Laccases: Production, Expression Regulation, and Applications in Pharmaceutical Biodegradation

PubMed Central

Yang, Jie; Li, Wenjuan; Ng, Tzi Bun; Deng, Xiangzhen; Lin, Juan; Ye, Xiuyun

2017-01-01

Laccases are a family of copper-containing oxidases with important applications in bioremediation and other various industrial and biotechnological areas. There have been over two dozen reviews on laccases since 2010 covering various aspects of this group of versatile enzymes, from their occurrence, biochemical properties, and expression to immobilization and applications. This review is not intended to be all-encompassing; instead, we highlighted some of the latest developments in basic and applied laccase research with an emphasis on laccase-mediated bioremediation of pharmaceuticals, especially antibiotics. Pharmaceuticals are a broad class of emerging organic contaminants that are recalcitrant and prevalent. The recent surge in the relevant literature justifies a short review on the topic. Since low laccase yields in natural and genetically modified hosts constitute a bottleneck to industrial-scale applications, we also accentuated a genus of laccase-producing white-rot fungi, Cerrena, and included a discussion with regards to regulation of laccase expression. PMID:28559880

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

PubMed Central

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

PubMed

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride

PubMed Central

Balcázar-López, Edgar; Méndez-Lorenzo, Luz Helena; Batista-García, Ramón Alberto; Esquivel-Naranjo, Ulises; Ayala, Marcela; Kumar, Vaidyanathan Vinoth; Savary, Olivier; Cabana, Hubert; Herrera-Estrella, Alfredo; Folch-Mallol, Jorge Luis

2016-01-01

Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus) sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc). To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor) from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation. PMID:26849129

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.

PubMed

Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min

Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.

Copper induction and differential expression of laccase in Aspergillus flavus

PubMed Central

Gomaa, Ola M.; Momtaz, Osama A.

2015-01-01

Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

Constitutive expression of Botrytis aclada laccase in Pichia pastoris

PubMed Central

Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland

2012-01-01

The heterologous expression of laccases is important for their large-scale production and genetic engineering—a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL-1) and the AOX1 system (495 mgL-1) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg-1 GAP, 14.2 Umg-1 AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

PubMed

Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

2012-10-23

Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

Laccase of Cyathus bulleri: structural, catalytic characterization and expression in Escherichia coli.

PubMed

Salony; Garg, N; Baranwal, R; Chhabra, M; Mishra, S; Chaudhuri, T K; Bisaria, V S

2008-02-01

Cyathus bulleri, a ligninolytic fungus, produces a single laccase the internal peptides (3) of which bear similarity to laccases of several white rot fungi. Comparison of the total amino acid composition of this laccase with several fungal laccases indicated dissimilarity in the proportion of some basic and hydrophobic amino acids. Analysis of the circular dichroism spectrum of the protein indicated 37% alpha-helical, 26% beta-sheet and 38% random coil content which differed significantly from that in the solved structures of other laccases, which contain higher beta-sheet structures. The critical role of the carboxylic group containing amino acids was demonstrated by determining the kinetic parameters at different pH and this was confirmed by the observation that a critical Asp is strongly conserved in both Ascomycete and Basidiomycete laccases. The enzyme was denatured in the presence of a number of denaturing agents and refolded back to functional state with copper. In the folding experiments under alkaline conditions, zinc could replace copper in restoring 100% of laccase activity indicating the non-essential role of copper in this laccase. The laccase was expressed in Escherichia coli by a modification of the ligation-anchored PCR approach making it the first fungal laccase to be expressed in a bacterial host. The laccase sequence was confirmed by way of analysis of a 435 bp sequence of the insert.

Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate.

PubMed

Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji

2016-01-01

Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

PubMed Central

2012-01-01

Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra

Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1

PubMed Central

Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah

2002-01-01

Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346

Heterologous expression of laccase cDNA from Ceriporiopsis subvermispora yields copper-activated apoprotein and complex isoform patterns

Treesearch

Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna

2003-01-01

Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...

Ultrasound-intensified laccase production from Trametes versicolor.

PubMed

Wang, Feng; Ma, An-Zhou; Guo, Chen; Zhuang, Guo-Qiang; Liu, Chun-Zhao

2013-01-01

An efficient intermittent ultrasonic treatment strategy was developed to improve laccase production from Trametes versicolor mycelia cultures. The optimized strategy consisted of exposing 2-day-old mycelia cultures to 5-min ultrasonic treatments for two times with a 12-h interval at the fixed ultrasonic power and frequency (120 W, 40 kHz). After 5 days of culture, this strategy produced the highest extracellular laccase activity of 588.9 U/L among all treatments tested which was 1.8-fold greater than the control without ultrasound treatment. The ultrasonic treatment resulted in a higher pellet porosity that facilitated the mass transfer of nutrients and metabolites from the pellets to the surrounding liquid. Furthermore, the ultrasonic treatment induced the expression of the laccase gene (lcc), which correlated with a sharp increase in both extracellular and intracellular laccase activity. This is the first study to find positive effects of ultrasound on gene expression in fungal cells. These results provide a basis for understanding the stimulation of metabolite production and process intensification by ultrasonic treatment in filamentous fungal culture. Copyright © 2012 Elsevier B.V. All rights reserved.

Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

PubMed

Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

2014-01-01

We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi

PubMed Central

Mander, Gerd J.; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C.; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G.; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard

2006-01-01

Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2′-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain. PMID:16820501

Use of laccase as a novel, versatile reporter system in filamentous fungi.

PubMed

Mander, Gerd J; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard

2006-07-01

Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2'-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain.

Heat shock treatment improves Trametes versicolor laccase production.

PubMed

Wang, Feng; Guo, Chen; Wei, Tao; Zhang, Tian; Liu, Chun-Zhao

2012-09-01

An efficient heat shock strategy has been developed to improve laccase production in submerged Trametes versicolor cultures. The optimized heat shock strategy consists of subjecting T. versicolor mycelial pellets to three heat shock treatments at 45 °C for 45 min, starting at culture day 0, with a 24-h interval between treatments. Laccase production increased by more than 1.6-fold relative to the control in both flasks and a 5-L bioreactor because the expression of the laccase gene was enhanced by heat shock induction. The present work demonstrates that heat shock induction is a promising method because it both improves fungal laccase production and has a good potential in industrial application.

Expression of a thermotolerant laccase from Pycnoporus sanguineus in Trichoderma reesei and its application in the degradation of bisphenol A.

PubMed

Zhao, Jie; Zeng, Shengquan; Xia, Ying; Xia, Liming

2018-04-01

The laccase gene from Pycnoporus sanguineus was cloned and inserted between the strong Pcbh1 promoter and the Tcbh1 terminator from Trichoderma reesei to form the recombinant plasmid pCH-lac. Using Agrobacterium-mediated technique, the pCH-lac was integrated into the chromosomes of T. reesei. Twenty positive transformants were obtained by employing hygromycin B as a selective agent. PCR was used to confirm that the laccase gene was integrated into the chromosomal DNA of T. reesei. Laccase production by recombinant transformants was performed in shaking flasks, and the activity of laccase reached 8.8 IU/mL after 96-h fermentation under a batch process, and 17.7 IU/mL after 144-h fermentation using a fed-batch process. SDS-PAGE analysis of the fermentation broth showed that the molecular mass of the protein was about 68 kDa, almost the same as that of the laccase produced by P. sanguineus, which indicated that laccase was successfully expressed in T. reesei and secreted out of the cells. The laccase produced by the recombinant T. reesei showed good thermal stability, and could degrade the toxic phenolic material bisphenol A efficiently, after 1-h reaction with 0.06 IU/mL laccase and 0.5 mmol/L ABTS as the mediator at 60 °C and pH 4.5, the degradation rate reached 95%, which demonstrated that it had great potential value in treating the household garbage and wastewater containing the bisphenol A. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Rice (Oryza sativa) Laccases Involved in Modification and Detoxification of Herbicides Atrazine and Isoproturon Residues in Plants.

PubMed

Huang, Meng Tian; Lu, Yi Chen; Zhang, Shuang; Luo, Fang; Yang, Hong

2016-08-24

Atrazine (ATR) and isoproturon (IPU) as herbicides have become serious environmental contaminants due to their overuse in crop production. Although ATR and IPU in soils are easily absorbed by many crops, the mechanisms for their degradation or detoxification in plants are poorly understood. This study identified a group of novel genes encoding laccases (EC 1.10.3.2) that are possibly involved in catabolism or detoxification of ATR and IPU residues in rice. Transcriptome profiling shows at least 22 differentially expressed laccase genes in ATR/IPU-exposed rice. Some of the laccase genes were validated by RT-PCR analysis. The biochemical properties of the laccases were analyzed, and their activities in rice were induced under ATR/IPU exposure. To investigate the roles of laccases in degrading or detoxifying ATR/IPU in rice, transgenic yeast cells (Pichia pastoris X-33) expressing two rice laccase genes (LOC_Os01g63180 and LOC_Os12g15680) were generated. Both transformants were found to accumulate less ATR/IPU compared to the control. The ATR/IPU-degraded products in the transformed yeast cells using UPLC-TOF-MS/MS were further characterized. Two metabolites, hydroxy-dehydrogenated atrazine (HDHA) and 2-OH-isopropyl-IPU, catalyzed by laccases were detected in the eukaryotic cells. These results indicate that the laccase-coding genes identified here could confer degradation or detoxification of the herbicides and suggest that the laccases could be one of the important enzymatic pathways responsible for ATR/IPU degradation/detoxification in rice.

On the diversity of the laccase gene: a phylogenetic perspective from Botryosphaeria rhodina (Ascomycota: Fungi) and other related taxa.

PubMed

Castilho, Flávio J D; Torres, Rodrigo A; Barbosa, Aneli M; Dekker, Robert F H; Garcia, José E

2009-02-01

The present study is the first describing the sequencing of a fragment of the copper-oxidase domain of a laccase gene in the family Botryosphaeriaceae. The aim of this work was to assess the degree of genetic and evolutionary relationships of a laccase gene from Botryosphaeria rhodina MAMB-05 with other ascomycete and basidiomycete laccase genes. The 193-amino acid sequences of the copper-oxidase domain from several different fungi, insects, a plant, and a bacterial species were retrieved from GenBank and aligned. Phylogenetic analyses were performed using neighbor-joining, maximum parsimony, and Bayesian inference methods. The organisms studied clustered into five gene clades: fungi (ascomycetes and basidiomycetes), insects, plants, and bacteria. Also, the topologies showed that fungal laccases of the ascomycetes and basidiomycetes are clearly separated into two distinct clusters. This evidence indicated that B. rhodina MAMB-05 and other closely related ascomycetes are a new biological resource given the biotechnological potential of their laccase genes.

Functional expression, production, and biochemical characterization of a laccase using yeast surface display technology.

PubMed

Bertrand, Brandt; Trejo-Hernández, María R; Morales-Guzmán, Daniel; Caspeta, Luis; Suárez Rodríguez, Ramón; Martínez-Morales, Fernando

2016-12-01

A Trametes versicolor laccase was functionally expressed on the membrane surface of Saccharomyces cerevisiae EBY100. Laccase expression was increased 6.57-fold by medium optimization and surpassed production by the native strain. Maximal laccase and biomass production reached 19 735 ± 1719 Ug -1 and 6.22 ± 0.53 gL -1 respectively, after 2 d of culture. Optimum oxidization of all substrates by laccase was observed at pH 3. Laccase showed high affinity towards substrates used with Km (mM) and Vmax (μmol min -1 ) values of 0.57 ± 0.0047 and 24.55 ± 0.64, 1.52 ± 0.52 and 9.25 ± 1.78, and 2.67 ± 0.12 and 11.26 ± 0.75, were reported for ABTS, 2, 6-DMP and GUA, respectively. EDTA and NaN 3 displayed none competitive inhibition towards laccase activity. The optimum temperature for activity was 50 °C; however, the enzyme was stable over a wide range of temperatures (25-70 °C). The biologically immobilized laccase showed high reusability towards phenolic substrates and low reusability with non-phenolic substrates. High affinity for a diversity phenolic compounds and great ethanol tolerance substantiates this laccase/yeast biocatalyst potential for application in the production of bioethanol. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Development of a Saccharomyces cerevisiae Strain with Enhanced Resistance to Phenolic Fermentation Inhibitors in Lignocellulose Hydrolysates by Heterologous Expression of Laccase

PubMed Central

Larsson, Simona; Cassland, Pierre; Jönsson, Leif J.

2001-01-01

To improve production of fuel ethanol from renewable raw materials, laccase from the white rot fungus Trametes versicolor was expressed under control of the PGK1 promoter in Saccharomyces cerevisiae to increase its resistance to phenolic inhibitors in lignocellulose hydrolysates. It was found that the laccase activity could be enhanced twofold by simultaneous overexpression of the homologous t-SNARE Sso2p. The factors affecting the level of active laccase obtained, besides the cultivation temperature, included pH and aeration. Laccase-expressing and Sso2p-overexpressing S. cerevisiae was cultivated in the presence of coniferyl aldehyde to examine resistance to lignocellulose-derived phenolic fermentation inhibitors. The laccase-producing transformant had the ability to convert coniferyl aldehyde at a faster rate than a control transformant not expressing laccase, which enabled faster growth and ethanol formation. The laccase-producing transformant was also able to ferment a dilute acid spruce hydrolysate at a faster rate than the control transformant. A decrease in the content of low-molecular-mass aromatic compounds, accompanied by an increase in the content of high-molecular-mass compounds, was observed during fermentation with the laccase-expressing strain, illustrating that laccase was active even at the very low levels of oxygen supplied. Our results demonstrate the importance of phenolic compounds as fermentation inhibitors and the advantage of using laccase-expressing yeast strains for producing ethanol from lignocellulose. PMID:11229906

Development of a Saccharomyces cerevisiae strain with enhanced resistance to phenolic fermentation inhibitors in lignocellulose hydrolysates by heterologous expression of laccase.

PubMed

Larsson, S; Cassland, P; Jönsson, L J

2001-03-01

To improve production of fuel ethanol from renewable raw materials, laccase from the white rot fungus Trametes versicolor was expressed under control of the PGK1 promoter in Saccharomyces cerevisiae to increase its resistance to phenolic inhibitors in lignocellulose hydrolysates. It was found that the laccase activity could be enhanced twofold by simultaneous overexpression of the homologous t-SNARE Sso2p. The factors affecting the level of active laccase obtained, besides the cultivation temperature, included pH and aeration. Laccase-expressing and Sso2p-overexpressing S. cerevisiae was cultivated in the presence of coniferyl aldehyde to examine resistance to lignocellulose-derived phenolic fermentation inhibitors. The laccase-producing transformant had the ability to convert coniferyl aldehyde at a faster rate than a control transformant not expressing laccase, which enabled faster growth and ethanol formation. The laccase-producing transformant was also able to ferment a dilute acid spruce hydrolysate at a faster rate than the control transformant. A decrease in the content of low-molecular-mass aromatic compounds, accompanied by an increase in the content of high-molecular-mass compounds, was observed during fermentation with the laccase-expressing strain, illustrating that laccase was active even at the very low levels of oxygen supplied. Our results demonstrate the importance of phenolic compounds as fermentation inhibitors and the advantage of using laccase-expressing yeast strains for producing ethanol from lignocellulose.

Genome-Wide Identification and Characterization of Novel Laccase Genes in the White-Rot Fungus Flammulina velutipes

PubMed Central

Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo

2014-01-01

The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003

Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.

PubMed

Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

2014-01-01

A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively.

Protein and gene structure of a blue laccase from Pleurotus ostreatus1.

PubMed Central

Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

1999-01-01

A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

A chloride tolerant laccase from the plant pathogen ascomycete Botrytis aclada expressed at high levels in Pichia pastoris.

PubMed

Kittl, Roman; Mueangtoom, Kitti; Gonaus, Christoph; Khazaneh, Shima Tahvilda; Sygmund, Christoph; Haltrich, Dietmar; Ludwig, Roland

2012-01-20

Fungal laccases from basidiomycetous fungi are thoroughly investigated in respect of catalytic mechanism and industrial applications, but the number of reported and well characterized ascomycetous laccases is much smaller although they exhibit interesting catalytic properties. We report on a highly chloride tolerant laccase produced by the plant pathogen ascomycete Botrytis aclada, which was recombinantly expressed in Pichia pastoris with an extremely high yield and purified to homogeneity. In a fed-batch fermentation, 495 mg L(-1) of laccase was measured in the medium, which is the highest concentration obtained for a laccase by a yeast expression system. The recombinant B. aclada laccase has a typical molecular mass of 61,565 Da for the amino acid chain. The pI is approximately 2.4, a very low value for a laccase. Glycosyl residues attached to the recombinant protein make up for approximately 27% of the total protein mass. B. aclada laccase exhibits very low K(M) values and high substrate turnover numbers for phenolic and non-phenolic substrates at acidic and near neutral pH. The enzyme's stability increases in the presence of chloride ions and, even more important, its substrate turnover is only weakly inhibited by chloride ions (I(50)=1.4M), which is in sharp contrast to most other described laccases. This high chloride tolerance is mandatory for some applications such as implantable biofuel cells and laccase catalyzed reactions, which suffer from the presence of chloride ions. The high expression yield permits fast and easy production for further basic and applied research. Copyright © 2011 Elsevier B.V. All rights reserved.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation

PubMed Central

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

2013-01-01

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

Systematic Analysis of the Pleurotus ostreatus Laccase Gene (PoLac) Family and Functional Characterization of PoLac2 Involved in the Degradation of Cotton-Straw Lignin.

PubMed

Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping

2018-04-11

Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

Improved recovery of active recombinant laccase from maize seed.

PubMed

Bailey, M R; Woodard, S L; Callaway, E; Beifuss, K; Magallanes-Lundback, M; Lane, J R; Horn, M E; Mallubhotla, H; Delaney, D D; Ward, M; Van Gastel, F; Howard, J A; Hood, E E

2004-01-01

Lignolytic enzymes such as laccase have been difficult to over-express in an active form. This paper describes the expression, characterization, and application of a fungal laccase in maize seed. The transgenic seed contains immobilized and extractable laccase. Fifty ppm dry weight of aqueously extractable laccase was obtained, and the remaining solids contained a significant amount of immobilized laccase that was active. Although a portion of the extractable laccase was produced as inactive apoenzyme, laccase activity was recovered by treatment with copper and chloride. In addition to allowing the apoenzyme to regain activity, treatment with copper also provided a partial purification step by precipitating other endogenous corn proteins while leaving >90% of the laccase in solution. The data also demonstrate the application of maize-produced laccase as a polymerization agent. The apparent concentration of laccase in ground, defatted corn germ is approximately 0.20% of dry weight.

Comparison of laccase production levels in Pichia pastoris and Cryptococcus sp. S-2.

PubMed

Nishibori, Nahoko; Masaki, Kazuo; Tsuchioka, Hiroaki; Fujii, Tsutomu; Iefuji, Haruyuki

2013-04-01

The heterologous expression of the laccase gene from Trametes versicolor and Gaeumannomyces graminis was evaluated in the yeasts Pichia pastoris and Cryptococcus sp. S-2. The expression levels of both laccase genes in Cryptococcus sp. S-2 were considerably higher than those in P. pastoris. The codon usage of Cryptococcus sp. S-2 as well as the GC content were similar to those of T. versicolor and G. graminis. These results suggest that using a host with a similar codon usage for the expressed gene may improve protein expression. The use of Cryptococcus sp. S-2 as a host may be advantageous for the heterologous expression of genes with high GC content. Moreover, this yeast provides the same advantages as P. pastoris for the production of recombinant proteins, such as growth on minimal medium, capacity for high-density growth during fermentation, and capability for post-translational modifications. Therefore, we propose that Cryptococcus sp. S-2 be used as an expression host to improve enzyme production levels when other hosts have not yielded good results. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

LACCASE Is Necessary and Nonredundant with PEROXIDASE for Lignin Polymerization during Vascular Development in Arabidopsis[C][W

PubMed Central

Zhao, Qiao; Nakashima, Jin; Chen, Fang; Yin, Yanbin; Fu, Chunxiang; Yun, Jianfei; Shao, Hui; Wang, Xiaoqiang; Wang, Zeng-Yu; Dixon, Richard A.

2013-01-01

The evolution of lignin biosynthesis was critical in the transition of plants from an aquatic to an upright terrestrial lifestyle. Lignin is assembled by oxidative polymerization of two major monomers, coniferyl alcohol and sinapyl alcohol. Although two recently discovered laccases, LAC4 and LAC17, have been shown to play a role in lignin polymerization in Arabidopsis thaliana, disruption of both genes only leads to a relatively small change in lignin content and only under continuous illumination. Simultaneous disruption of LAC11 along with LAC4 and LAC17 causes severe plant growth arrest, narrower root diameter, indehiscent anthers, and vascular development arrest with lack of lignification. Genome-wide transcript analysis revealed that all the putative lignin peroxidase genes are expressed at normal levels or even higher in the laccase triple mutant, suggesting that lignin laccase activity is necessary and nonredundant with peroxidase activity for monolignol polymerization during plant vascular development. Interestingly, even though lignin deposition in roots is almost completely abolished in the lac11 lac4 lac17 triple mutant, the Casparian strip, which is lignified through the activity of peroxidase, is still functional. Phylogenetic analysis revealed that lignin laccase genes have no orthologs in lower plant species, suggesting that the monolignol laccase genes diverged after the evolution of seed plants. PMID:24143805

The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

PubMed

Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

2015-01-01

Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

Heterologous laccase production and its role in industrial applications

PubMed Central

Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

2010-01-01

Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

Electrochemical studies of a truncated laccase produced in Pichia pastoris

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.

1999-12-01

The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms ofmore » their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.« less

The pbrB Gene Encodes a Laccase Required for DHN-Melanin Synthesis in Conidia of Talaromyces (Penicillium) marneffei

PubMed Central

Sapmak, Ariya; Boyce, Kylie J.; Andrianopoulos, Alex; Vanittanakom, Nongnuch

2015-01-01

Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type. PMID:25866870

Comparison of two laccases from Trametes versicolor for application in the decolorization of dyes.

PubMed

Li, Qi; Ge, Lin; Cai, Junli; Pei, Jianjun; Xie, Jingcong; Zhao, Linguo

2014-04-01

It has been previously demonstrated that laccases exhibit great potential for use in several industrial and environmental applications. In this paper, two laccase isoenzyme genes, lccB and lccC, were cloned and expressed in Pichia pastoris GS115. The sequence analysis indicated that the lccB and lccC genes consisted of 1,563 and 1,584 bp, and their open reading frames encoded 520 and 527 amino acids, respectively. They had 72.7% degree of identity in nucleotides and 86.7% in amino acids. The expression levels of LccB and LccC were up to 32,479 and 34,231 U/l, respectively. The recombinant laccases were purified by ultrafiltration and (NH4)2SO4 precipitation, showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimal pH and temperature for LccB were 2.0 and 55°C with 2,2'-azino-bis-[3-ethylbenzthiazolinesulfonic acid (ABTS) as a substrate, whereas LccC exhibited optimal pH and temperature at 3.0 and 60°C. The apparent kinetic parameters of LccB were 0.43 mM for ABTS with a Vmax value of 51.28 U/mg, and the Km and Vmax values for LccC were 0.29 mM and 62.89 U/mg. The recombinant laccases were able to decolorize five types of dyes. Acid Violet 43 (100 g/ml) was completely decolorized by LccB or LccC (2 U/ml), and the decolorization of Reactive Blue KN-R (100 g/ml) was 91.6% by LccC (2 U/ml). Thus, the study characterizes useful laccase isoenzymes from T. versicolor that have the capability of being incorporated into the treatment of similar azo and anthraquinone dyes from dyeing industries.

Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris

PubMed Central

Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.

1999-01-01

The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI→LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10−4 cm s−1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

PubMed

Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

2014-01-01

Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition

USGS Publications Warehouse

Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

2007-01-01

The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability.

PubMed

Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong

2011-02-01

Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.

Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.

PubMed

Ausec, Luka; Črnigoj, Miha; Šnajder, Marko; Ulrih, Nataša Poklar; Mandic-Mulec, Ines

2015-12-01

Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6× His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20 °C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH 5.0 and pH 9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50 °C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general.

Secretory expression of Lentinula edodes intracellular laccase by yeast high-cell-density system: sub-milligram production of difficult-to-express secretory protein.

PubMed

Kurose, Takeshi; Saito, Yuta; Kimata, Koichi; Nakagawa, Yuko; Yano, Akira; Ito, Keisuke; Kawarasaki, Yasuaki

2014-06-01

While a number of heterologous expression systems have been reported for extracellular laccases, there are few for the intracellular counterparts. The Lentinula edodes intracellular laccase Lcc4 is an industrially potential enzyme with its unique substrate specificity. The heterologous production of the intracellular laccase, however, had been difficult because of its expression-dependent toxicity. We previously demonstrated that recombinant yeast cells synthesized and, interestingly, secreted Lcc4 only when they were suspended to an inducing medium in a high cell-density (J. Biosci. Bioeng., 113, 154-159, 2012). The high cell-density system was versatile and applicable to other difficult-to-express secretory proteins. Nevertheless, the system's great dependence on aeration, which was a practical obstacle to scale-up production of the enzyme and some other proteins, left the secretion pathway and enzymatic properties of the Lcc4 uncharacterized. In this report, we demonstrate a successful production of Lcc4 by applying a jar-fermentor to the high cell-density system. The elevated yield (0.6 mg L(-1)) due to the sufficient aeration allowed us to prepare and purify the enzyme to homogeneity. The enzyme had been secreted as a hyper-glycosylated protein, resulting in smear band-formations in SDS-PAGE. The amino acid sequencing analysis suggested that the N-terminal 17 residues had been recognized as a secretion signal. The recombinant enzyme showed similar enzymatic properties to the naturally occurring Lcc4. The characteristics of the scale-upped expression system, which includes helpful information for the potential users, have also been described. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

PubMed

Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

2015-12-01

The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

PubMed Central

Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

2015-01-01

Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

Distribution, diversity and abundance of bacterial laccase-like genes in different particle size fractions of sediments in a subtropical mangrove ecosystem.

PubMed

Luo, Ling; Zhou, Zhi-Chao; Gu, Ji-Dong

2015-10-01

This study investigated the diversity and abundance of bacterial lacasse-like genes in different particle size fractions, namely sand, silt, and clay of sediments in a subtropical mangrove ecosystem. Moreover, the effects of nutrient conditions on bacterial laccase-like communities as well as the correlation between nutrients and, both the abundance and diversity indices of laccase-like bacteria in particle size fractions were also studied. Compared to bulk sediments, Bacteroidetes, Caldithrix, Cyanobacteria and Chloroflexi were dominated in all 3 particle-size fractions of intertidal sediment (IZ), but Actinobacteria and Firmicutes were lost after the fractionation procedures used. The diversity index of IZ fractions decreased in the order of bulk > clay > silt > sand. In fractions of mangrove forest sediment (MG), Verrucomicrobia was found in silt, and both Actinobacteria and Bacteroidetes appeared in clay, but no new species were found in sand. The declining order of diversity index in MG fractions was clay > silt > sand > bulk. Furthermore, the abundance of lacasse-like bacteria varied with different particle-size fractions significantly (p < 0.05), and decreased in the order of sand > clay > silt in both IZ and MG fractions. Additionally, nutrient availability was found to significantly affect the diversity and community structure of laccase-like bacteria (p < 0.05), while the total organic carbon contents were positively related to the abundance of bacterial laccase-like genes in particle size fractions (p < 0.05). Therefore, this study further provides evidence that bacterial laccase plays a vital role in turnover of sediment organic matter and cycling of nutrients.

Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

PubMed Central

Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo

2013-01-01

The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

Chitosan multiple addition enhances laccase production from Trametes versicolor.

PubMed

Adekunle, Abiodun Emmanuel; Wang, Feng; Hu, Jianhua; Ma, Anzhou; Guo, Chen; Zhuang, Guoqiang; Liu, Chun-Zhao

2015-10-01

Chitosan multiple addition strategy was developed to improve laccase production from Trametes versicolor cultures. The optimized multiple addition strategy was carried out by two-time addition of 0.1 g L(-1) chitosan to a 2-day-old culture media, with 24-h interval between the treatments. Under these conditions, laccase activity of 644.9 U l(-1) was achieved on the seventh day and laccase production was improved by 93.5 % higher than the control. Chitosan treatment increased reactive oxygen species generation and extracellular protein concentration in the treated mycelia. In contrast, the inducer inhibited the mycelia growth. The result of the quantitative reverse transcription polymerase chain reaction showed that the copy number of the laccase gene transcript increased by 16.7-fold in the treated mycelia relative to the control. This study provides insight into some of the intrinsic metabolic processes involved in the upregulation of laccase production in the presence of chitosan inducer in fungal culture.

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

PubMed Central

Rodríguez-Escribano, David; de Salas, Felipe; Camarero, Susana

2017-01-01

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin–Ciocalteau reagent (FCR), to detect the decrease in phenolic content produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). The method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates. PMID:28820431

Characterization of an Alkali- and Halide-Resistant Laccase Expressed in E. coli: CotA from Bacillus clausii

PubMed Central

Brander, Søren; Mikkelsen, Jørn D.; Kepp, Kasper P.

2014-01-01

The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ∼0.5–2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (KM) but to pH dependence of catalytic turnover: The kcat of B. clausii cotA was 1 s−1 at pH 6 and 5 s−1 at pH 8 in contrast to 6 s−1 at pH 6 and 2 s−1 at pH 8 for of B. subtilis cotA. Overall, kcat/KM was 10-fold higher for B. subtilis cotA at pHopt. While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500–700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ∼20 minutes half-life at 80°C, less than the ∼50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH∼8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

Spore cells from BPA degrading bacteria Bacillus sp. GZB displaying high laccase activity and stability for BPA degradation.

PubMed

Das, Ranjit; Li, Guiying; Mai, Bixian; An, Taicheng

2018-06-04

Laccase has been applied extensively as a biocatalyst to remove different organic pollutants. This study characterized a spore-laccase from the bisphenol A (BPA)-degrading strain Bacillus sp. GZB. The spore-laccase was encoded with 513 amino acids, containing spore coat protein A (CotA). It showed optimal activity at 70 °C and pH = 7.2 in presence of 2, 6-dimethoxyphenol. At 60 °C, optimal activity was also seen at pH = 3.0 and pH = 6.8 with 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) and syringaldazine, respectively. The spore-laccase was stable at high temperature, at acidic to alkaline pH values, and in the presence of different organic solvents. Spore-laccase activity was increased by introducing Cu 2+ , Mg 2+ , and Na + , but was strongly inhibited by Fe 2+ , Ag + , l-cysteine, dithiothreitol, and NaN 3 . The cotA gene was cloned and expressed in E. coli BL21 (DE3); the purified protein was estimated as having a molecular weight of ~63 kDa. Different synthetic dyes and BPA were effectively decolorized or degraded both by the spore laccase and recombinant laccase. When BPA oxidation was catalyzed using laccase, there was an initial formation of phenoxy radicals and further oxidation or CC bond cleavage of the radicals produced different organic acids. Detailed reaction pathways were developed based on nine identified intermediates. The acute toxicity decreased gradually during BPA degradation by laccase. This study is the first report about a genus of Bacillus that can produce a highly active and stable laccase to degrade BPA. Copyright © 2018 Elsevier B.V. All rights reserved.

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

DOE PAGES

Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel; ...

2017-08-18

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less

Evolved α-factor prepro-leaders for directed laccase evolution in Saccharomyces cerevisiae.

PubMed

Mateljak, Ivan; Tron, Thierry; Alcalde, Miguel

2017-11-01

Although the functional expression of fungal laccases in Saccharomyces cerevisiae has proven to be complicated, the replacement of signal peptides appears to be a suitable approach to enhance secretion in directed evolution experiments. In this study, twelve constructs were prepared by fusing native and evolved α-factor prepro-leaders from S. cerevisiae to four different laccases with low-, medium- and high-redox potential (PM1L from basidiomycete PM1; PcL from Pycnoporus cinnabarinus; TspC30L from Trametes sp. strain C30; and MtL from Myceliophthora thermophila). Microcultures of the prepro-leader:laccase fusions were grown in selective expression medium that used galactose as both the sole carbon source and as the inducer of expression so that the secretion and activity were assessed with low- and high-redox potential mediators in a high-throughput screening context. With total activity improvements as high as sevenfold over those obtained with the native α-factor prepro-leader, the evolved prepro-leader from PcL (α PcL ) most strongly enhanced secretion of the high- and medium-redox potential laccases PcL, PM1L and TspC30L in the microtiter format with an expression pattern driven by prepro-leaders in the order α PcL  > α PM 1L  ~ α native . By contrast, the pattern of the low-redox potential MtL was α native  > α PcL  > α PM 1L . When produced in flask with rich medium, the evolved prepro-leaders outperformed the α native signal peptide irrespective of the laccase attached, enhancing secretion over 50-fold. Together, these results highlight the importance of using evolved α-factor prepro-leaders for functional expression of fungal laccases in directed evolution campaigns. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Effect of different compounds on the induction of laccase production by Agaricus blazei.

PubMed

Valle, J S; Vandenberghe, L P S; Oliveira, A C C; Tavares, M F; Linde, G A; Colauto, N B; Soccol, C R

2015-12-03

Laccases are polyphenol oxidases produced by many fungi and have many applications in textile, food and beverage, and pulp and paper industries. Laccase production can be induced using aromatic or phenolic compounds that mostly affect the transcription of laccase-encoding genes. In this study, we analyzed laccase and biomass production by Agaricus blazei in the presence of different concentrations of nitrogen, copper, and inducers such as pyrogallol, veratryl alcohol, xylidine, vanillin, guaiacol, and ethanol. Laccase production by A. blazei U2-4 reached 43.8 U/mL in the presence of 2.8 g/L nitrogen and 150 μM copper. However, addition of copper to the cultivation medium decreased biomass production. Different compounds differentially induced laccase production by A. blazei. Moreover, different concentrations of these inducers exerted different effects on laccase activity. Ethanol (1.0 mM), guaiacol (0.5 mM), and vanillin (0.5 mM) were the best inducers and increased laccase activity by 120% (A. blazei U2-2), 30% (A. blazei U2-3), and 9% (A. blazei U2-4), respectively. In contrast, pyrogallol and xylidine decreased laccase activity but increased biomass production.

High Laccase Expression by Trametes versicolor in a Simulated Textile Effluent with Different Carbon Sources and PHs

PubMed Central

Ottoni, Cristiane; Simões, Marta F.; Fernandes, Sara; Santos, Cledir R.; Lima, Nelson

2016-01-01

Textile effluents are highly polluting and have variable and complex compositions. They can be extremely complex, with high salt concentrations and alkaline pHs. A fixed-bed bioreactor was used in the present study to simulate a textile effluent treatment, where the white-rot fungus, Trametes versicolor, efficiently decolourised the azo dye Reactive Black 5 over 28 days. This occurred under high alkaline conditions, which is unusual, but advantageous, for successful decolourisation processes. Active dye decolourisation was maintained by operation in continuous culture. Colour was eliminated during the course of operation and maximum laccase (Lcc) activity (80.2 U∙L−1) was detected after glycerol addition to the bioreactor. Lcc2 gene expression was evaluated with different carbon sources and pH values based on reverse transcriptase-PCR (polymerase chain reaction). Glycerol was shown to promote the highest lcc2 expression at pH 5.5, followed by sucrose and then glucose. The highest levels of expression occurred between three and four days, which corroborate the maximum Lcc activity observed for sucrose and glycerol on the bioreactor. These results give new insights into the use of T. versicolor in textile dye wastewater treatment with high pHs. PMID:27490563

High Laccase Expression by Trametes versicolor in a Simulated Textile Effluent with Different Carbon Sources and PHs.

PubMed

Ottoni, Cristiane; Simões, Marta F; Fernandes, Sara; Santos, Cledir R; Lima, Nelson

2016-08-02

Textile effluents are highly polluting and have variable and complex compositions. They can be extremely complex, with high salt concentrations and alkaline pHs. A fixed-bed bioreactor was used in the present study to simulate a textile effluent treatment, where the white-rot fungus, Trametes versicolor, efficiently decolourised the azo dye Reactive Black 5 over 28 days. This occurred under high alkaline conditions, which is unusual, but advantageous, for successful decolourisation processes. Active dye decolourisation was maintained by operation in continuous culture. Colour was eliminated during the course of operation and maximum laccase (Lcc) activity (80.2 U∙L(-1)) was detected after glycerol addition to the bioreactor. Lcc2 gene expression was evaluated with different carbon sources and pH values based on reverse transcriptase-PCR (polymerase chain reaction). Glycerol was shown to promote the highest lcc2 expression at pH 5.5, followed by sucrose and then glucose. The highest levels of expression occurred between three and four days, which corroborate the maximum Lcc activity observed for sucrose and glycerol on the bioreactor. These results give new insights into the use of T. versicolor in textile dye wastewater treatment with high pHs.

Suppression of Laccase 2 severely impairs cuticle tanning and pathogen resistance during the pupal metamorphosis of Anopheles sinensis (Diptera: Culicidae).

