Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

Expression and characterization of novel laccase gene from Pandoraea sp. ISTKB and its application.

PubMed

Kumar, Madan; Mishra, Arti; Singh, Shashi Shekhar; Srivastava, Shaili; Thakur, Indu Shekhar

2018-04-14

In the present study, a non-blue laccase gene from previously reported lignin degrading bacterium, Pandoraea sp. ISTKB, was isolated, cloned and expressed in E. coli. Bioinformatics analysis of sequence discovered twin-arginine translocation signal sequence, copper binding motifs and presence of more random coil compare to helices and sheets in structure. The enzyme was found to be active on wide pH range and the pH optima was observed at pH 4 and 8 on substrate 2,2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) and 2,6-Dimethoxyphenol respectively. This is a thermophilic enzyme with maximum activity around 50-70 °C. The enzyme was further characterized by spectroscopy, reaction kinetics and effect of metal ions and inhibitors were studied. Compared to laccase alone; the treatment of dyes with laccase plus mediator resulted in enhanced decolorization of crystal violet, methylene blue, azure B, carmine and Congo red but the effect of mediator was not observed on trypan blue. Laccase treatment triggered polymerization on vanillic acid (VA) and kraft lignin (KL). Laccase plus mediator treatment reversed the polymerization and resulted in transformation or degradation of VA and KL. This thermophilic and alkalophilic non-blue laccase from Pandoraea sp. ISTKB is promising with prospective biotechnological application. Copyright © 2018. Published by Elsevier B.V.

Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

PubMed Central

Feng, Bao Zhen; Li, Peiqian

2014-01-01

Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2′-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

Genome-wide identification of multifunctional laccase gene family in cotton (Gossypium spp.); expression and biochemical analysis during fiber development

PubMed Central

Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal

2016-01-01

The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939

Overproduction of recombinant laccase using a homologous expression system in Coriolus versicolor.

PubMed

Kajita, Shinya; Sugawara, Shinsuke; Miyazaki, Yasumasa; Nakamura, Masaya; Katayama, Yoshihiro; Shishido, Kazuo; Iimura, Yosuke

2004-12-01

One of the major extracellular enzymes of the white-rot fungus Coriolus versicolor is laccase, which is involved in the degradation of lignin. We constructed a homologous system for the expression of a gene for laccase III (cvl3) in C. versicolor, using a chimeric laccase gene driven by the promoter of a gene for glyceraldehyde-3-phosphate dehydrogenase (gpd) from this fungus. We transformed C. versicolor successfully by introducing both a gene for hygromycin B phosphotransferase (hph) and the chimeric laccase gene. In three independent experiments, we recovered 47 hygromycin-resistant transformants at a transformation frequency of 13 transformants microg(-1) of plasmid DNA. We confirmed the introduction of the chimeric laccase gene into the mycelia of transformants by a polymerase chain reaction in nine randomly selected transformants. Overproduction of extracellular laccase by the transformants was revealed by a colorimetric assay for laccase activity. We examined the transformant (T2) that had the highest laccase activity and found that its activity was significantly higher than that of the wild type, particularly in the presence of copper (II). Our transformation system should contribute to the efficient production of the extracellular proteins of C. versicolor for the accelerated degradation of lignin and aromatic pollutants.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Heterologous expression of the Pleurotus ostreatus MnP3 gene by the laccase gene promoter in Lentinula edodes.

PubMed

Sato, Toshitsugu; Irie, Toshikazu; Yoshino, Fumihiko

2017-08-01

Lentinula edodes (shiitake), which have a powerful ligninolytic system, is one of the most important edible mushrooms in Asia. In this study, we introduced the manganese peroxidase (MnP, EC 1.11.1.13) gene from Pleurotus ostreatus driven by L. edodes laccase 1 gene promoter into L. edodes for expression. The resulting transformant expressed the recombinant gene and showed a higher level of MnP activity than that of the wild-type strain.

Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.

PubMed

Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min

Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.

Scale-up laccase production from Trametes versicolor stimulated by vanillic acid.

