey, Simon

2011-01-01

The perceptions of Looked After Children (LAC; n = 51), their Designated Teachers (DTs), and a sample of non-LAC (n = 99) were elicited. LAC held more positive self-perceptions than the non-LAC, and similarly positive ratings were given for the LAC by their DTs; but LAC held lower career aspirations than the non-LAC. LAC differed in their levels…

Comparison of the theoretical and real-world evolutionary potential of a genetic circuit

NASA Astrophysics Data System (ADS)

Razo-Mejia, M.; Boedicker, J. Q.; Jones, D.; DeLuna, A.; Kinney, J. B.; Phillips, R.

2014-04-01

With the development of next-generation sequencing technologies, many large scale experimental efforts aim to map genotypic variability among individuals. This natural variability in populations fuels many fundamental biological processes, ranging from evolutionary adaptation and speciation to the spread of genetic diseases and drug resistance. An interesting and important component of this variability is present within the regulatory regions of genes. As these regions evolve, accumulated mutations lead to modulation of gene expression, which may have consequences for the phenotype. A simple model system where the link between genetic variability, gene regulation and function can be studied in detail is missing. In this article we develop a model to explore how the sequence of the wild-type lac promoter dictates the fold-change in gene expression. The model combines single-base pair resolution maps of transcription factor and RNA polymerase binding energies with a comprehensive thermodynamic model of gene regulation. The model was validated by predicting and then measuring the variability of lac operon regulation in a collection of natural isolates. We then implement the model to analyze the sensitivity of the promoter sequence to the regulatory output, and predict the potential for regulation to evolve due to point mutations in the promoter region.

Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA.

PubMed Central

Monedero, V; Gosalbes, M J; Pérez-Martínez, G

1997-01-01

The chromosomal ccpA gene from Lactobacillus casei ATCC 393 has been cloned and sequenced. It encodes the CcpA protein, a central catabolite regulator belonging to the LacI-GalR family of bacterial repressors, and shows 54% identity with CcpA proteins from Bacillus subtilis and Bacillus megaterium. The L. casei ccpA gene was able to complement a B. subtilis ccpA mutant. An L. casei ccpA mutant showed increased doubling times and a relief of the catabolite repression of some enzymatic activities, such as N-acetylglucosaminidase and phospho-beta-galactosidase. Detailed analysis of CcpA activity was performed by using the promoter region of the L. casei chromosomal lacTEGF operon which is subject to catabolite repression and contains a catabolite responsive element (cre) consensus sequence. Deletion of this cre site or the presence of the ccpA mutation abolished the catabolite repression of a lacp::gusA fusion. These data support the role of CcpA as a common regulatory element mediating catabolite repression in low-GC-content gram-positive bacteria. PMID:9352913

The Second Catalog Of Active Galactic Nuclei Detected By The Fermi Large Area Telescope

DOE PAGES

Ackermann, M.

2011-12-02

The second catalog of active galactic nuclei (AGNs) detected by the Fermi Large Area Telescope (LAT) in two years of scientific operation is presented. The Second LAT AGN Catalog (2LAC) includes 1017 γ-ray sources located at high Galactic latitudes (|b| > 10°) that are detected with a test statistic (TS) greater than 25 and associated statistically with AGNs. However some of these are affected by analysis issues and some are associated with multiple AGNs. Consequently we define a clean sample which includes 886 AGNs, comprising 395 BL Lacertae objects (BL Lacs), 310 flat-spectrum radio quasars (FSRQs), 157 candidate blazars ofmore » unknown type (i.e., with broad-band blazar characteristics but with no optical spectral measurement yet), eight misaligned AGNs, four narrow-line Seyfert 1 (NLS1s), 10 AGNs of other types and two starburst galaxies. Where possible, the blazars have been further classified based on their spectral energy distributions (SEDs) as archival radio, optical, and X-ray data permit. While almost all FSRQs have a synchrotron-peak frequency < 10 14 Hz, about half of the BL Lacs have a synchrotron-peak frequency > 10 15 Hz. The 2LAC represents a significant improvement relative to the First LAT AGN Catalog (1LAC), with 52% more associated sources. The full characterization of the newly detected sources will require more broad-band data. Various properties, such as γ-ray fluxes and photon power law spectral indices, redshifts, γ-ray luminosities, variability, and archival radio luminosities—and their correlations are presented and discussed for the different blazar classes. The general trends observed in 1LAC are confirmed.« less

THE SECOND CATALOG OF ACTIVE GALACTIC NUCLEI DETECTED BY THE FERMI LARGE AREA TELESCOPE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ackermann, M.; Ajello, M.; Allafort, A.

The second catalog of active galactic nuclei (AGNs) detected by the Fermi Large Area Telescope (LAT) in two years of scientific operation is presented. The second LAT AGN catalog (2LAC) includes 1017 {gamma}-ray sources located at high Galactic latitudes (|b| > 10 Degree-Sign ) that are detected with a test statistic (TS) greater than 25 and associated statistically with AGNs. However, some of these are affected by analysis issues and some are associated with multiple AGNs. Consequently, we define a Clean Sample which includes 886 AGNs, comprising 395 BL Lacertae objects (BL Lac objects), 310 flat-spectrum radio quasars (FSRQs), 157more » candidate blazars of unknown type (i.e., with broadband blazar characteristics but with no optical spectral measurement yet), 8 misaligned AGNs, 4 narrow-line Seyfert 1 (NLS1s), 10 AGNs of other types, and 2 starburst galaxies. Where possible, the blazars have been further classified based on their spectral energy distributions (SEDs) as archival radio, optical, and X-ray data permit. While almost all FSRQs have a synchrotron-peak frequency <10{sup 14} Hz, about half of the BL Lac objects have a synchrotron-peak frequency >10{sup 15} Hz. The 2LAC represents a significant improvement relative to the first LAT AGN catalog (1LAC), with 52% more associated sources. The full characterization of the newly detected sources will require more broadband data. Various properties, such as {gamma}-ray fluxes and photon power-law spectral indices, redshifts, {gamma}-ray luminosities, variability, and archival radio luminosities and their correlations are presented and discussed for the different blazar classes. The general trends observed in 1LAC are confirmed.« less

The influence of L-acetylcarnitine on reinnervation of the oculomotor nerve.

PubMed

Pettorossi, V E; Draicchio, F; Fernandez, E; Pallini, R

1993-01-01

In guinea-pigs the oral administration of L-acetylcarnitine (L-AC) markedly favours the process of reinnervation of the oculomotor nerve sectioned at intracranial level. The gains of the horizontal and vertical vestibulo-ocular reflexes (HVOR, VVOR) were taken into consideration in testing the functional recovery of the nerve. As a consequence of the drug administration, 24 weeks after the operation the gains of the treated animals were higher than those of the controls. Reduction of misalignments of the stimulus-response orientation was also observed in treated animals as compared to the controls. This suggests that L-AC potentiates motor reinnervation by enhancing the nerve-growing processes and favouring a better consolidation of the appropriate neuromuscular synapses. The increased gain, and the improvement of the alignment in ocular responses, due to L-AC would allow for an increase of visual function during head movement by optimizing gaze stability.

Factors affecting expression of the recF gene of Escherichia coli K-12.

PubMed

Sandler, S J; Clark, A J

1990-01-31

This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

Lightning Arrestor Connectors Production Readiness

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marten, Steve; Linder, Kim; Emmons, Jim

2008-10-20

The Lightning Arrestor Connector (LAC), part “M”, presented opportunities to improve the processes used to fabricate LACs. The A## LACs were the first production LACs produced at the KCP, after the product was transferred from Pinnellas. The new LAC relied on the lessons learned from the A## LACs; however, additional improvements were needed to meet the required budget, yield, and schedule requirements. Improvement projects completed since 2001 include Hermetic Connector Sealing Improvement, Contact Assembly molding Improvement, development of a second vendor for LAC shells, general process improvement, tooling improvement, reduction of the LAC production cycle time, and documention of themore » LAC granule fabrication process. This report summarizes the accomplishments achieved in improving the LAC Production Readiness.« less

Standardized emergency management system and response to a smallpox emergency.

PubMed

Kim-Farley, Robert J; Celentano, John T; Gunter, Carol; Jones, Jessica W; Stone, Rogelio A; Aller, Raymond D; Mascola, Laurene; Grigsby, Sharon F; Fielding, Jonathan E

2003-01-01

The smallpox virus is a high-priority, Category-A agent that poses a global, terrorism security risk because it: (1) easily can be disseminated and transmitted from person to person; (2) results in high mortality rates and has the potential for a major public health impact; (3) might cause public panic and social disruption; and (4) requires special action for public health preparedness. In recognition of this risk, the Los Angeles County Department of Health Services (LAC-DHS) developed the Smallpox Preparedness, Response, and Recovery Plan for LAC to prepare for the possibility of an outbreak of smallpox. A unique feature of the LAC-DHS plan is its explicit use of the Standardized Emergency Management System (SEMS) framework for detailing the functions needed to respond to a smallpox emergency. The SEMS includes the Incident Command System (ICS) structure (management, operations, planning/intelligence, logistics, and finance/administration), the mutual-aid system, and the multi/interagency coordination required during a smallpox emergency. Management for incident command includes setting objectives and priorities, information (risk communications), safety, and liaison. Operations includes control and containment of a smallpox outbreak including ring vaccination, mass vaccination, adverse events monitoring and assessment, management of confirmed and suspected smallpox cases, contact tracing, active surveillance teams and enhanced hospital-based surveillance, and decontamination. Planning/intelligence functions include developing the incident action plan, epidemiological investigation and analysis of smallpox cases, and epidemiological assessment of the vaccination coverage status of populations at risk. Logistics functions include receiving, handling, inventorying, and distributing smallpox vaccine and vaccination clinic supplies; personnel; transportation; communications; and health care of personnel. Finally, finance/administration functions include monitoring costs related to the smallpox emergency, procurement, and administrative aspects that are not handled by other functional divisions of incident command systems. The plan was developed and is under frequent review by the LAC-DHS Smallpox Planning Working Group, and is reviewed periodically by the LAC Bioterrorism Advisory Committee, and draws upon the Smallpox Response Plan and Guidelines of the Centers for Disease Control and Prevention (CDC) and recommendations of the Advisory Committee on Immunization Practices (ACIP). The Smallpox Preparedness, Response, and Recovery Plan, with its SEMS framework and ICS structure, now is serving as a model for the development of LAC-DHS plans for responses to other terrorist or natural-outbreak responses.

Laparoscopic resection of transverse colon cancer at splenic flexure: technical aspects and results.

PubMed

Okuda, Junji; Yamamoto, Masashi; Tanaka, Keitaro; Masubuchi, Shinsuke; Uchiyama, Kazuhisa

2016-03-01

Laparoscopic resection of transverse colon cancer at splenic flexure is technical demanding and its efficacy remains controversial. The aim of this study was to investigate its technical aspects such as pitfalls and overcoming them, and to demonstrate the short-term and oncologic long-term outcomes. To overcome the difficulty in laparoscopic resection of transverse colon cancer at splenic flexure, we recognized the following technical tips as essential. First of all, we have to precisely identify major vessels variations feeding tumor. Secondary, anatomical dissection of mesocolon through medial approach is indispensible. Third, safe takedown of splenic flexure to fully mobilization of left hemicolon is mandatory. This cohort study analyzed 95 patients with stage II (43) and III (52) underwent resection of transverse colon cancer at splenic flexure. 61 laparoscopic surgeries (LAC) and 34 conventional open surgeries (OC) from December 1996 to December 2009 were evaluated. Short-term and oncologic long-term outcomes were recorded. Operative time was longer in LAC. However, blood loss was less, recovery of bowel function and hospital stay were shorter in LAC. There was no conversion in LAC and no significant difference in the postoperative complications. Regarding oncologic long-term outcomes, there were no significant differences between OC and LAC. Laparoscopic resection of transverse colon cancer at splenic flexure resulted in acceptable short-term and oncologic long-term outcomes. Once technical tips acquired, laparoscopic resection of transverse colon cancer at splenic flexure could be feasible as minimally invasive surgery.

A comparative study of thermochemical and cold plasma treatment on lignin-based activated carbon for adsorbing Fe(III)

NASA Astrophysics Data System (ADS)

Shi, Shukai; Wang, Xin; Chen, Weimin; Chen, Minzhi; Zhou, Xiaoyan

2018-05-01

The as-prepared lignin-based activated carbon (LAC) was post-treated by urea and radio-frequency cold plasma separately. The obtained results demonstrated that the BET surface and total volumes of the LAC and plasma-treated LACs were greater than the urea-modified sample. The analysis of surface elemental composition showed that the nitrogen content of urea-modified LAC and nitrogen plasma-treated LAC are 3.79% and 2.62% higher than that of original LAC respectively, while the oxygen content of air plasma-treated LAC is 10.23% higher than that of original LAC. The Fe(III) ions adsorbed studies with pseudo-second order kinetic model revealed that urea-modified LAC had faster chemisorption rates while air plasma-treated LAC had larger adsorption capacity within 3 h. Moreover, the adsorption capacity and chemisorption rates of LAC post-treated by nitrogen plasma are inferior to the air plasma-treated LAC.

Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

PubMed Central

Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

2014-01-01

Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727

Role of an expansin-like molecule in Dictyostelium morphogenesis and regulation of its gene expression by the signal transducer and activator of transcription protein Dd-STATa.

PubMed

Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi

2009-02-01

Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.

Formation of DNA adducts and induction of lacI mutations in Big Blue Rat-2 cells treated with temozolomide: implications for the treatment of low-grade adult and pediatric brain tumors.

PubMed

Bodell, William J; Gaikwad, Nilesh W; Miller, Douglas; Berger, Mitchel S

2003-06-01

Temozolomide (TMZ) is a chemotherapeutic agent used in the treatment of high-grade brain tumors. Treatment of patients with alkylating chemotherapeutic agents has been established to increase their risk for acute myelogenous leukemia. The formation of DNA adducts and induction of mutations are likely to play a role in the etiology of therapy-related acute myeloid leukemia. To evaluate this issue for TMZ, we have measured the formation of DNA adducts and induction of lacI mutations in Big Blue Rat-2 cells treated with TMZ. Treatment of Big Blue Rat-2 cells with either 0, 0.5, or 1 mM TMZ resulted in lacI mutant frequencies of 9.1 +/- 2.9 x 10(-5), 48.9 +/- 12 x 10(-5), and 89.7 +/- 40.3 x 10(-5), respectively. Comparison of the mutant frequencies demonstrated that 0.5 and 1 mM TMZ treatments increased the mutant frequencies by 5.3- and 9.8-fold and that this increase was significant (P < 0.001). Sequence analysis of the lacI mutants from the TMZ treatment group demonstrated that they were GC-->AT transitions at non-CpG sites, which is significantly different from the mutation spectrum observed in the control treatment group. Treatment of Big Blue Rat-2 cells with various concentrations of TMZ produced a linear increase in the levels of N7-methylguanine and O(6)-methylguanine. The lacI mutation spectrum induced by TMZ treatment is consistent with these mutations being produced by O(6)-MeG. This study establishes TMZ has significant mutagenic potential and suggests that careful consideration in the use of TMZ for the treatment of low-grade adult and pediatric brain tumors should be given.

kdgREcc Negatively Regulates Genes for Pectinases, Cellulase, Protease, HarpinEcc, and a Global RNA Regulator in Erwinia carotovora subsp. carotovora†

PubMed Central

Liu, Yang; Jiang, Guoqiao; Cui, Yaya; Mukherjee, Asita; Ma, Wei Lei; Chatterjee, Arun K.

1999-01-01

Erwinia carotovora subsp. carotovora produces extracellular pectate lyase (Pel), polygalacturonase (Peh), cellulase (Cel), and protease (Prt). The concerted actions of these enzymes largely determine the virulence of this plant-pathogenic bacterium. E. carotovora subsp. carotovora also produces HarpinEcc, the elicitor of the hypersensitive reaction. We document here that KdgREcc (Kdg, 2-keto-3-deoxygluconate; KdgR, general repressor of genes involved in pectin and galacturonate catabolism), a homolog of the E. chrysanthemi repressor, KdgREch and the Escherichia coli repressor, KdgREco, negatively controls not only the pectinases, Pel and Peh, but also Cel, Prt, and HarpinEcc production in E. carotovora subsp. carotovora. The levels of pel-1, peh-1, celV, and hrpNEcc transcripts are markedly affected by KdgREcc. The KdgREcc− mutant is more virulent than the KdgREcc+ parent. Thus, our data for the first time establish a global regulatory role for KdgREcc in E. carotovora subsp. carotovora. Another novel observation is the negative effect of KdgREcc on the transcription of rsmB (previously aepH), which specifies an RNA regulator controlling exoenzyme and HarpinEcc production. The levels of rsmB RNA are higher in the KdgREcc− mutant than in the KdgREcc+ parent. Moreover, by DNase I protection assays we determined that purified KdgREcc protected three 25-bp regions within the transcriptional unit of rsmB. Alignment of the protected sequences revealed the 21-mer consensus sequence of the KdgREcc-binding site as 5′-G/AA/TA/TGAAA[N6]TTTCAG/TG/TA-3′. Two such KdgREcc-binding sites occur in rsmB DNA in a close proximity to each other within nucleotides +79 and +139 and the third KdgREcc-binding site within nucleotides +207 and +231. Analysis of lacZ transcriptional fusions shows that the KdgR-binding sites negatively affect the expression of rsmB. KdgREcc also binds the operator DNAs of pel-1 and peh-1 genes and represses expression of a pel1-lacZ and a peh1-lacZ transcriptional fusions. We conclude that KdgREcc affects extracellular enzyme production by two ways: (i) directly, by inhibiting the transcription of exoenzyme genes; and (ii) indirectly, by preventing the production of a global RNA regulator. Our findings support the idea that KdgREcc affects transcription by promoter occlusion, i.e., preventing the initiation of transcription, and by a roadblock mechanism, i.e., by affecting the elongation of transcription. PMID:10198003

Arabidopsis CER8 encodes LONG-CHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis.

PubMed

Lü, Shiyou; Song, Tao; Kosma, Dylan K; Parsons, Eugene P; Rowland, Owen; Jenks, Matthew A

2009-08-01

Plant cuticle is an extracellular lipid-based matrix of cutin and waxes, which covers aerial organs and protects them from many forms of environmental stress. We report here the characterization of CER8/LACS1, one of nine Arabidopsis long-chain acyl-CoA synthetases thought to activate acyl chains. Mutations in LACS1 reduced the amount of wax in all chemical classes on the stem and leaf, except in the very long-chain fatty acid (VLCFA) class wherein acids longer than 24 carbons (C(24)) were elevated more than 155%. The C(16) cutin monomers on lacs1 were reduced by 37% and 22%, whereas the C(18) monomers were increased by 28% and 20% on stem and leaf, respectively. Amounts of wax and cutin on a lacs1-1 lacs2-3 double mutant were much lower than on either parent, and lacs1-1 lacs2-3 had much higher cuticular permeability than either parent. These additive effects indicate that LACS1 and LACS2 have overlapping functions in both wax and cutin synthesis. We demonstrated that LACS1 has synthetase activity for VLCFAs C(20)-C(30), with highest activity for C(30) acids. LACS1 thus appears to function as a very long-chain acyl-CoA synthetase in wax metabolism. Since C(16) but not C(18) cutin monomers are reduced in lacs1, and C(16) acids are the next most preferred acid (behind C(30)) by LACS1 in our assays, LACS1 also appears to be important for the incorporation of C(16) monomers into cutin polyester. As such, LACS1 defines a functionally novel acyl-CoA synthetase that preferentially modifies both VLCFAs for wax synthesis and long-chain (C(16)) fatty acids for cutin synthesis.

Long-range transcriptional interference in E. coli used to construct a dual positive selection system for genetic switches

PubMed Central

Hoffmann, Stefan A.; Kruse, Sabrina M.; Arndt, Katja M.

2016-01-01

Abstract We have investigated transcriptional interference between convergent genes in E. coli and demonstrate substantial interference for inter-promoter distances of as far as 3 kb. Interference can be elicited by both strong σ70 dependent and T7 promoters. In the presented design, a strong promoter driving gene expression of a ‘forward’ gene interferes with the expression of a ‘reverse’ gene by a weak promoter. This arrangement allows inversely correlated gene expression without requiring further regulatory components. Thus, modulation of the activity of the strong promoter alters expression of both the forward and the reverse gene. We used this design to develop a dual selection system for conditional operator site binding, allowing positive selection both for binding and for non-binding to DNA. This study demonstrates the utility of this novel system using the Lac repressor as a model protein for conditional DNA binding, and spectinomycin and chloramphenicol resistance genes as positive selection markers in liquid culture. Randomized LacI libraries were created and subjected to subsequent dual selection, but mispairing IPTG and selection cues in respect to the wild-type LacI response, allowing the isolation of a LacI variant with a reversed IPTG response within three rounds of library generation and dual selection. PMID:26932362

Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)

Translational autocontrol of the Escherichia coli ribosomal protein S15.

PubMed

Portier, C; Dondon, L; Grunberg-Manago, M

1990-01-20

When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.

lac operon induction in Escherichia coli: Systematic comparison of IPTG and TMG induction and influence of the transacetylase LacA.

PubMed

Marbach, Anja; Bettenbrock, Katja

2012-01-01

Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.

Crystal Structure and Substrate Specificity of D-Galactose-6-Phosphate Isomerase Complexed with Substrates

PubMed Central

Lee, Jung-Kul; Pan, Cheol-Ho

2013-01-01

D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26), which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD), catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi). Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays. PMID:24015281

Extraction of organic materials from red water by metal-impregnated lignite activated carbon.

PubMed

Wei, Fangfang; Zhang, Yihe; Lv, Fengzhu; Chu, Paul K; Ye, Zhengfang

2011-12-15

Extraction of organic materials from 2,4,6-trinitrotoluene (TNT) red water by lignite activated carbon (LAC) impregnated with Cu(2+), Ba(2+), Sn(2+), Fe(3+), Ca(2+) and Ag(+) was investigated. The affinity to organic materials in red water was found to follow the order: Cu/LAC>Sn/LAC>Ag/LAC>Ba/LAC>Fe/LAC>Ca/LAC, which was explained by the hard and soft acid base (HSAB) theory. Cu(2+) showed the best performance and several parameters were further studied. X-ray photoelectron spectroscopy (XPS) verified effective loading of Cu(2+) on the LAC surface. The water quality before and after treated by Cu/LAC was evaluated using high performance liquid chromatograph, Gas Chromatography/Mass Spectroscopy (GC/MS), UV-vis spectroscopy and other analyses. The extraction performances and mechanism of organic materials on Cu/LAC were investigated through static methods. The experimental results showed that Cu/LAC possessed stronger extraction ability for the sulfonated nitrotoluenes than the non-sulfonated nitrotoluenes, the kinetic data fitted the pseudo-second-order kinetic model well. In addition, the leaching out of Cu(2+) from Cu/LAC was found much lower in the 100 times diluted red water (0.074%) than in the raw water (10.201%). Column adsorptions with more concentrated red water were also studied. Finally, Cu/LAC was observed to possess excellent reusability as well. Copyright © 2011 Elsevier B.V. All rights reserved.

Continuous ethanol fermentation of lactose by a recombinant flocculating Saccharomyces cerevisiae strain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Domingues, L.; Dantas, M.M.; Lima, N.

1999-09-20

Alcohol fermentation of lactose was investigated using a recombinant flocculating Saccharomyces cetevisiae, expressing the LAC4 (coding the {beta}-galactosidase) and LAC12 (coding for lactose permease) genes of Kluyveromyces marxianus. Data on yeast fermentation and growth on a medium containing lactose as the sole carbon source are presented. In the range of studied lactose concentrations, total lactose consumption was observed with a conversion yield of ethanol close to the expected theoretical value. For the continuously operating bioreactor, an ethanol productivity of 11 g L{sup {minus}1} h{sup {minus}1} (corresponding to a feed lactose concentration of 50 g L{sup {minus}1} and a dilution ratemore » of 0.55 h{sup {minus}1}) was obtained, which is 7 times larger than the continuous conventional systems. The system stability was confirmed by keeping it in operation for 6 months.« less

The expression of nifB gene from Herbaspirillum seropedicae is dependent upon the NifA and RpoN proteins.

PubMed

Rego, Fabiane G M; Pedrosa, Fábio O; Chubatsu, Leda S; Yates, M Geoffrey; Wassem, Roseli; Steffens, Maria B R; Rigo, Liu U; Souza, Emanuel M

2006-12-01

The putative nifB promoter region of Herbaspirillum seropedicae contained two sequences homologous to NifA-binding site and a -24/-12 type promoter. A nifB::lacZ fusion was assayed in the backgrounds of both Escherichia coli and H. seropedicae. In E. coli, the expression of nifB::lacZ occurred only in the presence of functional rpoN and Klebsiella pneumoniae nifA genes. In addition, the integration host factor (IHF) stimulated the expression of the nifB::lacZ fusion in this background. In H. seropedicae, nifB expression occurred only in the absence of ammonium and under low levels of oxygen, and it was shown to be strictly dependent on NifA. DNA band shift experiments showed that purified K. pneumoniae RpoN and E. coli IHF proteins were capable of binding to the nifB promoter region, and in vivo dimethylsulfate footprinting showed that NifA binds to both NifA-binding sites. These results strongly suggest that the expression of the nifB promoter of H. seropedicae is dependent on the NifA and RpoN proteins and that the IHF protein stimulates NifA activation of nifB promoter.

[Analysis of the risk factors of acute respiratory distress syndrome of Berlin new definition in patients with sepsis in emergency department].

PubMed

Qiao, Liang; Liu, Zhi

2015-07-01

To discuss the risk factors of acute respiratory distress syndrome (ARDS) in patients with sepsis in emergency department. 312 patients with sepsis admitted to Department of Emergency of China Medical University Affiliated First Hospital were retrospectively analyzed, and they were divided into two groups according to development of ARDS, which was defined according to the Berlin new definition. The age, gender, vital signs, laboratory results, underlying disease, the mortality in emergency department sepsis (MEDS) score and lung injury prediction score (LIPS) were collected. Univariate analysis was done for each parameter. Statistical significance results were evaluated by multivariate logistic regression analysis. Receiver operating characteristic (ROC) curve was plotted to analyze the predictive value of the parameter for ARDS. The incidence of sepsis-related ARDS was 11.2% (35/312). Within 35 cases of ARDS, there were 10 cases of mild ARDS, 18 cases of moderate ARDS, and 7 cases of severe ARDS. Univariate analysis showed that age (t=-2.134, P=0.035), oxygenation index (t=-4.245, P=0.001), arterial lactate (Lac, t=6.245, P<0.001), drugs for vascular diseases (χ2=4.261, P=0.026), shock (χ2=4.386, P=0.021), MEDS (t=4.021, P=0.045), LIPS (t=5.569, P<0.001), lung infections (χ2=4.289, P=0.025), and mechanical ventilation (χ2=6.245, P=0.001) were related to ARDS. The incidence of ARDS was different in different levels of Lac, which was 5.00% (3/16) at low level of Lac (<2.0 mmol/L), 9.46% (14/148) at middle level of Lac (2.0-3.9 mmol/L) and 17.31% (18/104) at high level of Lac (≥4.0 mmol/L). It was shown by multivariate logistic regression analysis that LIPS [ odds ratio (OR)=5.124, 95% confidence interval (95%CI)=3.642-10.153, P=0.002], Lac (OR=18.180, 95%CI=7.677-32.989, P<0.001) were independent risk factors for ARDS. It was shown by area under ROC (AUC) that the predictive value of LIPS and Lac in ARDS occurrence was significant. AUC of LIPS was 0.725, the cut-off value was 7, when LIPS≥7, the sensitivity was 71.0%, specificity was 75.6%. AUC of Lac was 0.793, the cut-off value was 4.2 mmol/L, when Lac≥4.2 mmol/L, the sensitivity was 72.1%, and specificity was 81.9%. LIPS and Lac are independent risk factors of ARDS in patients with sepsis in emergency department, which may be a reference for the early clinical diagnosis of ARDS.

A Search for Low-Luminosity BL Lacertae Objects

NASA Astrophysics Data System (ADS)

Rector, Travis A.; Stocke, John T.; Perlman, Eric S.

1999-05-01

Many properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis, whereby BL Lacs are FR 1 radio galaxies viewed nearly along the jet axis. However, a possible problem with this model is that a transition population between beamed BL Lacs and unbeamed FR 1 galaxies has not been detected. A transition population of ``low-luminosity BL Lacs'' was predicted to exist in abundance in X-ray-selected samples such as the Einstein Extended Medium Sensitivity Survey (EMSS) by Browne & Marcha. However, these BL Lacs may have been misidentified as clusters of galaxies. We have conducted a search for such objects in the EMSS with the ROSAT High-Resolution Imager (HRI) here we present ROSAT HRI images, optical spectra, and VLA radio maps for a small number of BL Lacs that were previously misidentified in the EMSS catalog as clusters of galaxies. While these objects are slightly lower in luminosity than other EMSS BL Lacs, their properties are too similar to the other BL Lacs in the EMSS sample to ``bridge the gap'' between BL Lacs and FR 1 radio galaxies. Also, the number of new BL Lacs found is too low to alter significantly the X-ray luminosity function or value for the X-ray-selected EMSS BL Lac sample. Thus, these observations do not explain fully the discrepancy between the X-ray- and radio-selected BL Lac samples.

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)

Temperature Regulation of Shigella Virulence: Identification of Temperature-Regulated Shigella Invasion Genes by the Isolation of inv::lacZ Operon Fusions and the Characterization of the Virulence Gene Regulator virR

DTIC Science & Technology

1991-04-10

Partial nucleotide sequence of viri? clone pAEH122 102 14. Effects of VirR’ activity on Ipa expression 106 15. Sequencing strategy for the 2.3 kb EcoRl...Confluent monolayers of mammalian cells are challenged with virulent organisms and invasion and intercellular spread result in a cytopathic effect ...destruction of the mucosal surface and an inflammatory response ensues which mimics the effects of invasion and intercellular spread in the mucosa of the

Distinct signatures for mutator sensitivity of lacZ reversions and for the spectrum of lacI/lacO forward mutations on the chromosome of nondividing Escherichia coli.

PubMed Central

Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J

2004-01-01

A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most likely to be fixed as a mutation if it allows the cell to immediately exit the nondividing state. PMID:15020459

Spectroscopic and polarimetric study of radio-quiet weak emission line quasars

NASA Astrophysics Data System (ADS)

Kumar, Parveen; Chand, Hum; Gopal-Krishna; Srianand, Raghunathan; Stalin, Chelliah Subramonian; Petitjean, Patrick

2018-04-01

A small subset of optically selected radio-quiet QSOs with weak or no emission lines may turn out to be the elusive radio-quiet BL Lac objects, or simply be radio-quiet QSOs with an infant/shielded broad line region (BLR). High polarisation (p > 3-4%), a hallmark of BL Lacs, can be used to test whether some optically selected ‘radio-quiet weak emission line QSOs’ (RQWLQs) show a fractional polarisation high enough to qualify as radio-quiet analogues of BL Lac objects. To check this possibility, we have made optical spectral and polarisation measurements of a sample of 19 RQWLQs. Out of these, only 9 sources show a non-significant proper motion (hence very likely extragalactic) and only two of them are found to have p > 1%. For these two RQWLQs, namely J142505.59+035336.2 and J154515.77+003235.2, we found the highest polarization to be 1.59±0.53%, which is again too low to classify them as (radio-quiet) BL Lacs, although one may recall that even genuine BL Lacs sometimes appear weakly polarised. We also present a statistical comparison of the optical spectral index, for a sample of 45 RQWLQs with redshift-luminosity matched control samples of 900 QSOs and an equivalent sample of 120 blazars, assembled from the literature. The spectral index distribution of RQWLQs is found to differ, at a high significance level, from that of blazars. This, too, is consistent with the common view that the mechanism of the central engine in RQWLQs, as a population, is close to that operating in normal QSOs and the primary difference between them is related to the BLR.

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage

PubMed Central

Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage.

PubMed

Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.

A Novel Mgp-Cre Knock-In Mouse Reveals an Anticalcification/Antistiffness Candidate Gene in the Trabecular Meshwork and Peripapillary Scleral Region.

PubMed

Borrás, Teresa; Smith, Matthew H; Buie, LaKisha K

2015-04-01

Soft tissue calcification is a pathological condition. Matrix Gla (MGP) is a potent mineralization inhibitor secreted by cartilage chondrocytes and arteries' vascular smooth muscle cells. Mgp knock-out mice die at 6 weeks due to massive arterial calcification. Arterial calcification results in arterial stiffness and higher systolic blood pressure. Intriguingly, MGP was highly abundant in trabecular meshwork (TM). Because tissue stiffness is relevant to glaucoma, we investigated which additional eye tissues use Mgp's function using knock-in mice. An Mgp-Cre-recombinase coding sequence (Cre) knock-in mouse, containing Mgp DNA plus an internal ribosomal entry site (IRES)-Cre-cassette was generated by homologous recombination. Founders were crossed with Cre-mediated reporter mouse R26R-lacZ. Their offspring expresses lacZ where Mgp is transcribed. Eyes from MgpCre/+;R26RlacZ/+ (Mgp-lacZ knock-in) and controls, 1 to 8 months were assayed for β-gal enzyme histochemistry. As expected, Mgp-lacZ knock-in's TM was intensely blue. In addition, this mouse revealed high specific expression in the sclera, particularly in the peripapillary scleral region (ppSC). Ciliary muscle and sclera above the TM were also positive. Scleral staining was located immediately underneath the choroid (chondrocyte layer), began midsclera and was remarkably high in the ppSC. Cornea, iris, lens, ciliary body, and retina were negative. All mice exhibited similar staining patterns. All controls were negative. Matrix Gla's restricted expression to glaucoma-associated tissues from anterior and posterior segments suggests its involvement in the development of the disease. Matrix Gla's anticalcification/antistiffness properties in the vascular tissue, together with its high TM and ppCS expression, place this gene as a strong candidate for TM's softness and sclera's stiffness regulation in glaucoma.

Sequence analysis of laci mutations obtained from lung cells of radon-exposed big blue{trademark} transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Layton, A.D.; Cross, F.T.; Steigler, G.L.

1994-12-31

We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less

Ploidy Variation in Kluyveromyces marxianus Separates Dairy and Non-dairy Isolates

PubMed Central

Ortiz-Merino, Raúl A.; Varela, Javier A.; Coughlan, Aisling Y.; Hoshida, Hisashi; da Silveira, Wendel B.; Wilde, Caroline; Kuijpers, Niels G. A.; Geertman, Jan-Maarten; Wolfe, Kenneth H.; Morrissey, John P.

2018-01-01

Kluyveromyces marxianus is traditionally associated with fermented dairy products, but can also be isolated from diverse non-dairy environments. Because of thermotolerance, rapid growth and other traits, many different strains are being developed for food and industrial applications but there is, as yet, little understanding of the genetic diversity or population genetics of this species. K. marxianus shows a high level of phenotypic variation but the only phenotype that has been clearly linked to a genetic polymorphism is lactose utilisation, which is controlled by variation in the LAC12 gene. The genomes of several strains have been sequenced in recent years and, in this study, we sequenced a further nine strains from different origins. Analysis of the Single Nucleotide Polymorphisms (SNPs) in 14 strains was carried out to examine genome structure and genetic diversity. SNP diversity in K. marxianus is relatively high, with up to 3% DNA sequence divergence between alleles. It was found that the isolates include haploid, diploid, and triploid strains, as shown by both SNP analysis and flow cytometry. Diploids and triploids contain long genomic tracts showing loss of heterozygosity (LOH). All six isolates from dairy environments were diploid or triploid, whereas 6 out 7 isolates from non-dairy environment were haploid. This also correlated with the presence of functional LAC12 alleles only in dairy haplotypes. The diploids were hybrids between a non-dairy and a dairy haplotype, whereas triploids included three copies of a dairy haplotype. PMID:29619042

Regulation of the glv Operon in Bacillus subtilis: YfiA (GlvR) Is a Positive Regulator of the Operon That Is Repressed through CcpA and cre

PubMed Central

Yamamoto, Hiroki; Serizawa, Masakuni; Thompson, John; Sekiguchi, Junichi

2001-01-01

Maltose metabolism and the regulation of the glv operon of Bacillus subtilis, comprising three genes, glvA (6-phospho-α-glucosidase), yfiA (now designated glvR), and glvC (EIICB transport protein), were investigated. Maltose dissimilation was dependent primarily upon the glv operon, and insertional inactivation of either glvA, glvR, or glvC markedly inhibited growth on the disaccharide. A second system (MalL) contributed to a minor extent to maltose metabolism. Northern blotting revealed two transcripts corresponding to a monocistronic mRNA of glvA and a polycistronic mRNA of glvA-glvR-glvC. Primer extension analysis showed that both transcripts started at the same base (G) located 26 bp upstream of the 5′ end of glvA. When glvR was placed under control of the spac promoter, expression of the glv operon was dependent upon the presence of isopropyl-β-d-thiogalactopyranoside (IPTG). In regulatory studies, the promoter sequence of the glv operon was fused to lacZ and inserted into the amyE locus, and the resultant strain (AMGLV) was then transformed with a citrate-controlled glvR plasmid, pHYCM2VR. When cultured in Difco sporulation medium containing citrate, this transformant [AMGLV(pHYCM2VR)] expressed LacZ activity, but synthesis of LacZ was repressed by glucose. In an isogenic strain, [AMGLVCR(pHYCM2VR)], except for a mutation in the sequence of a catabolite-responsive element (cre), LacZ activity was expressed in the presence of citrate and glucose. Insertion of a citrate-controlled glvR plasmid at the amyE locus of ccpA+ and ccpA mutant organisms yielded strains AMCMVR and AMCMVRCC, respectively. In the presence of both glucose and citrate, AMCMVR failed to express the glv operon, whereas under the same conditions high-level expression of both mRNA transcripts was found in strain AMCMVRCC. Collectively, our findings suggest that GlvR (the product of the glvR gene) is a positive regulator of the glv operon and that glucose exerts its effect via catabolite repression requiring both CcpA and cre. PMID:11489864

The effects of emission control strategies on light-absorbing carbon emissions from a modern heavy-duty diesel engine.

PubMed

Robinson, Michael A; Olson, Michael R; Liu, Z Gerald; Schauer, James J

2015-06-01

Control of atmospheric black carbon (BC) and brown carbon (BrC) has been proposed as an important pathway to climate change mitigation, but sources of BC and BrC are still not well understood. In order to better identify the role of modern heavy-duty diesel engines on the production of BC and BrC, emissions from a heavy-duty diesel engine operating with different emission control strategies were examined using a source dilution sampling system. The effect of a diesel oxidation catalyst (DOC) and diesel particulate filter (DPF) on light-absorbing carbon (LAC) was evaluated at three steady-state engine operation modes: idle, 50% speed and load, and 100% speed and load. LAC was measured with four different engine configurations: engine out, DOC out, DPF out, and engine out with an altered combustion calibration. BC and BrC emission rates were measured with the Aethalometer (AE-31). EC and BC emission rates normalized to the mass of CO₂emitted increased with increasing engine speed and load. Emission rates normalized to brake-specific work did not exhibit similar trends with speed and load, but rather the highest emission rate was measured at idle. EC and OC emissions were reduced by 99% when the DOC and DPF architecture was applied. The application of a DPF was equally effective at removing 99% of the BC fraction of PM, proving to be an important control strategy for both LAC and PM. BC emissions were unexpectedly increased across the DOC, seemingly due to a change aerosol optical properties. Removal of exhaust gas recirculation (EGR) flow due to simulated EGR cooler failure caused a large increase in OC and BrC emission rates at idle, but had limited influence during high load operation. LAC emissions proved to be sensitive to the same control strategies effective at controlling the total mass of diesel PM. In the context of black carbon emissions, very small emission rates of brown carbon were measured over a range of control technologies and engine operating conditions. During specific idle engine operation without EGR and adjusted fueling conditions, brown carbon can be formed in significant amounts, requiring careful management tactics. Control technologies for particulate matter are very effective for light-absorbing carbon, reducing black carbon emissions to near zero for modern engines equipped with a DPF. Efforts to control atmospheric brown carbon need to focus on other sources other than modern diesel engines, such as biomass burning.

76 FR 10894 - Notice of Issuance of Prevention of Significant Deterioration and Federal Operating Permits to...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-28

... (EPA). ACTION: Notice. SUMMARY: This notice announces that, on December 30, 2010, pursuant to title V of the Clean Air Act, EPA issued a title V Permit to Operate (title V permit) to the Mille Lacs Band... permits, which ended April 5, 2010, EPA received comments on the draft title V permit, and revised the...

Generation and characterization of Atoh1-Cre knock-in mouse line

PubMed Central

Yang, Hua; Xie, Xiaoling; Deng, Min; Chen, Xiaowei; Gan, Lin

2010-01-01

Summary Atoh1 encodes a basic helix-loop-helix (bHLH) transcription factor required for the development of the inner ear sensory epithelia, the dorsal spinal cord, brainstem, cerebellum, and intestinal secretory cells. In this study to create a genetic tool for the research on gene function in the ear sensory organs, we generated an Atoh1-Cre knock-in mouse line by replacing the entire Atoh1 coding sequences with the Cre coding sequences. Atoh1Cre/+mice were viable, fertile, and displayed no visible defects whereas the Atoh1Cre/Cremice died perinatally. The spatiotemporal activities of Cre recombinase were examined by crossing Atoh1-Cre mice with the R26R-lacZ conditional reporter mice. Atoh1-Cre activities were detected in the developing inner ear, the hindbrain, the spinal cord, and the intestine. In the inner ear, Atoh1-Cre activities were confined to the sensory organs in which lacZ expression is detected in nearly all of the hair cells and in many supporting cells. Thus, Atoh1-Cre mouse line serves as a useful tool for the functional study of genes in the inner ear. In addition, our results demonstrate that Atoh1 is expressed in the common progenitors destined for both hair and supporting cells. PMID:20533400

Helicobacter pylori β1,3-N-acetylglucosaminyltransferase for versatile synthesis of type 1 and type 2 poly-LacNAcs on N-linked, O-linked and I-antigen glycans

PubMed Central

Peng, Wenjie; Pranskevich, Jennifer; Nycholat, Corwin; Gilbert, Michel; Wakarchuk, Warren; Paulson, James C; Razi, Nahid

2012-01-01

Poly-N-acetyllactosamine extensions on N- and O-linked glycans are increasingly recognized as biologically important structural features, but access to these structures has not been widely available. Here, we report a detailed substrate specificity and catalytic efficiency of the bacterial β3-N-acetylglucosaminyltransferase (β3GlcNAcT) from Helicobacter pylori that can be adapted to the synthesis of a rich diversity of glycans with poly-LacNAc extensions. This glycosyltransferase has surprisingly broad acceptor specificity toward type-1, -2, -3 and -4 galactoside motifs on both linear and branched glycans, found commonly on N-linked, O-linked and I-antigen glycans. This finding enables the production of complex ligands for glycan-binding studies. Although the enzyme shows preferential activity for type 2 (Galβ1-4GlcNAc) acceptors, it is capable of transferring N-acetylglucosamine (GlcNAc) in β1-3 linkage to type-1 (Galβ1-3GlcNAc) or type-3/4 (Galβ1-3GalNAcα/β) sequences. Thus, by alternating the use of the H. pylori β3GlcNAcT with galactosyltransferases that make the β1-4 or β1-3 linkages, various N-linked, O-linked and I-antigen acceptors could be elongated with type-2 and type-1 LacNAc repeats. Finally, one-pot incubation of di-LacNAc biantennary N-glycopeptide with the β3GlcNAcT and GalT-1 in the presence of uridine diphosphate (UDP)-GlcNAc and UDP-Gal, yielded products with 15 additional LacNAc units on the precursor, which was seen as a series of sequential ion peaks representing alternative additions of GlcNAc and Gal residues, on matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis. Overall, our data demonstrate a broader substrate specificity for the H. pylori β3GlcNAcT than previously recognized and demonstrate its ability as a potent resource for preparative chemo-enzymatic synthesis of complex glycans. PMID:22786570

A five-residue sequence near the carboxyl terminus of the polytopic membrane protein lac permease is required for stability within the membrane.

PubMed Central

Roepe, P D; Zbar, R I; Sarkar, H K; Kaback, H R

1989-01-01

The lac permease (lacY gene product) of Escherichia coli contains 417 amino acid residues and is predicted to have a short hydrophilic amino terminus on the inner surface of the cytoplasmic membrane, multiple transmembrane hydrophobic segments in alpha-helical conformation, and a 17-amino acid residue hydrophilic carboxyl-terminal tail on the inner surface of the membrane. To assess the importance of the carboxyl terminus, the properties of several truncation mutants were studied. The mutants were constructed by site-directed mutagenesis such that stop codons were placed at specified positions, and the altered lacY genes were expressed at a relatively low rate from plasmid pACYC184. Permease truncated at position 407 or 401 retains full activity, and a normal complement of molecules is present in the membrane, as judged by immunoblot analyses. Thus, it is apparent that the carboxyl-terminal tail plays no direct role in membrane insertion of the permease, its stability, or in the mechanism of lactose/H+ symport. In marked contrast, when truncations are made at residues 396 (i.e., 4 amino acid residues from the carboxyl terminus of putative helix XII), 389, 372, or 346, the permease is no longer found in the membrane. Remarkably, however, when each of the mutated lacY genes is expressed at a high rate by means of the T7 RNA polymerase system [Tabor, S. & Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1079], all of the truncated permeases are present in the membrane, as indicated by [35S]methionine incorporation studies; however, permease truncated at residue 396, 389, 372, or 346 is defective with respect to lactose/H+ symport. Finally, pulse-chase experiments indicate that wild-type permease or permease truncated at residue 401 is stable, whereas permease truncated at or prior to residue 396 is degraded at a significant rate. The results are consistent with the notion that residues 396-401 in putative helix XII are important for protection against proteolytic degradation and suggest that this region of the permease may be necessary for proper folding. Images PMID:2657733

The Impact of Developmental Education at Triton College.

ERIC Educational Resources Information Center

Chand, Sunil

1985-01-01

Describes the following aspects of the Developmental Education Program at Triton College: student placement, courses, faculty selection, reading and writing instruction, mathematics instruction, the Learning Assistance Center (LAC), LAC tutoring, LAC special projects, LAC management, special needs assistance program for disabled students, and…

The Discovery of Low-Luminosity BL Lacs

NASA Astrophysics Data System (ADS)

Rector, Travis A.; Stocke, John T.

1995-12-01

Many of the properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis whereby BL Lacs are ``highly beamed'' FR-I radio galaxies (i.e. our line of sight to these objects is nearly along the jet axis). Further, radio-selected BL Lacs (RBLs) are believed to be seen nearly ``on-axis'' (the line-of-sight angle theta ~ 8deg ) while X-ray selected BL Lacs (XBLs) are seen at larger angles (theta ~ 30deg ; the X-ray emitting jet is believed to be less collimated). However, a major problem with this model was that a transition population between beamed BL Lacs and unbeamed FR-Is had not been detected. Low-luminosity BL Lacs may be such a transition population, and were predicted to exist by Browne and Marcha (1993). We present ROSAT HRI images, VLA radio maps and optical spectra which confirm the existence of low-luminosity BL Lacs, objects which were previously mis-identified in the EMSS catalog as clusters of galaxies. Thus our results strengthen the relativistic beaming hypothesis.

Level crossing analysis of chemically induced dynamic nuclear polarization: Towards a common description of liquid-state and solid-state cases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sosnovsky, Denis V.; Ivanov, Konstantin L., E-mail: ivanov@tomo.nsc.ru; Novosibirsk State University, Pirogova 2, 630090, Novosibirsk

Chemically Induced Dynamic Nuclear Polarization (CIDNP) is an efficient method of creating non-equilibrium polarization of nuclear spins by using chemical reactions, which have radical pairs as intermediates. The CIDNP effect originates from (i) electron spin-selective recombination of radical pairs and (ii) the dependence of the inter-system crossing rate in radical pairs on the state of magnetic nuclei. The CIDNP effect can be investigated by using Nuclear Magnetic Resonance (NMR) methods. The gain from CIDNP is then two-fold: it allows one to obtain considerable amplification of NMR signals; in addition, it provides a very useful tool for investigating elusive radicals andmore » radical pairs. While the mechanisms of the CIDNP effect in liquids are well established and understood, detailed analysis of solid-state CIDNP mechanisms still remains challenging; likewise a common theoretical frame for the description of CIDNP in both solids and liquids is missing. Difficulties in understanding the spin dynamics that lead to the CIDNP effect in the solid-state case are caused by the anisotropy of spin interactions, which increase the complexity of spin evolution. In this work, we propose to analyze CIDNP in terms of level crossing phenomena, namely, to attribute features in the CIDNP magnetic field dependence to Level Crossings (LCs) and Level Anti-Crossings (LACs) in a radical pair. This approach allows one to describe liquid-state CIDNP; the same holds for the solid-state case where anisotropic interactions play a significant role in CIDNP formation. In solids, features arise predominantly from LACs, since in most cases anisotropic couplings result in perturbations, which turn LCs into LACs. We have interpreted the CIDNP mechanisms in terms of the LC/LAC concept. This consideration allows one to find analytical expressions for a wide magnetic field range, where several different mechanisms are operative; furthermore, the LAC description gives a way to determine CIDNP sign rules. Thus, LCs/LACs provide a consistent description of CIDNP in both liquids and solids with the prospect of exploiting it for the analysis of short-lived radicals and for optimizing the polarization level.« less

Low Level Exposure to Sulfur Mustard: Development of a SOP for Analysis of Albumin Adducts and of a System for Non-Invasive Diagnosis on Skin

DTIC Science & Technology

2004-12-01

were primarily responsible for the organic chemistry and the analytical chemistry, and to Dr. F . Bikker, Mrs. Roos Mars and Mrs. Helma van Dijk for...study as hosts for bacteriophages: TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36proA+ B+ laclq lacZ AM 15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B...TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36 proA+ B+ lacPq lacZ AM15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B+ laclq Z AM15]. Both strains were

Intermediate BL Lac objects

NASA Astrophysics Data System (ADS)

Bondi, M.; Marchã, M. J. M.; Dallacasa, D.; Stanghellini, C.

2001-08-01

The 200-mJy sample, defined by Marchã et al., contains about 60 nearby, northern, flat-spectrum radio sources. In particular, the sample has proved effective at finding nearby radio-selected BL Lac objects with radio luminosities comparable to those of X-ray-selected objects, and low-luminosity flat-spectrum weak emission-line radio galaxies (WLRGs). The 200-mJy sample contains 23 BL Lac objects (including 6 BL Lac candidates) and 19 WLRGs. We will refer to these subsamples as the 200-mJy BL Lac sample and the 200-mJy WLRG sample, respectively. We have started a systematic analysis of the morphological pc-scale properties of the 200-mJy radio sources using VLBI observations. This paper presents VLBI observations at 5 and 1.6GHz of 14 BL Lac objects and WLRGs selected from the 200-mJy sample. The pc-scale morphology of these objects is briefly discussed. We derive the radio beaming parameters of the 200-mJy BL Lac objects and WLRGs and compare them with those of other BL Lac samples and with a sample of FR I radio galaxies. The overall broad-band radio, optical and X-ray properties of the 200-mJy BL Lac sample are discussed and compared with those of other BL Lac samples, radio- and X-ray-selected. We find that the 200-mJy BL Lac objects fill the gap between HBL and LBL objects in the colour-colour plot, and have intermediate αXOX as expected in the spectral energy distribution unification scenario. Finally, we briefly discuss the role of the WLRGs.

A chemometric approach for optimizing protein covalent immobilization on magnetic core-shell nanoparticles in view of an alternative immunoassay.

PubMed

Teste, Bruno; Vial, Jérôme; Descroix, Stéphanie; Georgelin, Thomas; Siaugue, Jean-Michel; Petr, Jan; Varenne, Anne; Hennion, Marie-Claire

2010-06-15

A chemometric approach was developed to optimize the grafting of a bovine milk allergen: alpha-Lactalbumin (alpha-Lac) on colloidal functionalized magnetic core-shell nanoparticles (MCSNP). Such nanoparticles, functionalized with polyethyleneglycol and amino groups, exhibit a 30nm physical diameter and behave as a quasi-homogeneous system. The alpha-Lac immobilization was achieved through the covalent binding between MCSNP amino groups and alpha-Lac carboxylic moieties using the well-known tandem carbodiimide (EDC) and hydroxysulfosuccinimide (NHS). In this study, a chemometric approach was employed to highlight the parameters influencing the number of grafted proteins on the MCSNP. Three factors were evaluated: the ratio in concentration between EDC and alpha-Lac, between NHS and EDC and the concentration of alpha-Lac. After a first full factorial design to delimit the region of the space where the optimum could be located, a central composite design was then carried out to predict the best grafting conditions. It was established and experimentally confirmed that the optimum parameters are [EDC]/[alpha-Lac]=25; [NHS]/[EDC]=1.55 and alpha-Lac=24.85nmolmL(-1). In these optimal conditions, MCSNP surface was successfully saturated with alpha-Lac (34 alpha-Lac/MCSNP) with a high reproducibility (RSD=2%). The colloidal stability of MCSNP grafted with alpha-Lac as well as the immunological interactions using anti alpha-Lac antibody were then investigated in different buffers. The results emphasized that a 50mM MES buffer (pH 6) allows an efficient immune capture and a satisfying colloidal stability which provide an immunological interaction in homogeneous liquid phase.

The REX survey as a Tool to Test the Beaming Model for BL Lacs

NASA Astrophysics Data System (ADS)

Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.

We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.

Design and application of a lactulose biosensor.

PubMed

Wu, Jieyuan; Jiang, Peixia; Chen, Wei; Xiong, Dandan; Huang, Linglan; Jia, Junying; Chen, Yuanyuan; Jin, Jian-Ming; Tang, Shuang-Yan

2017-04-07

In this study the repressor of Escherichia coli lac operon, LacI, has been engineered for altered effector specificity. A LacI saturation mutagenesis library was subjected to Fluorescence Activated Cell Sorting (FACS) dual screening. Mutant LacI-L5 was selected and it is specifically induced by lactulose but not by other disaccharides tested (lactose, epilactose, maltose, sucrose, cellobiose and melibiose). LacI-L5 has been successfully used to construct a whole-cell lactulose biosensor which was then applied in directed evolution of cellobiose 2-epimerase (C2E) for elevated lactulose production. The mutant C2E enzyme with ~32-fold enhanced expression level was selected, demonstrating the high efficiency of the lactulose biosensor. LacI-L5 can also be used as a novel regulatory tool. This work explores the potential of engineering LacI for customized molecular biosensors which can be applied in practice.