PubMed

Du, Ming-Hui; Yan, Zheng-Wen; Hao, You-Jin; Yan, Zhen-Tian; Si, Feng-Ling; Chen, Bin; Qiao, Liang

2017-04-04

Phenol oxidases (POs) catalyze the oxidation of dopa and dopamine to melanin, which is crucial for cuticle formation and innate immune maintenance in insects. Although, Laccase 2, a member of the PO family, has been reported to be a requirement for melanin-mediated cuticle tanning in the development stages of some insects, whether it participates in cuticle construction and other physiological processes during the metamorphosis of mosquito pupae is unclear. The association between the phenotype and the expression profile of Anopheles sinensis Laccase 2 (AsLac2) was assessed from pupation to adult eclosion. Individuals showing an expression deficiency of AsLac2 that was produced by RNAi and their phenotypic defects and physiological characterizations were compared in detail with the controls. During the dominant expression period, knockdown of AsLac2 in pupae caused the cuticle to be unpigmented, and produced thin and very soft cuticles, which further impeded the eclosion rate of adults as well as their fitness. Moreover, melanization immune responses in the pupae were sharply decreased, leading to poor resistance to microorganism infection. Both the high conservation among Laccase 2 homologs and a very similar genomic synteny of the neighborhood in Anopheles genus implies a conservative function in the pupal stage. To our knowledge, this is the first study to report the serious phenotypic defects in mosquito pupae caused by the dysfunction of Laccase 2. Our findings strongly suggest that Laccase 2 is crucial for Anopheles cuticle construction and melanization immune responses to pathogen infections during pupal metamorphosis. This irreplaceability provides valuable information on the application of Lacccase 2 and/or other key genes in the melanin metabolism pathway for developing mosquito control strategies.

Molecular modeling and simulation studies of recombinant laccase from Yersinia enterocolitica suggests significant role in the biotransformation of non-steroidal anti-inflammatory drugs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Deepti; Rawat, Surender; Waseem, Mohd

The YacK gene from Yersinia enterocolitica strain 7, cloned in pET28a vector and expressed in Escherichia coli BL21 (DE3), showed laccase activity when oxidized with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and guaiacol. The recombinant laccase protein was purified and characterized biochemically with a molecular mass of ≈58 KDa on SDS-PAGE and showed positive zymogram with ABTS. The protein was highly robust with optimum pH 9.0 and stable at 70 °C upto 12 h with residual activity of 70%. Kinetic constants, K{sub m} values, for ABTS and guaiacol were 675 μM and 2070 μM, respectively, with corresponding Vmax values of 0.125 μmol/ml/min and 6500 μmol/ml/min. It also possess antioxidative propertymore » against BSA and Cu{sup 2+}/H{sub 2}O{sub 2} model system. Constant pH MD simulation studies at different protonation states of the system showed ABTS to be most stable at acidic pH, whereas, diclofenac at neutral pH. Interestingly, aspirin drifted out of the binding pocket at acidic and neutral pH, but showed stable binding at alkaline pH. The biotransformation of diclofenac and aspirin by laccase also corroborated the in silico results. This is the first report on biotransformation of non-steroidal anti-inflammatory drugs (NSAIDs) using recombinant laccase from gut bacteria, supported by in silico simulation studies. - Highlights: • Laccase from Yersinia enterocolitica strain 7 was expressed in Escherichia coli BL21 (DE3). • Recombinant laccase was found to be thermostable and alkali tolerant. • The in silico and experimental studied proves the biotransformation of NSAIDs. • Laccase binds to ligands differentially under different protonation state. • Laccase also possesses free radical scavenging property.« less

Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts

PubMed Central

De Fine Licht, Henrik H.; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J.

2013-01-01

Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non–leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya. PMID:23267060

Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts.

PubMed

De Fine Licht, Henrik H; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J

2013-01-08

Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non-leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

III digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest

Laccase engineering: from rational design to directed evolution.

PubMed

Mate, Diana M; Alcalde, Miguel

2015-01-01

Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. Copyright © 2014 Elsevier Inc. All rights reserved.

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

PubMed Central

Kües, Ursula; Rühl, Martin

2011-01-01

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Laccase-13 Regulates Seed Setting Rate by Affecting Hydrogen Peroxide Dynamics and Mitochondrial Integrity in Rice.

PubMed

Yu, Yang; Li, Quan-Feng; Zhang, Jin-Ping; Zhang, Fan; Zhou, Yan-Fei; Feng, Yan-Zhao; Chen, Yue-Qin; Zhang, Yu-Chan

2017-01-01

Seed setting rate is one of the most important components of rice grain yield. To date, only several genes regulating setting rate have been identified in plant. In this study, we showed that laccase-13 ( OsLAC13 ), a member of laccase family genes which are known for their roles in modulating phenylpropanoid pathway and secondary lignification in cell wall, exerts a regulatory function in rice seed setting rate. OsLAC13 expressed in anthers and promotes hydrogen peroxide production both in vitro and in the filaments and anther connectives. Knock-out of OsLAC13 showed significantly increased seed setting rate, while overexpression of this gene exhibited induced mitochondrial damage and suppressed sugar transportation in anthers, which in turn affected seed setting rate. OsLAC13 also induced H 2 O 2 production and mitochondrial damage in the root tip cells which caused the lethal phenotype. We also showed that high abundant of OsmiR397, the suppressor of OsLAC13 mRNA, increased the seed setting rate of rice plants, and restrains H 2 O 2 accumulation in roots during oxidative stress. Our results suggested a novel regulatory role of OsLAC13 gene in regulating seed setting rate by affecting H 2 O 2 dynamics and mitochondrial integrity in rice.

Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor

USDA-ARS?s Scientific Manuscript database

Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...

Parallel metatranscriptome analyses of host and symbiont gene expression in the gut of the termite Reticulitermes flavipes

PubMed Central

Tartar, Aurélien; Wheeler, Marsha M; Zhou, Xuguo; Coy, Monique R; Boucias, Drion G; Scharf, Michael E

2009-01-01

Background Termite lignocellulose digestion is achieved through a collaboration of host plus prokaryotic and eukaryotic symbionts. In the present work, we took a combined host and symbiont metatranscriptomic approach for investigating the digestive contributions of host and symbiont in the lower termite Reticulitermes flavipes. Our approach consisted of parallel high-throughput sequencing from (i) a host gut cDNA library and (ii) a hindgut symbiont cDNA library. Subsequently, we undertook functional analyses of newly identified phenoloxidases with potential importance as pretreatment enzymes in industrial lignocellulose processing. Results Over 10,000 expressed sequence tags (ESTs) were sequenced from the 2 libraries that aligned into 6,555 putative transcripts, including 171 putative lignocellulase genes. Sequence analyses provided insights in two areas. First, a non-overlapping complement of host and symbiont (prokaryotic plus protist) glycohydrolase gene families known to participate in cellulose, hemicellulose, alpha carbohydrate, and chitin degradation were identified. Of these, cellulases are contributed by host plus symbiont genomes, whereas hemicellulases are contributed exclusively by symbiont genomes. Second, a diverse complement of previously unknown genes that encode proteins with homology to lignase, antioxidant, and detoxification enzymes were identified exclusively from the host library (laccase, catalase, peroxidase, superoxide dismutase, carboxylesterase, cytochrome P450). Subsequently, functional analyses of phenoloxidase activity provided results that were strongly consistent with patterns of laccase gene expression. In particular, phenoloxidase activity and laccase gene expression are mostly restricted to symbiont-free foregut plus salivary gland tissues, and phenoloxidase activity is inducible by lignin feeding. Conclusion To our knowledge, this is the first time that a dual host-symbiont transcriptome sequencing effort has been conducted in a

A designed bifunctional laccase/β-1,3-1,4-glucanase enzyme shows synergistic sugar release from milled sugarcane bagasse.

PubMed

Furtado, G P; Ribeiro, L F; Lourenzoni, M R; Ward, R J

2013-01-01

A bifunctional enzyme has been created by fusing two Bacillus subtilis enzymes: the β-1,3-1,4-glucanase (BglS, EC 3.2.1.73) that hydrolyzes plant cell wall β-glucans and the copper-dependent oxidase laccase (CotA, EC 1.10.3.2) that catalyzes the oxidation of aromatic compounds with simultaneous reduction of oxygen to water. The chimeric laccase/β-1,3-1,4-glucanase was created by insertion fusion of the bglS and cotA genes, and expressed in Escherichia coli. The affinity-purified recombinant chimeric enzyme showed both laccase and glucanase activities, with a maximum laccase activity at pH 4.5 and 75°C that showed a V(max) 30% higher than observed for the parental laccase. The maximum glucanase activity in the chimeric enzyme was at pH 6.0 and 50°C, with a slight reduction in V(max) by ∼10% compared with the parental glucanase. A decreased K(M) resulted in an overall increase in the K(cat)/K(M) value for the glucanase activity of the chimeric enzyme. The hydrolytic activity of the chimera was 20% higher against natural milled sugarcane bagasse as compared with equimolar mixtures of the separate parental enzymes. Molecular dynamics simulations indicated the approximation of the two catalytic domains in the chimeric enzyme, and the formation of an inter-domain interface may underlie the improved catalytic function.

Bioprospecting and biotechnological applications of fungal laccase.

PubMed

Upadhyay, Pooja; Shrivastava, Rahul; Agrawal, Pavan Kumar

2016-06-01

Laccase belongs to a small group of enzymes called the blue multicopper oxidases, having the potential ability of oxidation. It belongs to enzymes, which have innate properties of reactive radical production, but its utilization in many fields has been ignored because of its unavailability in the commercial field. There are diverse sources of laccase producing organisms like bacteria, fungi and plants. In fungi, laccase is present in Ascomycetes, Deuteromycetes, Basidiomycetes and is particularly abundant in many white-rot fungi that degrade lignin. Laccases can degrade both phenolic and non-phenolic compounds. They also have the ability to detoxify a range of environmental pollutants. Due to their property to detoxify a range of pollutants, they have been used for several purposes in many industries including paper, pulp, textile and petrochemical industries. Some other application of laccase includes in food processing industry, medical and health care. Recently, laccase has found applications in other fields such as in the design of biosensors and nanotechnology. The present review provides an overview of biological functions of laccase, its mechanism of action, laccase mediator system, and various biotechnological applications of laccase obtained from endophytic fungi.

Scale-up laccase production from Trametes versicolor stimulated by vanillic acid.

PubMed

Wang, Ke-Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2016-07-01

An efficient strategy for laccase production in Trametes versicolor cultures was developed using vanillic acid as the inducer. The optimized vanillic acid treatment strategy consisted of exposing 2-day-old mycelia cultures to 80 mg/L vanillic acid. After 4 days, laccase activity of 588.84 U/L was achieved in flasks which represented a 1.79-fold increase compared to the control. In 200-L airlift bioreactor, the maximal laccase activity reached up to 785.12 U/L using the optimized vanillic acid treatment strategy. The zymograms of culture supernatants revealed three bands with laccase activity, among which Lac1 and Lac2 were abundant laccase isoforms constitutively expressed, and Lac3 was an inducible isozyme by vanillic acid. The results of real-time quantitative PCR showed that the transcription level of lcc in T. versicolor cultures grown with vanillic acid for 7 days was about 5.64-fold greater than that without vanillic acid in flasks. In 200-L airlift bioreactor cultures of T. versicolor with addition of vanillic acid, the transcript level of lcc at day 7 was 2.62-fold higher than that in flasks with vanillic acid due to the good mass transfer and oxygen supply in the bioreactor system. This study provides a basis for understanding the induction mechanism of vanillic acid for laccase production and has good potential for industrial applications.

Blood tolerant laccase by directed evolution.

PubMed

Mate, Diana M; Gonzalez-Perez, David; Falk, Magnus; Kittl, Roman; Pita, Marcos; De Lacey, Antonio L; Ludwig, Roland; Shleev, Sergey; Alcalde, Miguel

2013-02-21

High-redox potential laccases are powerful biocatalysts with a wide range of applications in biotechnology. We have converted a thermostable laccase from a white-rot fungus into a blood tolerant laccase. Adapting the fitness of this laccase to the specific composition of human blood (above neutral pH, high chloride concentration) required several generations of directed evolution in a surrogate complex blood medium. Our evolved laccase was tested in both human plasma and blood, displaying catalytic activity while retaining a high redox potential at the T1 copper site. Mutations introduced in the second coordination sphere of the T1 site shifted the pH activity profile and drastically reduced the inhibitory effect of chloride. This proof of concept that laccases can be adapted to function in extreme conditions opens an array of opportunities for implantable nanobiodevices, chemical syntheses, and detoxification. Copyright © 2013 Elsevier Ltd. All rights reserved.

Laccase/HBT and laccase-CBM/HBT treatment of softwood kraft pulp: impact on pulp bleachability and physical properties.

PubMed

Ravalason, Holy; Bertaud, Frédérique; Herpoël-Gimbert, Isabelle; Meyer, Valérie; Ruel, Katia; Joseleau, Jean-Paul; Grisel, Sacha; Olivé, Caroline; Sigoillot, Jean-Claude; Petit-Conil, Michel

2012-10-01

Pycnoporus cinnabarinus laccase and a chimeric laccase-CBM were applied in softwood kraft pulp biobleaching in the presence of 1-hydroxybenzotriazole (HBT). The presence of CBM could enhance the laccase biobleaching potential as a decrease in the enzymatic charge and chlorine dioxide consumption, as well as an increase in pulp brightness were observed. Laccase/HBT treatment could be improved by increasing oxygen pressure from 1 to 3bar and pulp consistency from 5% to 10%. Conversely, under the same conditions, no improvement of laccase-CBM/HBT treatment was observed, indicating a different behavior of both systems. However, laccase-CBM/HBT treatment led to a better preservation of pulp properties. This effect was probably due to fiber surface modifications involving the action of the CBM. Transmission electron microscopy examination of pulp fibers indicated a retention of laccase-CBM inside the pulp fibers due to CBM binding and an increased external microfibrillation of the fibers due to enzymatic treatments. Copyright © 2012 Elsevier Ltd. All rights reserved.

Secretory expression of the non-secretory-type Lentinula edodes laccase by Aspergillus oryzae.

PubMed

Yano, Akira; Kikuchi, Sayaka; Nakagawa, Yuko; Sakamoto, Yuichi; Sato, Toshitsugu

2009-01-01

The shiitake mushroom, Lentinula edodes, has an extracelluar secretory-type laccase, Lcc1, and a fruiting-body-accumulation-type laccase, Lcc4. We previously reported the production of Lcc1 by plant cells, but had difficulty producing Lcc4. Here, we report the production of Lcc1 and Lcc4 by Aspergillus oryzae and the extracellular secretory production of Lcc4 using a modified secretion signal peptide (SP) from Lcc1. Sp-Lcc4 produced by A. oryzae had biochemical activities similar to Lcc4 produced by L. edodes. Lcc1 did not react with beta-(3,4-dihydroxyphenol) alanine (DOPA), but Lcc4 from L. edodes and A. oryzae could oxidize DOPA. K(M) values for the substrates 2,2'-azino-di-(3-ethylbenzthiazolinsulfonate), 2,6-dimethoxyphenol, guaiacol, pyrogallol, and catechol were similar for Lcc4 and Sp-Lcc4. In conclusion, a non-secretory-type fungal laccase is secreted into the culture media with its original enzymatic properties by exploiting modified secretory signal peptide. 2008 Elsevier GmbH.

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

PubMed Central

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Identification and evaluation of bioremediation potential of laccase isoforms produced by Cyathus bulleri on wheat bran.

PubMed

Vats, Arpita; Mishra, Saroj

2018-02-15

Multiplicity in laccases among lignin degrading fungal species is of interest as it confers the ability to degrade several types of lignocellulosics. The combination of laccases produced on such substrates could be beneficial for treatment of complex aromatics, including dyes. In this study, we report on production of high units (679.6Ug -1 substrate) of laccase on solid wheat bran (WB) by Cyathus bulleri. Laccase, purified from the culture filtrates of WB grown fungus, was effective for oxidation of veratryl alcohol, Reactive blue 21 and textile effluent without assistance of externally added mediators. De novo sequencing of the 'purified' laccase lead to identification of several peptides that originated from different laccase genes. Transcriptome analysis of the fungus, cultivated on WB, confirmed presence of 8 isozymes, that were re-amplified and sequenced from the cDNA prepared from WB grown fungus. The 8 isozymes were grouped into 3 classes, based on their sequence relationship with other basidiomycete laccases. The isoforms produced on WB decolorized (by ∼57%) and degraded textile effluent far more effectively, compared to laccase obtained from Basal salt cultivated fungus. The decolorization and degradation was also accompanied by more than 95% reduction in phytotoxicity. Copyright © 2017 Elsevier B.V. All rights reserved.

Metal release and sequestration from black slate mediated by a laccase of Schizophyllum commune.

PubMed

Kirtzel, Julia; Scherwietes, Eric Leon; Merten, Dirk; Krause, Katrin; Kothe, Erika

2018-06-25

Schizophyllum commune is a filamentous basidiomycete which can degrade complex organic macromolecules like lignin by the secretion of a large repertoire of enzymes. One of these white rot enzymes, laccase, exhibits a broad substrate specificity and is able to oxidize a variety of substances including carbonaceous rocks. To investigate the role of laccase in bioweathering, laccase gene lcc2 was overexpressed, and the influence on weathering of black slate, originating from a former alum mine in Schmiedefeld, Germany, was examined. The metal release from the rock material was enhanced, associated with a partial metal accumulation into the mycelium. A sequestration of metals could be shown with fluorescent staining methods, and an accumulation of Zn, Cd, and Pb was visualized in different cell organelles. Additionally, we could show an increased metal resistance of the laccase overexpressing strain.

Construction and direct electrochemistry of orientation controlled laccase electrode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Ying; Zhang, Jiwei; Huang, Xirong, E-mail: xrhuang@sdu.edu.cn

2014-03-28

Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, usingmore » genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.« less

Laccases from Aureobasidium pullulans

USDA-ARS?s Scientific Manuscript database

Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...

Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397).

PubMed

Dhakar, Kusum; Pandey, Anita

2013-01-01

Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03) isolated from a glacial site in Indian Himalayan Region (IHR) has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C ± 2 (25°C opt.) and pH 3-13 (5-7 opt.). Molecular weight of laccase was determined approximately 45 kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain) contained 200 bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0 mM) induced laccase production up to 2-fold, in case of 0.4 mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold) induction. The study has implications in bioprospecting of ecologically resilient microbial strains.

Fungal Laccases: Production, Function, and Applications in Food Processing

PubMed Central

Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.

2010-01-01

Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed. PMID:21048859

Construction and direct electrochemistry of orientation controlled laccase electrode.

PubMed

Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

2014-03-28

A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. Copyright © 2014 Elsevier Inc. All rights reserved.

Laccase/Mediator Systems: Their Reactivity toward Phenolic Lignin Structures.

PubMed

Hilgers, Roelant; Vincken, Jean-Paul; Gruppen, Harry; Kabel, Mirjam A

2018-02-05

Laccase-mediator systems (LMS) have been widely studied for their capacity to oxidize the nonphenolic subunits of lignin (70-90% of the polymer). The phenolic subunits (10-30% of the polymer), which can also be oxidized without mediators, have received considerably less attention. Consequently, it remains unclear to what extent the presence of a mediator influences the reactions of the phenolic subunits of lignin. To get more insight in this, UHPLC-MS was used to study the reactions of a phenolic lignin dimer (GBG), initiated by a laccase from Trametes versicolor , alone or in combination with the mediators HBT and ABTS. The role of HBT was negligible, as its oxidation by laccase occurred slowly in comparison to that of GBG. Laccase and laccase/HBT oxidized GBG at a comparable rate, resulting in extensive polymerization of GBG. In contrast, laccase/ABTS converted GBG at a higher rate, as GBG was oxidized both directly by laccase but also by ABTS radical cations, which were rapidly formed by laccase. The laccase/ABTS system resulted in Cα oxidation of GBG and coupling of ABTS to GBG, rather than polymerization of GBG. Based on these results, we propose reaction pathways of phenolic lignin model compounds with laccase/HBT and laccase/ABTS.

Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins.

PubMed

Kramer, Marianne C; Liang, Dongming; Tatomer, Deirdre C; Gold, Beth; March, Zachary M; Cherry, Sara; Wilusz, Jeremy E

2015-10-15

Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼ 400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3' end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine-arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. © 2015 Kramer et al.; Published by Cold Spring Harbor Laboratory Press.

Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins

PubMed Central

Kramer, Marianne C.; Liang, Dongming; Tatomer, Deirdre C.; Gold, Beth; March, Zachary M.; Cherry, Sara; Wilusz, Jeremy E.

2015-01-01

Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3′ end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine–arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. PMID:26450910

Effects of laccase on lignin depolymerization and enzymatic hydrolysis of ensiled corn stover.

PubMed

Chen, Qin; Marshall, Megan N; Geib, Scott M; Tien, Ming; Richard, Tom L

2012-08-01

The aim of this study was to explore the synergies of laccase, a ligninolytic enzyme, with cellulose and hemicellulase amendments on ensiled corn stover. Molecular signals of lignin decomposition were observed by tetramethylammonium hydroxide thermochemolysis and gas chromatography-mass spectroscopy (TMAH-GC-MS) analysis. The significant findings suggest that ensilage might provide a platform for biological pretreatment. By partially hydrolyzing cellulose and hemicellulose into soluble sugars, ensilage facilitates laccase penetration into the lignocellulose complex to enhance lignin degradation. Downstream cellulose hydrolysis was improved 7% with increasing laccase loading rate. These results demonstrate the potential of enzymes, either directly amended or expressed by microbes during ensilage, to maximize utilization of corn stover for cellulosic biofuels and other downstream fermentations. Copyright © 2012. Published by Elsevier Ltd.

Automated chromatographic laccase-mediator-system activity assay.

PubMed

Anders, Nico; Schelden, Maximilian; Roth, Simon; Spiess, Antje C

2017-08-01

To study the interaction of laccases, mediators, and substrates in laccase-mediator systems (LMS), an on-line measurement was developed using high performance anion exchange chromatography equipped with a CarboPac™ PA 100 column coupled to pulsed amperometric detection (HPAEC-PAD). The developed method was optimized for overall chromatographic run time (45 to 120 min) and automated sample drawing. As an example, the Trametes versicolor laccase induced oxidation of 1-(3,4-dimethoxyphenyl)-2-(2-methoxyphenoxy)-1,3-dihydroxypropane (adlerol) using 1-hydroxybenzotriazole (HBT) as mediator was measured and analyzed on-line. Since the Au electrode of the PAD detects only hydroxyl group containing substances with a limit of detection being in the milligram/liter range, not all products are measureable. Therefore, this method was applied for the quantification of adlerol, and-based on adlerol conversion-for the quantification of the LMS activity at a specific T. versicolor laccase/HBT ratio. The automated chromatographic activity assay allowed for a defined reaction start of all laccase-mediator-system reactions mixtures, and the LMS reaction progress was automatically monitored for 48 h. The automatization enabled an integrated monitoring overnight and over-weekend and minimized all manual errors such as pipetting of solutions accordingly. The activity of the LMS based on adlerol consumption was determined to 0.47 U/mg protein for a laccase/mediator ratio of 1.75 U laccase/g HBT. In the future, the automated method will allow for a fast screening of combinations of laccases, mediators, and substrates which are efficient for lignin modification. In particular, it allows for a fast and easy quantification of the oxidizing activity of an LMS on a lignin-related substrate which is not covered by typical colorimetric laccase assays. ᅟ.

Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

PubMed

Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

2009-03-01

Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

Biochemical and Molecular Characterization of a Laccase from Marasmius quercophilus

PubMed Central

Dedeyan, Boghos; Klonowska, Agnieszka; Tagger, Simone; Tron, Thierry; Iacazio, Gilles; Gil, Gérard; Le Petit, Jean

2000-01-01

The basidiomycete Marasmius quercophilus is commonly found during autumn on the decaying litter of the evergreen oak (Quercus ilex L.), a plant characteristic of Mediterranean forest. This white-rot fungus colonizes the leaf surface with rhizomorphs, causing a total bleaching of the leaf. In synthetic liquid media, this white-rot fungus has strong laccase activity. From a three-step chromatographic procedure, we purified a major isoform to homogeneity. The gene encodes a monomeric glycoprotein of approximately 63 kDa, with a 3.6 isoelectric point, that contains 12% carbohydrate. Spectroscopic analysis of the purified enzyme (UV/visible and electron paramagnetic resonance, atomic absorption) confirmed that it belongs to the “blue copper oxidase” family. With syringaldazine as the substrate, the enzyme's pH optimum was 4.5, the optimal temperature was 75°C, and the Km was 7.1 μM. The structural gene, lac1, was cloned and sequenced. This gene encodes a 517-amino-acid protein 99% identical to a laccase produced by PM1, an unidentified basidiomycete previously isolated from wastewater from a paper factory in Spain. This similarity may be explained by the ecological distribution of the evergreen oak in Mediterranean forest. PMID:10698753

Engineering and Applications of fungal laccases for organic synthesis

PubMed Central

Kunamneni, Adinarayana; Camarero, Susana; García-Burgos, Carlos; Plou, Francisco J; Ballesteros, Antonio; Alcalde, Miguel

2008-01-01

Laccases are multi-copper containing oxidases (EC 1.10.3.2), widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product) and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed. PMID:19019256

Gel-Based Purification and Biochemical Study of Laccase Isozymes from Ganoderma sp. and Its Role in Enhanced Cotton Callogenesis

PubMed Central

Kumar, Amit; Singh, Deepti; Sharma, Krishna K.; Arora, Sakshi; Singh, Amarjeet K.; Gill, Sarvajeet S.; Singhal, Barkha

2017-01-01

Basidiomycetous fungi, Ganoderma lucidum MDU-7 and Ganoderma sp. kk-02 secreted multiple laccase isozymes under diverse growth condition. Aromatic compounds and metal salts were also found to regulate the differential expression of laccase isozymes from both the Ganoderma sp. Laccase isozymes induced in the presence of copper from G. lucidum MDU-7 were purified by gel-based (native-PAGE) purification method. The purity of laccase isozymes was checked by zymogram and SDS-PAGE. The SDS-PAGE of purified proteins confirmed the multimeric nature of laccase isozymes. The molecular mass of isozymes was found to be in the range of 40–66 kDa. Further, the purified laccase isozymes and their peptides were confirmed with the help of MALDI-TOF peptide fingerprinting. The biochemical characterization of laccase isozymes viz. Glac L2, Glac L3, Glac L4, and Glac L5 have shown the optimum temperature in the range of 30°–45°C and pH 3.0. The Km values of all the laccase isozymes determined for guaiacol were (96–281 μM), ABTS (15–83 μM) and O-tolidine (78–724 μM). Further, laccase isozymes from G. lucidum whole genome were studied using bioinformatics tools. The molecular modeling and docking of laccase isozymes with different substrates showed a significant binding affinity, which further validates our experimental results. Interestingly, copper induced laccase of 40 U/ml in culture medium was found to significantly induce cotton callogenesis. Interestingly, all the laccase isozymes were found to have an antioxidative role and therefore capable in free radicals scavenging during callogenesis. This is the first detailed study on the biochemical characterization of all the laccase isozymes purified by a gel-based novel method. PMID:28473815

Complete biodegradation of chlorpyrifos by engineered Pseudomonas putida cells expressing surface-immobilized laccases.

PubMed

Liu, Jin; Tan, Luming; Wang, Jing; Wang, Zhiyong; Ni, Hong; Li, Lin

2016-08-01

The long-term abuse use of chlorpyrifos-like pesticides in agriculture and horticulture has resulted in significant soil or water contamination and a worldwide ecosystem threat. In this study, the ability of a solvent-tolerant bacterium, Pseudomonas putida MB285, with surface-displayed bacterial laccase, to biodegrade chlorpyrifos was investigated. The results of compositional analyses of the degraded products demonstrate that the engineered MB285 was capable of completely eliminating chlorpyrifos via direct biodegradation, as determined by high-performance liquid chromatography and gas chromatography-mass spectrometry assays. Two intermediate metabolites, namely 3,5,6-trichloro-2-pyridinol (TCP) and diethyl phosphate, were temporarily detectable, verifying the joint and stepwise degradation of chlorpyrifos by surface laccases and certain cellular enzymes, whereas the purified free laccase incompletely degraded chlorpyrifos into TCP. The degradation reaction can be conducted over a wide range of pH values (2-7) and temperatures (5-55 °C) without the need for Cu(2+). Bioassays using Caenorhabditis elegans as an indicator organism demonstrated that the medium was completely detoxified of chlorpyrifos by degradation. Moreover, the engineered cells exhibited a high capacity of repeated degradation and good performance in continuous degradation cycles, as well as a high capacity to degrade real effluents containing chlorpyrifos. Therefore, the developed system exhibited a high degradation capacity and performance and constitutes an improved approach to address chlorpyrifos contamination in chlorpyrifos-remediation practice. Copyright © 2016 Elsevier Ltd. All rights reserved.

Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

PubMed Central

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Synthesis of novel laccase-biotitania biocatalysts for malachite green decolorization.

PubMed

Zhang, Xinying; Wang, Meiyin; Lin, Linlin; Xiao, Gao; Tang, Zhenping; Zhu, Xuefeng

2018-07-01

Biomimetic mineralization has emerged as a novel tool for generating excellent supports for enzyme stabilization. In this work, protamine was used to induce titanium (IV) bis(ammonium lactato) dihydroxide (Ti-BALDH) into titania nanoparticles. This biomimetic titanification process was adopted for laccase immobilization. Laccase-biotitania biocatalyst was prepared and the effect of different parameters (buffer solution, titania precursor concentration, protamine concentration, and enzyme loading) on the encapsulation efficiency and recovery of laccase were evaluated. Compared with free laccase, the thermal and pH stability of immobilized laccase were improved significantly. In addition, laccase loaded on titania was effective at enhancing its storage stability. After seven consecutive cycles, the immobilized laccase still retained 51% of its original activity. Finally, laccase-biotitania biocatalysts showed good performance on decolorization of malachite green (MG), which can be attributed to an adsorption and degradation effect. The intermediates of the MG degradation were identified by gas chromatography-mass spectrometry (GC-MS) analysis, and the most probable degradation pathway was proposed. This study provides deeper understanding of the laccase-biotitania particles as a fast biocatalyst for MG decolorization. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Biochemical characterization and molecular evidence of a laccase from the bird's nest fungus Cyathus bulleri.

PubMed

Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander

2005-08-01

Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity.

Production of laccase by Coriolus versicolor and its application in decolorization of dyestuffs: (I). Production of laccase by batch and repeated-batch processes.

PubMed

Lin, Jian-Ping; Wei, Lian; Xia, Li-Ming; Cen, Pei-Lin

2003-01-01

The production of laccase by Coriolus versicolor was studied. The effect of cultivation conditions on laccase production by Coriolus versicolor was examined to obtain optimal medium and cultivation conditions. Both batch and repeated-batch processes were performed for laccase production. In repeated-batch fermentation with self-immobilized mycelia, total of 14 cycles were performed with laccase activity in the range between 3.4 and 14.8 U/ml.

Engineering laccases: in search for novel catalysts.

PubMed

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-04-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases.

Engineering Laccases: In Search for Novel Catalysts

PubMed Central

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-01-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases. PMID:21966250

Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

2007-12-01

The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

Fungal Laccases and Their Applications in Bioremediation

PubMed Central

Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

2014-01-01

Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

Disruption of LACCASE4 and 17 Results in Tissue-Specific Alterations to Lignification of Arabidopsis thaliana Stems[W

PubMed Central

Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise

2011-01-01

Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation

PubMed Central

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-01-01

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0–6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation. PMID:27775052

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation.

PubMed

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-10-24

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0-6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation.

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation

NASA Astrophysics Data System (ADS)

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-10-01

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0-6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation.

Production of Laccase by Recombinant Yarrowia lipolytica from Molasses: Bioprocess Development Using Statistical Modeling and Increase Productivity in Shake-Flask and Bioreactor Cultures.

PubMed

Darvishi, Farshad; Moradi, Marzieh; Madzak, Catherine; Jolivalt, Claude

2017-03-01

Laccases are used in numerous applications, from green degradation of various xenobiotic compounds, waste detoxification, textile dye bleaching, and delignification of lignocellulose materials to biofuel production. In this study, the recombinant Yarrowia lipolytica YL4 strain carrying the white-rot fungus Trametes versicolor laccase IIIb gene was used for laccase production from beet molasses as an agro-industrial residue. Response surface methodology was used to statistical optimization of the production of laccase by Y. lipolytica using an industrial medium containing molasses which allows a six times increase in laccase activity compared to primary medium contains glucose after 144 h. In bioreactor cultivation after 48 h, laccase production reached to 3.7- and 22.5-fold more than optimized and primary media in shake-flask cultures, respectively. Laccase productivity in bioreactor (0.0937 U/h) was higher than shake-flask culture (0.0084 U/h). The present study provides valuable information about statistical optimization of bioprocess development for cost-effective production of laccase and other heterologous proteins in Y. lipolytica from beet molasses as sole carbon source, thus allowing the valorization and decreasing environmental pollution of this agro-industrial waste.

Lignin oxidation and pulp delignification by laccase and mediators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bourbonnais, R.; Paice, M.G.; Reid, I.D.

1996-10-01

The phenol oxidizing enzyme laccase is produced abundantly by the lignin-degrading fungus Trametes versicolor. We found previously that laccase can oxidize veratryl alcohol and other non-phenolic lignin model compounds when a mediator such as 2,2{prime}-azinobis(3-ethylbenzthiazoline-5-sulphonate) (ABTS) was present. The laccase/mediator couple was also shown to be effective for delignification of kraft pulps. Two different isozymes of laccase produced by this fungus were purified and their reactivities towards lignins and kraft pulps were studied. The mediator ABTS was shown to be essential for pulp delignification and to reverse the polymerization of kraft lignin by either laccase. Pulp delignification with laccase andmore » ABTS was also optimized. resulting in up to 55% lignin removal from kraft pulp following sequential enzyme treatments and alkaline extractions. Several variables were surveyed including enzyme and mediator dosage, oxygen pressure, temperature, reaction time, and pH.« less

Knockdown of a laccase in Populus deltoides confers altered cell wall chemistry and increased sugar release

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bryan, Anthony C.; Jawdy, Sara; Gunter, Lee

Plant laccases are thought to function in the oxidation of monolignols which leads to higher order lignin formation. Only a hand-full of laccases in plants have been functionally evaluated and as such little is known about the breadth of their impact on cell wall chemistry or structure. Here we describe a previously uncharacterized laccase from Populus, encoded by locus Potri.008G06400, whose reduced expression resulted in transgenic Populus trees with changes in syringyl/guaiacyl (S/G) ratios as well as altered sugar release phenotypes. These phenotypes are consistent with plant biomass exhibiting reduced recalcitrance. Interestingly, the transgene effect on recalcitrance is dependent onmore » a mild pretreatment prior to chemical extraction of sugars. Metabolite profiling suggests the transgene modulates phenolics that are associated with the cell wall structure. Finally, we propose a model in which this particular laccase has a range of functions related to oxidation of phenolics that interact with lignin in the cell wall.« less

Knockdown of a laccase in Populus deltoides confers altered cell wall chemistry and increased sugar release

DOE PAGES

Bryan, Anthony C.; Jawdy, Sara; Gunter, Lee; ...

2016-04-15

Plant laccases are thought to function in the oxidation of monolignols which leads to higher order lignin formation. Only a hand-full of laccases in plants have been functionally evaluated and as such little is known about the breadth of their impact on cell wall chemistry or structure. Here we describe a previously uncharacterized laccase from Populus, encoded by locus Potri.008G06400, whose reduced expression resulted in transgenic Populus trees with changes in syringyl/guaiacyl (S/G) ratios as well as altered sugar release phenotypes. These phenotypes are consistent with plant biomass exhibiting reduced recalcitrance. Interestingly, the transgene effect on recalcitrance is dependent onmore » a mild pretreatment prior to chemical extraction of sugars. Metabolite profiling suggests the transgene modulates phenolics that are associated with the cell wall structure. Finally, we propose a model in which this particular laccase has a range of functions related to oxidation of phenolics that interact with lignin in the cell wall.« less

Changes is genes coding for laccases 1 and 2 may contribute to deformation and reduction of wings in apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) from the isolated population in Pieniny National Park (Poland).

PubMed

Łukasiewicz, Kinga; Węgrzyn, Grzegorz

2016-01-01

An isolated population of apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) occurs in Pieniny National Park (Poland). Deformations and reductions of wings in a relatively large number of individuals from this population is found, yet the reasons for these defects are unknown. During studies devoted to identify cause(s) of this phenomenon, we found that specific regions of genes coding of enzymes laccases 1 and 2 could not be amplified from DNA samples isolated from large fractions of malformed insects while expected PCR products were detected in almost all (with one exception) normal butterflies. Laccases (p-diphenol:dioxygen oxidoreductases) are oxidases containing several copper atoms. They catalyse single-electron oxidations of phenolic or other compounds with concomitant reduction of oxygen to water. In insects, their enzymatic activities were found previously in epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Therefore, we suggest that defects in genes coding for laccases might contribute to deformation and reduction of wings in apollo butterflies, though it seems obvious that deficiency in these enzymes could not be the sole cause of these developmental improperties in P. apollo from Pieniny National Park.

Roles of small laccases from Streptomyces in lignin degradation.

PubMed

Majumdar, Sudipta; Lukk, Tiit; Solbiati, Jose O; Bauer, Stefan; Nair, Satish K; Cronan, John E; Gerlt, John A

2014-06-24

Laccases (EC 1.10.3.2) are multicopper oxidases that can oxidize a range of substrates, including phenols, aromatic amines, and nonphenolic substrates. To investigate the involvement of the small Streptomyces laccases in lignin degradation, we generated acid-precipitable polymeric lignin obtained in the presence of wild-type Streptomyces coelicolor A3(2) (SCWT) and its laccase-less mutant (SCΔLAC) in the presence of Miscanthus x giganteus lignocellulose. The results showed that strain SCΔLAC was inefficient in degrading lignin compared to strain SCWT, thereby supporting the importance of laccase for lignin degradation by S. coelicolor A3(2). We also studied the lignin degradation activity of laccases from S. coelicolor A3(2), Streptomyces lividans TK24, Streptomyces viridosporus T7A, and Amycolatopsis sp. 75iv2 using both lignin model compounds and ethanosolv lignin. All four laccases degraded a phenolic model compound (LM-OH) but were able to oxidize a nonphenolic model compound only in the presence of redox mediators. Their activities are highest at pH 8.0 with a low krel/Kapp for LM-OH, suggesting that the enzymes’ natural substrates must be different in shape or chemical nature. Crystal structures of the laccases from S. viridosporus T7A (SVLAC) and Amycolatopsis sp. 75iv2 were determined both with and without bound substrate. This is the first report of a crystal structure for any laccase bound to a nonphenolic β-O-4 lignin model compound. An additional zinc metal binding site in SVLAC was also identified. The ability to oxidize and/or rearrange ethanosolv lignin provides further evidence of the utility of laccase activity for lignin degradation and/or modification.