PubMed

Wang, Ke-Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2016-07-01

An efficient strategy for laccase production in Trametes versicolor cultures was developed using vanillic acid as the inducer. The optimized vanillic acid treatment strategy consisted of exposing 2-day-old mycelia cultures to 80 mg/L vanillic acid. After 4 days, laccase activity of 588.84 U/L was achieved in flasks which represented a 1.79-fold increase compared to the control. In 200-L airlift bioreactor, the maximal laccase activity reached up to 785.12 U/L using the optimized vanillic acid treatment strategy. The zymograms of culture supernatants revealed three bands with laccase activity, among which Lac1 and Lac2 were abundant laccase isoforms constitutively expressed, and Lac3 was an inducible isozyme by vanillic acid. The results of real-time quantitative PCR showed that the transcription level of lcc in T. versicolor cultures grown with vanillic acid for 7 days was about 5.64-fold greater than that without vanillic acid in flasks. In 200-L airlift bioreactor cultures of T. versicolor with addition of vanillic acid, the transcript level of lcc at day 7 was 2.62-fold higher than that in flasks with vanillic acid due to the good mass transfer and oxygen supply in the bioreactor system. This study provides a basis for understanding the induction mechanism of vanillic acid for laccase production and has good potential for industrial applications.

Transcriptional response of lignin-degrading enzymes to 17α-ethinyloestradiol in two white rots

PubMed Central

Přenosilová, L; Křesinová, Z; Amemori, A Slavíková; Cajthaml, T; Svobodová, K

2013-01-01

Fungal, ligninolytic enzymes have attracted a great attention for their bioremediation capabilities. A deficient knowledge of regulation of enzyme production, however, hinders the use of ligninolytic fungi in bioremediation applications. In this work, a transcriptional analyses of laccase and manganese peroxidase (MnP) production by two white rots was combined with determination of pI of the enzymes and the evaluation of 17α-ethinyloestradiol (EE2) degradation to study regulation mechanisms used by fungi during EE2 degradation. In the cultures of Trametes versicolor the addition of EE2 caused an increase in laccase activity with a maximum of 34.2 ± 6.7 U g−1 of dry mycelia that was observed after 2 days of cultivation. It corresponded to a 4.9 times higher transcription levels of a laccase-encoding gene (lacB) that were detected in the cultures at the same time. Simultaneously, pI values of the fungal laccases were altered in response to the EE2 treatment. Like T. versicolor, Irpex lacteus was also able to remove 10 mg l−1 EE2 within 3 days of cultivation. While an increase to I. lacteus MnP activity and MnP gene transcription levels was observed at the later phase of the cultivation. It suggests another metabolic role of MnP but EE2 degradation. PMID:23170978

Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1

PubMed Central

Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah

2002-01-01

Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346

Transcriptional response of lignin-degrading enzymes to 17α-ethinyloestradiol in two white rots.

PubMed

Přenosilová, L; Křesinová, Z; Amemori, A Slavíková; Cajthaml, T; Svobodová, K

2013-05-01

Fungal, ligninolytic enzymes have attracted a great attention for their bioremediation capabilities. A deficient knowledge of regulation of enzyme production, however, hinders the use of ligninolytic fungi in bioremediation applications. In this work, a transcriptional analyses of laccase and manganese peroxidase (MnP) production by two white rots was combined with determination of pI of the enzymes and the evaluation of 17α-ethinyloestradiol (EE2) degradation to study regulation mechanisms used by fungi during EE2 degradation. In the cultures of Trametes versicolor the addition of EE2 caused an increase in laccase activity with a maximum of 34.2 ± 6.7 U g⁻¹ of dry mycelia that was observed after 2 days of cultivation. It corresponded to a 4.9 times higher transcription levels of a laccase-encoding gene (lacB) that were detected in the cultures at the same time. Simultaneously, pI values of the fungal laccases were altered in response to the EE2 treatment. Like T. versicolor, Irpex lacteus was also able to remove 10 mg l⁻¹ EE2 within 3 days of cultivation. While an increase to I. lacteus MnP activity and MnP gene transcription levels was observed at the later phase of the cultivation. It suggests another metabolic role of MnP but EE2 degradation. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Heat shock treatment improves Trametes versicolor laccase production.