Evaluation of coloring efficacy of lac dye in comminuted meat product.

PubMed

Divya; Singh, R P; Baboo, B; Prasad, K M

2011-06-01

Effect of incorporation of graded levels (4, 6, 8, 10, 25 ppm) of lac dye on coloring efficacy and possible use of this natural color in processed meat products was studied. Inclusion of lac dye at different concentrations did not affect the pH significantly whereas a linear increase in the Lovibond red color unit of chicken nuggets was noted with raising the level of lac dye from 4 to 10 ppm. The sensory rating for color was highest at addition level of 25 ppm of lac dye and it was comparable to color score of the product containing 200 ppm sodium nitrite. Lac dye inclusion in nuggets at all concentrations studied had better antimicrobial properties as compared to 200 ppm sodium nitrite. It was concluded that lac dye from 10 to 25 ppm could be incorporated in comminuted meat products as a natural colorant with antimicrobial action.

The business of refractive laser assisted cataract surgery (ReLACS).

PubMed

Berdahl, John P; Jensen, Matthew P

2014-01-01

Refractive Laser Assisted Cataract Surgery (ReLACS) combines the femtosecond laser with other noncovered tests and services in an attempt to reduce spectacle dependence in combination with cataract surgery. Significant interest is present among ophthalmologists who are considering adopting this technology, however significant capital outlays and continuing expenses can make the decision to adopt ReLACS foreboding. We review the financial considerations of ReLACS and review the trends seen in early adopters of this technology. Recent findings have shown that ReLACS is a growing segment of cataract surgery. Most practices who have implemented the technology have broken even and have a positive outlook on the financial return of implementing the ReLACS program. The average break-even analysis point for practices is around 230 cases a year. ReLACS is growing and appears to be a financial viable approach for many practices.

Evidence that selected amplification of a bacterial lac frameshift allele stimulates Lac(+) reversion (adaptive mutation) with or without general hypermutability.

PubMed Central

Slechta, E Susan; Liu, Jing; Andersson, Dan I; Roth, John R

2002-01-01

In the genetic system of Cairns and Foster, a nongrowing population of an E. coli lac frameshift mutant appears to specifically accumulate Lac(+) revertants when starved on medium including lactose (adaptive mutation). This behavior has been attributed to stress-induced general mutagenesis in a subpopulation of starved cells (the hypermutable state model). We have suggested that, on the contrary, stress has no direct effect on mutability but favors only growth of cells that amplify their leaky mutant lac region (the amplification mutagenesis model). Selection enhances reversion primarily by increasing the mutant lac copy number within each developing clone on the selection plate. The observed general mutagenesis is attributed to a side effect of growth with an amplification-induction of SOS by DNA fragments released from a tandem array of lac copies. Here we show that the S. enterica version of the Cairns system shows SOS-dependent general mutagenesis and behaves in every way like the original E. coli system. In both systems, lac revertants are mutagenized during selection. Eliminating the 35-fold increase in mutation rate reduces revertant number only 2- to 4-fold. This discrepancy is due to continued growth of amplification cells until some clones manage to revert without mutagenesis solely by increasing their lac copy number. Reversion in the absence of mutagenesis is still dependent on RecA function, as expected if it depends on lac amplification (a recombination-dependent process). These observations support the amplification mutagenesis model. PMID:12136002

Construction of a lactose-assimilating strain of baker's yeast.

PubMed

Adam, A C; Prieto, J A; Rubio-Texeira, M; Polaina, J

1999-09-30

A recombinant strain of baker's yeast has been constructed which can assimilate lactose efficiently. This strain has been designed to allow its propagation in whey, the byproduct resulting from cheese-making. The ability to metabolize lactose is conferred by the functional expression of two genes from Kluyveromyces lactis, LAC12 and LAC4, which encode a lactose permease and a beta-galactosidase, respectively. To make the recombinant strain more acceptable for its use in bread-making, the genetic transformation of the host baker's yeast was carried out with linear fragments of DNA of defined sequence, carrying as the only heterologous material the coding regions of the two K. lactis genes. Growth of the new strain on cheese whey affected neither the quality of bread nor the yeast gassing power. The significance of the newly developed strain is two-fold: it affords a cheap alternative to the procedure generally used for the propagation of baker's yeast, and it offers a profitable use for cheese whey. Copyright 1999 John Wiley & Sons, Ltd.

Evolutionary behaviour of AGN: Investigations on BL Lac objects and Seyfert II galaxies

NASA Astrophysics Data System (ADS)

Beckmann, V.

2000-12-01

The evolution and nature of AGN is still one of the enigmatic questions in astrophysics. While large and complete Quasar samples are available, special classes of AGN, like BL Lac objects and Seyfert II galaxies, are still rare objects. In this work I present two new AGN samples. The first one is the HRX-BL Lac survey, resulting in a sample of X-ray selected BL Lac objects. This sample results from 223 BL Lac candidates based on a correlation of X-ray sources with radio sources. The identification of this sample is 98% complete. 77 objects have been identified as BL Lac objects and form the HRX-BL Lac complete sample, the largest homogeneous sample of BL Lac objects existing today. For this sample, redshifts are now known for 62 objects (81 %). In total I present 101 BL Lac objects in the enlarged HRX-BL Lac survey, for which redshift information is available for 84 objects. During the HRX-BL Lac survey I found several objects of special interest. 1ES 1517+656 turned out to be the brightest known BL Lac object in the universe. 1ES 0927+500 could be the first BL Lac object with a line detected in the X-ray region. RX J1211+2242 is probably the the counterpart of the up to now unidentified gamma-ray source 3EG J1212+2304. Additionally I present seven candidates for ultra high frequency peaked BL Lac objects. RX J1054+3855 and RX J1153+3517 are rare high redshift X-ray bright QSO or accreting binary systems with huge magnetic fields. For the BL Lac objects I suggest an unified scenario in which giant elliptical galaxies, formed by merging events of spiral galaxies at z > 2, start as powerful, radio dominated BL Lacs. As the jet gets less powerful, the BL Lacs start to get more X-ray dominated, showing less total luminosities (for z < 1). This effect is seen in the different evolutionary behavior detected in high and low frequency cut off BL Lac objects (HBL and LBL, respectively). The model of negative evolution is supported by assumptions about the energetic effects which contribute to the BL Lac phenomenon. I also suggest an extension of the BL Lac definition to objects with a calcium break up to 40%, but do not support for the HBL the idea of allowing emission lines in the spectra of BL Lac galaxies. A way to find high redshift BL Lac objects might be the identification of faint X-ray sources (e.g. from the ROSAT All-Sky Survey) with neither optical nor radio counterpart in prominent databases (e.g. POSS plates for the optical, and NVSS/FIRST radio catalogues). The Seyfert II survey on the southern hemisphere derived a sample of 29 galaxies with 22 in a complete sample. The selection procedure developed in this work is able to select Seyfert II candidates with a success rate of ~40%. The Seyfert II galaxies outnumber the Seyfert I by a factor of 3...4 when comparing the total flux of the objects, but are less numerous than the type I objects when studying the core luminosity function. This luminosity function of the Seyfert II cores is the first one presented up to now. Hence it is possible to estimate the number of luminous Type II AGN, and the conclusion is drawn that absorbed AGN with MV < -28 mag might not exist within the universe. In 25 % of the Seyfert II galaxies I find evidence for merging events. In collaboration with Roberto Della Ceca I also showed that it is possible to find Type II AGN by selecting "hard" X-ray sources. I present a prototype of a Type II AGN found within this project. This work might be the basis to explore the universe for rare objects like BL Lacs and Seyfert II galaxies at higher redshifts. This could give an answer to the question: Whether there are BL Lac objects at redshifts z >> 1 and Type II Quasars or not. In summary the AGN phenomenon appears to be linked closely to merging and interacting events. For the BL Lac phenomenon the merging area seems to form the progenitor, while the Seyfert II phenomenon could be triggered by merging events. The role of star burst activity in terms of activity of the central engine remains illusive.

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

Lateral Attitude Change.

PubMed

Glaser, Tina; Dickel, Nina; Liersch, Benjamin; Rees, Jonas; Süssenbach, Philipp; Bohner, Gerd

2015-08-01

The authors propose a framework distinguishing two types of lateral attitude change (LAC): (a) generalization effects, where attitude change toward a focal object transfers to related objects, and (b) displacement effects, where only related attitudes change but the focal attitude does not change. They bring together examples of LAC from various domains of research, outline the conditions and underlying processes of each type of LAC, and develop a theoretical framework that enables researchers to study LAC more systematically in the future. Compared with established theories of attitude change, the LAC framework focuses on lateral instead of focal attitude change and encompasses both generalization and displacement. Novel predictions and designs for studying LAC are presented. © 2014 by the Society for Personality and Social Psychology, Inc.

Regulation of lac Operon Expression: Reappraisal of the Theory of Catabolite Repression

PubMed Central

Wanner, Barry L.; Kodaira, Ryoji; Neidhardt, Frederick C.

1978-01-01

The physiological state of Escherichia coli with respect to (permanent) catabolite repression was assessed by measuring the steady-state level of β-galactosidase in induced or in constitutive cells under a variety of growth conditions. Four results were obtained. (i) Catabolite repression had a major effect on fully induced or constitutive expression of the lac gene, and the magnitude of this effect was found to be dependent on the promoter structure; cells with a wild-type lac promoter showed an 18-fold variation in lac expression, and cells with the lacP37 (formerly lac-L37) promoter exhibited several hundred-fold variation. (ii) Exogenous adenosine cyclic 3′,5′-monophosphoric acid (cAMP) could not abolish catabolite repression, even though several controls demonstrated that cAMP was entering the cells in significant amounts. (Rapid intracellular degradation of cAMP could not be ruled out.) (iii) Neither the growth rate nor the presence of biosynthetic products altered the degree of catabolite repression; all variation could be related to the catabolites present in the growth medium. (iv) Slowing by imposing an amino acid restriction decreased the differential rate of β-galactosidase synthesis from the wild-type lac promoter when bacteria were cultured in either the absence or presence of cAMP; this decreased lac expression also occurred when the bacteria harbored the catabolite-insensitive lacP5 (formerly lacUV5) promoter mutation. These findings support the idea that (permanent) catabolite repression is set by the catabolites in the growth medium and may not be related to an imbalance between catabolism and anabolism. PMID:214424

Transcriptional regulation of fatty acid biosynthesis in mycobacteria

PubMed Central

Mondino, S.; Gago, G.; Gramajo, H.

2013-01-01

SUMMARY The main purpose of our study is to understand how mycobacteria exert control over the biosynthesis of their membrane lipids and find out the key components of the regulatory network that control fatty acid biosynthesis at the transcriptional level. In this paper we describe the identification and purification of FasR, a transcriptional regulator from Mycobacterium sp. that controls the expression of the fatty acid synthase (fas) and the 4-phosphopantetheinyl transferase (acpS) encoding genes, whose products are involved in the fatty acid and mycolic acid biosynthesis pathways. In vitro studies demonstrated that fas and acpS genes are part of the same transcriptional unit and that FasR specifically binds to three conserved operator sequences present in the fas-acpS promoter region (Pfas). The construction and further characterization of a fasR conditional mutant confirmed that FasR is a transcriptional activator of the fas-acpS operon and that this protein is essential for mycobacteria viability. Furthermore, the combined used of Pfas-lacZ fusions in different fasR backgrounds and electrophoretic mobility shift assays experiments, strongly suggested that long-chain acyl-CoAs are the effector molecules that modulate the affinity of FasR for its DNA binding sequences and therefore the expression of the essential fas-acpS operon. PMID:23721164

Comprehensive Truck Size and Weight (TS&W) Study. Phase 1-synthesis, working paper 6 : traffic operations and truck size and weight regulations

DOT National Transportation Integrated Search

2012-04-01

This report presents the Exogenous Factors Test Plan for the national evaluation of the Los Angeles County Congestion Reduction Demonstration (LAC CRD) under the United States Department of Transportation (U.S. DOT) Congestion Reduction Demonstration...

Data Collection: A Cybernetic Aspect of a Learning Assistance Center.

ERIC Educational Resources Information Center

Devirian, Margaret Coda

Data collection and analysis as a cybernetic aspect of a Learning Assistance Center (LAC) is discussed. Using the LAC at California State University Long Beach (CSULB) as a model, the LAC is defined as a support, delivery, and referral service for the entire campus community. A LAC is held accountable to itself and its users through a cybernetics…

The Health Role of Local Area Coordinators in Scotland: A Mixed Methods Study

ERIC Educational Resources Information Center

Brown, Michael; Karatzias, Thanos; O'Leary, Lisa

2013-01-01

The study set out to explore whether local area coordinators (LACs) and their managers view the health role of LACs as an essential component of their work and identify the health-related activities undertaken by LACs in Scotland. A mixed methods cross-sectional phenomenological study involving local authority service managers (n = 25) and LACs (n…

Increased circular RNA hsa_circ_0012673 acts as a sponge of miR-22 to promote lung adenocarcinoma proliferation.

PubMed

Wang, Xiyong; Zhu, Xiaoli; Zhang, Hongming; Wei, Shuzhen; Chen, Yan; Chen, Yang; Wang, Fei; Fan, Xiaobo; Han, Shuhua; Wu, Guoqiu

2018-02-19

Recent reports have indicated that circular RNA (circRNA) may regulate Lung adenocarcinoma (LAC) development. Our previous studies showed that hsa_circ_0012673 was up-regulated in a circRNA microarray. However, its expression level in LAC has not been verified, and the underlying molecular mechanisms in LAC are unknown. In this study, we found that the expression of hsa_circ_0012673 was up-regulated in LAC tissues compared to pair-matched adjacent non-tumor tissues (P = 0.0079), and that the expression level was associated with tumour size (P = 0.015). Furthermore, hsa_circ_0012673 was primarily localized in the cytoplasm and promoted cell proliferation of LAC cells by sponging miR-22, which targeted erb-b2 receptor tyrosine kinase 3 (ErbB3) in LAC. Hsa_circ_0012673 promotes LAC proliferation by suppressing miR-22, which targets ErbB3. Copyright © 2018 Elsevier Inc. All rights reserved.

Enhanced phenol removal in an innovative lignite activated coke-assisted biological process.

PubMed

Zhang, Chen; Li, Jianfeng; Cheng, Fangqin; Liu, Yu

2018-07-01

In this study, a lignite activated coke (LAC)-assisted activated sludge (AS) process was developed for enhancing biodegradation of phenol, while the effects of LAC on sludge properties and microbial community structure were investigated. It was found that more than 90% of phenol was removed within 1 h in the LAC/AS, which was 3 times higher than the conventional AS process. Moreover, the floc size and settleability were also significantly improved in the LAC/AS. These results suggested that LAC could serve as the nucleating agent to promote the formation of compact floc, which was beneficial for toxicity mitigation and system stability. The microbial community analysis by 16S high-throughput pyrosequencing technology further revealed a more abundant bacterial richness and diversity in the LAC/AS process loaded with phenol, while some phenol degraders, such as Propionibacteriaceae were enriched. Engineering implications further suggests the LAC-assisted AS process is technically sound and economically viable. Copyright © 2018 Elsevier Ltd. All rights reserved.

Light absorbing carbon emissions from commercial shipping

NASA Astrophysics Data System (ADS)

Lack, Daniel; Lerner, Brian; Granier, Claire; Baynard, Tahllee; Lovejoy, Edward; Massoli, Paola; Ravishankara, A. R.; Williams, Eric

2008-07-01

Extensive measurements of the emission of light absorbing carbon aerosol (LAC) from commercial shipping are presented. Vessel emissions were sampled using a photoacoustic spectrometer in the Gulf of Mexico region. The highest emitters (per unit fuel burnt) are tug boats, thus making significant contributions to local air quality in ports. Emission of LAC from cargo and non cargo vessels in this study appears to be independent of engine load. Shipping fuel consumption data (2001) was used to calculate a global LAC contribution of 133(+/-27) Ggyr-1, or ~1.7% of global LAC. This small fraction could have disproportionate effects on both air quality near port areas and climate in the Arctic if direct emissions of LAC occur in that region due to opening Arctic sea routes. The global contribution of this LAC burden was investigated using the MOZART model. Increases of 20-50 ng m-3 LAC (relative increases up to 40%) due to shipping occur in the tropical Atlantic, Indonesia, central America and the southern regions of South America and Africa.

Temporal regulation and forespore-specific expression of the spore photoproduct lyase gene by sigma-G RNA polymerase during Bacillus subtilis sporulation.

PubMed Central

Pedraza-Reyes, M; Gutiérrez-Corona, F; Nicholson, W L

1994-01-01

Bacterial spores are highly resistant to killing by UV radiation and exhibit unique DNA photochemistry. UV irradiation of spore DNA results in formation of spore photoproduct (SP), the thymine dimer 5-thyminyl-5,6-dihydrothymine. Repair of SP occurs during germination of Bacillus subtilis spores by two distinct routes, either by the general nucleotide excision repair (uvr) pathway or by a novel SP-specific monomerization reaction mediated by the enzyme SP lyase, which is encoded by the spl gene. Repair of SP occurs early in spore germination and is independent of de novo protein synthesis, suggesting that the SP repair enzymes are synthesized during sporulation and are packaged in the dormant spore. To test this hypothesis, the expression of a translational spl-lacZ fusion integrated at the spl locus was monitored during B. subtilis growth and sporulation. beta-Galactosidase expression from the spl-lacZ fusion was silent during vegetative growth and was not DNA damage inducible, but it was activated at morphological stage III of sporulation specifically in the forespore compartment, coincident with activation of expression of the stage III marker enzyme glucose dehydrogenase. Expression of the spl-lacZ fusion was shown to be dependent upon the sporulation-specific RNA polymerase containing the sigma-G factor (E sigma G), as spl-lacZ expression was abolished in a mutant harboring a deletion in the sigG gene and restored by expression of the sigG gene in trans. Primer extension analysis of spl mRNA revealed a major extension product initiating upstream from a small open reading frame of unknown function which precedes spl, and it revealed two other shorter minor extension products. All three extension products were present in higher quantities during sporulation and after sigG induction. The three putative transcripts are all preceded by sequences which share homology with the consensus sigma-G factor-type promoter sequence, but in vitro transcription by purified sigma-G RNA polymerase was detected only from the promoter corresponding to the major extension product. The open reading frame-spl operon therefore appears to be an additional member of the sigma-G regulon, which also includes as members the small, acid-soluble spore proteins which are in large part responsible for spore DNA photochemistry. Therefore, sporulating bacteria appear to coordinately regulate genes whose products not only alter spore DNA photochemistry but also repair the major spore-specific photoproduct during germination Images PMID:8021181

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F. William; Dubendorff, John W.

1998-01-01

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

Cloning and expression of autogenes encoding RNA poly,erases of T7-like bacteriophages

DOEpatents

Studier, F. William; Dubendorff, John W.

1998-01-01

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

Evidence for Lignin Oxidation by the Giant Panda Fecal Microbiome

PubMed Central

Zhou, Peng; Chang, Fei; Hong, Yuzhi; Zhang, Xuecheng; Peng, Hui; Xiao, Yazhong

2012-01-01

The digestion of lignin and lignin-related phenolic compounds from bamboo by giant pandas has puzzled scientists because of the lack of lignin-degrading genes in the genome of the bamboo-feeding animals. We constructed a 16S rRNA gene library from the microorganisms derived from the giant panda feces to identify the possibility for the presence of potential lignin-degrading bacteria. Phylogenetic analysis showed that the phylotypes of the intestinal bacteria were affiliated with the phyla Proteobacteria (53%) and Firmicutes (47%). Two phylotypes were affiliated with the known lignin-degrading bacterium Pseudomonas putida and the mangrove forest bacteria. To test the hypothesis that microbes in the giant panda gut help degrade lignin, a metagenomic library of the intestinal bacteria was constructed and screened for clones that contained genes encoding laccase, a lignin-degrading related enzyme. A multicopper oxidase gene, designated as lac51, was identified from a metagenomic clone. Sequence analysis and copper content determination indicated that Lac51 is a laccase rather than a metallo-oxidase and may work outside its original host cell because it has a TAT-type signal peptide and a transmembrane segment at its N-terminus. Lac51 oxidizes a variety of lignin-related phenolic compounds, including syringaldazine, 2,6-dimethoxyphenol, ferulic acid, veratryl alcohol, guaiacol, and sinapinic acid at conditions that simulate the physiologic environment in giant panda intestines. Furthermore, in the presence of 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), syringic acid, or ferulic acid as mediators, the oxidative ability of Lac51 on lignin was promoted. The absorbance of lignin at 445 nm decreased to 36% for ABTS, 51% for syringic acid, and 51% for ferulic acid after incubation for 10 h. Our findings demonstrate that the intestinal bacteria of giant pandas may facilitate the oxidation of lignin moieties, thereby clarifying the digestion of bamboo lignin by the animal. PMID:23209704

Anaerobically controlled expression system derived from the arcDABC operon of Pseudomonas aeruginosa: application to lipase production.

PubMed Central

Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D

1996-01-01

The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231

"Phloem sap analysis of Schleichera oleosa (Lour) Oken, Butea monosperma (Lam) Taub. and Ziziphus mauritiana (Lam) and hemolymph of Kerria lacca (Kerr) using HPLC and tandem mass spectrometry".

PubMed

Vashishtha, Amit; Rathi, Brijesh; Kaushik, Sandeep; Sharma, K K; Lakhanpaul, Suman

2013-10-01

Females of lac insects especially of Kerria lacca (Kerr) secret a resin known as lac for their own protection, which has tremendous applications. Lac insect completes its lifecycle on several host taxa where it exclusively feeds on phloem sap but Schleichera oleosa (Lour.) Oken, Butea monosperma (Lam.) and Ziziphus mauritiana (Lam.) are its major hosts. Analysis of phloem sap constituents as well as hemolymph of lac insect is important because it ultimately gets converted into lac by insect intervention. Main phloem sap constituent's viz. sugars and free amino acids and hemolymph of lac insect were analyzed using HPLC and tandem mass spectrometry, respectively. The results were transformed to relative percentage of the total sugars and free amino acids analyzed in each sample for comparison among lac insect hemolymph and the phloem sap of the three different host taxa. Sucrose (58.9 ± 3.6-85.6 ± 0.9) and trehalose (62.3 ± 0.4) were the predominant sugars in phloem sap of three taxa and hemolymph of lac insect, respectively. Glutamic acid (33.1 ± 1.4-39.8 ± 1.4) was found to be main amino acid among the phloem sap of three taxa while tyrosine (61 ± 2.6) was the major amino acid in hemolymph of lac insect. The relative percentage of non-essential amino acids (60.8 %-69.9 %) was found to be more in all the three host taxa while essential amino acids (30.1 %-35.4 %) were present at a lower relative percentage. In contrast to this, the relative percentage of essential amino acids (81.9 %) was observed to be higher as compared to non-essential amino acids (17.7 %) in lac insect hemolymph. These results led to the detection of lac insect's endosymbionts. Moreover, this study revealed a clue regarding the importance of development of a synthetic diet for this insect so that a precise pathway of lac biosynthesis could be investigated for thorough understanding.

Progress in gene targeting and gene therapy for retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farrar, G.J.; Humphries, M.M.; Erven, A.

1994-09-01

Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less

Lactose carrier mutants of Escherichia coli with changes in sugar recognition (lactose versus melibiose).

PubMed

Varela, M F; Brooker, R J; Wilson, T H

1997-09-01

The purpose of this research was to identify amino acid residues that mediate substrate recognition in the lactose carrier of Escherichia coli. The lactose carrier transports the alpha-galactoside sugar melibiose as well as the beta-galactoside sugar lactose. Mutants from cells containing the lac genes on an F factor were selected by the ability to grow on succinate in the presence of the toxic galactoside beta-thio-o-nitrophenylgalactoside. Mutants that grew on melibiose minimal plates but failed to grow on lactose minimal plates were picked. In sugar transport assays, mutant cells showed the striking result of having low levels of lactose downhill transport but high levels of melibiose downhill transport. Accumulation (uphill) of melibiose was completely defective in all of the mutants. Kinetic analysis of melibiose transport in the mutants showed either no change or a greater than normal apparent affinity for melibiose. PCR was used to amplify the lacY DNA of each mutant, which was then sequenced by the Sanger method. The following six mutations were found in the lacY structural genes of individual mutants: Tyr-26-->Asp, Phe-27-->Tyr, Phe-29-->Leu, Asp-240-->Val, Leu-321-->Gln, and His-322-->Tyr. We conclude from these experiments that Tyr-26, Phe-27, Phe-29 (helix 1), Asp-240 (helix 7), Leu-321, and His-322 (helix 10) either directly or indirectly mediate sugar recognition in the lactose carrier of E. coli.

Differences in lupus anticoagulant final conclusion through clotting time or Rosner index for mixing test interpretation.

PubMed

Depreter, Barbara; Devreese, Katrien M J

2016-09-01

Lupus anticoagulant (LAC) testing includes a screening, mixing and confirmation step. Although recently published guidelines on LAC testing are a useful step towards standardization, a lack of consensus remains whether to express mixing tests in clotting time (CT) or index of circulating anticoagulant (ICA). The influence of anticoagulant therapy, e.g. vitamin K antagonists (VKA) or direct oral anticoagulants (DOAC) on both methods of interpretation remains to be investigated. The objective of this study was to contribute to a simplification and standardization of the LAC three-step interpretation on the level of the mixing test. Samples from 148 consecutive patients with LAC request and prolonged screening step, and 77 samples from patients non-suspicious for LAC treated with VKA (n=37) or DOAC (n=30) were retrospectively evaluated. An activated partial thromboplastin time (aPTT) and dilute Russell's viper venom time (dRVVT) were used for routine LAC testing. The supplemental anticoagulant samples were tested with dRVVT only. We focused on the interpretation differences for mixing tests expressed as CT or ICA and compared the final LAC conclusion within each distinct group of concordant and discordant mixing test results. Mixing test interpretation by CT resulted in 10 (dRVVT) and 16 (aPTT) more LAC positive patients compared to interpretation with ICA. Isolated prolonged dRVVT screen mix ICA results were exclusively observed in samples from VKA-treated patients without suspicion for LAC. We recommend using CT in respect to the 99th percentile cut-off for interpretation of mixing steps in order to reach the highest sensitivity and specificity in LAC detection.

Lactation induces increases in the RANK/RANKL/OPG system in maxillary bone.

PubMed

Macari, Soraia; Sharma, Lavanya A; Wyatt, Amanda; da Silva, Janine Maíra; Dias, George J; Silva, Tarcília A; Szawka, Raphael E; Grattan, David R

2018-05-01

The underlying causes of maxillary bone loss during lactation remain poorly understood. We evaluated the impact of lactation on physiological and mechanically-induced alveolar bone remodeling. Nulliparous non-lactating (N-LAC) and 21-day lactating (LAC) mice underwent mechanically-induced bone remodeling by orthodontic tooth movement (OTM). Micro-computed tomography (microCT) was performed in the maxilla, femur and vertebra. Tartrate-resistant-acid phosphatase (TRAP) and Masson's trichrome labelling was performed in the maxillary bone and gene expression was determined in the periodontal ligament. The effect of prolactin on osteoclast (OCL) and osteoblast (OBL) differentiation was also investigated in N-LAC and LAC mice. Lactation increased alveolar bone loss in the maxilla, femur and vertebra, while OTM was enhanced. The number of OCL and OBL was higher in the maxilla of LAC mice. OTM increased OCL in both groups; while OBL was increased only in N-LAC but not in LAC mice, in which cell numbers were already elevated. The alveolar bone loss during lactation was associated with increased expression of receptor activator of nuclear factor-KappaB (RANK), RANK ligand (RANKL), and osteoprotegerin (OPG) in the maxilla. OTM induced the same responses in N-LAC mice, whereas it had no further effect in LAC mice. Lactation enhanced differentiation of OCL and OBL from bone marrow cells, and prolactin recapitulated OCL differentiation in N-LAC mice. Thus, lactation increases physiological maxillary bone remodeling and OTM, and both require activation of RANK/RANKL/OPG system. These findings expand our knowledge of lactation-induced osteopenia and have possible impact on clinical practice regarding orthodontic treatments and dental implants in lactating women. Copyright © 2018 Elsevier Inc. All rights reserved.

A biosensor based on Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes and graphene oxide for polyphenol detection

PubMed Central

Aguila, Sergio A; Shimomoto, David; Ipinza, Franscisco; Bedolla-Valdez, Zaira I; Romo-Herrera, José; Contreras, Oscar E; Farías, Mario H; Alonso-Núñez, Gabriel

2015-01-01

The use of nanomaterials allows the design of ultrasensitive biosensors with advantages in the detection of organic molecules. Catechol and catechin are molecules that occur naturally in fruits, and their presence in products like dyes and wines affects quality standards. In this study, catechol and catechin were measured at the nanoscale by means of cyclic voltammetry. The oxidation of Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes (Lac/CNx-MWCNT) and on graphene oxide (Lac/GO) was used to measure the concentrations of catechol and catechin. Nitrogen-doped multiwalled carbon nanotubes (CNx-MWCNT) were synthesized by spray pyrolysis and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). Covalently bonded hybrids with laccase (Lac/CNx-MWCNT and Lac/GO) were generated. Catalytic activity of free enzymes determined with syringaldazine yielded 14 584 UmL−1. With Lac/CNx-MWCNT at concentrations of 6.4 mmol L−1 activity was 9326 U mL−1, while enzyme activity measured with Lac/GO at concentration of 6.4 mmol L−1 was 9 234 U mL−1. The Lac/CNx-MWCNT hybrid showed higher stability than Lac/GO at different ethyl alcohol concentrations. The Lac/CNx-MWCNT hybrid can measure concentrations, not previously reported, as low as 1 × 10−8 mol L−1 by measuring the electric current responses. PMID:27877839

A biosensor based on Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes and graphene oxide for polyphenol detection

NASA Astrophysics Data System (ADS)

Aguila, Sergio A.; Shimomoto, David; Ipinza, Franscisco; Bedolla-Valdez, Zaira I.; Romo-Herrera, José; Contreras, Oscar E.; Farías, Mario H.; Alonso-Núñez, Gabriel

2015-10-01

The use of nanomaterials allows the design of ultrasensitive biosensors with advantages in the detection of organic molecules. Catechol and catechin are molecules that occur naturally in fruits, and their presence in products like dyes and wines affects quality standards. In this study, catechol and catechin were measured at the nanoscale by means of cyclic voltammetry. The oxidation of Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes (Lac/CNx-MWCNT) and on graphene oxide (Lac/GO) was used to measure the concentrations of catechol and catechin. Nitrogen-doped multiwalled carbon nanotubes (CNx-MWCNT) were synthesized by spray pyrolysis and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). Covalently bonded hybrids with laccase (Lac/CNx-MWCNT and Lac/GO) were generated. Catalytic activity of free enzymes determined with syringaldazine yielded 14 584 UmL-1. With Lac/CNx-MWCNT at concentrations of 6.4 mmol L-1 activity was 9326 U mL-1, while enzyme activity measured with Lac/GO at concentration of 6.4 mmol L-1 was 9 234 U mL-1. The Lac/CNx-MWCNT hybrid showed higher stability than Lac/GO at different ethyl alcohol concentrations. The Lac/CNx-MWCNT hybrid can measure concentrations, not previously reported, as low as 1 × 10-8 mol L-1 by measuring the electric current responses.

Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)

K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose.

PubMed

Sarabia-Sainz, Andre-I; Sarabia-Sainz, Hector Manuel; Montfort, Gabriela Ramos-Clamont; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz

2015-09-16

The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10-17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections.

K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose

PubMed Central

Sarabia-Sainz, Andre-i; Sarabia-Sainz, Hector Manuel; Ramos-Clamont Montfort, Gabriela; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz

2015-01-01

The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10–17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections. PMID:26389896

Lactosylated Gramicidin-based lipid nanoparticles (Lac-GLN) for targeted delivery of anti-miR-155 to hepatocellular carcinoma

PubMed Central

Zhang, Mengzi; Zhou, Xiaoju; Wang, Bo; Yung, Bryant C.; Lee, Ly J.; Ghoshal, Kalpana; Lee, Robert J.

2013-01-01

Lactosylated gramicidin-containing lipid nanoparticles (Lac-GLN) were developed for delivery of anti-microRNA-155 (anti-miR-155) to hepatocellular carcinoma (HCC) cells. MiR-155 is an oncomiR frequently elevated in HCC. The Lac-GLN formulation contained N-lactobionyl-dioleoyl phosphatidylethanolamine (Lac-DOPE), a ligand for the asialoglycoprotein receptor (ASGR), and an antibiotic peptide gramicidin A. The nanoparticles exhibited a mean particle diameter of 73 nm, zeta potential of +3.5 mV, anti-miR encapsulation efficiency of 88%, and excellent colloidal stability at 4°C. Lac-GLN effectively delivered anti-miR-155 to HCC cells with a 16.1- and 4.1-fold up-regulation of miR-155 targets C/EBPβ and FOXP3 genes, respectively, and exhibited significant greater efficiency over Lipofectamine 2000. In mice, intravenous injection of Lac-GLN containing Cy3-anti-miR-155 led to preferential accumulation of the anti-miR-155 in hepatocytes. Intravenous administration of 1.5 mg/kg anti-miR-155 loaded Lac-GLN resulted in up-regulation of C/EBPβ and FOXP3 by 6.9- and 2.2- fold, respectively. These results suggest potential application of Lac-GLN as a liver-specific delivery vehicle for anti-miR therapy. PMID:23567045

The BL Lac Classification

NASA Astrophysics Data System (ADS)

Landt, H.; Padovani, P.

1999-12-01

In the optical wavelength range the distinction between a radio galaxy and a BL Lac object is mainly based on the Ca II H and K break observed in the optical spectrum. Marchã et al. (1996, MNRAS, 281, 425) have expanded on the previously used division by suggesting objects with Ca II break values lower than 0.4 to be classified as BL Lacs and sources with values higher than 0.4 to be classified as galaxies. We present new evidence that there is a smooth transition between BL Lac objects and Fanaroff-Riley type I radio galaxies. We find an increase in X-ray and radio core luminosity as the Ca II break gets more and more diluted. This suggests that the only difference between BL Lac objects and their parent population lies in orientation. The closer the jet of the radio galaxy to the observer's line of sight, the more its luminosity gets amplified and the object becomes BL Lac-like. We will address the question of the BL Lac parent population and will propose to unify the beamed and unbeamed objects in nomenclature.

Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.

PubMed

Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min

Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.

DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

PubMed Central

Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

2014-01-01

As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252

Sequence analysis of the phs operon in Salmonella typhimurium and the contribution of thiosulfate reduction to anaerobic energy metabolism.

PubMed Central

Heinzinger, N K; Fujimoto, S Y; Clark, M A; Moreno, M S; Barrett, E L

1995-01-01

The phs chromosomal locus of Salmonella typhimurium is essential for the dissimilatory anaerobic reduction of thiosulfate to hydrogen sulfide. Sequence analysis of the phs region revealed a functional operon with three open reading frames, designated phsA, phsB, and phsC, which encode peptides of 82.7, 21.3, and 28.5 kDa, respectively. The predicted products of phsA and phsB exhibited significant homology with the catalytic and electron transfer subunits of several other anaerobic molybdoprotein oxidoreductases, including Escherichia coli dimethyl sulfoxide reductase, nitrate reductase, and formate dehydrogenase. Simultaneous comparison of PhsA to seven homologous molybdoproteins revealed numerous similarities among all eight throughout the entire frame, hence, significant amino acid conservation among molybdoprotein oxidoreductases. Comparison of PhsB to six other homologous sequences revealed four highly conserved iron-sulfur clusters. The predicted phsC product was highly hydrophobic and similar in size to the hydrophobic subunits of the molybdoprotein oxidoreductases containing subunits homologous to phsA and phsB. Thus, phsABC appears to encode thiosulfate reductase. Single-copy phs-lac translational fusions required both anaerobiosis and thiosulfate for full expression, whereas multicopy phs-lac translational fusions responded to either thiosulfate or anaerobiosis, suggesting that oxygen and thiosulfate control of phs involves negative regulation. A possible role for thiosulfate reduction in anaerobic respiration was examined. Thiosulfate did not significantly augment the final densities of anaerobic cultures grown on any of the 18 carbon sources tested. on the other hand, washed stationary-phase cells depleted of ATP were shown to synthesize small amounts of ATP on the addition of the formate and thiosulfate, suggesting that the thiosulfate reduction plays a unique role in anaerobic energy conservation by S typhimurium. PMID:7751291

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.

Differential Expression of Three α-Galactosidase Genes and a Single β-Galactosidase Gene from Aspergillus niger

PubMed Central

de Vries, Ronald P.; van den Broeck, Hetty C.; Dekkers, Ester; Manzanares, Paloma; de Graaff, Leo H.; Visser, Jaap

1999-01-01

A gene encoding a third α-galactosidase (AglB) from Aspergillus niger has been cloned and sequenced. The gene consists of an open reading frame of 1,750 bp containing six introns. The gene encodes a protein of 443 amino acids which contains a eukaryotic signal sequence of 16 amino acids and seven putative N-glycosylation sites. The mature protein has a calculated molecular mass of 48,835 Da and a predicted pI of 4.6. An alignment of the AglB amino acid sequence with those of other α-galactosidases revealed that it belongs to a subfamily of α-galactosidases that also includes A. niger AglA. A. niger AglC belongs to a different subfamily that consists mainly of prokaryotic α-galactosidases. The expression of aglA, aglB, aglC, and lacA, the latter of which encodes an A. niger β-galactosidase, has been studied by using a number of monomeric, oligomeric, and polymeric compounds as growth substrates. Expression of aglA is only detected on galactose and galactose-containing oligomers and polymers. The aglB gene is expressed on all of the carbon sources tested, including glucose. Elevated expression was observed on xylan, which could be assigned to regulation via XlnR, the xylanolytic transcriptional activator. Expression of aglC was only observed on glucose, fructose, and combinations of glucose with xylose and galactose. High expression of lacA was detected on arabinose, xylose, xylan, and pectin. Similar to aglB, the expression on xylose and xylan can be assigned to regulation via XlnR. All four genes have distinct expression patterns which seem to mirror the natural substrates of the encoded proteins. PMID:10347026

78 FR 48224 - Lac-Mégantic Railroad Accident Discussion and DOT Safety Recommendations

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-07

.... the train stopped near mile post 7.40 near Nantes, Quebec. At that location the single operator... their destinations safely and without incident. In calendar year 2011, for example, out of the... failures. For example, as based on FRA's accident reporting data for the period from 2008 through 2012...

78 FR 76709 - Proposed Agency Information Collection Activities; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-18

... of Emergency Order No. 28, which requires railroads operating on the general system of transportation... in Lac-M[eacute]gantic, Quebec, Canada, on July 6, 2013. See 78 FR 48218. Emergency Order No. 28 is... secured in order to protect the general public and communities near the general system of rail...

Prevalence and comparison of Streptococcus infantarius subsp. infantarius and Streptococcus gallolyticus subsp. macedonicus in raw and fermented dairy products from East and West Africa.

PubMed

Jans, Christoph; Kaindi, Dasel Wambua Mulwa; Böck, Désirée; Njage, Patrick Murigu Kamau; Kouamé-Sina, Sylvie Mireille; Bonfoh, Bassirou; Lacroix, Christophe; Meile, Leo

2013-10-15

Streptococcus infantarius subsp. infantarius (Sii) and Streptococcus gallolyticus subsp. macedonicus are members of the Streptococcus bovis/Streptococcus equinus complex (SBSEC) associated with human infections. SBSEC-related endocarditis was furthermore associated with rural residency in Southern Europe. SBSEC members are increasingly isolated as predominant species from fermented dairy products in Europe, Asia and Africa. African variants of Sii displayed dairy adaptations to lactose metabolism paralleling those of Streptococcus thermophilus including genome decay. In this study, the aim was to assess the prevalence of Sii and possibly other SBSEC members in dairy products of East and West Africa in order to identify their habitat, estimate their importance in dairy fermentation processes and determine geographic areas affected by this potential health risk. Presumptive SBSEC members were isolated on semi-selective M17 and SM agar media. Subsequent genotypic identification of isolates was based on rep-PCR fingerprinting and SBSEC-specific16S rRNA gene PCR assay. Detailed identification was achieved through application of novel primers enhancing the binding stringency in partial groES/groEL gene amplification and subsequent DNA sequencing. The presence of S. thermophilus-like lacS and lacZ genes in the SBSEC isolates was determined to elucidate the prevalence of this dairy adaptation. Isolates (n = 754) were obtained from 72 raw and 95 fermented milk samples from Côte d'Ivoire and Kenya on semi-selective agar media. Colonies of Sii were not detected from raw milk despite high microbial titers of approximately 10(6)CFU/mL on M17 agar medium. However, after spontaneous milk fermentation Sii was genotypically identified in 94.1% of Kenyan samples and 60.8% of Kenyan isolates. Sii prevalence in Côte d'Ivoire displayed seasonal variations in samples from 32.3% (June) to 40.0% (Dec/Jan) and isolates from 20.5% (June) to 27.7% (Dec/Jan) present at titers of 10(6)-10(8)CFU/mL. lacS and lacZ genes were detected in all Kenyan and 25.8% (June) to 65.4% (Dec/Jan) of Ivorian Sii isolates. Regional differences in prevalence of Sii and dairy adaptations were observed, but no clear effect of dairy animal, fermentation procedure and climate was revealed. Conclusively, the high prevalence of Sii in Kenya, Côte d'Ivoire in addition to Somalia, Sudan and Mali strongly indicates a pivotal role of Sii in traditional African dairy fermentations potentially paralleling that of typical western dairy species S. thermophilus. Putative health risks associated with the consumption of high amounts of live Sii and potential different degrees of evolutionary adaptation or ecological colonization require further epidemiologic and genomic investigations, particularly in Africa. © 2013.

Prevalence and comparison of Streptococcus infantarius subsp. infantarius and Streptococcus gallolyticus subsp. macedonicus in raw and fermented dairy products from East and West Africa

PubMed Central

Jans, Christoph; Kaindi, Dasel Wambua Mulwa; Böck, Désirée; Njage, Patrick Murigu Kamau; Kouamé-Sina, Sylvie Mireille; Bonfoh, Bassirou; Lacroix, Christophe; Meile, Leo

2016-01-01

Streptococcus infantarius subsp. infantarius (Sii) and Streptococcus gallolyticus subsp. macedonicus are members of the Streptococcus bovis/Streptococcus equinus complex (SBSEC) associated with human infections. SBSEC-related endocarditis was furthermore associated with rural residency in Southern Europe. SBSEC members are increasingly isolated as predominant species from fermented dairy products in Europe, Asia and Africa. African variants of Sii displayed dairy adaptations to lactose metabolism paralleling those of Streptococcus thermophilus including genome decay. In this study, the aim was to assess the prevalence of Sii and possibly other SBSEC members in dairy products of East and West Africa in order to identify their habitat, estimate their importance in dairy fermentation processes and determine geographic areas affected by this potential health risk. Presumptive SBSEC members were isolated on semi-selective M17 and SM agar media. Subsequent genotypic identification of isolates was based on rep-PCR fingerprinting and SBSEC-specific16S rRNA gene PCR assay. Detailed identification was achieved through application of novel primers enhancing the binding stringency in partial groES/groEL gene amplification and subsequent DNA sequencing. The presence of S. thermophilus-like lacS and lacZ genes in the SBSEC isolates was determined to elucidate the prevalence of this dairy adaptation. Isolates (n = 754) were obtained from 72 raw and 95 fermented milk samples from Côte d'Ivoire and Kenya on semi-selective agar media. Colonies of Sii were not detected from raw milk despite high microbial titers of approximately 106 CFU/mL on M17 agar medium. However, after spontaneous milk fermentation Sii was genotypically identified in 94.1% of Kenyan samples and 60.8% of Kenyan isolates. Sii prevalence in Côte d'Ivoire displayed seasonal variations in samples from 32.3% (June) to 40.0% (Dec/Jan) and isolates from 20.5% (June) to 27.7% (Dec/Jan) present at titers of 106–108 CFU/mL. lacS and lacZ genes were detected in all Kenyan and 25.8% (June) to 65.4% (Dec/Jan) of Ivorian Sii isolates. Regional differences in prevalence of Sii and dairy adaptations were observed, but no clear effect of dairy animal, fermentation procedure and climate was revealed. Conclusively, the high prevalence of Sii in Kenya, Côte d'Ivoire in addition to Somalia, Sudan and Mali strongly indicates a pivotal role of Sii in traditional African dairy fermentations potentially paralleling that of typical western dairy species S. thermophilus. Putative health risks associated with the consumption of high amounts of live Sii and potential different degrees of evolutionary adaptation or ecological colonization require further epidemiologic and genomic investigations, particularly in Africa. PMID:24131584

Preparation of a Ammonia-Treated Lac Dye and Structure Elucidation of Its Main Component.

PubMed

Nishizaki, Yuzo; Ishizuki, Kyoko; Akiyama, Hiroshi; Tada, Atsuko; Sugimoto, Naoki; Sato, Kyoko

2016-01-01

Lac dye and cochineal extract contain laccaic acids and carminic acid as the main pigments, respectively. Both laccaic acids and carminic acid are anthraquinone derivatives. 4-Aminocarminic acid (acid-stable carmine), an illegal colorant, has been detected in several processed foods. 4-Aminocarminic acid is obtained by heating cochineal extract (carminic acid) in ammonia solution. We attempted to prepare ammonia-treated lac dye and to identify the structures of the main pigment components. Ammonia-treated lac dye showed acid stability similar to that of 4-aminocarminic acid. The structures of the main pigments in ammonia-treated lac dye were analyzed using LC/MS. One of the main pigments was isolated and identified as 4-aminolaccaic acid C using various NMR techniques, including 2D-INADEQUATE. These results indicated that ammonia-treatment of lac dye results in the generation of 4-aminolaccaic acids.

5’-Terminal AUGs in Escherichia coli mRNAs with Shine-Dalgarno Sequences: Identification and Analysis of Their Roles in Non-Canonical Translation Initiation

PubMed Central

Beck, Heather J.; Fleming, Ian M. C.

2016-01-01

Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

Plasmid linkage of the D-tagatose 6-phosphate pathway in Streptococcus lactis: effect on lactose and galactose metabolism.

PubMed Central

Crow, V L; Davey, G P; Pearce, L E; Thomas, T D

1983-01-01

The three enzymes of the D-tagatose 6-phosphate pathway (galactose 6-phosphate isomerase, D-tagatose 6-phosphate kinase, and tagatose 1,6-diphosphate aldolase) were absent in lactose-negative (Lac-) derivatives of Streptococcus lactis C10, H1, and 133 grown on galactose. The lactose phosphoenolpyruvate-dependent phosphotransferase system and phospho-beta-galactosidase activities were also absent in Lac- derivatives of strains H1 and 133 and were low (possibly absent) in C10 Lac-. In all three Lac- derivatives, low galactose phosphotransferase system activity was found. On galactose, Lac- derivatives grew more slowly (presumably using the Leloir pathway) than the wild-type strains and accumulated high intracellular concentrations of galactose 6-phosphate (up to 49 mM); no intracellular tagatose 1,6-diphosphate was detected. The data suggest that the Lac phenotype is plasmid linked in the three strains studied, with the evidence being more substantial for strain H1. A Lac- derivative of H1 contained a single plasmid (33 megadaltons) which was absent from the Lac- mutant. We suggest that the genes linked to the lactose plasmid in S. lactis are more numerous than previously envisaged, coding for all of the enzymes involved in lactose metabolism from initial transport to the formation of triose phosphates via the D-tagatose 6-phosphate pathway. Images PMID:6294064

agr-Dependent Interactions of Staphylococcus aureus USA300 with Human Polymorphonuclear Neutrophils

PubMed Central

Pang, Yun Yun; Schwartz, Jamie; Thoendel, Matthew; Ackermann, Laynez W.; Horswill, Alexander R.; Nauseef, William M.

2010-01-01

The emergence of serious infections due to community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) has fueled interest in the contributions of specific staphylococcal virulence factors to clinical disease. To assess the contributions of agr-dependent factors to the fate of organisms in polymorphonuclear neutrophils (PMN), we examined the consequences for organism and host cells of feeding PMN with wild-type CA-MRSA (LAC) or CA-MRSA (LAC agr KO) at different multiplicities of infection (MOIs). Phagocytosed organisms rapidly increased the transcription of RNAIII in a time- and MOI-dependent fashion; extracellular USA300 (LAC) did not increase RNAIII expression despite having the capacity to respond to autoinducing peptide-enriched culture medium. HOCl-mediated damage and intracellular survival were the same in the wild-type and USA300 (LAC agr KO). PMN lysis by ingested USA300 (LAC) was time- and MOI-dependent and, at MOIs >1, required α-hemolysin (hla) as USA300 (LAC agr KO) and USA300 (LAC hla KO) promoted PMN lysis only at high MOIs. Taken together, these data demonstrate activation of the agr operon in human PMN with the subsequent production of α-hemolysin and PMN lysis. The extent to which these events in the phagosomes of human PMN contribute to the increased morbidity and mortality of infections with USA300 (LAC) merits further study. PMID:20829608

LACCASE Is Necessary and Nonredundant with PEROXIDASE for Lignin Polymerization during Vascular Development in Arabidopsis[C][W

PubMed Central

Zhao, Qiao; Nakashima, Jin; Chen, Fang; Yin, Yanbin; Fu, Chunxiang; Yun, Jianfei; Shao, Hui; Wang, Xiaoqiang; Wang, Zeng-Yu; Dixon, Richard A.

2013-01-01

The evolution of lignin biosynthesis was critical in the transition of plants from an aquatic to an upright terrestrial lifestyle. Lignin is assembled by oxidative polymerization of two major monomers, coniferyl alcohol and sinapyl alcohol. Although two recently discovered laccases, LAC4 and LAC17, have been shown to play a role in lignin polymerization in Arabidopsis thaliana, disruption of both genes only leads to a relatively small change in lignin content and only under continuous illumination. Simultaneous disruption of LAC11 along with LAC4 and LAC17 causes severe plant growth arrest, narrower root diameter, indehiscent anthers, and vascular development arrest with lack of lignification. Genome-wide transcript analysis revealed that all the putative lignin peroxidase genes are expressed at normal levels or even higher in the laccase triple mutant, suggesting that lignin laccase activity is necessary and nonredundant with peroxidase activity for monolignol polymerization during plant vascular development. Interestingly, even though lignin deposition in roots is almost completely abolished in the lac11 lac4 lac17 triple mutant, the Casparian strip, which is lignified through the activity of peroxidase, is still functional. Phylogenetic analysis revealed that lignin laccase genes have no orthologs in lower plant species, suggesting that the monolignol laccase genes diverged after the evolution of seed plants. PMID:24143805

Teflon Examination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dooraghi, A. A.; Seetho, I.; Smith, J.. A.

2017-04-27

In this document, we outline an experiment performed at LLNL to evaluate the radiation sensitivity of polytetrafluoroethylene (PTFE) and a PTFE isomer, fluorinated ethylene propylene (FEP). We demonstrate that PTFE, a material currently used for assessing MicroCT system stability, shows higher radiation-dependent change in x-ray attenuation than FEP. Specifically, for a dose of approximately 1.44 x 10 3 Gy, the linear attenuation coefficient (LAC) of PTFE changes by 0.8 ± 0.1 %. During the same irradiation period, the LAC for FEP changes by 0.02 ± 0.1 %, which is within the statistical uncertainty of the measurement. Due to its highermore » resistance to radiation damage, we recommend that LLNL and partner labs operating under the Department of Homeland Security’s Explosives Division (DHS EXD) transition to the use of FEP as a reference material in place of PTFE.« less

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-10-20

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

DOEpatents

Studier, F.W.; Dubendorff, J.W.

1998-11-03

This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

Poly-LacNAc as an Age-Specific Ligand for Rotavirus P[11] in Neonates and Infants

PubMed Central

Liu, Yang; Huang, Pengwei; Jiang, Baoming; Tan, Ming; Morrow, Ardythe L.; Jiang, Xi

2013-01-01

Rotavirus (RV) P[11] is an unique genotype that infects neonates. The mechanism of such age-specific host restriction remains unknown. In this study, we explored host mucosal glycans as a potential age-specific factor for attachment of P[11] RVs. Using in vitro binding assays, we demonstrated that VP8* of a P[11] RV (N155) could bind saliva of infants (60.3%, N = 151) but not of adults (0%, N = 48), with a significantly negative correlation between binding of VP8* and ages of infants (P<0.01). Recognition to the infant saliva did not correlate with the ABO, secretor and Lewis histo-blood group antigens (HBGAs) but with the binding of the lectin Lycopersicon esculentum (LEA) that is known to recognize the oligomers of N-acetyllactosamine (LacNAc), a precursor of human HBGAs. Direct evidence of LacNAc involvement in P[11] binding was obtained from specific binding of VP8* with homopolymers of LacNAc in variable lengths through a glycan array analysis of 611 glycans. These results were confirmed by strong binding of VP8* to the Lec2 cell line that expresses LacNAc oligomers but not to the Lec8 cell line lacking the LacNAc. In addition, N155 VP8* and authentic P[11] RVs (human 116E and bovine B223) hemagglutinated human red blood cells that are known to express poly-LacNAc. The potential role of poly-LacNAc in host attachment and infection of RVs has been obtained by abrogation of 116E replication by the PAA-conjugated poly-LacNAc, human milk, and LEA positive infant saliva. Overall, our results suggested that the poly-LacNAc could serve as an age-specific receptor for P[11] RVs and well explained the epidemiology that P[11] RVs mainly infect neonates and young children. PMID:24244290

A diverse range of bacterial and eukaryotic chitinases hydrolyzes the LacNAc (Galβ1-4GlcNAc) and LacdiNAc (GalNAcβ1-4GlcNAc) motifs found on vertebrate and insect cells.