Optimization of laccase production by Pleurotus ostreatus IMI 395545 using the Taguchi DOE methodology.

PubMed

Periasamy, Rathinasamy; Palvannan, Thayumanavan

2010-12-01

Production of laccase using a submerged culture of Pleurotus orstreatus IMI 395545 was optimized by the Taguchi orthogonal array (OA) design of experiments (DOE) methodology. This approach facilitates the study of the interactions of a large number of variables spanned by factors and their settings, with a small number of experiments, leading to considerable savings in time and cost for process optimization. This methodology optimizes the number of impact factors and enables to calculate their interaction in the production of industrial enzymes. Eight factors, viz. glucose, yeast extract, malt extract, inoculum, mineral solution, inducer (1 mM CuSO₄) and amino acid (l-asparagine) at three levels and pH at two levels, with an OA layout of L18 (2¹ × 3⁷) were selected for the proposed experimental design. The laccase yield obtained from the 18 sets of fermentation experiments performed with the selected factors and levels was further processed with Qualitek-4 software. The optimized conditions shared an enhanced laccase expression of 86.8% (from 485.0 to 906.3 U). The combination of factors was further validated for laccase production and reactive blue 221 decolorization. The results revealed an enhanced laccase yield of 32.6% and dye decolorization up to 84.6%. This methodology allows the complete evaluation of main and interaction factors. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Uses of Laccases in the Food Industry

PubMed Central

Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana

2010-01-01

Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873

A novel Laccase Biosensor based on Laccase immobilized Graphene-Cellulose Microfiber Composite modified Screen-Printed Carbon Electrode for Sensitive Determination of Catechol

PubMed Central

Palanisamy, Selvakumar; Ramaraj, Sayee Kannan; Chen, Shen-Ming; Yang, Thomas C. K.; Yi-Fan, Pan; Chen, Tse-Wei; Velusamy, Vijayalakshmi; Selvam, Sonadevi

2017-01-01

In the present work, we demonstrate the fabrication of laccase biosensor to detect the catechol (CC) using laccase immobilized on graphene-cellulose microfibers (GR-CMF) composite modified screen printed carbon electrode (SPCE). The direct electrochemical behavior of laccase was investigated using laccase immobilized different modified SPCEs, such as GR/SPCE, CMF/SPCE and GR-CMF/SPCE. Compared with laccase immobilized GR and CMF modified SPCEs, a well-defined redox couple of CuI/CuII for laccase was observed at laccase immobilized GR-CMF composite modified SPCE. Cyclic voltammetry results show that the as-prepared biosensor has 7 folds higher catalytic activity with lower oxidation potential towards CC than SPCE modified with GR-CMF composite. Under optimized conditions, amperometric i-t method was used for the quantification of CC, and the amperometric response of the biosensor was linear over the concertation of CC ranging from 0.2 to 209.7 μM. The sensitivity, response time and the detection limit of the biosensor for CC is 0.932 μMμA−1 cm−2, 2 s and 0.085 μM, respectively. The biosensor has high selectivity towards CC in the presence of potentially active biomolecules and phenolic compounds. The biosensor also accessed for the detection of CC in different water samples and shows good practicality with an appropriate repea. PMID:28117357

[Enhancement of laccase activity by combining white rot fungal strains].

PubMed

He, Rong-yu; Liu, Xiao-feng; Yan, Zhi-ying; Yuan, Yue-xiang; Liao, Yin-zhang; Li, Xu-dong

2010-02-01

The method of combining white rot fungal strains was used to enhance laccase activity, and the interaction mechanism between strains was also studied. The laccase activity of combined fungi of strain 55 (Trametes trogii) and strain m-6 (Trametes versicolor) were 24.13 and 4.07-fold higher than that of strain 55 and strain m-6, respectively. No inhibitory effect was observed when the two strains were co-cultivated. On plate cultivation, there was hyphal interference in the contact area, where laccase activity was the highest followed by brown pigmentation. In liquid cultivation, strain m-6 played much more important role on enhancement of laccase activity, and the laccase activity of strain 55 by adding strain m-6 was 7.03-fold higher than that of strain m-6 by adding strain 55, furthermore, filter sterilized- and high temperature autoclaved-extracellular substances of strain m-6 could also stimulate strain 55 to excrete more laccase, which led to 6.79-fold and 4. 60-fold increase in laccase activity by adding 20 mL, respectively. The native staining results of Native-PAGE showed that the types of laccase isozymes were not changed when strains were co-cultured, but the concentration of three types increased.

Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal.

PubMed

Shrestha, Prabin; Joshi, Bishnu; Joshi, Jarina; Malla, Rajani; Sreerama, Lakshmaiah

2016-01-01

At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum -CDBT1 , Ganoderma japonicum, and Lentinula edodes , isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum -CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum -CDBT1. Presence of lignin (5 g/L) and copper sulfate (30  μ M) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum -CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m , V max , and K cat , determined using 2,2'-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110  μ M, 36  μ mol/min/mg, and 246 min -1 , respectively. The isolated thermostable laccase will be used in future experiments for delignification process.

Light-induced inhibition of laccase in Pycnoporus sanguineus.

PubMed

Hernández, Christian A; Perroni, Yareni; Pérez, José Antonio García; Rivera, Beatriz Gutiérrez; Alarcón, Enrique

2016-03-01

The aim was to determine which specific regions of the visible light spectrum were responsible for the induction or inhibition of laccase in Pycnoporus sanguineus. Cultures were exposed to various bandwidth lights: blue (460 nm), green (525 nm), white (a combination of 460 and 560 nm), red (660 nm), and darkness. The results indicate that short wavelengths strongly inhibit the production of laccase: green (3.76 ± 1.12 U/L), blue (1.94 ± 0.36 U/L), and white (1.05 ± 0.21 U/L) in proportions of 85.8, 92.6, and 96.0%, respectively; whereas long wavelengths inhibit laccase production only partially i.e., red light (14.05 ± 4.79 U/L) in a proportion of 46.8%. Maximum activity was induced in absence of visible light (30 °C, darkness), i.e., 30.76 ± 4.0 U/L. It is concluded that the production of laccase in P. sanguineus responds to light stimuli [measured as wavelengths and lx] and that it does so inversely. This can be explained as an ecological mechanism of environmental recognition, given that P. sanguineus develops inside lignocellulose structures in conditions of darkness. The presence of short wavelength light (460-510 nm) would indicate that the organism finds itself in an external environment, unprovided of lignin, and that it is therefore unnecessary to secrete laccase. This possible new regulation in the laccase production in P. sanguineus has important biotechnological implications, for it would be possible to control the production of laccase using light stimuli.

Removal of acetaminophen in water by laccase immobilized in barium alginate.

PubMed

Ratanapongleka, Karnika; Punbut, Supot

2018-02-01

This research has focused on the optimization of immobilized laccase condition and utilization in degradation of acetaminophen contaminated in aqueous solution. Laccase from Lentinus polychrous was immobilized in barium alginate. The effects of laccase immobilization such as sodium alginate concentration, barium chloride concentration and gelation time were studied. The optimal conditions for immobilization were sodium alginate 5% (w/v), barium chloride 5% (w/v) and gelation time of 60 min. Immobilized laccase was then used for acetaminophen removal. Acetaminophen was removed quickly in the first 50 min. The degradation rate and percentage of removal increased when the enzyme concentration increased. Immobilized laccase at 0.57 U/g-alginate showed the maximum removal at 94% in 240 min. The removal efficiency decreased with increasing initial acetaminophen concentration. The K m value for immobilized laccase (98.86 µM) was lower than that of free laccase (203.56 µM), indicating that substrate affinity was probably enhanced by immobilization. The immobilized enzyme exhibited high activity and good acetaminophen removal at pH 7 and temperature of 35°C. The activation energies of free and immobilized laccase for degradation of acetaminophen were 8.08 and 17.70 kJ/mol, respectively. It was also found that laccase stability to pH and temperature increased after immobilization. Furthermore, immobilized laccase could be reused for five cycles. The capability of removal and enzyme activity were retained above 70%.

Molecular dynamics simulation studies suggests unconventional roles of non-secretary laccases from enteropathogenic gut bacteria and Cryptococcus neoformans serotype D.

PubMed

Sharma, Krishna Kant; Singh, Deepti; Rawat, Surender

2018-04-01

Laccase in Cryptococcus neoformans is covalently linked to the carbohydrate moiety of the cell wall, which allows it to get access to the different substrates for catalyzing their oxidation and therefore plays a vital role in the virulence. The laccase gene (3.0 kb) from C. neoformans serotype D was amplified, cloned and sequenced for protein modeling, docking and simulation studies. The three dimensional homology models of laccase protein from C. neoformans and other pathogenic gut bacteria were docked with selected biomolecules like prostaglandins (PG), membrane phospholipids, neurotransmitters (serotonin) using GOLD software. The GOLDscore values of laccase from C. neoformans docked with prostaglandinH 2 (59.76), prostaglandinG 2 (59.45), prostaglandinE 2 (60.99), phosphatidylinositol (54.95), phosphatidylcholine (46.26), phosphatidylserine (55.26), arachidonic acid (53.08) and serotonin (46.22) were similar to the laccase from enteropathogenic bacteria but showed a better binding affinity as compared to that of the non-pathogenic bacteria (e.g. Bacillus safensis, Bacillus pumilus and Bacillus subtilis). The RMSD of MD simulation study done for 25 ns using laccase protein from C. neoformans complexed with phosphatidylcholine was found to be highly stable, followed by the laccase-PGE 2 and laccase-serotonin complexes. Furthermore, the binding free energy results were found to support the docking and MD simulation results. The present study implies that few candidate ligands can be intermediate substrate in the catalysis of microbial laccases, which can further play some crucial role in the cell signaling and pathogenesis of enteropathogenic gut micro flora and C. neoformans. Copyright © 2018 Elsevier Ltd. All rights reserved.

Exploiting the oxidizing capabilities of laccases exploiting the oxidizing capabilities of laccases for sustainable chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cannatelli, Mark D.

Part one of this dissertation research has focused on harnessing the ability of laccases to generate reactive para-quinones in situ from the corresponding hydroquinones, followed by reaction with a variety of nucleophiles to perform novel carbon-carbon, carbon-nitrogen, and carbon-sulfur bond forming reactions for the synthesis of new and existing compounds. In part two of this dissertation, the fundamental laccase-catalyzed coupling chemistry developed in part one was applied to functionalize the surface of kraft lignin.

Bacterial versus fungal laccase: potential for micropollutant degradation

PubMed Central

2013-01-01

Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal

PubMed Central

Joshi, Jarina; Malla, Rajani

2016-01-01

At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μM) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m, V max, and K cat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process. PMID:27822471

Reactivity of bacterial and fungal laccases with lignin under alkaline conditions.

PubMed

Moya, Raquel; Saastamoinen, Päivi; Hernández, Manuel; Suurnäkki, Anna; Arias, Enriqueta; Mattinen, Maija-Liisa

2011-11-01

The ability of Streptomyces ipomoea laccase to polymerize secoisolariciresinol lignan and technical lignins was assessed. The reactivity of S. ipomoea laccase was also compared to that of low redox fungal laccase from Melanocarpus albomyces using low molecular mass p-coumaric, ferulic and sinapic acid as well as natural (acetosyringone) and synthetic 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO) mediators as substrates. Oxygen consumption measurement, MALDI-TOF MS and SEC were used to follow the enzymatic reactions at pH 7, 8, 9 and 10 at 30°C and 50°C. Polymerization of lignins and lignan by S. ipomoea laccase under alkaline reaction conditions was observed, and was enhanced in the presence of acetosyringone almost to the level obtained with M. albomyces laccase without mediator. Reactivities of the enzymes towards acetosyringone and TEMPO were similar, suggesting exploitation of the compounds and low redox laccase in lignin valorization under alkaline conditions. The results have scientific impact on basic research of laccases. Copyright © 2011 Elsevier Ltd. All rights reserved.

Stabilized Laccases as Heterogeneous Bioelectrocatalysts (Postprint)

DTIC Science & Technology

2012-10-01

nature, with examples that range from bacterial species to fungi and plants.19·101 However, certain properties of laccases, such as their protein...identified, includ- ing examples of extremophilic enzymes,l11·121 but the extracellu- lar laccases from wood-rotting fungi , such as Trametes spp...biomolecules not only affects the stability and selectivity of an enzyme towards different substrates but also the charge trans- fer at the electrode

Substrate-Specific Differential Gene Expression and RNA editing in the Brown Rot Fungus Fomitopsis pinicola.

PubMed

Wu, Baojun; Gaskell, Jill; Held, Benjamin W; Toapanta, Cristina; Vuong, Thu; Ahrendt, Steven; Lipzen, Anna; Zhang, Jiwei; Schilling, Jonathan S; Master, Emma; Grigoriev, Igor V; Blanchette, Robert A; Cullen, Dan; Hibbett, David S

2018-06-08

Wood-decaying fungi tend to have characteristic substrate ranges that partly define their ecological niche. Fomitopsis pinicola is a brown rot species of Polyporales that is reported on 82 species of softwoods and 42 species of hardwoods. We analyzed gene expression levels and RNA editing profiles of F. pinicola from submerged cultures with ground wood powder (sampled at five days) or solid wood wafers (sampled at ten and thirty days), using aspen, pine, and spruce substrates (aspen was used only in submerged cultures). Fomitopsis pinicola expressed similar sets of wood-degrading enzymes typical of brown rot fungi across all culture conditions and timepoints. Nevertheless, differential gene expression and RNA editing were observed across all pairwise comparisons of substrates and timepoints. Genes exhibiting differential expression and RNA editing encode diverse enzymes with known or potential function in brown rot decay, including laccase, benzoquinone reductase, aryl alcohol oxidase, cytochrome P450s, and various glycoside hydrolases. There was no overlap between differentially expressed and differentially edited genes, suggesting that these may provide F. pinicola with independent mechanisms for responding to different conditions. Comparing transcriptomes from submerged cultures and wood wafers, we found that culture conditions had a greater impact on global expression profiles than substrate wood species. In contrast, the suites of genes subject to RNA editing were much less affected by culture conditions. These findings highlight the need for standardization of culture conditions in studies of gene expression in wood-decaying fungi. IMPORTANCE All species of wood-decaying fungi occur on a characteristic range of substrates (host plants), which may be broad or narrow. Understanding the mechanisms that allow fungi to grow on particular substrates is important for both fungal ecology and applied uses of different feedstocks in industrial processes. We grew the

Induction of laccases in Trametes versicolor by aqueous wood extracts.

PubMed

Bertrand, Brandt; Martínez-Morales, Fernando; Tinoco, Raunel; Rojas-Trejo, Sonia; Serrano-Carreón, Leobardo; Trejo-Hernández, María R

2014-01-01

The induction of laccase isoforms in Trametes versicolor HEMIM-9 by aqueous extracts (AE) from softwood and hardwood was studied. Samples of sawdust of Pinus sp., Cedrela sp., and Quercus sp. were boiled in water to obtain AE. Different volumes of each AE were added to fungal cultures to determine the amount of AE needed for the induction experiments. Laccase activity was assayed every 24 h for 15 days. The addition of each AE (50 to 150 μl) to the fungal cultures increased laccase production compared to the control (0.42 ± 0.01 U ml(-1)). The highest laccase activities detected were 1.92 ± 0.15 U ml(-1) (pine), 1.87 ± 0.26 U ml(-1) (cedar), and 1.56 ± 0.34 U ml(-1) (oak); laccase productivities were also significantly increased. Larger volumes of any AE inhibited mycelial growth. Electrophoretic analysis revealed two laccase bands (lcc1 and lcc2) for all the treatments. However, when lcc2 was analyzed by isoelectric focusing, inducer-dependent isoform patterns composed of three (pine AE), four (oak AE), and six laccase bands (cedar AE) were observed. Thus, AE from softwood and hardwood had induction effects in T. versicolor HEMIM-9, as indicated by the increase in laccase activity and different isoform patterns. All of the enzymatic extracts were able to decolorize the dye Orange II. Dye decolorization was mainly influenced by pH. The optimum pH for decolorization was pH 5 (85%), followed by pH 7 (50%) and pH 3 (15%). No significant differences in the dye decolorizing capacity were detected between the control and the differentially induced laccase extracts (oak, pine and cedar). This could be due to the catalytic activities of isoforms with pI 5.4 and 5.8, which were detected under all induction conditions.

Validation of reference genes aiming accurate normalization of qRT-PCR data in Dendrocalamus latiflorus Munro.

PubMed

Liu, Mingying; Jiang, Jing; Han, Xiaojiao; Qiao, Guirong; Zhuo, Renying

2014-01-01

Dendrocalamus latiflorus Munro distributes widely in subtropical areas and plays vital roles as valuable natural resources. The transcriptome sequencing for D. latiflorus Munro has been performed and numerous genes especially those predicted to be unique to D. latiflorus Munro were revealed. qRT-PCR has become a feasible approach to uncover gene expression profiling, and the accuracy and reliability of the results obtained depends upon the proper selection of stable reference genes for accurate normalization. Therefore, a set of suitable internal controls should be validated for D. latiflorus Munro. In this report, twelve candidate reference genes were selected and the assessment of gene expression stability was performed in ten tissue samples and four leaf samples from seedlings and anther-regenerated plants of different ploidy. The PCR amplification efficiency was estimated, and the candidate genes were ranked according to their expression stability using three software packages: geNorm, NormFinder and Bestkeeper. GAPDH and EF1α were characterized to be the most stable genes among different tissues or in all the sample pools, while CYP showed low expression stability. RPL3 had the optimal performance among four leaf samples. The application of verified reference genes was illustrated by analyzing ferritin and laccase expression profiles among different experimental sets. The analysis revealed the biological variation in ferritin and laccase transcript expression among the tissues studied and the individual plants. geNorm, NormFinder, and BestKeeper analyses recommended different suitable reference gene(s) for normalization according to the experimental sets. GAPDH and EF1α had the highest expression stability across different tissues and RPL3 for the other sample set. This study emphasizes the importance of validating superior reference genes for qRT-PCR analysis to accurately normalize gene expression of D. latiflorus Munro.

Recent developments and applications of immobilized laccase.

PubMed

Fernández-Fernández, María; Sanromán, M Ángeles; Moldes, Diego

2013-12-01

Laccase is a promising biocatalyst with many possible applications, including bioremediation, chemical synthesis, biobleaching of paper pulp, biosensing, textile finishing and wine stabilization. The immobilization of enzymes offers several improvements for enzyme applications because the storage and operational stabilities are frequently enhanced. Moreover, the reusability of immobilized enzymes represents a great advantage compared with free enzymes. In this work, we discuss the different methodologies of enzyme immobilization that have been reported for laccases, such as adsorption, entrapment, encapsulation, covalent binding and self-immobilization. The applications of laccase immobilized by the aforementioned methodologies are presented, paying special attention to recent approaches regarding environmental applications and electrobiochemistry. Copyright © 2012 Elsevier Inc. All rights reserved.

Genes associated with lignin degradation in the polyphagous white-rot pathogen Heterobasidion irregulare show substrate-specific regulation.

PubMed

Yakovlev, Igor A; Hietala, Ari M; Courty, Pierre-Emmanuel; Lundell, Taina; Solheim, Halvor; Fossdal, Carl Gunnar

2013-07-01

The pathogenic white-rot basidiomycete Heterobasidion irregulare is able to remove lignin and hemicellulose prior to cellulose during the colonization of root and stem xylem of conifer and broadleaf trees. We identified and followed the regulation of expression of genes belonging to families encoding ligninolytic enzymes. In comparison with typical white-rot fungi, the H. irregulare genome has exclusively the short-manganese peroxidase type encoding genes (6 short-MnPs) and thereby a slight contraction in the pool of class II heme-containing peroxidases, but an expansion of the MCO laccases with 17 gene models. Furthermore, the genome shows a versatile set of other oxidoreductase genes putatively involved in lignin oxidation and conversion, including 5 glyoxal oxidases, 19 quinone-oxidoreductases and 12 aryl-alcohol oxidases. Their genetic multiplicity and gene-specific regulation patterns on cultures based on defined lignin, cellulose or Norway spruce lignocellulose substrates suggest divergent specificities and physiological roles for these enzymes. While the short-MnP encoding genes showed similar transcript levels upon fungal growth on heartwood and reaction zone (RZ), a xylem defense tissue rich in phenolic compounds unique to trees, a subset of laccases showed higher gene expression in the RZ cultures. In contrast, other oxidoreductases depending on initial MnP activity showed generally lower transcript levels on RZ than on heartwood. These data suggest that the rate of fungal oxidative conversion of xylem lignin differs between spruce RZ and heartwood. It is conceivable that in RZ part of the oxidoreductase activities of laccases are related to the detoxification of phenolic compounds involved in host-defense. Expression of the several short-MnP enzymes indicated an important role for these enzymes in effective delignification of wood by H. irregulare. Copyright © 2013 Elsevier Inc. All rights reserved.

Laccase-mediator catalyzed conversion of model lignin compounds

USDA-ARS?s Scientific Manuscript database

Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.

PubMed

Wang, J W; Wu, J H; Huang, W Y; Tan, R X

2006-03-01

The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.

TRANSPARENT TESTA10 Encodes a Laccase-Like Enzyme Involved in Oxidative Polymerization of Flavonoids in Arabidopsis Seed CoatW⃞

PubMed Central

Pourcel, Lucille; Routaboul, Jean-Marc; Kerhoas, Lucien; Caboche, Michel; Lepiniec, Loïc; Debeaujon, Isabelle

2005-01-01

The Arabidopsis thaliana transparent testa10 (tt10) mutant exhibits a delay in developmentally determined browning of the seed coat, also called the testa. Seed coat browning is caused by the oxidation of flavonoids, particularly proanthocyanidins, which are polymers of flavan-3-ol subunits such as epicatechin and catechin. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Moreover, intact testa cells of tt10 cannot trigger H2O2-independent browning in the presence of epicatechin and catechin, in contrast with wild-type cells. UV–visible light detection and mass spectrometry revealed that the major oxidation products obtained with epicatechin alone are yellow dimers called dehydrodiepicatechin A. These products differ from proanthocyanidins in the nature and position of their interflavan linkages. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. We identified the TT10 gene by a candidate gene approach. TT10 encodes a protein with strong similarity to laccase-like polyphenol oxidases. It is expressed essentially in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Together, these data establish that TT10 is involved in the oxidative polymerization of flavonoids and functions as a laccase-type flavonoid oxidase. PMID:16243908

Laccase-mediator catalyzed conversion of model lignin compounds

USDA-ARS?s Scientific Manuscript database

Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...

Combined sequence and structure analysis of the fungal laccase family.

PubMed

Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P

2003-08-20

Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal

De novo transcriptome assembly and quantification reveal differentially expressed genes between soft-seed and hard-seed pomegranate (Punica granatum L.).

PubMed

Xue, Hui; Cao, Shangyin; Li, Haoxian; Zhang, Jie; Niu, Juan; Chen, Lina; Zhang, Fuhong; Zhao, Diguang

2017-01-01

Pomegranate (Punica granatum L.) belongs to Punicaceae, and is valued for its social, ecological, economic, and aesthetic values, as well as more recently for its health benefits. The 'Tunisia' variety has softer seeds and big arils that are easily swallowed. It is a widely popular fruit; however, the molecular mechanisms of the formation of hard and soft seeds is not yet clear. We conducted a de novo assembly of the seed transcriptome in P. granatum L. and revealed differential gene expression between the soft-seed and hard-seed pomegranate varieties. A total of 35.1 Gb of data were acquired in this study, including 280,881,106 raw reads. Additionally, de novo transcriptome assembly generated 132,287 transcripts and 105,743 representative unigenes; approximately 13,805 unigenes (37.7%) were longer than 1,000 bp. Using bioinformatics annotation libraries, a total of 76,806 unigenes were annotated and, among the high-quality reads, 72.63% had at least one significant match to an existing gene model. Gene expression and differentially expressed genes were analyzed. The seed formation of the two pomegranate cultivars involves lignin biosynthesis and metabolism, including some genes encoding laccase and peroxidase, WRKY, MYB, and NAC transcription factors. In the hard-seed pomegranate, lignin-related genes and cellulose synthesis-related genes were highly expressed; in soft-seed pomegranates, expression of genes related to flavonoids and programmed cell death was slightly higher. We validated selection of the identified genes using qRT-PCR. This is the first transcriptome analysis of P. granatum L. This transcription sequencing greatly enriched the pomegranate molecular database, and the high-quality SSRs generated in this study will aid the gene cloning from pomegranate in the future. It provides important insights into the molecular mechanisms underlying the formation of soft seeds in pomegranate.

De novo transcriptome assembly and quantification reveal differentially expressed genes between soft-seed and hard-seed pomegranate (Punica granatum L.)

PubMed Central

Xue, Hui; Cao, Shangyin; Li, Haoxian; Zhang, Jie; Niu, Juan; Chen, Lina; Zhang, Fuhong; Zhao, Diguang

2017-01-01

Pomegranate (Punica granatum L.) belongs to Punicaceae, and is valued for its social, ecological, economic, and aesthetic values, as well as more recently for its health benefits. The ‘Tunisia’ variety has softer seeds and big arils that are easily swallowed. It is a widely popular fruit; however, the molecular mechanisms of the formation of hard and soft seeds is not yet clear. We conducted a de novo assembly of the seed transcriptome in P. granatum L. and revealed differential gene expression between the soft-seed and hard-seed pomegranate varieties. A total of 35.1 Gb of data were acquired in this study, including 280,881,106 raw reads. Additionally, de novo transcriptome assembly generated 132,287 transcripts and 105,743 representative unigenes; approximately 13,805 unigenes (37.7%) were longer than 1,000 bp. Using bioinformatics annotation libraries, a total of 76,806 unigenes were annotated and, among the high-quality reads, 72.63% had at least one significant match to an existing gene model. Gene expression and differentially expressed genes were analyzed. The seed formation of the two pomegranate cultivars involves lignin biosynthesis and metabolism, including some genes encoding laccase and peroxidase, WRKY, MYB, and NAC transcription factors. In the hard-seed pomegranate, lignin-related genes and cellulose synthesis-related genes were highly expressed; in soft-seed pomegranates, expression of genes related to flavonoids and programmed cell death was slightly higher. We validated selection of the identified genes using qRT-PCR. This is the first transcriptome analysis of P. granatum L. This transcription sequencing greatly enriched the pomegranate molecular database, and the high-quality SSRs generated in this study will aid the gene cloning from pomegranate in the future. It provides important insights into the molecular mechanisms underlying the formation of soft seeds in pomegranate. PMID:28594931

Characterization of C-terminally engineered laccases.

PubMed

Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry

2014-08-01

Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (CΔ) and its 6 His tagged counterpart (CΔ6H) were found active enzymes. The production of CΔ6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of CΔ6H noted CΔ6Hh. Properties of CΔ, CΔ6H and CΔ6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in CΔ for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of CΔ6H and CΔ6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. Copyright © 2014 Elsevier B.V. All rights reserved.

FTIR Spectroscopy Applied in Remazol Blue Dye Oxidation by Laccases

NASA Astrophysics Data System (ADS)

Juárez-Hernández, J.; Zavala-Soto, M. E.; Bibbins-Martínez, M.; Delgado-Macuil, R.; Díaz-Godinez, G.; Rojas-López, M.

2008-04-01

We have used FTIR with attenuated total reflectance (ATR) technique to analyze the decolourization process of Remazol Blue dye (RB19) caused by the oxidative activity of laccase enzyme. It is known that laccases catalyze the oxidation of a large range of phenolic compounds and aromatic amines carrying out one-electron oxidations, although also radicals could be formed which undergo subsequent nonenzymatic reactions. The enzyme laccase is a copper-containing polyphenol oxidase (EC 1.10.3.2) which has been tested as a potential alternative in detoxification of environmental pollutants such as dyes present in wastewaters generated for the textile industry. In order to ensure degradation or avoid formation of toxic compounds it is important to establish the mechanism by which laccase oxidizes dyes. In this research individual ATR-FTIR spectra have been recorded for several reaction times between 0 to 236 hours, and the temporal dependence of the reaction was analyzed through the relative diminution of the intensity of the infrared band at 1127 cm-1 (associated to C-N vibration), with respect to the intensity of the band at 1104 cm-1 (associated to S = O) from sulphoxide group. Decolourization process of this dye by laccase could be attributed to its accessibility on the secondary amino group, which is a potential point of attack of laccases, abstracting the hydrogen atom. This decolourization process of remazol blue dye by laccase enzyme might in a future replace the traditionally high chemical, energy and water consuming textile operations.

A New Laccase Based Biosensor for Tartrazine.

PubMed

Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu

2017-12-09

Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM ( R ² = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis.

A New Laccase Based Biosensor for Tartrazine

PubMed Central

Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu

2017-01-01

Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM (R2 = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis. PMID:29232842

Redox Chemistry in Laccase-Catalyzed Oxidation of N-Hydroxy Compounds

PubMed Central

Xu, Feng; Kulys, Juozas J.; Duke, Kyle; Li, Kaichang; Krikstopaitis, Kastis; Deussen, Heinz-Josef W.; Abbate, Eric; Galinyte, Vilija; Schneider, Palle

2000-01-01

1-Hydroxybenzotriazole, violuric acid, and N-hydroxyacetanilide are three N-OH compounds capable of mediating a range of laccase-catalyzed biotransformations, such as paper pulp delignification and degradation of polycyclic hydrocarbons. The mechanism of their enzymatic oxidation was studied with seven fungal laccases. The oxidation had a bell-shaped pH-activity profile with an optimal pH ranging from 4 to 7. The oxidation rate was found to be dependent on the redox potential difference between the N-OH substrate and laccase. A laccase with a higher redox potential or an N-OH compound with a lower redox potential tended to have a higher oxidation rate. Similar to the enzymatic oxidation of phenols, phenoxazines, phenothiazines, and other redox-active compounds, an “outer-sphere” type of single-electron transfer from the substrate to laccase and proton release are speculated to be involved in the rate-limiting step for N-OH oxidation. PMID:10788380

Laccase-catalyzed synthesis of 2,3-ethylenedithio-1,4-quinones

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2015-06-05

Laccases (benzenediol:oxygen oxidoreductase EC 1.10.3.2) are part of a family of multicopper oxidases. These environmentally friendly enzymes require O 2 as their only co-substrate and produce H 2O as their sole by-product. As a result, they have acquired increasing use in biotechnological applications, particularly in the field of organic synthesis. In the current study, laccases have been employed to successfully couple 1,2-ethanedithiol to various substituted hydroquinones to produce novel 2,3-ethylenedithio-1,4-quinones in good yields via an oxidation–addition–oxidation–addition–oxidation mechanism. The reactions proceeded in one-pot under mild conditions (room temperature, pH 5.0). This study further supports the use of laccases as green toolsmore » in organic chemistry. Furthermore, it provides evidence that laccase-catalyzed cross-coupling reactions involving small thiols are possible, in spite of research that suggests small thiols are potent inhibitors of laccases.« less

Laccase pretreatment for agrofood wastes valorization.

PubMed

Giacobbe, Simona; Pezzella, Cinzia; Lettera, Vincenzo; Sannia, Giovanni; Piscitelli, Alessandra

2018-06-01

Apple pomace, potato peels, and coffee silverskin are attractive agrofood wastes for the production of biofuels and chemicals, due to their abundance and carbohydrate content. As lignocellulosic biomasses, their conversion is challenged by the presence of lignin that prevents hydrolysis of polysaccharides, hence demanding a pretreatment step. In this work, the effectiveness of Pleurotus ostreatus laccases (with and without mediator) to remove lignin, improving the subsequent saccharification, was assessed. Optimized conditions for sequential protocol were set up for all agrofood wastes reaching delignification and detoxification yields correlated with high saccharification. Especially noteworthy were results for apple pomace and coffee silverskin for which 83% of and 73% saccharification yields were observed, by using laccase and laccase mediator system, respectively. The herein developed sequential protocol, saving soluble sugars and reducing the amount of wastewater, can improve the overall process for obtaining chemicals or fuels from agrofood wastes. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Cloning and Expression of Laccase from Trametes versicolor in Saccharomyces cerevisiae using a Novel Vector System

USDA-ARS?s Scientific Manuscript database

The long-term goal of this research is to increase efficiency and decrease cost of ethanol fermentation of lignocellulosic feedstocks by combining pre-treatment using laccase enzyme and subsequent fermentation to ethanol through simultaneous saccharification and fermentation paradigms. The first st...

FARO server: Meta-analysis of gene expression by matching gene expression signatures to a compendium of public gene expression data.

PubMed

Manijak, Mieszko P; Nielsen, Henrik B

2011-06-11

Although, systematic analysis of gene annotation is a powerful tool for interpreting gene expression data, it sometimes is blurred by incomplete gene annotation, missing expression response of key genes and secondary gene expression responses. These shortcomings may be partially circumvented by instead matching gene expression signatures to signatures of other experiments. To facilitate this we present the Functional Association Response by Overlap (FARO) server, that match input signatures to a compendium of 242 gene expression signatures, extracted from more than 1700 Arabidopsis microarray experiments. Hereby we present a publicly available tool for robust characterization of Arabidopsis gene expression experiments which can point to similar experimental factors in other experiments. The server is available at http://www.cbs.dtu.dk/services/faro/.

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composite for laccase immobilization

PubMed Central

Huang, Jun; Liu, Cheng; Xiao, Haiyan; Wang, Juntao; Jiang, Desheng; GU, Erdan

2007-01-01

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composites were prepared by organic-inorganic complex technology and characterized. It has been proved that the ZnTAPc dispersed randomly onto the surface of Fe3O4 nanoparticles to form molecular dispersion layer and there was a relatively strong bond between central zinc cation and oxygen. The nanoparticle composite took the shape of roundish spheres with the mean diameter of about 15 nm. Active amino groups of magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH for the activity of the immobilized laccases and free laccase were the same at pH 3.0 and the optimal temperature for laccase immobilization on ZnTAPc-Fe3O4 nanoparticle composite was 45°. The immobilization yields and Km value of the laccase immobilized on ZnTAPc-Fe3O4 nanoparticle composite were 25% and 20.1 μM, respectively. This kind of immobilized laccase has good thermal, storage and operation stability, and could be used as the sensing biocomponent for the fiber optic biosensor based on enzyme catalysis. PMID:18203444

Optimization of laccase production by Trametes versicolor cultivated on industrial waste.

PubMed

Tišma, Marina; Znidaršič-Plazl, Polona; Vasić-Rački, Durđa; Zelić, Bruno

2012-01-01

Laccases are very interesting biocatalysts for several industrial applications. Its production by different white-rot fungi can be stimulated by a variety of inducing substrates, and the use of lignocellulosic wastes or industrial by-products is one of the possible approaches to reduce production costs. In this work, various industrial wastes were tested for laccase production by Trametes versicolor MZKI G-99. Solid waste from chemomechanical treatment facility of a paper manufacturing plant showed the highest potential for laccase production. Enzyme production during submerged cultivation of T. versicolor on the chosen industrial waste has been further improved by medium optimization using genetic algorithm. Concentrations of five components in the medium were optimized within 60 shake-flasks experiments, where the highest laccase activity of 2,378 U dm(-3) was achieved. Waste from the paper industry containing microparticles of CaCO(3) was found to stimulate the formation of freely dispersed mycelium and laccase production during submerged cultivation of T. versicolor. It was proven to be a safe and inexpensive substrate for commercial production of laccase and might be more widely applicable for metabolite production by filamentous fungi.

Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications

PubMed Central

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

Laccase: microbial sources, production, purification, and potential biotechnological applications.

PubMed

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.

Ethidium bromide stimulated hyper laccase production from bird's nest fungus Cyathus bulleri.

PubMed

Dhawan, S; Lal, R; Kuhad, R C

2003-01-01

Effect of ethidium bromide, a DNA intercalating agent, on laccase production from Cyathus bulleri was studied. The bird's nest fungus, Cyathus bulleri was grown on 2% (w/v) malt extract agar (MEA) supplemented with 1.5 microg ml(-1) of the phenanthridine dye ethidium bromide (EtBr) for 7 d and when grown subsequently in malt extract broth (MEB), produced a 4.2-fold increase in laccase production as compared to the untreated fungus. The fungal cultures following a single EtBr treatment, when regrown on MEA devoid of EtBr, produced a sixfold increase in laccase in MEB. However, on subsequent culturing on MEA in the absence of EtBr, only a 2.5-fold increase in laccase production could be maintained. In another attempt, the initial EtBr-treated cultures, when subjected to a second EtBr treatment (1.5 microg ml(-1)) on MEA for 7 d, produced a 1.4-fold increase in laccase production in MEB. The white-rot fungus Cyathus bulleri, when treated with EtBr at a concentration of 1.5 microg ml(-1) and regrown on MEA devoid of EtBr, produced a sixfold increase in laccase production in MEB. The variable form of C. bulleri capable of hyper laccase production can improve the economic feasibility of environmentally benign processes involving use of fungal laccases in cosmetics (including hair dyes), food and beverages, clinical diagnostics, pulp and paper industry, industrial effluent treatment, animal biotechnology and biotransformations.

Neighboring Genes Show Correlated Evolution in Gene Expression

PubMed Central

Ghanbarian, Avazeh T.; Hurst, Laurence D.