PubMed

Wang, Feng; Guo, Chen; Wei, Tao; Zhang, Tian; Liu, Chun-Zhao

2012-09-01

An efficient heat shock strategy has been developed to improve laccase production in submerged Trametes versicolor cultures. The optimized heat shock strategy consists of subjecting T. versicolor mycelial pellets to three heat shock treatments at 45 °C for 45 min, starting at culture day 0, with a 24-h interval between treatments. Laccase production increased by more than 1.6-fold relative to the control in both flasks and a 5-L bioreactor because the expression of the laccase gene was enhanced by heat shock induction. The present work demonstrates that heat shock induction is a promising method because it both improves fungal laccase production and has a good potential in industrial application.

Ultrasound-intensified laccase production from Trametes versicolor.

PubMed

Wang, Feng; Ma, An-Zhou; Guo, Chen; Zhuang, Guo-Qiang; Liu, Chun-Zhao

2013-01-01

An efficient intermittent ultrasonic treatment strategy was developed to improve laccase production from Trametes versicolor mycelia cultures. The optimized strategy consisted of exposing 2-day-old mycelia cultures to 5-min ultrasonic treatments for two times with a 12-h interval at the fixed ultrasonic power and frequency (120 W, 40 kHz). After 5 days of culture, this strategy produced the highest extracellular laccase activity of 588.9 U/L among all treatments tested which was 1.8-fold greater than the control without ultrasound treatment. The ultrasonic treatment resulted in a higher pellet porosity that facilitated the mass transfer of nutrients and metabolites from the pellets to the surrounding liquid. Furthermore, the ultrasonic treatment induced the expression of the laccase gene (lcc), which correlated with a sharp increase in both extracellular and intracellular laccase activity. This is the first study to find positive effects of ultrasound on gene expression in fungal cells. These results provide a basis for understanding the stimulation of metabolite production and process intensification by ultrasonic treatment in filamentous fungal culture. Copyright © 2012 Elsevier B.V. All rights reserved.

Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

PubMed

Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

2014-01-01

Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi

PubMed Central

Mander, Gerd J.; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C.; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G.; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard

2006-01-01

Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2′-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain. PMID:16820501

Use of laccase as a novel, versatile reporter system in filamentous fungi.

PubMed

Mander, Gerd J; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard

2006-07-01

Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2'-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain.

Copper induction and differential expression of laccase in Aspergillus flavus

PubMed Central

Gomaa, Ola M.; Momtaz, Osama A.

2015-01-01

Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

Rice (Oryza sativa) Laccases Involved in Modification and Detoxification of Herbicides Atrazine and Isoproturon Residues in Plants.

PubMed

Huang, Meng Tian; Lu, Yi Chen; Zhang, Shuang; Luo, Fang; Yang, Hong

2016-08-24

Atrazine (ATR) and isoproturon (IPU) as herbicides have become serious environmental contaminants due to their overuse in crop production. Although ATR and IPU in soils are easily absorbed by many crops, the mechanisms for their degradation or detoxification in plants are poorly understood. This study identified a group of novel genes encoding laccases (EC 1.10.3.2) that are possibly involved in catabolism or detoxification of ATR and IPU residues in rice. Transcriptome profiling shows at least 22 differentially expressed laccase genes in ATR/IPU-exposed rice. Some of the laccase genes were validated by RT-PCR analysis. The biochemical properties of the laccases were analyzed, and their activities in rice were induced under ATR/IPU exposure. To investigate the roles of laccases in degrading or detoxifying ATR/IPU in rice, transgenic yeast cells (Pichia pastoris X-33) expressing two rice laccase genes (LOC_Os01g63180 and LOC_Os12g15680) were generated. Both transformants were found to accumulate less ATR/IPU compared to the control. The ATR/IPU-degraded products in the transformed yeast cells using UPLC-TOF-MS/MS were further characterized. Two metabolites, hydroxy-dehydrogenated atrazine (HDHA) and 2-OH-isopropyl-IPU, catalyzed by laccases were detected in the eukaryotic cells. These results indicate that the laccase-coding genes identified here could confer degradation or detoxification of the herbicides and suggest that the laccases could be one of the important enzymatic pathways responsible for ATR/IPU degradation/detoxification in rice.