PubMed

Frederiksen, Rikki F; Yoshimura, Yayoi; Storgaard, Birgit G; Paspaliari, Dafni K; Petersen, Bent O; Chen, Kowa; Larsen, Tanja; Duus, Jens Ø; Ingmer, Hanne; Bovin, Nicolai V; Westerlind, Ulrika; Blixt, Ola; Palcic, Monica M; Leisner, Jørgen J

2015-02-27

There is emerging evidence that chitinases have additional functions beyond degrading environmental chitin, such as involvement in innate and acquired immune responses, tissue remodeling, fibrosis, and serving as virulence factors of bacterial pathogens. We have recently shown that both the human chitotriosidase and a chitinase from Salmonella enterica serovar Typhimurium hydrolyze LacNAc from Galβ1-4GlcNAcβ-tetramethylrhodamine (LacNAc-TMR (Galβ1-4GlcNAcβ(CH2)8CONH(CH2)2NHCO-TMR)), a fluorescently labeled model substrate for glycans found in mammals. In this study we have examined the binding affinities of the Salmonella chitinase by carbohydrate microarray screening and found that it binds to a range of compounds, including five that contain LacNAc structures. We have further examined the hydrolytic specificity of this enzyme and chitinases from Sodalis glossinidius and Polysphondylium pallidum, which are phylogenetically related to the Salmonella chitinase, as well as unrelated chitinases from Listeria monocytogenes using the fluorescently labeled substrate analogs LacdiNAc-TMR (GalNAcβ1-4GlcNAcβ-TMR), LacNAc-TMR, and LacNAcβ1-6LacNAcβ-TMR. We found that all chitinases examined hydrolyzed LacdiNAc from the TMR aglycone to various degrees, whereas they were less active toward LacNAc-TMR conjugates. LacdiNAc is found in the mammalian glycome and is a common motif in invertebrate glycans. This substrate specificity was evident for chitinases of different phylogenetic origins. Three of the chitinases also hydrolyzed the β1-6 bond in LacNAcβ1-6LacNAcβ-TMR, an activity that is of potential importance in relation to mammalian glycans. The enzymatic affinities for these mammalian-like structures suggest additional functional roles of chitinases beyond chitin hydrolysis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Prevalence of ligamentum arteriosum calcification on multi-section spiral CT and digital radiography.

PubMed

Hong, Gil-Sun; Goo, Hyun Woo; Song, Jae-Woo

2012-06-01

To investigate the prevalence of ligamentum arteriosum calcification (LAC) on multi-section spiral CT and digital radiography. Five hundred and eight children and 232 adults who performed multi-section chest CT were included in this study and were divided into nine age groups: A (0-5 years), B (6-10 years), C (11-15 years), D (16-20 years), E (21-30 years), F (31-40 years), G (41-50 years), H (51-60 years), and I (61-70 years). Two radiologists assessed the presence of LAC on axial and coronal CT images, defined as focal calcific density on both or on one plane with attenuation >100 Hounsfield unit. The prevalence of LAC on CT was compared between children and adults, and between unenhanced and enhanced CT in children. The prevalence of LAC on digital radiography was evaluated in 476 children. The prevalence of definite LAC on unenhanced multi-section CT was significantly higher in children (37.8 %) than in adults (11.2 %) (P < 0.001), with prevalences in groups: A through I of 35.8, 48.7, 35.1, 28.6, 25.0, 10.2, 15.5, 7.8, and 5.6 %, respectively. The prevalences of indeterminate LAC in age groups A-I on unenhanced multi-section CT were 4.5, 12.8, 8.1, 19.0, 0.0, 0.0, 0.0, 2.0, and 1.9 %. In children, the prevalence of LAC was significantly higher on unenhanced than on enhanced CT (37.8 vs. 16.4 %, P < 0.001). The prevalence of LAC on digital radiography was 3.6 % in children. LAC is frequently observed in children and adults on multi-section spiral CT, more frequently than previously reported. Compared with that on multi-section spiral CT, the prevalence of LAC on digital radiography is substantially low.

Optical and radio properties of X-ray selected BL Lacertae objects

NASA Technical Reports Server (NTRS)

Stocke, J. T.; Liebert, J.; Schmidt, G.; Gioia, I. M.; Maccacaro, T.

1985-01-01

The eight BL Lac objects from the HEAO 1 A-2 all-sky survey and from the Einstein medium-sensitivity survey (MSS) form a flux-limited complete X-ray selected sample. The optical and radio properties of the MSS BL Lac objects are presented and compared with those of the HEAO 1 A-2 sample and with those of radio-selected BL Lac objects. The X-ray selected BL Lac objects possess smaller polarized fractions and less violent optical variability than radio-selected BL Lac objects. These properties are consistent with the substantial starlight fraction seen in the optical spectra of a majority of these objects. This starlight allows a determination of definite redshifts for two of four MSS BL Lac objects and a probable redshift for a third. These redshifts are 0.2, 0.3, and 0.6. Despite the differences in characteristics between the X-ray selected and radio-selected samples, it is concluded that these eight objects possess most of the basic qualities of BL Lac objects and should be considered members of that class. Moreover, as a class, these X-ray selected objects have the largest ratio of X-ray to optical flux of any active galactic nuclei yet discovered.

Cloning, Purification, and Characterization of a Heterodimeric β-Galactosidase from Lactobacillus kefiranofaciens ZW3.

PubMed

He, Xi; Han, Ning; Wang, Yan-Ping

2016-01-01

Lactobacillus kefiranofaciens ZW3 was obtained from kefir grains, which have high lactose hydrolytic activity. In this study, a heterodimeric LacLM-type β-galactosidase gene (lacLM) from ZW3 was isolated, which was composed of two overlapping genes, lacL (1,884 bp) and lacM (960 bp) encoding large and small subunits with calculated molecular masses of 73,620 and 35,682 Da, respectively. LacLM, LacL, and LacM were expressed in Escherichia coli BL21(DE3) and these recombinant proteins were purified and characterized. The results showed that, compared with the recombinant holoenzyme, the recombinant large subunit exhibits obviously lower thermostability and hydrolytic activity. Moreover, the optimal temperature and pH of the holoenzyme and large subunit are 60°C and 7.0, and 50°C and 8.0, respectively. However, the recombinant small subunit alone has no activity. Interestingly, the activity and thermostability of the large subunit were greatly improved after mixing it with the recombinant small subunit. Therefore, the results suggest that the small subunit might play an important role in maintaining the stability of the structure of the catalytic center located in the large subunit.

Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)

A two-stage refinement approach for the enhancement of excretory production of an exoglucanase from Escherichia coli.

PubMed

Fu, Z B; Ng, K L; Lam, C C; Leung, K C; Yip, W H; Wong, W K R

2006-08-01

Hyper-expression of a secretory exoglucanase, Exg, encoded by the cex gene of Cellulomonas fimi was previously shown to saturate the SecYEG pathway and result in dramatic cell death of recombinant Escherichia coli (Z.B. Fu, K.L. Ng, T.L. Lam, W.K.R. Wong, Cell death caused by hyper-expression of a secretory exoglucanase in Esherichia coli, Protein Expr. Purif. 42 (2005) 67-77). We propose here that the cell lysate ratio (Pre/Mat RQ) of the unprocessed precursor Exg protein (Pre-Exg) and its processed mature product (Mat-Exg) reflects the capacity of E. coli to secrete Exg. A Pre/Mat RQ of 20/80, designated the "Critical Value," was an important threshold measurement. A rise in the Pre/Mat RQ triggered a mass killing effect. The use of various secretion signal peptides did not improve the viability of cells expressing high levels of Pre-Exg under strong tac promoter control. However, use of the weaker vegG promoter in conjunction with a change in start codon of the spa leader sequence from ATG to TTG in a pM1vegGcexL plasmid construct resulted in a high level (0.9 U ml(-1)) of excreted Exg in shake-flask cultures. This was 50% higher than the best result obtained from plasmid construct lacUV5par8cex, using the lacUV5 promoter and the ompA leader sequence. Variations in the excreted Exg activities were attributable to differences in the Pre/Mat RQ values of the induced cultures harboring pM1vegGcexL and lacUV5par8cex. These values were 18/82 and 10/90, respectively. Employing fed-batch cultivation in two-liter fermentors, an induced JM101(pM1vegGcexL) culture yielded 4.5 U ml(-1) of excreted Exg, which was over six fold greater that previously reported. Our results illustrate the successful application of the Pre/Mat RQ ratio as a guide to the attainment of a maximum level of secreted/excreted Exg.

Major Cardiovascular Risk Factors in Latin America: A Comparison with the United States. The Latin American Consortium of Studies in Obesity (LASO)

PubMed Central

Chirinos, Julio A.; Gómez, Luis F.; Perel, Pablo; Pichardo, Rafael; González, Angel; Sánchez, José R.; Ferreccio, Catterina; Aguilera, Ximena; Silva, Eglé; Oróstegui, Myriam; Medina-Lezama, Josefina; Pérez, Cynthia M.; Suárez, Erick; Ortiz, Ana P.; Rosero, Luis; Schapochnik, Noberto; Ortiz, Zulma; Ferrante, Daniel; Casas, Juan P.

2013-01-01

Background Limited knowledge on the prevalence and distribution of risk factors impairs the planning and implementation of cardiovascular prevention programs in the Latin American and Caribbean (LAC) region. Methods and Findings Prevalence of hypertension, diabetes mellitus, abnormal lipoprotein levels, obesity, and smoking were estimated from individual-level patient data pooled from population-based surveys (1998–2007, n = 31,009) from eight LAC countries and from a national survey of the United States (US) population (1999–2004) Age and gender specific prevalence were estimated and age-gender adjusted comparisons between both populations were conducted. Prevalence of diabetes mellitus, hypertension, and low high-density lipoprotein (HDL)-cholesterol in LAC were 5% (95% confidence interval [95% CI]: 3.4, 7.9), 20.2% (95% CI: 12.5, 31), and 53.3% (95% CI: 47, 63.4), respectively. Compared to LAC region’s average, the prevalence of each risk factor tended to be lower in Peru and higher in Chile. LAC women had higher prevalence of obesity and low HDL-cholesterol than men. Obesity, hypercholesterolemia, and hypertriglyceridemia were more prevalent in the US population than in LAC population (31 vs. 16.1%, 16.8 vs. 8.9%, and 36.2 vs. 26.5%, respectively). However, the prevalence of low HDL-cholesterol was higher in LAC than in the US (53.3 vs. 33.7%). Conclusions Major cardiovascular risk factors are highly prevalent in LAC region, in particular low HDL-cholesterol. In addition, marked differences do exist in this prevalence profile between LAC and the US. The observed patterns of obesity-related risk factors and their current and future impact on the burden of cardiovascular diseases remain to be explained. PMID:23349785

Analysis of the initiation of nuclear pore assembly by ectopically targeting nucleoporins to chromatin

PubMed Central

Schwartz, Michal; Travesa, Anna; Martell, Steven W; Forbes, Douglass J

2015-01-01

Nuclear pore complexes (NPCs) form the gateway to the nucleus, mediating virtually all nucleocytoplasmic trafficking. Assembly of a nuclear pore complex requires the organization of many soluble sub-complexes into a final massive structure embedded in the nuclear envelope. By use of a LacI/LacO reporter system, we were able to assess nucleoporin (Nup) interactions, show that they occur with a high level of specificity, and identify nucleoporins sufficient for initiation of the complex process of NPC assembly in vivo. Eleven nucleoporins from different sub-complexes were fused to LacI-CFP and transfected separately into a human cell line containing a stably integrated LacO DNA array. The LacI-Nup fusion proteins, which bound to the array, were examined for their ability to recruit endogenous nucleoporins to the intranuclear LacO site. Many could recruit nucleoporins of the same sub-complex and a number could also recruit other sub-complexes. Strikingly, Nup133 and Nup107 of the Nup107/160 subcomplex and Nup153 and Nup50 of the nuclear pore basket recruited a near full complement of nucleoporins to the LacO array. Furthermore, Nup133 and Nup153 efficiently targeted the LacO array to the nuclear periphery. Our data support a hierarchical, seeded assembly pathway and identify Nup133 and Nup153 as effective “seeds” for NPC assembly. In addition, we show that this system can be applied to functional studies of individual nucleoporin domains as well as to specific nucleoporin disease mutations. We find that the R391H cardiac arrhythmia/sudden death mutation of Nup155 prevents both its subcomplex assembly and nuclear rim targeting of the LacO array. PMID:25602437

Major cardiovascular risk factors in Latin America: a comparison with the United States. The Latin American Consortium of Studies in Obesity (LASO).

PubMed

Miranda, J Jaime; Herrera, Victor M; Chirinos, Julio A; Gómez, Luis F; Perel, Pablo; Pichardo, Rafael; González, Angel; Sánchez, José R; Ferreccio, Catterina; Aguilera, Ximena; Silva, Eglé; Oróstegui, Myriam; Medina-Lezama, Josefina; Pérez, Cynthia M; Suárez, Erick; Ortiz, Ana P; Rosero, Luis; Schapochnik, Noberto; Ortiz, Zulma; Ferrante, Daniel; Casas, Juan P; Bautista, Leonelo E

2013-01-01

Limited knowledge on the prevalence and distribution of risk factors impairs the planning and implementation of cardiovascular prevention programs in the Latin American and Caribbean (LAC) region. Prevalence of hypertension, diabetes mellitus, abnormal lipoprotein levels, obesity, and smoking were estimated from individual-level patient data pooled from population-based surveys (1998-2007, n=31,009) from eight LAC countries and from a national survey of the United States (US) population (1999-2004) Age and gender specific prevalence were estimated and age-gender adjusted comparisons between both populations were conducted. Prevalence of diabetes mellitus, hypertension, and low high-density lipoprotein (HDL)-cholesterol in LAC were 5% (95% confidence interval [95% CI]: 3.4, 7.9), 20.2% (95% CI: 12.5, 31), and 53.3% (95% CI: 47, 63.4), respectively. Compared to LAC region's average, the prevalence of each risk factor tended to be lower in Peru and higher in Chile. LAC women had higher prevalence of obesity and low HDL-cholesterol than men. Obesity, hypercholesterolemia, and hypertriglyceridemia were more prevalent in the US population than in LAC population (31 vs. 16.1%, 16.8 vs. 8.9%, and 36.2 vs. 26.5%, respectively). However, the prevalence of low HDL-cholesterol was higher in LAC than in the US (53.3 vs. 33.7%). Major cardiovascular risk factors are highly prevalent in LAC region, in particular low HDL-cholesterol. In addition, marked differences do exist in this prevalence profile between LAC and the US. The observed patterns of obesity-related risk factors and their current and future impact on the burden of cardiovascular diseases remain to be explained.

Reclaiming the streets for people: Insights from Ciclovías Recreativas in Latin America.

PubMed

Sarmiento, Olga L; Díaz Del Castillo, Adriana; Triana, Camilo A; Acevedo, María José; Gonzalez, Silvia A; Pratt, Michael

2017-10-01

The Ciclovías comprise worldwide programs in which streets are closed to motor-vehicles and open to individuals for leisure activities. Currently, 93% of the regular programs are in Latin American countries (LAC). The aims of this study were to describe the characteristics of regular Ciclovías in 7 LAC and to analyze the factors that influence the sustainability and scaling-up of five case studies. We conducted a survey of 67 Ciclovías in 2014-2015. In addition, we conducted semi-structured interviews with current and former program coordinators and reviewed policy documents from Ciclovías in 5 LAC. The greatest expansion of Ciclovías has occurred since 2000. The number of participants per event ranged from 40 to 1,500,000 (mean 41,399±193,330; median 1600), and the length ranged from 1 to 113.6km (mean 9.1±16.4; median 3). Ciclovía routes connect low-middle and high income neighborhoods (89.3%), and include the participation of minority populations (61.2%). The main complementary activity offered was physical activity (PA) classes (94.0%), and 80.0% of the programs included strategies to promote biking. All five case studies met definitions for sustainability and scaling-up. All programs shared some level of government support, alliances, community appropriation, champions, compatibility with the mission of the host organization, organizational capacity, flexibility, perceived benefits, and funding stability. However, they differed in operational conditions, political favorability, sources of funding, and number of alliances. The Ciclovías of LAC showed heterogeneity within their design and sustainability factors. Both their heterogeneity and flexibility to adjust to changes make them promising examples of socially inclusive programs to promote PA. Copyright © 2016 Elsevier Inc. All rights reserved.

Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.

PubMed

Adebali, Ogun; Sancar, Aziz; Selby, Christopher P

2017-11-10

Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Mutants of Agrobacterium tumefaciens with elevated vir gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pazour, G.J.; Ta, C.N.; Das, A.

1991-08-15

Expression of Agrobacterium tumefaciens virulence (vir) genes requires virA, virG, and a plant-derived inducing compound such as acetosyringone. To identify the critical functional domains of virA and virG, a mutational approach was used. Agrobacterium A136 harboring plasmid pGP159, which contains virA, virG, and a reporter virB:lacZ gene fusion, was mutagenized with UV light or nitrosoguanidine. Survivors that formed blue colonies on a plate containing 5-bromo-4-chloro-3-indolyl beta-D-galactoside were isolated and analyzed. Quantification of beta-galactosidase activity in liquid assays identified nine mutant strains. By plasmid reconstruction and other procedures, all mutations mapped to the virA locus. These mutations caused an 11- tomore » 560-fold increase in the vegetative level of virB:lacZ reporter gene expression. DNA sequence analysis showed that the mutations are located in four regions of VirA: transmembrane domain one, the active site, a glycine-rich region with homology to ATP-binding sites, and a region at the C terminus that has homology to the N terminus of VirG.« less

Regulation of glutamine synthetase II activity in Rhizobium meliloti 104A14.

PubMed Central

Shatters, R G; Somerville, J E; Kahn, M L

1989-01-01

Most rhizobia contain two glutamine synthetase (GS) enzymes: GSI, encoded by glnA, and GSII, encoded by glnII. We have found that WSU414, a Rhizobium meliloti 104A14 glutamine auxotroph derived from a glnA parental strain, is an ntrA mutant. The R. meliloti glnII promoter region contains DNA sequences similar to those found in front of other genes that require ntrA for their transcription. No GSII was found in the glnA ntrA mutant, and when a translational fusion of glnII to the Escherichia coli lacZ gene was introduced into WSU414, no beta-galactosidase was expressed. These results indicate that ntrA is required for glnII expression. The ntrA mutation did not prevent the expression of GSI. In free-living culture, the level of GSII and of the glnII-lacZ fusion protein was regulated by altering transcription in response to available nitrogen. No GSII protein was detected in alfalfa, pea, or soybean nodules when anti-GSII-specific antiserum was used. Images PMID:2570059

The Cosmic Evolution of Fermi BL Lacertae Objects

NASA Astrophysics Data System (ADS)

Ajello, Marco; Gasparrini, Dario; Romani, Roger W.; Shaw, Michael S.

2014-06-01

It has been notoriously difficult in the past to measure the cosmological evolution of BL Lacs because of the challenges related to measure their redshift. Extensive optical follow-up observations of a sample of ~200 Fermi-detected BL Lac objects have provided much-needed redshift information for many of them. This stands as the largest and most complete sample of BL Lacs available in the literature and was used to determine the cosmological properties of this elusive source class. This talk will review the cosmic evolution of BL Lacs and discuss the link to their siblings flat-spectrum radio quasars (FSRQs). Evidence suggests that BL Lacs of the high-synchrotron peaked class might be an accretion-starved end-state of an earlier merger-driven gas-rich phase.

[Restriction polymorphism of the proto-oncogene c-Ha-ras-1 in patients with multiple primary malignant neoplasms and non-small-cell lung cancer].

PubMed

Gaspar'ian, A V; Sel'chuk, V Iu; Iakubovskaia, M G; Zborovskaia, I B; Tatosian, A G

1997-01-01

Restriction fragment length polymorphism in the human c-Ha-ras-1 locus, associated with a minisatellite sequence, was examined in 45 multiple primary cancer (MPC) patients, 56 patients with squamous cell lung cancer (SCLC), 21 patients with lung adenocarcinoma (LAC), and 53 individuals having no oncopathology. Southern analysis of cellular DNA revealed the presence of 4 common alleles (with collective allele frequency close to 94% in the control group) and a set of rare alleles. Allele a3, (2.1 kb in size under MspI/HpaII digestion) was shown to be more frequent in the MPC than in the control group. The same tendency was observed in the patients with highly differentiated cell lung cancer. An increased frequency of the a4 allele (2.5 kb under MspI/HpaII digestion) was observed in the patients with adenocarcinomas as well as in the patients with metastases and low levels of tumor tissue differentiation. The elevated frequencies of a3 in the MPC group and of a4 in the LAC patients did not correlate with increased risk of the cancers mentioned above but was associated with type of tumor progression. Previously, it was reported that the mini-satellite sequence within the c-Ha-ras-1 locus possesses enhancer activity. Our data indirectly confirm the hypothesis that the efficiency of minisatellite modulator activity is associated with fragment size.

Crystal structure of VmoLac, a tentative quorum quenching lactonase from the extremophilic crenarchaeon Vulcanisaeta moutnovskia

PubMed Central

Hiblot, Julien; Bzdrenga, Janek; Champion, Charlotte; Chabriere, Eric; Elias, Mikael

2015-01-01

A new representative of the Phosphotriesterase-Like Lactonases (PLLs) family from the hyperthermophilic crenarchaeon Vulcanisaeta moutnovskia has been characterized and crystallized. VmoLac is a native, proficient lactonase with promiscuous, low phosphotriesterase activity. VmoLac therefore represents an interesting candidate for engineering studies, with the aim of developing an efficient bacterial quorum-quenching agent. Here, we provide an extensive biochemical and kinetic characterization of VmoLac and describe the X-ray structures of the enzyme bound to a fatty acid and to its cognate substrate 3-oxo-C10 AHL (Acyl-Homoserine Lactone). The structures highlight possible structural determinants that may be involved in its extreme thermal stability (Tm = 128°C). Moreover, the structure reveals that the substrate binding mode of VmoLac significantly differs from those of its close homologues, possibly explaining the substrate specificity of the enzyme. Finally, we describe the specific interactions between the enzyme and its substrate, and discuss the possible lactone hydrolysis mechanism of VmoLac. PMID:25670483

Radio constraints on the nature of BL Lacertae objects and their parent population

NASA Technical Reports Server (NTRS)

Kollgaard, R. I.; Wardle, J. F. C.; Roberts, D. H.; Gabuzda, D. C.

1992-01-01

5 GHz VLA observations of 17 BL Lac objects with bright radio cores at both high and low resolution are reported. Extended emission is detected around most objects. None of the sources observed at low resolution show evidence of giant halos on the scale of tens of arcmin. In general, the sources with the most luminous extended emission exhibit FR II characteristics in both morphology and polarization, and less luminous sources exhibit FR I characteristics. Thus, the parent population of the BL Lac objects contains both FR I and FR II radio sources. No BL Lac objects are found that clearly exhibit quasarlike polarization at milliarcsec resolution. This argues against the view that the more luminous BL Lac objects are simply an extension of the quasar/OVV population, or that most BL Lac objects are gravitationally microlensed images of distant quasars. Other properties are generally consistent with the view the BL Lac objects are normal radio galaxies whose jets make a small angle to the line of sight.

Solving a discrete model of the lac operon using Z3

NASA Astrophysics Data System (ADS)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Plasma concentrations of glucagon-like peptide 1 and 2 in calves fed calf starters containing lactose.

PubMed

Inabu, Y; Saegusa, A; Inouchi, K; Koike, S; Oba, M; Sugino, T

2017-11-01

The objective of this study was to evaluate the effects of lactose inclusion in calf starters on plasma glucagon-like peptide (GLP)-1 and GLP-2 concentrations and gastrointestinal tract development in calves. Holstein bull calves (n = 45) were raised on an intensified nursing program using milk replacer containing 28.0% CP and 15.0% fat, and were fed a texturized calf starter containing 0 (control), 5.0 (LAC5), or 10.0% (LAC10; n = 15 for each treatment) lactose on a DM basis. Lactose was included in the starter by partially replacing dry ground corn in pelleted portion of the starter. All calf starters were formulated with 23.1% CP. The ethanol-soluble carbohydrate concentrations of the control, LAC5, and LAC10 starters were 7.3, 12.3, and 16.8% on a DM basis, respectively. Starch concentrations of the control, LAC5, and LAC10 starters were 29.7, 27.0, and 21.4% on a DM basis, respectively. All calves were fed treatment calf starters ad libitum. Blood samples were obtained weekly from 1 to 11 wk of age, and used to measure plasma GLP-1, GLP-2, and insulin concentrations, serum β-hydroxybutyrate (BHB) concentration, and blood glucose concentration. At 80 d of age, calves were euthanized, and weights of the reticulorumen, omasum, abomasum, small intestine, and large intestine tissue were measured. Serum BHB concentration was higher for calves fed the LAC10 (171 μmol/L) starter than for those fed the control (151 μmol/L) and LAC5 (145 μmol/L) starters. Plasma GLP-1 and GLP-2 concentrations did not differ between treatments. However, relative to the baseline (1 wk of age), the plasma GLP-1 concentration was higher for the LAC10 (125.9%) than for the LAC5 (68.2%) and control (36.8%), and for the LAC5 than for the control (36.8%). Moreover, similar differences between treatments were observed for GLP-2 concentration relative to the baseline (88.2, 76.9, and 74.9% for LAC10, LAC5, and control treatments, respectively). The serum BHB concentration was positively correlated with the plasma GLP-1 concentration (r = 0.428). Furthermore, the plasma GLP-1 concentration was positively correlated with the insulin concentration (r = 0.793). The weights of the reticulorumen, omasum, abomasum, small intestine, and large intestine were not affected by the treatments. In conclusion, inclusion of lactose in calf starters resulted in higher plasma GLP-1 and GLP-2 concentrations, and BHB might be associated with higher plasma GLP-1 concentration. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

2008 Stability, Security, Transition and Reconstruction Operations Conference

DTIC Science & Technology

2008-09-04

Facilitator Power of Public-Private Partnerships • Health Professional Education • Greater Access to Care China Diabetes Education Program Dominican Republic...Argentina Canada Chile Colombia Ecuador Peru Uruguay Interagency, multinational, inter-institutional partnerships State Department Homeland Security...Disaster Preparedness Disaster Response Regional Response Capacity OFDA-LAC / MDROs Regional Security System (RSS) UNCLASSIFIED ECUADOR / KY PERU / WV

Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1

PubMed Central

Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah

2002-01-01

Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346

Troponin T3 expression in skeletal and smooth muscle is required for growth and postnatal survival: characterization of Tnnt3(tm2a(KOMP)Wtsi) mice.

PubMed

Ju, Yawen; Li, Jie; Xie, Chao; Ritchlin, Christopher T; Xing, Lianping; Hilton, Matthew J; Schwarz, Edward M

2013-09-01

The troponin complex, which consists of three regulatory proteins (troponin C, troponin I, and troponin T), is known to regulate muscle contraction in skeletal and cardiac muscle, but its role in smooth muscle remains controversial. Troponin T3 (TnnT3) is a fast skeletal muscle troponin believed to be expressed only in skeletal muscle cells. To determine the in vivo function and tissue-specific expression of Tnnt3, we obtained the heterozygous Tnnt3+/flox/lacZ mice from Knockout Mouse Project (KOMP) Repository. Tnnt3(lacZ/+) mice are smaller than their WT littermates throughout development but do not display any gross phenotypes. Tnnt3(lacZ/lacZ) embryos are smaller than heterozygotes and die shortly after birth. Histology revealed hemorrhagic tissue in Tnnt3(lacZ/lacZ) liver and kidney, which was not present in Tnnt3(lacZ/+) or WT, but no other gross tissue abnormalities. X-gal staining for Tnnt3 promoter-driven lacZ transgene expression revealed positive staining in skeletal muscle and diaphragm and smooth muscle cells located in the aorta, bladder, and bronchus. Collectively, these findings suggest that troponins are expressed in smooth muscle and are required for normal growth and breathing for postnatal survival. Moreover, future studies with this mouse model can explore TnnT3 function in adult muscle function using the conditional-inducible gene deletion approach Copyright © 2013 Wiley Periodicals, Inc.

Synergistically enhanced stability of laccase immobilized on synthesized silver nanoparticles with water-soluble polymers.

PubMed

Cunha, M N M; Felgueiras, H P; Gouveia, I; Zille, A

2017-06-01

Silver nanoparticles (AgNPs) were synthesized by citrate reduction method in the presence of polymers, poly(ethylene glycol) (PEG), poly(vinyl alcohol) (PVA) and chitosan, used as stabilizing agents, and an oxidoreductase enzyme, laccase (Lac), with the goal of expanding the NPs antimicrobial action. AgNPs were characterized by UV-vis spectrometry, dynamic light scattering and transmission electron microscopy. As protecting agents, PEG and PVA promoted the formation of spherical uniformly-shaped, small-sized, monodispersed AgNPs (≈20nm). High Mw polymers were established as most effective in producing small-sized NPs. Chitosan's viscosity led to the formation of aggregates. Despite the decrease in Lac activity registered for the hybrid formulation, AgNPs-polymer-Lac, a significant augment in stability over time (up to 13days, at 50°C) was observed. This novel formulation displays improved synergistic performance over AgNPs-Lac or polymer-Lac conjugates, since in the former the Lac activity becomes residual at the end of 3days. By enabling many ionic interactions, chitosan restricted the mass transfer between Lac and substrate and, thus, inhibited the enzymatic activity. These hybrid nanocomposites made up of inorganic NPs, organic polymers and immobilized antimicrobial oxidoreductive enzymes represent a new class of materials with improved synergistic performance. Moreover, the Lac and the AgNPs different antimicrobial action, both in time and mechanism, may also constitute a new alternative to reduce the probability of developing resistance-associated mutations. Copyright © 2017 Elsevier B.V. All rights reserved.

Latin America: A Development Pole for Phenomics

PubMed Central

Camargo, Anyela V.; Lobos, Gustavo A.

2016-01-01

Latin America and the Caribbean (LAC) has long been associated with the production and export of a diverse range of agricultural commodities. Due to its strategic geographic location, which encompasses a wide range of climates, it is possible to produce almost any crop. The climate diversity in LAC is a major factor in its agricultural potential but this also means climate change represents a real threat to the region. Therefore, LAC farming must prepare and quickly adapt to an environment that is likely to feature long periods of drought, excessive rainfall and extreme temperatures. With the aim of moving toward a more resilient agriculture, LAC scientists have created the Latin American Plant Phenomics Network (LatPPN) which focuses on LAC's economically important crops. LatPPN's key strategies to achieve its main goal are: (1) training of LAC members on plant phenomics and phenotyping, (2) establish international and multidisciplinary collaborations, (3) develop standards for data exchange and research protocols, (4) share equipment and infrastructure, (5) disseminate data and research results, (6) identify funding opportunities and (7) develop strategies to guarantee LatPPN's relevance and sustainability across time. Despite the challenges ahead, LatPPN represents a big step forward toward the consolidation of a common mind-set in the field of plant phenotyping and phenomics in LAC. PMID:27999577

Latin America: A Development Pole for Phenomics.

PubMed

Camargo, Anyela V; Lobos, Gustavo A

2016-01-01

Latin America and the Caribbean (LAC) has long been associated with the production and export of a diverse range of agricultural commodities. Due to its strategic geographic location, which encompasses a wide range of climates, it is possible to produce almost any crop. The climate diversity in LAC is a major factor in its agricultural potential but this also means climate change represents a real threat to the region. Therefore, LAC farming must prepare and quickly adapt to an environment that is likely to feature long periods of drought, excessive rainfall and extreme temperatures. With the aim of moving toward a more resilient agriculture, LAC scientists have created the Latin American Plant Phenomics Network (LatPPN) which focuses on LAC's economically important crops. LatPPN's key strategies to achieve its main goal are: (1) training of LAC members on plant phenomics and phenotyping, (2) establish international and multidisciplinary collaborations, (3) develop standards for data exchange and research protocols, (4) share equipment and infrastructure, (5) disseminate data and research results, (6) identify funding opportunities and (7) develop strategies to guarantee LatPPN's relevance and sustainability across time. Despite the challenges ahead, LatPPN represents a big step forward toward the consolidation of a common mind-set in the field of plant phenotyping and phenomics in LAC.

Population Dynamics of a Lac(-) Strain of Escherichia Coli during Selection for Lactose Utilization

PubMed Central

Foster, P. L.

1994-01-01

During selection for lactose utilization, Lac(+) revertants of FC40, a Lac(-) strain of Escherichia coli, appear at a high rate. Yet, no Lac(+) revertants appear in the absence of lactose, or in its presence if the cells have another, unfulfilled requirement for growth. This study investigates more fully the population dynamics of FC40 when incubated in the absence of a carbon source or when undergoing selection for lactose utilization. In the absence of a carbon source, the viable cell numbers do not change over 6 days. When incubated in liquid lactose medium, Lac(-) cells do not undergo any measurable increase in numbers or in turbidity for at least 2 days. When FC40 is plated on lactose minimum medium in the presence of scavenger cells, the upper limit to the amount of growth of Lac(-) cells during 5 days is one doubling, and there is no evidence for turnover (i.e., a balance between growth and death). The presence of a minority population that could form microcolonies was not detected. The implications of these results, plus the fact that the appearance of Lac(+) revertants during lactose selection is nearly constant with time, are discussed in reference to several models that have been postulated to account for adaptive mutations. PMID:7828809

Unraveling the nexus between water and food security in Latin America and the Caribbean: regional and global implications

NASA Astrophysics Data System (ADS)

Willaarts, Barbara; Garrido, Alberto; Soriano, Barbara; De Stefano, Lucia; López Gunn, Elena; Aldaya, Maite; Martínez-Santos, Pedro; Llamas, Ramon

2014-05-01

Latin American and the Caribbean (LAC) is a water and land abundant region, and plays a key role in meeting global food and water security. During the last decade, LAC has experience a rapid socio-economic growth, largely sustained by its competitive advantage in the production and exports of agricultural and mining products and by the high commodity prices in the global market. This study seeks to quantify the contribution of LAC's agriculture to global food and water security, i.e. virtual water trade, and evaluate the environmental and societal implications for regional development. Results show that between 2000 and 2011, LAC has increase its agricultural production 27%, and it now accounts for nearly 18% of the global agricultural market. As a result, the agricultural water footprint (WF) of LAC was augmented 65%; and yet, nearly 19% to 44% of the actual agricultural WF - depending on the countries - is virtual water exported to third countries. In fact, almost 50% of the increase in global virtual water trade during the last decade, corresponds to LAC. Such global contribution has significant implications for regional water and food security. From an environmental perspective, crop expansion (mostly rain-fed) resulted in the deforestation of nearly 1 million km2, turning this region into the second most important deforestation hotspots worldwide. This land clearing is having large impacts of ecosystem services, e.g. carbon sequestration, water quality or biodiversity conservation. From a socio-economic perspective, increasing agricultural production has improved regional food security indicators, although one every seven children is still stunted in LAC and nearly 10% of the population remains undernourished. Dietary shifts and socio-cultural factors also lag behind the growing problem of malnutrition in the region, i.e. overweight and obesity. Improvements of water access and sanitation, have had a positive impact on food security indicators, especially among the high-income LAC countries. We conclude that despite the large contribution of LAC's agriculture to global water and food security, this goal is at present intensively tapping into LAC's natural capital. Also, regional improvements in water security have improved, but important goals remain and new challenges are emerging. Water governance in LAC is evolving to address the challenges posed by rapid socio-economic changes, however, as is often the case, the implementation of reforms lags behind.

Eye drop delivery of nano-polymeric micelle formulated genes with cornea-specific promoters.

PubMed

Tong, Yaw-Chong; Chang, Shwu-Fen; Liu, Chia-Yang; Kao, Winston W-Y; Huang, Chong Heng; Liaw, Jiahorng

2007-11-01

This study evaluates the eye drop delivery of genes with cornea-specific promoters, i.e., keratin 12 (K12) and keratocan (Kera3.2) promoters, by non-ionic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles (PM) to mouse and rabbit eyes, and investigates the underlying mechanisms. Three PM-formulated plasmids (pCMV-Lac Z, pK12-Lac Z and pKera3.2-Lac Z) containing the Lac Z gene for beta-galactosidase (beta-Gal) whose expression was driven by the promoter of either the cytomegalovirus early gene, the keratin 12 gene or the keratocan gene, were characterized by critical micelle concentration (CMC), dynamic light scattering (DLS), and atomic force microscopy (AFM). Transgene expression in ocular tissue after gene delivery was analyzed by 5-bromo-4-chloro-3-indolyl-beta-D-galactoside (X-Gal) color staining, 1,2-dioxetane beta-Gal enzymatic activity measurement, and real-time polymerase chain reaction (PCR) analysis. The delivery mechanisms of plasmid-PM on mouse and rabbit corneas were evaluated by EDTA and RGD (arginine-glycine-aspartic acid) peptide. The sizes of the three plasmid-PM complexes were around 150-200 nm with unimodal distribution. Enhanced stability was found for three plasmid-PM formulations after DNase I treatment. After six doses of eye drop delivery of pK12-Lac Z-PM three times a day, beta-Gal activity was significantly increased in both mouse and rabbit corneas. Stroma-specific Lac Z expression was only found in pKera3.2-Lac Z-PM-treated animals with pretreatment by 5 mM EDTA, an opener of junctions. Lac Z gene expression in both pK12-Lac Z-PM and pKera3.2-Lac Z-PM delivery groups was decreased by RGD peptide pretreatment. Cornea epithelium- and stroma-specific gene expression could be achieved using cornea-specific promoters of keratin 12 and keratocan genes, and the gene was delivered with PM formulation through non-invasive, eye drop in mice and rabbits. The transfection mechanism of plasmid-PM may involve endocytosis and particle size dependent paracellular transport. 2007 John Wiley & Sons, Ltd

Polymeric bionanocomposite cast thin films with in situ laccase-catalyzed polymerization of dopamine for biosensing and biofuel cell applications.

PubMed

Tan, Yueming; Deng, Wenfang; Li, Yunyong; Huang, Zhao; Meng, Yue; Xie, Qingji; Ma, Ming; Yao, Shouzhuo

2010-04-22

We report here on the facile preparation of polymer-enzyme-multiwalled carbon nanotubes (MWCNTs) cast films accompanying in situ laccase (Lac)-catalyzed polymerization for electrochemical biosensing and biofuel cell applications. Lac-catalyzed polymerization of dopamine (DA) as a new substrate was examined in detail by UV-vis spectroscopy, cyclic voltammetry, quartz crystal microbalance, and scanning electron microscopy. Casting the aqueous mixture of DA, Lac and MWCNTs on a glassy carbon electrode (GCE) yielded a robust polydopamine (PDA)-Lac-MWCNTs/GCE that can sense hydroquinone with 643 microA mM(-1) cm(-2) sensitivity and 20-nM detection limit (S/N = 3). The DA substrate yielded the best biosensing performance, as compared with aniline, o-phenylenediamine, or o-aminophenol as the substrate for similar Lac-catalyzed polymerization. Casting the aqueous mixture of DA, glucose oxidase (GOx), Lac, and MWCNTs on a Pt electrode yielded a robust PDA-GOx-Lac-MWCNTs/Pt electrode that exhibits glucose-detection sensitivity of 68.6 microA mM(-1) cm(-2). In addition, 2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS) was also coimmobilized to yield a PDA-Lac-MWCNTs-ABTS/GCE that can effectively catalyze the reduction of O(2), and it was successfully used as the biocathode of a membraneless glucose/O(2) biofuel cell (BFC) in pH 5.0 Britton-Robinson buffer. The proposed biomacromolecule-immobilization platform based on enzyme-catalyzed polymerization may be useful for preparing many other multifunctional polymeric bionanocomposites for wide applications.

Photometric monitoring of three BL Lacertae objects in 1993-1998

NASA Astrophysics Data System (ADS)

Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.

1999-05-01

The results of optical photometric (BVRI) monitoring of three BL Lac objects over a time interval of about four years are presented. The sources are three classical radio-selected BL Lac objects, BL Lac, OJ 287 and PKS 0735+178. During our observation OJ 287 was in the stage of a large periodic outburst which consisted of at least two peaks. Almost all the observations obtained over consecutive nights detected intranight variations. In 1995 and 1996 BL Lac kept in faint states, with fewer and smaller rapid flares and fluctuations. On the contrary, in late 1997 BL Lac was at the stage of a large outburst, accompanied with much more large amplitude rapid flares and fluctuations. PKS 0735+178 was almost at its faint end from 1994 to early 1998. Over this time interval, the intraday variations and microvariations in PKS 0735+178 were rare and the amplitude was very small, except a rapid darkening of ~ 0.4 mag on 24 January 1995. Previous work by \\cite[Webb et al. (1988);]{web88} \\cite[Wagner et al. (1996);]{wag96} \\cite[Pian et al. (1997)]{pia97} also showed the same behaviour of variability as BL Lac and PKS 0735+178 in BL Lac, S5 0716+714, PKS 2155-304, respectively. We propose that the motion of orientation of the relativistic jet in a BL Lac object be responsible for these variability behaviours. Table~1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html

Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.

PubMed

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina

2016-08-23

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.

Lupus anticoagulant: a multicenter study for a standardized and harmonized reporting.

PubMed

Poz, Alessandra; Pradella, Paola; Azzarini, Gabriella; Santarossa, Liliana; Bardin, Cristina; Zardo, Lorena; Giacomello, Roberta

2016-03-01

Laboratory assessment of Lupus anticoagulant (LAC) is very challenging because of inter and intralaboratory variability, which makes it difficult to standardize and harmonize results expression. Five hospital laboratories in North-eastern Italy shared their efforts and their experience in a cross-laboratory study, conducting the diagnostic process as homogeneously as possible and providing a better interpretation for LAC positivity. Hundred normal samples from healthy subjects (20 from each center) were processed to confirm negative upper limits and calculate positivity cutoffs of LAC integrated assays, that is dilute Russell's viper venom time (dRVVT) and silica clotting time (SCT). Moreover, 311 samples previously diagnosed by the laboratories as positive for LAC were analyzed to characterize different positivity levels for each assay. As far as the analysis of healthy subjects is concerned, negative upper limits are set at 1.17 and 1.19 for dRVVT and SCT screen ratio, respectively. Positivity cutoffs are set at 1.20 for dRVVT and 1.23 for SCT, expressed as Test Ratio calculated on screen and confirm integrated tests. Positive results for each integrated assay are subsequently divided into three subgroups: weak, moderate and strong; the results obtained are presented as a score proposal that can provide LAC interpretation. The combined use of both dRVVT and SCT assays and the definition of different positivity levels may lead to clearer, more objective LAC reporting. An interpretative table for LAC-proposed score provides LAC-positive results and it is now adopted by all centers involved in the study.

Microbial keratitis in los angeles: the doheny eye institute and the los angeles county hospital experience.

PubMed

Sand, Daniel; She, Rosemary; Shulman, Ira A; Chen, David S; Schur, Mathew; Hsu, Hugo Y

2015-05-01

To evaluate the spectrum and antibiotic susceptibility panel of infectious keratitis at a major tertiary care referral eye center and a major county hospital in Southern California. Retrospective case series. All cultured infectious keratitis cases from July 1, 2008, through December 31, 2012, from the Doheny Eye Institute (DEI) and the Los Angeles County + University of Southern California Medical Center (LAC+USC) were evaluated. Microbiology records were reviewed retrospectively. Microbial isolates as well as antibiotic susceptibility patterns were analyzed. One hundred eighty-four (63%) of 290 cases showed positive culture results at DEI and 152 (82%) of 186 cases showed positive culture results at LAC+USC. Gram-positive pathogens were found to be the most common at both DEI (70%) and LAC+USC (68%), with coagulase-negative Staphylococcus being the most common gram-positive organism (58% at DEI and 44% at LAC+USC). Pseudomonas aeruginosa was the most common gram-negative organism (57% at DEI and 43% at LAC+USC). Ciprofloxacin and levofloxacin susceptibility for all tested pathogens was 73% at DEI and 81% at LAC+USC (P = 0.16). Oxacillin-resistant Staphylococcus aureus (ORSA) was found in 42% of cases at DEI and in 45% of cases at LAC+USC (P = 1.00). There is no significant difference in the spectrum of pathogens or antibiotic susceptibility of pathogens at DEI versus LAC+USC, and ORSA was found in approximately half of all S. aureus samples. Copyright © 2015 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Indian Americans at Mille Lacs.

ERIC Educational Resources Information Center

Holbert, Victoria L.; And Others

The Training Center for Community Programs prepared a report on the Mille Lacs (Chippewa) Reservation in Minnesota. Data for the report were from 2 separate sources: a survey conducted by the Training Center with the assistance of the Mille Lacs community action program (1967) and an attitudinal survey conducted by Victoria Holbert during 1969.…

Program Evaluation of Community College Learning Assistance Centers: What Do LAC Directors Think?

ERIC Educational Resources Information Center

Franklin, Doug; Blankenberger, Bob

2016-01-01

Objective: This study seeks to determine the nature of current program evaluation practices for learning assistance centers (LACs), the practices being used for program evaluation, and whether LAC directors believe their practices are appropriate for evaluating program effectiveness. Method: We conducted a survey (n = 61) of community college LAC…

Protein Degradation in a TX-TL Cell-free Expression System Using ClpXP Protease

DTIC Science & Technology

2014-07-14

function in TX-TL, as well as bacteriophage assembly [2, 6]. Circuits can also be prototyped from basic parts within 8 hours, avoiding cloning and...mRFP, and Venus and variants eGFP-ssrA, mRFP-ssrA, and Venus-ssrA, coding sequences were cloned into a T7-lacO inducible vector containing a N...12672L12677.! 6.! Shin,!J.,!P.!Jardine,!and!V.!Noireaux,!Genome(Replication,(Synthesis,(and( Assembly(of(the( Bacteriophage (T7(in(a(Single(Cell9Free

Lactose-induced cell death of beta-galactosidase mutants in Kluyveromyces lactis.

PubMed

Lodi, Tiziana; Donnini, Claudia

2005-05-01

The Kluyveromyces lactis lac4 mutants, lacking the beta-galactosidase gene, cannot assimilate lactose, but grow normally on many other carbon sources. However, when these carbon sources and lactose were simultaneously present in the growth media, the mutants were unable to grow. The effect of lactose was cytotoxic since the addition of lactose to an exponentially-growing culture resulted in 90% loss of viability of the lac4 cells. An osmotic stabilizing agent prevented cells killing, supporting the hypothesis that the lactose toxicity could be mainly due to intracellular osmotic pressure. Deletion of the lactose permease gene, LAC12, abolished the inhibitory effect of lactose and allowed the cell to assimilate other carbon substrates. The lac4 strains gave rise, with unusually high frequency, to spontaneous mutants tolerant to lactose (lar1 mutation: lactose resistant). These mutants were unable to take up lactose. Indeed, lar1 mutation turned out to be allelic to LAC12. The high mutability of the LAC12 locus may be an advantage for survival of K. lactis whose main habitat is lactose-containing niches.

Spectroscopy and formation of lanthanum-hydrocarbon radicals formed by association and carbon-carbon bond cleavage of isoprene

NASA Astrophysics Data System (ADS)

Cao, Wenjin; Hewage, Dilrukshi; Yang, Dong-Sheng

2018-05-01

La atom reaction with isoprene is carried out in a laser-vaporization molecular beam source. The reaction yields an adduct as the major product and C—C cleaved and dehydrogenated species as the minor ones. La(C5H8), La(C2H2), and La(C3H4) are characterized with mass-analyzed threshold ionization (MATI) spectroscopy and quantum chemical computations. The MATI spectra of all three species exhibit a strong origin band and several weak vibronic bands corresponding to La-ligand stretch and ligand-based bend excitations. La(C5H8) is a five-membered metallacycle, whereas La(C2H2) and La(C3H4) are three-membered rings. All three metallacycles prefer a doublet ground state with a La 6s1-based valence electron configuration and a singlet ion. The five-membered metallacycle is formed through La addition and isoprene isomerization, whereas the two three-membered rings are produced by La addition and insertion, hydrogen migration, and carbon-carbon bond cleavage.

An Easy Method to Eliminate the Effect of Lupus Anticoagulants in the Coagulation Factor Assay.

PubMed

Tang, Ning; Yin, Shiyu

2016-07-01

To build and evaluate intrinsic coagulation factor assays which can eliminate the effect of lupus anticoagulants (LAC). Commercial silica clotting time confirmatory (SCT-C) reagent containing sufficient synthetic phospholipid and routine activated partial thromboplastin time (APTT) reagent were each used for one-stage detection of FVIII, FIX, and FXI activities, in samples with or without LAC, and the results were compared. For samples without LAC, consistent results of FVIII, FIX, and FXI using both SCT-C reagent and APTT reagent were obtained. For samples with LAC, the assays with SCT-C reagent not only could eliminate the effect of strong lupus anticoagulants but also needed fewer dilutions than that with routine APTT reagent. The intrinsic factor detections by SCT-C reagent are credible and convenient to be used for samples with LAC.

An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.

PubMed

Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K

2003-01-01

The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.

Magnesium for treatment of acute lacunar stroke syndromes: further analysis of the IMAGES trial.

PubMed

Aslanyan, Stella; Weir, Christopher J; Muir, Keith W; Lees, Kennedy R

2007-04-01

A prespecified interaction analysis of the neutral Intravenous Magnesium Efficacy in Stroke (IMAGES) trial revealed significant benefit from magnesium (Mg) in patients with noncortical stroke. Post hoc analysis indicated that this effect was seen in lacunar clinical syndromes (LACS), interaction P=0.005. We have now examined whether this interaction could be explained by confounding baseline factors. LACS was defined on the basis of neurological signs and did not include imaging. We investigated the interaction between baseline variables and Mg treatment on global outcome. We used logistic-regression models to test whether the Mg-LACS interaction remained significant after adjusting for stratification variables, sex, a novel stroke severity score, and baseline variables that had an interaction with treatment (P<0.1). The Mg (n=383) and placebo (n=382) groups of LACS patients were well matched on baseline factors. In addition to LACS, we found an interaction between beneficial Mg treatment effect and younger age (P=0.003), higher baseline diastolic blood pressure (P=0.02), higher mean blood pressure (P=0.02), and absence of ischemic heart disease (P=0.07). Even so, the adjusted Mg-LACS interaction remained significant (odds ratio [OR] 0.57; 95% CI, 0.39 to 0.83; P=0.003). In the LACS subgroup, Mg improved Barthel Index <95 (OR 0.73; 95% CI, 0.55 to 0.98), modified Rankin Scale >1 (OR 0.67; 95% CI, 0.50 to 0.91), and global outcome (OR 0.70; 95% CI, 0.53 to 0.92) but not Barthel Index <60 or mortality. The positive treatment effect of Mg in LACS cannot be ascribed to general issues of severity, time to treatment, blood pressure, or other baseline factors; equally, this finding may be due to chance. A large trial of Mg treatment in LACS appears justified.

A novel strategy of integrated microarray analysis identifies CENPA, CDK1 and CDC20 as a cluster of diagnostic biomarkers in lung adenocarcinoma.

PubMed

Liu, Wan-Ting; Wang, Yang; Zhang, Jing; Ye, Fei; Huang, Xiao-Hui; Li, Bin; He, Qing-Yu

2018-07-01

Lung adenocarcinoma (LAC) is the most lethal cancer and the leading cause of cancer-related death worldwide. The identification of meaningful clusters of co-expressed genes or representative biomarkers may help improve the accuracy of LAC diagnoses. Public databases, such as the Gene Expression Omnibus (GEO), provide rich resources of valuable information for clinics, however, the integration of multiple microarray datasets from various platforms and institutes remained a challenge. To determine potential indicators of LAC, we performed genome-wide relative significance (GWRS), genome-wide global significance (GWGS) and support vector machine (SVM) analyses progressively to identify robust gene biomarker signatures from 5 different microarray datasets that included 330 samples. The top 200 genes with robust signatures were selected for integrative analysis according to "guilt-by-association" methods, including protein-protein interaction (PPI) analysis and gene co-expression analysis. Of these 200 genes, only 10 genes showed both intensive PPI network and high gene co-expression correlation (r > 0.8). IPA analysis of this regulatory networks suggested that the cell cycle process is a crucial determinant of LAC. CENPA, as well as two linked hub genes CDK1 and CDC20, are determined to be potential indicators of LAC. Immunohistochemical staining showed that CENPA, CDK1 and CDC20 were highly expressed in LAC cancer tissue with co-expression patterns. A Cox regression model indicated that LAC patients with CENPA + /CDK1 + and CENPA + /CDC20 + were high-risk groups in terms of overall survival. In conclusion, our integrated microarray analysis demonstrated that CENPA, CDK1 and CDC20 might serve as novel cluster of prognostic biomarkers for LAC, and the cooperative unit of three genes provides a technically simple approach for identification of LAC patients. Copyright © 2018 Elsevier B.V. All rights reserved.

Pesticides in surface water, bed sediment, and ground water adjacent to commercial cranberry bogs, Lac du Flambeau Reservation, Vilas County, Wisconsin

USGS Publications Warehouse

Saad, David A.

2005-01-01

In samples from the Trout River, which is used as a source of water to maintain lake levels in the Corn Lakes, the only pesticides detected were the non-targeted compounds atrazine and deethyl atrazine, indicating it was not a source of targeted compounds detected in the Corn Lakes. Only two pesticides (chlorpyrifos and metolachlor) were detected in bed-sediment samples collected from the lakes; chlorpyrifos from Little Trout Lake and metolachlor from the Corn Lakes. Four pesticides (the targeted compounds napropamide and norflurazon and the non-targeted compounds atrazine and deethyl atrazine) were detected in ground-water samples from two of four sampled monitor wells. The highest ground-water concentrations (up to 0.14 ?g/L napropamide and 0.56 ?g/L norflurazon) were measured in samples from the monitoring well located directly downgradient from the Corn Lakes and commercial cranberry operations. No pesticides were detected in samples from the reference well located upgradient from the Corn Lakes and cranberry operations. Further study is needed to identify additional pesticides as well as chronic effects on aquatic organisms to determine whether cranberry-related pesticides affect the lake ecosystems of the Lac du Flambeau Reservation.

RESEARCH: Influence of Social, Biophysical, and Managerial Conditions on Tourism Experiences Within the Great Barrier Reef World Heritage Area.

PubMed

Shafer; Inglis

2000-07-01

/ Managing protected areas involves balancing the enjoyment of visitors with the protection of a variety of cultural and biophysical resources. Tourism pressures in the Great Barrier Reef World Heritage Area (GBRWHA) are creating concerns about how to strike this balance in a marine environment. Terrestrial-based research has led to conceptual planning and management frameworks that address issues of human use and resource protection. The limits of acceptable change (LAC) framework was used as a conceptual basis for a study of snorkeling at reef sites in the GBRWHA. The intent was to determine if different settings existed among tourism operators traveling to the reef and, if so, to identify specific conditions relating to those settings. Snorkelers (N = 1475) traveling with tourism operations of different sizes who traveled to different sites completed surveys. Results indicated that snorkelers who traveled with larger operations (more people and infrastructure) differed from those traveling with smaller operations (few people and little on-site infrastructure) on benefits received and in the way that specific conditions influenced their enjoyment. Benefits related to nature, escape, and family helped to define reef experiences. Conditions related to coral, fish, and operator staff had a positive influence on the enjoyment of most visitors but, number of people on the trip and site infrastructure may have the greatest potential as setting indicators. Data support the potential usefulness of visitor input in applying the LAC concept to a marine environment where tourism and recreational uses are rapidly changing.