2015-01-01

When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

Neighboring Genes Show Correlated Evolution in Gene Expression.

PubMed

Ghanbarian, Avazeh T; Hurst, Laurence D

2015-07-01

When considering the evolution of a gene's expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Laccases as palladium oxidases.

PubMed

Mekmouche, Yasmina; Schneider, Ludovic; Rousselot-Pailley, Pierre; Faure, Bruno; Simaan, A Jalila; Bochot, Constance; Réglier, Marius; Tron, Thierry

2015-02-01

The first example of a coupled catalytic system involving an enzyme and a palladium(ii) catalyst competent for the aerobic oxidation of alcohol in mild conditions is described. In the absence of dioxygen, the fungal laccase LAC3 is reduced by a palladium(0) species as evidenced by the UV/VIS and ESR spectra of the enzyme. During the oxidation of veratryl alcohol performed in water, at room temperature and atmospheric pressure, LAC3 regenerates the palladium catalyst, is reduced and catalyzes the four-electron reduction of dioxygen into water with no loss of enzyme activity. The association of a laccase with a water-soluble palladium complex results in a 7-fold increase in the catalytic efficiency of the complex. This is the first step in the design of a family of renewable palladium catalysts for aerobic oxidation.

Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.

PubMed

Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

2014-02-01

Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

Inactivation of Laccase by the Attack of As (III) Reaction in Water.

PubMed

Hu, Jinyuan; Lu, Kun; Dong, Shipeng; Huang, Qingguo; Mao, Liang

2018-03-06

Laccase is a multicopper oxidase containing four coppers as reaction sites, including one type 1, one type 2, and two type 3. We here provide the first experimental data showing that As (III) can be effectively removed from water and transformed to As (V) through reactions mediated by laccase with the presence of oxygen. To this end, the As (III) removal, As (V) yields, total protein, active laccase, and copper concentrations in the aqueous phase were determined, respectively. Additionally, electron paramagnetic resonance spectra and UV-vis spectra were applied to probe possible structural changes of the laccase during the reaction. The data offer the first evidence that laccase can be inactivated by As (III) attack thus leading to the release of type 2 copper. The released copper has no reactivity with the As (III). These findings provide new ideas into a significant pathway likely to master the environmental transformation of arsenite, and advance the understanding of laccase inactivation mechanisms, thus providing a foundation for optimization of enzyme-based processes and potential development for removal and remediation of arsenite contamination in the environment.

Influence of nutrients on enhancing laccase production by Botryosphaeria rhodina MAMB-05.

PubMed

Dekker, Robert F H; Barbosa, Aneli M; Giese, Ellen C; Godoy, Saulo D S; Covizzi, Luiz G

2007-09-01

The physiological requirements needed to enhance the production of laccases by the ascomycete Botryosphaeria rhodina MAMB-05 in submerged cultivation were examined under non-induced and induced (veratryl alcohol, VA) conditions. Under non-induced conditions (-VA), the initial pH, C:N ratio, and inorganic N source did not influence laccase production, in contrast to Tween 80, soybean oil, and copper, which significantly increased laccase production, and proline and urea, which suppressed laccase formation. In addition, Tween 60 could serve as the sole carbon source for the production of these enzymes. Under VA-induced conditions of fungal growth, factors such as inoculum type, time-point of addition of inducer, initial pH, C:N ratio, and type of N source, influenced the production of laccases; however, unlike the non-induced conditions, proline and urea did not act as suppressors. Each of these physiological conditions exerted different effects on biomass production. The nutritional conditions examined for B. rhodina MAMB-05 are discussed in relation to their influence on fungal growth and laccase production.

Immobilization of laccase of Pycnoporus sanguineus CS43.

PubMed

Gonzalez-Coronel, Luis A; Cobas, Marta; Rostro-Alanis, Magdalena de J; Parra-Saldívar, Roberto; Hernandez-Luna, Carlos; Pazos, Marta; Sanromán, M Ángeles

2017-10-25

Laccase from Pycnoporus sanguineus CS43 was successfully immobilized onto Immobead-150 and Eupergit-C by covalent binding and by entrapment in LentiKats. The highest immobilization was onto Immobead-150 (97.1±1.2%) compared to the other supports, LentiKats (89±1.1%) and Eupergit-C (83.2±1.4%). All three immobilized enzyme systems showed increased thermostability and better mechanical properties than free laccase. Moreover, after 5 cycles of reuse of these systems, 90% of initial laccase activity was retained. Immobead-150 and LentiKats systems exhibited the highest efficiencies in removal of m-cresol under the combined actions of biodegradation and adsorption, while laccase entrapped in LentiKats showed a high ability for degradation of m-cresol within 24h. In addition, the typical Michaelis-Menten enzymatic model effectively described the kinetic profile of m-cresol degradation by the enzyme entrapped in LentiKats. Based on the results obtained in the present study, it can be established that the immobilized biocatalysts developed here possess significant potential for wastewater treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Potential of acetylacetone as a mediator for Trametes versicolor laccase in enzymatic transformation of organic pollutants.

PubMed

Yang, Hua; Sun, Hongfei; Zhang, Shujuan; Wu, Bingdang; Pan, Bingcai

2015-07-01

Low-cost and environmentally friendly mediators could facilitate the application of laccase (EC 1.10.3.2) in variant biotechnological processes. Acetylacetone (AA) represents an inexpensive and low toxic small molecular diketone that has been proven as an effective mediator for laccase in free radical polymerization. However, the potential of AA as a mediator for laccase in pollutant detoxification and/or degradation is still unknown. In this work, the roles of AA in laccase-induced polymerization and transformation were investigated. AA was demonstrated to be a highly efficient mediator in the laccase-induced grafting copolymerization of acrylamide and chitosan. The efficacy of AA in the laccase-induced decoloration of malachite green (MG) was compared with that of the widely used 1-hydroxybenzotriazole (HBT). The laccase-AA system had the highest turnover number (TON, 39.1 μmol/U), followed by the laccase-only system (28.5 μmol/U), while the TON of the laccase-HBT system was the lowest (14.9 μmol/U). The pseudo-first-order transformation rate constant (k 1) of MG in the laccase-AA system was up to 0.283 h(-1) under the given conditions, while the k 1 of AA caused by laccase was only 0.008 h(-1). In the five-cycle run, the concentration of AA remained stable. The larger TON of the laccase-AA system and the stability of AA in the cycling runs demonstrate that AA was more recyclable than HBT in the LMS, leading to a prolonged serving life of laccase. These results suggest that AA might be a potential redox mediator for laccase.

Laccase-catalyzed oxidation of oxybenzone in municipal wastewater primary effluent.

PubMed

Garcia, Hector A; Hoffman, Catherine M; Kinney, Kerry A; Lawler, Desmond F

2011-02-01

Pharmaceuticals and personal care products (PPCPs) are now routinely detected in raw and treated municipal wastewater. Since conventional wastewater treatment processes are not particularly effective for PPCP removal, treated wastewater discharges are the main entry points for PPCPs into the environment, and eventually into our drinking water. This study investigates the use of laccase-catalyzed oxidation for removing low concentrations of PPCPs from municipal wastewater primary effluent. Oxybenzone was selected as a representative PPCP. Like many other PPCPs, it is not recognized directly by the laccase enzyme. Therefore, mediators were used to expand the oxidative range of laccase, and the efficacy of this laccase-mediator system in primary effluent was evaluated. Eight potential mediators were investigated, and 2,2'-Azino-bis(3-ethylbenzthiazoline-6sulphonic acid) diammonium salt (ABTS), a synthetic mediator, and acetosyringone (ACE), a natural mediator, provided the greatest oxybenzone removal efficiencies. An environmentally relevant concentration of oxybenzone (43.8 nM, 10 μg/L) in primary effluent was completely removed (below the detection limit) after two hours of treatment with ABTS, and 95% was removed after two hours of treatment with ACE. Several mediator/oxybenzone molar ratios were investigated at two different initial oxybenzone concentrations. Higher mediator/oxybenzone molar ratios were required at the lower (environmentally relevant) oxybenzone concentration, and ACE required higher molar ratios than ABTS to achieve comparable oxybenzone removal. Oxybenzone oxidation byproducts generated by the laccase-mediator system were characterized and compared to those generated during ozonation. Enzymatic treatment generated byproducts with higher mass to charge (m/z) ratios, likely due to oxidative coupling reactions. The results of this study suggest that, with further development, the laccase-mediator system has the potential to extend the treatment

CotA of Bacillus subtilis Is a Copper-Dependent Laccase

PubMed Central

Hullo, Marie-Françoise; Moszer, Ivan; Danchin, Antoine; Martin-Verstraete, Isabelle

2001-01-01

The spore coat protein CotA of Bacillus subtilis displays similarities with multicopper oxidases, including manganese oxidases and laccases. B. subtilis is able to oxidize manganese, but neither CotA nor other sporulation proteins are involved. We demonstrate that CotA is a laccase. Syringaldazine, a specific substrate of laccases, reacted with wild-type spores but not with ΔcotA spores. CotA may participate in the biosynthesis of the brown spore pigment, which appears to be a melanin-like product and to protect against UV light. PMID:11514528

Dehalogenation of Chlorinated Hydroxybiphenyls by Fungal Laccase

PubMed Central

Schultz, Asgard; Jonas, Ulrike; Hammer, Elke; Schauer, Frieder

2001-01-01

We have investigated the transformation of chlorinated hydroxybiphenyls by laccase produced by Pycnoporus cinnabarinus. The compounds used were transformed to sparingly water-soluble colored precipitates which were identified by gas chromatography-mass spectrometry as oligomerization products of the chlorinated hydroxybiphenyls. During oligomerization of 2-hydroxy-5-chlorobiphenyl and 3-chloro-4-hydroxybiphenyl, dechlorinated C—C-linked dimers were formed, demonstrating the dehalogenation ability of laccase. In addition to these nonhalogenated dimers, both monohalogenated and dihalogenated dimers were identified. PMID:11526052

Location of laccase in ordered mesoporous materials

NASA Astrophysics Data System (ADS)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.

2007-09-15

Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. Inmore » the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.« less

Role of laccase from Coriolus versicolor MTCC-138 in selective oxidation of aromatic methyl group.

PubMed

Chaurasia, Pankaj Kumar; Singh, Sunil Kumar; Bharati, Shashi Lata

2014-01-01

Now a day, laccases are the most promising enzymes in the area of biotechnology and synthesis. One of the best applications of laccases is the selective oxidation of aromatic methyl group to aldehyde group. Such transformations are valuable because it is difficult to stop the reaction at aldehyde stage. Chemical methods used for such biotransformations areexpensive and give poor yields. But, the laccase-catalyzed biotransformations of such type are non-expensive and yield is excellent. Authors have used crude laccase obtained from the liquid culture growth medium of fungal strain Coriolus versicolor MTCC-138 for the biotransformations of toluene, 3-nitrotoluene, and 4-chlorotoluene to benzaldehyde, 3-nitrobenzaldehyde, and 4-chlorobenzaldehyde, respectively, instead of purified laccase because purification process requires much time and cost. This communication reports that crude laccase can also be used in the place of purified laccase as effective biocatalyst.

Upgrading Laccase Production and Biochemical Properties: Strategies and Challenges.

PubMed

Bertrand, Brandt; Martínez-Morales, Fernando; Trejo-Hernández, María R

2017-07-01

Improving laccases continues to be crucial in novel biotechnological developments and industrial applications, where they are concerned. This review breaks down and explores the potential of the strategies (conventional and modern) that can be used for laccase enhancement (increased production and upgraded biochemical properties such as stability and catalytic efficiency). The challenges faced with these approaches are briefly discussed. We also shed light on how these strategies merge and give rise to new options and advances in this field of work. Additionally, this article seeks to serve as a guide for students and academic researchers interested in laccases. This document not only gives basic information on laccases, but also provides updated information on the state of the art of various technologies that are used in this line of investigation. It also gives the readers an idea of the areas extensively studied and the areas where there is still much left to be done. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1015-1034, 2017. © 2017 American Institute of Chemical Engineers.

Laccase/mediator assisted degradation of triarylmethane dyes in a continuous membrane reactor.

PubMed

Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

2009-08-10

Laccase/mediator systems are important bioremediation agents as the rates of reactions can be enhanced in the presence of the mediators. The decolorization mechanism of two triarylmethane dyes, namely, Basic Green 4 and Acid Violet 17 is reported using Cyathus bulleri laccase. Basic Green 4 was decolorized through N-demethylation by laccase alone, while in mediator assisted reactions, dye breakdown was initiated from oxidation of carbinol form of the dye. Benzaldehyde and N,N-dimethyl aniline were the major end products. With Acid Violet 17, laccase carried out N-deethylation and in mediator assisted reactions, oxidation of the carbinol form of the dye occurred resulting in formation of formyl benzene sulfonic acid, carboxy benzene sulfonic acid and benzene sulfonic acid. Toxicity analysis revealed that Basic Green 4 was toxic and treatment with laccase/mediators resulted in 80-100% detoxification. The treatment of the textile dye solution using laccase and 2,2'-azino-di-(-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was demonstrated in an enzyme membrane reactor. At a hydraulic retention time of 6h, the process was operated for a period of 15 days with nearly 95% decolorization, 10% reduction in flux and 70% recovery of active ABTS.

Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta

PubMed Central

Abadulla, Elias; Tzanov, Tzanko; Costa, Silgia; Robra, Karl-Heinz; Cavaco-Paulo, Artur; Gübitz, Georg M.

2000-01-01

Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC50) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (ΔE*) below 1.1 were measured for most dyes. PMID:10919791

Pycnoporus cinnabarinus laccases: an interesting tool for food or non-food applications.

PubMed

Georis, J; Lomascolo, A; Camarero, S; Dorgeo, V; Herpoël, I; Asther, M; Martinez, A T; Dauvrin, T

2003-01-01

The effects of the addition of ferulic acid and ethanol in P. cinnabarinus ss3 culture medium in fermentor were compared in 15-L fermentor. In the presence of 30 g l(-1) ethanol, laccase activity (270,000 U/L1) was 3-fold higher as compared with ferulic acid-induced cultures, and 150-fold higher as compared with non-induced cultures, respectively. High-quality flax pulp was bleached in a totally-chlorine free (TCF) sequence using a laccase-mediator system constituted by laccase from Pycnoporus cinnabarinus and 1-hydroxybenzotriazole (HBT) as mediator. Up to 90% delignification and strong brightness increase were attained after the laccase-mediator treatment followed by H2O2 bleaching. This TCF sequence was further improved by applying H2O2 under pressurized O2. In this way, up to 82% ISO brightness was obtained (compared with 37% in the initial pulp and 60% in the peroxide-bleached control) as well as very low kappa number. A positive evaluation of the laccase has been also performed in a food application. The colour of a tea-based beverage was significantly improved by incubating an infusion of green tea with the Pycnoporus laccase.

Location of laccase in ordered mesoporous materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Thermokinetic comparison of trypan blue decolorization by free laccase and fungal biomass.

PubMed

Razak, N N A; Annuar, M S M

2014-03-01

Free laccase and fungal biomass from white-rot fungi were compared in the thermokinetics study of the laccase-catalyzed decolorization of an azo dye, i.e., Trypan Blue. The decolorization in both systems followed a first-order kinetics. The apparent first-order rate constant, k1', value increases with temperature. Apparent activation energy of decolorization was similar for both systems at ∼ 22 kJ mol(-1), while energy for laccase inactivation was 18 kJ mol(-1). Although both systems were endothermic, fungal biomass showed higher enthalpy, entropy, and Gibbs free energy changes for the decolorization compared to free laccase. On the other hand, free laccase showed reaction spontaneity over a wider range of temperature (ΔT = 40 K) as opposed to fungal biomass (ΔT = 15 K). Comparison of entropy change (ΔS) values indicated metabolism of the dye by the biomass.

Media optimization for laccase production by Trichoderma harzianum ZF-2 using response surface methodology.

PubMed

Gao, Huiju; Chu, Xiang; Wang, Yanwen; Zhou, Fei; Zhao, Kai; Mu, Zhimei; Liu, Qingxin

2013-12-01

Trichoderma harzianum ZF-2 producing laccase was isolated from decaying samples from Shandong, China, and showed dye decolorization activities. The objective of this study was to optimize its culture conditions using a statistical analysis of its laccase production. The interactions between different fermentation parameters for laccase production were characterized using a Plackett-Burman design and the response surface methodology. The different media components were initially optimized using the conventional one-factor-at-a-time method and an orthogonal test design, and a Plackett-Burman experiment was then performed to evaluate the effects on laccase production. Wheat straw powder, soybean meal, and CuSO4 were all found to have a significant influence on laccase production, and the optimal concentrations of these three factors were then sequentially investigated using the response surface methodology with a central composite design. The resulting optimal medium components for laccase production were determined as follows: wheat straw powder 7.63 g/l, soybean meal 23.07 g/l, (NH4)2SO4 1 g/l, CuSO4 0.51 g/l, Tween-20 1 g/l, MgSO4 1 g/l, and KH2PO4 0.6 g/l. Using this optimized fermentation method, the yield of laccase was increased 59.68 times to 67.258 U/ml compared with the laccase production with an unoptimized medium. This is the first report on the statistical optimization of laccase production by Trichoderma harzianum ZF-2.

Laccase-catalyzed oxidation of iodide and formation of organically bound iodine in soils.

PubMed

Seki, Miharu; Oikawa, Jun-ichi; Taguchi, Taro; Ohnuki, Toshihiko; Muramatsu, Yasuyuki; Sakamoto, Kazunori; Amachi, Seigo

2013-01-02

Laccase oxidizes iodide to molecular iodine or hypoiodous acid, both of which are easily incorporated into natural soil organic matter. In this study, iodide sorption and laccase activity in 2 types of Japanese soil were determined under various experimental conditions to evaluate possible involvement of this enzyme in the sorption of iodide. Batch sorption experiment using radioactive iodide tracer ((125)I(-)) revealed that the sorption was significantly inhibited by autoclaving (121 °C, 40 min), heat treatment (80 and 100 °C, 10 min), γ-irradiation (30 kGy), N(2) gas flushing, and addition of reducing agents and general laccase inhibitors (KCN and NaN(3)). Interestingly, very similar tendency of inhibition was observed in soil laccase activity, which was determined using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a substrate. The partition coefficient (K(d): mL g(-1)) for iodide and specific activity of laccase in soils (Unit g(-1)) showed significant positive correlation in both soil samples. Addition of a bacterial laccase with an iodide-oxidizing activity to the soils strongly enhanced the sorption of iodide. Furthermore, the enzyme addition partially restored iodide sorption capacity of the autoclaved soil samples. These results suggest that microbial laccase is involved in iodide sorption on soils through the oxidation of iodide.

One-pot synthesis of active copper-containing carbon dots with laccase-like activities

NASA Astrophysics Data System (ADS)

Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

2015-11-01

Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching

Enhanced laccase production by Trametes versicolor using corn steep liquor as both nitrogen source and inducer.

PubMed

Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2014-08-01

A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. Copyright © 2014 Elsevier Ltd. All rights reserved.

Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.

PubMed

Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

2010-12-01

Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. 2010 Elsevier Ltd. All rights reserved.

Laccase-conjugated amino-functionalized nanosilica for efficient degradation of Reactive Violet 1 dye

NASA Astrophysics Data System (ADS)

Gahlout, Mayur; Rudakiya, Darshan M.; Gupte, Shilpa; Gupte, Akshaya

2017-08-01

Immobilization of enzyme with nanostructures enhances its ideal characteristics, which may allow the enzyme to become more stable and resistant. The present investigation deals with the formulation of laccase nanosilica conjugates to overcome the problems associated with its stability and reusability. Synthesized nanosilica and laccase nanoparticles were spherical shaped, with the mean size of 220 and 615 nm, respectively. Laccase nanoparticles had an optimum temperature of 55 °C and pH 4.0 for the oxidation of ABTS. Laccase nanoparticle retained 79% of residual activity till 20th cycle. It also showed 91% of its initial activity at lower temperatures even after 60 days. Laccase nanoparticles were applied for Reactive Violet 1 degradation wherein 96.76% of decolourization was obtained at pH 5.0 and 30 °C within 12 h. Toxicity studies on microbes and plants suggested that the degraded metabolites were less toxic than control dye. Thus, the method applied for immobilization increased storage stability and reusability of laccase, and therefore, it can be utilized for efficient degradation of azo dyes.

Immobilization of fungal laccase onto a nonionic surfactant-modified clay material: application to PAH degradation.

PubMed

Chang, Yi-Tang; Lee, Jiunn-Fwu; Liu, Keng-Hua; Liao, Yi-Fen; Yang, Vivian

2016-03-01

Nonionic surfactant-modified clay is a useful absorbent material that effectively removes hydrophobic organic compounds from soil/groundwater. We developed a novel material by applying an immobilized fungal laccase onto nonionic surfactant-modified clay. Low-water-solubility polycyclic aromatic hydrocarbons (PAHs) (naphthalene/phenanthrene) were degraded in the presence of this bioactive material. PAH degradation by free laccase was higher than degradation by immobilized laccase when the surfactant concentration was allowed to form micelles. PAH degradation by immobilized laccase on TX-100-modified clay was higher than on Brij35-modified clay. Strong laccase degradation of PAH can be maintained by adding surfactant monomers or micelles. The physical adsorption of nonionic surfactants onto clay plays an important role in PAH degradation by laccase, which can be explained by the structure and molecular interactions of the surfactant with the clay and enzyme. A system where laccase is immobilized onto TX-100-monomer-modified clay is a good candidate bioactive material for in situ PAHs bioremediation.

Effect of antibiotics on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus.

PubMed

Dhawan, Shikha; Lal, Rup; Hanspal, Manjit; Kuhad, Ramesh Chander

2005-08-01

The effect of nine different antibiotics (chloramphenicol, ampicillin trihydrate, kanamycin A monosulfate, neomycin sulfate, erythromycin, thiostrepton, tetracycline, apramycin sulfate and streptomycin sulfate) on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus has been investigated. All the antibiotics tested at a concentration of 200 mg/l affected the fungal growth, release of protein and laccase production to different extent. Inhibition in fungal growth was found to be positively correlated with increase in laccase production. Interestingly, apramycin sulfate inhibited biomass production (14.9-26.2%), nevertheless, it stimulated maximum laccase production (18.2 U/ml) in both the fungi. Increasing concentrations of apramycin sulfate enhanced laccase production from P. cinnabarinus but not from C. bulleri.

Controlling the simultaneous production of laccase and lignin peroxidase from Streptomyces cinnamomensis by medium formulation

PubMed Central

2012-01-01

Background Use of crude ligninase of bacterial origin is one of the most promising ways to improve the practical biodegradation of lignocellulosic biomass. However, lignin is composed of diverse monolignols with different abundance levels in different plant biomass and requires different proportions of ligninase to realize efficient degradation. To improve activity and reduce cost, the simultaneous submerged fermentation of laccase and lignin peroxidase (LiP) from a new bacterial strain, Streptomyces cinnamomensis, was studied by adopting formulation design, principal component analysis, regression analysis and unconstrained mathematical programming. Results The activities of laccase and LiP from S. cinnamomensis cultured with the optimal medium formulations were improved to be five to eight folders of their initial activities, and the measured laccase:LiP activity ratios reached 0.1, 0.4 and 1.7 when cultured on medium with formulations designed to produce laccase:LiP complexes with theoretical laccase:LiP activity ratios of 0.05 to 0.1, 0.5 to 1 and 1.1 to 2. Conclusion Both the laccase and LiP activities and also the activity ratio of laccase to LiP could be controlled by the medium formulation as designed. Using a crude laccase-LiP complex with a specially designed laccase:LiP activity ratio has the potential to improve the degradation of various plant lignins composed of diverse monolignols with different abundance levels. PMID:22429569

Characterization and immobilization of Trametes versicolor laccase on magnetic chitosan-clay composite beads for phenol removal.

PubMed

Aydemir, Tülin; Güler, Semra

2015-01-01

Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h.

A step forward in laccase exploitation: Recombinant production and evaluation of techno-economic feasibility of the process.

PubMed

Pezzella, Cinzia; Giacobelli, Valerio Guido; Lettera, Vincenzo; Olivieri, Giuseppe; Cicatiello, Paola; Sannia, Giovanni; Piscitelli, Alessandra

2017-10-10

Protein heterologous production offers viable opportunities to tailor laccase properties to specific industrial needs. The high redox potential laccase POXA1b from Pleurotus ostreatus was chosen as case study of marketable enzyme, due to its desirable properties in terms of activity/stability profile, and already assessed applicability. POXA1b was heterologously produced in Pichia pastoris by investigating the effect of inducible and constitutive expression systems on both the yield and the cost of its production. System performances were first assessed in shaken-flasks and then scaled-up in bioreactor. The production level obtained in the inducible system is 42U/mL, while the activity value achieved with the constitutive one is 60U/mL, the highest obtained in constitutive systems so far. The economic feasibility of recombinant laccase production was simulated, describing the case of an Italian small-medium enterprise. Two scenarios were evaluated: Scenario (I) production based on methanol inducible system; Scenario (II) production based on the constitutive system, fed with glycerol. At all the scales the glycerol-based fermentation is more economic than the methanol-based one. The price forecast for rPOXA1b production is 0.34€kU -1 for glycerol-based process, and is very competitive with the current price of commercial laccase. Copyright © 2017 Elsevier B.V. All rights reserved.

Gene Architectures that Minimize Cost of Gene Expression.

PubMed

Frumkin, Idan; Schirman, Dvir; Rotman, Aviv; Li, Fangfei; Zahavi, Liron; Mordret, Ernest; Asraf, Omer; Wu, Song; Levy, Sasha F; Pilpel, Yitzhak

2017-01-05

Gene expression burdens cells by consuming resources and energy. While numerous studies have investigated regulation of expression level, little is known about gene design elements that govern expression costs. Here, we ask how cells minimize production costs while maintaining a given protein expression level and whether there are gene architectures that optimize this process. We measured fitness of ∼14,000 E. coli strains, each expressing a reporter gene with a unique 5' architecture. By comparing cost-effective and ineffective architectures, we found that cost per protein molecule could be minimized by lowering transcription levels, regulating translation speeds, and utilizing amino acids that are cheap to synthesize and that are less hydrophobic. We then examined natural E. coli genes and found that highly expressed genes have evolved more forcefully to minimize costs associated with their expression. Our study thus elucidates gene design elements that improve the economy of protein expression in natural and heterologous systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Laccase from Aspergillus niger: A novel tool to graft multifunctional materials of interests and their characterization.

PubMed

Iqbal, Hafiz M N; Kyazze, Godfrey; Tron, Thierry; Keshavarz, Tajalli

2018-03-01

In the present study, we propose a green route to prepare poly(3-hydroxybutyrate) [(P(3HB)] grafted ethyl cellulose (EC) based green composites with novel characteristics through laccase-assisted grafting. P(3HB) was used as a side chain whereas, EC as a backbone material under ambient processing conditions. A novel laccase obtained from Aspergillus niger through its heterologous expression in Saccharomyces cerevisiae was used as a green catalyst for grafting purposes without the use of additional initiator and/or cross-linking agents. Subsequently, the resulting P(3HB)- g -EC composites were characterized using a range of analytical and imagining techniques. Fourier transform infrared spectroscopy (FT-IR) spectra showed an increase in the hydrogen-bonding type interactions between the side chains of P(3HB) and backbone material of EC. Evidently, X-ray diffraction (XRD) analysis revealed a decrease in the crystallinity of the P(3HB)- g -EC composites as compared to the pristine individual polymers. A homogeneous P(3HB) distribution was also achieved in case of the graft composite prepared in the presence of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) as a mediator along with laccase as compared to the composite prepared using pure laccase alone. A substantial improvement in the thermal and mechanical characteristics was observed for grafted composites up to the different extent as compared to the pristine counterparts. The hydrophobic/hydrophilic properties of the grafted composites were better than those of the pristine counterparts.

Overexpression of a novel thermostable and chloride-tolerant laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and its application in synthetic dye decolorization.

PubMed

Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

2015-01-01

Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.

Overexpression of a Novel Thermostable and Chloride-Tolerant Laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and Its Application in Synthetic Dye Decolorization

PubMed Central

Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

2015-01-01

Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0–11.0 and thermostable at 40°C–90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters. PMID:25790466

[Decolorization of dyestuff and dying waste water by laccase solution with self-flocculent mycelial pellets of Coriolus versicolor].

PubMed

Wu, Mianbin; Xia, Liming

2002-06-01

Both laccase production by the white-rot fungus Coriolus versicolor and decolorization of dyestuff and dying waste water with crude solution of laccase were studied in this work. Laccase production meets the definition of secondary metabolism. For laccase production the optimum initial pH is 4.5. Addition of veratryl alcohol or elevated trace metals could both enhance the laccase activity, while Tween80 showed some inhibition. The immobilized mycelia of C. versicolor in polyurethane foam had less laccase production ability than mycelial pellets. A repeated batch cultivation process was found to be a very economical way for laccase harvest. The same pellets could be used for at least 14 times and average laccase activity of each batch could maintain 6.72 IU/mL. This method reduces the enzyme production course, medium consumption and the possibility of contamination, showing high efficient and great economic benefit. Good results were also obtained in decolorization experiments with the crude solution of laccase. With 3.3 IU/mL initial laccase activity, color removal of Acid Orange reached 98.5% after 24 h reaction. Also with 2.6 IU/mL initial laccase activity, color removal of dying waste water reached 93% after 24 h reaction.

Direct analysis by time-of-flight secondary ion mass spectrometry reveals action of bacterial laccase-mediator systems on both hardwood and softwood samples.

PubMed

Goacher, Robyn E; Braham, Erick J; Michienzi, Courtney L; Flick, Robert M; Yakunin, Alexander F; Master, Emma R

2017-12-29

The modification and degradation of lignin play a vital role in carbon cycling as well as production of biofuels and bioproducts. The possibility of using bacterial laccases for the oxidation of lignin offers a route to utilize existing industrial protein expression techniques. However, bacterial laccases are most frequently studied on small model compounds that do not capture the complexity of lignocellulosic materials. This work studied the action of laccases from Bacillus subtilis and Salmonella typhimurium (EC 1.10.3.2) on ground wood samples from yellow birch (Betula alleghaniensis) and red spruce (Picea rubens). The ability of bacterial laccases to modify wood can be facilitated by small molecule mediators. Herein, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), gallic acid and sinapic acid mediators were tested. Direct analysis of the wood samples was achieved by time-of-flight secondary ion mass spectrometry (ToF-SIMS), a surface sensitive mass spectrometry technique that has characteristic peaks for H, G and S lignin. The action of the bacterial laccases on both wood samples was demonstrated and revealed a strong mediator influence. The ABTS mediator led to delignification, evident in an overall increase of polysaccharide peaks in the residual solid, along with equal loss of G and S-lignin peaks. The gallic acid mediator demonstrated minimal laccase activity. Meanwhile, the sinapic acid mediator altered the S/G peak ratio consistent with mediator attaching to the wood solids. The current investigation demonstrates the action of bacterial laccase-mediator systems directly on woody materials, and the potential of using ToF-SIMS to uncover the fundamental and applied role of bacterial enzymes in lignocellulose conversion. © 2017 Scandinavian Plant Physiology Society.

Purification of a thermostable alkaline laccase from papaya (Carica papaya) using affinity chromatography.

PubMed

Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

2015-01-01

A laccase from papaya leaves was purified to homogeneity by a two step procedure namely, heat treatment (at 70 °C) and Con-A affinity chromatography. The procedure resulted in 1386.7-fold purification of laccase with a specific activity of 41.3 units mg(-1) and an overall yield of 61.5%. The native purified laccase was found to be a hexameric protein of ∼ 260 kDa. The purified enzyme exhibited acidic and alkaline pH optima of 6.0 and 8.0 with the non-phenolic substrate (ABTS) and phenolic substrate (catechol), respectively. The purified laccase was found to be thermostable up to 70 °C such that it retained ∼ 80% activity upon 30 min incubation at 70 °C. The Arrhenius energy of activation for purified laccase was found to be 7.7 kJ mol(-1). The enzyme oxidized various phenolic and non-phenolic substrates having catalytic efficiency (K(cat)/K(m)) in the order of 7.25>0.67>0.27 mM(-1) min(-1) for ABTS, catechol and hydroquinone, respectively. The purified laccase was found to be activated by Mn(2+), Cd(2+), Ca(2+), Na(+), Fe(2+), Co(2+) and Cu(2+) while weakly inhibited by Hg(2+). The properties such as thermostability, alkaline pH optima and metal tolerance exhibited by the papaya laccase make it a promising candidate enzyme for industrial exploitation. Copyright © 2014 Elsevier B.V. All rights reserved.

One-pot synthesis of active copper-containing carbon dots with laccase-like activities.

PubMed

Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

2015-12-14

Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.

Simultaneous production of laccase and degradation of bisphenol A with Trametes versicolor cultivated on agricultural wastes.

PubMed

Zeng, Shengquan; Zhao, Jie; Xia, Liming

2017-08-01

Solid state fermentation with Trametes versicolor was carried out on agricultural wastes containing bisphenol A (BPA). It was found that BPA degradation was along with the occurrence of laccase production, and wheat bran and corn straw were identified as suitable mixed substrates for laccase production. In the process of BPA degradation with T. versicolor, laccase activity increased rapidly at the 6th-10th day after inoculation. Moreover, BPA can enhance the production of laccase. After 10 days of fermentation, degradation rate of BPA exceeded 90% without the usage of mediators ABTS and acetosyringone at pH 4.0-8.0. In addition, metal ions did not affect the BPA degradation with T. versicolor. In vitro, the optimum pH range of BPA degradation with laccase was in the acidic region with the optimal performance of pH 5.0. Metal ions Cu 2+ , Zn 2+ , and Co 2+ showed little effect on BPA degradation. However, Fe 3+ and Fe 2+ substantially inhibited the BPA degradation. Natural mediator acetosyringone showed optimum enhancement on BPA degradation. Greater than 90% of the estrogenic activity of BPA was removed by T. versicolor and its laccase. Compared to in vitro degradation with laccase, this study shows that the process of simultaneous laccase production and BPA degradation with T. versicolor was more advantageous since BPA can enhance the laccase production, mediators were unnecessary, degradation rate was not affected by metal ions, and the applicable pH range was broader. This study concludes that T. versicolor and laccase have great potential to treat industrial wastewater containing BPA.

Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination

PubMed Central

Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

2012-01-01

In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology.

PubMed

D'Souza-Ticlo, Donna; Garg, Sandeep; Raghukumar, Chandralata

2009-11-25

The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159. Inducible laccases were produced in the idiophase only after addition of an inducer such as CuSO(4). Concentration of carbon and nitrogen acted antagonistically with respect to laccase production. A combination of low nitrogen and high carbon concentration favored both biomass and laccase production. The most favorable combination resulted in 917 U L(-1) of laccase. After sufficient growth had occurred, addition of a surfactant such as Tween 80 positively impacted biomass and increased the laccase activity to around 1,300 U L(-1). Increasing the surface to volume ratio of the culture vessel further increased its activity to almost 2,000 U L(-1).

Comparative transcriptomics of Pleurotus eryngii reveals blue-light regulation of carbohydrate-active enzymes (CAZymes) expression at primordium differentiated into fruiting body stage.

PubMed

Xie, Chunliang; Gong, Wenbing; Zhu, Zuohua; Yan, Li; Hu, Zhenxiu; Peng, Yuande

2018-05-01

Blue light is an important environmental factor which could induce mushroom primordium differentiation and fruiting body development. However, the mechanisms of Pleurotus eryngii primordium differentiation and development induced by blue light are still unclear. The CAZymes (carbohydrate-active enzymes) play important roles in degradation of renewable lignocelluloses to provide carbohydrates for fungal growth, development and reproduction. In the present research, the expression profiles of genes were measured by comparison between the Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation and dark using high-throughput sequencing approach. After assembly and compared to the Pleurotus eryngii reference genome, 11,343 unigenes were identified. 539 differentially expressed genes including white collar 2 type of transcription factor gene, A mating type protein gene, MAP kinase gene, oxidative phosphorylation associated genes, CAZymes genes and other metabolism related genes were identified during primordium differentiated into fruiting body stage after blue light stimulation. KEGG results showed that carbon metabolism, glycolysis/gluconeogenesis and biosynthesis of amino acids pathways were affected during blue light inducing primordia formation. Most importantly, 319 differentially expressed CAZymes participated in carbon metabolism were identified. The expression patterns of six representative CAZymes and laccase genes were further confirmed by qRT-PCR. Enzyme activity results indicated that the activities of CAZymes and laccase were affected in primordium differentiated into fruiting body under blue light stimulation. In conclusion, the comprehensive transcriptome and CAZymes of Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation were obtained. The biological insights gained from this integrative system represent a valuable resource for future genomic studies on this

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

PubMed Central

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with K m and k cat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data.

PubMed

Ezer, Daphne; Moignard, Victoria; Göttgens, Berthold; Adryan, Boris

2016-08-01

Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete pipeline for the analysis of single cell qPCR data that uses the mathematics behind bursty expression to develop more accurate and robust algorithms for analyzing the origin of heterogeneity in experimental samples, specifically an algorithm for clustering cells by their bursting behavior (Simulated Annealing for Bursty Expression Clustering, SABEC) and a statistical tool for comparing the kinetic parameters of bursty expression across populations of cells (Estimation of Parameter changes in Kinetics, EPiK). We applied these methods to hematopoiesis, including a new single cell dataset in which transcription factors (TFs) involved in the earliest branchpoint of blood differentiation were individually up- and down-regulated. We could identify two unique sub-populations within a seemingly homogenous group of hematopoietic stem cells. In addition, we could predict regulatory mechanisms controlling the expression levels of eighteen key hematopoietic transcription factors throughout differentiation. Detailed information about gene regulatory mechanisms can therefore be obtained simply from high throughput single cell gene expression data, which should be widely applicable given the rapid expansion of single cell genomics.

Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.

PubMed

Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong

2018-04-01

Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.

Annotation of gene function in citrus using gene expression information and co-expression networks

PubMed Central

2014-01-01

Background The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world’s most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a “guilt-by-association” principle whereby genes encoding proteins involved in similar and/or related biological processes may exhibit similar expression patterns across diverse sets of experimental conditions. While bioinformatics resources such as GCN analysis are widely available for efficient gene function prediction in model plant species including Arabidopsis, soybean and rice, in citrus these tools are not yet developed. Results We have constructed a comprehensive GCN for citrus inferred from 297 publicly available Affymetrix Genechip Citrus Genome microarray datasets, providing gene co-expression relationships at a genome-wide scale (33,000 transcripts). The comprehensive citrus GCN consists of a global GCN (condition-independent) and four condition-dependent GCNs that survey the sweet orange species only, all citrus fruit tissues, all citrus leaf tissues, or stress-exposed plants. All of these GCNs are clustered using genome-wide, gene-centric (guide) and graph clustering algorithms for flexibility of gene function prediction. For each putative cluster, gene ontology (GO) enrichment and gene expression specificity analyses were performed to enhance gene function, expression and regulation pattern prediction. The guide-gene approach was used to infer novel roles of genes involved in disease susceptibility and vitamin C metabolism, and graph-clustering approaches were used to investigate isoprenoid/phenylpropanoid metabolism in citrus peel, and citric acid catabolism via the GABA shunt in citrus fruit. Conclusions Integration of citrus gene co-expression networks

Middle-redox potential laccase from Ganoderma sp.: its application in improvement of feed for monogastric animals

PubMed Central

Sharma, Krishna Kant; Shrivastava, Bhuvnesh; Sastry, V. R. B.; Sehgal, Neeta; Kuhad, Ramesh Chander

2013-01-01

The variables influencing laccase production by white-rot fungus Ganoderma sp. rckk-02 were optimized employing response surface methodology. Malt extract (6.0% w/v), lignin (0.5% w/v) and pH (5.5) were found to be the most significant factors for enhanced laccase production by 7 fold (226.0 U/ml) as compared to unoptimized growth conditions (32.0 U/ml). The N-terminal sequence of laccase revealed its distinct amino acid profile (S- I- R- N- S- G), which suggested it as a novel enzyme. The Far-UV CD spectrum of the laccase showed single broad negative trough at around 213 nm, a typical signature of all β proteins. The laccase was found to fall in the range of middle redox potential laccases. Purified laccase at dosage of 2.5 Ug−1 body weight when supplemented with pelleted diet of rats, a significant improvement (p < 0.05) in nutrients digestibility without causing any elevation of blood stress enzymes was observed. PMID:23416696

Continuous adsorption and biotransformation of micropollutants by granular activated carbon-bound laccase in a packed-bed enzyme reactor.

PubMed

Nguyen, Luong N; Hai, Faisal I; Dosseto, Anthony; Richardson, Christopher; Price, William E; Nghiem, Long D

2016-06-01

Laccase was immobilized on granular activated carbon (GAC) and the resulting GAC-bound laccase was used to degrade four micropollutants in a packed-bed column. Compared to the free enzyme, the immobilized laccase showed high residual activities over a broad range of pH and temperature. The GAC-bound laccase efficiently removed four micropollutants, namely, sulfamethoxazole, carbamazepine, diclofenac and bisphenol A, commonly detected in raw wastewater and wastewater-impacted water sources. Mass balance analysis showed that these micropollutants were enzymatically degraded following adsorption onto GAC. Higher degradation efficiency of micropollutants by the immobilized compared to free laccase was possibly due to better electron transfer between laccase and substrate molecules once they have adsorbed onto the GAC surface. Results here highlight the complementary effects of adsorption and enzymatic degradation on micropollutant removal by GAC-bound laccase. Indeed laccase-immobilized GAC outperformed regular GAC during continuous operation of packed-bed columns over two months (a throughput of 12,000 bed volumes). Copyright © 2016 Elsevier Ltd. All rights reserved.

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus) Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

PubMed Central

Teixeira, Ricardo Sposina S.; Pereira, Patrícia Maia; Ferreira-Leitão, Viridiana S.

2010-01-01

Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR), Drimaren Blue X-BLN (DMBBLN), Drimaren Rubinol X-3LR (DMR), and Drimaren Blue C-R (RBBR). The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h) and RBBR (80–90%, 24 h) with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h) and DMBBLN (63–84%, 24 h). The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h. PMID:21052547

Electron beam-induced immobilization of laccase on porous supports for waste water treatment applications.

PubMed

Jahangiri, Elham; Reichelt, Senta; Thomas, Isabell; Hausmann, Kristin; Schlosser, Dietmar; Schulze, Agnes

2014-08-08

The versatile oxidase enzyme laccase was immobilized on porous supports such as polymer membranes and cryogels with a view of using such biocatalysts in bioreactors aiming at the degradation of environmental pollutants in wastewater. Besides a large surface area for supporting the biocatalyst, the aforementioned porous systems also offer the possibility for simultaneous filtration applications in wastewater treatment. Herein a "green" water-based, initiator-free, and straightforward route to highly reactive membrane and cryogel-based bioreactors is presented, where laccase was immobilized onto the porous polymer supports using a water-based electron beam-initiated grafting reaction. In a second approach, the laccase redox mediators 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and syringaldehyde were cross-linked instead of the enzyme via electron irradiation in a frozen aqueous poly(acrylate) mixture in a one pot set-up, yielding a mechanical stable macroporous cryogel with interconnected pores ranging from 10 to 50 µm in size. The membranes as well as the cryogels were characterized regarding their morphology, chemical composition, and catalytic activity. The reactivity towards waste- water pollutants was demonstrated by the degradation of the model compound bisphenol A (BPA). Both membrane- and cryogel-immobilized laccase remained highly active after electron beam irradiation. Apparent specific BPA removal rates were higher for cryogel- than for membrane-immobilized and free laccase, whereas membrane-immobilized laccase was more stable with respect to maintenance of enzymatic activity and prevention of enzyme leakage from the carrier than cryogel-immobilized laccase. Cryogel-immobilized redox mediators remained functional in accelerating the laccase-catalyzed BPA degradation, and especially ABTS was found to act more efficiently in immobilized than in freely dissolved state.

Immobilized laccase mediated dye decolorization and transformation pathway of azo dye acid red 27.

PubMed

Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

2015-01-01

Laccases have good potential as bioremediating agents and can be used continuously in the immobilized form like many other enzymes. In the present study, laccase from Cyathus bulleri was immobilized by entrapment in Poly Vinyl Alcohol (PVA) beads cross-linked with either nitrate or boric acid. Immobilized laccase was used for dye decolorization in both batch and continuous mode employing a packed bed column. The products of degradation of dye Acid Red 27 were identified by LC MS/MS analysis. The method led to very effective (90%) laccase immobilization and also imparted significant stability to the enzyme (more than 70% after 5 months of storage at 4°C). In batch decolorization, 90-95% decolorization was achieved of the simulated dye effluent for up to 10-20 cycles. Continuous decolorization in a packed bed bioreactor led to nearly 90% decolorization for up to 5 days. The immobilized laccase was also effective in decolorization and degradation of Acid Red 27 in the presence of a mediator. Four products of degradation were identified by LC-MS/MS analysis. The immobilized laccase in PVA-nitrate was concluded to be an effective agent in treatment of textile dye effluents.

High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.

PubMed

Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu

2014-09-15

In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum μ(ap) was 2.7×10(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high α-helical content (68%). The MW of the purified EPS was determined to be 1.8×10(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). Copyright © 2014 Elsevier Ltd. All rights reserved.

Evaluation of laccase-mediator system (LMS) in the oxidation of veratryl alcohol

USDA-ARS?s Scientific Manuscript database

Identifying suitable reaction conditions remains an important task in the development of enzyme catalysis. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially...

Cost analysis in laccase production.

PubMed

Osma, Johann F; Toca-Herrera, José L; Rodríguez-Couto, Susana

2011-11-01

In this paper the cost of producing the enzyme laccase by the white-rot fungus Trametes pubescens under both submerged (SmF) and solid-state fermentation (SSF) conditions was studied. The fungus was cultured using more than 45 culture medium compositions. The cost of production was estimated by analyzing the cost of the culture medium, the cost of equipment and the operating costs. The cost of the culture medium represented, in all cases, the highest contribution to the total cost, while, the cost of equipment was significantly low, representing less than 2% of the total costs. The cultivation under SSF conditions presented a final cost 50-fold lower than the one obtained when culturing under SmF conditions at flask scale. In addition, the laccase production under SSF conditions in tray bioreactors reduced the final cost 4-fold compared to the one obtained under SSF conditions at flask scale, obtaining a final price of 0.04 cent €/U. Copyright © 2011 Elsevier Ltd. All rights reserved.

Characterization of a novel laccase produced by the wood-rotting fungus Phellinus ribis.

PubMed

Min, K L; Kim, Y H; Kim, Y W; Jung, H S; Hah, Y C

2001-08-15

The white-rot fungus Phellinus ribis produced a single form of laccase, which was purified to apparent electrophoretic homogeneity from cultures induced with 2,5-xylidine. This protein was a dimer, consisting of two subunits of 76 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Carbohydrate analysis revealed that the enzyme contained about 28% carbohydrate content. The laccase appeared to be different from other known laccases by the UV-visible absorption spectrum analysis. One enzyme molecule contained one copper, one manganese, and two zinc atoms. The laccase showed optimal activity at pH 4.0-6.0, 5.0, and 6.0 with 2,6-dimethoxyphenol, ABTS [2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)], and syringaldazine, respectively. The enzyme preferably oxidized dimethoxyphenol and aromatic amine compounds. The stability of the laccase was low at acidic pH, whereas it showed high stability at neutral pH and mild temperature. The N-terminal amino acid sequence revealed a very low homology with other microbial laccases. With some substrates, the addition of manganese and H2O2 resulted in a remarkable increase in the oxidation rate. Without an appropriate phenolic substrate, the enzyme could not oxidize Mn(II) in the presence of H2O2 or pyrophosphate. Copyright 2001 Academic Press.

Reactivities of various mediators and laccases with kraft pulp and lignin model compounds.

PubMed

Bourbonnais, R; Paice, M G; Freiermuth, B; Bodie, E; Borneman, S

1997-12-01

Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification.

Laccase produced by a thermotolerant strain of Trametes trogii LK13

PubMed Central

Yan, Jinping; Chen, Yuhui; Niu, Jiezhen; Chen, Daidi; Chagan, Irbis

2015-01-01

Thermophilic and thermotolerant micro-organisms strains have served as the natural source of industrially relevant and thermostable enzymes. Although some strains of the Trametes genus are thermotolerant, few Trametes strains were studied at the temperature above 30 °C until now. In this paper, the laccase activity and the mycelial growth rate for Trametes trogii LK13 are superior at 37 °C. Thermostability and organic cosolvent tolerance assays of the laccase produced at 37 °C indicated that the enzyme possessed fair thermostability with 50% of its initial activity at 80 °C for 5 min, and could remain 50% enzyme activity treated with organic cosolvent at the concentration range of 25%–50% (v/v). Furthermore, the test on production of laccase and lignocellulolytic enzymes showed the crude enzymes possessed high laccase level (1000 U g −1 ) along with low cellulose (2 U g −1 ) and xylanase (140 U g −1 ) activity. Thus, T. trogii LK13 is a potential strain to be applied in many biotechnological processes. PMID:26221089

Unraveling the effects of laccase treatment on enzymatic hydrolysis of steam-exploded wheat straw.

PubMed

Oliva-Taravilla, Alfredo; Moreno, Antonio D; Demuez, Marie; Ibarra, David; Tomás-Pejó, Elia; González-Fernández, Cristina; Ballesteros, Mercedes

2015-01-01

Laccase enzymes are promising detoxifying agents during lignocellulosic bioethanol production from wheat straw. However, they affect the enzymatic hydrolysis of this material by lowering the glucose recovery yields. This work aimed at explaining the negative effects of laccase on enzymatic hydrolysis. Relative glucose recovery in presence of laccase (10IU/g substrate) with model cellulosic substrate (Sigmacell) at 10% (w/v) was almost 10% points lower (P<0.01) than in the absence of laccase. This fact could be due to an increase in the competition of cellulose binding sites between the enzymes and a slight inhibition of β-glucosidase activity. However, enzymatic hydrolysis and infrared spectra of laccase-treated and untreated wheat straw filtered pretreated residue (WS-FPR), revealed that a grafting process of phenoxy radicals onto the lignin fiber could be the cause of diminished accessibility of cellulases to cellulose in pretreated wheat straw. Copyright © 2014 Elsevier Ltd. All rights reserved.

Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination

PubMed Central

Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

2009-01-01

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

Digital gene expression analysis of gene expression differences within Brassica diploids and allopolyploids.

PubMed

Jiang, Jinjin; Wang, Yue; Zhu, Bao; Fang, Tingting; Fang, Yujie; Wang, Youping

2015-01-27

Brassica includes many successfully cultivated crop species of polyploid origin, either by ancestral genome triplication or by hybridization between two diploid progenitors, displaying complex repetitive sequences and transposons. The U's triangle, which consists of three diploids and three amphidiploids, is optimal for the analysis of complicated genomes after polyploidization. Next-generation sequencing enables the transcriptome profiling of polyploids on a global scale. We examined the gene expression patterns of three diploids (Brassica rapa, B. nigra, and B. oleracea) and three amphidiploids (B. napus, B. juncea, and B. carinata) via digital gene expression analysis. In total, the libraries generated between 5.7 and 6.1 million raw reads, and the clean tags of each library were mapped to 18547-21995 genes of B. rapa genome. The unambiguous tag-mapped genes in the libraries were compared. Moreover, the majority of differentially expressed genes (DEGs) were explored among diploids as well as between diploids and amphidiploids. Gene ontological analysis was performed to functionally categorize these DEGs into different classes. The Kyoto Encyclopedia of Genes and Genomes analysis was performed to assign these DEGs into approximately 120 pathways, among which the metabolic pathway, biosynthesis of secondary metabolites, and peroxisomal pathway were enriched. The non-additive genes in Brassica amphidiploids were analyzed, and the results indicated that orthologous genes in polyploids are frequently expressed in a non-additive pattern. Methyltransferase genes showed differential expression pattern in Brassica species. Our results provided an understanding of the transcriptome complexity of natural Brassica species. The gene expression changes in diploids and allopolyploids may help elucidate the morphological and physiological differences among Brassica species.

Aberrant Gene Expression in Humans

PubMed Central

Yang, Ence; Ji, Guoli; Brinkmeyer-Langford, Candice L.; Cai, James J.

2015-01-01

Gene expression as an intermediate molecular phenotype has been a focus of research interest. In particular, studies of expression quantitative trait loci (eQTL) have offered promise for understanding gene regulation through the discovery of genetic variants that explain variation in gene expression levels. Existing eQTL methods are designed for assessing the effects of common variants, but not rare variants. Here, we address the problem by establishing a novel analytical framework for evaluating the effects of rare or private variants on gene expression. Our method starts from the identification of outlier individuals that show markedly different gene expression from the majority of a population, and then reveals the contributions of private SNPs to the aberrant gene expression in these outliers. Using population-scale mRNA sequencing data, we identify outlier individuals using a multivariate approach. We find that outlier individuals are more readily detected with respect to gene sets that include genes involved in cellular regulation and signal transduction, and less likely to be detected with respect to the gene sets with genes involved in metabolic pathways and other fundamental molecular functions. Analysis of polymorphic data suggests that private SNPs of outlier individuals are enriched in the enhancer and promoter regions of corresponding aberrantly-expressed genes, suggesting a specific regulatory role of private SNPs, while the commonly-occurring regulatory genetic variants (i.e., eQTL SNPs) show little evidence of involvement. Additional data suggest that non-genetic factors may also underlie aberrant gene expression. Taken together, our findings advance a novel viewpoint relevant to situations wherein common eQTLs fail to predict gene expression when heritable, rare inter-individual variation exists. The analytical framework we describe, taking into consideration the reality of differential phenotypic robustness, may be valuable for investigating

Degradation of phenanthrene by Trametes versicolor and its laccase.

PubMed

Han, Mun-Jung; Choi, Hyoung-Tae; Song, Hong-Gyu

2004-06-01

Phenanthrene is a three-ring polycyclic aromatic hydrocarbon and commonly found as a pollutant in various environments. Degradation of phenanthrene by white rot fungus Trametes versicolor 951022 and its laccase, isolated in Korea, was investigated. After 36 h of incubation, about 46% and 65% of 100 mg/l of phenanthrene added in shaken and static fungal cultures were removed, respectively. Phenanthrene degradation was maximal at pH 6 and the optimal temperature for phenanthrene removal was 30 degrees C. Although the removal percentage of phenanthrene was highest (76.7%) at 10 mg/l of phenanthrene concentration, the transformation rate was maximal (0.82 mg/h) at 100 mg/L of phenanthrene concentration in the fungal culture. When the purified laccase of T versicolor 951022 reacted with phenanthrene, phenanthrene was not transformed. The addition of redox mediator, 2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) or 1-hydroxybenzotriazole (HBT) to the reaction mixture increased oxidation of phenanthrene by laccase about 40% and 30%, respectively.

An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp.

PubMed

Fang, Fang; Zhang, Xue-lian; Luo, Hong-hui; Zhou, Jia-jian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi; Pang, Xue-qun

2015-12-01

In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. © 2015 American Society of Plant Biologists. All Rights Reserved.

Laccase isoenzymes of Pleurotus eryngii: characterization, catalytic properties, and participation in activation of molecular oxygen and Mn2+ oxidation.

PubMed Central

Muñoz, C; Guillén, F; Martínez, A T; Martínez, M J

1997-01-01

Two laccase isoenzymes produced by Pleurotus eryngii were purified to electrophoretic homogeneity (42- and 43-fold) with an overall yield of 56.3%. Laccases I and II from this fungus are monomeric glycoproteins with 7 and 1% carbohydrate content, molecular masses (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 65 and 61 kDa, and pIs of 4.1 and 4.2, respectively. The highest rate of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) oxidation for laccase I was reached at 65 degrees C and pH 4, and that for laccase II was reached at 55 degrees C and pH 3.5. Both isoenzymes are stable at high pH, retaining 60 to 70% activity after 24 h from pH 8 to 12. Their amino acid compositions and N-terminal sequences were determined, the latter strongly differing from those of laccases of other basidiomycetes. Antibodies against laccase I reacted with laccase II, as well as with laccases from Pleurotus ostreatus, Pleurotus pulmonarius, and Pleurotus floridanus. Different hydroxy- and methoxy-substituted phenols and aromatic amines were oxidized by the two laccase isoenzymes from P. eryngii, and the influence of the nature, number, and disposition of aromatic-ring substituents on kinetic constants is discussed. Although both isoenzymes presented similar substrate affinities, the maximum rates of reactions catalyzed by laccase I were higher than those of laccase II. In reactions with hydroquinones, semiquinones produced by laccase isoenzymes were in part converted into quinones via autoxidation. The superoxide anion radical produced in the latter reaction dismutated, producing hydrogen peroxide. In the presence of manganous ion, the superoxide union was reduced to hydrogen peroxide with the concomitant production of manganic ion. These results confirmed that laccase in the presence of hydroquinones can participate in the production of both reduced oxygen species and manganic ions. PMID:9172335

Riboflavin induces Metarhizium spp. to produce conidia with elevated tolerance to UV-B, and upregulates photolyases, laccases and polyketide synthases genes.

PubMed

Pereira-Junior, R A; Huarte-Bonnet, C; Paixão, F R S; Roberts, D W; Luz, C; Pedrini, N; Fernandes, É K K

2018-02-23

The effect of nutritional supplementation of two Metarhizium species with riboflavin (Rb) during production of conidia was evaluated on (i) conidial tolerance (based on germination) to UV-B radiation and on (ii) conidial expression following UV-B irradiation, of enzymes known to be active in photoreactivation, viz., photolyase (Phr), laccase (Lac) and polyketide synthase (Pks). Metarhizium acridum (ARSEF 324) and Metarhizium robertsii (ARSEF 2575) were grown either on (i) potato dextrose agar medium (PDA), (ii) PDA supplemented with 1% yeast extract (PDAY), (iii) PDA supplemented with Rb (PDA+Rb), or (iv) PDAY supplemented with Rb (PDAY+Rb). Resulting conidia were exposed to 866·7 mW m -2 of UV-B Quaite-weighted irradiance to total doses of 3·9 or 6·24 kJ m -2 . Some conidia also were exposed to 16 klux of white light (WL) after being irradiated, or not, with UV-B to investigate the role of possible photoreactivation. Relative germination of conidia produced on PDA+Rb (regardless Rb concentration) or on PDAY and exposed to UV-B was higher compared to conidia cultivated on PDA without Rb supplement, or to conidia suspended in Rb solution immediately prior to UV-B exposure. The expression of MaLac3 and MaPks2 for M. acridum, as well as MrPhr2, MrLac1, MrLac2 and MrLac3 for M. robertsii was higher when the isolates were cultivated on PDA+Rb and exposed to UV-B followed by exposure to WL, or exposed to WL only. Rb in culture medium increases the UV-B tolerance of M. robertsii and M. acridum conidia, and which may be related to increased expression of Phr, Lac and Pks genes in these conidia. The enhanced UV-B tolerance of Metarhizium spp. conidia produced on Rb-enriched media may improve the effectiveness of these fungi in biological control programs. © 2018 The Society for Applied Microbiology.

Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.

PubMed

Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko

2014-05-01

Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Production of laccase by Pynoporus sanguineus using 2,5 - Xylidine and ethanol

PubMed Central

Valeriano, Viviane S.; Silva, Anna Maria F.; Santiago, Mariângela F.; Bara, Maria T. F.; Garcia, Telma A.

2009-01-01

Enzyme application in biotechnological and environmental processes has had increasing interest due to its efficiency, selectivity and mainly for being environmentally healthful, but these applications require a great volume of enzymes. In this work the effect of different concentrations of ethanol and 2,5-xylidine on growth and production of laccase by Pycnoporus sanguineus was investigated. In a medium containing 200 mg.L-1 of 2,5-xylidine or 50 g.L-1 of ethanol, the maximum activity of laccase was 2019 U.L-1 and 1035 U.L-1, respectively. No direct correlation between biomass and activity of laccase was observed for any of the inducers used during the tests. Ethanol concentrations, larger than or equal to 20 g.L-1, inhibited the radial growth of P. sanguineus. This study showed that ethanol, which has less toxicity and cost than the majority of the studied inducers, presents promising perspectives for laccase production by P. sanguineus. PMID:24031426

Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity

PubMed Central

Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

2014-01-01

Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

Reactivities of Various Mediators and Laccases with Kraft Pulp and Lignin Model Compounds

PubMed Central

Bourbonnais, R.; Paice, M. G.; Freiermuth, B.; Bodie, E.; Borneman, S.

1997-01-01

Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification. PMID:16535747

Structural insights into 2,2'-azino-Bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS)-mediated degradation of reactive blue 21 by engineered Cyathus bulleri Laccase and characterization of degradation products.

PubMed

Kenzom, T; Srivastava, P; Mishra, S

2014-12-01

Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Diversity of Ligninolytic Enzymes and Their Genes in Strains of the Genus Ganoderma: Applicable for Biodegradation of Xenobiotic Compounds?

PubMed Central

Torres-Farradá, Giselle; Manzano León, Ana M.; Rineau, François; Ledo Alonso, Lucía L.; Sánchez-López, María I.; Thijs, Sofie; Colpaert, Jan; Ramos-Leal, Miguel; Guerra, Gilda; Vangronsveld, Jaco

2017-01-01

White-rot fungi (WRF) and their ligninolytic enzymes (laccases and peroxidases) are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba). All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR)-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains. PMID:28588565

Laccase modification of the physical properties of bark and pulp of loblolly pine and spruce pulp

Treesearch

William Kenealy; John Klungness; Mandla Tshabalala; Eric Horn; Masood Akhtar; Roland Gleisner; Gisela Buschle-Diller

2004-01-01

Pine bark, pine pulp, and spruce pulp were reacted with laccase in the presence of phenolic laccase substrates to modify the fiber surface properties. The acid-base and dispersive characteristics of these modified steam-treated thermomechanical loblolly pine pulps were determined by inverse gas chromatography. Different combinations of substrates with laccase modified...

An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp1[OPEN

PubMed Central

Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi

2015-01-01

In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

Immobilization of laccase on a novel ZnO/SiO2 nano-composited support for dye decolorization

NASA Astrophysics Data System (ADS)

Li, Wei-Xun; Sun, Huai-Yan; Zhang, Rui-Feng

2015-07-01

ZnO nanowires were introduced into macroporous SiO2 by means of in situ hydrothermal growth. The obtained nano-composite was then used to immobilize laccase (secured from Trametes versicolor) through the process of static adsorption. The average loading amount was as high as 193.4 μmol-g-1. The immobilized laccase was proven to be an effective biocatalyst in the decolorization of two dyes: Remazol Brilliant Blue B, and Acid Blue 25. The decolorization percentage of Remazol Brilliant Blue B and Acid Blue 25 reached 93% and 82% respectively. The immobilized laccase exhibited enhanced thermal stability and pH adaptability compared to free laccase. After ten recycles, the immobilized laccase retained 42% decolorization catalytic activity.

Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri.

PubMed

Dhawan, Shikha; Kuhad, Ramesh Chander

2002-08-01

Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production.

Structural Insights into 2,2′-Azino-Bis(3-Ethylbenzothiazoline-6-Sulfonic Acid) (ABTS)-Mediated Degradation of Reactive Blue 21 by Engineered Cyathus bulleri Laccase and Characterization of Degradation Products

PubMed Central

Kenzom, T.; Srivastava, P.

2014-01-01

Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. PMID:25261507

Polycistronic gene expression in Aspergillus niger.

PubMed

Schuetze, Tabea; Meyer, Vera

2017-09-25

Genome mining approaches predict dozens of biosynthetic gene clusters in each of the filamentous fungal genomes sequenced so far. However, the majority of these gene clusters still remain cryptic because they are not expressed in their natural host. Simultaneous expression of all genes belonging to a biosynthetic pathway in a heterologous host is one approach to activate biosynthetic gene clusters and to screen the metabolites produced for bioactivities. Polycistronic expression of all pathway genes under control of a single and tunable promoter would be the method of choice, as this does not only simplify cloning procedures, but also offers control on timing and strength of expression. However, polycistronic gene expression is a feature not commonly found in eukaryotic host systems, such as Aspergillus niger. In this study, we tested the suitability of the viral P2A peptide for co-expression of three genes in A. niger. Two genes descend from Fusarium oxysporum and are essential to produce the secondary metabolite enniatin (esyn1, ekivR). The third gene (luc) encodes the reporter luciferase which was included to study position effects. Expression of the polycistronic gene cassette was put under control of the Tet-On system to ensure tunable gene expression in A. niger. In total, three polycistronic expression cassettes which differed in the position of luc were constructed and targeted to the pyrG locus in A. niger. This allowed direct comparison of the luciferase activity based on the position of the luciferase gene. Doxycycline-mediated induction of the Tet-On expression cassettes resulted in the production of one long polycistronic mRNA as proven by Northern analyses, and ensured comparable production of enniatin in all three strains. Notably, gene position within the polycistronic expression cassette matters, as, luciferase activity was lowest at position one and had a comparable activity at positions two and three. The P2A peptide can be used to express at

Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.

2006-10-01

The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccasemore » structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.« less

Transcriptome-Level Signatures in Gene Expression and Gene Expression Variability during Bacterial Adaptive Evolution.

PubMed

Erickson, Keesha E; Otoupal, Peter B; Chatterjee, Anushree

2017-01-01

Antibiotic-resistant bacteria are an increasingly serious public health concern, as strains emerge that demonstrate resistance to almost all available treatments. One factor that contributes to the crisis is the adaptive ability of bacteria, which exhibit remarkable phenotypic and gene expression heterogeneity in order to gain a survival advantage in damaging environments. This high degree of variability in gene expression across biological populations makes it a challenging task to identify key regulators of bacterial adaptation. Here, we research the regulation of adaptive resistance by investigating transcriptome profiles of Escherichia coli upon adaptation to disparate toxins, including antibiotics and biofuels. We locate potential target genes via conventional gene expression analysis as well as using a new analysis technique examining differential gene expression variability. By investigating trends across the diverse adaptation conditions, we identify a focused set of genes with conserved behavior, including those involved in cell motility, metabolism, membrane structure, and transport, and several genes of unknown function. To validate the biological relevance of the observed changes, we synthetically perturb gene expression using clustered regularly interspaced short palindromic repeat (CRISPR)-dCas9. Manipulation of select genes in combination with antibiotic treatment promotes adaptive resistance as demonstrated by an increased degree of antibiotic tolerance and heterogeneity in MICs. We study the mechanisms by which identified genes influence adaptation and find that select differentially variable genes have the potential to impact metabolic rates, mutation rates, and motility. Overall, this work provides evidence for a complex nongenetic response, encompassing shifts in gene expression and gene expression variability, which underlies adaptive resistance. IMPORTANCE Even initially sensitive bacteria can rapidly thwart antibiotic treatment through stress

Immobilization of Trametes versicolor cultures for improving laccase production in bubble column reactor intensified by sonication.

PubMed

Wang, Feng; Guo, Chen; Liu, Chun-Zhao

2013-01-01

The mycelia of Trametes versicolor immobilized in alginate beads provided higher laccase production than that in pelleted form. An efficient ultrasonic treatment enhanced laccase production from the immobilized T. versicolor cultures. The optimized treatment process consisted of exposing 36-h-old bead cultures to 7-min ultrasonic treatments twice with a 12-h interval using a fixed ultrasonic power and frequency (120 W, 40 kHz). Using the intensification strategy with sonication, laccase production increased by more than 2.1-fold greater than the untreated control in both flasks and bubble column reactors. The enhancement of laccase production by ultrasonic treatment is related to the improved mass transfer of nutrients and product between the liquid medium and the gel matrix. These results provide a basis for the large-scale and highly-efficient production of laccase using sonobioreactors.

Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, P.J.; Dobson, A.D.W.; Kotterman, M.J.J.

1996-12-01

Polycyclic aromatic hydrocarbons, particularly benzene homologs, are highly toxic organic pollutants. One of the three major groups of extracellular oxidative enzymes involved in the white rot fungal lignin degradative process are laccases. This study presents evidence indicating that laccase has a role in PAH oxidation by white rot fungi. 36 refs., 5 figs., 1 tab.

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

PubMed

Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

2011-10-01

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

A high effective NADH-ferricyanide dehydrogenase coupled with laccase for NAD(+) regeneration.

PubMed

Wang, Jizhong; Yang, Chengli; Chen, Xing; Bao, Bingxin; Zhang, Xuan; Li, Dali; Du, Xingfan; Shi, Ruofu; Yang, Junfang; Zhu, Ronghui

2016-08-01

To find an efficient and cheap system for NAD(+) regeneration A NADH-ferricyanide dehydrogenase was obtained from an isolate of Escherichia coli. Optimal activity of the NADH dehydrogenase was at 45 °C and pH 7.5, with a K m value for NADH of 10 μM. By combining the NADH dehydrogenase, potassium ferricyanide and laccase, a bi-enzyme system for NAD(+) regeneration was established. The system is attractive in that the O2 consumed by laccase is from air and the sole byproduct of the reaction is water. During the reaction process, 10 mM NAD(+) was transformed from NADH in less than 2 h under the condition of 0.5 U NADH dehydrogenase, 0.5 U laccase, 0.1 mM potassium ferricyanide at pH 5.6, 30 °C CONCLUSION: The bi-enzyme system employed the NADH-ferricyanide dehydrogenase and laccase as catalysts, and potassium ferricyanide as redox mediator, is a promising alternative for NAD(+) regeneration.

Modeling of growth and laccase production by Pycnoporus sanguineus.

PubMed

Saat, Muhammad Naziz; Annuar, Mohamad Suffian Mohamad; Alias, Zazali; Chuan, Ling Tau; Chisti, Yusuf

2014-05-01

Production of extracellular laccase by the white-rot fungus Pycnoporus sanguineus was examined in batch submerged cultures in shake flasks, baffled shake flasks and a stirred tank bioreactor. The biomass growth in the various culture systems closely followed a logistic growth model. The production of laccase followed a Luedeking-Piret model. A modified Luedeking-Piret model incorporating logistic growth effectively described the consumption of glucose. Biomass productivity, enzyme productivity and substrate consumption were enhanced in baffled shake flasks relative to the cases for the conventional shake flasks. This was associated with improved oxygen transfer in the presence of the baffles. The best results were obtained in the stirred tank bioreactor. At 28 °C, pH 4.5, an agitation speed of 600 rpm and a dissolved oxygen concentration of ~25 % of air saturation, the laccase productivity in the bioreactor exceeded 19 U L(-1 )days(-1), or 1.5-fold better than the best case for the baffled shake flask. The final concentration of the enzyme was about 325 U L(-1).

Plasticity of laccase generated by homeologous recombination in yeast.

PubMed

Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry

2009-10-01

Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.

Kraft Pulp Biobleaching and Mediated Oxidation of a Nonphenolic Substrate by Laccase from Streptomyces cyaneus CECT 3335

PubMed Central

Arias, M. Enriqueta; Arenas, María; Rodríguez, Juana; Soliveri, Juan; Ball, Andrew S.; Hernández, Manuel

2003-01-01

A new laccase (EC 1.10.3.2) produced by Streptomyces cyaneus CECT 3335 in liquid media containing soya flour (20 g per liter) was purified to homogeneity. The physicochemical, catalytic, and spectral characteristics of this enzyme, as well as its suitability for biobleaching of eucalyptus kraft pulps, were assessed. The purified laccase had a molecular mass of 75 kDa and an isoelectric point of 5.6, and its optimal pH and temperature were 4.5 and 70°C, respectively. The activity was strongly enhanced in the presence of Cu2+, Mn2+, and Mg2+ and was completely inhibited by EDTA and sodium azide. The purified laccase exhibited high levels of activity against 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and 2,6-dimethoxyphenol and no activity against tyrosine. The UV-visible spectrum of the purified laccase was the typical spectrum of the blue laccases, with an absorption peak at 600 nm and a shoulder around 330 to 340 nm. The ability of the purified laccase to oxidize a nonphenolic compound, such as veratryl alcohol, in the presence of ABTS opens up new possibilities for the use of bacterial laccases in the pulp and paper industry. We demonstrated that application of the laccase from S. cyaneus in the presence of ABTS to biobleaching of eucalyptus kraft pulps resulted in a significant decrease in the kappa number (2.3 U) and an important increase in the brightness (2.2%, as determined by the International Standard Organization test) of pulps, showing the suitability of laccases produced by streptomycetes for industrial purposes. PMID:12676669

Quantification of the Influence of Extracellular Laccase and Intracellular Reactions on the Isomer-Specific Biotransformation of the Xenoestrogen Technical Nonylphenol by the Aquatic Hyphomycete Clavariopsis aquatica▿

PubMed Central

Martin, Claudia; Corvini, Philippe F. X.; Vinken, Ralph; Junghanns, Charles; Krauss, Gudrun; Schlosser, Dietmar

2009-01-01

The aquatic hyphomycete Clavariopsis aquatica was used to quantify the effects of extracellular laccase and intracellular reactions on the isomer-specific biotransformation of technical nonylphenol (t-NP). In laccase-producing cultures, maximal removal rates of t-NP and the isomer 4-(1-ethyl-1,4-dimethylpentyl)phenol (NP112) were about 1.6- and 2.4-fold higher, respectively, than in laccase-lacking cultures. The selective suppression of either laccase or intracellular reactions resulted in essentially comparable maximal removal rates for both compounds. Evidence for an unspecific oxidation of t-NP isomers was consistently obtained from laccase-expressing fungal cultures when intracellular biotransformation was suppressed and from reaction mixtures containing isolated laccase. This observation contrasts with the selective degradation of t-NP isomers by bacteria and should prevent the enrichment of highly estrogenic isomers in remaining t-NP. In contrast with laccase reactions, intracellular fungal biotransformation caused a significant shift in the isomeric composition of remaining t-NP. As a result, certain t-NP constituents related to more estrogenic isomers were less efficiently degraded than others. In contrast to bacterial degradation via ipso-hydroxylation, the substitution pattern of the quaternary α-carbon of t-NP isomers does not seem to be very important for intracellular transformation in C. aquatica. As-yet-unknown intracellular enzymes are obviously induced by nonylphenols. Mass spectral data of the metabolites resulting from the intracellular oxidation of t-NP, NP112, and 4-(1-ethyl-1,3-dimethylpentyl)phenol indicate nonyl chain hydroxylation, further oxidation into keto or aldehyde compounds, and the subsequent formation of carboxylic acid derivatives. Further metabolites suggest nonyl chain desaturation and methylation of carboxylic acids. The phenolic moieties of the nonylphenols remained unchanged. PMID:19429559

Copper and dyes enhance laccase production in gamma-proteobacterium JB.

PubMed

Malhotra, Kanam; Sharma, Prince; Capalash, Neena

2004-07-01

Laccase production in gamma-proteobacterium JB was enhanced 13-fold by adding 0.1 mM CuSO(4) 24 h after the onset of growth. Ethidium bromide (2.5 microM), Malachite Green, Phenol Red and Thymol Blue (10 microM each) enhanced laccase production 17-, 19-, 4- and 2-fold, respectively. Among the fourteen aromatic/organic compounds tried, p-aminobenzoic acid and an industrial effluent, from where the organism was isolated, showed 1.2- and 1.26-fold increases in production.