Distribution, diversity and abundance of bacterial laccase-like genes in different particle size fractions of sediments in a subtropical mangrove ecosystem.

PubMed

Luo, Ling; Zhou, Zhi-Chao; Gu, Ji-Dong

2015-10-01

This study investigated the diversity and abundance of bacterial lacasse-like genes in different particle size fractions, namely sand, silt, and clay of sediments in a subtropical mangrove ecosystem. Moreover, the effects of nutrient conditions on bacterial laccase-like communities as well as the correlation between nutrients and, both the abundance and diversity indices of laccase-like bacteria in particle size fractions were also studied. Compared to bulk sediments, Bacteroidetes, Caldithrix, Cyanobacteria and Chloroflexi were dominated in all 3 particle-size fractions of intertidal sediment (IZ), but Actinobacteria and Firmicutes were lost after the fractionation procedures used. The diversity index of IZ fractions decreased in the order of bulk > clay > silt > sand. In fractions of mangrove forest sediment (MG), Verrucomicrobia was found in silt, and both Actinobacteria and Bacteroidetes appeared in clay, but no new species were found in sand. The declining order of diversity index in MG fractions was clay > silt > sand > bulk. Furthermore, the abundance of lacasse-like bacteria varied with different particle-size fractions significantly (p < 0.05), and decreased in the order of sand > clay > silt in both IZ and MG fractions. Additionally, nutrient availability was found to significantly affect the diversity and community structure of laccase-like bacteria (p < 0.05), while the total organic carbon contents were positively related to the abundance of bacterial laccase-like genes in particle size fractions (p < 0.05). Therefore, this study further provides evidence that bacterial laccase plays a vital role in turnover of sediment organic matter and cycling of nutrients.

Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

PubMed Central

Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo

2013-01-01

The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

Enhanced delignification of lignocellulosic substrates by Pichia GS115 expressed recombinant laccase.

PubMed

Kumar, Vidya Pradeep; Kolte, Atul P; Dhali, Arindam; Naik, Chandrashekar; Sridhar, Manpal

2018-04-25

Utilization of energy-rich crop residues by ruminants is restricted by the presence of lignin, which is recalcitrant to digestion. Application of lignin degrading enzymes on the lignocellulosic biomass exposes the cellulose for easy digestion by ruminants. Laccases have been found to be considerably effective in improving the digestibility by way of delignification. However, laccase yields from natural hosts are not sufficient for industrial scale applications, which restricts their use. A viable option would be to express the laccase gene in compatible hosts to achieve higher production yields. A codon-optimized synthetic variant of Schizophyllum commune laccase gene was cloned into a pPIC9K vector and expressed in P. pastoris GS115 (his4) under the control of an alcohol oxidase promoter. Colonies were screened for G418 resistance and the methanol utilization phenotype was established. The transformant yielded a laccase activity of 344 U·mL -1 after 5 days of growth at 30°C (0.019 g·mL -1 wet cell weight). The laccase protein produced by the recombinant Pichia clone was detected as two bands with apparent molecular weights of 55 kDa and 70 kDa on SDS-PAGE. Activity staining on native PAGE confirmed the presence of bioactive laccase. Treatment of five common crop residues with recombinant laccase recorded a lignin loss ranging between 1.64% in sorghum stover, to 4.83% in finger millet, with an enhancement in digestibility ranging between 8.71% in maize straw to 24.61% in finger millet straw. Treatment with recombinant laccase was effective in enhancing the digestibility of lignocellulosic biomass for ruminant feeding through delignification. To date, a number of hosts have been adventured to produce laccase in large quantities, but, to our knowledge, there are no reports of the expression of laccase protein from Schizophyllum commune in Pichia pastoris, and also on the treatment of crop residues using recombinant laccase for ruminant feeding.

Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.

PubMed

Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

2014-01-01

A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively.

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

PubMed Central

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

PubMed

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

PubMed

Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

2014-01-01

We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

PubMed Central

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with K m and k cat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

III digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest

Systematic Analysis of the Pleurotus ostreatus Laccase Gene (PoLac) Family and Functional Characterization of PoLac2 Involved in the Degradation of Cotton-Straw Lignin.

PubMed

Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping

2018-04-11

Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .

A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation

PubMed Central

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

2013-01-01

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

PubMed

Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

2015-01-01

Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

Electrochemical studies of a truncated laccase produced in Pichia pastoris

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.

1999-12-01

The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms ofmore » their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.« less

Bioprospecting and biotechnological applications of fungal laccase.

PubMed

Upadhyay, Pooja; Shrivastava, Rahul; Agrawal, Pavan Kumar

2016-06-01

Laccase belongs to a small group of enzymes called the blue multicopper oxidases, having the potential ability of oxidation. It belongs to enzymes, which have innate properties of reactive radical production, but its utilization in many fields has been ignored because of its unavailability in the commercial field. There are diverse sources of laccase producing organisms like bacteria, fungi and plants. In fungi, laccase is present in Ascomycetes, Deuteromycetes, Basidiomycetes and is particularly abundant in many white-rot fungi that degrade lignin. Laccases can degrade both phenolic and non-phenolic compounds. They also have the ability to detoxify a range of environmental pollutants. Due to their property to detoxify a range of pollutants, they have been used for several purposes in many industries including paper, pulp, textile and petrochemical industries. Some other application of laccase includes in food processing industry, medical and health care. Recently, laccase has found applications in other fields such as in the design of biosensors and nanotechnology. The present review provides an overview of biological functions of laccase, its mechanism of action, laccase mediator system, and various biotechnological applications of laccase obtained from endophytic fungi.

Blood tolerant laccase by directed evolution.

PubMed

Mate, Diana M; Gonzalez-Perez, David; Falk, Magnus; Kittl, Roman; Pita, Marcos; De Lacey, Antonio L; Ludwig, Roland; Shleev, Sergey; Alcalde, Miguel

2013-02-21

High-redox potential laccases are powerful biocatalysts with a wide range of applications in biotechnology. We have converted a thermostable laccase from a white-rot fungus into a blood tolerant laccase. Adapting the fitness of this laccase to the specific composition of human blood (above neutral pH, high chloride concentration) required several generations of directed evolution in a surrogate complex blood medium. Our evolved laccase was tested in both human plasma and blood, displaying catalytic activity while retaining a high redox potential at the T1 copper site. Mutations introduced in the second coordination sphere of the T1 site shifted the pH activity profile and drastically reduced the inhibitory effect of chloride. This proof of concept that laccases can be adapted to function in extreme conditions opens an array of opportunities for implantable nanobiodevices, chemical syntheses, and detoxification. Copyright © 2013 Elsevier Ltd. All rights reserved.

Laccase/HBT and laccase-CBM/HBT treatment of softwood kraft pulp: impact on pulp bleachability and physical properties.

PubMed

Ravalason, Holy; Bertaud, Frédérique; Herpoël-Gimbert, Isabelle; Meyer, Valérie; Ruel, Katia; Joseleau, Jean-Paul; Grisel, Sacha; Olivé, Caroline; Sigoillot, Jean-Claude; Petit-Conil, Michel

2012-10-01

Pycnoporus cinnabarinus laccase and a chimeric laccase-CBM were applied in softwood kraft pulp biobleaching in the presence of 1-hydroxybenzotriazole (HBT). The presence of CBM could enhance the laccase biobleaching potential as a decrease in the enzymatic charge and chlorine dioxide consumption, as well as an increase in pulp brightness were observed. Laccase/HBT treatment could be improved by increasing oxygen pressure from 1 to 3bar and pulp consistency from 5% to 10%. Conversely, under the same conditions, no improvement of laccase-CBM/HBT treatment was observed, indicating a different behavior of both systems. However, laccase-CBM/HBT treatment led to a better preservation of pulp properties. This effect was probably due to fiber surface modifications involving the action of the CBM. Transmission electron microscopy examination of pulp fibers indicated a retention of laccase-CBM inside the pulp fibers due to CBM binding and an increased external microfibrillation of the fibers due to enzymatic treatments. Copyright © 2012 Elsevier Ltd. All rights reserved.

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

PubMed Central

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Identification and evaluation of bioremediation potential of laccase isoforms produced by Cyathus bulleri on wheat bran.