The effects of adsorbing organic pollutants from super heavy oil wastewater by lignite activated coke.

PubMed

Tong, Kun; Lin, Aiguo; Ji, Guodong; Wang, Dong; Wang, Xinghui

2016-05-05

The adsorption of organic pollutants from super heavy oil wastewater (SHOW) by lignite activated coke (LAC) was investigated. Specifically, the effects of LAC adsorption on pH, BOD5/COD(Cr)(B/C), and the main pollutants before and after adsorption were examined. The removed organic pollutants were characterized by Fourier transform infrared spectroscopy (FTIR), Boehm titrations, gas chromatography-mass spectrometry (GC-MS), and liquid chromatography with organic carbon detection (LC-OCD). FTIR spectra indicated that organic pollutants containing -COOH and -NH2 functional groups were adsorbed from the SHOW. Boehm titrations further demonstrated that carboxyl, phenolic hydroxyl, and lactonic groups on the surface of the LAC increased. GC-MS showed that the removed main organic compounds are difficult to be degraded or extremely toxics to aquatic organisms. According to the results of LC-OCD, 30.37 mg/L of dissolved organic carbons were removed by LAC adsorption. Among these, hydrophobic organic contaminants accounted for 25.03 mg/L. Furthermore, LAC adsorption was found to increase pH and B/C ratio of the SHOW. The mechanisms of adsorption were found to involve between the hydrogen bonding and the functional groups of carboxylic, phenolic, and lactonic on the LAC surface. In summary, all these results demonstrated that LAC adsorption can remove bio-refractory DOCs, which is beneficial for biodegradation. Copyright © 2016. Published by Elsevier B.V.

Modification of natural matrix lac-bagasse for matrix composite films

NASA Astrophysics Data System (ADS)

Nurhayati, Nanik Dwi; Widjaya, Karna; Triyono

2016-02-01

Material technology continues to be developed in order to a material that is more efficient with composite technology is a combination of two or more materials to obtain the desired material properties. The objective of this research was to modification and characterize the natural matrix lac-bagasse as composite films. The first step, natural matrix lac was changed from solid to liquid using an ethanol as a solvent so the matrix homogenly. Natural matrix lac was modified by adding citric acid with concentration variation. Secondly, the bagasse delignification using acid hydrolysis method. The composite films natural matrix lac-bagasse were prepared with optimum modified the addition citric acid 5% (v/v) and delignification bagasse optimum at 1,5% (v/v) in hot press at 80°C 6 Kg/cm-1. Thirdly, composite films without and with modification were characterized functional group analysis using FTIR spectrophotometer and mechanical properties using Universal Testing Machine. The result of research showed natural matrix lac can be modified by reaction with citric acid. FTIR spectra showed without and with modification had functional groups wide absorption 3448 cm-1 group -OH, C=O ester strong on 1712 cm-1 and the methylene group -CH2 on absorption 1465 cm-1. The mechanical properties showed tensile strength 0,55 MPa and elongation at break of 0,95 %. So that composite films natural matrix lac can be made with reinforcement bagasse for material application.

Evaluating the Outcomes of a School Based Theraplay® Project for Looked after Children

ERIC Educational Resources Information Center

Francis, Yvonne J.; Bennion, Kim; Humrich, Sarah

2017-01-01

Research shows that Looked After Children (LAC) may experience emotional instability which can reduce their capacity to engage with education. This study evaluates an attachment based therapeutic Theraplay® intervention designed to bridge the gap between the emotional well-being of LAC and their engagement in education. Twenty LAC between the ages…

Overexpression of a novel thermostable and chloride-tolerant laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and its application in synthetic dye decolorization.

PubMed

Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

2015-01-01

Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.

Overexpression of a Novel Thermostable and Chloride-Tolerant Laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and Its Application in Synthetic Dye Decolorization

PubMed Central

Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

2015-01-01

Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0–11.0 and thermostable at 40°C–90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters. PMID:25790466

Degradation of dyes using crude extract and a thermostable and pH-stable laccase isolated from Pleurotus nebrodensis.

PubMed

Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun

2016-08-01

Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC-MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. © 2016 The Author(s).

Aflatoxin B1 and M1 Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators

PubMed Central

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C.; Quintieri, Laura; Cimmarusti, Maria T.; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F.; Sanjust, Enrico; Mulè, Giuseppina

2016-01-01

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B1 (AFB1) and M1 (AFM1). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB1 degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2′-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB1 was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM1 was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB1 and, for the first time, AFM1, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB1 and AFM1. PMID:27563923

Degradation of dyes using crude extract and a thermostable and pH-stable laccase isolated from Pleurotus nebrodensis

PubMed Central

Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun

2016-01-01

Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC–MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. PMID:27354563

The third catalog of active galactic nuclei detected by the Fermi large area telescope

DOE PAGES

Ackermann, M.; Ajello, M.; Atwood, W. B.; ...

2015-08-25

We present the third catalog of active galactic nuclei (AGNs) detected by the Fermi-LAT (3LAC). It is based on the third Fermi-LAT catalog (3FGL) of sources detected between 100 MeV and 300 GeV with a Test Statistic greater than 25, between 2008 August 4 and 2012 July 31. The 3LAC includes 1591 AGNs located at high Galactic latitudes (more » $$| b| \\gt 10^\\circ $$), a 71% increase over the second catalog based on 2 years of data. There are 28 duplicate associations, thus 1563 of the 2192 high-latitude gamma-ray sources of the 3FGL catalog are AGNs. Most of them (98%) are blazars. About half of the newly detected blazars are of unknown type, i.e., they lack spectroscopic information of sufficient quality to determine the strength of their emission lines. Based on their gamma-ray spectral properties, these sources are evenly split between flat-spectrum radio quasars (FSRQs) and BL Lacs. The most abundant detected BL Lacs are of the high-synchrotron-peaked (HSP) type. There were about 50% of the BL Lacs that had no measured redshifts. A few new rare outliers (HSP-FSRQs and high-luminosity HSP BL Lacs) are reported. The general properties of the 3LAC sample confirm previous findings from earlier catalogs. The fraction of 3LAC blazars in the total population of blazars listed in BZCAT remains non-negligible even at the faint ends of the BZCAT-blazar radio, optical, and X-ray flux distributions, which hints that even the faintest known blazars could eventually shine in gamma-rays at LAT-detection levels. Furthermore, the energy-flux distributions of the different blazar populations are in good agreement with extrapolation from earlier catalogs.« less

New approaches to cervical cancer screening in Latin America and the Caribbean.

PubMed

Herrero, Rolando; Ferreccio, Catterina; Salmerón, Jorge; Almonte, Maribel; Sánchez, Gloria Ines; Lazcano-Ponce, Eduardo; Jerónimo, José

2008-08-19

Cervical cancer remains an important public health problem in the Latin America and Caribbean region (LAC), with an expected significant increase in disease burden in the next decades as a result of population ageing. Prophylactic human papillomavirus (HPV) vaccine is currently unaffordable in LAC countries. However, even if vaccination was implemented, an additional two decades will be required to observe its impact on HPV related disease and cancer. With some exceptions, cytology-based screening programs have been largely ineffective to control the problem in the region, and there is a need for new approaches to the organization of screening and for use of newly developed techniques. Several research groups in LAC have conducted research on new screening methods, some of which are summarized in this paper. A recommendation to reorganize screening programs is presented considering visual inspection for very low resource areas, improvement of cytology where it is operating successfully and HPV DNA testing followed by visual inspection with acetic acid (VIA) or cytology as soon as this method becomes technically and economically sustainable. This could be facilitated by the incorporation of new, low-cost HPV DNA testing methods and the use of self-collected vaginal specimens for selected groups of the population. An important requisite for screening based on HPV testing will be the quality assurance of the laboratory and the technique by validation and certification measures.

Randomized clinical trial of robot-assisted versus standard laparoscopic right colectomy.

PubMed

Park, J S; Choi, G-S; Park, S Y; Kim, H J; Ryuk, J P

2012-09-01

Robotic surgery was invented to overcome the demerits of laparoscopic technique. However, it is unclear whether robot-assisted colectomy (RAC) has significant clinical advantages over laparoscopically assisted colectomy (LAC) in treating colonic cancer. The aim of this study was to compare the surgical outcomes of RAC versus LAC for right-sided colonic cancer. Patients with right-sided colonic cancer were randomized to receive RAC or LAC. The primary outcome measure was length of hospital stay. Secondary outcomes were duration of operation, morbidity, postoperative pain, hospital costs and pathological quality of the specimen. Of 71 patients randomized, 70 (35 in each group) were included in the analysis. Hospital stay, surgical complications, postoperative pain score, resection margin clearance and number of lymph nodes harvested were similar in both groups. The duration of surgery was longer in the RAC group (195 versus 130 min; P < 0·001). No conversion to open surgery was needed in either group. Overall hospital costs were significantly higher for RAC (US $ 12,235 versus $ 10,320; P = 0·013); the higher costs were attributed primarily to the costs of surgery, including consumables. Robotic-assisted laparoscopic right colectomy was feasible but provided no benefit to justify the greater cost. NCT01042743 (http://www.clinicaltrials.gov). Copyright © 2012 British Journal of Surgery Society Ltd. Published by John Wiley & Sons, Ltd.

The intraday variability in the radio-selected and X-ray-selected BL Lacertae objects

NASA Astrophysics Data System (ADS)

Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.

1998-10-01

Seven BL Lac objects have been photometrically observed in an effort to study the difference of optical intraday variability between the radio-selected BL Lac objects (RBLs) and X-ray-selected BL Lac objects (XBLs). The objects we observed are selected arbitrarily. They are four RBLs, PKS 0735+178, PKS 0754+101, OJ 287 and BL Lac, and three XBLs, H 0323+022, H 0548-322 and H 2154-304. During the observation all of them exhibited microvariation, and H 0323+022 and H 0548-322 sometimes showed brightness oscillation. PKS 0735+178 and BL Lac were in their faint states and not very active. It seems that RBLs do not show microvariability more frequently than XBLs. Table 2 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5)

LAC indicators: an evaluation of progress and list of proposed indicators

Treesearch

Alan E. Watson; David N. Cole

1992-01-01

One of the most critical, and difficult, steps in the Limits of Acceptable Change (LAC) process is the selection of indicators. To help with this step, this paper (I) briefly reviews some desirable characteristics of indicators and (2) lists indicators that have been proposed or adopted in LAC plans. From a comparison of this list of indicators and desirable...

Historical development of limits of acceptable change: conceptual clarifications and possible extensions

Treesearch

David N. Cole; George H. Stankey

1997-01-01

The Limits of Acceptable Change (LAC) process was developed to deal with the issue of recreational carrying capacity. For that purpose, the LAC process sought to explicitly define a compromise between resource/visitor experience protection and recreation use goals. The most critical and unique element of the process is the specification of LAC standards that define...

An Actor-Network Theory Reading of Change for Children in Public Care

ERIC Educational Resources Information Center

Parker, Elisabeth

2017-01-01

The education of children in public, or Local Authority (LA), care, known in the United Kingdom (UK) as looked-after children (LAC), is supported by government initiatives to reduce the attainment gap that exists between LAC and their non-LAC peers. These children often find remaining in education a challenge, are twice as likely to be permanently…

Lac Télé structure, Republic of Congo: Geological setting of a cryptozoological and biodiversity hotspot, and evidence against an impact origin

NASA Astrophysics Data System (ADS)

Master, Sharad

2010-11-01

Lac Télé is a large lake, ˜5.6 km in diameter, with an ovoid shape, situated at 17°10'E, 1°20'N, in the great tropical rain forest region of the Republic of Congo. This lake has attracted widespread attention, mainly because of the legends among the local people that it harbours a strange animal known as the Mokele-Mbembe, but also because it is situated in a region that is a hotbed of biodiversity and conservation efforts with respect to various endangered mammalian species, including gorillas and chimpanzees. Because of its appearance, Lac Télé has been regarded as a possible meteorite impact structure. Various expeditions, studying cryptozoology, conservation ecology, biodiversity, and the impact hypothesis, have visited Lac Télé in the past several decades. The Lac Télé structure is located in the NW part of the intracratonic Congo Basin, in a region dominated by Holocene alluvium, dense tropical rain forest, and swamps which form part of the basin of the Likouala aux Herbes, a multi-branched meandering river flowing over very low gradients into the Sangha river, a major tributary of the Congo river. Previous bathymetric studies have shown that the average depth of Lac Télé is only 4 m, including organic-rich silty sediments. The structure is that of a flat-bottomed dish. Modelling of the Lac Télé as an impact structure indicates a number of features which ought to be present. The absence of any of these features, coupled with the irregular ovoid shape, the palynological record, and the location of the structure at the intersection of major regional lineaments, is regarded as evidence against the impact hypothesis. Lac Télé as an isolated lake ecosystem is not unique in the Congo Basin, and there are several other similar small shallow isolated lakes surrounded by rain forest and marshes, some of which formed by damming of drainage systems by neotectonic faults. It is suggested that the formation of Lac Télé may be related to its location over neotectonically reactivated regional lineaments, which are also seismically active. Lac Télé and other similar hydrologic systems may be biodiversity hotspots because they acted as refugia following neotectonic hydrological re-organization of the Congo Basin.

The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

PubMed Central

Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

2008-01-01

Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

PubMed

Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

1998-03-01

Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

The antiretrovirus drug 3'-azido-3'-deoxythymidine increases the retrovirus mutation rate.

PubMed Central

Julias, J G; Kim, T; Arnold, G; Pathak, V K

1997-01-01

It was previously observed that the nucleoside analog 5-azacytidine increased the spleen necrosis virus (SNV) mutation rate 13-fold in one cycle of retrovirus replication (V. K. Pathak and H. M. Temin, J. Virol. 66:3093-3100, 1992). Based on this observation, we hypothesized that nucleoside analogs used as antiviral drugs may also increase retrovirus mutation rates. We sought to determine if 3'-azido-3'-deoxythymidine (AZT), the primary treatment for human immunodeficiency virus type 1 (HIV-1) infection, increases the retrovirus mutation rate. Two assays were used to determine the effects of AZT on retrovirus mutation rates. The strategy of the first assay involved measuring the in vivo rate of inactivation of the lacZ gene in one replication cycle of SNV- and murine leukemia virus-based retroviral vectors. We observed 7- and 10-fold increases in the SNV mutant frequency following treatment of target cells with 0.1 and 0.5 microM AZT, respectively. The murine leukemia virus mutant frequency increased two- and threefold following treatment of target cells with 0.5 and 1.0 microM AZT, respectively. The second assay used an SNV-based shuttle vector containing the lacZ alpha gene. Proviruses were recovered as plasmids in Escherichia coli, and the rate of inactivation of lacZ alpha was measured. The results indicated that treatment of target cells increased the overall mutation rate two- to threefold. DNA sequence analysis of mutant proviruses indicated that AZT increased both the deletion and substitution rates. These results suggest that AZT treatment of HIV-1 infection may increase the degree of viral variation and alter virus evolution or pathogenesis. PMID:9151812

PbrmiR397a regulates lignification during stone cell development in pear fruit.

PubMed

Xue, Cheng; Yao, Jia-Long; Qin, Meng-Fan; Zhang, Ming-Yue; Allan, Andrew C; Wang, De-Fu; Wu, Jun

2018-05-13

Lignified stone cells substantially reduce fruit quality. Therefore, it is desirable to inhibit stone cell development by using genetic technologies. However, the molecular mechanisms regulating lignification are poorly understood in fruit stone cells. In this study, we have shown that microRNA (miR) miR397a regulates fruit cell lignification by inhibiting laccase (LAC) genes that encode key lignin biosynthesis enzymes. Transient overexpression of PbrmiR397a, which is the miR397a of Chinese pear (Pyrus bretschneideri), and simultaneous silencing of three LAC genes reduced the lignin content and stone cell number in pear fruit. A single nucleotide polymorphism (SNP) identified in the promoter of the PbrmiR397a gene was found to associate with low levels of fruit lignin, after analysis of the genome sequences of sixty pear varieties. This SNP created a TCA-element that responded to salicylic acid (SA) to induce gene expression as confirmed using a cell-based assay system. Furthermore, stable overexpression of PbrmiR397a in transgenic tobacco plants reduced the expression of target LAC genes and decreased the content of lignin but did not change the ratio of syringyl and guaiacyl lignin monomers. Consistent with reduction of lignin content, the transgenic plants showed fewer numbers of vessel elements and thinner secondary walls in the remaining elements compared to wild-type control plants. This study has advanced our understanding of the regulation of lignin biosynthesis and provided useful molecular genetic information for improving pear fruit quality. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Formation of Archean batholith-hosted gold veins at the Lac Herbin deposit, Val-d'Or district, Canada: Mineralogical and fluid inclusion constraints

NASA Astrophysics Data System (ADS)

Rezeau, Hervé; Moritz, Robert; Beaudoin, Georges

2017-03-01

The Lac Herbin deposit consists of a network of mineralized, parallel steep-reverse faults within the synvolcanic Bourlamaque granodiorite batholith at Val-d'Or in the Archean Abitibi greenstone belt. There are two related quartz-tourmaline-carbonate fault-fill vein sets in the faults, which consist of subvertical fault-fill veins associated with subhorizontal veins. The paragenetic sequence is characterized by a main vein filling ore stage including quartz, tourmaline, carbonate, and pyrite-hosted gold, chalcopyrite, tellurides, pyrrhotite, and cubanite inclusions. Most of the gold is located in fractures in deformed pyrite and quartz in equilibrium with chalcopyrite and carbonates, with local pyrrhotite, sphalerite, galena, cobaltite, pyrite, or tellurides. Petrography and microthermometry on quartz from the main vein filling ore stage reveal the presence of three unrelated fluid inclusion types: (1) gold-bearing aqueous-carbonic inclusions arranged in three-dimensional intragranular clusters in quartz crystals responsible for the main vein filling stage, (2) barren high-temperature, aqueous, moderately saline inclusions observed in healed fractures, postdating the aqueous-carbonic inclusions, and considered as a remobilizing agent of earlier precipitated gold in late fractures, and (3) barren low-temperature, aqueous, high saline inclusions in healed fractures, similar to the crustal brines reported throughout the Canadian Shield and considered to be unrelated to the gold mineralization. At the Lac Herbin deposit, the aqueous-carbonic inclusions are interpreted to have formed first and to represent the gold-bearing fluid, which were generated contemporaneous with regional greenschist facies metamorphism. In contrast, the high-temperature aqueous fluid dissolved gold from the main vein filling ore stage transported and reprecipitated it in late fractures during a subsequent local thermal event.

Cigarette smoke induces the expression of Notch3, not Notch1, protein in lung adenocarcinoma.

PubMed

Cheng, Zhenshun; Tan, Qiuyue; Tan, Weijun; Zhang, L I

2015-08-01

The aim of the present study was to determine the effect of cigarette smoke on the expression of Notch proteins in lung adenocarcinoma (LAC). Protein expression levels of Notch1 and Notch3 were analyzed using immunohistochemistry in 102 human LAC specimens. Of these, 52 were obtained from smokers and 50 from non-smokers. In addition, cigarette smoke extract (CSE) at varying concentrations (1, 2.5 and 5%) was administered to A549 cells. The expression of Notch1 and Notch3 protein was then detected by western blot analysis at different time points (0, 8, 24 and 48 h). Of the 102 LAC specimens, 42 (41.2%) were positive for Notch1 and 63 (61.8%) were positive for Notch3. There was no significant difference in the level of Notch1 expression between smokers and non-smokers with LAC (P>0.05). The positive rate and staining intensity of Notch3 expression were increased in the smokers compared with the non-smokers (P<0.05). The expression of Notch3 protein in A549 cells increased in a time- and dose-dependent manner following treatment with CSE, whilst the expression of Notch1 protein appeared stable. The results suggested that cigarette smoke was able to induce the expression of Notch3, not Notch1, protein in LAC. The data revealed an upregulation of Notch3 in LAC following cigarette smoke exposure. Such findings may provide a novel therapeutic target for the treatment of LAC.

Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.

PubMed

Repetto, B; Tzagoloff, A

1989-06-01

Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several putative activation sites with sequences matching the core element proposed to be essential for binding of the HAP2 and HAP3 regulatory proteins.

Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.

PubMed Central

Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C

1990-01-01

Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625

Control of transcription of the Bacillus subtilis spoIIIG gene, which codes for the forespore-specific transcription factor sigma G.

PubMed

Sun, D X; Cabrera-Martinez, R M; Setlow, P

1991-05-01

The Bacillus subtilis spoIIIG gene codes for a sigma factor termed sigma G which directs transcription of genes expressed only in the forespore compartment of the sporulating cell. Use of spoIIIG-lacZ transcriptional fusions showed that spoIIIG is cotranscribed with the spoIIG operon beginning at t0.5-1 of sporulation. However, this large mRNA produced little if any sigma G, and transferring the spoIIIG gene without the spoIIG promoter into the amyE locus resulted in a Spo+ phenotype. Significant translation of spoIIIG began at t2.5-3 with use of an mRNA whose 5' end is just upstream of the spoIIIG coding sequence. Synthesis of this spoIIIG-specific mRNA was not abolished by a deletion in spoIIIG itself. Similar results were obtained when a spoIIIG-lacZ translational fusion lacking the spoIIG promoter was integrated at the amyE locus. These data suggest that synthesis of sigma G is dependent neither on transcription from the spoIIG promoter nor on sigma G itself but can be due to another transcription factor. This transcription factor may be sigma F, the product of the spoIIAC locus, since a spoIIAC mutation blocked spoIIIG expression, and sequences upstream of the 5' end of the spoIIIG-specific mRNA agree well with the recognition sequence for sigma F. RNA polymerase containing sigma F (E sigma F) initiated transcription in vitro on a spoIIIG template at the 5' end found in vivo, as did E sigma G. However, E sigma F showed a greater than 20-fold preference for spoIIIG over a known sigma G-dependent gene compared with the activity of E sigma G.

40 CFR 272.951 - Louisiana State-administered program: Final authorization.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., 1997. Copies of the document can be obtained from EPA Region 6, 1445 Ross Avenue, Dallas, Texas 75202... November 20, 1988 LR 18:1375 December 20, 1992. LAC § 303.K.1 (previously LHWR § 3.2(k)(1)) July 20, 1984 LR 14:790 November 20, 1988. LAC § 901 (LHWR § 6.1) March 20, 1984 LR 20:1000 September 20, 1994. LAC...

Two modes of control of pilA, the gene encoding type 1 pilin in Escherichia coli.

PubMed Central

Orndorff, P E; Spears, P A; Schauer, D; Falkow, S

1985-01-01

Type 1 piliation in Escherichia coli is subject to metastable regulation at the transcriptional level (B. I. Eisenstein, Science 214:337-339, 1981). However, the genes controlling in this fashion are not known. We present evidence that the pilA gene, encoding the structural subunit of type 1 pili, is subject to metastable transcriptional regulation. A pilA'-lacZ fusion, constructed in vitro on a recombinant plasmid, was used in conjunction with a recBC sbcB mutant of E. coli K-12 to introduce the fusion into the chromosomal region encoding Pil. This fusion was found to be subject to metastable transcriptional control. The rate of switching from the Lac+ to the Lac- phenotype was 4 X 10(-4) per cell per generation and 6.2 X 10(-4) in the opposite direction. A ca. 10-fold difference in beta-galactosidase activity was observed between phenotypically "ON" (Lac+) and "OFF" (Lac-) populations. P1 transduction experiments showed that the element determining the ON or OFF phenotype was tightly linked to pilA. In addition to the metastable regulation of pilA, a second type of transcriptional regulation was effected by the product of a gene, hyp, adjacent to pilA. By using a recombinant plasmid containing just a pilA'-lacZ fusion and the putative pilA promoter, we found that a lesion in hyp conferred a beta-galactosidase activity about fivefold higher than that of a strain possessing the parental hyp gene. Mutants constructed to have a pilA'-lacZ fusion and a hyp::Tn5-132 mutation in the chromosome exhibited a frequency of switching from Lac+ to Lac- and vice versa indistinguishable from that of the parental strain. However, in the ON mode, hyp::Tn5-132 mutants showed a twofold-higher beta-galactosidase activity. Thus, hyp does not appear to affect metastable variation but does affect the level of transcription of the pilA gene in the ON (transcribed) mode. Images PMID:3930469

Conscious Sedation Versus General Anesthesia in Transcatheter Aortic Valve Replacement: The German Aortic Valve Registry.

PubMed

Husser, Oliver; Fujita, Buntaro; Hengstenberg, Christian; Frerker, Christian; Beckmann, Andreas; Möllmann, Helge; Walther, Thomas; Bekeredjian, Raffi; Böhm, Michael; Pellegrini, Costanza; Bleiziffer, Sabine; Lange, Rüdiger; Mohr, Friedrich; Hamm, Christian W; Bauer, Timm; Ensminger, Stephan

2018-03-26

The aims of this study were to report on the use of local anesthesia or conscious sedation (LACS) and general anesthesia in transcatheter aortic valve replacement and to analyze the impact on outcome. Transcatheter aortic valve replacement can be performed in LACS or general anesthesia. Potential benefits of LACS, such as faster procedures and shorter hospital stays, need to be balanced with safety. A total of 16,543 patients from the German Aortic Valve Registry from 2011 to 2014 were analyzed, and propensity-matched analyses were performed to correct for potential selection bias. LACS was used in 49% of patients (8,121 of 16,543). In hospital, LACS was associated with lower rates of low-output syndrome, respiratory failure, delirium, cardiopulmonary resuscitation, and death. There was no difference in paravalvular leakage (II+) between LACS and general anesthesia in the entire population (5% vs. 4.8%; p = 0.76) or in the matched population (3.9% vs. 4.9%, p = 0.13). The risk for prolonged intensive care unit stay (≥3 days) was significantly reduced with LACS (odds ratio: 0.82; 95% confidence interval [CI]: 0.73 to 0.92; p = 0.001). Thirty-day mortality was lower with LACS in the entire population (3.5% vs. 4.9%; hazard ratio [HR]: 0.72; 95% CI: 0.60 to 0.86; p < 0.001) and in the matched population (2.8% vs. 4.6%; HR: 0.6; 95% CI: 0.45 to 0.8; p < 0.001). However, no differences in 1-year mortality between both groups in the entire population (16.5% vs. 16.9%; HR: 0.93; 95% CI: 0.85 to 1.02; p = 0.140) and in the propensity-matched population (14.1% vs. 15.5%; HR: 0.90; 95% CI: 0.78 to 1.03; p = 0.130) were observed. Use of LACS in transcatheter aortic valve replacement is safe, with fewer post-procedural complications and lower early mortality, suggesting its broad application. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Validation of the LacTek test applied to spiked extracts of tissue samples: determination of performance characteristics.

PubMed

Mitchell, J M; Yee, A J; McNab, W B; Griffiths, M W; McEwen, S A

1999-01-01

LacTek tests are competitive enzyme-linked immunosorbent assays intended for rapid detection of antimicrobial residues in bovine milk. In this study, the LacTek test protocol was modified for use with extracts of bovine tissue to detect beta-lactam, tetracycline, and sulfamethazine residues. Test performance characteristics--precision, accuracy, ruggedness, practicability, and analytical specificity and sensitivity--were investigated. Results suggest that LacTek tests can be easily adapted to detect antimicrobial residues in extracts of lean ground beef. However, positive samples may not contain residues at violative concentrations (i.e., Canadian maximum residue limits), and therefore, additional analysis would be required for final confirmation and quantitation (e.g., chromatography).

High density growth of T7 expression strains with auto-induction option

DOEpatents

Studier, F. William

2010-07-20

A bacterial growth medium for promoting auto-induction of transcription of cloned DNA in cultures of bacterial cells grown batchwise is disclosed. The transcription is under the control of a lac repressor. Also disclosed is a bacterial growth medium for improving the production of a selenomethionine-containing protein or polypeptide in a bacterial cell, the protein or polypeptide being produced by recombinant DNA techniques from a lac or T7lac promoter, the bacterial cell encoding a vitamin B12-dependent homocysteine methylase. Finally, disclosed is a bacterial growth medium for suppressing auto-induction of expression in cultures of bacterial cells grown batchwise, said transcription being under the control of lac repressor.

Galactose transport in Kluyveromyces lactis: major role of the glucose permease Hgt1.

PubMed

Baruffini, Enrico; Goffrini, Paola; Donnini, Claudia; Lodi, Tiziana

2006-12-01

In Kluyveromyces lactis, galactose transport has been thought to be mediated by the lactose permease encoded by LAC12. In fact, a lac12 mutant unable to grow on lactose did not grow on galactose either and showed low and uninducible galactose uptake activity. The existence of other galactose transport systems, at low and at high affinity, had, however, been hypothesized on the basis of galactose uptake kinetics studies. Here we confirmed the existence of a second galactose transporter and we isolated its structural gene. It turned out to be HGT1, previously identified as encoding the high-affinity glucose carrier. Analysis of galactose transporter mutants, hgt1 and lac12, and the double mutant hgt1lac12, suggested that Hgt1 was the high-affinity and Lac12 was the low-affinity galactose transporter. HGT1 expression was strongly induced by galactose and insensitive to glucose repression. This could explain the rapid adaptation to galactose observed in K. lactis after a shift from glucose to galactose medium.

Evidence for an intermediate conformational state of LacY.

PubMed

Jiang, Xiaoxu; Guan, Lan; Zhou, Yonggang; Hong, Wen-Xu; Zhang, Qinghai; Kaback, H Ronald

2012-03-20

LacY mutant Cys154 → Gly exhibits a periplasmic-closed crystal structure identical to the WT, but is periplasmic-open in the membrane. The mutant hardly catalyzes transport, but binds galactosides from either side of the membrane with the same affinity and is resistant to site-directed proteolysis relative to the pseudo-WT. Site-directed alkylation was also applied to 11 single-Cys mutants in Cys154 → Gly LacY in right-side-out membrane vesicles or after solubilization and purification in dodecyl-β-D-maltopyranoside (DDM). Unlike the pseudo-WT, Cys replacements on the periplasmic side of the Cys154 → Gly mutant label rapidly in the membrane without sugar, but labeling decreases markedly after the mutant proteins are purified. Thus, Cys154 → Gly LacY likely favors a higher-energy intermediate periplasmic-open conformation in situ, but collapses to a lower-energy periplasmic-closed conformation in DDM after purification. Notably, branched-chain or neopentyl glycol maltoside detergents stabilize Cys154 → Gly LacY in the membrane-embedded form.

Are some BL Lacs artefacts of gravitational lensing?

PubMed

Ostriker, J P; Vietri, M

1990-03-01

WE suggested in 1985 that a significant fraction of BL Lacertae objects, a kind of lineless quasar, seen in nearby galaxies are in fact images, gravitationally lensed and substantially amplified by stars in the nearby galaxy, of background objects, optically violent variable (OVV) quasars at redshifts z > 1 (ref. 1). This hypothesis was made on the basis of certain general similarities between BL Lacs and O Ws, but for two recently observed BL Lacs(2,3) a strong case can be made that the accompanying elliptical galaxy is a foreground object. In addition, we argue that the distribution of BL Lac redshifts is hard to understand without gravitational lensing, unless we happen to be at a very local maximum of the spatial cosmic distribution of BL Lacs. Our analysis also indicates that the galaxies whose stars are likely to act as microlenses will be found in two peaks, one nearby, with redshift 0.05-0.10, and the other near the distant quasar.

Plasmids encoding therapeutic agents

DOEpatents

Keener, William K [Idaho Falls, ID

2007-08-07

Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

Are some BL Lac objects artefacts of gravitational lensing?

NASA Technical Reports Server (NTRS)

Ostriker, J. P.; Vietri, M.

1985-01-01

It is proposed here that a significant fraction of BL Lac objects are optically violently variable quasars whose continuum emission has been greatly amplified, relative to the line emission, by pointlike gravitational lenses in intervening galaxies. Several anomalous physical and statistical properties of BL Lacs can be understood on the basis of this model, which is immediately testable on the basis of absorption line studies and by direct imaging.

Effect of surfactants on the interaction of phenol with laccase: Molecular docking and molecular dynamics simulation studies.

PubMed

Liu, Yujie; Liu, Zhifeng; Zeng, Guangming; Chen, Ming; Jiang, Yilin; Shao, Binbin; Li, Zhigang; Liu, Yang

2018-05-22

Some surfactants can enhance the removal of phenol by laccase (Lac) in various industrial effluents. Their behavior and function in the biodegradation of phenolic wastewater have been experimentally reported by many researchers, but the underlying molecular mechanism is still unclear. Therefore, the interaction mechanisms of phenol with Lac from Trametes versicolor were investigated in the presence or absence of Triton X-100 (TX100) or rhamnolipid (RL) by molecular docking and molecular dynamics (MD) simulations. The results indicate that phenol contacts with an active site of Lac by hydrogen bonds (HBs) and van der Waals (vdW) interactions in aqueous solution for maintaining its stability. The presence of TX100 or RL results in the significant changes of enzymatic conformations. Meanwhile, the hydrophobic parts of surfactants contact with the outside surface of Lac. These changes lead to the decrease of binding energy between phenol and Lac. The migration behavior of water molecules within hydration shell is also inevitably affected. Therefore, the amphipathic TX100 or RL may influence the phenol degradation ability of Lac by modulating their interactions and water environment. This study offers molecular level of understanding on the function of surfactants in biosystem. Copyright © 2018 Elsevier B.V. All rights reserved.

Enhanced delignification of steam-pretreated poplar by a bacterial laccase

DOE PAGES

Singh, Rahul; Hu, Jinguang; Regner, Matthew R.; ...

2017-02-07

The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less

Involvement of glycosphingolipid-enriched lipid rafts in inflammatory responses.

PubMed

Iwabuchi, Kazuhisa

2015-01-01

Glycosphingolipids (GSLs) are membrane components consisting of hydrophobic ceramide and hydrophilic sugar moieties. GSLs cluster with cholesterol in cell membranes to form GSL-enriched lipid rafts. Biochemical analyses have demonstrated that GSL-enriched lipid rafts contain several kinds of transducer molecules, including Src family kinases. Among the GSLs, lactosylceramide (LacCer, CDw17) can bind to various microorganisms, is highly expressed on the plasma membranes of human phagocytes, and forms lipid rafts containing the Src family tyrosine kinase Lyn. LacCer-enriched lipid rafts mediate immunological and inflammatory reactions, including superoxide generation, chemotaxis, and non-opsonic phagocytosis. Therefore, LacCer-enriched membrane microdomains are thought to function as pattern recognition receptors (PRRs), which recognize pathogen-associated molecular patterns (PAMPs) expressed on microorganisms. LacCer also serves as a signal transduction molecule for functions mediated by CD11b/CD18-integrin (αM/β2-integrin, CR3, Mac-1), as well as being associated with several key cellular processes. LacCer recruits PCKα/ε and phospholipase A2 to stimulate PECAM-1 expression in human monocytes and their adhesion to endothelial cells, as well as regulating β1-integrin clustering and endocytosis on cell surfaces. This review describes the organizational and inflammation-related functions of LacCer-enriched lipid rafts.

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

PubMed

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Enhanced delignification of steam-pretreated poplar by a bacterial laccase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Rahul; Hu, Jinguang; Regner, Matthew R.

The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less

Coarse-grained Simulations of Sugar Transport and Conformational Changes of Lactose Permease

NASA Astrophysics Data System (ADS)

Liu, Jin; Jewel, S. M. Yead; Dutta, Prashanta

2016-11-01

Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves sugar translocation, H+ transfer, as well as large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear due to the complexity and multiscale nature of the process. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the transport of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule across a wild-type LacY during lactose/H+ symport process. Results show that the local interactions between TDG and LacY at the binding pocket are consistent with the X-ray experiment. Protonation of Glu325 stabilizes the TDG and inward-facing conformation of LacY. Protonation of Glu269 induces a dramatic protein structural reorganization and causes the expulsion of TDG from LacY to both sides of the membrane. The structural changes occur primarily in the N-terminal domain of LacY. This work is supported by NSF Grants: CBET-1250107 and CBET -1604211.

Laccase-13 Regulates Seed Setting Rate by Affecting Hydrogen Peroxide Dynamics and Mitochondrial Integrity in Rice.

PubMed

Yu, Yang; Li, Quan-Feng; Zhang, Jin-Ping; Zhang, Fan; Zhou, Yan-Fei; Feng, Yan-Zhao; Chen, Yue-Qin; Zhang, Yu-Chan

2017-01-01

Seed setting rate is one of the most important components of rice grain yield. To date, only several genes regulating setting rate have been identified in plant. In this study, we showed that laccase-13 ( OsLAC13 ), a member of laccase family genes which are known for their roles in modulating phenylpropanoid pathway and secondary lignification in cell wall, exerts a regulatory function in rice seed setting rate. OsLAC13 expressed in anthers and promotes hydrogen peroxide production both in vitro and in the filaments and anther connectives. Knock-out of OsLAC13 showed significantly increased seed setting rate, while overexpression of this gene exhibited induced mitochondrial damage and suppressed sugar transportation in anthers, which in turn affected seed setting rate. OsLAC13 also induced H 2 O 2 production and mitochondrial damage in the root tip cells which caused the lethal phenotype. We also showed that high abundant of OsmiR397, the suppressor of OsLAC13 mRNA, increased the seed setting rate of rice plants, and restrains H 2 O 2 accumulation in roots during oxidative stress. Our results suggested a novel regulatory role of OsLAC13 gene in regulating seed setting rate by affecting H 2 O 2 dynamics and mitochondrial integrity in rice.

An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp1[OPEN

PubMed Central

Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi

2015-01-01

In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

Two Gene Clusters Coordinate Galactose and Lactose Metabolism in Streptococcus gordonii

PubMed Central

Zeng, Lin; Martino, Nicole C.

2012-01-01

Streptococcus gordonii is an early colonizer of the human oral cavity and an abundant constituent of oral biofilms. Two tandemly arranged gene clusters, designated lac and gal, were identified in the S. gordonii DL1 genome, which encode genes of the tagatose pathway (lacABCD) and sugar phosphotransferase system (PTS) enzyme II permeases. Genes encoding a predicted phospho-β-galactosidase (LacG), a DeoR family transcriptional regulator (LacR), and a transcriptional antiterminator (LacT) were also present in the clusters. Growth and PTS assays supported that the permease designated EIILac transports lactose and galactose, whereas EIIGal transports galactose. The expression of the gene for EIIGal was markedly upregulated in cells growing on galactose. Using promoter-cat fusions, a role for LacR in the regulation of the expressions of both gene clusters was demonstrated, and the gal cluster was also shown to be sensitive to repression by CcpA. The deletion of lacT caused an inability to grow on lactose, apparently because of its role in the regulation of the expression of the genes for EIILac, but had little effect on galactose utilization. S. gordonii maintained a selective advantage over Streptococcus mutans in a mixed-species competition assay, associated with its possession of a high-affinity galactose PTS, although S. mutans could persist better at low pHs. Collectively, these results support the concept that the galactose and lactose systems of S. gordonii are subject to complex regulation and that a high-affinity galactose PTS may be advantageous when S. gordonii is competing against the caries pathogen S. mutans in oral biofilms. PMID:22660715

Volatile compounds of Celta dry-cured 'lacón' as affected by cross-breeding with Duroc and Landrace genotypes.

PubMed

Lorenzo, José M; Fonseca, Sonia

2014-11-01

Dry-cured 'lacón' is a traditional cured meat product made in the north-west of Spain from the pigs' foreleg, with similar manufacturing process to that used in dry-cured ham. The aim of this study was to assess the influence of cross-breeding of Celta pig with Landrace or Duroc breeds on the formation of volatile compounds through the manufacture of 'lacón'. 'Lacón' from the crosses with Duroc presented lower final moisture (534 g kg(-1) ) and higher intra-muscular fat content [144 g kg(-1) dry matter (DM)] than 'lacón' from Celta pure breed (587 g kg(-1) and 36 g kg(-1) DM, respectively). Volatile compounds were extracted by solid-phase microextraction and analysed by gas chromatography-mass spectrometry. Volatile compounds from 'lacón' were affected by cross-breeding. The total amount of volatile compounds significantly (P < 0.001) increased during the manufacturing process, this increase being more marked in samples from the Landrace cross-breed. The most abundant group of flavour compounds at the end of the manufacturing process was esters in the three batches, followed by aldehydes, hydrocarbons and alcohols. The most abundant ester at the end of the process was hexanoic acid methyl ester, while the aldehyde found in a higher amount was hexanal. The profile of volatile compounds was affected by cross-breed, especially at the end of the 'lacón' dry-curing process. © 2014 Society of Chemical Industry.

Group II metabotropic glutamate receptor type 2 allosteric potentiators prevent sodium lactate-induced panic-like response in panic-vulnerable rats

PubMed Central

Johnson, Philip L; Fitz, Stephanie D; Engleman, Eric A; Svensson, Kjell A; Schkeryantz, Jeffrey M; Shekhar, Anantha

2015-01-01

Rats with chronic inhibition of GABA synthesis by infusion of l-allyglycine, a glutamic acid decarboxylase inhibitor, into their dorsomedial/perifornical hypothalamus are anxious and exhibit panic-like cardio-respiratory responses to treatment with intravenous (i.v.) sodium lactate (NaLac) infusions, in a manner similar to what occurs in patients with panic disorder. We previously showed that either NMDA receptor antagonists or metabotropic glutamate receptor type 2/3 receptor agonists can block such a NaLac response, suggesting that a glutamate mechanism is contributing to this panic-like state. Using this animal model of panic, we tested the efficacy of CBiPES and THIIC, which are selective group II metabotropic glutamate type 2 receptor allosteric potentiators (at 10–30mg/kg i.p.), in preventing NaLac-induced panic-like behavioral and cardiovascular responses. The positive control was alprazolam (3mg/kg i.p.), a clinically effective anti-panic benzodiazepine. As predicted, panic-prone rats given a NaLac challenge displayed NaLac-induced panic-like cardiovascular (i.e. tachycardia and hypertensive) responses and “anxiety” (i.e. decreased social interaction time) and “flight” (i.e. increased locomotion) -associated behaviors; however, systemic injection of the panic-prone rats with CBiPES, THIIC or alprazolam prior to the NaLac dose blocked all NaLac-induced panic-like behaviors and cardiovascular responses. These data suggested that in a rat animal model, selective group II metabotropic glutamate type 2 receptor allosteric potentiators show an anti-panic efficacy similar to alprazolam. PMID:22914798

Localization of aPKC lambda/iota and its interacting protein, Lgl2, is significantly associated with lung adenocarcinoma progression.

PubMed

Imamura, Naoko; Horikoshi, Yosuke; Matsuzaki, Tomohiko; Toriumi, Kentaro; Kitatani, Kanae; Ogura, Go; Masuda, Ryota; Nakamura, Naoya; Takekoshi, Susumu; Iwazaki, Masayuki

2013-12-20

Atypical protein kinase C lambda/iota (aPKC λ/ι) is expressed in several human cancers; however, the correlation between aPKC λ/ι localization and cancer progression in human lung adenocarcinoma (LAC) remains to be clarified. We found that patients with a high level of aPKC λ/ι expression in LAC had significantly shorter overall survival than those with a low level of aPKC λ/ι expression. In addition, localization of aPKC λ/ι in the apical membrane or at the cell-cell contact was associated with both lymphatic invasion and metastasis. The intercellular adhesion molecule, E-cadherin, was decreased in LACs with highly expressed aPKC λ/ι at the invasion site of tumor cells. This result suggested that the expression levels of aPKC λ/ι and E-cadherin reflect the progression of LAC. On double-immunohistochemical analysis, aPKC λ/ι and Lgl2, a protein that interacts with aPKC λ/ι, were co-localized within LACs. Furthermore, we found that Lgl2 bound the aPKC λ/ι-Par6 complex in tumor tissue by immune-cosedimentation analysis. Apical membrane localization of Lgl2 was correlated with lymphatic invasion and lymph node metastasis. These results thus indicate that aPKC λ/ι expression is altered upon the progression of LAC. This is also the first evidence to show aPKC λ/ι overexpression in LAC and demonstrates that aPKC λ/ι localization at the apical membrane or cell-cell contact is associated with lymphatic invasion and metastasis of the tumor.

Branched chain amino acids supplemented with L-acetylcarnitine versus BCAA treatment in hepatic coma: a randomized and controlled double blind study.

PubMed

Malaguarnera, Mariano; Risino, Corrado; Cammalleri, Lisa; Malaguarnera, Lucia; Astuto, Marinella; Vecchio, Ignazio; Rampello, Liborio

2009-07-01

Our earlier study has demonstrated that the administration of L-acetylcarnitine (LAC) improves neurological symptoms and serum parameters in hepatic coma. The aim of this work has been to evaluate the efficacy of the LAC and branched chain amino acids (BCAA) versus BCAA, administered in intravenous infusion, in patients with cirrhotic hepatic coma. Forty-eight highly selected patients were enrolled in the study and, after randomization, received blindly LAC+BCAA (n=24) versus BCAA (n=24). The two groups were similar in age, sex, pathogenesis of cirrhosis, and severity of liver disease. The comparison between values before and after LAC planned treatment showed statistical significant differences in neurological findings, evaluated by the Glasgow Scale, ammonia serum levels, blood urea nitrogen, and EEG. After 60 min of the study period, the LAC+BCAA treated patients compared with BCCA treated showed a significant decrease of ammonia serum levels: 41.20 versus 10.40 mumol P<0.05. After 1 day of the study period, the LAC+BCAA treated patients compared with BCCA treated patients showed a significant increase of Glasgow's score: 3.60 versus 1.50 score P<0.05; a significant decrease of ammonia serum levels: 63.30 versus 27.00 mumol P<0.01; a significant improvement of EEG cps/s: 2.70 versus 0.6 P<0.001. No side-effects were observed in our study series. Our study demonstrated that the administration of BCAA supplemented with LAC might improve neurological symptoms and serum ammonium levels in selected cirrhotic patients with hepatic coma.

Purification of cold-shock-like proteins from Stigmatella aurantiaca - molecular cloning and characterization of the cspA gene.

PubMed

Stamm, I; Leclerque, A; Plaga, W

1999-09-01

Prominent low-molecular-weight proteins were isolated from vegetative cells of the myxobacterium Stigmatella aurantiaca and were found to be members of the cold-shock protein family. A first gene of this family (cspA) was cloned and sequenced. It encodes a protein of 68 amino acid residues that displays up to 71% sequence identity with other bacterial cold-shock(-like) proteins. A cysteine residue within the RNP-2 motif is a peculiarity of Stigmatella CspA. A cspA::(Deltatrp-lacZ) fusion gene construct was introduced into Stigmatella by electroporation, a method that has not been used previously for this strain. Analysis of the resultant transformants revealed that cspA transcription occurs at high levels during vegetative growth at 20 and 32 degrees C, and during fruiting body formation.

Late Holocene dinosterol hydrogen isotope variability in Lac Lalolalo and Lac Lanutavake on Wallis Island

NASA Astrophysics Data System (ADS)

Maloney, A. E.; Hing, S. N.; Richey, J. N.; Nelson, D. B.; Sachs, J. P.

2017-12-01

The South Pacific Convergence Zone (SPCZ) is the Southern Hemisphere's largest precipitation feature, yet little is known about the region's rainfall prior to the instrumental record. In the tropics, hydrogen isotopes of precipitation are controlled by the "amount effect" where higher mean annual rainfall rates result in 2H-depleted rain. In turn, hydrogen isotopes in tropical lakes are influenced by both rain water isotopes and evaporative enrichment. Molecular fossils preserved in lake sediments offer a promising tool for improving our understanding of the past SPCZ by tracking changes in lake water isotopes. Hydrogen isotope compositions (δ2H) of the algal lipid biomarker dinosterol were measured in duplicate sediment cores from lakes 2.75km apart on Wallis Island. The modern lakes differ in physical and chemical conditions but are both freshwater in the photic zone and experience identical climate conditions. They are an ideal setting to investigate the fidelity to which δ2Hdinosterol records climate. Duplicate records from Lac Lanutavake are in excellent agreement and reveal little change in during the past 1700 years with minor δ2Hdinosterol fluctuations between -280‰ and -290‰. Duplicate records from Lac Lalolalo also agree extremely well during the past 2,000 years. However, contrary to its neighbor, Lac Lalolalo has a highly variable δ2Hdinosterol history with 2H-depleted values of -300‰ during the youngest part of the record climbing to 2H-enriched values of -230‰ around 1000-2000 years ago. The large shift in Lac Lalolalo δ2Hdinosterol may be due to changes in lake biogeochemistry that impact growth conditions or shifts in dinoflagellate species composition. Alternatively, if the Lac Lalolalo record actually reflects changes in hydrology, large limnological changes must have occurred in Lac Lanutavke to mute the climate signal. This work emphasizes the importance of redundancy and duplication when investigating changes in past climate using molecular tools that are also sensitive to environmental parameters.

On the possibility of real time air quality and toxicology assessment using multi-wavelength photoacoustic spectroscopy

NASA Astrophysics Data System (ADS)

Ajtai, Tibor; Pinter, Mate; Utry, Noemi; Kiss-Albert, Gergely; Palagyi, Andrea; Manczinger, Laszlo; Vagvölgyi, Csaba; Szabo, Gabor; Bozoki, Zoltan

2016-04-01

In this study we present results of field measurement campaigns focusing on the in-situ characterization of absorption spectra and the health relevance of light absorbing carbonaceous (LAC) in the ambient. The absorption spectra is measured @ 266, 355, 532 and 1064 nm by our state-of-the-art four-wavelength photoacoustic instrument, while for health relevance the eco- cito and genotoxicity parameters were measured using standardized methodologies. We experimentally demonstrated a correlation between the toxicities and the measured absorption spectra quantified by its wavelength dependency. Based on this correlation, we present novel possibilities on real-time air quality monitoring. LAC is extensively studied not only because of its considerable climate effects but as a serious air pollutant too. Gradually increasing number of studies demonstrated experimentally that the health effect of LAC is more serious than it is expected based on its share in total atmospheric aerosol mass. Furthermore during many local pollution events LAC not only has dominancy but it is close to exclusivity. Altogether due to its climate and health effects many studies and proposed regulations focus on the physical, chemical and toxicological properties of LAC as well as on its source apportionment. Despites of its importance, there is not yet a widely accepted standard methodology for the real-time and selective identification of LAC. There are many different reasons of that: starting from its complex inherent physicochemical features including many unknown constituents, via masking effect of ambient on the inherent physicochemical properties taking place even in case of a short residence, ending with the lack of reliable instrumentation for its health or source relevant parameters. Therefore, the methodology and instrument development for selective and reliable identification of LAC is timely and important issues in climate and air quality researches. Recently, many studies demonstrated correlation between the chemical compositions and the absorption features of LAC which open up novel possibilities in real time source apportionment and in air quality monitoring.

Statins: cost analysis in Indian scenario from eight major clinical trials.

PubMed

Sanmukhani, J; Shah, V

2010-01-01

Coronary heart disease (CHD) is the leading cause of death in India resulting in loss of young Indians. Statins have proved to reduce the CHD mortality in various clinical trials. The aim of the study is to find the cost-effectiveness ratio (CER) for each major coronary event averted and a coronary death avoided by use of statins in different clinical settings based on the data from the major clinical trials on statins. Using electronic database and as per our inclusion and exclusion criteria we selected the West of Scotland Coronary Prevention Study (WOSCOPS), the Air Force Coronary Atherosclerosis Prevention Study (AFCAPS) and the Anglo-Scandinavian Cardiac Outcomes Trial--Lipid Lowering Arm (ASCOT-LLA) study for primary prevention; the Cholesterol and Recurrent Events Trial (CARE), the Long-term Intervention with Pravastatin in Ischemic Disease (LIPID) Study and the Scandinavian Simvastatin Survival Study (4S) for secondary prevention and two studies, the Heart Protection Study (HPS) and the Pravastatin in elderly individuals at risk of vascular disease (PROSPER) study for high-risk patients. The results of these studies were used for cost-effectiveness analysis of statins in different patient groups. Absolute risk reduction, Number Needed to Benefit (NNTB), NNTB/year for total sample and in subgroups of males, females and age >65 was derived. CER for branded and generic versions was calculated by using the prices of statins listed in Indian Drug Review Triple i. Cost-effectiveness ratio (CER) in primary prevention studies i.e., the WOSCOPS, the AFCAPS and the ASCOT-LLA was Rs. 25.8 lacs, Rs. 23.8 lacs and Rs. 7.9 lacs per major coronary event averted respectively. CER in secondary prevention studies i.e., the CARE and the LIPID was approximately Rs. 20 lacs per major coronary event averted while it was Rs. 52.4 lacs and Rs. 37 lacs per coronary heart disease (CHD) death avoided. CER from the 4S was Rs. 6.9 lacs per major coronary event and Rs. 16.9 lacs per CHD death averted. CER in the HPS and the PROSPER study was Rs. 17.9 lacs and Rs. 27.1 lacs per major coronary event avoided in high-risk patients. Cost associated with the use of statins is higher in primary prevention as compared to secondary prevention. More studies are needed to confirm the cost-effectiveness of statins to make any decision for health policy.

N7-platinated ribonucleotides are not incorporated by RNA polymerases. New perspectives for a rational design of platinum antitumor drugs.

PubMed

Benedetti, Michele; Romano, Alessandro; De Castro, Federica; Girelli, Chiara R; Antonucci, Daniela; Migoni, Danilo; Verri, Tiziano; Fanizzi, Francesco P

2016-10-01

In this work, we assessed the capacity of RNA polymerases to use platinated ribonucleotides as substrates for RNA synthesis by testing the incorporation of the model compound [Pt(dien)(N7-5'-GTP)] (dien=diethylenetriamine; GTP=5'-guanosine triphosphate) into a natural RNA sequence. The yield of in vitro transcription operated by T7 RNA polymerase, on the LacZ (Escherichia coli gene encoding for β-galactosidase) sequence, decreases progressively with decreasing the concentration of natural GTP, in favor of the platinated nucleotide, [Pt(dien)(N7-5'-GTP)]. Comparison of the T7 RNA polymerase transcription activities for [Pt(dien)(N7-5'-GTP)] compound incorporation reaction test, with respect to the effect of a decreasing concentration of natural GTP, showed no major differences. A specific inhibitory effect of compound [Pt(dien)(N7-5'-GTP)] (which may pair the complementary base on the DNA strand, without being incorporated in the RNA by the T7 RNA polymerase) was evidenced. Our findings therefore suggest that RNA polymerases, unlike DNA polymerases, are unable to incorporate N7-platinated nucleotides into newly synthesized nucleic acids. In this respect, specifically designed N7-platinated nucleotides based compounds could be used in alternative to the classical platinum based drugs. This approach may offer a possible strategy to target specifically DNA, without affecting RNA, and is potentially able to better modulate pharmacological activity. Copyright © 2016 Elsevier Inc. All rights reserved.