Gene expression inference with deep learning

PubMed Central

Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui

2016-01-01

Motivation: Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. Results: We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. Availability and implementation: D-GEX is available at https://github.com/uci-cbcl/D-GEX. Contact: xhx@ics.uci.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26873929

Gene expression inference with deep learning.

PubMed

Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui

2016-06-15

Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. D-GEX is available at https://github.com/uci-cbcl/D-GEX CONTACT: xhx@ics.uci.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Optimization of media components for laccase production by litter dwelling fungal isolate Fusarium incarnatum LD-3.

PubMed

Chhaya, Urvish; Gupte, Akshaya

2010-02-01

Laccase production by solid state fermentation (SSF) using an indigenously isolated litter dwelling fungus Fusarium incarnatum LD-3 was optimized. Fourteen medium components were screened by the initial screening method of Plackett-Burman. Each of the components was screened on the basis of 'p' (probability value) which was above 95% confidence level. Ortho-dianisidine, thiamine HCl and CuSO(4) . 5 H(2)O were identified as significant components for laccase production. The Central Composite Design response surface methodology was then applied to further optimize the laccase production. The optimal concentration of these three medium components for higher laccase production were (g/l): CuSO(4) . 5 H(2)O, 0.01; thiamine HCl, 0.0136 and ortho-dianisidine, 0.388 mM served as an inducer. Wheat straw, 5.0 g was used as a solid substrate. Using this statistical optimization method the laccase production was found to increase from 40 U/g to 650 U/g of wheat straw, which was sixteen times higher than non optimized medium. This is the first report on statistical optimization of laccase production from Fusarium incarnatum LD-3.

Oxidative polymerization of lignins by laccase in water-acetone mixture.

PubMed

Fiţigău, Ionița Firuța; Peter, Francisc; Boeriu, Carmen Gabriela

2013-01-01

The enzymatic oxidative polymerization of five technical lignins with different molecular properties, i.e. Soda Grass/Wheat straw Lignin, Organosolv Hardwood Lignin, Soda Wheat straw Lignin, Alkali pretreated Wheat straw Lignin, and Kraft Softwood was studied. All lignins were previously fractionated by acetone/water 50:50 (v/v) and the laccase-catalyzed polymerization of the low molecular weight fractions (Mw < 4000 g/mol) was carried out in the same solvent system. Reactivity of lignin substrates in laccase-catalyzed reactions was determined by monitoring the oxygen consumption. The oxidation reactions in 50% acetone in water mixture proceed with high rate for all tested lignins. Polymerization products were analyzed by size exclusion chromatography, FT-IR, and (31)P-NMR and evidence of important lignin modifications after incubation with laccase. Lignin polymers with higher molecular weight (Mw up to 17500 g/mol) were obtained. The obtained polymers have potential for applications in bioplastics, adhesives and as polymeric dispersants.

Sonochemical and hydrodynamic cavitation reactors for laccase/hydrogen peroxide cotton bleaching.

PubMed

Gonçalves, Idalina; Martins, Madalena; Loureiro, Ana; Gomes, Andreia; Cavaco-Paulo, Artur; Silva, Carla

2014-03-01

The main goal of this work is to develop a novel and environmental-friendly technology for cotton bleaching with reduced processing costs. This work exploits a combined laccase-hydrogen peroxide process assisted by ultrasound. For this purpose, specific reactors were studied, namely ultrasonic power generator type K8 (850 kHz) and ultrasonic bath equipment Ultrasonic cleaner USC600TH (45 kHz). The optimal operating conditions for bleaching were chosen considering the highest levels of hydroxyl radical production and the lowest energy input. The capacity to produce hydroxyl radicals by hydrodynamic cavitation was also assessed in two homogenizers, EmulsiFlex®-C3 and APV-2000. Laccase nanoemulsions were produced by high pressure homogenization using BSA (bovine serum albumin) as emulsifier. The bleaching efficiency of these formulations was tested and the results showed higher whiteness values when compared to free laccase. The combination of laccase-hydrogen peroxide process with ultrasound energy produced higher whiteness levels than those obtained by conventional methods. The amount of hydrogen peroxide was reduced 50% as well as the energy consumption in terms of temperature (reduction of 40 °C) and operating time (reduction of 90 min). Copyright © 2013 Elsevier Inc. All rights reserved.

A novel multicopper oxidase (laccase) from cyanobacteria: Purification, characterization with potential in the decolorization of anthraquinonic dye.

PubMed

Afreen, Sumbul; Shamsi, Tooba Naz; Baig, Mohd Affan; Ahmad, Nadeem; Fatima, Sadaf; Qureshi, M Irfan; Hassan, Md Imtaiyaz; Fatma, Tasneem

2017-01-01

A novel extracellular laccase enzyme produced from Spirulina platensis CFTRI was purified by ultrafiltration, cold acetone precipitation, anion exchange and size exclusion chromatography with 51.5% recovery and 5.8 purification fold. The purified laccase was a monomeric protein with molecular mass of ~66 kDa that was confirmed by zymogram analysis and peptide mass fingerprinting. The optimum pH and temperature of the enzyme activity was found at 3.0 and 30°C using ABTS as substrate but the enzyme was quite stable at high temperature and alkaline pH. The laccase activity was enhanced by Cu+2, Zn+2 and Mn+2. In addition, the dye decolorization potential of purified laccase was much higher in terms of extent as well as time. The purified laccase decolorized (96%) of anthraquinonic dye Reactive blue- 4 within 4 h and its biodegradation studies was monitored by UV visible spectra, FTIR and HPLC which concluded that cyanobacterial laccase can be efficiently used to decolorize synthetic dye and help in waste water treatment.

A novel multicopper oxidase (laccase) from cyanobacteria: Purification, characterization with potential in the decolorization of anthraquinonic dye

PubMed Central

Afreen, Sumbul; Shamsi, Tooba Naz; Baig, Mohd Affan; Ahmad, Nadeem; Fatima, Sadaf; Qureshi, M. Irfan; Hassan, Md. Imtaiyaz

2017-01-01

A novel extracellular laccase enzyme produced from Spirulina platensis CFTRI was purified by ultrafiltration, cold acetone precipitation, anion exchange and size exclusion chromatography with 51.5% recovery and 5.8 purification fold. The purified laccase was a monomeric protein with molecular mass of ~66 kDa that was confirmed by zymogram analysis and peptide mass fingerprinting. The optimum pH and temperature of the enzyme activity was found at 3.0 and 30°C using ABTS as substrate but the enzyme was quite stable at high temperature and alkaline pH. The laccase activity was enhanced by Cu+2, Zn+2 and Mn+2. In addition, the dye decolorization potential of purified laccase was much higher in terms of extent as well as time. The purified laccase decolorized (96%) of anthraquinonic dye Reactive blue- 4 within 4 h and its biodegradation studies was monitored by UV visible spectra, FTIR and HPLC which concluded that cyanobacterial laccase can be efficiently used to decolorize synthetic dye and help in waste water treatment. PMID:28384218

Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipov, E. M., E-mail: e.m.osipov@gmail.com; Polyakov, K. M.; Engelhardt Institute of Molecular Biology, Vavilova str. 32, Moscow 119991

2015-11-18

The restoration of the native form of laccase from B. aclada from the type 2 copper-depleted form of the enzyme was investigated. Copper ions were found to be incorporated into the active site after soaking the depleted enzyme in a Cu{sup +}-containing solution. Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. Withmore » the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu{sup +}- and Cu{sup 2+}-containing solutions. Copper ions were found to be incorporated into the active site only when Cu{sup +} was used. A comparative analysis of the native and depleted forms of the enzymes was performed.« less

Aldehyde PEGylation of laccase from Trametes versicolor in route to increase its stability: effect on enzymatic activity.

PubMed

Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco

2015-03-01

Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12 mg/ml), reaction time (4 and 17 h), molecular weight, and type of mPEG (20, 30, 40 kDa and 40 kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12 mg/ml of laccase, molar ratio 1:4, and 4 h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. Copyright © 2015 John Wiley & Sons, Ltd.

Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.

PubMed

Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

2015-09-01

Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase.

Enhanced production of laccase from Coriolus versicolor NCIM 996 by nutrient optimization using response surface methodology.

PubMed

Arockiasamy, Santhiagu; Krishnan, Indira Packialakshmi Gurusamy; Anandakrishnan, Nimalanandan; Seenivasan, Sabitha; Sambath, Agalya; Venkatasubramani, Janani Priya

2008-12-01

Plackett and Burman design criterion and central composite design were applied successfully for enhanced production of laccase by Coriolus versicolor NCIM 996 for the first time. Plackett and Burman design criterion was applied to screen the significance of ten nutrients on laccase production by C. versicolor NCIM 996. Out of the ten nutrients tested, starch, yeast extract, MnSO(4), MgSO(4) x 7H(2)O, and phenol were found to have significant effect on laccase production. A central composite design was applied to determine the optimum concentrations of the significant variables obtained from Plackett-Burman design. The optimized medium composition for production of laccase was (g/l): starch, 30.0; yeast extract, 4.53; MnSO(4), 0.002; MgSO(4) x 7H(2)O, 0.755; and phenol, 0.026, and the optimum laccase production was 6,590.26 (U/l), which was 7.6 times greater than the control.

The laccase-like reactivity of manganese oxide nanomaterials for pollutant conversion: rate analysis and cyclic voltammetry.

PubMed

Wang, Xinghao; Liu, Jiaoqin; Qu, Ruijuan; Wang, Zunyao; Huang, Qingguo

2017-08-10

Nanostructured manganese oxides, e.g. MnO 2 , have shown laccase-like catalytic activities, and are thus promising for pollutant oxidation in wastewater treatment. We have systematically compared the laccase-like reactivity of manganese oxide nanomaterials of different crystallinity, including α-, β-, γ-, δ-, and ɛ-MnO 2 , and Mn 3 O 4 , with 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 17β-estradiol (E2) as the probing substrates. The reaction rate behaviors were examined with regard to substrate oxidation and oxygen reduction to evaluate the laccase-like catalysis of the materials, among which γ-MnO 2 exhibits the best performance. Cyclic voltammetry (CV) was employed to assess the six MnO x nanomaterials, and the results correlate well with their laccase-like catalytic activities. The findings help understand the mechanisms of and the factors controlling the laccase-like reactivity of different manganese oxides nanomaterials, and provide a basis for future design and application of MnO x -based catalysts.

Renal Gene Expression Database (RGED): a relational database of gene expression profiles in kidney disease

PubMed Central

Zhang, Qingzhou; Yang, Bo; Chen, Xujiao; Xu, Jing; Mei, Changlin; Mao, Zhiguo

2014-01-01

We present a bioinformatics database named Renal Gene Expression Database (RGED), which contains comprehensive gene expression data sets from renal disease research. The web-based interface of RGED allows users to query the gene expression profiles in various kidney-related samples, including renal cell lines, human kidney tissues and murine model kidneys. Researchers can explore certain gene profiles, the relationships between genes of interests and identify biomarkers or even drug targets in kidney diseases. The aim of this work is to provide a user-friendly utility for the renal disease research community to query expression profiles of genes of their own interest without the requirement of advanced computational skills. Availability and implementation: Website is implemented in PHP, R, MySQL and Nginx and freely available from http://rged.wall-eva.net. Database URL: http://rged.wall-eva.net PMID:25252782

Renal Gene Expression Database (RGED): a relational database of gene expression profiles in kidney disease.

PubMed

Zhang, Qingzhou; Yang, Bo; Chen, Xujiao; Xu, Jing; Mei, Changlin; Mao, Zhiguo

2014-01-01

We present a bioinformatics database named Renal Gene Expression Database (RGED), which contains comprehensive gene expression data sets from renal disease research. The web-based interface of RGED allows users to query the gene expression profiles in various kidney-related samples, including renal cell lines, human kidney tissues and murine model kidneys. Researchers can explore certain gene profiles, the relationships between genes of interests and identify biomarkers or even drug targets in kidney diseases. The aim of this work is to provide a user-friendly utility for the renal disease research community to query expression profiles of genes of their own interest without the requirement of advanced computational skills. Website is implemented in PHP, R, MySQL and Nginx and freely available from http://rged.wall-eva.net. http://rged.wall-eva.net. © The Author(s) 2014. Published by Oxford University Press.

Combinatorial evaluation of the laccase-mediator system (LMS) in the oxidation of veratryl alcohol

USDA-ARS?s Scientific Manuscript database

Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both co...

Gene Expression Profiling of Gastric Cancer

PubMed Central

Marimuthu, Arivusudar; Jacob, Harrys K.C.; Jakharia, Aniruddha; Subbannayya, Yashwanth; Keerthikumar, Shivakumar; Kashyap, Manoj Kumar; Goel, Renu; Balakrishnan, Lavanya; Dwivedi, Sutopa; Pathare, Swapnali; Dikshit, Jyoti Bajpai; Maharudraiah, Jagadeesha; Singh, Sujay; Sameer Kumar, Ghantasala S; Vijayakumar, M.; Veerendra Kumar, Kariyanakatte Veeraiah; Premalatha, Chennagiri Shrinivasamurthy; Tata, Pramila; Hariharan, Ramesh; Roa, Juan Carlos; Prasad, T.S.K; Chaerkady, Raghothama; Kumar, Rekha Vijay; Pandey, Akhilesh

2015-01-01

Gastric cancer is the second leading cause of cancer death worldwide, both in men and women. A genomewide gene expression analysis was carried out to identify differentially expressed genes in gastric adenocarcinoma tissues as compared to adjacent normal tissues. We used Agilent’s whole human genome oligonucleotide microarray platform representing ~41,000 genes to carry out gene expression analysis. Two-color microarray analysis was employed to directly compare the expression of genes between tumor and normal tissues. Through this approach, we identified several previously known candidate genes along with a number of novel candidate genes in gastric cancer. Testican-1 (SPOCK1) was one of the novel molecules that was 10-fold upregulated in tumors. Using tissue microarrays, we validated the expression of testican-1 by immunohistochemical staining. It was overexpressed in 56% (160/282) of the cases tested. Pathway analysis led to the identification of several networks in which SPOCK1 was among the topmost networks of interacting genes. By gene enrichment analysis, we identified several genes involved in cell adhesion and cell proliferation to be significantly upregulated while those corresponding to metabolic pathways were significantly downregulated. The differentially expressed genes identified in this study are candidate biomarkers for gastric adenoacarcinoma. PMID:27030788

A Laccase with HIV-1 Reverse Transcriptase Inhibitory Activity from the Broth of Mycelial Culture of the Mushroom Lentinus tigrinus

PubMed Central

Xu, LiJing; Wang, HeXiang; Ng, TziBun

2012-01-01

A 59 kDa laccase with inhibitory activity against HIV-1 reverse transcriptase (IC50 = 2.4 μM) was isolated from the broth of mycelial culture of the mushroom Lentinus tigrinus. The isolation procedure involved ion exchange chromatography on DEAE-cellulose and CM-cellulose, and gel filtration by fast protein liquid chromatography on Superdex 75. The laccase was adsorbed on both types of ion exchangers. About 95-fold purification was achieved with a 25.9% yield of the enzyme. The procedure resulted in a specific enzyme activity of 76.6 U/mg. Its N-terminal amino acid sequence was GIPDLHDLTV, which showed little similarity to other mushroom laccase and other Lentinus tigrinus strain laccase. Its characteristics were different from previously reported laccase of other Lentinus tigrinus strain. Maximal laccase activity was observed at a pH of 4 and at a temperature of 60°C, respectively. This study yielded the information about the potentially exploitable activities of Lentinus tigrinus laccase. PMID:22536022

Optimization and modeling of laccase production by Trametes versicolor in a bioreactor using statistical experimental design.

PubMed

Tavares, A P M; Coelho, M A Z; Agapito, M S M; Coutinho, J A P; Xavier, A M R B

2006-09-01

Experimental design and response surface methodologies were applied to optimize laccase production by Trametes versicolor in a bioreactor. The effects of three factors, initial glucose concentration (0 and 9 g/L), agitation (100 and 180 rpm), and pH (3.0 and 5.0), were evaluated to identify the significant effects and its interactions in the laccase production. The pH of the medium was found to be the most important factor, followed by initial glucose concentration and the interaction of both factors. Agitation did not seem to play an important role in laccase production, nor did the interaction agitation x medium pH and agitation x initial glucose concentration. Response surface analysis showed that an initial glucose concentration of 11 g/L and pH controlled at 5.2 were the optimal conditions for laccase production by T. versicolor. Under these conditions, the predicted value for laccase activity was >10,000 U/L, which is in good agreement with the laccase activity obtained experimentally (11,403 U/L). In addition, a mathematical model for the bioprocess was developed. It is shown that it provides a good description of the experimental profile observed, and that it is capable of predicting biomass growth based on secondary process variables.

Induction of lcc2 expression and activity by Agaricus bisporus provides defence against Trichoderma aggressivum toxic extracts

PubMed Central

Sjaarda, Calvin P; Abubaker, Kamal S; Castle, Alan J

2015-01-01

Laccases are used by fungi for several functions including defence responses to stresses associated with attack by other fungi. Laccase activity changes and the induction of two laccase genes, lcc1 and lcc2, in Agaricus bisporus were measured in response to toxic extracts of medium in which Trichoderma aggressivum, the cause of green mould disease, was grown. A strain of A. bisporus that shows resistance to the extracts showed higher basal levels and greater enzymatic activity after extract exposure than did a sensitive strain. Furthermore, pre-incubation of T. aggressivum extract with laccases reduced toxicity. Faster induction and greater numbers of lcc2 transcripts in response to the extract were noted in the resistant strain than in the sensitive strain. The timing and increase in lcc2 transcript abundance mirrored changes in total laccase activity. No correlation between resistance and lcc1 transcription was apparent. Transcript abundance in transformants with a siRNA construct homologous to both genes varied widely. A strong negative correlation between transcript abundance and sensitivity of the transformant to toxic extract was observed in plate assays. These results indicated that laccase activity and in particular that encoded by lcc2 contributes to toxin metabolism and by extension green mould disease resistance. PMID:25824278

T-cell lymphomas associated gene expression signature: Bioinformatics analysis based on gene expression Omnibus.

PubMed

Zhou, Lei-Lei; Xu, Xiao-Yue; Ni, Jie; Zhao, Xia; Zhou, Jian-Wei; Feng, Ji-Feng

2018-06-01

Due to the low incidence and the heterogeneity of subtypes, the biological process of T-cell lymphomas is largely unknown. Although many genes have been detected in T-cell lymphomas, the role of these genes in biological process of T-cell lymphomas was not further analyzed. Two qualified datasets were downloaded from Gene Expression Omnibus database. The biological functions of differentially expressed genes were evaluated by gene ontology enrichment and KEGG pathway analysis. The network for intersection genes was constructed by the cytoscape v3.0 software. Kaplan-Meier survival curves and log-rank test were employed to assess the association between differentially expressed genes and clinical characters. The intersection mRNAs were proved to be associated with fundamental processes of T-cell lymphoma cells. These intersection mRNAs were involved in the activation of some cancer-related pathways, including PI3K/AKT, Ras, JAK-STAT, and NF-kappa B signaling pathway. PDGFRA, CXCL12, and CCL19 were the most significant central genes in the signal-net analysis. The results of survival analysis are not entirely credible. Our findings uncovered aberrantly expressed genes and a complex RNA signal network in T-cell lymphomas and indicated cancer-related pathways involved in disease initiation and progression, providing a new insight for biotargeted therapy in T-cell lymphomas. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Properties of the glycoprotein laccase immobilized by two methods.

PubMed

Froehner, S C; Eriksson, K

1975-01-01

Laccase (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2) from Neurospora crassa has been immobilized by two different procedures: (1) Covalent attachment to Sepharose 4B activated with cyanogen bromide, and (2) Adsorption to Concanavalin A-Sepharose via the carbohydrate moiety. Except for small changes in the Michaelis-Menten constants, no differences were noted in the enzymological properties of the immobilized enzymes when compared to free enzyme. The carbohydrate moiety of laccase involved in the interaction with Concanavalin A does not appear to be closely associated with the active center since binding to the lectin has no effect on the enzymological parameters investigated.

Hybrid microfluidic fuel cell based on Laccase/C and AuAg/C electrodes.

PubMed

López-González, B; Dector, A; Cuevas-Muñiz, F M; Arjona, N; Cruz-Madrid, C; Arana-Cuenca, A; Guerra-Balcázar, M; Arriaga, L G; Ledesma-García, J

2014-12-15

A hybrid glucose microfluidic fuel cell composed of an enzymatic cathode (Laccase/ABTS/C) and an inorganic anode (AuAg/C) was developed and tested. The enzymatic cathode was prepared by adsorption of 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and Laccase on Vulcan XC-72, which act as a redox mediator, enzymatic catalyst and support, respectively. The Laccase/ABTS/C composite was characterised by Fourier Transform Infrared (FTIR) Spectroscopy, streaming current measurements (Zeta potential) and cyclic voltammetry. The AuAg/C anode catalyst was characterised by Transmission electron microscopy (TEM) and cyclic voltammetry. The hybrid microfluidic fuel cell exhibited excellent performance with a maximum power density value (i.e., 0.45 mW cm(-2)) that is the highest reported to date. The cell also exhibited acceptable stability over the course of several days. In addition, a Mexican endemic Laccase was used as the biocathode electrode and evaluated in the hybrid microfluidic fuel cell generating 0.5 mW cm(-2) of maximum power density. Copyright © 2014 Elsevier B.V. All rights reserved.

Bacterial exopolysaccharides as a modern biotechnological tool for modification of fungal laccase properties and metal ion binding.

PubMed

Osińska-Jaroszuk, Monika; Jaszek, Magdalena; Starosielec, Magdalena; Sulej, Justyna; Matuszewska, Anna; Janczarek, Monika; Bancerz, Renata; Wydrych, Jerzy; Wiater, Adrian; Jarosz-Wilkołazka, Anna

2018-03-26

Four bacterial EPSs extracted from Rhizobium leguminosarum bv. trifolii Rt24.2, Sinorhizobium meliloti Rm1021, Bradyrhizobium japonicum USDA110, and Bradyrhizobium elkanii USDA76 were determined towards their metal ion adsorption properties and possible modification of Cerrena unicolor laccase properties. The highest magnesium and iron ion-sorption capacity (~ 42 and ~ 14.5%, respectively) was observed for EPS isolated from B. japonicum USDA110. An evident influence of EPSs on the stability of laccase compared to the control values (without EPSs) was shown after 30-day incubation at 25 °C. The residual activity of laccases was obtained in the presence of Rh76EPS and Rh1021EPS, i.e., 49.5 and 41.5% of the initial catalytic activity, respectively. This result was confirmed by native PAGE electrophoresis. The EPS effect on laccase stability at different pH (from 3.8 to 7.0) was also estimated. The most significant changes at the optimum pH value (pH 5.8) was observed in samples of laccase stabilized by Rh76EPS and Rh1021EPS. Cyclic voltamperometry was used for analysis of electrochemical parameters of laccase stabilized by bacterial EPS and immobilized on single-walled carbon nanotubes (SWCNTs) with aryl residues. Laccases with Rh76EPS and Rh1021EPS had an evident shift of the value of the redox potential compared to the control without EPS addition. In conclusion, the results obtained in this work present a new potential use of bacterial EPSs as a metal-binding component and a modulator of laccase properties especially stability of enzyme activity, which can be a very effective tool in biotechnology and industrial applications.

Cross-linking proteins by laccase: Effects on the droplet size and rheology of emulsions stabilized by sodium caseinate.

PubMed

Sato, A C K; Perrechil, F A; Costa, A A S; Santana, R C; Cunha, R L

2015-09-01

The aim of this work was to evaluate the influence of laccase and ferulic acid on the characteristics of oil-in-water emulsions stabilized by sodium caseinate at different pH (3, 5 and 7). Emulsions were prepared by high pressure homogenization of soybean oil with sodium caseinate solution containing varied concentrations of laccase (0, 1 and 5mg/mL) and ferulic acid (5 and 10mM). Laccase treatment and pH exerted a strong influence on the properties with a consequent effect on stability, structure and rheology of emulsions stabilized by Na-caseinate. At pH7, O/W emulsions were kinetically stable due to the negative protein charge which enabled electrostatic repulsion between oil droplets resulting in an emulsion with small droplet size, low viscosity, pseudoplasticity and viscoelastic properties. The laccase treatment led to emulsions showing shear-thinning behavior as a result of a more structured system. O/W emulsions at pH5 and 3 showed phase separation due to the proximity to protein pI, but the laccase treatment improved their stability of emulsions especially at pH3. At pH3, the addition of ferulic acid and laccase produced emulsions with larger droplet size but with narrower droplet size distribution, increased viscosity, pseudoplasticity and viscoelastic properties (gel-like behavior). Comparing laccase treatments, the combined addition of laccase and ferulic acid generally produced emulsions with lower stability (pH5), larger droplet size (pH3, 5 and 7) and higher pseudoplasticity (pH5 and 7) than emulsion with only ferulic acid. The results suggested that the cross-linking of proteins by laccase and ferulic acid improved protein emulsifying properties by changing functional mechanisms of the protein on emulsion structure and rheology, showing that sodium caseinate can be successfully used in acid products when treated with laccase. Copyright © 2015 Elsevier Ltd. All rights reserved.

Decolorization of industrial synthetic dyes using engineered Pseudomonas putida cells with surface-immobilized bacterial laccase

PubMed Central

2012-01-01

Background Microbial laccases are highly useful in textile effluent dye biodegradation. However, the bioavailability of cellularly expressed or purified laccases in continuous operations is usually limited by mass transfer impediment or enzyme regeneration difficulty. Therefore, this study develops a regenerable bacterial surface-displaying system for industrial synthetic dye decolorization, and evaluates its effects on independent and continuous operations. Results A bacterial laccase (WlacD) was engineered onto the cell surface of the solvent-tolerant bacterium Pseudomonas putida to construct a whole-cell biocatalyst. Ice nucleation protein (InaQ) anchor was employed, and the ability of 1 to 3 tandemly aligned N-terminal repeats to direct WlacD display were compared. Immobilized WlacD was determined to be surface-displayed in functional form using Western blot analysis, immunofluorescence microscopy, flow cytometry, and whole-cell enzymatic activity assay. Engineered P. putida cells were then applied to decolorize the anthraquinone dye Acid Green (AG) 25 and diazo-dye Acid Red (AR) 18. The results showed that decolorization of both dyes is Cu2+- and mediator-independent, with an optimum temperature of 35°C and pH of 3.0, and can be stably performed across a temperature range of 15°C to 45°C. A high activity toward AG25 (1 g/l) with relative decolorization values of 91.2% (3 h) and 97.1% (18 h), as well as high activity to AR18 (1 g/l) by 80.5% (3 h) and 89.0% (18 h), was recorded. The engineered system exhibited a comparably high activity compared with those of separate dyes in a continuous three-round shake-flask decolorization of AG25/AR18 mixed dye (each 1 g/l). No significant decline in decolorization efficacy was noted during first two-rounds but reaction equilibriums were elongated, and the residual laccase activity eventually decreased to low levels. However, the decolorizing capacity of the system was easily retrieved via a subsequent 4-h

Reconstructing directed gene regulatory network by only gene expression data.

PubMed

Zhang, Lu; Feng, Xi Kang; Ng, Yen Kaow; Li, Shuai Cheng

2016-08-18

Accurately identifying gene regulatory network is an important task in understanding in vivo biological activities. The inference of such networks is often accomplished through the use of gene expression data. Many methods have been developed to evaluate gene expression dependencies between transcription factor and its target genes, and some methods also eliminate transitive interactions. The regulatory (or edge) direction is undetermined if the target gene is also a transcription factor. Some methods predict the regulatory directions in the gene regulatory networks by locating the eQTL single nucleotide polymorphism, or by observing the gene expression changes when knocking out/down the candidate transcript factors; regrettably, these additional data are usually unavailable, especially for the samples deriving from human tissues. In this study, we propose the Context Based Dependency Network (CBDN), a method that is able to infer gene regulatory networks with the regulatory directions from gene expression data only. To determine the regulatory direction, CBDN computes the influence of source to target by evaluating the magnitude changes of expression dependencies between the target gene and the others with conditioning on the source gene. CBDN extends the data processing inequality by involving the dependency direction to distinguish between direct and transitive relationship between genes. We also define two types of important regulators which can influence a majority of the genes in the network directly or indirectly. CBDN can detect both of these two types of important regulators by averaging the influence functions of candidate regulator to the other genes. In our experiments with simulated and real data, even with the regulatory direction taken into account, CBDN outperforms the state-of-the-art approaches for inferring gene regulatory network. CBDN identifies the important regulators in the predicted network: 1. TYROBP influences a batch of genes that are

Studies on Acetone Powder and Purified Rhus Laccase Immobilized on Zirconium Chloride for Oxidation of Phenols

PubMed Central

Lu, Rong; Miyakoshi, Tetsuo

2012-01-01

Rhus laccase was isolated and purified from acetone powder obtained from the exudates of Chinese lacquer trees (Rhus vernicifera) from the Jianshi region, Hubei province of China. There are two blue bands appearing on CM-sephadex C-50 chromatography column, and each band corresponding to Rhus laccase 1 and 2, the former being the major constituent, and each had an average molecular weight of approximately 110 kDa. The purified and crude Rhus laccases were immobilized on zirconium chloride in ammonium chloride solution, and the kinetic properties of free and immobilized Rhus laccase, such as activity, molecular weight, optimum pH, and thermostability, were examined. In addition, the behaviors on catalytic oxidation of phenols also were conducted. PMID:22545205

Monoallelic Gene Expression in Mammals.

PubMed

Chess, Andrew

2016-11-23

Monoallelic expression not due to cis-regulatory sequence polymorphism poses an intriguing problem in epigenetics because it requires the unequal treatment of two segments of DNA that are present in the same nucleus and that can indeed have absolutely identical sequences. Here, I focus on a few recent developments in the field of monoallelic expression that are of particular interest and raise interesting questions for future work. One development is regarding analyses of imprinted genes, in which recent work suggests the possibility that intriguing networks of imprinted genes exist and are important for genetic and physiological studies. Another issue that has been raised in recent years by a number of publications is the question of how skewed allelic expression should be for it to be designated as monoallelic expression and, further, what methods are appropriate or inappropriate for analyzing genomic data to examine allele-specific expression. Perhaps the most exciting recent development in mammalian monoallelic expression is a clever and carefully executed analysis of genetic diversity of autosomal genes subject to random monoallelic expression (RMAE), which provides compelling evidence for distinct evolutionary forces acting on random monoallelically expressed genes.

Flocculation and haze removal from crude beer using in-house produced laccase from Trametes versicolor cultured on brewer's spent grain.

PubMed

Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur; Verma, Mausam

2012-08-15

The potential of brewer's spent grain (BSG), a common waste from the brewing industry, as a support-substrate for laccase production by the well-known laccase producer Trametes versicolor ATCC 20869 under solid-state fermentation conditions was assessed. An attempt was made to improve the laccase production by T. versicolor through supplementing the cultures with inducers, such as 2,2-azino bis(3-ethylbenzthiazoline-6-sulfonic acid), copper sulfate, ethanol, gallic acid, veratryl alcohol, and phenol. A higher laccase activity of 13506.2 ± 138.2 IU/gds (gram dry substrate) was obtained with a phenol concentration of 10 mg/kg substrate in a tray bioreactor after 12 days of incubation time. The flocculation properties of the laccase treated crude beer samples have been studied by using various parameters, such as viscosity, turbidity, ζ potential, total polyphenols, and total protein content. The present results indicated that laccase (25 IU/L) showed promising results as a good flocculating agent. The laccase treatment showed better flocculation capacity compared to the industrial flocculation process using stabifix as a flocculant. The laccase treatments (25 IU/L) at 4 ± 1 °C and room temperature have shown almost similar flocculation properties without much variability. The study demonstrated the potential of in-house produced laccase using brewer's spent grain for the clarification and flocculation of crude beer as a sustainable alternative to traditional flocculants, such as stabifix and bentonite.

Laccase production by free and immobilized mycelia of Peniophora cinerea and Trametes versicolor: a comparative study.

PubMed

Silvério, Sara C; Moreira, Sérgio; Milagres, Adriane M F; Macedo, Eugénia A; Teixeira, José A; Mussatto, Solange I

2013-03-01

The production of laccase by immobilized mycelia of Peniophora cinerea and Trametes versicolor was studied. In an initial stage, experimental assays were performed in Erlenmeyer flasks using free and immobilized mycelium, and the performance of the fungal strains to produce the enzyme was compared. Both fungi adhered into the support material (a synthetic fiber), growing not only on the surface but also in the interspaces of the fibers. Immobilization of P. cinerea provided a 35-fold increase in laccase production when compared to the production obtained by using free mycelium. On the other hand, immobilization of T. versicolor caused a decrease in laccase activity. A comparison between the strains revealed that immobilized P. cinerea (3,500 U/L) surpassed the enzyme production by free T. versicolor (800 U/L). When the conditions that gave the best laccase production to each fungus were employed in a stirred tank bioreactor, very low laccase production was observed for both the cases, suggesting that shear stress and mycelia damage caused by the agitation impellers negatively affected the enzyme production.

Expressing genes do not forget their LINEs: transposable elements and gene expression

PubMed Central

Kines, Kristine J.; Belancio, Victoria P.

2012-01-01

1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807

Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.

PubMed

Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F

2013-01-01

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.

Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes

PubMed Central

Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

2013-01-01

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametes pubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

Radical Scavenging by Acetone: A New Perspective to Understand Laccase/ABTS Inactivation and to Recover Redox Mediator.

PubMed

Liu, Hao; Zhou, Pandeng; Wu, Xing; Sun, Jianliang; Chen, Shicheng

2015-11-04

The biosynthetic utilization of laccase/mediator system is problematic because the use of organic cosolvent causes significant inhibition of laccase activity. This work explored how the organic cosolvent impacts on the laccase catalytic capacity towards 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) in aqueous solution. Effects of acetone on the kinetic constants of laccase were determined and the results showed Km and Vmax varied exponentially with increasing acetone content. Acetone as well as some other cosolvents could transform ABTS radicals into its reductive form. The content of acetone in media significantly affected the radical scavenging rates. Up to 95% of the oxidized ABTS was successfully recovered in 80% (v/v) acetone in 60 min. This allows ABTS recycles at least six times with 70%-75% of active radicals recovered after each cycle. This solvent-based recovery strategy may help improve the economic feasibility of laccase/ABTS system in biosynthesis.

Potentiality of a ceramic membrane reactor for the laccase-catalyzed removal of bisphenol A from secondary effluents.

PubMed

Arca-Ramos, A; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T

2015-11-01

In this study, the removal of bisphenol A (BPA) by laccase in a continuous enzymatic membrane reactor (EMR) was investigated. The effects of key parameters, namely, type of laccase, pH, and enzyme activity, were initially evaluated. Once optimal conditions were determined, the continuous removal of the pollutant in an EMR was assessed in synthetic and real biologically treated wastewaters. The reactor configuration consisted of a stirred tank reactor coupled to a ceramic membrane, which prevented the sorption of the pollutant and allowed the recovery and recycling of laccase. Nearly complete removal of BPA was attained under both operation regimes with removal yields above 94.5 %. In experiments with real wastewater, the removal of BPA remained high while the presence of colloids and certain ions and the formation of precipitates on the membrane potentially affected enzyme stability and made necessary the periodic addition of laccase. Polymerization and degradation were observed as probable mechanisms of BPA transformation by laccase.

LacSubPred: predicting subtypes of Laccases, an important lignin metabolism-related enzyme class, using in silico approaches

PubMed Central

2014-01-01

Background Laccases (E.C. 1.10.3.2) are multi-copper oxidases that have gained importance in many industries such as biofuels, pulp production, textile dye bleaching, bioremediation, and food production. Their usefulness stems from the ability to act on a diverse range of phenolic compounds such as o-/p-quinols, aminophenols, polyphenols, polyamines, aryl diamines, and aromatic thiols. Despite acting on a wide range of compounds as a family, individual Laccases often exhibit distinctive and varied substrate ranges. This is likely due to Laccases involvement in many metabolic roles across diverse taxa. Classification systems for multi-copper oxidases have been developed using multiple sequence alignments, however, these systems seem to largely follow species taxonomy rather than substrate ranges, enzyme properties, or specific function. It has been suggested that the roles and substrates of various Laccases are related to their optimal pH. This is consistent with the observation that fungal Laccases usually prefer acidic conditions, whereas plant and bacterial Laccases prefer basic conditions. Based on these observations, we hypothesize that a descriptor-based unsupervised learning system could generate homology independent classification system for better describing the functional properties of Laccases. Results In this study, we first utilized unsupervised learning approach to develop a novel homology independent Laccase classification system. From the descriptors considered, physicochemical properties showed the best performance. Physicochemical properties divided the Laccases into twelve subtypes. Analysis of the clusters using a t-test revealed that the majority of the physicochemical descriptors had statistically significant differences between the classes. Feature selection identified the most important features as negatively charges residues, the peptide isoelectric point, and acidic or amidic residues. Secondly, to allow for classification of new Laccases

Crystal structures of E. coli laccase CueO at different copper concentrations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Xu; Wei Zhiyi; National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101

2007-03-02

CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra {alpha}-helixmore » from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper.« less

Analysis of bHLH coding genes using gene co-expression network approach.

PubMed

Srivastava, Swati; Sanchita; Singh, Garima; Singh, Noopur; Srivastava, Gaurava; Sharma, Ashok

2016-07-01

Network analysis provides a powerful framework for the interpretation of data. It uses novel reference network-based metrices for module evolution. These could be used to identify module of highly connected genes showing variation in co-expression network. In this study, a co-expression network-based approach was used for analyzing the genes from microarray data. Our approach consists of a simple but robust rank-based network construction. The publicly available gene expression data of Solanum tuberosum under cold and heat stresses were considered to create and analyze a gene co-expression network. The analysis provide highly co-expressed module of bHLH coding genes based on correlation values. Our approach was to analyze the variation of genes expression, according to the time period of stress through co-expression network approach. As the result, the seed genes were identified showing multiple connections with other genes in the same cluster. Seed genes were found to be vary in different time periods of stress. These analyzed seed genes may be utilized further as marker genes for developing the stress tolerant plant species.