PubMed

Vats, Arpita; Mishra, Saroj

2018-02-15

Multiplicity in laccases among lignin degrading fungal species is of interest as it confers the ability to degrade several types of lignocellulosics. The combination of laccases produced on such substrates could be beneficial for treatment of complex aromatics, including dyes. In this study, we report on production of high units (679.6Ug -1 substrate) of laccase on solid wheat bran (WB) by Cyathus bulleri. Laccase, purified from the culture filtrates of WB grown fungus, was effective for oxidation of veratryl alcohol, Reactive blue 21 and textile effluent without assistance of externally added mediators. De novo sequencing of the 'purified' laccase lead to identification of several peptides that originated from different laccase genes. Transcriptome analysis of the fungus, cultivated on WB, confirmed presence of 8 isozymes, that were re-amplified and sequenced from the cDNA prepared from WB grown fungus. The 8 isozymes were grouped into 3 classes, based on their sequence relationship with other basidiomycete laccases. The isoforms produced on WB decolorized (by ∼57%) and degraded textile effluent far more effectively, compared to laccase obtained from Basal salt cultivated fungus. The decolorization and degradation was also accompanied by more than 95% reduction in phytotoxicity. Copyright © 2017 Elsevier B.V. All rights reserved.

Metal release and sequestration from black slate mediated by a laccase of Schizophyllum commune.

PubMed

Kirtzel, Julia; Scherwietes, Eric Leon; Merten, Dirk; Krause, Katrin; Kothe, Erika

2018-06-25

Schizophyllum commune is a filamentous basidiomycete which can degrade complex organic macromolecules like lignin by the secretion of a large repertoire of enzymes. One of these white rot enzymes, laccase, exhibits a broad substrate specificity and is able to oxidize a variety of substances including carbonaceous rocks. To investigate the role of laccase in bioweathering, laccase gene lcc2 was overexpressed, and the influence on weathering of black slate, originating from a former alum mine in Schmiedefeld, Germany, was examined. The metal release from the rock material was enhanced, associated with a partial metal accumulation into the mycelium. A sequestration of metals could be shown with fluorescent staining methods, and an accumulation of Zn, Cd, and Pb was visualized in different cell organelles. Additionally, we could show an increased metal resistance of the laccase overexpressing strain.

Construction and direct electrochemistry of orientation controlled laccase electrode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Ying; Zhang, Jiwei; Huang, Xirong, E-mail: xrhuang@sdu.edu.cn

2014-03-28

Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, usingmore » genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.« less

Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris

PubMed Central

Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.

1999-01-01

The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI→LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10−4 cm s−1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

Laccases from Aureobasidium pullulans

USDA-ARS?s Scientific Manuscript database

Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

PubMed

Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

2012-10-23

Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

Improved recovery of active recombinant laccase from maize seed.

PubMed

Bailey, M R; Woodard, S L; Callaway, E; Beifuss, K; Magallanes-Lundback, M; Lane, J R; Horn, M E; Mallubhotla, H; Delaney, D D; Ward, M; Van Gastel, F; Howard, J A; Hood, E E

2004-01-01

Lignolytic enzymes such as laccase have been difficult to over-express in an active form. This paper describes the expression, characterization, and application of a fungal laccase in maize seed. The transgenic seed contains immobilized and extractable laccase. Fifty ppm dry weight of aqueously extractable laccase was obtained, and the remaining solids contained a significant amount of immobilized laccase that was active. Although a portion of the extractable laccase was produced as inactive apoenzyme, laccase activity was recovered by treatment with copper and chloride. In addition to allowing the apoenzyme to regain activity, treatment with copper also provided a partial purification step by precipitating other endogenous corn proteins while leaving >90% of the laccase in solution. The data also demonstrate the application of maize-produced laccase as a polymerization agent. The apparent concentration of laccase in ground, defatted corn germ is approximately 0.20% of dry weight.

Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition

USGS Publications Warehouse

Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

2007-01-01

The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

PubMed

Osato, Naoki

2018-01-19

Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional

The pbrB Gene Encodes a Laccase Required for DHN-Melanin Synthesis in Conidia of Talaromyces (Penicillium) marneffei

PubMed Central

Sapmak, Ariya; Boyce, Kylie J.; Andrianopoulos, Alex; Vanittanakom, Nongnuch

2015-01-01

Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type. PMID:25866870

Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397).