3FGLzoo: classifying 3FGL unassociated Fermi-LAT γ-ray sources by artificial neural networks

NASA Astrophysics Data System (ADS)

Salvetti, D.; Chiaro, G.; La Mura, G.; Thompson, D. J.

2017-09-01

In its first four years of operation, the Fermi-Large Area Telescope (LAT) detected 3033 γ-ray emitting sources. In the Fermi-LAT Third Source Catalogue (3FGL) about 50 per cent of the sources have no clear association with a likely γ-ray emitter. We use an artificial neural network algorithm aimed at distinguishing BL Lacs from FSRQs to investigate the source subclass of 559 3FGL unassociated sources characterized by γ-ray properties very similar to those of active galactic nuclei. Based on our method, we can classify 271 objects as BL Lac candidates, 185 as FSRQ candidates, leaving only 103 without a clear classification. We suggest a new zoo for γ-ray objects, where the percentage of sources of uncertain type drops from 52 per cent to less than 10 per cent. The result of this study opens up new considerations on the population of the γ-ray sky, and it will facilitate the planning of significant samples for rigorous analyses and multiwavelength observational campaigns.

The Radio-optical Spectra of BL Lacs and Possible Relatives

NASA Astrophysics Data System (ADS)

Dennett-Thorpe, J.

I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?

Proton MR spectroscopy in predicting the increase of perfusion MR imaging for WHO grade II gliomas.

PubMed

Guillevin, Remy; Menuel, Carole; Abud, Lucas; Costalat, Robert; Capelle, Laurent; Hoang-Xuan, Khê; Habas, Christophe; Chiras, Jacques; Vallée, Jean-Noel

2012-03-01

To investigate the correlation between the metabolite ratios obtained from proton magnetic resonance (MR) spectroscopy and those obtained from MR perfusion parameters (relative cerebral blood volume [rCBV]) in a cohort of low-grade glioma (LGG). Patients underwent prospectively conventional MR, proton magnetic resonance spectroscopy ((1) HMRS), and perfusion-weighted images (PWI). Statistical analyses were performed to determine the correlative and independent predictive factors of rCBVmax and the metabolite ratio thresholds with optimum sensitivity and specificity. Thirty-one patients were included in this study. Linear correlations were observed between the metabolic ratios (lactate [Lac]/creatine [Cr], choline [Cho]/N-acetyl-aspartate [NAA], free-lipids/Cr) and rCBVmax (P < 0.05). These metabolic ratios were determined to be independent predictive factors of rCBVmax (P = 0.027, 0.011 and 0.032, respectively). According to the receiver operating characteristic curves, the cutoff values of the metabolic ratios to discriminate between the two populations of rCBVmax (<1.7 versus = 1.7) were 1.72, 1.54, and 1.40, respectively, with a sensitivity = 75% and a specificity >95% for Lac/Cr. This study demonstrated consistent correlations between the data from (1) HMRS and PWI. The Lac/Cr ratio predicts regional hemodynamic changes, which are themselves a useful biomarker of clinical prognosis in patients with LGG. As such, this ratio may provide a new parameter for making improved clinical decisions. Copyright © 2011 Wiley-Liss, Inc.

Differences in the INR evaluation of two different thromboplastins in patients with positivity to lupus anticoagulant in ongoing oral anticoagulation.

PubMed

Ferrazzi, Paola; Colombo, Anna; Di Micco, Pierpaolo; Lodigiani, Corrado; Librè, Luca; Rota, Lidia Luciana; Montanelli, Alessandro; Quaglia, Ilaria

2010-01-01

A possible interference between lupus anticoagulant (LAC), a well characterized clotting inhibitor, in the International Normalized Ratio (INR) determination during oral anticoagulation (OA) has been reported in the literature. Few data are available about the relationship between this kind of interference and the daily clinical management of oral anticoagulation. The aim of the study is to evaluate the role of two different thromboplastins-RecombiPlasTin 2G and HepatoComplex-in the determination of INR values of several patients' ongoing OA for a previous thrombotic disorder with and without positivity to LAC, and to evaluate possible interferences in the daily therapeutic approach. We selected 16 patients (13 females and 3 males, mean age 59 ± 16 years) with LAC positivity ongoing OA and 11 control subjects (7 females and 4 males, mean age 58 ± 14.5 years) with similar characteristics (ie, ethnic background and weight) with LAC negativity ongoing OA. 165 assays for INR determination were analyzed from both groups. Statistical analysis was performed using STATA 10 software. P values were considered significant if <0.05. Mean values of INR for patients with LAC positivity were 3.79 ± 1.63 when tested with RecombiPlasTin 2G vs 3.18 ± 1.15 when tested with HepatoComplex (P < 0.001, s); while mean values of INR for patients with antiphospholipid syndrome (APS) with LAC negativity were 3.54 ± 1.39 when tested with RecombiPlasTin 2G vs 3.23 ± 1.14 when tested with HepatoComplex (P < 0.002, s). An INR value > than 4.5 was found in 31/165 samples in 9 subjects, 8 patients with LAC positivity, and 1 control group subject with LAC negativity. There was a great difference in INR values in these subjects if we use the common thromboplastin (ie, RecombiPlasTin 2G) with a INR range varying from 5.14 ± 0.35 vs 3.79 ± 0.38 if we use another thromboplastin (ie, HepatoComplex) (P < 0.001, s). A change in the therapeutic approach for OA is possible in these cases because different INR values were obtained using different thromboplastins. Our data confirm that INR evaluation does not reveal significant changes also if tested with two different thromboplastins, for patients ongoing OA with and without LAC positivity, when the INR value is < than 4. Over this INR value there is a significant difference in patients with LAC positivity if we use a different thromboplastin for the INR determination. For this reason values obtained by RecombiPlasTin 2G need to be confirmed and matched with another thromboplastin (ie, HepatoComplex). This approach may be useful in order to have a good INR testing for the chronic long-term treatment with OA in particular in patients with LAC positivity.

LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313

DOE PAGES

Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...

2016-12-21

Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those genes encode global regulatory proteins with extensive regulons. This study indicates that there are small specificC. thermocellumLacI regulons. Finally, the identification of LacI repressor activity for hemicellulase gene expression is a key result of this work and will add to the small body of existing literature on the area of gene regulation inC. thermocellum.« less

Hydroxychloroquine use is associated with lower odds of persistently positive antiphospholipid antibodies and/or lupus anticoagulant in systemic lupus erythematosus.

PubMed

Broder, Anna; Putterman, Chaim

2013-01-01

Antiphospholipid antibodies (aPL) play an active role in the pathogenesis of the antiphospholipid syndrome (APS). Primary prevention in APS may be aimed at decreasing existing elevated aPL levels, or preventing high aPL titers and/or lupus anticoagulant (LAC) from developing in the first place. Hydroxychloroquine (HCQ) has been shown in retrospective studies to decrease aPL titers in laboratory studies, and to decrease thrombosis risk in patients with systemic lupus erythematosus (SLE). We investigated an association between HCQ use and persistent aPL and/or LAC in SLE. We identified all patients over 21 years old with SLE from an urban tertiary care center who had aPL and LAC measured on at least 2 occasions at least 12 weeks apart. We defined the presence of persistent LAC+ and/or at least 1 aPL ≥ 40 U [immunoglobulin A (IgA), IgG, or IgM] as the main outcome variable. Among 90 patients included in the study, 17 (19%) had persistent LAC+ and/or at least 1 aPL ≥ 40 U. HCQ use was associated with significantly lower odds of having persistent LAC+ and/or aPL ≥ 40 U (OR 0.21, 95% CI 0.05, 0.79, p = 0.02), adjusted for age, ethnicity, and sex. This is the first study to show that HCQ use is associated with lower odds of having persistently positive LAC and/or aPL. Data from this study provide a basis for the design of future prospective studies investigating the role of HCQ in primary and secondary prevention of APS.

Restoration of parathyroid function after change of phosphate binder from calcium carbonate to lanthanum carbonate in hemodialysis patients with suppressed serum parathyroid hormone.

PubMed

Inaba, Masaaki; Okuno, Senji; Nagayama, Harumi; Yamada, Shinsuke; Ishimura, Eiji; Imanishi, Yasuo; Shoji, Shigeichi

2015-03-01

Control of phosphate is the most critical in the treatment of chronic kidney disease with mineral and bone disorder (CKD-MBD). Because calcium-containing phosphate binder to CKD patients is known to induce adynamic bone disease with ectopic calcification by increasing calcium load, we examined the effect of lanthanum carbonate (LaC), a non-calcium containing phosphate binder, to restore bone turnover in 27 hemodialysis patients with suppressed parathyroid function (serum intact parathyroid hormone [iPTH] ≦ 150 pg/mL). At the initiation of LaC administration, the dose of calcium-containing phosphate binder calcium carbonate (CaC) was withdrawn or reduced based on serum phosphate. After initiation of LaC administration, serum calcium and phosphate decreased significantly by 4 weeks, whereas whole PTH and iPTH increased. A significant and positive correlation between decreases of serum calcium, but not phosphate, with increases of whole PTH and iPTH, suggested that the decline in serum calcium with reduction of calcium load by LaC might increase parathyroid function. Serum bone resorption markers, such as serum tartrate-resistant acid phosphatase 5b, and N-telopeptide of type I collagen increased significantly by 4 weeks after LaC administration, which was followed by increases of serum bone formation markers including serum bone alkaline phosphatase, intact procollagen N-propeptide, and osteocalcin. Therefore, it was suggested that LaC attenuated CaC-induced suppression of parathyroid function and bone turnover by decreasing calcium load. In conclusion, replacement of CaC with LaC, either partially or totally, could increase parathyroid function and resultant bone turnover in hemodialysis patients with serum iPTH ≦ 150 pg/mL. Copyright © 2015 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

PubMed Central

Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

2013-01-01

β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp.

PubMed

Fang, Fang; Zhang, Xue-lian; Luo, Hong-hui; Zhou, Jia-jian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi; Pang, Xue-qun

2015-12-01

In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. © 2015 American Society of Plant Biologists. All Rights Reserved.

Improving in vivo conversion of oleuropein into hydroxytyrosol by oral granules containing probiotic Lactobacillus plantarum 299v and an Olea europaea standardized extract.

PubMed

Aponte, Maria; Ungaro, Francesca; d'Angelo, Ivana; De Caro, Carmen; Russo, Roberto; Blaiotta, Giuseppe; Dal Piaz, Fabrizio; Calignano, Antonio; Miro, Agnese

2018-05-30

This study reports novel food-grade granules for co-delivery of L. plantarum 299v and a standardized extract of Olea europaea leaves (Phenolea®) as oral carrier of probiotics and hydroxytyrosol. Different granule formulations containing either L. plantarum 299v (Lac), or the olive leave extract (Phe) or their combination (Lac-Phe) have been successfully produced through wet granulation employing excipients generally regarded as safe as granulating/binding agents. L. plantarum cells withstood the manufacturing process and were stable upon storage at 4 °C for more than 6 months. In vitro dissolution studies in simulated gastro-intestinal fluids showed the capability of the granules to rapidly dissolve and deliver both olive leave phenols and living L. plantarum cells. In simulated digestion conditions, Lac and Lac-Phe granules protected L. plantarum against the harsh environment of the gastro-intestinal tract. Co-administration of Lac and Phe oral granules to healthy mice provided for higher amounts of hydroxytyrosol in urines as compared to Phe granules alone, suggesting that L. plantarum 299v boosted in vivo conversion of oleuropein to hydroxytyrosol. On the other hand, PCR-assisted profiling of the Lactobacillus population in faeces obtained from mice treated with Lac or Lac plus Phe confirmed that the probiotic arrived alive to colon and was there able to exert a sort of perturbing effect on the climax colonic microflora. Overall, these results pave the way towards the development of a nutraceutical useful for combined delivery of bioactive hydroxytyrosol and probiotics to colon site. Copyright © 2018 Elsevier B.V. All rights reserved.

Combinational effects of prebiotic oligosaccharides on bifidobacterial growth and host gene expression in a simplified mixed culture model and neonatal mice.

PubMed

Ehara, Tatsuya; Izumi, Hirohisa; Tsuda, Muneya; Nakazato, Yuki; Iwamoto, Hiroshi; Namba, Kazuyoshi; Takeda, Yasuhiro

2016-07-01

It is important to provide formula-fed infants with a bifidobacteria-enriched gut microbiota similar to those of breastfed infants to ensure intestinal health. Prebiotics, such as certain oligosaccharides, are a useful solution to this problem, but the combinational benefits of these oligosaccharides have not been evaluated. This study investigated the benefits of oligosaccharide combinations and screened for an optimal combination of oligosaccharides to promote healthy gut microbiota of formula-fed infants. In vitro and in vivo experiments were performed to assess the bifidogenic effects of lactulose (LAC) alone and LAC combined with raffinose (RAF) and/or galacto-oligosaccharide (GOS), using a mixed culture model and neonatal mice orally administered with these oligosaccharides and Bifidobacterium breve. In the in vitro culture model, the combination of the three oligosaccharides (LAC-RAF-GOS) significantly increased cell numbers of B. breve and Bifidobacterium longum (P<0·05) compared with either LAC alone or the combination of two oligosaccharides, and resulted in the production of SCFA under anaerobic conditions. In the in vivo experiment, the LAC-RAF-GOS combination significantly increased cell numbers of B. breve and Bacteroidetes in the large intestinal content (P<0·05) and increased acetate concentrations in the caecal content and serum of neonatal mice. Genes related to metabolism and immune responses were differentially expressed in the liver and large intestine of mice administered with LAC-RAF-GOS. These results indicate a synergistic effect of the LAC-RAF-GOS combination on the growth of bifidobacteria and reveal possible benefits of this combination to the gut microbiota and health of infants.

Mechanisms of Mutation in Non-Dividing Cells

DTIC Science & Technology

2003-05-01

which cells with a lac +1 frameshift allele on an F’ plasmid generate Lac+ mutants upon starvation on lactose medium (3). The stationary-phase mutations...starved on lactose . The accumulation of ampD mutants requires RecA, and is promoted at a greater frequency in RecG-deficient cells, similar to Lac...stationary-phase cells after they are starved in the presence of lactose . In studies performed to date by our lab and others, mutation in stationary-phase

Genetic and Molecular Studies of the Phlebotomus Fever Group of Viruses.

DTIC Science & Technology

1980-08-01

unrelated rhabdovirus , VSV. Two sources of LAC viral antigens were used, those from virus grown in BHK-21 cells and those obtained from LAC virus grown in...KAR, SFS and CHG, as well as those of the bunyaviruses LAC, ORI and BUN, and the viral antigens of the unrelated rhabdovirus , VSV. Again two sources...and Shope, R.E., 1977b, Oligonucleotide fingerprints of RNA obtained from rhabdoviruses belonging to the vesicular stornatitis virus subgroup. J

Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon

PubMed Central

Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier

2008-01-01

Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364

Gender differences in Latin-American patients with rheumatoid arthritis.

PubMed

Barragán-Martínez, Carolina; Amaya-Amaya, Jenny; Pineda-Tamayo, Ricardo; Mantilla, Rubén D; Castellanos-de la Hoz, Juan; Bernal-Macías, Santiago; Rojas-Villarraga, Adriana; Anaya, Juan-Manuel

2012-12-01

Data on the effect of gender in rheumatoid arthritis (RA) in non-Caucasian populations is scarce. Latin America and the Caribbean (LAC) is a large population with unique characteristics, including high admixture. Our aim was to examine the effect of gender in patients with RA in LAC. This was a 2-phase study. First we conducted a cross-sectional and analytical study in which 1128 consecutive Colombian patients with RA were assessed. Second, a systematic review of the literature was done to evaluate the effect of gender in LAC patients with RA. Our results show a high prevalence of RA in LAC women with a ratio of 5.2 women per man. Colombian women with RA are more at risk of having an early age at onset and developing polyautoimmunity and abdominal obesity, and they perform more household duties than their male counterparts. However, male gender was associated with the presence of extra-articular manifestations. Of a total of 641 potentially relevant articles, 38 were considered for final analysis, in which several factors and outcomes related to gender were identified. RA in LAC women is not only more common but presents with some clinical characteristics that differ from RA presentation in men. Some of those characteristics could explain the high rates of disability and worse prognosis observed in women with RA in LAC. Copyright © 2012 Elsevier HS Journals, Inc. All rights reserved.

Supermagnetically Tuned Halloysite Nanotubes Functionalized with Aminosilane for Covalent Laccase Immobilization.

PubMed

Kadam, Avinash A; Jang, Jiseon; Lee, Dae Sung

2017-05-10

Halloysite nanotubes (HNTs) were tuned with supermagnetic Fe 3 O 4 (M-HNTs) and functionalized with γ-aminopropyltriethoxysilane (APTES) (A-M-HNTs). Gluteraldehyde (GTA) was linked to A-M-HNTs (A-M-HNTs-GTA) and explored for covalent laccase immobilization. The structural characterization of M-HNTs, A-M-HNTs, and A-M-HNTs-GTA-immobilized laccase (A-M-HNTs-GTA-Lac) was determined by X-ray photoelectron spectroscopy, field-emission high-resolution transmission electron microscopy, a magnetic property measurement system, and thermogavimetric analyses. A-M-HNTs-GTA-Lac gave 90.20% activity recovery and a loading capability of 84.26 mg/g, with highly improved temperature and storage stabilities. Repeated usage of A-M-HNTs-GTA-Lac revealed a remarkably consistent relative activity of 80.49% until the ninth cycle. The A-M-HNTs-GTA-Lac gave consistent redox-mediated sulfamethoxazole (SMX) degradation up to the eighth cycle. In the presence of guaiacol, A-M-HNTs-GTA-Lac gave elevated SMX degradation compared with 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic acid) and syrinialdehyde. Therefore, the A-M-HNTs can serve as supermagnetic amino-functionalized nanoreactors for biomacromolecule immobilization. The obtained A-M-HNTs-GTA-Lac is an environmentally friendly biocatalyst for effective degradation of micropollutants, such as SMX, and can be easily retrieved from an aqueous solution by a magnet after decontamination of pollutants in water and wastewater.

Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.

PubMed

Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen

2014-07-14

The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions.

Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-03-10

The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

Tissue specific expression of the retinoic acid receptor-beta 2: regulation by short open reading frames in the 5'-noncoding region

PubMed Central

1994-01-01

The 40-S subunit of eukaryotic ribosomes binds to the capped 5'-end of mRNA and scans for the first AUG in a favorable sequence context to initiate translation. Most eukaryotic mRNAs therefore have a short 5'- untranslated region (5'-UTR) and no AUGs upstream of the translational start site; features that seem to assure efficient translation. However, approximately 5-10% of all eukaryotic mRNAs, particularly those encoding for regulatory proteins, have complex leader sequences that seem to compromise translational initiation. The retinoic-acid- receptor-beta 2 (RAR beta 2) mRNA is such a transcript with a long (461 nucleotides) 5'-UTR that contains five, partially overlapping, upstream open reading frames (uORFs) that precede the major ORF. We have begun to investigate the function of this complex 5'-UTR in transgenic mice, by introducing mutations in the start/stop codons of the uORFs in RAR beta 2-lacZ reporter constructs. When we compared the expression patterns of mutant and wild-type constructs we found that these mutations affected expression of the downstream RAR beta 2-ORF, resulting in an altered regulation of RAR beta 2-lacZ expression in heart and brain. Other tissues were unaffected. RNA analysis of adult tissues demonstrated that the uORFs act at the level of translation; adult brains and hearts of transgenic mice carrying a construct with either the wild-type or a mutant UTR, had the same levels of mRNA, but only the mutant produced protein. Our study outlines an unexpected role for uORFs: control of tissue-specific and developmentally regulated gene expression. PMID:7962071

Evidence for the pulsational origin of the Long Secondary Periods: The red supergiant star V424 Lac (HD 216946)

NASA Astrophysics Data System (ADS)

Messina, Sergio

2007-10-01

The results of a long-term UBV photometric monitoring of the red supergiant (RSG) star V424 Lac are presented. V424 Lac shows multiperiodic brightness variations which can be attributed to pulsational oscillations. A much longer period ( P = 1601 d), that allows us to classify this star as a long secondary period variable star (LSPV) has been also detected. The B - V and U - B color variations related to the long secondary period (LSP) are similar to those related to the shorter periods, supporting the pulsational nature of LSP. The long period brightness variation of V424 Lac is accompanied by a near-UV (NUV) excess, which was spectroscopically detected in a previous study [Massey, P., Plez, B., Levesque, E.M., et al., 2005. ApJ 634, 1286] and which is now found to be variable from photometry. On the basis of the results found for V424 Lac, the NUV excess recently found in a number of RSGs may be due not solely to circumstellar dust but may also have a contribution from a still undetected LSP variability.

[Genotype-related changes in the reproductive function under social hierarchy in laboratory male mice].

PubMed

Osadchuk, L V; Salomacheva, I N; Osadchuk, A V

2010-01-01

The study was designed to investigate genetic differences in reproductive consequences of social hierarchy using inbred mice strains BALB/cLac, PT and CBA/Lac. Two adult males of different genotypes were housed together for 5 days. Hierarchical status of both partners was determined by asymmetry in agonistic behavior. The number of epididymal sperm and a proportion of abnormal sperm, weights of reproductive organs, serum concentration and testicular content of testosterone, and the testosterone response to introduction of a receptive female were determined. The testosterone measures were significantly decreased in the PT strain, the epididymal sperm number was significantly decreased in the BALB/cLac strain and a proportion of abnormal sperm heads was significantly increase in the CBA/Lac (in both dominants and subordinates) as compared to control mice. The testicular testosterone response to a receptive female and precopulatory behavior was unchanged in dominants and suppressed in subordinates of the BALB/cLac strain. The results indicate that in laboratory mice the pattern of reproductive response to social hierarchy is determined by genetic background.

The effects of pre-slaughter pig management from the farm to the processing plant on pork quality.

PubMed

Edwards, L N; Grandin, T; Engle, T E; Ritter, M J; Sosnicki, A A; Carlson, B A; Anderson, D B

2010-12-01

Two experiments (Exp.1, n=80; Exp.2, n=144) were conducted to determine the effects of pre-slaughter pig management on pork quality by monitoring blood lactate concentration ([LAC]) during marketing. [LAC] was measured at: (1) baseline at farm, (2) post-loading on truck, (3) pre-unloading after transport, (4) post-unloading at plant, (5) post-lairage, (6) post-movement to stun, and (7) exsanguination. Pearson correlations were used to determine relationships between [LAC] and meat quality. Higher [LAC] post-loading or a greater change in [LAC] during loading resulted in increased 24h pH (P=0.002, P=0.0006, Exp.1; P=0.0001, P=0.01, Exp.2, respectively), decreased L* (P=0.03, P=0.04; P=0.001, P=0.01) and decreased drip loss (P=0.02, P=0.12; P=0.002, P=0.01). Even though improved handling during loading is important to animal well-being, it will not necessarily translate into improved pork quality. Copyright © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.

Recombinant levels of Escherichia coli K-12 mutants deficient in various replication, recombination, or repair genes.

PubMed Central

Zieg, J; Maples, V F; Kushner, S R

1978-01-01

Escherichia coli strains containing mutations in lexA, rep, uvrA, uvrD, uvrE, lig, polA, dam, or xthA were constructed and tested for conjugation and transduction proficiencies and ability to form Lac+ recombinants in an assay system utilizing a nontandem duplication of two partially deleted lactose operons (lacMS286phi80dIIlacBK1). lexA and rep mutants were as deficient (20% of wild type) as recB and recC strains in their ability to produce Lac+ progeny. All the other strains exhibited increased frequencies of Lac+ recombinant formation, compared with wild type, ranging from 2- to 13-fold. Some strains showed markedly increased conjugation proficiency (dam uvrD) compared to wild type, while others appeared deficient (polA107). Some differences in transduction proficiency were also observed. Analysis of the Lac+ recombinants formed by the various mutants indicated that they were identical to the recombinants formed by a wild-type strain. The results indicate that genetic recombination in E. coli is a highly regulated process involving multiple gene products. PMID:350859

Deposition Mechanism and Microstructure of Laser-Assisted Cold-Sprayed (LACS) Al-12 wt.%Si Coatings: Effects of Laser Power

NASA Astrophysics Data System (ADS)

Olakanmi, E. O.; Tlotleng, M.; Meacock, C.; Pityana, S.; Doyoyo, M.

2013-06-01

Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries, and renewable energy systems. This article highlights some of those potential applications. In the LACS process, a laser beam irradiates the substrate and the particles, thereby softening both of them. Consequently, the particles deform upon impact at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS deposition mechanism and microstructural properties is presented. The deposition efficiency, the microstructure, and the microhardness of the LACS-deposited coatings produced by a 4.4-kW Nd:YAG laser system were evaluated. The outcome of this study shows that pore- and crack-free Al-12 wt.%Si coatings were deposited via softening by laser irradiation and adiabatic shearing phenomena at an optimum laser power of 2.5 kW.

Escherichia coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ.

PubMed

Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo

2002-03-01

Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.

Low-luminosity Blazars in Wise: A Mid-infrared View of Unification

NASA Astrophysics Data System (ADS)

Plotkin, Richard M.; Anderson, S. F.; Brandt, W. N.; Markoff, S.; Shemmer, O.; Wu, J.

2012-01-01

We use the preliminary data release from the Wide-Field Infrared Survey Explorer (WISE) to perform the first statistical study on the mid-infrared (IR) properties of a large number ( 102) of BL Lac objects -- low-luminosity Active Galactic Nuclei (AGN) with a jet beamed toward the Earth. As expected, many BL Lac objects are so highly beamed that their jet synchrotron emission dominates their IR spectral energy distributions (SEDs), and the shape of their SEDs in the IR correlates well with SED peak frequency. In other BL Lac objects, the jet is not strong enough to completely dilute the rest of the AGN, and we do not see observational signatures of the dusty torus from these weakly beamed BL Lac objects. While at odds with simple unification, the missing torus is consistent with recent suggestions that BL Lac objects are fed by radiatively inefficient accretion flows. We discuss implications on the ``nature vs. nurture" debate for FR I and FR II galaxies, and also on the standard orientation-based AGN unification model.

Flood Control Project Lac Qui Parle, Emergency Plan

DTIC Science & Technology

1988-10-01

elevation of the breach (924.0 as shown in Table 1), is approximately 22.2 feet. The value of the envelope curve shown on Plate D-10 for a hydraulic...approximately 83% of the computed maximum outflow. Several failure scenarios for Lac qui Parle Dam were studied. The case of failure concurrent with a PKF ...discharge would plot very close to Lac qui Parle in Plate D-10. Plate D-10 shows that the value of the envelope curve for a hydraulic depth of 18.8 feet

Investigation of physical parameters in stellar flares observed by GINGA

NASA Technical Reports Server (NTRS)

Stern, Robert A.

1994-01-01

This program involves analysis and interpretation of results from GINGA Large Area Counter (LAC) observations from a group of large stellar x-ray flares. All LAC data are re-extracted using the standard Hayashida method of LAC background subtraction and analyzed using various models available with the XSPEC spectral fitting program. Temperature-emission measure histories are available for a total of 5 flares observed by GINGA. These will be used to compare physical parameters of these flares with solar and stellar flare models.

Investigation of physical parameters in stellar flares observed by GINGA

NASA Technical Reports Server (NTRS)

Stern, Robert A.

1994-01-01

This program involves analysis and interpretation of results from GINGA Large Area Counter (LAC) observations from a group of large stellar X-ray flares. All LAC data are re-extracted using the standard Hayashida method of LAC background subtraction and analyzed using various models available with the XSPEC spectral fitting program.Temperature-emission measure histories are available for a total of 5 flares observed by GINGA. These will be used to compare physical parameters of these flares with solar and stellar flare models.

Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample

NASA Astrophysics Data System (ADS)

Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.

1994-12-01

The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15 = 0.304 +/- 0.062 for XBLs but = 0.60 +/- 0.05 for RBLs. Models of the X-ray luminosity function (XLF) are also poorly constrained. WARPS will allow us to compute an accurate XLF, decreasing the error bars above by over a factor of two. We will also test for low-luminosity BL Lacs, whose non-thermal nuclear sources are dim compared to the host galaxy. Browne and Marcha (1993) claim the EMSS missed most of these objects and is incomplete. If their predictions are correct, 20-40% of the BL Lacs we find will fall in this category, enabling us to probe the evolution and internal workings of BL Lacs at lower luminosities than ever before. By removing likely QSOs before optical spectroscopy, WARPS requires only modest amounts of telescope time. It will extend measurement of the cluster XLF both to higher redshifts (z>0.5) and lower luminosities (LX<1x10(44) erg s(-1) ) than previous measurements, confirming or rejecting the 3sigma detection of negative evolution found in the EMSS, and constraining Cold Dark Matter cosmologies. Faint NELGs are a recently discovered major contributor to the X-ray background. They are a mixture of Sy2s, starbursts and galaxies of unknown type. Detailed classification and evolution of their XLF will be determined for the first time.

Dietary α-lactalbumin induced fatty liver by enhancing nuclear liver X receptor αβ/sterol regulatory element-binding protein-1c/PPARγ expression and minimising PPARα/carnitine palmitoyltransferase-1 expression and AMP-activated protein kinase α phosphorylation associated with atherogenic dyslipidaemia, insulin resistance and oxidative stress in Balb/c mice.

PubMed

López-Oliva, María Elvira; Garcimartin, Alba; Muñoz-Martínez, Emilia

2017-12-01

The effect and the role played by dietary α-lactalbumin (α-LAC) on hepatic fat metabolism are yet to be fully elucidated. We reported previously that α-LAC intake induced atherogenic dyslipidaemia in Balb/c mice. The aim of the present study was to investigate if this atherogenic effect could be due to a possible α-LAC-induced hepatic steatosis. We examine the ability of dietary α-LAC to induce liver steatosis, identifying the molecular mechanisms underlying hepatic lipid metabolism in association with the lipid profile, peripheral insulin resistance (IR) and changes in the hepatic oxidative environment. Male Balb/c mice (n 6) were fed with diets containing either chow or 14 % α-LAC for 4 weeks. The α-LAC-fed mice developed abdominal adiposity and IR. Moderate liver steatosis with increased TAG and NEFA contents was correlated with atherogenic dyslipidaemia. There was increased nuclear expression of liver X receptor αβ (LXRαβ), sterol regulatory element-binding protein-1c (SREBP-1c) and PPARγ transcription factors and of the cytosolic enzymes acetyl-CoA carboxylase 1 (ACC1) and fatty acid synthase involved in the hepatic de novo lipogenesis. The opposite was found for the nuclear receptor PPARα and the mitochondrial enzyme carnitine palmitoyltransferase-1 (CPT-1), leading to reduced fatty acid β-oxidation (FAO). These changes were associated with a significant decrease in both p-Thr172-AMP-activated protein kinase α (AMPKα) (inactivation) and p-Ser79-ACC1 (activation) and with a more oxidative liver environment increasing lipid peroxidation and protein oxidation and reducing GSH:GSSG ratio in the α-LAC-fed mice. In conclusion, 4 weeks of 14 % α-LAC feeding induced liver steatosis associated with atherogenic dyslipidaemia, IR and oxidative stress by enhancing nuclear LXRαβ/SREBP-1c/PPARγ expression and diminishing PPARα/CPT-1 expression and AMPKα phosphorylation shifting the hepatic FAO toward fatty acid synthesis in Balb/c mice.

[Toward a model of communications in public health in Latin America and the Caribbean].

PubMed

Macías-Chapula, César A

2005-12-01

So far, there have been no bibliometric or scientometric studies that make it possible to examine, with quantitative, retrospective, and comprehensive criteria, the scientific output on public health in Latin America and the Caribbean (LAC). Further, the weakness of the existing information systems makes it impossible to examine the relevance, quality, and impact of this scientific output, with a view to evaluating it in terms of societal needs and existing patterns of scientific communication. This article presents the results of a bibliographic analysis of the scientific output in the area of public health in Latin America and the Caribbean. The ultimate goal of the analysis is to build a model of scientific communication in this field, to help researchers, managers, and others working in the area of public health to make decisions and choose actions to take. We conducted a literature review in order to identify the distribution of publications on public health that were produced by LAC researchers and published in each of the LAC countries from 1980 through 2002. The review used the Literatura Latino-Americana e do Caribe em Saúde Pública (LILACS-SP) (Latin American and Caribbean Literature on Public Health) bibliographic database. That database is operated by the Latin American and Caribbean Center on Health Sciences Information (BIREME), which is in São Paulo, Brazil. We processed the LILACS-SP data using two software packages, Microsoft Excel and Bibexcel, to obtain indicators of the scientific output, the type of document, the language, the number of authors for each publication, the thematic content, and the participating institutions. For the 1980-2002 period, there were 97,605 publications registered, from a total of 37 LAC countries. For the analysis presented in this article, we limited the sample to the 8 countries in Latin America and the Caribbean that had at least 3,000 documents each registered in the LILACS-SP database over the 1980-2002 study period. In descending order of the number of publications registered, the 8 nations were: Argentina, Brazil, Chile, Colombia, Cuba, Mexico, Peru, and Venezuela. Those 8 countries were responsible for 83,054 publications (85.10% of the total of 97,605 registered documents produced by the 37 LAC countries). Of those 83,054 publications from the 8 countries, 56,253 of them (67.73%) were articles published in scientific journals and 24,488 were monographs (29.48%). The proportion of works produced by two or more coauthors was relatively high (56.48%). The 56,253 articles appeared in a total of 929 different journals. Of the 929 journals, 91 of them published at least 150 articles over the study period. In descending order, LAC journals with the largest number of articles on public health were: Revista de Saúde Pública (Brazil); Cadernos de Saúde Pública (Brazil); Revista Médica de Chile; Archivos Latinoamericanos de Nutrición (Venezuela); and Salud Pública de México. The 91 journals that published at least 150 articles represented 29 different specialties. The most common of the specialties for the 91 journals were general medicine (18 journals) and pediatrics (10 journals). In descending order, the populations that the publications dealt with primarily were human beings in general, females, males, and adults; and, in descending order, a relatively small number of publications dealt with pregnant women and middle-aged or elderly persons. The topics most often covered in the publications were risk factors, health policy, and primary health care, as well as family doctors in the case of Cuba. This research produced a preliminary model of communications in public health in LAC countries that will hopefully help lay the groundwork for further research to develop a model of scientific communication in LAC nations.

Characterization of C-terminally engineered laccases.

PubMed

Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry

2014-08-01

Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (CΔ) and its 6 His tagged counterpart (CΔ6H) were found active enzymes. The production of CΔ6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of CΔ6H noted CΔ6Hh. Properties of CΔ, CΔ6H and CΔ6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in CΔ for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of CΔ6H and CΔ6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. Copyright © 2014 Elsevier B.V. All rights reserved.

Organization of the Indian hedgehog--parathyroid hormone-related protein system in the postnatal growth plate.

PubMed

Chau, Michael; Forcinito, Patricia; Andrade, Anenisia C; Hegde, Anita; Ahn, Sohyun; Lui, Julian C; Baron, Jeffrey; Nilsson, Ola

2011-08-01

In embryonic growth cartilage, Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP) participate in a negative feedback loop that regulates chondrocyte differentiation. Postnatally, this region undergoes major structural and functional changes. To explore the organization of the Ihh–PTHrP system in postnatal growth plate, we microdissected growth plates of 7-day-old rats into their constituent zones and assessed expression of genes participating in the h–PTHrP feedback loop. Ihh, Patched 1, Smoothened, Gli1, Gli2, Gli3, and Pthr1 were expressed in regions analogous to the expression domains in embryonic growth cartilage. However, PTHrP was expressed in resting zone cartilage, a site that differs from the embryonic source, the periarticular cells. We then used mice in which lacZ has replaced coding sequences of Gli1 and thus serves as a marker for active hedgehog signaling. At 1, 4, 8, and 12 weeks of age, lacZ expression was detected in a pattern analogous to that of embryonic cartilage. The findings support the hypothesis that the embryonic Ihh–PTHrP feedback loop is maintained in the postnatal growth plate except that the source of PTHrP has shifted to a more proximal location in the resting zone.

EPA Efforts in Latin America and the Caribbean

EPA Pesticide Factsheets

The Latin America and Caribbean (LAC) program provides environmental tools and information to build the capacity of LAC governments and civil society organizations to reduce environmental degradation and its impacts on public health.

University of Wisconsin - Extension

MedlinePlus

... Fond du Lac County Forest County Grant County Green County Green Lake County Iowa County Iron County Jackson County ... Fond du Lac County Forest County Grant County Green County Green Lake County Iowa County Iron County ...

Over-expression of phage HK022 Nun protein is toxic for Escherichia coli

PubMed Central

Uc-Mass, Augusto; Khodursky, Arkady; Brown, Lewis; Gottesman, Max E.

2008-01-01

The Nun protein of coliphage HK022 excludes superinfecting λ phage. Nun recognizes and binds to the N utilization (nut) sites on phage λ nascent RNA and induces transcription termination. Over-expression of Nun from a high-copy plasmid is toxic for E.coli, despite the fact that nut sites are not encoded in the E.coli genome. Cells expressing Nun cannot exit stationary phase. Toxicity is related to transcription termination, since host and nun mutations that block termination also suppress cell killing. Nun inhibits expression of wild-type lacZ, but not lacZ expressed from the Crp/cAMP–independent lacUV5 promoter. Microarray and proteomics analyses show Nun down-regulates crp and tnaA. Crp over-expression and high indole concentrations partially reverse Nun-mediated toxicity and restore lacZ expression. PMID:18571198

VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)

NASA Astrophysics Data System (ADS)

Marcha, M. J. M.; Caccianiga, A.

2014-04-01

This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).

Study of the counts, species and characteristics of the yeast population during the manufacture of dry-cured "lacón". Effect of salt level.

PubMed

Purriños, Laura; García Fontán, María C; Carballo, Javier; Lorenzo, José M

2013-05-01

The aim of this work was to study the yeast population during the manufacture of dry-cured "lacón" (a Spanish traditional meat product) and the effect of the salting time. For this study, six batches of "lacón" were manufactured with three different salting times (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). Yeast counts increased significantly (P < 0.001) during the whole process from 2.60 to 6.37 log cfu/g. An increased length of salting time did not affect yeast counts throughout the manufacture of dry-cured "lacón", although the highest yeast counts were obtained from LS batches. A total of 226 isolates were obtained from dry-cured "lacón" during drying-ripening stage, of which 151 were yeasts and were identified at the species level using molecular techniques. The total of 151 identified yeasts belonged to 4 different genera: Debaryomyces, Candida, Cryptococcus and Rhodotorula. Debaryomyces hansenii was the most abundant species isolated throughout the whole process as much in the interior as in the exterior of the pieces of three salt levels of "lacón" studied, while Candida zeylanoides was only isolated from the interior of MS and HS batches and from the exterior of LS and HS groups, but at lesser proportion than D. hansenii. Copyright © 2012. Published by Elsevier Ltd.

Serum resistance, gallium nitrate tolerance and extrapulmonary dissemination are linked to heme consumption in a bacteremic strain of Acinetobacter baumannii.

PubMed

de Léséleuc, Louis; Harris, Greg; KuoLee, Rhonda; Xu, H Howard; Chen, Wangxue

2014-05-01

Bacteremia caused by Acinetobacter baumannii is a highly lethal complication of hospital-acquired pneumonia. In the present study, we investigated the serum resistance, gallium nitrate tolerance and heme consumption of A. baumannii strain LAC-4 which was recently reported to display high virulence in a mouse pneumonia model with extrapulmonary dissemination leading to fatal bacteremia. This strain showed enhanced growth in mouse and fetal bovine serum that was independent of complement and was not observed with regular growth media. The LAC-4 strain was found to possess a high tolerance to gallium nitrate (GaN), whereas serum synergized with GaN in inhibiting A. baumannii strain ATCC 17978. We found that LAC-4 contains a heme oxygenase gene and expresses a highly efficient heme consumption system. This system can be fully blocked in vitro and in vivo by gallium protoporphyrin IX (GaPPIX). Inhibition of heme consumption by GaPPIX completely abrogated the growth advantage of LAC-4 in serum as well as its tolerance to GaN. More importantly, GaPPIX treatment of mice intranasally infected with LAC-4 prevented extrapulmonary dissemination and death. Thus, we propose that heme provides an additional source of iron for LAC-4 to bypass iron restriction caused by serum transferrin, lactoferrin or free gallium salts. Heme consumption systems in A. baumannii may constitute major virulence factors for lethal bacteremic isolates. Copyright © 2014 Crown Copyright and Elsevier Inc. Published by Elsevier GmbH.. All rights reserved.

Beneficial effect of mechanical stimulation on the regenerative potential of muscle-derived stem cells is lost by inhibiting vascular endothelial growth factor.

PubMed

Beckman, Sarah A; Chen, William C W; Tang, Ying; Proto, Jonathan D; Mlakar, Logan; Wang, Bing; Huard, Johnny

2013-08-01

We previously reported that mechanical stimulation increased the effectiveness of muscle-derived stem cells (MDSCs) for tissue repair. The objective of this study was to determine the importance of vascular endothelial growth factor (VEGF) on mechanically stimulated MDSCs in a murine model of muscle regeneration. MDSCs were transduced with retroviral vectors encoding the LacZ reporter gene (lacZ-MDSCs), the soluble VEGF receptor Flt1 (sFlt1-MDSCs), or a short hairpin RNA (shRNA) targeting messenger RNA of VEGF (shRNA_VEGF MDSCs). Cells were subjected to 24 hours of mechanical cyclic strain and immediately transplanted into the gastrocnemius muscles of mdx/scid mice. Two weeks after transplantation, angiogenesis, fibrosis, and regeneration were analyzed. There was an increase in angiogenesis in the muscles transplanted with mechanically stimulated lacZ-MDSCs compared with nonstimulated lacZ-MDSCs, sFlt1-MDSCs, and shRNA _VEGF MDSCs. Dystrophin-positive myofiber regeneration was significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. In vitro proliferation of MDSCs was not decreased by inhibition of VEGF; however, differentiation into myotubes and adhesion to collagen were significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. The beneficial effects of mechanical stimulation on MDSC-mediated muscle repair are lost by inhibiting VEGF.

Beneficial Effect of Mechanical Stimulation on the Regenerative Potential of Muscle-Derived Stem Cells Is Lost by Inhibiting Vascular Endothelial Growth Factor

PubMed Central

Beckman, Sarah A.; Chen, William C.W.; Tang, Ying; Proto, Jonathan D.; Mlakar, Logan; Wang, Bing; Huard, Johnny

2016-01-01

Objective We previously reported that mechanical stimulation increased the effectiveness of muscle-derived stem cells (MDSCs) for tissue repair. The objective of this study was to determine the importance of vascular endothelial growth factor (VEGF) on mechanically stimulated MDSCs in a murine model of muscle regeneration. Approach and Results MDSCs were transduced with retroviral vectors encoding the LacZ reporter gene (lacZ-MDSCs), the soluble VEGF receptor Flt1 (sFlt1-MDSCs), or a short hairpin RNA (shRNA) targeting messenger RNA of VEGF (shRNA_VEGF MDSCs). Cells were subjected to 24 hours of mechanical cyclic strain and immediately transplanted into the gastrocnemius muscles of mdx/scid mice. Two weeks after transplantation, angiogenesis, fibrosis, and regeneration were analyzed. There was an increase in angiogenesis in the muscles transplanted with mechanically stimulated lacZMDSCs compared with nonstimulated lacZ-MDSCs, sFlt1-MDSCs, and shRNA _VEGF MDSCs. Dystrophin-positive myofiber regeneration was significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. In vitro proliferation of MDSCs was not decreased by inhibition of VEGF; however, differentiation into myotubes and adhesion to collagen were significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. Conclusions The beneficial effects of mechanical stimulation on MDSC-mediated muscle repair are lost by inhibiting VEGF. PMID:23723372

Finding the rarest objects in the universe: A new, efficient method for discovering BL Lacertae objects

NASA Technical Reports Server (NTRS)

Stocke, John; Perlman, Eric; Granados, Arno; Schachter, Jonathan; Elvis, Martin; Urry, Meg; Impey, Chris; Smith, Paul

1993-01-01

We present a new, efficient method for discovering new BL Lac Objects based upon the results of the Einstein Extended Medium Sensitivity Survey (EMSS). We have found that all x-ray selected BL Lacs are radio emitters, and further, that in a 'color-color' diagram (radio/optical and optical/x-ray) the BL Lac Objects occupy an area distinct from both radio loud quasars and the radio quiet QSOs and Seyferts which dominate x-ray selected samples. After obtaining radio counterparts via VLA 'snapshot' observations of a large sample of unidentified x-ray sources, the list of candidates is reduced. These candidates then can be confirmed with optical spectroscopy and/or polarimetry. Since greater than 70 percent of these sources are expected to be BL Lacs, the optical observations are very efficient. We have tested this method using unidentified sources found in the Einstein Slew Survey. The 162 Slew Survey x-ray source positions were observed with the VLA in a mixed B/C configuration at 6 cm resulting in 60 detections within 1.5 position error circle radii. These x-ray/optical/radio sources were then plotted, and 40 BL Lac candidates were identified. To date, 10 candidates have been spectroscopically observed resulting in 10 new BL Lac objects! Radio flux, optical magnitude, and polarization statistics (obtained in white light with the Steward Observatory 2.3 m CCD polarimeter) for each are given.

Molecular characterization of the Salmonella typhi StpA protein that is related to both Yersinia YopE cytotoxin and YopH tyrosine phosphatase.

PubMed

Arricau, N; Hermant, D; Waxin, H; Popoff, M Y

1997-01-01

Analysis of the nucleotide sequence of a 4-kb DNA fragment located between the sip and iag loci on Salmonella typhi chromosome revealed three open reading frames, termed sipF, ctpA and stpA. The 82-amino-acid (aa) sipF product showed extensive similarity to the lacP protein from S. typhimurium. The StpA protein (535 aa) exhibited significant similarity to both Yersinia enterocolitica YopE cytotoxin and YopH tyrosine phosphatase. The CtpA polypeptide (130 aa) might be the molecular chaperone of the StpA protein.

Hypothesis-driven classification of materials using nuclear magnetic resonance relaxometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Espy, Michelle A.; Matlashov, Andrei N.; Schultz, Larry J.

Technologies related to identification of a substance in an optimized manner are provided. A reference group of known materials is identified. Each known material has known values for several classification parameters. The classification parameters comprise at least one of T.sub.1, T.sub.2, T.sub.1.rho., a relative nuclear susceptibility (RNS) of the substance, and an x-ray linear attenuation coefficient (LAC) of the substance. A measurement sequence is optimized based on at least one of a measurement cost of each of the classification parameters and an initial probability of each of the known materials in the reference group.

Laccase-catalyzed decolorization of malachite green: performance optimization and degradation mechanism.

PubMed

Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

2015-01-01

Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1) LacA, 109.9 mg L(-1) MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1), respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Bacterial recognition of thermal glycation products derived from porcine serum albumin with lactose.

PubMed

Sarabia-Sainz, Andre-I; Ramos-Clamont, Gabriela; Winzerling, Joy; Vázquez-Moreno, Luz

2011-01-01

Recently, glyco-therapy is proposed to prevent the interaction of bacterial lectins with host ligands (glycoconjugates). This interaction represents the first step in infection. Neoglycans referred to as PSA-Lac (PSA-Glu (β1-4) Gal) were obtained by conjugation of porcine serum albumin (PSA) with lactose at 80 °C, 100 °C and 120 ºC. Characterization studies of the products showed that PSA could contain 1, 38 or 41 added lactoses, depending on the reaction temperature. These neoglycans were approximately 10 times more glycated than PSA-Lac obtained in previous work. Lactose conjugation occurred only at lysines and PSA-Lac contained terminal galactoses as confirmed by Ricinus communis lectin recognition. Furthermore, Escherichia coli K88+, K88ab, K88ac and K88ad adhesins showed affinity toward all PSA-Lac neoglycans, and the most effective was the PSA-Lac obtained after 100 ºC treatment. In vitro, this neoglycan partially inhibited the adhesion of E. coli K88+ to piglet mucin (its natural ligand). These results provide support for the hypothesis that glycated proteins can be used as an alternative for bioactive compounds for disease prevention.

Laccase-Catalyzed Decolorization of Malachite Green: Performance Optimization and Degradation Mechanism

PubMed Central

Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

2015-01-01

Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270

X-Ray Variability of BL Lac Objects

NASA Astrophysics Data System (ADS)

McHardy, Ian

I present an overview of the X-ray temporal and spectral variability of BL Lacs on both short and long timescales. The previously observed behaviour of short (~days) flares superimposed on a relatively steady `quiescent' level is still broadly correct. However, for the brighter BL Lacs, the well sampled lightcurves from the RXTE ASM show that the `quiescent' level also varies considerably on timescales of ~100 days in a manner similar to that seen in Optically Violently Variable Quasars (OVVs) such as 3C279 and 3C273. Possible reasons for this behaviour are discussed. For the large majority of BL Lacs the soft and medium energy X-ray bands are dominated by synchrotron emission and, unlike the case of OVVs, the emission mechanism is not in doubt. Most interest then centres on the structure of the emitting region, and the electron acceleration processes, particularly during outbursts. That structure, and the acceleration processes, can be investigated by consideration of the spectral variability during flares, which is not simple. I review the observations of spectral variability and consider the evidence for and against homogeneous models. I also briefly compare the X-ray spectral variability of BL Lacs with that of OVVs such as 3C273.

Lactosaminated- N-succinyl chitosan nanoparticles for hepatocyte-targeted delivery of acyclovir

NASA Astrophysics Data System (ADS)

Jain, Nivrati; Rajoriya, Vaibhav; Jain, Prateek Kumar; Jain, Ashish Kumar

2014-01-01

The present study discusses lactose-acyclovir- N-succinyl chitosan nanoparticles (Lac- N-Suc-CSNP) using lactose as an asialoglycoprotein receptor (ASGPR) ligand for hepatic parenchymatic cells targeting. For this purpose, N-succinyl chitosan nanoparticles ( N-Suc-CSNP) were prepared previously by ionotropic gelation method and lactose was conjugated to the free amino terminal group of chitosan. Lactose conjugation with N-Suc-CSNP was confirmed by FT-IR and zeta potential measurements. The Lac- N-Suc-CSNP obtained were characterized for their morphology, particle size, polydispersity index, and zeta potential. The Lac- N-Suc-CSNP showed spherical in shape with 220.3 ± 5.0 nm size range, +4.1 ± 0.2 mV zeta potential, 62.5 ± 1.2 % acyclovir entrapment efficiency and showed 27.3 ± 0.9 % cumulative acyclovir release up to 72 h. The acyclovir concentration from Lac- N-Suc-CSNP was found to be 19.9 ± 1.62 μg/g after 24 h administration revealed remarkably targeting potential to the hepatocytes and keep at a high level during the experiment. These results suggest that Lac- N-Suc-CSNP are potentially vector for hepatocytes targeting.

[Feasibility and effectiveness of laparoscopic right colectomy with extracorporeal anastomosis].

PubMed

Feroci, F; Lenzi, E; Kröning, K C; Moraldi, L; Cantafio, S; Borrelli, A; Giaconi, G; Scatizzi, M

2011-02-01

Despite the laparoscopic right hemicolectomy has been validated by many randomized prospective trials, clear evidences on the validity of the totally mini-invasive technique, namely, through intracorporeal anastomosis, are still lacking. The aim of this study was the assessment of short-term outcome within three months from laparoscopic right colectomy with intra- or extra-corporeal anastomosis. With no exclusion, all patients undergoing laparoscopic right hemicolectomy at our institution have been enrolled in this study. Group A included patients undergoing laparoscopic right hemicolectomy with extracorporeal anastomosis (LAC) and Group B, included patients undergoing laparoscopic right hemicolectomy with intracorporeal anastomosis (TLC). Patients' data, surgery details, results of postoperative period and histological tests have been prospectively recorded in a database and analysed. Between December 2006 and December 2008, 45 patients underwent right hemicolectomy, 21 with extracorporeal anastomosis and 24 had intracorporeal ones. As to patients' characteristics and histopathological results there are no difference between the groups. Anastomotic dehiscence occurred one in group A and one in group B (P>0.05). Both patients underwent reoperation. We recorded 6 postoperative ileus with vomiting in the LAC group and only 1 in the TLC group (P<0.05). The incidence of Non-Surgical Site Complications (NSSC) was of 4.54% in LAC group and 8.33% in TLC group (P>0.05). Hospitalization was of 5 days for both groups. In conclusion, we believe that this technique is feasible in terms of safety; it doesn't significatively affect the length of surgical procedure and guarantees maintenance of oncological radicality standards of reference. Besides it significatively improves quality of the post-operative period.

Relations between a novel, reliable, and rapid index of arterial compliance (PP-HDI) and well-established inidices of arterial blood pressure (ABP) in a sample of hypertensive elderly subjects.

PubMed

Bergamini, L; Finelli, M E; Bendini, C; Ferrari, E; Veschi, M; Neviani, F; Manni, B; Pelosi, A; Rioli, G; Neri, M

2009-01-01

Hypertension is a risk factor for a long-lasting arterial wall-remodelling leading to stiffness. The rapid method measuring the pulse pressure (PP) by means of the tool of Hypertension Diagnostic Instruments (HDI) called PP-HDI, overcomes some of the problems arising with more-time consuming methods, like ambulatory blood pressure monitoring (ABPM), and give information about the elasticity of the arterial walls. We studied the relationship between the PP-HDI, the large artery compliance (LA-C) and small artery compliance (SA-C) and few well-established indices of arterial blood pressure (ABP) in a sample of 75 hypertensive subjects, aged 65 years and over. Significant correlations between LA-C and heart rate (HR), PP-ABPM and PP-HDI were found. SA-C relates with HR and systolic blood pressure (SBP) measured in lying and standing positions. Applying a stepwise regression analysis, we found that LA-C variance stems from PP-HDI and HR, while SA-C variance stems from SBP in lying position. Receiver operator characteristic (ROC) curves for thresholds of PP showed that PP-HDI reached levels of sensitivity/specificity similar to PP-ABPM. In conclusion, surveillance of ABP through hemo-dynamic indices, in particular of SBP, is essential, nevertheless the advantage of this control is not known in an elderly population where the organ damage is already evident. PP needs necessarily an instrumental measurement. The PP-HDI result is similar in reliability with respect to PPABPM, but is more rapid and well applicable in an elderly population.

Clustering environments of BL Lac objects

NASA Technical Reports Server (NTRS)

Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.

1993-01-01

We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.

Transcriptional Regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK Operons and Their Role in Biofilm Formation

PubMed Central

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.