Selective oxidation of lignin model compounds – a combinatorial application of the laccase-mediator system

USDA-ARS?s Scientific Manuscript database

Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

GENE EXPRESSION NETWORKS

EPA Science Inventory

"Gene expression network" is the term used to describe the interplay, simple or complex, between two or more gene products in performing a specific cellular function. Although the delineation of such networks is complicated by the existence of multiple and subtle types of intera...

A novel ethanol-tolerant laccase, Tvlac, from Trametes versicolor.

PubMed

Chen, Lei; Yi, Xiaoming; Deng, Fajun; Fang, Wei; Zhang, Xuecheng; Wang, Xiaotang; Fang, Zemin; Xiao, Yazhong

2016-03-01

To produce and characterize novel laccases with ethanol tolerance from Trametes versicolor using agriculture by-products as energy source. Trametes versicolor 1017 produces two laccase isoenzymes with a total activity of 10 U ml(-1) within 8 days when using wheat bran and peanut powder as energy sources in liquid culture medium. A novel isoenzyme, named Tvlac, was identified, purified and characterized. Its optimum pH and temperature were from 4.5 to 5 and 55 to 60 °C, respectively. Its activity was stimulated by ethanol at 10 % (v/v) which increased the V 0. The biochemical properties of Tvlac substantiate the potential of this enzyme for applications under an aqueous ethanol mixture environment.

Modification of lignocellulosic materials by laccase

Treesearch

William Kenealy; John Klungness; Mandla Tshabalala; Roland Gleisner; Eric Horn; Masood Akhtar; Hilda Zulaica-Villagomez; Gisela Buschle-Diller

2003-01-01

Altering the surface properties of pulp can enhance binding, increase paper strength, and decrease the cost of fiber. In this study, we modified lignocellulosic materials (bark and pulp) with laccase and selected substrates to change the nature of the pulp surface. Modified pulps were evaluated by the amount of methylene blue (a cationic dye) that would bind to the...

Use of sugarcane molasses by Pycnoporus sanguineus for the production of laccase for dye decolorization.

PubMed

Marim, R A; Oliveira, A C C; Marquezoni, R S; Servantes, J P R; Cardoso, B K; Linde, G A; Colauto, N B; Valle, J S

2016-10-17

Pycnoporus sanguineus is a white-rot basidiomycete that produces laccase as the only oxidoreductase; enzyme synthesis depends on cultivation variables, and fungal species and strain. Laccases have wide substrate specificity, oxidize a broad range of compounds, and show potential for use in dye decolorization. We evaluated laccase production in a recently isolated strain of P. sanguineus cultivated with sugarcane molasses as the only carbon source, and urea or yeast extract as the nitrogen source [at various nitrogen concentrations (0.4, 1.4, 2.4, 3.4, and 4.4 g/L)], supplemented with copper (0, 150, 200, 250, and 300 µM), with or without agitation. The enzymatic extract produced at laccase peak activity was tested for dye decolorization capability on Remazol Brilliant Blue R, Reactive Black 5, Reactive Red 195, and Reactive Yellow 145. The nitrogen source did not affect enzyme production and the higher nitrogen concentration (3.4 g/L nitrogen as urea) increased enzymatic activity. The addition of up to 300 µM of Cu did not affect laccase production, whereas cultivation with agitation increased the activity peak by 17%. The highest laccase activity was ~50,000 U/L on the ninth day of cultivation. After 24 h, decolorization was 80% for Remazol Brilliant Blue R, 9% for Reactive Yellow 145, 6% for Reactive Red 195, and 2% for Reactive Black 5. The enzymatic extract of P. sanguineus provides a potential alternative to wastewater treatment. A better understanding of the behavior of this fungus under various culture conditions would allow improvement of the enzyme production bioprocess.

Arabidopsis gene expression patterns during spaceflight

NASA Astrophysics Data System (ADS)

Paul, A.-L.; Ferl, R. J.

The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

Ecofriendly syntheses of phenothiazones and related structures facilitated by laccase – A comparative study

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2016-07-06

The biocatalytic synthesis of phenothiazones and related compounds has been achieved in an aqueous system under mild conditions facilitated by laccase oxidation. It was found that by coupling 2-aminothiophenol directly with 1,4-quinones, the product yields could be significantly increased compared to generating the 1,4-quinones in situ from the corresponding hydroquinones via laccase oxidation. However, laccase still proved to be pivotal for achieving highest product yields by catalyzing the final oxidation step. Furthermore, a difference in reactivity of aromatic and aliphatic amines toward 1,4-naphthoquinone is observed. Furthermore, this study provides a sustainable approach to the synthesis of a biologically important classmore » of compounds.« less

Enhanced phenol degradation in coking wastewater by immobilized laccase on magnetic mesoporous silica nanoparticles in a magnetically stabilized fluidized bed.

PubMed

Wang, Feng; Hu, Yiru; Guo, Chen; Huang, Wei; Liu, Chun-Zhao

2012-04-01

The immobilized laccase on magnetic mesoporous silica nanoparticles has been developed for efficient phenol degradation. The degradation rate of phenol by the immobilized laccase was 2-fold higher than that of the free laccase, and the immobilized laccase retained 71.3% of its initial degradation ability after 10 successive batch treatments of coking wastewater. The phenol degradation in the coking wastewater was enhanced in a continuous treatment process by the immobilized laccase in a magnetically stabilized fluidized bed (MSFB) because of good mixing and mass transfer. The degradation rate of phenol maintained more than 99% at a flow rate of less than 450mLh(-1) and decreased slowly to 91.5% after 40h of the continuous operation in the MSFB. The present work indicated that the immobilized laccase on magnetic mesoporous supports together with the MSFB provided a promising avenue for the continuous enzymatic degradation of phenolic compounds in industrial wastewater. Copyright © 2012 Elsevier Ltd. All rights reserved.

Candidate genes for panhypopituitarism identified by gene expression profiling

PubMed Central

Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

2011-01-01

Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

Alternative-splicing-mediated gene expression

NASA Astrophysics Data System (ADS)

Wang, Qianliang; Zhou, Tianshou

2014-01-01

Alternative splicing (AS) is a fundamental process during gene expression and has been found to be ubiquitous in eukaryotes. However, how AS impacts gene expression levels both quantitatively and qualitatively remains to be fully explored. Here, we analyze two common models of gene expression, each incorporating a simple splice mechanism that a pre-mRNA is spliced into two mature mRNA isoforms in a probabilistic manner. In the constitutive expression case, we show that the steady-state molecular numbers of two mature mRNA isoforms follow mutually independent Poisson distributions. In the bursting expression case, we demonstrate that the tail decay of the steady-state distribution for both mature mRNA isoforms that in general are not mutually independent can be characterized by the product of mean burst size and splicing probability. In both cases, we find that AS can efficiently modulate both the variability (measured by variance) and the noise level of the total mature mRNA, and in particular, the latter is always lower than the noise level of the pre-mRNA, implying that AS always reduces the noise. These results altogether reveal that AS is a mechanism of efficiently controlling the gene expression noise.

Gene Expression Noise, Fitness Landscapes, and Evolution

NASA Astrophysics Data System (ADS)

Charlebois, Daniel

The stochastic (or noisy) process of gene expression can have fitness consequences for living organisms. For example, gene expression noise facilitates the development of drug resistance by increasing the time scale at which beneficial phenotypic states can be maintained. The present work investigates the relationship between gene expression noise and the fitness landscape. By incorporating the costs and benefits of gene expression, we track how the fluctuation magnitude and timescale of expression noise evolve in simulations of cell populations under stress. We find that properties of expression noise evolve to maximize fitness on the fitness landscape, and that low levels of expression noise emerge when the fitness benefits of gene expression exceed the fitness costs (and that high levels of noise emerge when the costs of expression exceed the benefits). The findings from our theoretical/computational work offer new hypotheses on the development of drug resistance, some of which are now being investigated in evolution experiments in our laboratory using well-characterized synthetic gene regulatory networks in budding yeast. Nserc Postdoctoral Fellowship (Grant No. PDF-453977-2014).

Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation

PubMed Central

Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

2015-01-01

Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 μM, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

[Induce of laccase from Trametes gallica and its degradation on neutral dyes and organophosphorus pesticides].

PubMed

Jing, De-Jun; Huang, Jian-Bo; Yang, Zhou-Ping; Hu, Rong; Cheng, Zi-Zhang; Huang, Qian-Ming

2011-12-01

The characteristics of the induction of laccase in Trametes gallica under different initial cultural pH, incubation time by different inducers were discussed, as well as the effects of temperature, pH and time on laccase degradation of six dyes and four organophosphors. The results showed that RB-bright blue, ABTS and o-toluidine affected the production of laccase at different levels, and ABTS was the best inductive agent in our test conditions, whose optimal initial pH and incubation time were 4.0 and 13 days, respectively. The appropriate reaction temperature of the laccase produced was 38 degrees C, and it got a good stability, for it could retain 78.6% of the enzyme activity after 20 min holding at 40 degrees C. Mediated by ABTS, the optimal temperature for laccase to degrade the six types of neutral dyes could be divided into two cases, that was 30 degrees C (neutral black, neutral bordeaux, neutral pink, methyl orange) and 60 degrees C (neutral dark yellow, cresol red), the optimal pH were 6.0 (neutral black), 2.0 (neutral bordeaux, neutral pink) and 4.0 (methyl orange, neutral dark yellow, cresol red), respectively, while the optimal times separately were 6 h (methyl orange, neutral dark yellow, cresol red), 12 h (neutral pink) and 24 h (neutral bordeaux). And using the same inductive agent, the best temperature for laccase to degrade dimethoate, chlorpyrifos, trichlorfon and parathion-pyridazine was 25 degrees C, the suitable time was 9 h, and the optimal pH was 10.0 for dimethoate, chlorpyrifos and parathion-pyridazine, and 8.0 for trichlorfon.

Familial aggregation analysis of gene expressions

PubMed Central

Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K

2007-01-01

Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

HOXB homeobox gene expression in cervical carcinoma.

PubMed

López, R; Garrido, E; Piña, P; Hidalgo, A; Lazos, M; Ochoa, R; Salcedo, M

2006-01-01

The homeobox (HOX) genes are a family of transcription factors that bind to specific DNA sequences in target genes regulating gene expression. Thirty-nine HOX genes have been mapped in four conserved clusters: A, B, C, and D; they act as master genes regulating the identity of body segments along the anteroposterior axis of the embryo. The role played by HOX genes in adult cell differentiation is unclear to date, but growing evidence suggests that they may play an important role in the development of cancer. To study the role played by HOX genes in cervical cancer, in the present work, we analyzed the expression of HOXB genes and the localization of their transcripts in human cervical tissues. Reverse transcription-polymerase chain reaction analysis and nonradioactive RNA in situ hybridization were used to detect HOXB expression in 11 normal cervical tissues and 17 cervical carcinomas. It was determined that HOXB1, B3, B5, B6, B7, B8, and B9 genes are expressed in normal adult cervical epithelium and squamous cervical carcinomas. Interestingly, HOXB2, HOXB4, and HOXB13 gene expression was found only in tumor tissues. Our findings suggest that the new expression of HOXB2, HOXB4, and B13 genes is involved in cervical cancer.

Identifying potential maternal genes of Bombyx mori using digital gene expression profiling

PubMed Central

Xu, Pingzhen

2018-01-01

Maternal genes present in mature oocytes play a crucial role in the early development of silkworm. Although maternal genes have been widely studied in many other species, there has been limited research in Bombyx mori. High-throughput next generation sequencing provides a practical method for gene discovery on a genome-wide level. Herein, a transcriptome study was used to identify maternal-related genes from silkworm eggs. Unfertilized eggs from five different stages of early development were used to detect the changing situation of gene expression. The expressed genes showed different patterns over time. Seventy-six maternal genes were annotated according to homology analysis with Drosophila melanogaster. More than half of the differentially expressed maternal genes fell into four expression patterns, while the expression patterns showed a downward trend over time. The functional annotation of these material genes was mainly related to transcription factor activity, growth factor activity, nucleic acid binding, RNA binding, ATP binding, and ion binding. Additionally, twenty-two gene clusters including maternal genes were identified from 18 scaffolds. Altogether, we plotted a profile for the maternal genes of Bombyx mori using a digital gene expression profiling method. This will provide the basis for maternal-specific signature research and improve the understanding of the early development of silkworm. PMID:29462160

Time-Course Gene Set Analysis for Longitudinal Gene Expression Data

PubMed Central

Hejblum, Boris P.; Skinner, Jason; Thiébaut, Rodolphe

2015-01-01

Gene set analysis methods, which consider predefined groups of genes in the analysis of genomic data, have been successfully applied for analyzing gene expression data in cross-sectional studies. The time-course gene set analysis (TcGSA) introduced here is an extension of gene set analysis to longitudinal data. The proposed method relies on random effects modeling with maximum likelihood estimates. It allows to use all available repeated measurements while dealing with unbalanced data due to missing at random (MAR) measurements. TcGSA is a hypothesis driven method that identifies a priori defined gene sets with significant expression variations over time, taking into account the potential heterogeneity of expression within gene sets. When biological conditions are compared, the method indicates if the time patterns of gene sets significantly differ according to these conditions. The interest of the method is illustrated by its application to two real life datasets: an HIV therapeutic vaccine trial (DALIA-1 trial), and data from a recent study on influenza and pneumococcal vaccines. In the DALIA-1 trial TcGSA revealed a significant change in gene expression over time within 69 gene sets during vaccination, while a standard univariate individual gene analysis corrected for multiple testing as well as a standard a Gene Set Enrichment Analysis (GSEA) for time series both failed to detect any significant pattern change over time. When applied to the second illustrative data set, TcGSA allowed the identification of 4 gene sets finally found to be linked with the influenza vaccine too although they were found to be associated to the pneumococcal vaccine only in previous analyses. In our simulation study TcGSA exhibits good statistical properties, and an increased power compared to other approaches for analyzing time-course expression patterns of gene sets. The method is made available for the community through an R package. PMID:26111374

Hydrophobic modification of jute fiber used for composite reinforcement via laccase-mediated grafting

NASA Astrophysics Data System (ADS)

Dong, Aixue; Yu, Yuanyuan; Yuan, Jiugang; Wang, Qiang; Fan, Xuerong

2014-05-01

Jute fiber is a lignocellulosic material which could be utilized for reinforcement of composites. To improve the compatibility of hydrophilic jute fiber with hydrophobic resin, surface hydrophobization of the fiber is often needed. In this study, the feasibility of laccase-mediated grafting dodecyl gallate (DG) on the jute fiber was investigated. First, the grafting products were characterized by FT-IR, XPS, SEM and AFM. And then the grafting percentage (Gp) and the DG content of the modified jute were determined in terms of weighting and saponification, respectively. The parameters of the enzymatic grafting process were optimized to the target application. Lastly, the hydrophobicity of the jute fabrics was estimated by means of contact angle and wetting time. The mechanical properties and the fracture section of the jute fabric/polypropylene (PP) composites were studied. The results revealed covalently coupling of DG to the jute substrates mediated by laccase. The enzymatic process reached the maximum grafting rate of 4.16% when the jute fabric was incubated in the 80/20 (v/v, %) pH 3 0.2 M acetate buffer/ethanol medium with 1.0 U/mL laccase and 5 mM DG at 50 °C for 4 h. The jute fabric modified with laccase and DG showed increased contact angle of 111.49° and wetting time of at least 30 min, indicating that the surface hydrophobicity of the jute fabric was increased after the enzymatic graft modification with hydrophobic DG. The breaking strength of the modified jute fiber/PP composite was also increased and the fracture section became neat and regular due to the laccase-assisted grafting with DG.

Pre-gastrula expression of zebrafish extraembryonic genes

PubMed Central

2010-01-01

Background Many species form extraembryonic tissues during embryogenesis, such as the placenta of humans and other viviparous mammals. Extraembryonic tissues have various roles in protecting, nourishing and patterning embryos. Prior to gastrulation in zebrafish, the yolk syncytial layer - an extraembryonic nuclear syncytium - produces signals that induce mesoderm and endoderm formation. Mesoderm and endoderm precursor cells are situated in the embryonic margin, an external ring of cells along the embryo-yolk interface. The yolk syncytial layer initially forms below the margin, in a domain called the external yolk syncytial layer (E-YSL). Results We hypothesize that key components of the yolk syncytial layer's mesoderm and endoderm inducing activity are expressed as mRNAs in the E-YSL. To identify genes expressed in the E-YSL, we used microarrays to compare the transcription profiles of intact pre-gastrula embryos with pre-gastrula embryonic cells that we had separated from the yolk and yolk syncytial layer. This identified a cohort of genes with enriched expression in intact embryos. Here we describe our whole mount in situ hybridization analysis of sixty-eight of them. This includes ten genes with E-YSL expression (camsap1l1, gata3, znf503, hnf1ba, slc26a1, slc40a1, gata6, gpr137bb, otop1 and cebpa), four genes with expression in the enveloping layer (EVL), a superficial epithelium that protects the embryo (zgc:136817, zgc:152778, slc14a2 and elovl6l), three EVL genes whose expression is transiently confined to the animal pole (elovl6l, zgc:136359 and clica), and six genes with transient maternal expression (mtf1, wu:fj59f04, mospd2, rftn2, arrdc1a and pho). We also assessed the requirement of Nodal signaling for the expression of selected genes in the E-YSL, EVL and margin. Margin expression was Nodal dependent for all genes we tested, including the concentrated margin expression of an EVL gene: zgc:110712. All other instances of EVL and E-YSL expression that we

The Effect of Different Pollination on the Expression of Dangshan Su Pear MicroRNA

PubMed Central

Cheng, Xi; Yan, Chongchong; Zhang, Jinyun; Ma, Chenhui; Li, Shumei; Jin, Qing; Zhang, Nan; Cao, Yunpeng; Lin, Yi

2017-01-01

The high-throughput sequencing of pear “Dangshan Su” × “Yali” (whose fruits lignin and stone cell content are high and quality is poor) and pear “Dangshan Su” × “Wonhwang” (whose fruits with low content of lignin and stone cell and the quality are better ) found that the expressions of these two miRNAs (pyr-1809 and pyr-novel-miR-144-3p) were significantly different; their corresponding target genes encode two kinds of laccase (Pbr018935.1 and Pbr003857.1). qRT-PCR results showed that these two enzymes are involved in the formation of lignin and stone cells and the existence of these two miRNAs has a negative effect on them. It was concluded that the effect of pollination on the development of stone cells may affect the synthesis of lignin, through the regulation of laccase controlled by miRNAs, and ultimately affect the formation of stone cell and fruit quality. PMID:28497043

Fabrication, characterization and application of laccase-nylon 6,6/Fe3+ composite nanofibrous membrane for 3,3'-dimethoxybenzidine detoxification.

PubMed

Jasni, M Jasmin Fathi; Sathishkumar, Palanivel; Sornambikai, Sundaram; Yusoff, Abdull Rahim Mohd; Ameen, Fuad; Buang, Nor Aziah; Kadir, Mohammed Rafiq Abdul; Yusop, Zulkifli

2017-02-01

In this study, laccase was immobilized on nylon 6,6/Fe 3+ composite (NFC) nanofibrous membrane and used for the detoxification of 3,3'-dimethoxybenzidine (DMOB). The average size and tensile strength of the NFC membrane were found to be 60-80 nm (diameter) and 2.70 MPa, respectively. The FTIR results confirm that the amine (N-H) group of laccase was attached with Fe 3+ particles and the carbonyl (C=O) group of NFC membrane via hydrogen bonding. The half-life of the laccase-NFC membrane storage stability was increased from 6 to 11 weeks and the reusability was significantly extended up to 43 cycles against ABTS oxidation. Enhanced electro-oxidation of DMOB by laccase was observed at 0.33 V and the catalytic current was found to be 30 µA. The DMOB-treated mouse fibroblast 3T3-L1 preadipocytes showed maximum (97 %) cell inhibition at 75 µM L -1 within 24 h. The cytotoxicity of DMOB was significantly decreased to 78 % after laccase treatment. This study suggests that laccase-NFC membrane might be a good candidate for emerging pollutant detoxification.

Optimization of laccase production from Marasmiellus palmivorus LA1 by Taguchi method of Design of experiments.

PubMed

Chenthamarakshan, Aiswarya; Parambayil, Nayana; Miziriya, Nafeesathul; Soumya, P S; Lakshmi, M S Kiran; Ramgopal, Anala; Dileep, Anuja; Nambisan, Padma

2017-02-13

Fungal laccase has profound applications in different fields of biotechnology due to its broad specificity and high redox potential. Any successful application of the enzyme requires large scale production. As laccase production is highly dependent on medium components and cultural conditions, optimization of the same is essential for efficient product production. Production of laccase by fungal strain Marasmiellus palmivorus LA1 under solid state fermentation was optimized by the Taguchi design of experiments (DOE) methodology. An orthogonal array (L8) was designed using Qualitek-4 software to study the interactions and relative influence of the seven selected factors by one factor at a time approach. The optimum condition formulated was temperature (28 °C), pH (5), galactose (0.8%w/v), cupric sulphate (3 mM), inoculum concentration (number of mycelial agar pieces) (6Nos.) and substrate length (0.05 m). Overall yield increase of 17.6 fold was obtained after optimization. Statistical optimization leads to the elimination of an insignificant medium component ammonium dihydrogen phosphate from the process and contributes to a 1.06 fold increase in enzyme production. A final production of 667.4 ± 13 IU/mL laccase activity paves way for the application of this strain for industrial applications. Study optimized lignin degrading laccases from Marasmiellus palmivorus LA1. This laccases can thus be used for further applications in different scales of production after analyzing the properties of the enzyme. Study also confirmed the use of taguchi method for optimizations of product production.

Regulation of gene expression in plasmid ColE1: delayed expression of the kil gene.

PubMed Central

Zhang, S P; Yan, L F; Zubay, G

1988-01-01

cea, imm, and kil are a cluster of three functionally related genes of the plasmid ColE1. The cea and kil genes are in the same inducible operon, with transcription being initiated from a promoter adjacent to the cea gene. The imm gene is located between the cea and kil genes, but it is transcribed in the opposite direction. Complementary interaction between the imm mRNA and the anti-imm sequences in the middle of the cea-kil transcript causes a pronounced delay in expression of the kil gene when the cea-kil operon is induced. A segment in the overlapping region between the cea and imm genes causes delayed expression of the kil gene in the absence of imm gene transcription. This delay effect increases the yields of colicin synthesized in induced cells. Images PMID:3142845

Digital gene expression for non-model organisms

PubMed Central

Hong, Lewis Z.; Li, Jun; Schmidt-Küntzel, Anne; Warren, Wesley C.; Barsh, Gregory S.

2011-01-01

Next-generation sequencing technologies offer new approaches for global measurements of gene expression but are mostly limited to organisms for which a high-quality assembled reference genome sequence is available. We present a method for gene expression profiling called EDGE, or EcoP15I-tagged Digital Gene Expression, based on ultra-high-throughput sequencing of 27-bp cDNA fragments that uniquely tag the corresponding gene, thereby allowing direct quantification of transcript abundance. We show that EDGE is capable of assaying for expression in >99% of genes in the genome and achieves saturation after 6–8 million reads. EDGE exhibits very little technical noise, reveals a large (106) dynamic range of gene expression, and is particularly suited for quantification of transcript abundance in non-model organisms where a high-quality annotated genome is not available. In a direct comparison with RNA-seq, both methods provide similar assessments of relative transcript abundance, but EDGE does better at detecting gene expression differences for poorly expressed genes and does not exhibit transcript length bias. Applying EDGE to laboratory mice, we show that a loss-of-function mutation in the melanocortin 1 receptor (Mc1r), recognized as a Mendelian determinant of yellow hair color in many different mammals, also causes reduced expression of genes involved in the interferon response. To illustrate the application of EDGE to a non-model organism, we examine skin biopsy samples from a cheetah (Acinonyx jubatus) and identify genes likely to control differences in the color of spotted versus non-spotted regions. PMID:21844123

Gene expression systems in corynebacteria.

PubMed

Srivastava, Preeti; Deb, J K

2005-04-01

Corynebacterium belongs to a group of gram-positive bacteria having moderate to high G+C content, the other members being Mycobacterium, Nocardia, and Rhodococcus. Considerable information is now available on the plasmids, gene regulatory elements, and gene expression in corynebacteria, especially in soil corynebacteria such as Corynebacterium glutamicum. These bacteria are non-pathogenic and, unlike Bacillus and Streptomyces, are low in proteolytic activity and thus have the potential of becoming attractive systems for expression of heterologous proteins. This review discusses recent advances in our understanding of the organization of various regulatory elements, such as promoters, transcription terminators, and development of vectors for cloning and gene expression.

Comparison of the efficiency of bacterial and fungal laccases in delignification and detoxification of steam-pretreated lignocellulosic biomass for bioethanol production.

PubMed

De La Torre, María; Martín-Sampedro, Raquel; Fillat, Úrsula; Eugenio, María E; Blánquez, Alba; Hernández, Manuel; Arias, María E; Ibarra, David

2017-11-01

This study evaluates the potential of a bacterial laccase from Streptomyces ipomoeae (SilA) for delignification and detoxification of steam-exploded wheat straw, in comparison with a commercial fungal laccase from Trametes villosa. When alkali extraction followed by SilA laccase treatment was applied to the water insoluble solids fraction, a slight reduction in lignin content was detected, and after a saccharification step, an increase in both glucose and xylose production (16 and 6%, respectively) was observed. These effects were not produced with T. villosa laccase. Concerning to the fermentation process, the treatment of the steam-exploded whole slurry with both laccases produced a decrease in the phenol content by up to 35 and 71% with bacterial and fungal laccases, respectively. The phenols reduction resulted in an improved performance of Saccharomyces cerevisiae during a simultaneous saccharification and fermentation (SSF) process, improving ethanol production rate. This enhancement was more marked with a presaccharification step prior to the SSF process.

Laccase catalyzed elimination of morphine from aqueous systems.

PubMed

Huber, Daniela; Bleymaier, Klaus; Pellis, Alessandro; Vielnascher, Robert; Daxbacher, Andreas; Greimel, Katrin J; Guebitz, Georg M

2018-05-25

Pharmaceuticals contaminate the environment for several reasons, including metabolic excretion after intake, industrial waste and improper disposal. The narcotic drug morphine is commonly utilized for chronic pain management, and the distribution of morphine in aqueous systems and in waste waters is of high concern. Here, the removal of morphine by a laccase from Myceliophthora thermophila both in its free form as well as immobilized on Accurel MP1000 beads was investigated. Complete morphine elimination was achieved within 30 min for the free and the immobilized enzyme (70% bound protein) for concentrations between 1 and 1,000 mg L -1 according to LC-TOF mass spectrometry analysis. Higher morphine concentrations up to 60 g L -1 were also tested and total elimination was achieved within 6 h. Therefore, laccases are ideal candidates for removing morphine from aqueous systems. Copyright © 2018 Elsevier B.V. All rights reserved.

Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

PubMed

Kosinová, Lucie; Cahová, Monika; Fábryová, Eva; Týcová, Irena; Koblas, Tomáš; Leontovyč, Ivan; Saudek, František; Kříž, Jan

2016-01-01

The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3) in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information from 48 hrs onwards.

Laccase induction by synthetic dyes in Pycnoporus sanguineus and their possible use for sugar cane bagasse delignification.

PubMed

Hernández, Christian; Farnet Da Silva, Anne-Marie; Ziarelli, Fabio; Perraud-Gaime, Isabelle; Gutiérrez-Rivera, Beatriz; García-Pérez, José Antonio; Alarcón, Enrique

2017-02-01

The use of synthetic dyes for laccase induction in vivo has been scarcely explored. We characterized the effect of adding different synthetic dyes to liquid cultures of Pycnoporus sanguineus on laccase production. We found that carminic acid (CA) can induce 722 % and alizarin yellow 317 % more laccase than control does, and they promoted better fungal biomass development in liquid cultures. Aniline blue and crystal violet did not show such positive effect. CA and alizarin yellow were degraded up to 95 % during P. sanguineus culturing (12 days). With this basis, CA was selected as the best inducer and used to evaluate the induction of laccase on solid-state fermentation (SSF), using sugarcane bagasse (SCB) as substrate, in an attempt to reach selective delignification. We found that laccase induction occurred in SSF, and a slight inhibition of cellulase production was observed when CA was added to the substrate; also, a transformation of SCB under SSF was followed by the 13 C cross polarization magic angle spinning (CPMAS) solid-state nuclear magnetic resonance (NMR). Results showed that P. sanguineus can selectively delignify SCB, decreasing aromatic C compounds by 32.67 % in 16 days; O-alkyl C region (polysaccharides) was degraded less than 2 %; delignification values were not correlated with laccase activities. Cellulose-crystallinity index was increased by 27.24 % in absence of CA and 15.94 % when 0.01 mM of CA was added to SCB; this dye also inhibits the production of fungal biomass in SSF (measured as alkyl C gain). We conclude that CA is a good inducer of laccase in liquid media, and that P. sanguineus is a fungus with high potential for biomass delignification.

Expression Atlas: gene and protein expression across multiple studies and organisms

PubMed Central

Tang, Y Amy; Bazant, Wojciech; Burke, Melissa; Fuentes, Alfonso Muñoz-Pomer; George, Nancy; Koskinen, Satu; Mohammed, Suhaib; Geniza, Matthew; Preece, Justin; Jarnuczak, Andrew F; Huber, Wolfgang; Stegle, Oliver; Brazma, Alvis; Petryszak, Robert

2018-01-01

Abstract Expression Atlas (http://www.ebi.ac.uk/gxa) is an added value database that provides information about gene and protein expression in different species and contexts, such as tissue, developmental stage, disease or cell type. The available public and controlled access data sets from different sources are curated and re-analysed using standardized, open source pipelines and made available for queries, download and visualization. As of August 2017, Expression Atlas holds data from 3,126 studies across 33 different species, including 731 from plants. Data from large-scale RNA sequencing studies including Blueprint, PCAWG, ENCODE, GTEx and HipSci can be visualized next to each other. In Expression Atlas, users can query genes or gene-sets of interest and explore their expression across or within species, tissues, developmental stages in a constitutive or differential context, representing the effects of diseases, conditions or experimental interventions. All processed data matrices are available for direct download in tab-delimited format or as R-data. In addition to the web interface, data sets can now be searched and downloaded through the Expression Atlas R package. Novel features and visualizations include the on-the-fly analysis of gene set overlaps and the option to view gene co-expression in experiments investigating constitutive gene expression across tissues or other conditions. PMID:29165655

A Laccase with Antiproliferative and HIV-I Reverse Transcriptase Inhibitory Activities from the Mycorrhizal Fungus Agaricus placomyces

PubMed Central

Sun, Jian; Chen, Qing-Jun; Cao, Qing-Qin; Wu, Ying-Ying; Xu, Li-Jing; Zhu, Meng-Juan; Ng, Tzi-Bun; Wang, He-Xiang; Zhang, Guo-Qing

2012-01-01

A novel 68 kDa laccase was purified from the mycorrhizal fungus Agaricus placomyces by utilizing a procedure that comprised three successive steps of ion exchange chromatography and gel filtration as the final step. The monomeric enzyme exhibited the N-terminal amino acid sequence of DVIGPQAQVTLANQD, which showed only a low extent of homology to sequences of other fungal laccases. The optimal temperature for A. placomyces laccase was 30°C, and optimal pH values for laccase activity towards the substrates 2,7′-azinobis[3-ethylbenzothiazolone-6-sulfonic acid] diammonium salt (ABTS) and hydroquinone were 5.2 and 6.8, respectively. The laccase displayed, at 30°C and pH 5.2, Km values of 0.392 mM towards hydroquinone and 0.775 mM towards ABTS. It potently suppressed proliferation of MCF 7 human breast cancer cells and Hep G2 hepatoma cells and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) activity with an IC50 of 1.8 μM, 1.7 μM, and 1.25 μM, respectively, signifying that it is an antipathogenic protein. PMID:23093860

Performance of an alkalophilic and halotolerant laccase from gamma-proteobacterium JB in the presence of industrial pollutants.

PubMed

Singh, Gursharan; Sharma, Prince; Capalash, Neena

2009-08-01

An alkalophilic and halotolerant laccase from gamma-proteobacterium JB catalyzed in high concentrations of organic solvents and various salts. The enzyme retained 80-100% activity in 10% concentration of dimethylsulfoxide (DMSO), ethanol, acetone or methanol; 100, 85 and 50% activity in 20 mM MgCl(2), 5.0 mM MnCl(2) and 0.1 mM CuCl(2); 140, 120 and 110% activity in 5.0 mM MnSO(4), 10 mM MgSO(4) and 1mM CaSO(4), respectively. Sodium halides inhibited the enzyme in the order: F(-)> Br(-)> I(-)> Cl(-). In 0.5 M NaCl, pH 6.0, laccase was approximately 60% active. Decolorization of indigo carmine by laccase at pH 9.0 was not inhibited even in the presence of 0.5 M NaCl. Release of chromophoric, reducing and hydrophobic compounds during biobleaching of straw rich-soda pulp by laccase was not inhibited when the enzyme was applied in the presence of 1 M NaCl at pH 8.0. Laccase retained 50% residual activity even when incubated with 5% calcium hypochlorite for 30 min.

Enhanced the enzymatic hydrolysis efficiency of wheat straw after combined steam explosion and laccase pretreatment.

PubMed

Qiu, Weihua; Chen, Hongzhang

2012-08-01

Laccase, capable of selectively degrading lignin while keeping cellulose intact, has been widely applied for the modification and bio-bleaching of pulp. In this study Sclerotium sp. laccase (MSLac) was employed in combination with steam explosion to evaluate the effect of this treatment on cellulose hydrolysis. Combined steam explosion with laccase pretreatment enhanced the cellulose conversion rate of wheat straw no matter in the case of successive (MSLac-Cel) and simultaneous (MSLac+Cel) MSLac and cellulase hydrolysis. The highest cellulose conversion rate of 84.23% was obtained when steam-exploded wheat straw (SEWS) (1.3 MPa, 5 min) was treated by MSLac+Cel at a laccase loading of 0.55 U g(-1) substrate. FT-IR and SEM analyses indicated that MSLac oxidized the phenol and changed electron configuration of the ring, which contributed to loosening the compact wrap of lignin-carbohydrate complex and consequently enhancing the enzymatic hydrolysis efficiency of cellulose. This article provided a promising method for lignocellulose bio-pretreatment. Copyright © 2012 Elsevier Ltd. All rights reserved.

Laccase-catalyzed α-arylation of benzoylacetonitrile with substituted hydroquinones

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2014-09-03

This article investigates a green method for α-arylation of a primary nitrile. Compounds possessing a benzylic nitrile have shown to exhibit biological activity. Laccases (benzenediol:oxygen oxidoreductase EC 1.10.3.2) were used as the catalysts to perform the cross-coupling reaction between benzoylacetonitrile and substituted hydroquinones. The corresponding 2-substituted 3-oxo-3-phenylpropanenitriles where synthesized in moderate to excellent yields in pH 7.0 buffered water under mild conditions. The substituent on the hydroquinone had a significant impact on product yields and regioselectivity of reaction. The use of laccases, which require O 2 as their only co-substrate and produce H 2O as their only by-product, to performmore » this transformation is an environmentally benign method for α-arylation of primary nitriles.« less

Gene Expression: Sizing it all up

USDA-ARS?s Scientific Manuscript database

Genomic architecture appears to be a largely unexplored component of gene expression. Although surely not the end of the story, we are learning that when it comes to gene expression, size is important. We have been surprised to find that certain patterns of expression, tissue-specific versus constit...

Direct Introduction of Genes into Rats and Expression of the Genes

NASA Astrophysics Data System (ADS)

Benvenisty, Nissim; Reshef, Lea

1986-12-01

A method of introducing actively expressed genes into intact mammals is described. DNA precipitated with calcium phosphate has been injected intraperitoneally into newborn rats. The injected genes have been taken up and expressed by the animal tissues. To examine the generality of the method we have injected newborn rats with the chloramphenicol acetyltransferase prokaryotic gene fused with various viral and cellular gene promoters and the gene for hepatitis B surface antigen, and we observed appearance of chloramphenicol acetyltransferase activity and hepatitis B surface antigen in liver and spleen. In addition, administration of genes coding for hormones (insulin or growth hormone) resulted in their expression.

Methods for monitoring multiple gene expression

DOEpatents

Berka, Randy; Bachkirova, Elena; Rey, Michael

2013-10-01

The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

Methods for monitoring multiple gene expression

DOEpatents

Berka, Randy [Davis, CA; Bachkirova, Elena [Davis, CA; Rey, Michael [Davis, CA

2012-05-01

The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

Methods for monitoring multiple gene expression

DOEpatents

Berka, Randy [Davis, CA; Bachkirova, Elena [Davis, CA; Rey, Michael [Davis, CA

2008-06-01

The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

Polypeptides having laccase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Tang, Lan; Duan, Junxin

The present invention relates to isolated polypeptides having laccase activity and polynucleotides encoding the polypeptides and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Hematopoietic progenitors express neural genes

PubMed Central

Goolsby, James; Marty, Marie C.; Heletz, Dafna; Chiappelli, Joshua; Tashko, Gerti; Yarnell, Deborah; Fishman, Paul S.; Dhib-Jalbut, Suhayl; Bever, Christopher T.; Pessac, Bernard; Trisler, David

2003-01-01

Bone marrow, or cells selected from bone marrow, were reported recently to give rise to cells with a neural phenotype after in vitro treatment with neural-inducing factors or after delivery into the brain. However, we showed previously that untreated bone marrow cells express products of the neural myelin basic protein gene, and we demonstrate here that a subset of ex vivo bone marrow cells expresses the neurogenic transcription factor Pax-6 as well as neuronal genes encoding neurofilament H, NeuN (neuronal nuclear protein), HuC/HuD (Hu-antigen C/Hu-antigen D), and GAD65 (glutamic acid decarboxylase 65), as well as the oligodendroglial gene encoding CNPase (2′,3′ cyclic nucleotide 3′-phosphohydrolase). In contrast, astroglial glial fibrillary acidic protein (GFAP) was not detected. These cells also were CD34+, a marker of hematopoietic stem cells. Cultures of these highly proliferative CD34+ cells, derived from adult mouse bone marrow, uniformly displayed a phenotype comparable with that of hematopoietic progenitor cells (CD45+, CD34+, Sca-1+, AA4.1+, cKit+, GATA-2+, and LMO-2+). The neuronal and oligodendroglial genes expressed in ex vivo bone marrow also were expressed in all cultured CD34+ cells, and GFAP was not observed. After CD34+ cell transplantation into adult brain, neuronal or oligodendroglial markers segregated into distinct nonoverlapping cell populations, whereas astroglial GFAP appeared, in the absence of other neural markers, in a separate set of implanted cells. Thus, neuronal and oligodendroglial gene products are present in a subset of bone marrow cells, and the expression of these genes can be regulated in brain. The fact that these CD34+ cells also express transcription factors (Rex-1 and Oct-4) that are found in early development elicits the hypothesis that they may be pluripotent embryonic-like stem cells. PMID:14634211

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates

Regulatory systems for hypoxia-inducible gene expression in ischemic heart disease gene therapy.

PubMed

Kim, Hyun Ah; Rhim, Taiyoun; Lee, Minhyung

2011-07-18

Ischemic heart diseases are caused by narrowed coronary arteries that decrease the blood supply to the myocardium. In the ischemic myocardium, hypoxia-responsive genes are up-regulated by hypoxia-inducible factor-1 (HIF-1). Gene therapy for ischemic heart diseases uses genes encoding angiogenic growth factors and anti-apoptotic proteins as therapeutic genes. These genes increase blood supply into the myocardium by angiogenesis and protect cardiomyocytes from cell death. However, non-specific expression of these genes in normal tissues may be harmful, since growth factors and anti-apoptotic proteins may induce tumor growth. Therefore, tight gene regulation is required to limit gene expression to ischemic tissues, to avoid unwanted side effects. For this purpose, various gene expression strategies have been developed for ischemic-specific gene expression. Transcriptional, post-transcriptional, and post-translational regulatory strategies have been developed and evaluated in ischemic heart disease animal models. The regulatory systems can limit therapeutic gene expression to ischemic tissues and increase the efficiency of gene therapy. In this review, recent progresses in ischemic-specific gene expression systems are presented, and their applications to ischemic heart diseases are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

Production of Laccase by a New Myrothecium verrucaria MD-R-16 Isolated from Pigeon Pea [Cajanus cajan (L.) Millsp.] and its Application on Dye Decolorization.

PubMed

Sun, Jiao; Guo, Na; Niu, Li-Li; Wang, Qing-Fang; Zang, Yu-Ping; Zu, Yuan-Gang; Fu, Yu-Jie

2017-04-23

The present study was conducted to screen a laccase-producing fungal endophyte, optimize fermentation conditions, and evaluate the decolorization ability of the laccase. A new fungal endophyte capable of laccase-producing was firstly isolated from pigeon pea and identified as Myrothecium verrucaria based on a ITS-rRNA sequences analysis. Meanwhile, various fermentation parameters on the laccase production were optimized via response surface methodology (RSM). The optimal fermentation conditions were a fermentation time of five days, temperature 30 °C and pH 6.22. Laccase activity reached 16.52 ± 0.18 U/mL under the above conditions. Furthermore, the laccase showed effective decolorization capability toward synthetic dyes (Congo red, Methyl orange, Methyl red, and Crystal violet) in the presence of the redox mediator ABTS, with more than 70% of dyes decolorizing after 24 h of incubation. Additionally, the activity of laccase was relatively stable with pH (4.5-6.5) and a temperature range of 35-55 °C. Therefore, the high laccase production of the strain and the new fungal laccase could provide a promising alterative approach for industrial and environmental applications.

Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation.

PubMed

Sitarz, Anna K; Mikkelsen, Jørn D; Højrup, Peter; Meyer, Anne S

2013-12-10

Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ∼3U/mL toward syringaldazine. This activity was 13-17 fold higher than the corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ∼62.5kDa, and a Km value of 0.107mM (determined on ABTS). A partial amino acid sequence analysis of four short de novo sequenced peptides, defined after trypsin digest analysis using MALDI-TOF MS/MS analysis, revealed 64-100% homology to sequences in related laccases in the UniProt database, but also indicated that certain sequence stretches had low homology. Addition of the laccase-rich G. lucidum broth to lignocellulosic biomass (pretreated sugar cane bagasse) together with a state-of-the-art cellulase enzyme preparation (Cellic™CTec1) produced significantly increased cellulolytic yields, which were also better than those obtained with a T. versicolor laccase addition, indicating that the laccase from G. lucidum has unique properties that may be momentous in lignocellulosic biomass conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Laccase and lectin activities of intracellular proteins produced in a submerged culture of the xylotrophic basidiomycete Lentinus edodes.

PubMed

Vetchinkina, Elena P; Pozdnyakova, Natalia N; Nikitina, Valentina E

2008-10-01

The white-rot fungus Lentinus edodes produced D-melibiose-specific lectins and two laccase forms in a lignin-containing medium. The maxima of laccase and lectin activities coincided, falling within the period of active mycelial growth. The enzymes and lectins were isolated and purified by gel filtration followed by anion-exchange chromatography. The L. edodes lectins were found to be able to stabilize the activity of the fungus's own laccases. Lectin activity during the formation of lectin-enzyme complexes remained unchanged.

Method of controlling gene expression

DOEpatents

Peters, Norman K.; Frost, John W.; Long, Sharon R.

1991-12-03

A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

An atlas of gene expression and gene co-regulation in the human retina.

PubMed

Pinelli, Michele; Carissimo, Annamaria; Cutillo, Luisa; Lai, Ching-Hung; Mutarelli, Margherita; Moretti, Maria Nicoletta; Singh, Marwah Veer; Karali, Marianthi; Carrella, Diego; Pizzo, Mariateresa; Russo, Francesco; Ferrari, Stefano; Ponzin, Diego; Angelini, Claudia; Banfi, Sandro; di Bernardo, Diego

2016-07-08

The human retina is a specialized tissue involved in light stimulus transduction. Despite its unique biology, an accurate reference transcriptome is still missing. Here, we performed gene expression analysis (RNA-seq) of 50 retinal samples from non-visually impaired post-mortem donors. We identified novel transcripts with high confidence (Observed Transcriptome (ObsT)) and quantified the expression level of known transcripts (Reference Transcriptome (RefT)). The ObsT included 77 623 transcripts (23 960 genes) covering 137 Mb (35 Mb new transcribed genome). Most of the transcripts (92%) were multi-exonic: 81% with known isoforms, 16% with new isoforms and 3% belonging to new genes. The RefT included 13 792 genes across 94 521 known transcripts. Mitochondrial genes were among the most highly expressed, accounting for about 10% of the reads. Of all the protein-coding genes in Gencode, 65% are expressed in the retina. We exploited inter-individual variability in gene expression to infer a gene co-expression network and to identify genes specifically expressed in photoreceptor cells. We experimentally validated the photoreceptors localization of three genes in human retina that had not been previously reported. RNA-seq data and the gene co-expression network are available online (http://retina.tigem.it). © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Transient, Inducible, Placenta-Specific Gene Expression in Mice

PubMed Central

Fan, Xiujun; Petitt, Matthew; Gamboa, Matthew; Huang, Mei; Dhal, Sabita; Druzin, Maurice L.; Wu, Joseph C.

2012-01-01

Molecular understanding of placental functions and pregnancy disorders is limited by the absence of methods for placenta-specific gene manipulation. Although persistent placenta-specific gene expression has been achieved by lentivirus-based gene delivery methods, developmentally and physiologically important placental genes have highly stage-specific functions, requiring controllable, transient expression systems for functional analysis. Here, we describe an inducible, placenta-specific gene expression system that enables high-level, transient transgene expression and monitoring of gene expression by live bioluminescence imaging in mouse placenta at different stages of pregnancy. We used the third generation tetracycline-responsive tranactivator protein Tet-On 3G, with 10- to 100-fold increased sensitivity to doxycycline (Dox) compared with previous versions, enabling unusually sensitive on-off control of gene expression in vivo. Transgenic mice expressing Tet-On 3G were created using a new integrase-based, site-specific approach, yielding high-level transgene expression driven by a ubiquitous promoter. Blastocysts from these mice were transduced with the Tet-On 3G-response element promoter-driving firefly luciferase using lentivirus-mediated placenta-specific gene delivery and transferred into wild-type pseudopregnant recipients for placenta-specific, Dox-inducible gene expression. Systemic Dox administration at various time points during pregnancy led to transient, placenta-specific firefly luciferase expression as early as d 5 of pregnancy in a Dox dose-dependent manner. This system enables, for the first time, reliable pregnancy stage-specific induction of gene expression in the placenta and live monitoring of gene expression during pregnancy. It will be widely applicable to studies of both placental development and pregnancy, and the site-specific Tet-On G3 mouse will be valuable for studies in a broad range of tissues. PMID:23011919

Degradation of lindane and endosulfan by fungi, fungal and bacterial laccases.

PubMed

Ulčnik, A; Kralj Cigić, I; Pohleven, F

2013-12-01

The ability of two white-rot fungi (Trametes versicolor and Pleurotus ostreatus) and one brown-rot fungus (Gloeophyllum trabeum) to degrade two organochlorine insecticides, lindane and endosulfan, in liquid cultures was studied and dead fungal biomass was examined for adsorption of both insecticides from liquid medium. Lindane and endosulfan were also treated with fungal laccase and bacterial protein CotA, which has laccase activities. The amount of degraded lindane and endosulfan increased with their exposure period in the liquid cultures of both examined white-rot fungi. Endosulfan was transformed to endosulfan sulphate by T. versicolor and P. ostreatus. A small amount of endosulfan ether was also detected and its origin was examined. Degradation of lindane and endosulfan by a brown rot G. trabeum did not occur. Mycelial biomasses of all examined fungi have been found to adsorb lindane and endosulfan and adsorption onto fungal biomass should therefore be considered as a possible mechanism of pollutant removal when fungal degradation potentials are studied. Bacterial protein CotA performed more efficient degradation of lindane and endosulfan than fungal laccase and has shown potential for bioremediation of organic pollutants.

Laccase-catalyzed decolorization of malachite green: performance optimization and degradation mechanism.

PubMed

Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

2015-01-01

Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1) LacA, 109.9 mg L(-1) MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1), respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries.

Laccase-Catalyzed Decolorization of Malachite Green: Performance Optimization and Degradation Mechanism

PubMed Central

Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

2015-01-01

Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270

Faster-X Evolution of Gene Expression in Drosophila

PubMed Central

Meisel, Richard P.; Malone, John H.; Clark, Andrew G.

2012-01-01

DNA sequences on X chromosomes often have a faster rate of evolution when compared to similar loci on the autosomes, and well articulated models provide reasons why the X-linked mode of inheritance may be responsible for the faster evolution of X-linked genes. We analyzed microarray and RNA–seq data collected from females and males of six Drosophila species and found that the expression levels of X-linked genes also diverge faster than autosomal gene expression, similar to the “faster-X” effect often observed in DNA sequence evolution. Faster-X evolution of gene expression was recently described in mammals, but it was limited to the evolutionary lineages shortly following the creation of the therian X chromosome. In contrast, we detect a faster-X effect along both deep lineages and those on the tips of the Drosophila phylogeny. In Drosophila males, the dosage compensation complex (DCC) binds the X chromosome, creating a unique chromatin environment that promotes the hyper-expression of X-linked genes. We find that DCC binding, chromatin environment, and breadth of expression are all predictive of the rate of gene expression evolution. In addition, estimates of the intraspecific genetic polymorphism underlying gene expression variation suggest that X-linked expression levels are not under relaxed selective constraints. We therefore hypothesize that the faster-X evolution of gene expression is the result of the adaptive fixation of beneficial mutations at X-linked loci that change expression level in cis. This adaptive faster-X evolution of gene expression is limited to genes that are narrowly expressed in a single tissue, suggesting that relaxed pleiotropic constraints permit a faster response to selection. Finally, we present a conceptional framework to explain faster-X expression evolution, and we use this framework to examine differences in the faster-X effect between Drosophila and mammals. PMID:23071459

Laccase-initiated cross-linking of lignocellulose fibres using a ultra-filtered lignin isolated from kraft black liquor.

PubMed

Elegir, G; Bussini, D; Antonsson, S; Lindström, M E; Zoia, L

2007-12-01

In this work, the effect of Trametes pubescens laccase (TpL) used in combination with a low-molecular-weight ultra-filtered lignin (UFL) to improve mechanical properties of kraft liner pulp and chemi-thermo-mechanical pulp was studied. UFL was isolated by ultra-filtration from the kraft cooking black liquor obtained from softwood pulping. This by-product from the pulp industry contains an oligomeric lignin with almost twice the amount of free phenolic moieties than residual kraft pulp lignin. The reactivity of TpL on UFL and kraft pulp was studied by nuclear magnetic resonance spectroscopy and size exclusion chromatography. Laccase was shown to polymerise UFL and residual kraft pulp lignin in the fibres, seen by the increase in their average molecular weight and in the case of UFL as a decrease in the amount of phenolic hydroxyls. The laccase initiated cross-linking of lignin, mediated by UFL, which gives rise to more than a twofold increase in wet strength of kraft liner pulp handsheets without loosing other critical mechanical properties. Hence, this could be an interesting path to decrease mechano-sorptive creep that has been reported to lessen in extent as wet strength is given to papers. The laccase/2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) mediator system showed a greater increase in wet tensile strength of the resulting pulp sheets than the laccase/UFL system. However, other mechanical properties such as dry tensile strength, compression strength and Scott Bond internal strength were negatively affected by the laccase/ABTS system.

Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

PubMed

Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

2014-11-01

Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

Microarray expression profiling identifies genes with altered expression in HDL-deficient mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Callow, Matthew J.; Dudoit, Sandrine; Gong, Elaine L.

2000-05-05

Based on the assumption that severe alterations in the expression of genes known to be involved in HDL metabolism may affect the expression of other genes we screened an array of over 5000 mouse expressed sequence tags (ESTs) for altered gene expression in the livers of two lines of mice with dramatic decreases in HDL plasma concentrations. Labeled cDNA from livers of apolipoprotein AI (apo AI) knockout mice, Scavenger Receptor BI (SR-BI) transgenic mice and control mice were co-hybridized to microarrays. Two-sample t-statistics were used to identify genes with altered expression levels in the knockout or transgenic mice compared withmore » the control mice. In the SR-BI group we found 9 array elements representing at least 5 genes to be significantly altered on the basis of an adjusted p value of less than 0.05. In the apo AI knockout group 8 array elements representing 4 genes were altered compared with the control group (p < 0.05). Several of the genes identified in the SR-BI transgenic suggest altered sterol metabolism and oxidative processes. These studies illustrate the use of multiple-testing methods for the identification of genes with altered expression in replicated microarray experiments of apo AI knockout and SR-BI transgenic mice.« less

Stochastic gene expression in Arabidopsis thaliana.

PubMed

Araújo, Ilka Schultheiß; Pietsch, Jessica Magdalena; Keizer, Emma Mathilde; Greese, Bettina; Balkunde, Rachappa; Fleck, Christian; Hülskamp, Martin

2017-12-14

Although plant development is highly reproducible, some stochasticity exists. This developmental stochasticity may be caused by noisy gene expression. Here we analyze the fluctuation of protein expression in Arabidopsis thaliana. Using the photoconvertible KikGR marker, we show that the protein expressions of individual cells fluctuate over time. A dual reporter system was used to study extrinsic and intrinsic noise of marker gene expression. We report that extrinsic noise is higher than intrinsic noise and that extrinsic noise in stomata is clearly lower in comparison to several other tissues/cell types. Finally, we show that cells are coupled with respect to stochastic protein expression in young leaves, hypocotyls and roots but not in mature leaves. Our data indicate that stochasticity of gene expression can vary between tissues/cell types and that it can be coupled in a non-cell-autonomous manner.

Decolorization and detoxification of two textile industry effluents by the laccase/1-hydroxybenzotriazole system.

PubMed

Benzina, Ouafa; Daâssi, Dalel; Zouari-Mechichi, Héla; Frikha, Fakher; Woodward, Steve; Belbahri, Lassaad; Rodriguez-Couto, Susana; Mechichi, Tahar

2013-08-01

The aim of this work was to determine the optimal conditions for the decolorization and the detoxification of two effluents from a textile industry-effluent A (the reactive dye bath Bezactive) and effluent B (the direct dye bath Tubantin)-using a laccase mediator system. Response surface methodology (RSM) was applied to optimize textile effluents decolorization. A Box-Behnken design using RSM with the four variables pH, effluent concentration, 1-hydroxybenzotriazole (HBT) concentration, and enzyme (laccase) concentration was used to determine correlations between the effects of these variables on the decolorization of the two effluents. The optimum conditions for pH and concentrations of HBT, effluent and laccase were 5, 1 mM, 50 % and 0.6 U/ml, respectively, for maximum decolorization of effluent A (68 %). For effluent B, optima were 4, 1 mM, 75 %, and 0.6 U/ml, respectively, for maximum decolorization of approximately 88 %. Both effluents were treated at 30 °C for 20 h. A quadratic model was obtained for each decolorization through this design. The experimental and predicted values were in good agreement and both models were highly significant. In addition, the toxicity of the two effluents was determined before and after laccase treatment using Saccharomyces cerevisiae, Bacillus cereus, and germination of tomato seeds.

Laccase production in bioreactor scale under saline condition by the marine-derived basidiomycete Peniophora sp. CBMAI 1063.

PubMed

Mainardi, Pedro H; Feitosa, Valker A; Brenelli de Paiva, Livia B; Bonugli-Santos, Rafaella C; Squina, Fabio M; Pessoa, Adalberto; Sette, Lara D

2018-05-01

Laccase production in saline conditions is still poorly studied. The aim of the present study was to investigate the production of laccase in two different types of bioreactors by the marine-derived basidiomycete Peniophora sp. CBMAI 1063. The highest laccase activity and productivity were obtained in the Stirred Tank (ST) bioreactor, while the highest biomass concentration in Air-lift (AL) bioreactor. The main laccase produced was purified by ion exchange and size exclusion chromatography and appeared to be monomeric with molecular weight of approximately 55 kDa. The optimum oxidation activity was obtained at pH 5.0. The thermal stability of the enzyme ranged from 30 to 50 °C (120 min). The Far-UV Circular Dichroism revealed the presence of high β-sheet and low α-helical conformation in the protein structure. Additional experiments carried out in flask scale showed that the marine-derived fungus was able to produce laccase only in the presence of artificial seawater and copper sulfate. Results from the present study confirmed the fungal adaptation to marine conditions and its potential for being used in saline environments and/or processes. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Analysis of multiplex gene expression maps obtained by voxelation.

PubMed

An, Li; Xie, Hongbo; Chin, Mark H; Obradovic, Zoran; Smith, Desmond J; Megalooikonomou, Vasileios

2009-04-29

Gene expression signatures in the mammalian brain hold the key to understanding neural development and neurological disease. Researchers have previously used voxelation in combination with microarrays for acquisition of genome-wide atlases of expression patterns in the mouse brain. On the other hand, some work has been performed on studying gene functions, without taking into account the location information of a gene's expression in a mouse brain. In this paper, we present an approach for identifying the relation between gene expression maps obtained by voxelation and gene functions. To analyze the dataset, we chose typical genes as queries and aimed at discovering similar gene groups. Gene similarity was determined by using the wavelet features extracted from the left and right hemispheres averaged gene expression maps, and by the Euclidean distance between each pair of feature vectors. We also performed a multiple clustering approach on the gene expression maps, combined with hierarchical clustering. Among each group of similar genes and clusters, the gene function similarity was measured by calculating the average gene function distances in the gene ontology structure. By applying our methodology to find similar genes to certain target genes we were able to improve our understanding of gene expression patterns and gene functions. By applying the clustering analysis method, we obtained significant clusters, which have both very similar gene expression maps and very similar gene functions respectively to their corresponding gene ontologies. The cellular component ontology resulted in prominent clusters expressed in cortex and corpus callosum. The molecular function ontology gave prominent clusters in cortex, corpus callosum and hypothalamus. The biological process ontology resulted in clusters in cortex, hypothalamus and choroid plexus. Clusters from all three ontologies combined were most prominently expressed in cortex and corpus callosum. The experimental

Comparative analyses of laccase-catalyzed amination reactions for production of novel β-lactam antibiotics.

PubMed

Mikolasch, Annett; Manda, Katrin; Schlüter, Rabea; Lalk, Michael; Witt, Sabine; Seefeldt, Simone; Hammer, Elke; Schauer, Frieder; Jülich, Wolf-Dieter; Lindequist, Ulrike

2012-01-01

Seven novel β-lactam antibiotics with activities against Gram-positive bacterial strains, among them methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci, were synthesized by amination of 2,5-dihydroxyphenylacetic acid in usable yields (30-60%). These products protected mice against an infection with S. aureus lethal to the control animals. The results show the usefulness of laccase for the synthesis of potential new antibiotics, in addition to the interdependence of the laccase substrates, the amino coupling partners, and the product formation, yield, and activity. The syntheses of β-lactam antibiotics with 2,5-dihydroxyaromatic acid substructures (para-substituted) are then compared with those of 3,4-dihydroxyaromatic acid substructures (ortho-substituted). Para-substituted laccase substrates were better reaction partners in these syntheses than ortho-substituted compounds. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

Multiscale Embedded Gene Co-expression Network Analysis

PubMed Central

Song, Won-Min; Zhang, Bin

2015-01-01

Gene co-expression network analysis has been shown effective in identifying functional co-expressed gene modules associated with complex human diseases. However, existing techniques to construct co-expression networks require some critical prior information such as predefined number of clusters, numerical thresholds for defining co-expression/interaction, or do not naturally reproduce the hallmarks of complex systems such as the scale-free degree distribution of small-worldness. Previously, a graph filtering technique called Planar Maximally Filtered Graph (PMFG) has been applied to many real-world data sets such as financial stock prices and gene expression to extract meaningful and relevant interactions. However, PMFG is not suitable for large-scale genomic data due to several drawbacks, such as the high computation complexity O(|V|3), the presence of false-positives due to the maximal planarity constraint, and the inadequacy of the clustering framework. Here, we developed a new co-expression network analysis framework called Multiscale Embedded Gene Co-expression Network Analysis (MEGENA) by: i) introducing quality control of co-expression similarities, ii) parallelizing embedded network construction, and iii) developing a novel clustering technique to identify multi-scale clustering structures in Planar Filtered Networks (PFNs). We applied MEGENA to a series of simulated data and the gene expression data in breast carcinoma and lung adenocarcinoma from The Cancer Genome Atlas (TCGA). MEGENA showed improved performance over well-established clustering methods and co-expression network construction approaches. MEGENA revealed not only meaningful multi-scale organizations of co-expressed gene clusters but also novel targets in breast carcinoma and lung adenocarcinoma. PMID:26618778

Multiscale Embedded Gene Co-expression Network Analysis.

PubMed

Song, Won-Min; Zhang, Bin

2015-11-01

Gene co-expression network analysis has been shown effective in identifying functional co-expressed gene modules associated with complex human diseases. However, existing techniques to construct co-expression networks require some critical prior information such as predefined number of clusters, numerical thresholds for defining co-expression/interaction, or do not naturally reproduce the hallmarks of complex systems such as the scale-free degree distribution of small-worldness. Previously, a graph filtering technique called Planar Maximally Filtered Graph (PMFG) has been applied to many real-world data sets such as financial stock prices and gene expression to extract meaningful and relevant interactions. However, PMFG is not suitable for large-scale genomic data due to several drawbacks, such as the high computation complexity O(|V|3), the presence of false-positives due to the maximal planarity constraint, and the inadequacy of the clustering framework. Here, we developed a new co-expression network analysis framework called Multiscale Embedded Gene Co-expression Network Analysis (MEGENA) by: i) introducing quality control of co-expression similarities, ii) parallelizing embedded network construction, and iii) developing a novel clustering technique to identify multi-scale clustering structures in Planar Filtered Networks (PFNs). We applied MEGENA to a series of simulated data and the gene expression data in breast carcinoma and lung adenocarcinoma from The Cancer Genome Atlas (TCGA). MEGENA showed improved performance over well-established clustering methods and co-expression network construction approaches. MEGENA revealed not only meaningful multi-scale organizations of co-expressed gene clusters but also novel targets in breast carcinoma and lung adenocarcinoma.

Computational gene expression profiling under salt stress reveals patterns of co-expression

PubMed Central

Sanchita; Sharma, Ashok

2016-01-01

Plants respond differently to environmental conditions. Among various abiotic stresses, salt stress is a condition where excess salt in soil causes inhibition of plant growth. To understand the response of plants to the stress conditions, identification of the responsible genes is required. Clustering is a data mining technique used to group the genes with similar expression. The genes of a cluster show similar expression and function. We applied clustering algorithms on gene expression data of Solanum tuberosum showing differential expression in Capsicum annuum under salt stress. The clusters, which were common in multiple algorithms were taken further for analysis. Principal component analysis (PCA) further validated the findings of other cluster algorithms by visualizing their clusters in three-dimensional space. Functional annotation results revealed that most of the genes were involved in stress related responses. Our findings suggest that these algorithms may be helpful in the prediction of the function of co-expressed genes. PMID:26981411

Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water

PubMed Central

Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

2015-01-01

Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

Laccase production by Coriolopsis caperata RCK2011: Optimization under solid state fermentation by Taguchi DOE methodology

PubMed Central

Nandal, Preeti; Ravella, Sreenivas Rao; Kuhad, Ramesh Chander

2013-01-01

Laccase production by Coriolopsis caperata RCK2011 under solid state fermentation was optimized following Taguchi design of experiment. An orthogonal array layout of L18 (21 × 37) was constructed using Qualitek-4 software with eight most influensive factors on laccase production. At individual level pH contributed higher influence, whereas, corn steep liquor (CSL) accounted for more than 50% of the severity index with biotin and KH2PO4 at the interactive level. The optimum conditions derived were; temperature 30°C, pH 5.0, wheat bran 5.0 g, inoculum size 0.5 ml (fungal cell mass = 0.015 g dry wt.), biotin 0.5% w/v, KH2PO4 0.013% w/v, CSL 0.1% v/v and 0.5 mM xylidine as an inducer. The validation experiments using optimized conditions confirmed an improvement in enzyme production by 58.01%. The laccase production to the level of 1623.55 Ugds−1 indicates that the fungus C. caperata RCK2011 has the commercial potential for laccase. PMID:23463372

Vascular gene expression: a hypothesis

PubMed Central

Martínez-Navarro, Angélica C.; Galván-Gordillo, Santiago V.; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto

2013-01-01

The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a “primitive” vascular tissue (a lycophyte), as well as from others that lack a true vascular tissue (a bryophyte), and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non-vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT, and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants. PMID:23882276

GSEH: A Novel Approach to Select Prostate Cancer-Associated Genes Using Gene Expression Heterogeneity.

PubMed

Kim, Hyunjin; Choi, Sang-Min; Park, Sanghyun

2018-01-01

When a gene shows varying levels of expression among normal people but similar levels in disease patients or shows similar levels of expression among normal people but different levels in disease patients, we can assume that the gene is associated with the disease. By utilizing this gene expression heterogeneity, we can obtain additional information that abets discovery of disease-associated genes. In this study, we used collaborative filtering to calculate the degree of gene expression heterogeneity between classes and then scored the genes on the basis of the degree of gene expression heterogeneity to find "differentially predicted" genes. Through the proposed method, we discovered more prostate cancer-associated genes than 10 comparable methods. The genes prioritized by the proposed method are potentially significant to biological processes of a disease and can provide insight into them.

Biobleaching of wheat straw-rich soda pulp with alkalophilic laccase from gamma-proteobacterium JB: optimization of process parameters using response surface methodology.

PubMed

Singh, Gursharan; Ahuja, Naveen; Batish, Mona; Capalash, Neena; Sharma, Prince

2008-11-01

An alkalophilic laccase from gamma-proteobacterium JB was applied to wheat straw-rich soda pulp to check its bleaching potential by using response surface methodology based on central composite design. The design was employed by selecting laccase units, ABTS (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) concentration and pH as model factors. The results of second order factorial design experiments showed that all three independent variables had significant effect on brightness and kappa number of laccase-treated pulp. Optimum conditions for biobleaching of pulp with laccase preparation (specific activity, 65 nkat mg(-1) protein) were 20 nkat g(-1) of pulp, 2mM ABTS and pH 8.0 which enhanced brightness by 5.89% and reduced kappa number by 21.1% within 4h of incubation at 55 degrees C, without further alkaline extraction of pulp. Tear index (8%) and burst index (18%) also improved for laccase-treated pulp as compared to control raw pulp. Treatment of chemically (CEH1H2) bleached pulp with laccase showed significant effect on release of chromophores, hydrophobic and reducing compounds. Laccase-prebleaching of raw pulp reduced the use of hypochlorite by 10% to achieve brightness of resultant hand sheets similar to the fully chemically bleached pulp.

Validating internal controls for quantitative plant gene expression studies

PubMed Central

Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H

2004-01-01

Background Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Results Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Conclusion Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments. PMID:15317655

Validating internal controls for quantitative plant gene expression studies.

PubMed

Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H

2004-08-18

Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments.

HOX gene expression in phenotypic and genotypic subgroups and low HOXA gene expression as an adverse prognostic factor in pediatric ALL.

PubMed

Starkova, Julia; Zamostna, Blanka; Mejstrikova, Ester; Krejci, Roman; Drabkin, Harry A; Trka, Jan

2010-12-01

HOX genes play an important role in both normal lymphopoiesis and leukemogenesis. However, HOX expression patterns in leukemia cells compared to normal lymphoid progenitors have not been systematically studied in acute lymphoblastic leukemia (ALL) subtypes. The RNA expression levels of HOXA, HOXB, and CDX1/2 genes were analyzed by qRT-PCR in a cohort of 61 diagnostic pediatric ALL samples and FACS-sorted subpopulations of normal lymphoid progenitors. The RNA expression of HOXA7-10, HOXA13, and HOXB2-4 genes was exclusively detected in leukemic cells and immature progenitors. The RNA expression of HOXB6 and CDX2 genes was exclusively detected in leukemic cells but not in B-lineage cells at any of the studied developmental stages. HOXA3-4, HOXA7, and HOXB3-4 genes were differentially expressed between BCP-ALL and T-ALL subgroups, and among genotypically defined MLL/AF4, TEL/AML1, BCR/ABL, hyperdiploid and normal karyotype subgroups. However, this differential expression did not define specific clusters in hierarchical cluster analysis. HOXA7 gene was low expressed at the RNA level in patients with hyperdiploid leukemia, whereas HOXB7 and CDX2 genes were low expressed in TEL/AML1-positive and BCR/ABL-positive cases, respectively. In contrast to previous findings in acute myeloid leukemia, high HOXA RNA expression was associated with an excellent prognosis in Cox's regression model (P = 0.03). In MLL/AF4-positive ALL, lower HOXA RNA expression correlated with the methylation status of their promoters. HOX gene RNA expression cannot discriminate leukemia subgroups or relative maturity of leukemic cells. However, HOXA RNA expression correlates with prognosis, and particular HOX genes are expressed in specific genotypically characterized subgroups.

Validation of reference genes for quantitative gene expression analysis in experimental epilepsy.

PubMed

Sadangi, Chinmaya; Rosenow, Felix; Norwood, Braxton A

2017-12-01

To grasp the molecular mechanisms and pathophysiology underlying epilepsy development (epileptogenesis) and epilepsy itself, it is important to understand the gene expression changes that occur during these phases. Quantitative real-time polymerase chain reaction (qPCR) is a technique that rapidly and accurately determines gene expression changes. It is crucial, however, that stable reference genes are selected for each experimental condition to ensure that accurate values are obtained for genes of interest. If reference genes are unstably expressed, this can lead to inaccurate data and erroneous conclusions. To date, epilepsy studies have used mostly single, nonvalidated reference genes. This is the first study to systematically evaluate reference genes in male Sprague-Dawley rat models of epilepsy. We assessed 15 potential reference genes in hippocampal tissue obtained from 2 different models during epileptogenesis, 1 model during chronic epilepsy, and a model of noninjurious seizures. Reference gene ranking varied between models and also differed between epileptogenesis and chronic epilepsy time points. There was also some variance between the four mathematical models used to rank reference genes. Notably, we found novel reference genes to be more stably expressed than those most often used in experimental epilepsy studies. The consequence of these findings is that reference genes suitable for one epilepsy model may not be appropriate for others and that reference genes can change over time. It is, therefore, critically important to validate potential reference genes before using them as normalizing factors in expression analysis in order to ensure accurate, valid results. © 2017 Wiley Periodicals, Inc.

DNMT3B modulates the expression of cancer-related genes and downregulates the expression of the gene VAV3 via methylation

PubMed Central

Peralta-Arrieta, Irlanda; Hernández-Sotelo, Daniel; Castro-Coronel, Yaneth; Leyva-Vázquez, Marco Antonio; Illades-Aguiar, Berenice

2017-01-01

Altered promoter DNA methylation is one of the most important epigenetic abnormalities in human cancer. DNMT3B, de novo methyltransferase, is clearly related to abnormal methylation of tumour suppressor genes, DNA repair genes and its overexpression contributes to oncogenic processes and tumorigenesis in vivo. The purpose of this study was to assess the effect of the overexpression of DNMT3B in HaCaT cells on global gene expression and on the methylation of selected genes to the identification of genes that can be target of DNMT3B. We found that the overexpression of DNMT3B in HaCaT cells, modulate the expression of genes related to cancer, downregulated the expression of 151 genes with CpG islands and downregulated the expression of the VAV3 gene via methylation of its promoter. These results highlight the importance of DNMT3B in gene expression and human cancer. PMID:28123849

DNMT3B modulates the expression of cancer-related genes and downregulates the expression of the gene VAV3 via methylation.

PubMed

Peralta-Arrieta, Irlanda; Hernández-Sotelo, Daniel; Castro-Coronel, Yaneth; Leyva-Vázquez, Marco Antonio; Illades-Aguiar, Berenice

2017-01-01

Altered promoter DNA methylation is one of the most important epigenetic abnormalities in human cancer. DNMT3B, de novo methyltransferase, is clearly related to abnormal methylation of tumour suppressor genes, DNA repair genes and its overexpression contributes to oncogenic processes and tumorigenesis in vivo . The purpose of this study was to assess the effect of the overexpression of DNMT3B in HaCaT cells on global gene expression and on the methylation of selected genes to the identification of genes that can be target of DNMT3B. We found that the overexpression of DNMT3B in HaCaT cells, modulate the expression of genes related to cancer, downregulated the expression of 151 genes with CpG islands and downregulated the expression of the VAV3 gene via methylation of its promoter. These results highlight the importance of DNMT3B in gene expression and human cancer.

[Differential expression genes of bone tissues surrounding implants in diabetic rats by gene chip].

PubMed

Wang, Xin-xin; Ma, Yue; Li, Qing; Jiang, Bao-qi; Lan, Jing

2012-10-01

To compare mRNA expression profiles of bone tissues surrounding implants between normal rats and rats with diabetes using microarray technology. Six Wistar rats were randomly selected and divided into normal model group and diabetic group. Diabetic model condition was established by injecting Streptozotocin into peritoneal space. Titanium implants were implanted into the epiphyseal end of the rats' tibia. Bone tissues surrounding implant were harvested and sampled after 3 months to perform comprehensive RNA gene expression profiling, including 17983 for genome-wide association study.GO analysis was used to compare different gene expression and real-time PCR was used to confirm the results on core samples. The results indicated that there were 1084 differential gene expression. In the diabetic model, there were 352 enhanced expression genes, 732 suppressed expression genes. GO analysis involved 1154 different functional type. Osteoblast related gene expressions in bone tissue samples of diabetic rats were decreased, and lipid metabolism pathway related gene expression was increased.

Magnetic field-controlled gene expression in encapsulated cells

PubMed Central

Ortner, Viktoria; Kaspar, Cornelius; Halter, Christian; Töllner, Lars; Mykhaylyk, Olga; Walzer, Johann; Günzburg, Walter H.; Dangerfield, John A.; Hohenadl, Christine; Czerny, Thomas

2012-01-01

Cell and gene therapies have an enormous range of potential applications, but as for most other therapies, dosing is a critical issue, which makes regulated gene expression a prerequisite for advanced strategies. Several inducible expression systems have been established, which mainly rely on small molecules as inducers, such as hormones or antibiotics. The application of these inducers is difficult to control and the effects on gene regulation are slow. Here we describe a novel system for induction of gene expression in encapsulated cells. This involves the modification of cells to express potential therapeutic genes under the control of a heat inducible promoter and the co-encapsulation of these cells with magnetic nanoparticles. These nanoparticles produce heat when subjected to an alternating magnetic field; the elevated temperatures in the capsules then induce gene expression. In the present study we define the parameters of such systems and provide proof-of-principle using reporter gene constructs. The fine-tuned heating of nanoparticles in the magnetic field allows regulation of gene expression from the outside over a broad range and within short time. Such a system has great potential for advancement of cell and gene therapy approaches. PMID:22197778