2013-01-01

Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800

p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

NASA Technical Reports Server (NTRS)

Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

2001-01-01

Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

Intestinal Microbiota Ecological Response to Oral Administrations of Hydrogen-Rich Water and Lactulose in Female Piglets Fed a Fusarium Toxin-Contaminated Diet.

PubMed

Zheng, Weijiang; Ji, Xu; Zhang, Qing; Yao, Wen

2018-06-16

The objective of the current experiment was to explore the intestinal microbiota ecological response to oral administrations of hydrogen-rich water (HRW) and lactulose (LAC) in female piglets fed a Fusarium mycotoxin-contaminated diet. A total of 24 individually-housed female piglets (Landrace × large × white; initial average body weight, 7.25 ± 1.02 kg) were randomly assigned to receive four treatments (six pigs/treatment): uncontaminated basal diet (negative control, NC), mycotoxin-contaminated diet (MC), MC diet + HRW (MC + HRW), and MC diet + LAC (MC + LAC) for 25 days. Hydrogen levels in the mucosa of different intestine segments were measured at the end of the experiment. Fecal scoring and diarrhea rate were recorded every day during the whole period of the experiment. Short-chain fatty acids (SCFAs) profiles in the digesta of the foregut and hindgut samples were assayed. The populations of selected bacteria and denaturing gradient gel electrophoresis (DGGE) profiles of total bacteria and methanogenic Archaea were also evaluated. Results showed that Fusarium mycotoxins not only reduced the hydrogen levels in the caecum but also shifted the SCFAs production, and populations and communities of microbiota. HRW treatment increased the hydrogen levels of the stomach and duodenum. HRW and LAC groups also had higher colon and caecum hydrogen levels than the MC group. Both HRW and LAC protected against the mycotoxin-contaminated diet-induced higher diarrhea rate and lower SCFA production in the digesta of the colon and caecum. In addition, the DGGE profile results indicated that HRW and LAC might shift the pathways of hydrogen-utilization bacteria, and change the diversity of intestine microbiota. Moreover, HRW and LAC administrations reversed the mycotoxin-contaminated diet-induced changing of the populations of Escherichia coli (E. coli) and Bifidobacterium in ileum digesta and hydrogen-utilizing bacteria in colon digesta.

A helper virus-free HSV-1 vector containing the vesicular glutamate transporter-1 promoter supports expression preferentially in VGLUT1-containing glutamatergic neurons.

PubMed

Zhang, Guo-rong; Geller, Alfred I

2010-05-17

Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.

Sex-dependent regulation of hypothalamic neuropeptide Y-Y1 receptor gene expression in moderate/high fat, high-energy diet-fed mice

PubMed Central

Zammaretti, Francesca; Panzica, Giancarlo; Eva, Carola

2007-01-01

In this study we investigated whether long-term consumption of a moderate/high fat (MHF), high-energy diet can affect the gene expression of the Y1 receptor (Y1R) for neuropeptide Y (NPY) in the dorsomedial (DMH), ventromedial (VMH), arcuate (ARC) and paraventricular (PVN) hypothalamic nuclei of male and female Y1R/LacZ transgenic mice, carrying the murine Y1R promoter linked to the LacZ gene. MHF diet-fed male mice showed an increased consumption of metabolizable energy that was associated with a significant increase in body weight as compared with chow-fed controls. In parallel, consumption of a MHF diet for 8 weeks significantly decreased Y1R/LacZ transgene expression in the DMH and VMH of male mice whereas no changes were found in the ARC and PVN. Leptin treatment reduced body weight of both MHF diet- and chow-fed male mice but failed to prevent the decrease in Y1R/LacZ transgene expression apparent in the DMH and VMH of male mice after 8 weeks of MHF diet intake. Conversely, no significant changes of metabolizable energy intake, body weight or hypothalamic β-galactosidase expression were found in MHF diet-fed female Y1R/LacZ transgenic mice. A gender-related difference of Y1R/LacZ transgenic mice was also observed in response to leptin treatment that failed to decrease body weight of both MHF diet- and chow-fed female mice. Results herein demonstrate that Y1R/LacZ FVB mice show a sexual dimorphism both on energy intake and on nucleus-specific regulation of the NPY Y1R system in the hypothalamus. Overall, these results provide new insights into the mechanism by which diet composition affects the hypothalamic circuit that controls energy homeostasis. PMID:17584829

Identification and characterization of a locus which regulates multiple functions in Pseudomonas tolaasii, the cause of brown blotch disease of Agaricus bisporus.

PubMed Central

Grewal, S I; Han, B; Johnstone, K

1995-01-01

Pseudomonas tolaasii, the causal agent of brown blotch disease of Agaricus bisporus, spontaneously gives rise to morphologically distinct stable sectors, referred to as the phenotypic variant form, at the margins of the wild-type colonies. The phenotypic variant form is nonpathogenic and differs from the wild type in a range of biochemical and physiological characteristics. A genomic cosmid clone (pSISG29) from a wild-type P. tolaasii library was shown to be capable of restoring a range of characteristics of the phenotypic variant to those of the wild-type form, when present in trans. Subcloning and saturation mutagenesis analysis with Tn5lacZ localized a 3.0-kb region from pSISG29, designated the pheN locus, required for complementation of the phenotypic variant to the wild-type form. Marker exchange of the Tn5lacZ-mutagenized copy of the pheN locus into the wild-type strain demonstrated that a functional copy of the pheN gene is required to maintain the wild-type pathogenic phenotype and that loss of the pheN gene or its function results in conversion of the wild-type form to the phenotypic variant form. The pheN locus contained a 2,727-bp open reading frame encoding an 83-kDa protein. The predicted amino acid sequence of the PheN protein showed homology to the sensor and regulator domains of the conserved family of two component bacterial sensor regulator proteins. Southern hybridization analysis of pheN genes from the wild type and the phenotypic variant form revealed that DNA rearrangement occurs within the pheN locus during phenotypic variation. Analysis of pheN expression with a pheN::lacZ fusion demonstrated that expression is regulated by environmental factors. These results are related to a model for control for phenotypic variation in P. tolaasii. PMID:7642492

Period Variations of the Eclipsing Binary Systems T LMi and VX Lac

NASA Astrophysics Data System (ADS)

Yılmaz, M.; İzci, D. D.; Gümüş, D.; Özavci, İ.; Selam, S. O.

2015-07-01

We present a period analysis of the two Algol-type eclipsing binary systems T LMi and VX Lac using all available times of minimum in the literature, as well as new minima obtained at the Ankara University Kreiken Observatory. The period analysis of T LMi suggests mass transfer between the components and also a third body that is dynamically bound to the binary system. The analysis of VX Lac also suggests mass transfer between the components, and the presence of a third and a fourth body under the assumption of a Light-Time Effect. In addition, the periodic variation of VX Lac was examined under the hypothesis of magnetic activity, and the corresponding parameters were derived. We report here the orbital parameters for both systems, along with the ones related to mass transfer, and those for the third and fourth bodies.

The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

PubMed Central

Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

1988-01-01

We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

Time-dependent inhomogeneous jet models for BL Lac objects

NASA Technical Reports Server (NTRS)

Marlowe, A. T.; Urry, C. M.; George, I. M.

1992-01-01

Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.

Time-dependent inhomogeneous jet models for BL Lac objects

NASA Astrophysics Data System (ADS)

Marlowe, A. T.; Urry, C. M.; George, I. M.

1992-05-01

Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.

On the surface density of X-ray selected BL Lacertae objects

NASA Technical Reports Server (NTRS)

Maccacaro, T.; Gioia, I. M.; Maccagni, D.; Stocke, J. T.

1984-01-01

Only a handful of BL Lac objects have been found as a result of systematic optical identification of serendipitous Einstein X-ray sources. By combining the data from two flux-limited complete X-ray surveys (the HEAO 1 A-2 and the Einstein Observatory Medium Sensitivity Survey) the surface density of X-ray emitting BL Lac objects is evaluated as a function of their X-ray flux. It is found that a single power law is not an acceptable representation of the BL Lac objects' X-ray log N-log S. The number-flux relationship is consistent with the Euclidean slope at 'high' flux levels but shows a drastic flattnring below fluxes of the order of 10 to the -12th ergs per sq cm/s. The implications of this result are briefly discussed with respect to the luminosity function, the cosmological evolution, and the X-ray to optical flux ratio in BL Lac objects.

Development of Engineered Bacteriophages for Escherichia coli Detection and High-Throughput Antibiotic Resistance Determination.

PubMed

Chen, Juhong; Alcaine, Samuel D; Jackson, Angelyca A; Rotello, Vincent M; Nugen, Sam R

2017-04-28

T7 bacteriophages (phages) have been genetically engineered to carry the lacZ operon, enabling the overexpression of beta-galactosidase (β-gal) during phage infection and allowing for the enhanced colorimetric detection of Escherichia coli (E. coli). Following the phage infection of E. coli, the enzymatic activity of the released β-gal was monitored using a colorimetric substrate. Compared with a control T7 phage, our T7 lacZ phage generated significantly higher levels of β-gal expression following phage infection, enabling a lower limit of detection for E. coli cells. Using this engineered T7 lacZ phage, we were able to detect E. coli cells at 10 CFU·mL -1 within 7 h. Furthermore, we demonstrated the potential for phage-based sensing of bacteria antibiotic resistance profiling using our T7 lacZ phage, and subsequent β-gal expression to detect antibiotic resistant profile of E. coli strains.

Cytoplasmic delivery of ribozymes leads to efficient reduction in alpha-lactalbumin mRNA levels in C127I mouse cells.

PubMed Central

L'Huillier, P J; Davis, S R; Bellamy, A R

1992-01-01

Ribozymes targeted to five sites along the alpha-lactalbumin (alpha-lac) mRNA were delivered to the cytoplasm of mouse C127I mammary cells using the T7-vaccinia virus delivery system and the amount of alpha-lac mRNA was monitored 24-48 h post-transfection. Three target sites were selected in the alpha-lac coding region (nucleotides 15, 145 and 361) and two were located in the 3' non-coding region (nucleotides 442 and 694). Acting in trans and at a target:ribozyme ratio of 1:1000, ribozymes targeting sites 361 and 694 reduced alpha-lac mRNA by > 80%; another two ribozymes (targeting nucleotides 442 and 145) reduced mRNA levels by 80 and 60% respectively; the fifth ribozyme (targeting nucleotide 15, near the AUG) was largely ineffective. The kinetic activity (kcat) of each ribozyme in vitro was somewhat predictive of the activity of the two ribozymes that targeted nucleotides 361 and 694, but was not predictive of the in vivo activity of the other three ribozymes. Down-regulation of the intracellular levels of alpha-lac paralleled the ribozyme-dependent reduction achieved for mRNA. For site 442, the reduction in both mRNA and protein was attributed to the catalytic activity of the ribozyme rather than to the antisense effects of the flanking arms, because delivery of an engineered (catalytically-inactive) variant had no effect on mRNA levels and a minimal effect on the level of alpha-lac present in the cell. Images PMID:1425576

THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aartsen, M. G.; Abraham, K.; Ackermann, M.

2017-01-20

The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in themore » 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.« less

Trends in Public and Global Health Education among Nationally Recognized Undergraduate Liberal Arts Colleges in the United States.

PubMed

Robinson, Patrick A; Orroth, Kate K; Stutts, Lauren A; Baron, Patrick A; Wessner, David R

2018-05-01

The prevalence of public health and global health (PH/GH) curricular offerings appear to be increasing in terms of undergraduate curricula and in the context of liberal arts education in the United States. Liberal arts colleges (LACs) represent stand-alone institutions, which exclusively focus on undergraduate education. The objective of this study was to assess the prevalence of PH/GH study pathways and PH/GH course offerings among LACs. All LACs identified through the US News and World Report (USNWR) college rankings were contacted with a survey about the following: formal majors, minors, or concentrations in PH/GH; independent study (IS) pathways for PH/GH; specific PH/GH courses offered; and the number of students graduating in 2016, 2017, and 2018 with formal and IS degrees in PH/GH. Demographic characteristics of the colleges came from the USNWR database. Almost half (43%) of all LACs in our sample offer a PH/GH major, minor, concentration, or IS pathway. Almost all (90%) colleges offer at least one course in PH/GH. Approximately 2,000 students attending these LACs pursued or are pursuing graduation with majors, minors, or concentrations in PH/GH for the years 2016-2018. The number of students pursuing formal PH/GH programs has increased by 25% from 2016 to 2018. Student interest in public health is rising in U.S. LACs, with more students seeking formal curricular or IS PH degree pathways. Public health messages are prevalent even among institutions without formal programs. Colleges without programs should consider integrating public health into their curriculum.

BL Lacertae Objects Beyond Redshift 1.3 - UV-to-NIR Photometry and Photometric Redshift for Fermi/LAT Blazars

NASA Technical Reports Server (NTRS)

Rau, A.; Schady, P.; Greiner, J.; Salvato, M.; Ajello, M.; Bottacini, E.; Gehrels, N.; Afonso, P. M. J.; Elliott, J.; Filgas, R.;

Arm-Gal4 inheritance influences development and lifespan in Drosophila melanogaster.

PubMed

Slade, F A; Staveley, B E

2015-10-19

The UAS-Gal4 ectopic expression system is a widely used and highly valued tool that allows specific gene expression in Drosophila melanogaster. Yeast transcription factor Gal4 can be directed using D. melanogaster transcriptional control elements, and is often assumed to have little effect on the organism. By evaluation of the consequences of maternal and paternal inheritance of a Gal4 transgene under the transcriptional regulation of armadillo control elements (arm-Gal4), we demonstrated that Gal4 expression could be detrimental to development and longevity. Male progeny expressing arm-Gal4 in the presence of UAS-lacZ transgene had reduced numbers and size of ommatidia, compared to flies expressing UAS-lacZ transgene under the control of other Gal4 transgenes. Aged at 25°C, the median life span of male flies with maternally inherited elav-Gal4 was 70 days, without a responding transgene or with UAS-lacZ. The median life span of maternally inherited arm-Gal4 male flies without a responding transgene was 48 days, and 40 days with the UAS-lacZ transgene. A partial rescue of this phenotype was observed with the expression of UAS-lacZ under paternal arm-Gal4 control, having an average median lifespan of 60 days. This data suggests that arm-Gal4 has detrimental effects on Drosophila development and lifespan that are directly dependent upon parental inheritance, and that the benign responder and reporter gene UAS-lacZ may influence D. melanogaster development. These findings should be taken into consideration during the design and execution of UAS-Gal4 expression experiments.

Efficacy of anticoagulation in resolving left atrial and left atrial appendage thrombi: A transesophageal echocardiographic study

NASA Technical Reports Server (NTRS)

Jaber, W. A.; Prior, D. L.; Thamilarasan, M.; Grimm, R. A.; Thomas, J. D.; Klein, A. L.; Asher, C. R.

2000-01-01

BACKGROUND: Transesophageal echocardiography (TEE) is the gold standard for evaluation of the left atrium and the left atrial appendage (LAA) for the presence of thrombi. Anticoagulation is conventionally used for patients with atrial fibrillation to prevent embolization of atrial thrombi. The mechanism of benefit and effectiveness of thrombi resolution with anticoagulation is not well defined. METHODS AND RESULTS: We used a TEE database of 9058 consecutive studies performed between January 1996 and November 1998 to identify all patients with thrombi reported in the left atrium and/or LAA. One hundred seventy-four patients with thrombi in the left atrial cavity (LAC) and LAA were identified (1.9% of transesophageal studies performed). The incidence of LAA thrombi was 6.6 times higher than LAC thrombi (151 vs 23, respectively). Almost all LAC thrombi were visualized on transthoracic echocardiography (90.5%). Mitral valve pathology was associated with LAC location of thrombi (P <.0001), whereas atrial fibrillation or flutter was present in most patients with LAA location of thrombi. Anticoagulation of 47 +/- 18 days was associated with thrombus resolution in 80.1% of the patients on follow-up TEE. Further anticoagulation resulted in limited additional benefit. CONCLUSIONS: LAC thrombi are rare and are usually associated with mitral valve pathology. Transthoracic echocardiography is effective in identifying these thrombi. LAA thrombi occur predominantly in patients with atrial fibrillation or flutter. Short-term anticoagulation achieves a high rate of resolution of LAA and LAC thrombi but does not obviate the need for follow-up TEE.

Identification of putative candidate genes involved in cuticle formation in Prunus avium (sweet cherry) fruit

PubMed Central

Alkio, Merianne; Jonas, Uwe; Sprink, Thorben; van Nocker, Steven; Knoche, Moritz

2012-01-01

Background and Aims The cuticular membrane (CM) of Prunus avium (sweet cherry) and other fleshy fruit is under stress. Previous research indicates that the resultant strain promotes microscopic cuticular cracking. Microcracks impair the function of the CM as a barrier against pathogens and uncontrolled water loss/uptake. Stress and strain result from a cessation of CM deposition during early development, while the fruit surface continues to expand. The cessation of CM deposition, in turn, may be related to an early downregulation of CM-related genes. The aims of this study were to identify genes potentially involved in CM formation in sweet cherry fruit and to quantify their expression levels. Methods Fruit growth and CM deposition were quantified weekly from anthesis to maturity and rates of CM deposition were calculated. Sequences of genes expressed in the sweet cherry fruit skin (exocarp) were generated using high-throughput sequencing of cDNA and de novo assembly and analysed using bioinformatics tools. Relative mRNA levels of selected genes were quantified in the exocarp and fruit flesh (mesocarp) weekly using reverse transcriptase-quantitative real-time PCR and compared with the calculated CM deposition rate over time. Key Results The rate of CM deposition peaked at 93 (±5) μg per fruit d−1 about 19 d after anthesis. Based on sequence analyses, 18 genes were selected as potentially involved in CM formation. Selected sweet cherry genes shared up to 100 and 98 % similarity with the respective Prunus persica (peach) and Arabidopsis thaliana genes. Expression of 13 putative CM-related genes was restricted to the exocarp and correlated positively with the CM deposition rate. Conclusions The results support the view that the cessation of CM deposition during early sweet cherry fruit development is accounted for by a downregulation of genes involved in CM deposition. Genes that merit further investigation include PaWINA, PaWINB, PaLipase, PaLTPG1, PaATT1, PaLCR, PaGPAT4/8, PaLACS2, PaLACS1 and PaCER1. PMID:22610921

The comparative effects of 3% saline and 0.5M sodium lactate on cardiac function:a randomised, crossover study in volunteers.

PubMed

Nalos, Marek; Kholodniak, Euguenia; Smith, Louise; Orde, Sam; Ting, Iris; Slama, Michel; Seppelt, Ian; McLean, Anthony S; Huang, Stephen

2018-06-01

To investigate the metabolic and cardiac effects of intravenous administration of two hypertonic solutions - 3% saline (SAL) and 0.5M sodium lactate (LAC). A randomised, doubleblind, crossover study in ten human volunteers. Intravenous bolus of either SAL or LAC at 3 mL/kg over 20 min followed by a 2 mL/kg infusion over 60 min. Acid base parameters and echocardiographic indices of cardiac function, cardiac output (CO), left ventricular ejection fraction (LVEF) and mitral annular peak systolic velocity (Sm) before and after infusion of SAL or LAC. Despite haemodilution, we observed an increase in sodium (139 ± 2 mmol/L to 142 ± 2 mmol/L in both groups) and respective anions, chloride (106 ± 2 mmol/L to 112 ± 3 mmol/L) and lactate (1.01 ± 0.28 mmol/L to 2.38 ± 0.38 mmol/L) with SAL and LAC, respectively. The pH (7.37 ± 0.03 to 7.45 ± 0.03; P < 0.01) and simplified strong ion difference (SID) (36.3 ± 4.6 mmol/L to 39.2 ± 3.6 mmol/L; P < 0.01) increased during the LAC infusion. The pH was unchanged, but SID decreased during SAL infusion (36.3 ± 2.5 mmol/L to 33.9 ± 3.1 mmol/L; P = 0.01). Both solutions led to an increase in preload and cardiac function, CO (4.36 ± 0.79 L/min to 4.98 ± 1.37 L/ min v 4.62 ± 1.30 L/min to 5.13 ± 1.44 L/min), LVEF (61 ± 6% to 63 ± 8% v 64 ± 6% to 68 ± 7%). The averaged Sm improved in the LAC group as compared with the SAL group (0.088 ± 0.008 to 0.096 ± 0.016 v 0.086 ± 0.012 to 0.082 ± 0.012; P = 0.032). The administration of SAL or LAC has opposing effects on acid base variables such as SID. Hypertonic fluid infusion lead to increased cardiac preload and performance with Sm, suggesting better left ventricular systolic function during LAC as compared with SAL. Lactated hypertonic solutions should be evaluated as resuscitation fluids.

Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

PubMed

Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

2014-01-01

Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Membrane microdomains in immunity: glycosphingolipid-enriched domain-mediated innate immune responses.

PubMed

Iwabuchi, Kazuhisa; Nakayama, Hitoshi; Masuda, Hiromi; Kina, Katsunari; Ogawa, Hideoki; Takamori, Kenji

2012-01-01

Over the last 30 years, many studies have indicated that glycosphingolipids (GSLs) expressed on the cell surface may act as binding sites for microorganisms. Based on their physicochemical characteristics, GSLs form membrane microdomains with cholesterol, sphingomyelin, glycosylphosphatidylinositol (GPI)-anchored proteins, and various signaling molecules, and GSL-enriched domains have been shown to be involved in these defense responses. Among the GSLs, lactosylceramide (LacCer, CDw17) can bind to various microorganisms. LacCer is expressed at high levels on the plasma membrane of human neutrophils, and forms membrane microdomains associated with the Src family tyrosine kinase Lyn. LacCer-enriched membrane microdomains mediate superoxide generation, chemotaxis, and non-opsonic phagocytosis. Therefore, LacCer-enriched membrane microdomains are thought to function as pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs) expressed on microorganisms. In contrast, several pathogens have developed infection mechanisms using membrane microdomains. In addition, some pathogens have the ability to avoid degradation by escaping from the vacuolar compartment or preventing phagosome maturation, utilizing membrane microdomains, such as LacCer-enriched domains, of host cells. The detailed molecular mechanisms of these membrane microdomain-associated host-pathogen interactions remain to be elucidated. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.

PubMed Central

Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D

1993-01-01

Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005

LC–MS/MS Quantitation of Esophagus Disease Blood Serum Glycoproteins by Enrichment with Hydrazide Chemistry and Lectin Affinity Chromatography

PubMed Central

2015-01-01

Changes in glycosylation have been shown to have a profound correlation with development/malignancy in many cancer types. Currently, two major enrichment techniques have been widely applied in glycoproteomics, namely, lectin affinity chromatography (LAC)-based and hydrazide chemistry (HC)-based enrichments. Here we report the LC–MS/MS quantitative analyses of human blood serum glycoproteins and glycopeptides associated with esophageal diseases by LAC- and HC-based enrichment. The separate and complementary qualitative and quantitative data analyses of protein glycosylation were performed using both enrichment techniques. Chemometric and statistical evaluations, PCA plots, or ANOVA test, respectively, were employed to determine and confirm candidate cancer-associated glycoprotein/glycopeptide biomarkers. Out of 139, 59 common glycoproteins (42% overlap) were observed in both enrichment techniques. This overlap is very similar to previously published studies. The quantitation and evaluation of significantly changed glycoproteins/glycopeptides are complementary between LAC and HC enrichments. LC–ESI–MS/MS analyses indicated that 7 glycoproteins enriched by LAC and 11 glycoproteins enriched by HC showed significantly different abundances between disease-free and disease cohorts. Multiple reaction monitoring quantitation resulted in 13 glycopeptides by LAC enrichment and 10 glycosylation sites by HC enrichment to be statistically different among disease cohorts. PMID:25134008

Influence of excipients in comilling on mitigating milling-induced amorphization or structural disorder of crystalline pharmaceutical actives.

PubMed

Balani, Prashant N; Ng, Wai Kiong; Tan, Reginald B H; Chan, Sui Yung

2010-05-01

The feasibility of using excipients to suppress the amorphization or structural disorder of crystalline salbutamol sulphate (SS) during milling was investigated. SS was subjected to ball-milling in the presence of alpha-lactose monohydrate (LAC), adipic acid (AA), magnesium stearate (MgSt), or polyvinyl pyrrolidone (PVP). X-ray powder diffraction, dynamic vapor sorption (DVS), high sensitivity differential scanning calorimetry (HSDSC) were used to analyze the crystallinity of the milled mixtures. Comilling with crystalline excipients, LAC, AA, and MgSt proved effective in reducing the amorphization of SS. LAC, AA, or MgSt acting as seed crystals to induce recrystallization of amorphous SS formed by milling. During comilling, both SS and LAC turned predominantly amorphous after 45 min but transformed back to a highly crystalline state after 60 min. Amorphous content was below the detection limits of DVS (0.5%) and HSDSC (5%). Comilled and physical mixtures of SS and ALM were stored under normal and elevated humidity conditions. This was found to prevent subsequent changes in crystallinity and morphology of comilled SS:LAC as compared to significant changes in milled SS and physical mixture. These results demonstrate a promising application of comilling with crystalline excipients in mitigating milling induced amorphization of pharmaceutical actives.

Evaluation of anaerobic threshold in non-pregnant and pregnant rats.

PubMed

Netto, Aline Oliveira; Macedo, Nathália C D; Gallego, Franciane Q; Sinzato, Yuri K; Volpato, Gustavo T; Damasceno, Débora C

2017-01-01

Several studies present different methodologies and results about intensity exercise, and many of them are performed in male rats. However, the impact of different type, intensity, frequency and duration of exercise on female rats needs more investigation. From the analysis of blood lactate concentration during lactate minimum test (LacMin) in the swimming exercise, the anaerobic threshold (AT) was identified, which parameter is defined as the transition point between aerobic and anaerobic metabolism. LacMin test is considered a good indicator of aerobic conditioning and has been used in prescription of training in different exercise modalities. However, there is no evidence of LacMin test in female rats. The objective was to determine AT in non-pregnant and pregnant Wistar rats. The LacMin test was performed and AT defined for mild exercise intensity was from a load equivalent to 1% of body weight (bw), moderate exercise as carrying 4% bw and severe intensity as carrying 7% bw. In pregnant rats, the AT was reached at a lower loading from 5.0% to 5.5% bw, while in non-pregnant the load was from 5.5% to 6.0% bw. Thus, this study was effective to identify exercise intensities in pregnant and non-pregnant rats using anaerobic threshold by LacMin test.

A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.

PubMed

Elliott, T

1992-01-01

This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.

In vitro effect of dietary protein level and nondigestible oligosaccharides on feline fecal microbiota.

PubMed

Pinna, C; Stefanelli, C; Biagi, G

2014-12-01

The aim of the present study was to evaluate in vitro the effect of some prebiotic substances and 2 dietary protein levels on the composition and activity of feline fecal microbiota. Two in vitro studies were conducted. First, 6 nondigestible oligosaccharides were studied; treatments were control diet (CTRL), gluconic acid (GA), carrot fiber (CF), fructooligosaccharides (FOS), galactooligosaccharides (GOS), lactitol (LAC), and pectins from citrus fruit (PEC). Substrates were added to feline fecal cultures at 2 g/L for 24 h incubation. Compared with the CTRL, ammonia had been reduced (P<0.05) by GOS (-9%) after 6 h and by GA (-14%), LAC (-12%), and PEC (-10%) after 24 h. After 24 h, all treatments had resulted in a lower pH versus the CTRL. Putrescine concentrations at 24 h were greater (P<0.05) in cultures treated with FOS (+90%), GOS (+96%), and LAC (+87%). Compared with the CTRL, total VFA were higher (P<0.05) in bottles containing CF (+41%), whereas the acetic to propionic acid ratio was reduced by LAC (-51%; P<0.05). After 24 h, Enterobacteriaceae had been reduced (P<0.05) by LAC and PEC. In a second study, LAC and FOS were selected to be tested in the presence of 2 diets differing in their protein content. There were 6 treatments: low-protein (LP) CTRL with no addition of prebiotics (CTRL-LP), high-protein (HP) CTRL with no addition of prebiotics (CTRL-HP), LP diet plus FOS, CTRL-HP plus FOS, LP diet plus LAC, and CTRL-HP plus LAC. Both FOS and LAC were added to feline fecal cultures at 2 g/L for 24 h incubation. Ammonia at 24 h was affected (P<0.05) by the protein level (36.2 vs. 50.2 mmol/L for LP and HP, respectively). The CTRL-HPs resulted in a higher pH and increased concentrations of biogenic amines were found after 6 and 24 h of incubation (P<0.05); putrescine at 24 h showed an increase (P<0.05) in cultures treated with FOS. Total VFA were influenced (P<0.05) by the protein level (40.9 vs. 32.6 mmol/L for LP and HP, respectively). At 24 h, the CTRL-HPs were associated with increased Clostridium perfringens and reduced Lactobacillus spp. and enterococci counts (P<0.05). The results from the present study show that different prebiotics exert different effects on the composition and activity of feline intestinal microbiota and that high dietary protein levels in a cat's diet can have negative effects on the animal intestinal environment.

Developing and piloting a peer mentoring intervention to reduce teenage pregnancy in looked-after children and care leavers: an exploratory randomised controlled trial.

PubMed

Mezey, Gillian; Meyer, Deborah; Robinson, Fiona; Bonell, Chris; Campbell, Rona; Gillard, Steve; Jordan, Peter; Mantovani, Nadia; Wellings, Kaye; White, Sarah

2015-10-01

Looked-after children (LAC) are at greater risk of teenage pregnancy than non-LAC, which is associated with adverse health and social consequences. Existing interventions have failed to reduce rates of teenage pregnancy in LAC. Peer mentoring is proposed as a means of addressing many of the factors associated with the increased risk of teenage pregnancy in this group. To develop a peer mentoring intervention to reduce teenage pregnancy in LAC. Phase I and II randomised controlled trial of a peer mentoring intervention for LAC; scoping exercise and literature search; national surveys of social care professionals and LAC; and focus groups and interviews with social care professionals, mentors and mentees. Three local authorities (LAs) in England. LAC aged 14-18 years (mentees/care as usual) and 19-25 years (mentors). Recruitment and training of mentors; randomisation and matching of mentors to mentees; and 1-year individual peer mentoring. pregnancy in LAC aged 14-18 years. sexual attitudes, behaviour and knowledge; psychological health; help-seeking behaviour; locus of control; and attachment style. A health economic evaluation was also carried out. In total, 54% of target recruitment was reached for the exploratory trial and 13 out of 20 mentors (65%) and 19 out of 30 LAC aged 14-18 years (63%) (recruited during Phases I and II) were retained in the research. The training programme was acceptable and could be manualised and replicated. Recruitment and retention difficulties were attributed to systemic problems and LA lack of research infrastructure and lack of additional funding to support and sustain such an intervention. Mentees appeared to value the intervention but had difficulty in meeting weekly as required. Only one in four of the relationships continued for the full year. A future Phase III trial would require the intervention to be modified to include provision of group and individual peer mentoring; internal management of the project, with support from an external agency such as a charity or the voluntary sector; funds to cover LA research costs, including the appointment of a dedicated project co-ordinator; a reduction in the lower age for mentee recruitment and an increase in the mentor recruitment age to 21 years; and the introduction of a more formal recruitment and support structure for mentors. Given the problems identified and described in mounting this intervention, a new development phase followed by a small-scale exploratory trial incorporating these changes would be necessary before proceeding to a Phase III trial. This project was funded by the NIHR Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 19, No. 85. See the NIHR Journals Library website for further project information.

Characteristics of the LacTek test as applied to tissue samples: assessment of performance using incurred field samples.

PubMed

Mitchell, J M; McNab, W B; Yee, A J; Griffiths, M W; McEwen, S A; Spilsbury, L; Boison, J O

1998-08-01

The Lactek test, marketed for antimicrobial residue detection in milk, was validated for the detection of antimicrobial residues in tissues. A previous study found that the LacTek test could confidently identify tissue samples spiked with antimicrobial residues. However, the test could not reliably distinguish violative from nonviolative spiked samples relative to Canadian maximum residue limits (MRLs). The objectives of this study were to assess and compare the performance of the LacTek tests for beta-lactams, tetracyclines, gentamicin, and sulfamethazine on samples containing naturally incurred residues by running the test in parallel with the standard microbial inhibition test (MIT) presently used for the routine testing of tissues at our facility and to assess the agreement with high pressure liquid chromatographic (HPLC) determinative methods. Parallel testing with the official MIT found that the Lactek tests could be confidently used for testing tissue samples containing incurred residues. Among 1,008 MIT-positive samples, the LacTek test found that 90% contained beta-lactams and/or tetracyclines. A further 7.3% of violative residues could not be identified to an antimicrobial class. In addition, 9% of samples testing negative on the MIT were found to contain an antimicrobial residue by the LacTek tests. Comparative testing with HPLC methods found that there was very good agreement between the two tests and that most violations were due to penicillin G and oxytetracycline. Although the LacTek test cannot be used to distinguish violative from nonviolative residue levels, it does offer several advantages over the present MIT. These include speed, ease of use, the ability to identify residues to a specific class, and an improved sensitivity at the MRL level for the most commonly found antimicrobials in tissue.

Comparison of vonoprazan and proton pump inhibitors for eradication of Helicobacter pylori.

PubMed

Shinozaki, Satoshi; Nomoto, Hiroaki; Kondo, Yoshie; Sakamoto, Hirotsugu; Hayashi, Yoshikazu; Yamamoto, Hironori; Lefor, Alan Kawarai; Osawa, Hiroyuki

2016-05-01

Alternative eradication therapies for Helicobacter pylori infection are needed because of an increasing failure rate over the past decade. The aim of this study was to determine if vonoprazan, a new potassium-competitive acid blocker, showed superiority to existing proton pump inhibitors for primary eradication of H. pylori in routine clinical practice. Data for 573 patients who underwent primary H. pylori eradication therapy were retrospectively reviewed. Regimens included clarithromycin 200 mg, amoxicillin 750 mg, and an acid-suppressing drug [lansoprazole 30 mg (LAC), rabeprazole 10 mg (RAC), esomeprazole 20 mg (EAC), or vonoprazan 20 mg (VAC)] twice daily for 1 week. Eradication was successful in 73% (419/573) of patients using intention-to-treat (ITT) analysis and 76% (419/549) of patients in per-protocol (PP) analysis. The VAC group had a significantly superior eradication rate compared with the LAC and RAC groups in ITT (VAC 83%, LAC 66% and RAC 67%, p < 0.01) and PP analysis (VAC 85%, LAC 69% and RAC 70%, p < 0.01), and had a similarly high eradication rate to the EAC group (83% in ITT and 87% in PP). Although the eradication rate in the VAC and EAC groups was not significantly higher than in the LAC and RAC groups in patients with mild gastric atrophy with both ITT and PP analyses, it was significantly higher in patients with severe gastric atrophy (p < 0.01). The VAC group had a significantly higher H. pylori eradication rate than the LAC and RAC groups, and a > 80% eradication rate regardless of the degree of atrophy. Copyright © 2016. Published by Elsevier Taiwan.

L-Acetylcarnitine in dysthymic disorder in elderly patients: a double-blind, multicenter, controlled randomized study vs. fluoxetine.

PubMed

Bersani, Giuseppe; Meco, Giuseppe; Denaro, Alessandro; Liberati, Damien; Colletti, Chiara; Nicolai, Raffaella; Bersani, Francesco Saverio; Koverech, Aleardo

2013-10-01

L-Acetylcarnitine (LAC), the acetyl ester of carnitine naturally present in the central nervous system and involved in several neural pathways, has been demonstrated to be active in various animal experimental models resembling some features of human depression. The aim of the study is to verify whether LAC can have an antidepressant action in a population of elderly patients with dysthymic disorder in comparison with a traditional antidepressant such as fluoxetine. Multicentric, double-blind, double-dummy, controlled, randomized study based on a observation period of 7 weeks. 80 patients with DSM-IV diagnosis of dysthymic disorder were enrolled in the study and subdivided into 2 groups. Group A patients received LAC plus placebo; group B patients received fluoxetine 20 mg/die plus placebo. Clinical assessment was performed through several psychometric scales at 6 different moments. Group A patients showed a statistically significant improvement in the following scales: HAM-D, HAM-A, BDI and Touluse Pieron Test. Comparison between the two groups, A and B, generally showed very similar clinical progression. The results obtained with LAC and fluoxetine were equivalent. As the subjects in this study were of senile age, it is possible to hypothesize that the LAC positive effect on mood could be associated with improvement in subjective cognitive symptomatology. The difference in the latency time of clinical response (1 week of LAC treatment, compared with the 2 weeks' latency time with fluoxetine) suggests the existence of different mechanisms of action possibly in relation to the activation of rapid support processes of neuronal activity. Copyright © 2012 Elsevier B.V. and ECNP. All rights reserved.

Unspecific membrane protein-lipid recognition: combination of AFM imaging, force spectroscopy, DSC and FRET measurements.

PubMed

Borrell, Jordi H; Montero, M Teresa; Morros, Antoni; Domènech, Òscar

2015-11-01

In this work, we will describe in quantitative terms the unspecific recognition between lactose permease (LacY) of Escherichia coli, a polytopic model membrane protein, and one of the main components of the inner membrane of this bacterium. Supported lipid bilayers of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) (3:1, mol/mol) in the presence of Ca(2+) display lateral phase segregation that can be distinguished by atomic force microscopy (AFM) as well as force spectroscopy. LacY shows preference for fluid (Lα) phases when it is reconstituted in POPE : POPG (3:1, mol/mol) proteoliposomes at a lipid-to-protein ratio of 40. When the lipid-to-protein ratio is decreased down to 0.5, two domains can be distinguished by AFM. While the upper domain is formed by self-segregated units of LacY, the lower domain is constituted only by phospholipids in gel (Lβ) phase. On the one hand, classical differential scanning calorimetry (DSC) measurements evidenced the segregation of a population of phospholipids and point to the existence of a boundary region at the lipid-protein interface. On the other hand, Förster Resonance Energy Transfer (FRET) measurements in solution evidenced that POPE is selectively recognized by LacY. A binary pseudophase diagram of POPE : POPG built from AFM observations enables to calculate the composition of the fluid phase where LacY is inserted. These results are consistent with a model where POPE constitutes the main component of the lipid-LacY interface segregated from the fluid bulk phase where POPG predominates. Copyright © 2015 John Wiley & Sons, Ltd.

Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.

PubMed

Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco

2013-04-01

Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

Mutations in the sigma subunit of E. coli RNA polymerase which affect positive control of transcription.

PubMed

Hu, J C; Gross, C A

1985-01-01

The sigma subunits of bacterial RNA polymerases are required for the selective initiation of transcription. We have isolated and characterized mutations in rpoD, the gene which encodes the major form of sigma in E. coli, which affect the selectivity of transcription. These mutations increase the expression of araBAD up to 12-fold in the absence of CAP-cAMP. Expression of lac is unaffected, while expression of malT-activated operons is decreased. We determined the DNA sequence of 17 independently isolated mutations, and found that they consist of three different changes in a single CGC arginine codon at position 596 in the sigma polypeptide.

Deep Eutectic Solvents (DESs) for the Isolation of Willow Lignin (Salix matsudana cv. Zhuliu)

PubMed Central

Li, Tengfei; Liu, Yu; Lou, Rui; Yang, Guihua; Chen, Jiachuan; Saeed, Haroon A. M.

2017-01-01

Deep eutectic solvents (DESs) are a potentially high-value lignin extraction methodology. DESs prepared from choline chloride (ChCl) and three hydrogen-bond donors (HBD)—lactic acid (Lac), glycerol, and urea—were evaluated for isolation of willow (Salix matsudana cv. Zhuliu) lignin. DESs types, mole ratio of ChCl to HBD, extraction temperature, and time on the fractionated DES-lignin yield demonstrated that the optimal DES-lignin yield (91.8 wt % based on the initial lignin in willow) with high purity of 94.5% can be reached at a ChCl-to-Lac molar ratio of 1:10, extraction temperature of 120 °C, and time of 12 h. Fourier transform infrared spectroscopy (FT-IR) , 13C-NMR, and 31P-NMR showed that willow lignin extracted by ChCl-Lac was mainly composed of syringyl and guaiacyl units. Serendipitously, a majority of the glucan in willow was preserved after ChCl-Lac treatment. PMID:29143790

An alkaline bacterial laccase for polymerization of natural precursors for hair dye synthesis.

PubMed

Kumar, Deepak; Kumar, Aditya; Sondhi, Sonica; Sharma, Prince; Gupta, Naveen

2018-03-01

In the present study, an extracellular alkali stable laccase (Lac DS) from Bacillus subtilis DS which has pH optima at 8.5 using p -phenylenediamine (PPD) as substrate has been reported. Lac DS retained 70% activity for 4 h at pH 8.5 and 90% activity for 24 h at 55 °C. The enzyme yield was enhanced by optimization of fermentation conditions. A 746-fold increase in yield was observed under optimized conditions using 150 µM MgSO 4 , 1.2% yeast extract, 0.35% tryptone, and 150 µM vanillic acid. Lac DS was used to polymerize natural dye precursor catechol, pyrogallol, syringaldehyde, syringic acid, ferulic acid and gallic acid to develop a range of natural hair colors such as black, golden yellow, and reddish brown. The results indicate that alkaline Lac DS is a suitable candidate to develop a user-friendly and commercially applicable hair dyeing process in the area of cosmetic industry.

Significance of blood pressure variability in patients with sepsis.

PubMed

Pandey, Nishant Raj; Bian, Yu-Yao; Shou, Song-Tao

2014-01-01

This study was undertaken to observe the characteristics of blood pressure variability (BPV) and sepsis and to investigate changes in blood pressure and its value on the severity of illness in patients with sepsis. Blood parameters, APACHE II score, and 24-hour ambulatory BP were analyzed in 89 patients with sepsis. In patients with APACHE II score>19, the values of systolic blood pressure (SBPV), diasystolic blood pressure (DBPV), non-dipper percentage, cortisol (COR), lactate (LAC), platelet count (PLT) and glucose (GLU) were significantly higher than in those with APACHE II score ≤19 (P<0.05), whereas the values of procalcitonin (PCT), white blood cell (WBC), creatinine (Cr), PaO2, C-reactive protein (CRP), adrenocorticotropic hormone (ACTH) and tumor necrosis factor α (TNF-α) were not statistically significant (P>0.05). Correlation analysis showed that APACHE II scores correlated significantly with SBPV and DBPV (P<0.01, r=0.732 and P<0.01, r=0.762). SBPV and DBPV were correlated with COR (P=0.018 and r=0.318; P=0.008 and r=0.353 respectively). However, SBPV and DBPV were not correlated with TNF-α, IL-10, and PCT (P>0.05). Logistic regression analysis of SBPV, DBPV, APACHE II score, and LAC was used to predict prognosis in terms of survival and non-survival rates. Receiver operating characteristics curve (ROC) showed that DBPV was a better predictor of survival rate with an AUC value of 0.890. However, AUC of SBPV, APACHE II score, and LAC was 0.746, 0.831 and 0.915, respectively. The values of SBPV, DBPV and non-dipper percentage are higher in patients with sepsis. DBPV and SBPV can be used to predict the survival rate of patients with sepsis.

Repression of choline kinase by inositol and choline in Saccharomyces cerevisiae.

PubMed Central

Hosaka, K; Murakami, T; Kodaki, T; Nikawa, J; Yamashita, S

1990-01-01

The regulation of choline kinase (EC 2.7.1.32), the initial enzyme in the CDP-choline pathway, was examined in Saccharomyces cerevisiae. The addition of myo-inositol to a culture of wild-type cells resulted in a significant decrease in choline kinase activity. Additional supplementation of choline caused a further reduction in the activity. The coding frame of the choline kinase gene, CK1, was joined to the carboxyl terminus of lacZ and expressed in Escherichia coli as a fusion protein, which was then used to prepare an anti-choline kinase antibody. Upon Western (immuno-) and Northern (RNA) blot analyses using the antibody and a CK1 probe, respectively, the decrease in the enzyme activity was found to be correlated with decreases in the enzyme amount and mRNA abundance. The molecular mass of the enzyme was estimated to be 66 kilodaltons, in agreement with the value predicted previously from the nucleotide sequence of the gene. The coding region of CK1 was replaced with that of lacZ, and CK1 expression was measured by assaying beta-galactosidase. The expression of beta-galactosidase from this fusion was repressed by myo-inositol and choline and derepressed in a time-dependent manner upon their removal. The present findings indicate that yeast choline kinase is regulated by myo-inositol and choline at the level of mRNA abundance. Images FIG. 3 FIG. 4 PMID:2156807

Transcriptional silencing of a transgene by RNAi in the soma of C. elegans.

PubMed

Grishok, Alla; Sinskey, Jina L; Sharp, Phillip A

2005-03-15

The silencing of transgene expression at the level of transcription in the soma of Caenorhabditis elegans through an RNAi-dependent pathway has not been previously characterized. Most gene silencing due to RNAi in C. elegans occurs at the post-transcriptional level. We observed transcriptional silencing when worms containing the elt-2::gfp/LacZ transgene were fed RNA produced from the commonly used L4440 vector. The transgene and the vector share plasmid backbone sequences. This transgene silencing depends on multiple RNAi pathway genes, including dcr-1, rde-1, rde-4, and rrf-1. Unlike post-transcriptional gene silencing in worms, elt-2::gfp/LacZ silencing is dependent on the PAZ-PIWI protein Alg-1 and on the HP1 homolog Hpl-2. The latter is a chromatin silencing factor, and expression of the transgene is inhibited at the level of intron-containing precursor mRNA. This inhibition is accompanied by a decrease in the acetylation of histones associated with the transgene. This transcriptional silencing in the soma can be distinguished from transgene silencing in the germline by its inability to be transmitted across generations and its dependence on the rde-1 gene. We therefore define this type of silencing as RNAi-induced Transcriptional Gene Silencing (RNAi-TGS). Additional chromatin-modifying components affecting RNAi-TGS were identified in a candidate RNAi screen.

Application of a protocol for magnetic resonance spectroscopy of adrenal glands: an experiment with over 100 cases.

PubMed

Melo, Homero José de Farias E; Goldman, Suzan M; Szejnfeld, Jacob; Faria, Juliano F; Huayllas, Martha K P; Andreoni, Cássio; Kater, Cláudio E

2014-01-01

To evaluate a protocol for two-dimensional (2D) hydrogen proton (1H) magnetic resonance spectroscopy (MRS) (Siemens Medical Systems; Erlangen, Germany) in the detection of adrenal nodules and differentiation between benign and malignant masses (adenomas, pheochromocytomas, carcinomas and metastases). A total of 118 patients (36 men; 82 women) (mean age: 57.3 ± 13.3 years) presenting with 138 adrenal nodules/masses were prospectively assessed. A multivoxel system was utilized with a 2D point-resolved spectroscopy/chemical shift imaging sequence. The following ratios were calculated: choline (Cho)/creatine (Cr), 4.0-4.3/Cr, lipid (Lip)/Cr, Cho/Lip and lactate (Lac)/Cr. 2D-1H-MRS was successful in 123 (89.13%) lesions. Sensitivity and specificity values observed for the ratios and cutoff points were the following: Cho/Cr ≥ 1.2, 100% sensitivity, 98.2% specificity (differences between adenomas/pheochromocytomas and carcinomas/ metastases); 4.0-4.3 ppm/Cr ≥ 1.5, 92.3% sensitivity, 96.9% specificity (differences between carcinomas/pheochromocytomas and adenomas/metastases); Lac/Cr ≤ -7.449, 90.9% sensitivity and 77.8% specificity (differences between pheochromocytomas and carcinomas/adenomas). Information provided by 2D-1H-MRS were effective and allowed for the differentiation between adrenal masses and nodules in most cases of lesions with > 1.0 cm in diameter.

Integrity of the yeast mitochondrial genome, but not its distribution and inheritance, relies on mitochondrial fission and fusion

PubMed Central

Osman, Christof; Noriega, Thomas R.; Okreglak, Voytek; Fung, Jennifer C.; Walter, Peter

2015-01-01

Mitochondrial DNA (mtDNA) is essential for mitochondrial and cellular function. In Saccharomyces cerevisiae, mtDNA is organized in nucleoprotein structures termed nucleoids, which are distributed throughout the mitochondrial network and are faithfully inherited during the cell cycle. How the cell distributes and inherits mtDNA is incompletely understood although an involvement of mitochondrial fission and fusion has been suggested. We developed a LacO-LacI system to noninvasively image mtDNA dynamics in living cells. Using this system, we found that nucleoids are nonrandomly spaced within the mitochondrial network and observed the spatiotemporal events involved in mtDNA inheritance. Surprisingly, cells deficient in mitochondrial fusion and fission distributed and inherited mtDNA normally, pointing to alternative pathways involved in these processes. We identified such a mechanism, where we observed fission-independent, but F-actin–dependent, tip generation that was linked to the positioning of mtDNA to the newly generated tip. Although mitochondrial fusion and fission were dispensable for mtDNA distribution and inheritance, we show through a combination of genetics and next-generation sequencing that their absence leads to an accumulation of mitochondrial genomes harboring deleterious structural variations that cluster at the origins of mtDNA replication, thus revealing crucial roles for mitochondrial fusion and fission in maintaining the integrity of the mitochondrial genome. PMID:25730886

Relationship among Shigella spp. and enteroinvasive Escherichia coli (EIEC) and their differentiation.

PubMed

Ud-Din, Abu; Wahid, Syeda

2014-01-01

Shigellosis produces inflammatory reactions and ulceration on the intestinal epithelium followed by bloody or mucoid diarrhea. It is caused by enteroinvasive E. coli (EIEC) as well as any species of the genus Shigella, namely, S. dysenteriae, S. flexneri, S. boydii, and S. sonnei. This current species designation of Shigella does not specify genetic similarity. Shigella spp. could be easily differentiated from E. coli, but difficulties observed for the EIEC-Shigella differentiation as both show similar biochemical traits and can cause dysentery using the same mode of invasion. Sequencing of multiple housekeeping genes indicates that Shigella has derived on several different occasions via acquisition of the transferable forms of ancestral virulence plasmids within commensal E. coli and form a Shigella-EIEC pathovar. EIEC showed lower expression of virulence genes compared to Shigella, hence EIEC produce less severe disease than Shigella spp. Conventional microbiological techniques often lead to confusing results concerning the discrimination between EIEC and Shigella spp. The lactose permease gene (lacY) is present in all E. coli strains but absent in Shigella spp., whereas β-glucuronidase gene (uidA) is present in both E. coli and Shigella spp. Thus uidA gene and lacY gene based duplex real-time PCR assay could be used for easy identification and differentiation of Shigella spp. from E. coli and in particular EIEC.

Relationship among Shigella spp. and enteroinvasive Escherichia coli (EIEC) and their differentiation

PubMed Central

Ud-Din, Abu; Wahid, Syeda

2014-01-01

Shigellosis produces inflammatory reactions and ulceration on the intestinal epithelium followed by bloody or mucoid diarrhea. It is caused by enteroinvasive E. coli (EIEC) as well as any species of the genus Shigella, namely, S. dysenteriae, S. flexneri, S. boydii, and S. sonnei. This current species designation of Shigella does not specify genetic similarity. Shigella spp. could be easily differentiated from E. coli, but difficulties observed for the EIEC-Shigella differentiation as both show similar biochemical traits and can cause dysentery using the same mode of invasion. Sequencing of multiple housekeeping genes indicates that Shigella has derived on several different occasions via acquisition of the transferable forms of ancestral virulence plasmids within commensal E. coli and form a Shigella-EIEC pathovar. EIEC showed lower expression of virulence genes compared to Shigella, hence EIEC produce less severe disease than Shigella spp. Conventional microbiological techniques often lead to confusing results concerning the discrimination between EIEC and Shigella spp. The lactose permease gene (lacY) is present in all E. coli strains but absent in Shigella spp., whereas β-glucuronidase gene (uidA) is present in both E. coli and Shigella spp. Thus uidA gene and lacY gene based duplex real-time PCR assay could be used for easy identification and differentiation of Shigella spp. from E. coli and in particular EIEC. PMID:25763015

Multiple pathways for SOS-induced mutagenesis in Escherichia coli: An overexpression of dinB/dinP results in strongly enhancing mutagenesis in the absence of any exogenous treatment to damage DNA

PubMed Central

Kim, Su-Ryang; Maenhaut-Michel, Geneviéve; Yamada, Masami; Yamamoto, Yoshihiro; Matsui, Keiko; Sofuni, Toshio; Nohmi, Takehiko; Ohmori, Haruo

1997-01-01

dinP is an Escherichia coli gene recently identified at 5.5 min of the genetic map, whose product shows a similarity in amino acid sequence to the E. coli UmuC protein involved in DNA damage-induced mutagenesis. In this paper we show that the gene is identical to dinB, an SOS gene previously localized near the lac locus at 8 min, the function of which was shown to be required for mutagenesis of nonirradiated λ phage infecting UV-preirradiated bacterial cells (termed λUTM for λ untargeted mutagenesis). A newly constructed dinP null mutant exhibited the same defect for λUTM as observed previously with a dinB::Mu mutant, and the defect was complemented by plasmids carrying dinP as the only intact bacterial gene. Furthermore, merely increasing the dinP gene expression, without UV irradiation or any other DNA-damaging treatment, resulted in a strong enhancement of mutagenesis in F′lac plasmids; at most, 800-fold increase in the G6-to-G5 change. The enhanced mutagenesis did not depend on recA, uvrA, or umuDC. Thus, our results establish that E. coli has at least two distinct pathways for SOS-induced mutagenesis: one dependent on umuDC and the other on dinB/P. PMID:9391106

Direct adenovirus-mediated gene delivery to the temporomandibular joint in guinea-pigs.

PubMed

Kuboki, T; Nakanishi, T; Kanyama, M; Sonoyama, W; Fujisawa, T; Kobayashi, K; Ikeda, T; Kubo, T; Yamashita, A; Takigawa, M

1999-09-01

Adenovirus vector system is expected to be useful for direct gene therapy for joint disease. This study first sought to confirm that foreign genes can be transferred to articular chondrocytes in primary culture. Next, recombinant adenovirus vectors harbouring beta-galactosidase gene (LacZ) was injected directly into the temporomandibular joints of Hartley guinea-pigs to clarify the in vivo transfer availability of the adenovirus vectors. Specifically, recombinant adenovirus harbouring LacZ gene (AxlCALacZ) was injected into the upper joint cavities of both mandibular joints of four male 6-week-old Hartley guinea-pigs. Either the same amount of recombinant adenovirus without LacZ gene (Axlw) suspension (placebo) or the same amount of phosphate-buffered saline solution (control) were injected into the upper joint cavities of both joints of another four male guinea-pigs. At 1, 2, 3 and 4 weeks after injection, the joints were dissected and the expression of delivered LacZ was examined by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal) staining and reverse transcriptase-polymerase chain reaction (RT-PCR). To investigate the expression of transferred gene in other organs, total RNA was extracted from liver, kidney, heart and brain and the expression of LacZ mRNA and 18 S ribosomal RNA were analysed by RT-PCR. Clear expression of LacZ was observed in the articular surfaces of the temporal tubercle, articular disc and synovium of the temporomandibular joints even 4 weeks after injection in the AxlCALacZ-injected group, while no expression was detected in placebo and control groups. Histological examination confirmed that LacZ activity was clearly detected in a few cell layers of the articular surface tissues, which is much more efficient than in a previously study of the knee joint. In the other organs, expression of the delivered transgene was not observed. Based on these findings, direct gene delivery into the articular surface of the temporomandibular joint using the adenovirus vector is feasible as an effective in vivo method.

Scale is not an Issue : Opportunities for Collaboration among Geoscientists in Latin America and the Caribbean

NASA Astrophysics Data System (ADS)

Carby, B. E.

2015-12-01

Latin American and Caribbean (LAC) countries face multiple hazards such as earthquakes, volcanoes, accelerated erosion, landslides, drought, flooding, windstorms and the effects of climate variability and change. World Bank (2005) data indicate that seventeen of the top thirty-five countries with relatively high mortality risk from 3 or more hazards are located in LAC, El Salvador has the second highest per cent of its population at risk - 77.7% and 7 of the top 10 countries for population exposure to multiple hazards are in LAC. All LAC countries have half or more of GDP exposed to at least one hazard. The report underscores the need for better data and information on hazards and disasters to inform disaster risk reduction (DRR) and supports the view that reduction of disaster risk is essential for achieving Sustainable Development (SD). This suggests that DRR must be integrated into development planning of countries. However the Global Assessment Report notes that globally, there has been little progress in mainstreaming DRR in national development (UNISDR 2009). Without this, countries will not realise development goals. DRR efforts in LAC require an integrated approach including societal input in deciding priority DRR research themes and interdisciplinary, multi-hazard research informing DRR policy and practice. Jiminez (2015) from a study of countries across LAC reports that efforts are being made to link research to national planning through inclusion of policy makers in some university-led research projects. Research by the author in Jamaica reveals that the public sector has started to apply research on hazards to inform DRR policy, programmes and plans. As most research is done by universities, there is collaboration between the public sector and academia. Despite differences in scale among countries across the region, similarities in exposure to multiple hazards and potential hazard impacts suggest that collaboration among researchers in LAC could be beneficial. It is proposed here that this collaboration should go beyond the scientific community and should include sharing of experiences in linking DRR research to national development needs, inclusion of policy makers in research design and implementation and integration of research results in policy and programme development.

What are the blood lead levels of children living in Latin America and the Caribbean?

PubMed

Olympio, Kelly Polido Kaneshiro; Gonçalves, Cláudia Gaudência; Salles, Fernanda Junqueira; Ferreira, Ana Paula Sacone da Silva; Soares, Agnes Silva; Buzalaf, Marília Afonso Rabelo; Cardoso, Maria Regina Alves; Bechara, Etelvino José Henriques

2017-04-01

Information on the prevalence of lead exposure is essential to formulate efficient public health policies. Developed countries have implemented successful public policies for the prevention and control of lead poisoning. In the United States, Canada, Japan and the European Union, for instance, periodically repeated prevalence studies show that blood lead levels (BLLs) in children have decreased overall. Although BLL of Latino children in the U.S. have also dropped in recent years, the geometric mean remains higher than that of white children. Little is known about lead exposure in children in Latin America and the Caribbean (LAC). In this review, we responded to two questions: What is currently known about lead sources and levels in children in LAC? Are there public policies to prevent children's exposure to lead in LAC? We conducted a literature review covering the period from January 2000 to March 2014 in the PubMed and Lilacs databases to obtain English, Portuguese and Spanish language studies reporting the prevalence of BLLs in children aged 0-18years living in LAC countries. No specific analytical method was selected, and given the scarcity of data, the study was highly inclusive. Fifty-six papers were selected from 16 different LAC countries. The children's BLLs found in this review are high (≥10μg/dL) compared to BLLs for the same age group in the U. S. However, most studies reported an association with some type of "lead hot spot", in which children can be exposed to lead levels similar to those of occupational settings. Only Peru and Mexico reported BLLs in children from population-based studies. Most BLLs prevalence studies carried out in LAC were in areas with known emission sources. The percentage of children at risk of lead poisoning in LAC is unknown, and probably underestimated. Thus, there is an urgent need to establish public health policies to quantify and prevent lead poisoning, specifically by prioritizing the identification and control of "hot spots". Copyright © 2017 Elsevier Ltd. All rights reserved.

Fermi LAT detection of a GeV flare from the BL Lac object PKS 2233-148

NASA Astrophysics Data System (ADS)

Ciprini, Stefano

2012-06-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2233-148 (also known as 2FGL J2236.5-1431, Nolan et al. 2012, ApJS, 199, 31, and OY -156) placed at R.A.: 339.1420296 deg, Dec.: -14.5561633 (J2000, Petrov et al. 2008, AJ, 136, 580). No redshift for the source has been measured up to now, demonstrating the BL Lac object character type of this source.

BL Lacertae Objects

NASA Technical Reports Server (NTRS)

Stocke, John T.

1998-01-01

This grant has contributed to one of the original goals of the NAS/LTSA program, the goal of junior faculty development. Below I briefly summarize the following major results on BL Lacertae Objects that we have obtained. An invited talk on BL Lac Objects at IAU 175 "Extragalactic Radio Sources" at Bologna Italy in October 1995 summarized some of these results. A second invited talk in Oct 1998 at Green Bamk, WVA presented other BL Lac results at the conference entitled: "Highly Redshifted Radio Lines". We have used the EMSS sample to measure the X-ray luminosity function and cosmological evolution of BL Lacs. A new large sample of XBLs has been discovered.

A KPC-scale X-ray jet in the BL LAC Source S5 2007+777

NASA Technical Reports Server (NTRS)

Sambruna, Rita; Maraschi, Laura; Tavecchio, Fabrizio

2008-01-01

The BL Lac S3 2007++777, a classical radio-selected BL Lac from the sample of Stirkel et al. exhibiting an extended (19") radio jet. was observed with Chandra revealing an X-ray jet with simi1ar morphology. The hard X-ray spectrum and broad band SED is consistent with an IC/CMB origin for the X-ray emission, implying a highly relativistic flow at small angle to the line of sight with an unusually large deprojected length, 300 kpc. A structured jet consisting of a fast spine and slow wall is consistent with the observations.

Identification and characterization of mutant clones with enhanced propagation rates from phage-displayed peptide libraries.

PubMed

Nguyen, Kieu T H; Adamkiewicz, Marta A; Hebert, Lauren E; Zygiel, Emily M; Boyle, Holly R; Martone, Christina M; Meléndez-Ríos, Carola B; Noren, Karen A; Noren, Christopher J; Hall, Marilena Fitzsimons

2014-10-01

A target-unrelated peptide (TUP) can arise in phage display selection experiments as a result of a propagation advantage exhibited by the phage clone displaying the peptide. We previously characterized HAIYPRH, from the M13-based Ph.D.-7 phage display library, as a propagation-related TUP resulting from a G→A mutation in the Shine-Dalgarno sequence of gene II. This mutant was shown to propagate in Escherichia coli at a dramatically faster rate than phage bearing the wild-type Shine-Dalgarno sequence. We now report 27 additional fast-propagating clones displaying 24 different peptides and carrying 14 unique mutations. Most of these mutations are found either in or upstream of the gene II Shine-Dalgarno sequence, but still within the mRNA transcript of gene II. All 27 clones propagate at significantly higher rates than normal library phage, most within experimental error of wild-type M13 propagation, suggesting that mutations arise to compensate for the reduced virulence caused by the insertion of a lacZα cassette proximal to the replication origin of the phage used to construct the library. We also describe an efficient and convenient assay to diagnose propagation-related TUPS among peptide sequences selected by phage display. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Research on Biodiversity and Climate Change at a Distance: Collaboration Networks between Europe and Latin America and the Caribbean.

PubMed

Dangles, Olivier; Loirat, Jean; Freour, Claire; Serre, Sandrine; Vacher, Jean; Le Roux, Xavier

2016-01-01

Biodiversity loss and climate change are both globally significant issues that must be addressed through collaboration across countries and disciplines. With the December 2015 COP21 climate conference in Paris and the recent creation of the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES), it has become critical to evaluate the capacity for global research networks to develop at the interface between biodiversity and climate change. In the context of the European Union (EU) strategy to stand as a world leader in tackling global challenges, the European Commission has promoted ties between the EU and Latin America and the Caribbean (LAC) in science, technology and innovation. However, it is not clear how these significant interactions impact scientific cooperation at the interface of biodiversity and climate change. We looked at research collaborations between two major regions-the European Research Area (ERA) and LAC-that addressed both biodiversity and climate change. We analysed the temporal evolution of these collaborations, whether they were led by ERA or LAC teams, and which research domains they covered. We surveyed publications listed on the Web of Science that were authored by researchers from both the ERA and LAC and that were published between 2003 and 2013. We also run similar analyses on other topics and other continents to provide baseline comparisons. Our results revealed a steady increase in scientific co-authorships between ERA and LAC countries as a result of the increasingly complex web of relationships that has been weaved among scientists from the two regions. The ERA-LAC co-authorship increase for biodiversity and climate change was higher than those reported for other topics and for collaboration with other continents. We also found strong differences in international collaboration patterns within the LAC: co-publications were fewest from researchers in low- and lower-middle-income countries and most prevalent from researchers in emerging countries like Mexico and Brazil. Overall, interdisciplinary publications represented 25.8% of all publications at the interface of biodiversity and climate change in the ERA-LAC network. Further scientific collaborations should be promoted 1) to prevent less developed countries from being isolated from the global cooperation network, 2) to ensure that scientists from these countries are trained to lead visible and recognized biodiversity and climate change research, and 3) to develop common study models that better integrate multiple scientific disciplines and better support decision-making.

Influence of salt content and processing time on sensory characteristics of cooked "lacón".

PubMed

Purriños, Laura; Bermúdez, Roberto; Temperán, Sara; Franco, Daniel; Carballo, Javier; Lorenzo, José M

2011-04-01

The influence of salt content and processing time on the sensory properties of cooked "lacón" were determined. "Lacón" is a traditional dry-cured and ripened meat product made in the north-west of Spain from the fore leg of the pig, following a similar process to that of dry-cured ham. Six batches of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)) and ripened during two times (56 and 84 days of dry-ripening). Cured odour in all batches studied, red colour and rancid odour in MS and HS batches, flavour intensity in MS batch and fat yellowness, rancid flavour and hardness in the HS batch were significantly different with respect to the time of processing. Appearance, odour, flavour and texture were not significantly affected by the salt content (P>0.05). However, the saltiness score showed significant differences with respect to the salt levels in all studied batches (56 and 84 days of process). The principal component analysis showed that physicochemical traits were the most important ones concerning the quality of dry-cured "lacón" and offered a good separation of the mean samples according to the dry ripening days and salt level. © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.

RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massaro, F.; Marchesini, E. J.; D’Abrusco, R.

2017-01-10

The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated bymore » the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.« less

GSL-enriched membrane microdomains in innate immune responses.

PubMed

Nakayama, Hitoshi; Ogawa, Hideoki; Takamori, Kenji; Iwabuchi, Kazuhisa

2013-06-01

Many pathogens target glycosphingolipids (GSLs), which, together with cholesterol, GPI-anchored proteins, and various signaling molecules, cluster on host cell membranes to form GSL-enriched membrane microdomains (lipid rafts). These GSL-enriched membrane microdomains may therefore be involved in host-pathogen interactions. Innate immune responses are triggered by the association of pathogens with phagocytes, such as neutrophils, macrophages and dendritic cells. Phagocytes express a diverse array of pattern-recognition receptors (PRRs), which sense invading microorganisms and trigger pathogen-specific signaling. PRRs can recognize highly conserved pathogen-associated molecular patterns expressed on microorganisms. The GSL lactosylceramide (LacCer, CDw17), which binds to various microorganisms, including Candida albicans, is expressed predominantly on the plasma membranes of human mature neutrophils and forms membrane microdomains together with the Src family tyrosine kinase Lyn. These LacCer-enriched membrane microdomains can mediate superoxide generation, migration, and phagocytosis, indicating that LacCer functions as a PRR in innate immunity. Moreover, the interactions of GSL-enriched membrane microdomains with membrane proteins, such as growth factor receptors, are important in mediating the physiological properties of these proteins. Similarly, we recently found that interactions between LacCer-enriched membrane microdomains and CD11b/CD18 (Mac-1, CR3, or αMβ2-integrin) are significant for neutrophil phagocytosis of non-opsonized microorganisms. This review describes the functional role of LacCer-enriched membrane microdomains and their interactions with CD11b/CD18.

Genome engineering using a synthetic gene circuit in Bacillus subtilis.

PubMed

Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun

2015-03-31

Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application of Zoning and ``Limits of Acceptable Change'' to Manage Snorkelling Tourism

NASA Astrophysics Data System (ADS)

Roman, George S. J.; Dearden, Philip; Rollins, Rick

2007-06-01

Zoning and applying Limits of Acceptable Change (LAC) are two promising strategies for managing tourism in Marine Protected Areas (MPAs). Typically, these management strategies require the collection and integration of ecological and socioeconomic data. This problem is illustrated by a case study of Koh Chang National Marine Park, Thailand. Biophysical surveys assessed coral communities in the MPA to derive indices of reef diversity and vulnerability. Social surveys assessed visitor perceptions and satisfaction with conditions encountered on snorkelling tours. Notably, increased coral mortality caused a significant decrease in visitor satisfaction. The two studies were integrated to prescribe zoning and “Limits of Acceptable Change” (LAC). As a biophysical indicator, the data suggest a LAC value of 0.35 for the coral mortality index. As a social indicator, the data suggest that a significant fraction of visitors would find a LAC value of under 30 snorkellers per site as acceptable. The draft zoning plan prescribed four different types of zones: (I) a Conservation Zone with no access apart from monitoring or research; (II) Tourism Zones with high tourism intensities at less vulnerable reefs; (III) Ecotourism zones with a social LAC standard of <30 snorkellers per site, and (IV) General Use Zones to meet local artisanal fishery needs. This study illustrates how ecological and socioeconomic field studies in MPAs can be integrated to craft zoning plans addressing multiple objectives.

Effect of Vinylene Carbonate and Fluoroethylene Carbonate on SEI Formation on Graphitic Anodes in Li-Ion Batteries

DOE PAGES

Nie, Mengyun; Demeaux, Julien; Young, Benjamin T.; ...

2015-07-23

Binder free (BF) graphite electrodes were utilized to investigate the effect of electrolyte additives fluoroethylene carbonate (FEC) and vinylene carbonate (VC) on the structure of the solid electrolyte interface (SEI). The structure of the SEI has been investigated via ex-situ surface analysis including X-ray Photoelectron spectroscopy (XPS), Hard XPS (HAXPES), Infrared spectroscopy (IR) and transmission electron microscopy (TEM). The components of the SEI have been further investigated via nuclear magnetic resonance (NMR) spectroscopy of D2O extractions. The SEI generated on the BF-graphite anode with a standard electrolyte (1.2 M LiPF6 in ethylene carbonate (EC) / ethyl methyl carbonate (EMC), 3/7more » (v/v)) is composed primarily of lithium alkyl carbonates (LAC) and LiF. Incorporation of VC (3% wt) results in the generation of a thinner SEI composed of Li2CO3, poly(VC), LAC, and LiF. Incorporation of VC inhibits the generation of LAC and LiF. Incorporation of FEC (3% wt) also results in the generation of a thinner SEI composed of Li2CO3, poly(FEC), LAC, and LiF. The concentration of poly(FEC) is lower than the concentration of poly(VC) and the generation of LAC is inhibited in the presence of FEC. The SEI appears to be a homogeneous film for all electrolytes investigated.« less

Application of zoning and "limits of acceptable change" to manage snorkelling tourism.

PubMed

Roman, George S J; Dearden, Philip; Rollins, Rick

2007-06-01

Zoning and applying Limits of Acceptable Change (LAC) are two promising strategies for managing tourism in Marine Protected Areas (MPAs). Typically, these management strategies require the collection and integration of ecological and socioeconomic data. This problem is illustrated by a case study of Koh Chang National Marine Park, Thailand. Biophysical surveys assessed coral communities in the MPA to derive indices of reef diversity and vulnerability. Social surveys assessed visitor perceptions and satisfaction with conditions encountered on snorkelling tours. Notably, increased coral mortality caused a significant decrease in visitor satisfaction. The two studies were integrated to prescribe zoning and "Limits of Acceptable Change" (LAC). As a biophysical indicator, the data suggest a LAC value of 0.35 for the coral mortality index. As a social indicator, the data suggest that a significant fraction of visitors would find a LAC value of under 30 snorkellers per site as acceptable. The draft zoning plan prescribed four different types of zones: (I) a Conservation Zone with no access apart from monitoring or research; (II) Tourism Zones with high tourism intensities at less vulnerable reefs; (III) Ecotourism zones with a social LAC standard of <30 snorkellers per site, and (IV) General Use Zones to meet local artisanal fishery needs. This study illustrates how ecological and socioeconomic field studies in MPAs can be integrated to craft zoning plans addressing multiple objectives.

Dementia in Latin America

PubMed Central

Parra, Mario A.; Baez, Sandra; Allegri, Ricardo; Nitrini, Ricardo; Lopera, Francisco; Slachevsky, Andrea; Custodio, Nilton; Lira, David; Piguet, Olivier; Kumfor, Fiona; Huepe, David; Cogram, Patricia; Bak, Thomas; Manes, Facundo

2018-01-01

The demographic structure of Latin American countries (LAC) is fast approaching that of developing countries, and the predicted prevalence of dementia in the former already exceeds the latter. Dementia has been declared a global challenge, yet regions around the world show differences in both the nature and magnitude of such a challenge. This article provides evidence and insights on barriers which, if overcome, would enable the harmonization of strategies to tackle the dementia challenge in LAC. First, we analyze the lack of available epidemiologic data, the need for standardizing clinical practice and improving physician training, and the existing barriers regarding resources, culture, and stigmas. We discuss how these are preventing timely care and research. Regarding specific health actions, most LAC have minimal mental health facilities and do not have specific mental health policies or budgets specific to dementia. In addition, local regulations may need to consider the regional context when developing treatment and prevention strategies. The support needed nationally and internationally to enable a smooth and timely transition of LAC to a position that integrates global strategies is highlighted. We focus on shared issues of poverty, cultural barriers, and socioeconomic vulnerability. We identify avenues for collaboration aimed to study unique populations, improve valid assessment methods, and generate opportunities for translational research, thus establishing a regional network. The issues identified here point to future specific actions aimed at tackling the dementia challenge in LAC. PMID:29305437

Targeted delivery of microRNA 146b mimic to hepatocytes by lactosylated PDMAEMA nanoparticles for the treatment of NAFLD.

PubMed

He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing

2018-03-21

Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.

Detoxification of diphenyl ether herbicide lactofen by Bacillus sp. Za and enantioselective characteristics of an esterase gene lacE.

PubMed

Zhang, Jing; Lu, Luyao; Chen, Feng; Chen, Lingling; Yin, Jingang; Huang, Xing

2018-01-05

A bacterial strain Za capable of degrading diphenyl ether herbicide lactofen was isolated and identified as Bacillus sp. This strain could degrade 94.8% of 50mgL -1 lactofen after 4days of inoculation in flasks. It was revealed that lactofen was initially hydrolyzed to desethyl lactofen, which was further transformed to acifluorfen, followed by the reduction of the nitro group to yield aminoacifluorfen. The phytotoxicity of the transformed product aminoacifluorfen to maize was decreased significantly compared with the lactofen. A gene lacE, encoding an esterase responsible for lactofen hydrolysis to desethyl lactofen and acifluorfen continuously, was cloned from Bacillus sp. Za. The deduced amino acid belonging to the esterase family VII contained a typical Ser-His-Asp/Glu catalytic triad and the conserved motifs GXSXG. The purified recombinant protein LacE displayed maximal esterase activity at 40°C and pH 7.0. Additionally, LacE had broad substrate specificity and was capable of hydrolyzing p-nitrophenyl esters. The enantioselectivity of LacE during lactofen degradation was further studied, and the results indicated that the (S)-(+)-lactofen was degraded faster than the (R)-(-)-lactofen, which could illustrate the reported phenomenon that (S)-(+)-lactofen was preferentially degraded in soil and sediment. Copyright © 2017 Elsevier B.V. All rights reserved.

Radio-weak BL Lac Objects in the Fermi Era

NASA Astrophysics Data System (ADS)

Massaro, F.; Marchesini, E. J.; D'Abrusco, R.; Masetti, N.; Andruchow, I.; Smith, Howard A.

2017-01-01

The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]-[4.6]-[12] μm color-color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.

Developing and piloting a peer mentoring intervention to reduce teenage pregnancy in looked-after children and care leavers: an exploratory randomised controlled trial.

PubMed Central

Mezey, Gillian; Meyer, Deborah; Robinson, Fiona; Bonell, Chris; Campbell, Rona; Gillard, Steve; Jordan, Peter; Mantovani, Nadia; Wellings, Kaye; White, Sarah

2015-01-01

BACKGROUND: Looked-after children (LAC) are at greater risk of teenage pregnancy than non-LAC, which is associated with adverse health and social consequences. Existing interventions have failed to reduce rates of teenage pregnancy in LAC. Peer mentoring is proposed as a means of addressing many of the factors associated with the increased risk of teenage pregnancy in this group. OBJECTIVE: To develop a peer mentoring intervention to reduce teenage pregnancy in LAC. DESIGN: Phase I and II randomised controlled trial of a peer mentoring intervention for LAC; scoping exercise and literature search; national surveys of social care professionals and LAC; and focus groups and interviews with social care professionals, mentors and mentees. SETTING: Three local authorities (LAs) in England. PARTICIPANTS: LAC aged 14-18 years (mentees/care as usual) and 19-25 years (mentors). INTERVENTION: Recruitment and training of mentors; randomisation and matching of mentors to mentees; and 1-year individual peer mentoring. MAIN OUTCOME MEASURES: PRIMARY OUTCOME: pregnancy in LAC aged 14-18 years. SECONDARY OUTCOMES: sexual attitudes, behaviour and knowledge; psychological health; help-seeking behaviour; locus of control; and attachment style. A health economic evaluation was also carried out. RESULTS: In total, 54% of target recruitment was reached for the exploratory trial and 13 out of 20 mentors (65%) and 19 out of 30 LAC aged 14-18 years (63%) (recruited during Phases I and II) were retained in the research. The training programme was acceptable and could be manualised and replicated. Recruitment and retention difficulties were attributed to systemic problems and LA lack of research infrastructure and lack of additional funding to support and sustain such an intervention. Mentees appeared to value the intervention but had difficulty in meeting weekly as required. Only one in four of the relationships continued for the full year. A future Phase III trial would require the intervention to be modified to include provision of group and individual peer mentoring; internal management of the project, with support from an external agency such as a charity or the voluntary sector; funds to cover LA research costs, including the appointment of a dedicated project co-ordinator; a reduction in the lower age for mentee recruitment and an increase in the mentor recruitment age to 21 years; and the introduction of a more formal recruitment and support structure for mentors. CONCLUSIONS: Given the problems identified and described in mounting this intervention, a new development phase followed by a small-scale exploratory trial incorporating these changes would be necessary before proceeding to a Phase III trial. FUNDING: This project was funded by the NIHR Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 19, No. 85. See the NIHR Journals Library website for further project information. PMID:26497730

The rpoE operon regulates heat stress response in Burkholderia pseudomallei.

PubMed

Vanaporn, Muthita; Vattanaviboon, Paiboon; Thongboonkerd, Visith; Korbsrisate, Sunee

2008-07-01

Burkholderia pseudomallei is a gram-negative bacterium and the causative agent of melioidosis, one of the important lethal diseases in tropical regions. In this article, we demonstrate the crucial role of the B. pseudomallei rpoE locus in the response to heat stress. The rpoE operon knockout mutant exhibited growth retardation and reduced survival when exposed to a high temperature. Expression analysis using rpoH promoter-lacZ fusion revealed that heat stress induction of rpoH, which encodes heat shock sigma factor (sigma(H)), was abolished in the B. pseudomallei rpoE mutant. Analysis of the rpoH promoter region revealed sequences sharing high homology to the consensus sequence of sigma(E)-dependent promoters. Moreover, the putative heat-induced sigma(H)-regulated heat shock proteins (i.e. GroEL and HtpG) were also absent in the rpoE operon mutant. Altogether, our data suggest that the rpoE operon regulates B. pseudomallei heat stress response through the function of rpoH.

Beyond wilderness: Broadening the applicability of limits of acceptable change

Treesearch

Mark W. Brunson

1977-01-01

The Limits of Acceptable Change (LAC) process helps managers preserve wilderness attributes along with recreation opportunities. Ecosystem management likewise requires managers to balance societal and ecosystem needs. Both are more likely to succeed through collaborative planning. Consequently, LAC can offer a conceptual framework for achieving sustainable solutions...

NPDES Permit – East Lake Sewage Lagoon – Mille Lacs Indian Reservation (Aitkin County, MN)

EPA Pesticide Factsheets

EPA proposes to reissue a NPDES permit for the treated wastewater discharges from the East Lake Sewage Lagoon located within the boundaries of the Mille Lacs Indian Reservation located in East Lake (McGregor), Minnesota (Aitkin County) to be issued by EPA.

Paratachardina pseudolobata (Cocccoidea: Kerriidae): bionomics in Florida

USDA-ARS?s Scientific Manuscript database

Observations on the bionomics of lobate lac scale, Paratachardina pseudolobata Kondo & Gullan in Florida are reported. Lobate lac scale infests primarily the branches and main stems of <2 cm in dia; rarely were they found on stems larger than 4 cm in dia or on leaves and never on roots. They produce...

77 FR 2774 - Notice of Intent To Prepare a Supplemental Environmental Impact Statement: Fond du Lac...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-19

... Fredrichs, Assistant Division Administrator, Federal Highway Administration, Madison, Wisconsin. [FR Doc... capacity improvements to Wisconsin Highway 23 from U.S. Highway 151 to County Highway P in Fond du Lac and Sheboygan Counties, Wisconsin. FOR FURTHER INFORMATION CONTACT: Bethaney Bacher-Gresock, Environmental...

Manager Pumped on Tribal College Degree

ERIC Educational Resources Information Center

Ness, Jean E.

2005-01-01

This column relates the story of Dylan Olson, a struggling business student at Fond du Lac Tribal and Community College (Cloquet, Minnesota). During construction of a new gas and convenience store on the Fond du Lac Reservation, Olson recognized an opportunity, applied for the manager's position, and was hired. Olson's experience illustrates the…

Identification of Cryptosporidium Species in Fish from Lake Geneva (Lac Léman) in France.

PubMed

Certad, Gabriela; Dupouy-Camet, Jean; Gantois, Nausicaa; Hammouma-Ghelboun, Ourida; Pottier, Muriel; Guyot, Karine; Benamrouz, Sadia; Osman, Marwan; Delaire, Baptiste; Creusy, Colette; Viscogliosi, Eric; Dei-Cas, Eduardo; Aliouat-Denis, Cecile Marie; Follet, Jérôme

2015-01-01

Cryptosporidium, a protozoan parasite that can cause severe diarrhea in a wide range of vertebrates including humans, is increasingly recognized as a parasite of a diverse range of wildlife species. However, little data are available regarding the identification of Cryptosporidium species and genotypes in wild aquatic environments, and more particularly in edible freshwater fish. To evaluate the prevalence of Cryptosporidiumspp. in fish from Lake Geneva (Lac Léman) in France, 41 entire fish and 100 fillets (cuts of fish flesh) were collected from fishery suppliers around the lake. Nested PCR using degenerate primers followed by sequence analysis was used. Five fish species were identified as potential hosts of Cryptosporidium: Salvelinus alpinus, Esox lucius, Coregonus lavaretus, Perca fluviatilis, and Rutilus rutilus. The presence of Cryptosporidium spp. was found in 15 out of 41 fish (37%), distributed as follows: 13 (87%) C. parvum, 1 (7%) C. molnari, and 1 (7%) mixed infection (C. parvum and C. molnari). C. molnari was identified in the stomach, while C. parvum was found in the stomach and intestine. C. molnari was also detected in 1 out of 100 analyzed fillets. In order to identify Cryptosporidium subtypes, sequencing of the highly polymorphic 60-kDa glycoprotein (gp60) was performed. Among the C. parvum positive samples, three gp60 subtypes were identified: IIaA15G2R1, IIaA16G2R1, and IIaA17G2R1. Histological examination confirmed the presence of potential developmental stages of C. parvum within digestive epithelial cells. These observations suggest that C. parvum is infecting fish, rather than being passively carried. Since C. parvum is a zoonotic species, fish potentially contaminated by the same subtypes found in terrestrial mammals would be an additional source of infection for humans and animals, and may also contribute to the contamination of the environment with this parasite. Moreover, the risk of human transmission is strengthened by the observation of edible fillet contamination.

Identification of Cryptosporidium Species in Fish from Lake Geneva (Lac Léman) in France

PubMed Central

Certad, Gabriela; Dupouy-Camet, Jean; Gantois, Nausicaa; Hammouma-Ghelboun, Ourida; Pottier, Muriel; Guyot, Karine; Benamrouz, Sadia; Osman, Marwan; Delaire, Baptiste; Creusy, Colette; Viscogliosi, Eric; Aliouat-Denis, Cecile Marie; Follet, Jérôme

2015-01-01

Cryptosporidium, a protozoan parasite that can cause severe diarrhea in a wide range of vertebrates including humans, is increasingly recognized as a parasite of a diverse range of wildlife species. However, little data are available regarding the identification of Cryptosporidium species and genotypes in wild aquatic environments, and more particularly in edible freshwater fish. To evaluate the prevalence of Cryptosporidiumspp. in fish from Lake Geneva (Lac Léman) in France, 41 entire fish and 100 fillets (cuts of fish flesh) were collected from fishery suppliers around the lake. Nested PCR using degenerate primers followed by sequence analysis was used. Five fish species were identified as potential hosts of Cryptosporidium: Salvelinus alpinus, Esox lucius, Coregonus lavaretus, Perca fluviatilis, and Rutilus rutilus. The presence of Cryptosporidium spp. was found in 15 out of 41 fish (37%), distributed as follows: 13 (87%) C. parvum, 1 (7%) C. molnari, and 1 (7%) mixed infection (C. parvum and C. molnari). C. molnari was identified in the stomach, while C. parvum was found in the stomach and intestine. C. molnari was also detected in 1 out of 100 analyzed fillets. In order to identify Cryptosporidium subtypes, sequencing of the highly polymorphic 60-kDa glycoprotein (gp60) was performed. Among the C. parvum positive samples, three gp60 subtypes were identified: IIaA15G2R1, IIaA16G2R1, and IIaA17G2R1. Histological examination confirmed the presence of potential developmental stages of C. parvum within digestive epithelial cells. These observations suggest that C. parvum is infecting fish, rather than being passively carried. Since C. parvum is a zoonotic species, fish potentially contaminated by the same subtypes found in terrestrial mammals would be an additional source of infection for humans and animals, and may also contribute to the contamination of the environment with this parasite. Moreover, the risk of human transmission is strengthened by the observation of edible fillet contamination. PMID:26213992

Phylogenetic, epidemiological and functional analyses of the Streptococcus bovis/Streptococcus equinus complex through an overarching MLST scheme.

PubMed

Jans, Christoph; de Wouters, Tomas; Bonfoh, Bassirou; Lacroix, Christophe; Kaindi, Dasel Wambua Mulwa; Anderegg, Janine; Böck, Désirée; Vitali, Sabrina; Schmid, Thomas; Isenring, Julia; Kurt, Fabienne; Kogi-Makau, Wambui; Meile, Leo

2016-06-21

The Streptococcus bovis/Streptococcus equinus complex (SBSEC) comprises seven (sub)species classified as human and animal commensals, emerging opportunistic pathogens and food fermentative organisms. Changing taxonomy, shared habitats, natural competence and evidence for horizontal gene transfer pose difficulties for determining their phylogeny, epidemiology and virulence mechanisms. Thus, novel phylogenetic and functional classifications are required. An SBSEC overarching multi locus sequence type (MLST) scheme targeting 10 housekeeping genes was developed, validated and combined with host-related properties of adhesion to extracellular matrix proteins (ECM), activation of the immune responses via NF-KB and survival in simulated gastric juice (SGJ). Commensal and pathogenic SBSEC strains (n = 74) of human, animal and food origin from Europe, Asia, America and Africa were used in the MLST scheme yielding 66 sequence types and 10 clonal complexes differentiated into distinct habitat-associated and mixed lineages. Adhesion to ECMs collagen I and mucin type II was a common characteristic (23 % of strains) followed by adhesion to fibronectin and fibrinogen (19.7 %). High adhesion abilities were found for East African dairy and human blood isolate branches whereas commensal fecal SBSEC displayed low adhesion. NF-KB activation was observed for a limited number of dairy and blood isolates suggesting the potential of some pathogenic strains for reduced immune activation. Strains from dairy MLST clades displayed the highest relative survival to SGJ independently of dairy adaptation markers lacS/lacZ. Combining phylogenetic and functional analyses via SBSEC MLST enabled the clear delineation of strain clades to unravel the complexity of this bacterial group. High adhesion values shared between certain dairy and blood strains as well as the behavior of NF-KB activation are concerning for specific lineages. They highlighted the health risk among shared lineages and establish the basis to elucidate (zoonotic-) transmission, host specificity, virulence mechanisms and enhanced risk assessment as pathobionts in an overarching One Health approach.

Purification of a Novel Bacteriocin-Like Inhibitory Substance Produced by Enterococcus faecium ICIS 8 and Characterization of Its Mode of Action.

PubMed

Vasilchenko, Alexey S; Rogozhin, Eugene A; Valyshev, Alexander V

2017-06-01

The aim of this work was to purify and characterize a bacteriocin-like antimicrobial substance produced by an antagonistic active strain of Enterococcus faecium. A novel bacteriocin-like inhibitory substance (BLIS) produced by the E. faecium ICIS 8 strain was purified and characterized using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and N-terminal amino acid sequencing revealed the following partial sequence: NH 2 -APKEKCFPKYCV. The proteinaceous nature of purified BLIS was assessed by treatment with proteolytic enzyme. Studies of the action of BLIS using bacteriological and bioluminescence assays revealed a dose-dependent inhibition of Listeria monocytogenes 88BK and Escherichia coli K12 TG1 lac::lux viability. The interaction of the BLIS with the bacterial surface led to the compensation of a negative charge value, as shown by zeta-potential measurements. Assessments of membrane integrity using fluorescent probes and atomic force microscopy revealed the permeabilization of the cellular barrier structures in both L. monocytogenes and E. coli. The novel BLIS from E. faecium ICIS 8 was characterized by a unique primary peptide sequence and exerted bactericidal activity against L. monocytogenes and E. coli by disrupting membrane integrity.

Efficient Extracellular Expression of Phospholipase D in Escherichia Coli with an Optimized Signal Peptide

NASA Astrophysics Data System (ADS)

Yang, Leyun; Xu, Yu; Chen, Yong; Ying, Hanjie

2018-01-01

New secretion vectors containing the synthetic signal sequence (OmpA’) was constructed for the secretory production of recombinant proteins in Escherichia coli. The E. coli Phospholipase D structural gene (Accession number:NC_018658) fused to various signal sequence were expressed from the Lac promoter in E. coli Rosetta strains by induction with 0.4mM IPTG at 28°C for 48h. SDS-PaGe analysis of expression and subcellular fractions of recombinant constructs revealed the translocation of Phospholipase D (PLD) not only to the medium but also remained in periplasm of E. coli with OmpA’ signal sequence at the N-terminus of PLD. Thus the study on the effects of various surfactants on PLD extracellular production in Escherichia coli in shake flasks revealed that optimal PLD extracellular production could be achieved by adding 0.4% Triton X-100 into the medium. The maximal extracellular PLD production and extracellular enzyme activity were 0.23mg ml-1 and 16U ml-1, respectively. These results demonstrate the possibility of efficient secretory production of recombinant PLD in E. coli should be a potential industrial applications.

Development of a new fluorescent reporter:operator system: location of AraC regulated genes in Escherichia coli K-12.

PubMed

Sellars, Laura E; Bryant, Jack A; Sánchez-Romero, María-Antonia; Sánchez-Morán, Eugenio; Busby, Stephen J W; Lee, David J

2017-08-03

In bacteria, many transcription activator and repressor proteins regulate multiple transcription units that are often distally distributed on the bacterial genome. To investigate the subcellular location of DNA bound proteins in the folded bacterial nucleoid, fluorescent reporters have been developed which can be targeted to specific DNA operator sites. Such Fluorescent Reporter-Operator System (FROS) probes consist of a fluorescent protein fused to a DNA binding protein, which binds to an array of DNA operator sites located within the genome. Here we have developed a new FROS probe using the Escherichia coli MalI transcription factor, fused to mCherry fluorescent protein. We have used this in combination with a LacI repressor::GFP protein based FROS probe to assess the cellular location of commonly regulated transcription units that are distal on the Escherichia coli genome. We developed a new DNA binding fluorescent reporter, consisting of the Escherichia coli MalI protein fused to the mCherry fluorescent protein. This was used in combination with a Lac repressor:green fluorescent protein fusion to examine the spatial positioning and possible co-localisation of target genes, regulated by the Escherichia coli AraC protein. We report that induction of gene expression with arabinose does not result in co-localisation of AraC-regulated transcription units. However, measurable repositioning was observed when gene expression was induced at the AraC-regulated promoter controlling expression of the araFGH genes, located close to the DNA replication terminus on the chromosome. Moreover, in dividing cells, arabinose-induced expression at the araFGH locus enhanced chromosome segregation after replication. Regions of the chromosome regulated by AraC do not colocalise, but transcription events can induce movement of chromosome loci in bacteria and our observations suggest a role for gene expression in chromosome segregation.

Pharmacokinetics of intramuscular microparticle depot of valdecoxib in an experimental model.

PubMed

Agnihotri, Sagar M; Vavia, Pradeep R

2009-09-01

We did a prospective study to investigate pharmacokinetics of a single intramuscularly (i.m.) administered Valdecoxib (VC) polymeric microparticles in New Zealand white rabbits. Poly[lac(glc-leu)] microparticles encapsulating a potent cyclooxygenase-2- selective inhibitor, VC, were prepared by emulsion and solvent evaporation technique and administered i.m. to rabbits for pharmacokinetic study. A single i.m. dose of drug-loaded poly[lac(glc-leu)] microparticles resulted in sustained therapeutic drug levels in the plasma for 49 days. The relative bioavailability was increased severalfold as compared with unencapsulated drug. Injectable poly[lac(glc-leu)] microparticles hold promise for increasing drug bioavailability and reducing dosing frequency for better management of rheumatoid arthritis.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Gains in efficiency and scientific potential of continental climate reconstruction provided by the LRC LacCore Facility, University of Minnesota

NASA Astrophysics Data System (ADS)

Noren, A.; Brady, K.; Myrbo, A.; Ito, E.

2007-12-01

Lacustrine sediment cores comprise an integral archive for the determination of continental paleoclimate, for their potentially high temporal resolution and for their ability to resolve spatial variability in climate across vast sections of the globe. Researchers studying these archives now have a large, nationally-funded, public facility dedicated to the support of their efforts. The LRC LacCore Facility, funded by NSF and the University of Minnesota, provides free or low-cost assistance to any portion of research projects, depending on the specific needs of the project. A large collection of field equipment (site survey equipment, coring devices, boats/platforms, water sampling devices) for nearly any lacustrine setting is available for rental, and Livingstone-type corers and drive rods may be purchased. LacCore staff can accompany field expeditions to operate these devices and curate samples, or provide training prior to device rental. The Facility maintains strong connections to experienced shipping agents and customs brokers, which vastly improves transport and importation of samples. In the lab, high-end instrumentation (e.g., multisensor loggers, high-resolution digital linescan cameras) provides a baseline of fundamental analyses before any sample material is consumed. LacCore staff provide support and training in lithological description, including smear-slide, XRD, and SEM analyses. The LRC botanical macrofossil reference collection is a valuable resource for both core description and detailed macrofossil analysis. Dedicated equipment and space for various subsample analyses streamlines these endeavors; subsamples for several analyses may be submitted for preparation or analysis by Facility technicians for a fee (e.g., carbon and sulfur coulometry, grain size, pollen sample preparation and analysis, charcoal, biogenic silica, LOI, freeze drying). The National Lacustrine Core Repository now curates ~9km of sediment cores from expeditions around the world, and stores metadata and analytical data for all cores processed at the facility. Any researcher may submit sample requests for material in archived cores. Supplies for field (e.g., polycarbonate pipe, endcaps), lab (e.g., sample containers, pollen sample spike), and curation (e.g., D-tubes) are sold at cost. In collaboration with facility users, staff continually develop new equipment, supplies, and procedures as needed in order to provide the best and most comprehensive set of services to the research community.

Portage Lake: Memories of an Ojibwe Childhood.

ERIC Educational Resources Information Center

Kegg, Maude; Nichols, John D., Ed.

Anishinaabe (Ojibwe or Chippewa) elder Maude Kegg relates stories of her childhood nearly 90 years ago on the Mille Lacs Reservation in central Minnesota. The Nonremoval Mille Lacs Band of Chippewa to which she belonged accommodated their way of life to altered land and new neighbors, but retained their rich religious and social life. Traditional…

The environment of x ray selected BL Lacs: Host galaxies and galaxy clustering

NASA Technical Reports Server (NTRS)

Wurtz, Ron; Stocke, John T.; Ellingson, Erica; Yee, Howard K. C.

1993-01-01

Using the Canada-France-Hawaii Telescope, we have imaged a complete, flux-limited sample of Einstein Medium Sensitivity Survey BL Lacertae objects in order to study the properties of BL Lac host galaxies and to use quantitative methods to determine the richness of their galaxy cluster environments.

Teaching the Big Ideas of Biology with Operon Models

ERIC Educational Resources Information Center

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

40 CFR 272.951 - Louisiana State-Administered Program: Final Authorization.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., Baton Rouge, LA 70804-9095; Phone number: (225) 342-5015; Web site: http://doa.louisiana.gov/osr/lac/lac.... Paul, Minnesota 55164-0526; Phone: 1-800-328-4880; Web site: http://west.thomson.com. You may inspect a... National Archives and Records Administration (NARA). For information on the availability of this material...

40 CFR 272.951 - Louisiana state-administered Program: Final authorization.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., Baton Rouge, LA 70804-9095; Phone number: (225) 342-5015; Web site: http://doa.louisiana.gov/osr/lac/lac.... Paul, Minnesota 55164 0526; Phone: 1-800-328-4880; Web site: http://west.thomson.com. You may inspect a... National Archives and Records Administration (NARA). For information on the availability of this material...

76 FR 78974 - Wisconsin Central Ltd.-Abandonment Exemption-in Fond Du Lac County, WI

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-20

... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 303 (Sub-No. 38X)] Wisconsin Central Ltd.--Abandonment Exemption--in Fond Du Lac County, WI Wisconsin Central Ltd. (WCL) \\1\\ filed a verified notice of exemption under 49 CFR pt. 1152 subpart F--Exempt Abandonments to abandon...

The Nature of Relationships and Rewards for Student Affairs Professionals at Liberal Arts Institutions

ERIC Educational Resources Information Center

Hirt, Joan B.; Schneiter, Steven R.; Amelink, Catherine T.

2005-01-01

This study examined the nature of relationships and rewards for student affairs administrators at liberal arts colleges (LACs). Forty-three student affairs administrators from LACs participated in five focus groups. Results indicate that administrators tend to spend most of their time with students, followed try other student affairs…

A Modified Consumer Inkjet for Spatiotemporal Control of Gene Expression

PubMed Central

Cohen, Daniel J.; Morfino, Roberto C.; Maharbiz, Michel M.

2009-01-01

This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 µm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer) and glucose (inhibitor), can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity. PMID:19763256

Complex genomic rearrangement in CCS-LacZ transgenic mice.

PubMed

Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

2007-02-01

The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

Degradation of synthetic pollutants in real wastewater using laccase encapsulated in core-shell magnetic copper alginate beads.

PubMed

Le, Thao Thanh; Murugesan, Kumarasamy; Lee, Chung-Seop; Vu, Chi Huong; Chang, Yoon-Seok; Jeon, Jong-Rok

2016-09-01

Immobilization of laccase has been highlighted to enhance their stability and reusability in bioremediation. In this study, we provide a novel immobilization technique that is very suitable to real wastewater treatment. A perfect core-shell system composing copper alginate for the immobilization of laccase (Lac-beads) was produced. Additionally, nFe2O3 was incorporated for the bead recycling through magnetic force. The beads were proven to immobilize 85.5% of total laccase treated and also to be structurally stable in water, acetate buffer, and real wastewater. To test the Lac-beads reactivity, triclosan (TCS) and Remazol Brilliant Blue R (RBBR) were employed. The Lac-beads showed a high percentage of TCS removal (89.6%) after 8h and RBBR decolonization at a range from 54.2% to 75.8% after 4h. Remarkably, the pollutants removal efficacy of the Lac-beads was significantly maintained in real wastewater with the bead recyclability, whereas that of the corresponding free laccase was severely deteriorated. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification and characterization of stress degradants of lacosamide by LC-MS and ESI-Q-TOF-MS/MS: development and validation of a stability indicating RP-HPLC method.

PubMed

Ramisetti, Nageswara Rao; Kuntamukkala, Ramakrishna; Lakshetti, Sridhar; Sripadi, Prabhakar

2014-07-01

The current study dealt with the degradation behavior of lacosamide (LAC) under ICH prescribed stress conditions. LAC was found to be labile under acid and base hydrolytic stress conditions, while it was stable to neutral hydrolytic, oxidative, photolytic and thermal stress. In total, seven degradation products (DPs) were formed, which were separated on a C18 column using a stability-indicating method. LC-MS analyses indicated that one of the DPs had the same molecular mass as that of the drug. Structural characterization of DPs was carried out using ESI-Q-TOF-MS/MS technique. The degradation pathways and mechanisms of degradation of the drug were delineated by carrying out the degradation in different co-solvents viz. methanol, deuterated methanol, ethanol, 1-propanol and acetonitrile. The developed LC method was validated for the determination of related substances and assay of LAC as per ICH guidelines. This study demonstrates a comprehensive approach of LAC degradation studies during its development phase. Copyright © 2014. Published by Elsevier B.V.

STRUCTURED JETS IN BL LAC OBJECTS: EFFICIENT PeV NEUTRINO FACTORIES?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tavecchio, Fabrizio; Ghisellini, Gabriele; Guetta, Dafne

2014-09-20

The origin of high-energy neutrinos (0.1–1 PeV range) detected by IceCube remains a mystery. In this work, we explore the possibility that efficient neutrino production can occur in structured jets of BL Lac objects, characterized by a fast inner spine surrounded by a slower layer. This scenario has been widely discussed in the framework of the high-energy emission models for BL Lac objects and radio galaxies. One of the relevant consequences of a velocity structure is the enhancement of the inverse Compton emission caused by the radiative coupling of the two zones. We show that a similar boosting could occurmore » for the neutrino output of the spine through the photo-meson reaction of high-energy protons scattering off the amplified soft target photon field of the layer. Assuming the local density and the cosmological evolution of γ-ray BL Lac object derived from Fermi Large Area Telescope data, we calculate the expected diffuse neutrino intensity, which can match the IceCube data for a reasonable choice of parameters.« less

An emerging population of BL Lacs with extreme properties: towards a class of EBL and cosmic magnetic field probes?

NASA Astrophysics Data System (ADS)

Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Sbarrato, T.

2015-07-01

High-energy observations of extreme BL Lac objects, such as 1ES 0229+200 or 1ES 0347-121, recently focused interest both for blazar and jet physics and for the implication on the extragalactic background light and intergalactic magnetic field estimate. However, the number of these extreme highly peaked BL Lac objects (EHBL) is still rather small. Aiming at increase their number, we selected a group of EHBL candidates starting from the BL Lac sample of Plotkin et al. (2011), considering those undetected (or only barely detected) by the Large Area Telescope onboard Fermi and characterized by a high X-ray versus radio flux ratio. We assembled the multiwavelength spectral energy distribution of the resulting nine sources, profiting of publicly available archival observations performed by Swift, GALEX, and Fermi satellites, confirming their nature. Through a simple one-zone synchrotron self-Compton model we estimate the expected very high energy flux, finding that in the majority of cases it is within the reach of present generation of Cherenkov arrays or of the forthcoming Cherenkov Telescope Array.

Cooperative DNA binding of heterologous proteins: Evidence for contact between the cyclic AMP receptor protein and RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Y.L.; Garges, S.; Adhya, S.

1988-06-01

Four cAMP-independent receptor protein mutants (designated CRP* mutants) isolated previously are able to activate in vivo gene transcription in the absence of cAMP and their activity can be enhanced by cAMP or cGMP. One of the four mutant proteins, CRP*598 (Arg-142 to His, Ala-144 to Thr), has been characterized with regard to its conformational properties and ability to bind to and support abortive initiation from the lac promoter. Binding of wild-type CRP to its site on the lac promoter and activation of abortive initiation by RNA polymerase on this promoter are effected by cAMP but not by cGMP. CRP*598 canmore » activate lacP{sup +}-directed abortive initiation in the presence of cAMP and less efficiently in the presence of cGMP or in the absence of cyclic nucleotide. DNase I protection (footprinting) indicates that cAMP-CRP* binds to its site on the lac promoter whereas unliganded CRP* and cGMP-CRP* form a stable complex with the ({sup 32}P)lacP{sup +} fragment only in the presence of RNA polymerase, showing cooperative binding of two heterologous proteins. This cooperative binding provides strong evidence for a contact between CRP and RNA polymerase for activation of transcription. Although cGMP binds to CRP, it cannot replace cAMP in effecting the requisite conformational transition necessary for site-specific promoter binding.« less

New High-z BL Lacs Using the Photometric Method with Swift and SARA

NASA Astrophysics Data System (ADS)

Kaur, A.; Rau, A.; Ajello, M.; Domínguez, A.; Paliya, V. S.; Greiner, J.; Hartmann, D. H.; Schady, P.

2018-06-01

BL Lacertae (BL Lac) objects are prominent members of the third Fermi Large Area Telescope catalog of γ-ray sources. Half of the members of the BL Lac population (∼300) lack redshift measurements, which is due to the absence of lines in their optical spectra, thereby making it difficult to utilize spectroscopic methods. Our photometric dropout technique can be used to establish the redshift for a fraction of these sources. This work employed six filters mounted on the Swift-UVOT and four optical filters on two telescopes, the 0.65 m SARA-CTIO in Chile and 1.0 m SARA-ORM in the Canary Islands, Spain. A sample of 15 sources was extracted from the Swift archival data for which six filter UVOT observations were conducted. By complementing the Swift observations with the SARA ones, we were able to discover two high-redshift sources: 3FGL J1155.4-3417 and 3FGL J1156.7–2250 at z={1.83}-0.13+0.10 and z={1.73}-0.19+0.11, respectively, resulting from the dropouts in the power-law template fits to these data. The discoveries add to the important (26 total) sample of high-redshift BL Lacs. While the sample of high-z BL Lacs is still rather small, these objects do not seem to fit well within known schemes of the blazar population and represent the best probes of the extragalactic background light.

Proteomic identification of proteins translocated to membrane microdomains upon treatment of fibroblasts with the glycosphingolipid, C8-beta-D-lactosylceramide.

PubMed

Kim, Seong-Youl; Wang, Teng-ke; Singh, Raman Deep; Wheatley, Christine L; Marks, David L; Pagano, Richard E

2009-09-01

Plasma membrane (PM) microdomains, including caveolae and other cholesterol-enriched subcompartments, are involved in the regulation of many cellular processes, including endocytosis, attachment and signaling. We recently reported that brief incubation of human skin fibroblasts with the synthetic glycosphingolipid, D-erythro-octanoyl-lactosylceramide (C8-D-e-LacCer), stimulates endocytosis via caveolae and induces the appearance of micron-size microdomains on the PM. To further understand the effects of C8-D-e-LacCer treatment on PM microdomains, we used a detergent-free method to isolate microdomain-enriched membranes from fibroblasts treated +/-C8-D-e-LacCer, and performed 2-DE and mass spectrophotometry to identify proteins that were altered in their distribution in microdomains. Several proteins were identified in the microdomain-enriched fractions, including lipid transfer proteins and proteins related to the functions of small GTPases. One protein, Rho-associated protein kinase 2 (ROCK2), was verified by Western blotting to occur in microdomain fractions and to increase in these fractions after D-e-LacCer treatment. Immunofluorescence revealed that ROCK2 exhibited an increased localization at or near the PM in C8-D-e-LacCer-treated cells. In contrast, ROCK2 distribution in microdomains was decreased by treatment of cells with C8-L-threo-lactosylceramide, a glycosphingolipid with non-natural stereochemistry. This study identifies new microdomain-associated proteins and provides evidence that microdomains play a role in the regulation of the Rho/ROCK signaling pathway.

A selective, non-peptide CRF receptor 1 antagonist prevents sodium lactate-induced acute panic-like responses.

PubMed

Shekhar, Anantha; Johnson, Philip L; Fitz, Stephanie D; Nakazato, Atsuro; Chaki, Shigeyuki; Steckler, Thomas; Schmidt, Mark

2011-04-01

Corticotropin releasing factor (CRF) is implicated in a variety of stress-related disorders such as depression and anxiety, and blocking CRF receptors is a putative strategy for treating such disorders. Using a well-studied animal model of panic, we tested the efficacy of JNJ19567470/CRA5626, a selective, non-peptidergic CRF type 1 receptor (CRF1) antagonist (3, 10 and 40 mg/kg intraperitoneal injection), in preventing the sodium lactate (NaLac)-induced panic-like behavioural and cardiovascular responses. Adult male rats with chronic reduction of GABA levels (by inhibition of GABA synthesis with l-allyglycine, a glutamic acid decarboxylase inhibitor) in the dorsomedial/perifornical hypothalamus are highly anxious and exhibit physiological and behavioural responses to intravenous NaLac infusions similar to patients with panic disorder. These 'panic-prone' rats pre-treated with vehicle injections displayed NaLac-induced increases in autonomic responses (i.e. tachycardia and hypertensive responses), anxiety-like behaviour in the social interaction test, and flight-like increases in locomotor activity. However, systemically injecting such panic-prone rats with the highest dose of CRF1 receptor antagonist prior to NaLac infusions blocked all NaLac-induced behaviour and cardiovascular responses. These data suggest that selective CRF1 receptor antagonists could be a novel target for developing anti-panic drugs that are as effective as benzodiazepines in acute treatment of a panic attack without the deleterious side-effects (e.g. sedation and cognitive impairment) associated with benzodiazepines.

Risk factors for human papillomavirus exposure and co-factors for cervical cancer in Latin America and the Caribbean.

PubMed

Almonte, Maribel; Albero, Ginesa; Molano, Mónica; Carcamo, César; García, Patricia J; Pérez, Gonzalo

2008-08-19

The incidence of cervical cancer in Latin America and the Caribbean (LAC) is among the highest in the world. Because there are major demographic shifts happening in LAC countries (population growth, urbanization and ageing) cervical cancer incidence and mortality will likely continue to be a significant public health problem. Overall human papillomavirus (HPV) prevalence in the LAC general population has been found to be 2-fold higher than the average worldwide prevalence. The large HPV and cancer burden may be explained by the highly prevalent HPV variants of HPV types -16 and 18, which have an increased oncogenic potential. Given the major mode of transmission of genital HPV is sexual, certain, patterns of sexual behaviour (early age at first sexual intercourse, number of sexual partners and sexual behaviour of the partner) are associated with an increased risk of HPV genital acquisition. Although HPV infection is necessary for carcinogenesis, certain co-factors (high parity, long term use of oral contraceptives, smoking and co-infection with the human immunodeficiency virus (HIV)) help in the progression from infection to cancer. Many studies that have contributed to this evidence have been carried out in LAC and are reviewed and summarised in this article. Since HPV vaccines will likely take years to implement, and many more years to show impact on disease, cervical cancer screening programmes remain as the key intervention to control disease in LAC in the years to come.

Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.

PubMed

Cowing, D W; Kenyon, C

1992-10-01

mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.

Active galaxies observed during the Extreme Ultraviolet Explorer all-sky survey

NASA Technical Reports Server (NTRS)

Marshall, H. L.; Fruscione, A.; Carone, T. E.

1995-01-01

We present observations of active galactic nuclei (AGNs) obtained with the Extreme Ultraviolet Explorer (EUVE) during the all-sky survey. A total of 13 sources were detected at a significance of 2.5 sigma or better: seven Seyfert galaxies, five BL Lac objects, and one quasar. The fraction of BL Lac objects is higher in our sample than in hard X-ray surveys but is consistent with the soft X-ray Einstein Slew Survey, indicating that the main reason for the large number of BL Lac objects in the extreme ulktraviolet (EUV) and soft X-ray bands is their steeper X-ray spectra. We show that the number of AGNs observed in both the EUVE and ROSAT Wide Field Camera surveys can readily be explained by modelling the EUV spectra with a simple power law in the case of BL Lac objects and with an additional EUV excess in the case of Seyferts and quasars. Allowing for cold matter absorption in Seyfert galaxy hosts drive up the inferred average continuum slope to 2.0 +/- 0.5 (at 90% confidence), compared to a slope of 1.0 usually found from soft X-ray data. If Seyfert galaxies without EUV excesses form a significant fraction of the population, then the average spectrum of those with bumps should be even steeper. We place a conservative limit on neutral gas in BL Lac objects: N(sub H) less than 10(exp 20)/sq cm.

Implementation of HPV vaccination guidelines in a diverse population in Los Angeles: Results from an environmental scan of local HPV resources and needs.

PubMed

Baezconde-Garbanati, Lourdes; Lienemann, Brianna A; Robles, Marisela; Johnson, Ethel; Sanchez, Kathleen; Singhal, Rita; Steinberg, Jane; Jaque, Jenny M; Pentz, Mary Ann; Gruber, Stephen

2017-09-05

Research shows that vaccination against human papillomavirus (HPV) infection is one of the most effective methods for reducing risk for cervical cancer; it also protects against other HPV-related cancers. Controversies exist regarding HPV vaccination in several communities; which may in part explain why although rates of HPV vaccination are increasing nationwide, Los Angeles County (LAC) data show that many adolescents are still not vaccinated. These adolescents remain at high-risk for infection. Using community-based participatory principles, we conducted an environmental scan that included a literature review, the development of a community advisory board, community feedback from HPV community meetings, and interviews with stakeholders to understand attitudes toward HPV vaccination and their impact in follow through with HPV vaccines. Twenty-eight key stakeholders participated in our coalition comprised of community organizations and clinics with strong ties to the local community. This is the only coalition dedicated exclusively to improving HPV vaccine uptake in LAC. Of these, twenty-one participated in an environmental scan via qualitative interviews about HPV vaccination programs, service delivery priorities, and proposed steps to increase HPV vaccination uptake in LAC. The environmental scan revealed targets for future efforts, barriers to HPV uptake, and next steps for improving local HPV vaccination uptake rates. The environmental scan also identified local HPV vaccination interventions and resources. Although LAC has developed important efforts for vaccination, some interventions are no longer being implemented due to lack of funds; others have not been evaluated with sufficient outcome data. The risk for cervical and other HPV-related cancers could be greatly reduced in LAC if a multilevel, multicultural, and multilingual approach is taken to better understand rates of HPV vaccination uptake, particularly among racial/ethnic minorities and LGBTQ youth. Our environmental scan provides guidance on attitudes toward vaccination, and how best to address the needs of LAC families and providers. Copyright © 2017 Elsevier Ltd. All rights reserved.

An MSC2 Promoter-lacZ Fusion Gene Reveals Zinc-Responsive Changes in Sites of Transcription Initiation That Occur across the Yeast Genome

PubMed Central

Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.

2016-01-01

The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924

Blockade of PD-1/B7-H1 Interaction Restores Effector CD8+ T Cell Responses in a Hepatitis C Virus Core Murine Model1

PubMed Central

Lukens, John R.; Cruise, Michael W.; Lassen, Matthew G.; Hahn, Young S.

2010-01-01

The impaired function of CD8+ T cells is characteristic of hepatitis C virus (HCV) persistent infection. HCV core protein has been reported to inhibit CD8+ T cell responses. To determine the mechanism of the HCV core in suppressing Ag-specific CD8+ T cell responses, we generated a transgenic mouse, core(+) mice, where the expression of core protein is directed to the liver using the albumin promoter. Using a recombinant adenovirus to deliver Ag, we demonstrated that core(+) mice failed to clear adenovirus-LacZ (Ad-LacZ) infection in the liver. The effector function of LacZ-specific CD8+ T cells was particularly impaired in the livers of core(+) mice, with suppression of IFN-γ, TNF-α, and granzyme B production by CD8+ T cells. In addition, the impaired CD8+ T cell responses in core(+) mice were accompanied by the enhanced expression of the inhibitory receptor programmed death-1 (PD-1) by LacZ-specific CD8+ T cells and its ligand B7-H1 on liver dendritic cells following Ad-LacZ infection. Importantly, blockade of the PD-1/B7-H1 inhibitory pathway (using a B7-H1 blocking antibody) in core(+) mice enhanced effector function of CD8+ T cells and cleared Ad-LacZ-infection as compared with that in mice treated with control Ab. This suggests that the regulation of the PD-1/B7-H1 inhibitory pathway is crucial for HCV core-mediated impaired T cell responses and viral persistence in the liver. This also suggests that manipulation of the PD-1/B7-H1 pathway may be a potential immunotherapy to enhance effector T cell responses during persistent HCV infection. PMID:18354211

Regulatory Circuitry of the CsrA/CsrB and BarA/UvrY Systems of Escherichia coli

PubMed Central

Suzuki, Kazushi; Wang, Xin; Weilbacher, Thomas; Pernestig, Anna-Karin; Melefors, Öjar; Georgellis, Dimitris; Babitzke, Paul; Romeo, Tony

2002-01-01

The global regulator CsrA (carbon storage regulator) is an RNA binding protein that coordinates central carbon metabolism, activates flagellum biosynthesis and motility, and represses biofilm formation in Escherichia coli. CsrA activity is antagonized by the untranslated RNA CsrB, to which it binds and forms a globular ribonucleoprotein complex. CsrA indirectly activates csrB transcription, in an apparent autoregulatory mechanism. In the present study, we elucidate the intermediate regulatory circuitry of this system. Mutations affecting the BarA/UvrY two-component signal transduction system decreased csrB transcription but did not affect csrA′-′lacZ expression. The uvrY defect was severalfold more severe than that of barA. Both csrA and uvrY were required for optimal barA expression. The latter observation suggests an autoregulatory loop for UvrY. Ectopic expression of uvrY suppressed the csrB-lacZ expression defects caused by uvrY, csrA, or barA mutations; csrA suppressed csrA or barA defects; and barA complemented only the barA mutation. Purified UvrY protein stimulated csrB-lacZ expression approximately sixfold in S-30 transcription-translation reactions, revealing a direct effect of UvrY on csrB transcription. Disruption of sdiA, which encodes a LuxR homologue, decreased the expression of uvrY′-′lacZ and csrB-lacZ fusions but did not affect csrA′-′lacZ. The BarA/UvrY system activated biofilm formation. Ectopic expression of uvrY stimulated biofilm formation by a csrB-null mutant, indicative of a CsrB-independent role for UvrY in biofilm development. Collectively, these results demonstrate that uvrY resides downstream from csrA in a signaling pathway for csrB and that CsrA stimulates UvrY-dependent activation of csrB expression by BarA-dependent and -independent mechanisms. PMID:12193630

Epidemiology in Latin America and the Caribbean: current situation and challenges

PubMed Central

Barreto, Sandhi M; Miranda, Jaime J; Figueroa, J Peter; Schmidt, Maria Inês; Munoz, Sergio; Kuri-Morales, P Pablo; Silva, Jarbas B

2012-01-01

Background This article analyses the epidemiological research developments in Latin America and the Caribbean (LAC). It integrates the series commissioned by the International Epidemiological Association to all WHO Regions to identify global opportunities to promote the development of epidemiology. Methods Health situations of the regions were analysed based on published data on selected mortality, morbidity and risk factors. Epidemiological publication output by country was estimated by Medline bibliometrics. Internet and literature searches and data provided by key informants were used to describe perspectives on epidemiological training, research and funding. Findings Despite important advances in recent decades, LAC remains the world's most unequal region. In 2010, 10% of the LAC's people still lived in conditions of multidimensional poverty, with huge variation among countries. The region has experienced fast and complex epidemiological changes in past decades, combining increasing rates of non-communicable diseases and injuries, and keeping uncontrolled many existing endemic and emerging diseases. Overall, epidemiological publications per year increased from 160 articles between 1961 and 1970 to 2492 between 2001 and 2010. The increase in papers per million inhabitants in the past three decades varied from 57% in Panama to 1339% in Paraguay. Universities are the main epidemiological training providers. There are at least 34 universities and other institutions in the region that offer postgraduate programmes at the master’s and doctoral levels in epidemiology or public health. Most LAC countries rely largely on external funding and donors to initiate and sustain long-term research efforts. Despite the limited resources, the critical mass of LAC researchers has produced significant scientific contributions. Future needs The health research panorama of the region shows enormous regional discrepancies, but great prospects. Improving research and human resources capacity in the region will require establishing research partnerships within and outside the region, between rich and poor countries, promoting collaborations between LAC research institutions and universities to boost postgraduate programmes and aligning research investments and outputs with the current burden of disease. PMID:22407860

Epidemiology in Latin America and the Caribbean: current situation and challenges.

PubMed

Barreto, Sandhi M; Miranda, Jaime J; Figueroa, J Peter; Schmidt, Maria Inês; Munoz, Sergio; Kuri-Morales, P Pablo; Silva, Jarbas B

2012-04-01

This article analyses the epidemiological research developments in Latin America and the Caribbean (LAC). It integrates the series commissioned by the International Epidemiological Association to all WHO Regions to identify global opportunities to promote the development of epidemiology. Health situations of the regions were analysed based on published data on selected mortality, morbidity and risk factors. Epidemiological publication output by country was estimated by Medline bibliometrics. Internet and literature searches and data provided by key informants were used to describe perspectives on epidemiological training, research and funding. Despite important advances in recent decades, LAC remains the world's most unequal region. In 2010, 10% of the LAC's people still lived in conditions of multidimensional poverty, with huge variation among countries. The region has experienced fast and complex epidemiological changes in past decades, combining increasing rates of non-communicable diseases and injuries, and keeping uncontrolled many existing endemic and emerging diseases. Overall, epidemiological publications per year increased from 160 articles between 1961 and 1970 to 2492 between 2001 and 2010. The increase in papers per million inhabitants in the past three decades varied from 57% in Panama to 1339% in Paraguay. Universities are the main epidemiological training providers. There are at least 34 universities and other institutions in the region that offer postgraduate programmes at the master's and doctoral levels in epidemiology or public health. Most LAC countries rely largely on external funding and donors to initiate and sustain long-term research efforts. Despite the limited resources, the critical mass of LAC researchers has produced significant scientific contributions. FUTURE NEEDS: The health research panorama of the region shows enormous regional discrepancies, but great prospects. Improving research and human resources capacity in the region will require establishing research partnerships within and outside the region, between rich and poor countries, promoting collaborations between LAC research institutions and universities to boost postgraduate programmes and aligning research investments and outputs with the current burden of disease.

Isolating LacZ-expressing cells from mouse inner ear tissues using flow cytometry.

PubMed

Jan, Taha A; Chai, Renjie; Sayyid, Zahra N; Cheng, Alan G

2011-12-23

Isolation of specific cell types allows one to analyze rare cell populations such as stem/progenitor cells. Such an approach to studying inner ear tissues presents a unique challenge because of the paucity of cells of interest and few transgenic reporter mouse models. Here, we describe a protocol using fluorescence-conjugated probes to selectively label LacZ-positive cells from the neonatal cochleae. The most common underlying pathology of sensorineural hearing loss is the irreversible damage and loss of cochlear sensory hair cells, which are required to transduce sound waves to neural impulses. Recent evidence suggests that the murine auditory and vestibular organs harbor stem/progenitor cells that may have regenerative potential. These findings warrant further investigation, including identifying specific cell types with stem/progenitor cell characteristics. The Wnt signaling pathway has been demonstrated to play a critical role in maintaining stem/progenitor cell populations in several organ systems. We have recently identified Wnt-responsive Axin2-expressing cells in the neonatal cochlea, but their function is largely unknown. To better understand the behavior of these Wnt-responsive cells in vitro, we have developed a method of isolating Axin2-expressing cells from cochleae of Axin2-LacZ reporter mice. Using flow cytometry to isolate Axin2-LacZ positive cells from the neonatal cochleae, we could in turn execute a variety of experiments on live cells to interrogate their behavior as stem/progenitor cells. Here, we describe in detail the steps for the microdissection of neonatal cochlea, dissociation of these tissues, labeling of the LacZ-positive cells using a fluorogenic substrate, and cell sorting. Techniques for dissociating cochleae into single cells and isolating cochlear cells via flow cytometry have been described. We have made modifications to these techniques to establish a novel protocol to isolate LacZ-expressing cells from the neonatal cochlea.

Mice over-expressing human O6 alkylguanine-DNA alkyltransferase selectively reduce O6 methylguanine mediated carcinogenic mutations to threshold levels after N-methyl-N-nitrosourea.

PubMed

Allay, E; Veigl, M; Gerson, S L

1999-06-24

While it is well known that MNU induces thymic lymphomas in the mouse, it remains unclear which pre-mutagenic lesions are responsible for lymphomagenic transformation. One lesion thought to play a critical role is O6methylguanine[O6mG]which initiates G: C to A:T transition mutations in K-ras and other oncogenes. O6alkylguanine-DNA alkyltransferase (AGT), encoded by the methylguanine methyltransferase gene [MGMT], removes the methyl group thereby preventing the mutation from occurring. When overexpressed in the thymus, MGMT protects mice from MNU-induced thymic lymphomas. To determine whether MGMT overexpression reduced G: C to A: T mutation frequency after MNU, Big Blue lacI and MGMT+/Big Blue mice were treated with MNU and analysed for mutations in the lacI and K-ras genes. The incidence of MNU-induced lymphomas was 84% in Big Blue lacI mice compared to 14% in MGMT+Big Blue lacI mice. Sixty-two per cent of the lymphomas had a GGT to GAT activating mutation in codon 12 of K-ras consistent with O6mG adduct-mediated point mutagenesis. LacI mutation frequency in thymus of MNU treated Big Blue mice was 45-fold above background whereas it was 11-fold above background in MNU treated MGMT+/Big Blue mice. Most lacI mutations were G:C to A:T transitions, implicating O6mG even in the MGMT+mice. No mutations were attributable to chromosomal aberrations or rearrangements. Thus, O6mG adducts account for the carcinogenic effect of MNU and MGMT overexpression is selectively able to reduce O6methylguanine adducts below a carcinogenic threshold. Other adducts are mutagenic but appear to contribute much less to malignant transformation or oncogene activation.

Commissioning of a PTW 34070 large-area plane-parallel ionization chamber for small field megavoltage photon dosimetry.

PubMed

Kupfer, Tom; Lehmann, Joerg; Butler, Duncan J; Ramanathan, Ganesan; Bailey, Tracy E; Franich, Rick D

2017-11-01

This study investigates a large-area plane-parallel ionization chamber (LAC) for measurements of dose-area product in water (DAP w ) in megavoltage (MV) photon fields. Uniformity of electrode separation of the LAC (PTW34070 Bragg Peak Chamber, sensitive volume diameter: 8.16 cm) was measured using high-resolution microCT. Signal dependence on angle α of beam incidence for square 6 MV fields of side length s = 20 cm and 1 cm was measured in air. Polarity and recombination effects were characterized in 6, 10, and 18 MV photons fields. To assess the lateral setup tolerance, scanned LAC profiles of a 1 × 1 cm 2 field were acquired. A 6 MV calibration coefficient, N D ,w, LAC , was determined in a field collimated by a 5 cm diameter stereotactic cone with known DAP w . Additional calibrations in 10 × 10 cm 2 fields at 6, 10, and 18 MV were performed. Electrode separation is uniform and agrees with specifications. Volume-averaging leads to a signal increase proportional to ~1/cos(α) in small fields. Correction factors for polarity and recombination range between 0.9986 to 0.9996 and 1.0007 to 1.0024, respectively. Off-axis displacement by up to 0.5 cm did not change the measured signal in a 1 × 1 cm 2 field. N D ,w, LAC was 163.7 mGy cm -2 nC -1 and differs by +3.0% from the coefficient derived in the 10 × 10 cm 2 6 MV field. Response in 10 and 18 MV fields increased by 1.0% and 2.7% compared to 6 MV. The LAC requires only small correction factors for DAP w measurements and shows little energy dependence. Lateral setup errors of 0.5 cm are tolerated in 1 × 1 cm 2 fields, but beam incidence must be kept as close to normal as possible. Calibration in 10 × 10 fields is not recommended because of the LAC's over-response. The accuracy of relative point-dose measurements in the field's periphery is an important limiting factor for the accuracy of DAP w measurements. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

Bistability of the lac operon during growth of Escherichia coli on lactose and lactose+glucose.

PubMed

Narang, Atul; Pilyugin, Sergei S

2008-05-01

The lac operon of Escherichia coli can exhibit bistability. Early studies showed that bistability occurs during growth on TMG/succinate and lactose+glucose, but not during growth on lactose. More recently, studies with lacGFP-transfected cells show bistability during growth on TMG/succinate, but not during growth on lactose and lactose+glucose. In the literature, these results are invariably attributed to variations in the destabilizing effect of the positive feedback generated by induction. Specifically, during growth on TMG/succinate, lac induction generates strong positive feedback because the permease stimulates the accumulation of intracellular TMG, which in turn, promotes the synthesis of even more permease. This positive feedback is attenuated during growth on lactose because hydrolysis of intracellular lactose by beta-galactosidase suppresses the stimulatory effect of the permease. It is attenuated even more during growth on lactose + glucose because glucose inhibits the uptake of lactose. But it is clear that the stabilizing effect of dilution also changes dramatically as a function of the medium composition. For instance, during growth on TMG/succinate, the dilution rate of lac permease is proportional to its activity, e, because the specific growth rate is independent of e (it is completely determined by the concentration of succinate). However, during growth on lactose, the dilution rate of the permease is proportional to e2 because the specific growth rate is proportional to the specific lactose uptake rate, which in turn, proportional to e. We show that: (a) This dependence on e2 creates such a strong stabilizing effect that bistability is virtually impossible during growth on lactose, even in the face of the intense positive feedback generated by induction. (b) This stabilizing effect is weakened during growth on lactose+glucose because the specific growth rate on glucose is independent of e, so that the dilution rate once again contains a term that is proportional to e. These results imply that the lac operon is much more prone to bistability if the medium contains carbon sources that cannot be metabolized by the lac enzymes, e.g., succinate during growth on TMG/succinate and glucose during growth on lactose+glucose. We discuss the experimental data in the light of these results.

Somato-synaptic variation of GABA(A) receptors in cultured murine cerebellar granule cells: investigation of the role of the alpha6 subunit.

PubMed

Mellor, J R; Wisden, W; Randall, A D

2000-07-10

Electrophysiological investigation of cultured cerebellar murine granule cells revealed differences between the GABA(A) receptors at inhibitory synapses and those on the cell body. Specifically, mIPSCs decayed more rapidly than cell body receptors deactivated, the mean single channel conductance at the synapse (32 pS) was greater than that at cell body (21 pS) and only cell body receptors were sensitive to Zn(2+) (150 microM), which depressed response amplitude by 82+/-5% and almost doubled the rate of channel deactivation. The GABA(A) receptor alpha6 subunit is selectively expressed in cerebellar granule cells. Although concentrated at synapses, it is also found on extrasynaptic membranes. Using a mouse line (Deltaalpha6lacZ) lacking this subunit, we investigated its role in the somato-synaptic differences in GABA(A) receptor function. All differences between cell body and synaptic GABA(A) receptors observed in wild-type (WT) granule cells persisted in Deltaalpha6lacZ cells, thus demonstrating that they are not specifically due to the cellular distribution of the alpha6 subunit. However, mIPSCs from WT and Deltaalpha6lacZ cells differed in both their kinetics (faster decay in WT cells) and underlying single channel conductance (32 pS WT, 25 pS Deltaalpha6lacZ). This provides good evidence for a functional contribution of the alpha6 subunit to postsynaptic GABA(A) receptors in these cells. Despite this, deactivation kinetics of mIPSCs in WT and Deltaalpha6lacZ granule cells exhibited similar benzodiazepene (BDZ) sensitivity. This suggests that the enhanced BDZ-induced ataxia seen in Deltaalpha6lacZ mice may reflect physiological activity at extrasynaptic receptors which, unlike those at synapses, display differential BDZ-sensitivity in WT and Deltaalpha6lacZ granule cells (Jones, A.M., Korpi, E.R., McKernan, R.M., Nusser, Z., Pelz, R., Makela, R., Mellor, J.R., Pollard, S., Bahn, S., Stephenson, F.A., Randall, A.D., Sieghart, W., Somogyi, P., Smith, A.J.H., Wisden, W., 1997. Ligand-gated ion channel partnerships: GABA(A) receptor alpha(6) subunit inactivation inhibits delta subunit expression. Journal of Neuroscience 17, 1350-1362).

Treatment of grain with organic acids at 2 different dietary phosphorus levels modulates ruminal microbial community structure and fermentation patterns in vitro.

PubMed

Harder, H; Khol-Parisini, A; Metzler-Zebeli, B U; Klevenhusen, F; Zebeli, Q

2015-11-01

Recent data indicate positive effects of treating grain with citric (CAc) or lactic acid (LAc) on the hydrolysis of phytate phosphorus (P) and fermentation products of the grain. This study used a semicontinuous rumen simulation technique to evaluate the effects of processing of barley with 50.25 g/L (wt/vol) CAc or 76.25 g/L LAc on microbial composition, metabolic fermentation profile, and nutrient degradation at low or high dietary P supply. The low P diet [3.1g of P per kg of dry matter (DM) of dietary P sources only] was not supplemented with inorganic P, whereas the high P diet was supplemented with 0.5 g of inorganic P per kg of DM through mineral premix and 870 mg of inorganic P/d per incubation fermenter via artificial saliva. Target microbes were determined using quantitative PCR. Data showed depression of total bacteria but not of total protozoa or short-chain fatty acid (SCFA) concentration with the low P diet. In addition, the low P diet lowered the relative abundance of Ruminococcus albus and decreased neutral detergent fiber (NDF) degradation and acetate proportion, but increased the abundance of several predominantly noncellulolytic bacterial species and anaerobic fungi. Treatment of grain with LAc increased the abundance of total bacteria in the low P diet only, and this effect was associated with a greater concentration of SCFA in the ruminal fluid. Interestingly, in the low P diet, CAc treatment of barley increased the most prevalent bacterial group, the genus Prevotella, in ruminal fluid and increased NDF degradation to the same extent as did inorganic P supplementation in the high P diet. Treatment with either CAc or LAc lowered the abundance of Megasphaera elsdenii but only in the low P diet. On the other hand, CAc treatment increased the proportion of acetate in the low P diet, whereas LAc treatment decreased this variable at both dietary P levels. The propionate proportion was significantly increased by LAc at both P levels, whereas butyrate increased only with the low P diet. Treatments with CAc or LAc reduced the degradation of CP and ammonia concentration compared with the control diet at both P levels. In conclusion, the beneficial effects of CAc and LAc treatment on specific ruminal microbes, fermentation profile, and fiber degradation in the low P diet suggest the potential for the treatment to compensate for the lack of inorganic P supplementation in vitro. Further research is warranted to determine the extent to which the treatment can alleviate the shortage of inorganic P supplementation under in vivo conditions. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Blazars in Hard X-rays

NASA Astrophysics Data System (ADS)

Ghisellini, Gabriele

2009-05-01

Although blazars are thought to emit most of their luminosity in the γ-ray band, there are subclasses of them very prominent in hard X-rays. These are the best candidates to be studied by Simbol-X. They are at the extremes of the blazar sequence, having very small or very high jet powers. The former are the class of TeV emitting BL Lacs, whose synchrotron emission often peaks at tens of keV or more. The latter are the blazars with the most powerful jets, have high black hole masses accreting at high (i.e. close to Eddington) rates. These sources are predicted to have their high energy peak even below the MeV band, and therefore are very promising candidates to be studied with Simbol-X.

Selection of a platinum-binding sequence in a loop of a four-helix bundle protein.

PubMed

Yagi, Sota; Akanuma, Satoshi; Kaji, Asumi; Niiro, Hiroya; Akiyama, Hayato; Uchida, Tatsuya; Yamagishi, Akihiko

2018-02-01

Protein-metal hybrids are functional materials with various industrial applications. For example, a redox enzyme immobilized on a platinum electrode is a key component of some biofuel cells and biosensors. To create these hybrid materials, protein molecules are bound to metal surfaces. Here, we report the selection of a novel platinum-binding sequence in a loop of a four-helix bundle protein, the Lac repressor four-helix protein (LARFH), an artificial protein in which four identical α-helices are connected via three identical loops. We created a genetic library in which the Ser-Gly-Gln-Gly-Gly-Ser sequence within the first inter-helical loop of LARFH was semi-randomly mutated. The library was then subjected to selection for platinum-binding affinity by using the T7 phage display method. The majority of the selected variants contained the Tyr-Lys-Arg-Gly-Tyr-Lys (YKRGYK) sequence in their randomized segment. We characterized the platinum-binding properties of mutant LARFH by using quartz crystal microbalance analysis. Mutant LARFH seemed to interact with platinum through its loop containing the YKRGYK sequence, as judged by the estimated exclusive area occupied by a single molecule. Furthermore, a 10-residue peptide containing the YKRGYK sequence bound to platinum with reasonably high affinity and basic side chains in the peptide were crucial in mediating this interaction. In conclusion, we have identified an amino acid sequence, YKRGYK, in the loop of a helix-loop-helix motif that shows high platinum-binding affinity. This sequence could be grafted into loops of other polypeptides as an approach to immobilize proteins on platinum electrodes for use as biosensors among other applications. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Comparative analysis of conditional reporter alleles in the developing embryo and embryonic nervous system.

PubMed

Ellisor, Debra; Koveal, Dorothy; Hagan, Nellwyn; Brown, Ashly; Zervas, Mark

2009-10-01

A long-standing problem in development is understanding how progenitor cells transiently expressing genes contribute to complex anatomical and functional structures. In the developing nervous system an additional level of complexity arises when considering how cells of distinct lineages relate to newly established neural circuits. To address these problems, we used both cumulative marking with Cre/loxP and Genetic Inducible Fate Mapping (GIFM), which permanently and heritably marks small populations of progenitors and their descendants with fine temporal control using CreER/loxP. A key component used in both approaches is a conditional phenotyping allele that has the potential to be expressed in all cell types, but is quiescent because of a loxP flanked Stop sequence, which precedes a reporter allele. Upon recombination, the resulting phenotyping allele is 'turned on' and then constitutively expressed. Thus, the reporter functions as a high fidelity genetic lineage tracer in vivo. Currently there is an array of reporter alleles that can be used in marking strategies, but their recombination efficiency and applicability to a wide array of tissues has not been thoroughly described. To assess the recombination/marking potential of the reporters, we utilized CreER(T) under the control of a Wnt1 transgene (Wnt1-CreER(T)) as well as a cumulative, non-inducible En1(Cre) knock-in line in combination with three different reporters: R26R (LacZ reporter), Z/EG (EGFP reporter), and Tau-Lox-STOP-Lox-mGFP-IRES-NLS-LacZ (membrane-targeted GFP/nuclear LacZ reporter). We marked the Wnt1 lineage using each of the three reporters at embryonic day (E) 8.5 followed by analysis at E10.0, E12.5, and in the adult. We also compared cumulative marking of cells with a history of En1 expression at the same stages. We evaluated the reporters by whole-mount and section analysis and ascertained the strengths and weaknesses of each of the reporters. Comparative analysis with the reporters elucidated complexities of how the Wnt1 and En1 lineages contribute to developing embryos and to axonal projection patterns of neurons derived from these lineages.

Redshift determination of the BL Lac object 3C 66A by the detection of its host galaxy cluster at z = 0.340

NASA Astrophysics Data System (ADS)

Torres-Zafra, Juanita; Cellone, Sergio A.; Buzzoni, Alberto; Andruchow, Ileana; Portilla, José G.

2018-03-01

The BL Lac object 3C 66A is one of the most luminous extragalactic sources at TeV γ-rays (very high energy, i.e. E > 100 GeV). Since TeV γ-ray radiation is absorbed by the extragalactic background light (EBL), it is crucial to know the redshift of the source in order to reconstruct its original spectral energy distribution, as well as to constrain EBL models. However, the optical spectrum of this BL Lac is almost featureless, so a direct measurement of z is very difficult; in fact, the published redshift value for this source (z = 0.444) has been strongly questioned. Based on EBL absorption arguments, several constraints to its redshift, in the range 0.096 < z < 0.5, were proposed. Since these active galactic nuclei (AGNs) are hosted, typically, in early-type galaxies that are members of groups or clusters, we have analysed spectro-photometrically the environment of 3C 66A, with the goal of finding the galaxy group hosting this blazar. This study was made using optical images of a 5.5 × 5.5 arcmin2 field centred on the blazar, and spectra of 24 sources obtained with Gemini/GMOS-N multi-object spectroscopy. We found spectroscopic evidence of two galaxy groups along the blazar's line of sight: one at z ≃ 0.020 and the second one at z ≃ 0.340. The first one is consistent with a known foreground structure, while the second group presented here has six spectroscopically confirmed members. Their location along a red sequence in the colour-magnitude diagram allows us to identify 34 additional candidate members of the more distant group. The blazar's spectrum shows broad absorption features that we identify as arising in the intergalactic medium, thus allowing us to tentatively set a redshift lower limit at z_3C66A ≳ 0.33. As a consequence, we propose that 3C 66A is hosted in a galaxy that belongs to a cluster at z = 0.340.

LUNSORT list of lunar orbiter data by LAC area

NASA Technical Reports Server (NTRS)

Hixon, S.

1976-01-01

Lunar orbiter (missions 1-5) photographic data are listed sequentially according to the number (1 to 147) LAC (Lunar Aeronautical Chart) areas by use of a computer program called LUNSORT. This listing, as well as a similar one from Apollo would simplify the task of identifying images of a given Lunar area. Instructions and sample case are included.

Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis

USDA-ARS?s Scientific Manuscript database

As the outermost layer on aerial tissues of the primary plant body, the cuticle plays important roles in plant development and physiology. The major components of the cuticle are cutin and cuticular wax, both of which are composed primarily of fatty acid derivatives synthesized in the epidermal cell...

Neato Mosquito: An Elementary Curriculum Guide. 2nd Edition.

ERIC Educational Resources Information Center

Nasci, Roger S.; Herrington, James E.

This curriculum guide was designed with the purpose of developing public awareness of LaCrosse (LAC) encephalitis, which is a mosquito transmitted disease. LAC cases have been increasing in large numbers in the Upper Midwest and Great Lakes regions during recent years. This disease primarily affects children under the age of 15, and this guide…

The LAC Test: A New Look at Auditory Conceptualization and Literacy Development K-12.

ERIC Educational Resources Information Center

Lindamood, Charles; And Others

The Lindamood Auditory Conceptualization (LAC) Test was constructed with the recognition that the process of decoding involves an integration of the auditory, visual, and motor senses. Requiring the manipulation of colored blocks to indicate conceptualization of test patterns spoken by the examiner, subtest 1 entails coding of identity, number,…

Quantitative approaches to the study of bistability in the lac operon of Escherichia coli.

PubMed

Santillán, Moisés; Mackey, Michael C

2008-08-06

In this paper, the history and importance of the lac operon in the development of molecular and systems biology are briefly reviewed. We start by presenting a description of the regulatory mechanisms in this operon, taking into account the most recent discoveries. Then we offer a survey of the history of the lac operon, including the discovery of its main elements and the subsequent influence on the development of molecular and systems biology. Next the bistable behaviour of the operon is discussed, both with respect to its discovery and its molecular origin. A review of the literature in which this bistable phenomenon has been studied from a mathematical modelling viewpoint is then given. We conclude with some brief remarks.

Biorecognition of Escherichia coli K88 adhesin for glycated porcine albumin.

PubMed

Sarabia-Sainz, Andre-i; Ramos-Clamont, Gabriela; Candia-Plata, Ma María del Carmen; Vázquez-Moreno, Luz

2009-03-01

Escherichia coli (E. coli) that expresses galactose-reactive lectins, like K88 adhesin, causes high mortality among piglets. Carbohydrates that compete for adhesion could serve as an alternative for disease prevention. Porcine serum albumin (PSA) was modified by non-enzymatic glycation with lactose to produce PSA-Lac or PSA-Glc beta (1-4) Gal, as confirmed by reduction of available free amino groups, increased molecular mass and by Ricinus communis lectin recognition. E. coli K88 binds to PSA-Lac treatments containing three and four lactoses, respectively. In addition, PSA-Lac partially inhibited K88 strain adherence to mucins. These results suggest that neoglycoconjugates obtained by non-enzymatic glycation of proteins may serve in the prophylaxis of piglets' diarrhea.

Connective tissue growth factor is required for skeletal development and postnatal skeletal homeostasis in male mice.

PubMed

Canalis, Ernesto; Zanotti, Stefano; Beamer, Wesley G; Economides, Aris N; Smerdel-Ramoya, Anna

2010-08-01

Connective tissue growth factor (CTGF), a member of the cysteine-rich 61 (Cyr 61), CTGF, nephroblastoma overexpressed (NOV) (CCN) family of proteins, is synthesized by osteoblasts, and its overexpression inhibits osteoblastogenesis and causes osteopenia. The global inactivation of Ctgf leads to defective endochondral bone formation and perinatal lethality; therefore, the consequences of Ctgf inactivation on the postnatal skeleton are not known. To study the function of CTGF, we generated Ctgf(+/LacZ) heterozygous null mice and tissue-specific null Ctgf mice by mating Ctgf conditional mice, where Ctgf is flanked by lox sequences with mice expressing the Cre recombinase under the control of the paired-related homeobox gene 1 (Prx1) enhancer (Prx1-Cre) or the osteocalcin promoter (Oc-Cre). Ctgf(+/LacZ) heterozygous mice exhibited transient osteopenia at 1 month of age secondary to decreased trabecular number. A similar osteopenic phenotype was observed in 1-month-old Ctgf conditional null male mice generated with Prx1-Cre, suggesting that the decreased trabecular number was secondary to impaired endochondral bone formation. In contrast, when the conditional deletion of Ctgf was achieved by Oc-Cre, an osteopenic phenotype was observed only in 6-month-old male mice. Osteoblast and osteoclast number, bone formation, and eroded surface were not affected in Ctgf heterozygous or conditional null mice. In conclusion, CTGF is necessary for normal skeletal development but to a lesser extent for postnatal skeletal homeostasis.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Alpha-Toxin Contributes to Biofilm Formation among Staphylococcus aureus Wound Isolates

PubMed Central

Anderson, Michele J.; Schaaf, Emily; Wallis, Heidi W.; Johnson, James R.; Tkaczyk, Christine; Sellman, Bret R.; Sun, Jisun; Peterson, Marnie L.

2018-01-01

Biofilms complicate treatment of Staphylococcus aureus (SA) wound infections. Previously, we determined alpha-toxin (AT)-promoted SA biofilm formation on mucosal tissue. Therefore, we evaluated SA wound isolates for AT production and biofilm formation on epithelium and assessed the role of AT in biofilm formation. Thirty-eight wound isolates were molecularly typed by pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (ST), and spa typing. We measured biofilm formation of these SA isolates in vitro and ex vivo and quantified ex vivo AT production. We also investigated the effect of an anti-AT monoclonal antibody (MEDI4893*) on ex vivo biofilm formation by methicillin-resistant SA (USA 300 LAC) and tested whether purified AT rescued the biofilm defect of hla mutant SA strains. The predominant PFGE/ST combinations were USA100/ST5 (50%) and USA300/ST8 (33%) for methicillin-resistant SA (MRSA, n = 18), and USA200/ST30 (20%) for methicillin-susceptible SA (MSSA, n = 20). Ex vivo AT production correlated significantly with ex vivo SA wound isolate biofilm formation. Anti-alpha-toxin monoclonal antibody (MEDI4893*) prevented ex vivo biofilm formation by MRSA USA300 strain LAC. Wild-type AT rescued the ex vivo biofilm defect of non-AT producing SA strains. These findings provide evidence that AT plays a role in SA biofilm formation on epithelial surfaces and suggest that neutralization of AT may be useful in preventing and treating SA infections. PMID:29659477

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

PubMed

Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

1996-07-01

A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene.

Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.

PubMed Central

Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J

1996-01-01

A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene. PMID:8763940

Extracellular levels of lactate, but not oxygen, reflect sleep homeostasis in the rat cerebral cortex.

PubMed

Dash, Michael B; Tononi, Giulio; Cirelli, Chiara

2012-07-01

It is well established that brain metabolism is higher during wake and rapid eye movement (REM) sleep than in nonrapid eye movement (NREM) sleep. Most of the brain's energy is used to maintain neuronal firing and glutamatergic transmission. Recent evidence shows that cortical firing rates, extracellular glutamate levels, and markers of excitatory synaptic strength increase with time spent awake and decline throughout NREM sleep. These data imply that the metabolic cost of each behavioral state is not fixed but may reflect sleep-wake history, a possibility that is investigated in the current report. Chronic (4d) electroencephalographic (EEG) recordings in the rat cerebral cortex were coupled with fixed-potential amperometry to monitor the extracellular concentration of oxygen ([oxy]) and lactate ([lac]) on a second-by-second basis across the spontaneous sleep-wake cycle and in response to sleep deprivation. Basic sleep research laboratory. Wistar Kyoto (WKY) adult male rats. N/A. Within 30-60 sec [lac] and [oxy] progressively increased during wake and REM sleep and declined during NREM sleep (n = 10 rats/metabolite), but with several differences. [Oxy], but not [lac], increased more during wake with high motor activity and/or elevated EEG high-frequency power. Meanwhile, only the NREM decline of [lac] reflected sleep pressure as measured by slow-wave activity, mirroring previous results for cortical glutamate. The observed state-dependent changes in cortical [lac] and [oxy] are consistent with higher brain metabolism during waking and REM sleep in comparison with NREM sleep. Moreover, these data suggest that glycolytic activity, most likely through its link with glutamatergic transmission, reflects sleep homeostasis.

Community-Acquired Pneumonia in Latin America.

PubMed

Iannella, Hernán A; Luna, Carlos M

2016-12-01

Community-acquired pneumonia (CAP) is associated with significant morbidity and mortality in Latin America and the Caribbean (LAC) region. Poverty, socioeconomic factors, and malnutrition influence the incidence and outcome of CAP in LAC. In LAC, Streptococcus pneumoniae is the most frequent microorganism responsible for CAP, (incidence: 24-78%); the incidence of atypical microorganisms is similar to other regions of the world. Human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) is a growing problem in the LAC region, with the Caribbean being the second most affected area worldwide after Sub-Saharan Africa. Pneumococcal pneumonia remains the most common cause of CAP in HIV-infected patients, but Pneumocystis jirovecii and tuberculosis (TB) are also common in this population. The heterogeneity of the health care systems and social inequity between different countries in LAC, and even between different settings inside the same country, is a difficult issue. TB, including multidrug-resistant TB, is several times more common in South American and Central American countries compared with North America. Furthermore, hantaviruses circulating in the Americas (new world hantaviruses) generate a severe respiratory disease called hantavirus pulmonary syndrome, with an associated mortality as high as 50%. More than 30 hantaviruses have been reported in the Western Hemisphere, with more frequent cases registered in the southern cone (Argentina, Chile, Uruguay, Paraguay, Bolivia, and Brazil). Respiratory viruses (particularly influenza) remain an important cause of morbidity and mortality, particularly in the elderly. Low rates of vaccination (against influenza as well as pneumococcus) may heighten the risk of these infections in low- and middle-income countries. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Design of the lac gene circuit revisited

PubMed Central

Savageau, Michael A.

2011-01-01

The lactose (lac) operon of Escherichia coli serves as the paradigm for gene regulation, not only for bacteria, but also for all biological systems from simple phage to humans. The details of the systems may differ, but the key conceptual framework remains, and the original system continues to reveal deeper insights with continued experimental and theoretical study. Nearly as long lasting in impact as the pivotal work of Jacob and Monod is the classic experiment of Novick and Weiner in which they demonstrated all-or-none gene expression in response to an artificial inducer. These results are often cited in claims that normal gene expression is in fact a discontinuous bistable phenomenon. In this paper, I review several levels of analysis of the lac system and introduce another perspective based on the construction of the system design space. These represent variations on a theme, based on a simply stated design principle, that captures the key qualitative features of the system in a largely mechanism-independent fashion. Moreover, this principle can be readily interpreted in terms of specific mechanisms to make predictions regarding monostable vs. bistable behavior. The regions of design space representing bifurcations are compared with the corresponding regions identified through bifurcation analysis. I present evidence based on biological considerations as well as modeling and analysis to suggest that induction of the lac system in its natural setting is a monostable continuously graded phenomenon. Nevertheless, it must be acknowledged that the lac stability question remains unsettled, and it undoubtedly will remain so until there are definitive experimental results. PMID:21414326

Induction of the mar operon by miscellaneous groceries.

PubMed

Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

2004-01-01

To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

γ-Ray And Parsec-Scale Jet Properties Of A Complete Sample Of Blazars From The Mojave Program

DOE PAGES

Lister, M. L.

2011-11-02

We investigate the Fermi LAT -ray and 15 GHz VLBA radio properties of a joint -ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -30° during this period, and thus probes the full range of -ray loudness ( -ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders ofmagnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. Themore » BL Lac objects, however, display a linear correlation of increasing -ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the -ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - -ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.« less

Seeing red; the development of pON.mCherry, a broad-host range constitutive expression plasmid for Gram-negative bacteria.

PubMed

Gebhardt, Michael J; Jacobson, Rachael K; Shuman, Howard A

2017-01-01

The development of plasmid-mediated gene expression control in bacteria revolutionized the field of bacteriology. Many of these expression control systems rely on the addition of small molecules, generally metabolites or non-metabolized analogs thereof, to the growth medium to induce expression of the genes of interest. The paradigmatic example of an expression control system is the lac system from Escherichia coli, which typically relies on the Ptac promoter and the Lac repressor, LacI. In many cases, however, constitutive gene expression is desired, and other experimental approaches require the coordinated control of multiple genes. While multiple systems have been developed for use in E. coli and its close relatives, the utility and/or functionality of these tools does not always translate to other species. For example, for the Gram-negative pathogen, Legionella pneumophila, a causative agent of Legionnaires' Disease, the aforementioned Ptac system represents the only well-established expression control system. In order to enhance the tools available to study bacterial gene expression in L. pneumophila, we developed a plasmid, pON.mCherry, which confers constitutive gene expression from a mutagenized LacI binding site. We demonstrate that pON.mCherry neither interferes with other plasmids harboring an intact LacI-Ptac expression system nor alters the growth of Legionella species during intracellular growth. Furthermore, the broad-host range plasmid backbone of pON.mCherry allows constitutive gene expression in a wide variety of Gram-negative bacterial species, making pON.mCherry a useful tool for the greater research community.

Palliative care research in Latin America and the Caribbean: from the beginning to the Declaration of Venice and beyond.

PubMed

Pastrana, Tania; De Lima, Liliana; Eisenchlas, Jorge; Wenk, Roberto

2012-03-01

Research in palliative care has increased significantly in the last decade, while the vast majority of the global disease burden occurs in developing countries. To explore the palliative care research activity in Latin America and the Caribbean (LAC) and its visibility in the international palliative care literature, with a special focus on research studies. A bibliometric analysis was conducted in MEDLINE(®), Embase(®), PsycINFO(®), and CINAHL(®). Inclusion criteria were: (1) articles published in peer-reviewed scientific journals; (2) main subject was palliative care; (3) research study; (4) the first author or coauthors was based in LAC; and/or (5) the data collected derived from LAC. One hundred six articles from 10 countries were identified in the literature research. The first publication dates from 1989 and was a qualitative study in Brazil. This study shows a modest contribution of publications from LAC. However, the volume of publications within the region is distributed unequally, reflecting the heterogeneity of the region: Brazil published more than half of the articles, while 35 countries have no publications. Most of the studies were quantitative research, predominantly cross-sectional studies. Qualitative studies often used interviews. Health care service was the most researched issue. Seventy percent of studies were carried out in institutions. Palliative care research should have a place in LAC. The development of a regional research agenda tailored to the needs and features of the region considering the health care structure and local resources available is indispensable.

Gamma-Ray and Parsec-Scale Jet Properties of a Complete Sample of Blazars from the MOJAVE Program

NASA Technical Reports Server (NTRS)

Lister, M.L.; Aller, M.; Aller, H.; Hovatta, T.; Kellermann, K. I.; Kovalev, Y. Y.; Meyer, E. T.; Pushkarev, A. B.; Ros, E.; Ackermann, M.;

Experiencing limits of acceptable change: some thoughts after a decade of implementation

Treesearch

Stephen F. McCool; David N. Cole

1997-01-01

Wilderness managers and researchers have experienced implementation of the Limits of Acceptable Change planning system for over a decade. In a sense, implementation of LAC has been a broad scale experiment in planning, with the hypothesis being that LAC processes are more effective approaches to deal with questions of recreation management in protected areas than the...

Institutional barriers and opportunities in application of the limits of acceptable change

Treesearch

George H. Stankey

1997-01-01

Although the Limits of Acceptable Change (LAC) process has been in use since the mid-1980’s and has contributed to improved wilderness management, significant barriers and challenges remain. Formal and informal institutional barriers are the principal constraint to more effective implementation. Although grounded in a traditional management-by-objectives model, the LAC...

78 FR 3911 - Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-17

... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R3-R-2012-N259; FXRS1265030000-134-FF03R06000] Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive... significant impact (FONSI) for the environmental assessment (EA) for Big Stone National Wildlife Refuge...

Defining fire and wilderness objectives: Applying limits of acceptable change

Treesearch

David N. Cole

1995-01-01

The Limits of Acceptable Change (LAC) planning process was developed to help define objectives for recreation management in wilderness. This process can be applied to fire in wilderness if its conceptual foundation is broadened. LAC would lead decision makers to identify a compromise between the goal of allowing fire to play its natural role in wilderness and various...

The limits of acceptable change process: modifications and clarifications

Treesearch

David N. Cole; Stephen F. McCool

1997-01-01

Limits of Acceptable Change (LAC) was originally formulated to deal with the issue of recreation carrying capacity in wilderness. Enthusiasm for the process has led to questions about its applicability to a broad range of natural resource issues—both within and outside of protected areas. This paper uses a generic version of the LAC process to identify situations where...

Whoever Would Have Thought Book Shopping Might Raise Eyebrows?

ERIC Educational Resources Information Center

Jud, Edie

2007-01-01

In this article, the author shares how she follows the policy developed by the Library Advisory Council (LAC) when she acquires new books for her school library. LAC is a group of fifty or so teaching librarians from all five New York City boroughs. They meet four times a year to help the Office of School Library Services focus on issues important…

Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.

PubMed Central

Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J

1986-01-01

Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717

A small molecule nanodrug consisting of amphiphilic targeting ligand-chemotherapy drug conjugate for targeted cancer therapy.

PubMed

Mou, Quanbing; Ma, Yuan; Zhu, Xinyuan; Yan, Deyue

2016-05-28

Targeted drug delivery is a broadly applicable approach for cancer therapy. However, the nanocarrier-based targeted delivery system suffers from batch-to-batch variation, quality concerns and carrier-related toxicity issues. Thus, to develop a carrier-free targeted delivery system with nanoscale characteristics is very attractive. Here, a novel targeting small molecule nanodrug self-delivery system consisting of targeting ligand and chemotherapy drug was constructed, which combined the advantages of small molecules and nano-assemblies together and showed excellent targeting ability and long blood circulation time with well-defined structure, high drug loading ratio and on-demand drug release behavior. As a proof-of-concept, lactose (Lac) and doxorubicin (DOX) were chosen as the targeting ligand and chemotherapy drug, respectively. Lac and DOX were conjugated through a pH-responsive hydrazone group. For its intrinsic amphiphilic property, Lac-DOX conjugate could self-assemble into nanoparticles in water. Both in vitro and in vivo assays indicated that Lac-DOX nanoparticles exhibited enhanced anticancer activity and weak side effects. This novel active targeting nanodrug delivery system shows great potential in cancer therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular recognition of glyconanoparticles by RCA and E. coli K88 - designing transports for targeted therapy.

PubMed

Gallegos-Tabanico, Amed; Sarabia-Sainz, Jose A; Sarabia-Sainz, H Manuel; Carrillo Torres, Roberto; Guzman-Partida, Ana M; Monfort, Gabriela Ramos-Clamont; Silva-Campa, Erika; Burgara-Estrella, Alexel J; Angulo-Molina, Aracely; Acosta-Elias, Mónica; Pedroza-Montero, Martín; Vazquez-Moreno, Luz

2017-01-01

The targeted drug delivery has been studied as one of the main methods in medicine to ensure successful treatments of diseases. Pharmaceutical sciences are using micro or nano carriers to obtain a controlled delivery of drugs, able to selectively interact with pathogens, cells or tissues. In this work, we modified bovine serum albumin (BSA) with lactose, obtaining a neoglycan (BSA-Lac). Subsequently, we synthesized glyconanoparticles (NPBSA-Lac) with the premise that it would be recognized by microbial galactose specific lectins. NPBSA-Lac were tested for bio-recognition with adhesins of E. coli K88 and Ricinus communis agglutinin I (RCA). Glycation of BSA with lactose was analyzed by electrophoresis, infrared spectroscopy and fluorescence. Approximately 41 lactoses per BSA molecule were estimated. Nanoparticles were obtained using water in oil emulsion method and spheroid morphology with a range size of 300-500 nm was observed. Specific recognition of NPBSA-Lac by RCA and E. coli K88 was displayed by aggregation of nanoparticles analyzed by dynamic light scattering and atomic force microscopy. The results indicate that the lactosylated nanovectors could be targeted at the E. coli K88 adhesin and potentially could be used as a transporter for an antibacterial drug.

Single-target regulators form a minor group of transcription factors in Escherichia coli K-12.

PubMed

Shimada, Tomohiro; Ogasawara, Hiroshi; Ishihama, Akira

2018-05-04

The identification of regulatory targets of all TFs is critical for understanding the entire network of the genome regulation. The lac regulon of Escherichia coli K-12 W3110 is composed of the lacZYA operon and its repressor lacI gene, and has long been recognized as the seminal model of transcription regulation in bacteria with only one highly preferred target. After the Genomic SELEX screening in vitro of more than 200 transcription factors (TFs) from E. coli K-12, however, we found that most TFs regulate multiple target genes. With respect to the number of regulatory targets, a total of these 200 E. coli TFs form a hierarchy ranging from a single target to as many as 1000 targets. Here we focus a total of 13 single-target TFs, 9 known TFs (BetI, KdpE, LacI, MarR, NanR, RpiR, TorR, UlaR and UxuR) and 4 uncharacterized TFs (YagI, YbaO, YbiH and YeaM), altogether forming only a minor group of TFs in E. coli. These single-target TFs were classified into three groups based on their functional regulation.

Bradyrhizobium japonicum mutants with enhanced sensitivity to genistein resulting in altered nod gene regulation.

PubMed

Ip, H; D'Aoust, F; Begum, A A; Zhang, H; Smith, D L; Driscoll, B T; Charles, T C

2001-12-01

Bradyrhizobium japonicum mutants with altered nod gene induction characteristics were isolated by screening mutants for genistein-independent nod gene expression. Plasmid pZB32, carrying a nodY::lacZ transcriptional gene fusion, was introduced into B. japonicum cells that had been subjected to UV mutagenesis. Ten independent transformants producing a blue color on plates containing 5bromo-4chloro-3indolyl-beta-D-galactopyranoside but lacking genistein, indicative of constitutive expression of the nodY::lacZ reporter gene, were isolated. Beta-galactosidase activity assays revealed that while all of the 10 strains were sensitive to low concentrations of genistein, none exhibited truly constitutive nodY::lacZ expression in liquid culture. Soybean plants inoculated with three of the mutants were chlorotic and stunted, with shoot dry weights close to those of the uninoculated plants, indicating the absence of nitrogen fixation. Differences in the kinetics of nodY::lacZ expression and lipochitin oligosaccharide Nod signal production suggested that the strains carried different mutations. Some of these strains may be useful in mitigating the low root zone temperature-associated delay in soybean nodulation at the northern extent of soybean cultivation.