PubMed

Dhakar, Kusum; Pandey, Anita

2013-01-01

Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03) isolated from a glacial site in Indian Himalayan Region (IHR) has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C ± 2 (25°C opt.) and pH 3-13 (5-7 opt.). Molecular weight of laccase was determined approximately 45 kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain) contained 200 bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0 mM) induced laccase production up to 2-fold, in case of 0.4 mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold) induction. The study has implications in bioprospecting of ecologically resilient microbial strains.

Fungal Laccases: Production, Function, and Applications in Food Processing

PubMed Central

Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.

2010-01-01

Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed. PMID:21048859

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

PubMed Central

2012-01-01

Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra

Construction and direct electrochemistry of orientation controlled laccase electrode.

PubMed

Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

2014-03-28

A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. Copyright © 2014 Elsevier Inc. All rights reserved.

The significance of alternative transcripts for Caenorhabditis elegans transcription factor genes, based on expression pattern analysis

PubMed Central

2013-01-01

Background Sequence-specific DNA-binding proteins, with their paramount importance in the regulation of expression of the genetic material, are encoded by approximately 5% of the genes in an animal’s genome. But it is unclear to what extent alternative transcripts from these genes may further increase the complexity of the transcription factor complement. Results Of the 938 potential C. elegans transcription factor genes, 197 were annotated in WormBase as encoding at least two distinct isoforms. Evaluation of prior evidence identified, with different levels of confidence, 50 genes with alternative transcript starts, 23 with alternative transcript ends, 35 with alternative splicing and 34 with alternative transcripts generated by a combination of mechanisms, leaving 55 that were discounted. Expression patterns were determined for transcripts for a sample of 29 transcription factor genes, concentrating on those with alternative transcript starts for which the evidence was strongest. Seamless fosmid recombineering was used to generate reporter gene fusions with minimal modification to assay expression of specific transcripts while maintaining the broad genomic DNA context and alternative transcript production. Alternative transcription factor gene transcripts were typically expressed with identical or substantially overlapping distributions rather than in distinct domains. Conclusions Increasingly sensitive sequencing technologies will reveal rare transcripts but many of these are clearly non-productive. The majority of the transcription factor gene alternative transcripts that are productive may represent tolerable noise rather than encoding functionally distinct isoforms. PMID:23586691

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

Laccase/Mediator Systems: Their Reactivity toward Phenolic Lignin Structures.

PubMed

Hilgers, Roelant; Vincken, Jean-Paul; Gruppen, Harry; Kabel, Mirjam A

2018-02-05

Laccase-mediator systems (LMS) have been widely studied for their capacity to oxidize the nonphenolic subunits of lignin (70-90% of the polymer). The phenolic subunits (10-30% of the polymer), which can also be oxidized without mediators, have received considerably less attention. Consequently, it remains unclear to what extent the presence of a mediator influences the reactions of the phenolic subunits of lignin. To get more insight in this, UHPLC-MS was used to study the reactions of a phenolic lignin dimer (GBG), initiated by a laccase from Trametes versicolor , alone or in combination with the mediators HBT and ABTS. The role of HBT was negligible, as its oxidation by laccase occurred slowly in comparison to that of GBG. Laccase and laccase/HBT oxidized GBG at a comparable rate, resulting in extensive polymerization of GBG. In contrast, laccase/ABTS converted GBG at a higher rate, as GBG was oxidized both directly by laccase but also by ABTS radical cations, which were rapidly formed by laccase. The laccase/ABTS system resulted in Cα oxidation of GBG and coupling of ABTS to GBG, rather than polymerization of GBG. Based on these results, we propose reaction pathways of phenolic lignin model compounds with laccase/HBT and laccase/ABTS.

Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride

PubMed Central

Balcázar-López, Edgar; Méndez-Lorenzo, Luz Helena; Batista-García, Ramón Alberto; Esquivel-Naranjo, Ulises; Ayala, Marcela; Kumar, Vaidyanathan Vinoth; Savary, Olivier; Cabana, Hubert; Herrera-Estrella, Alfredo; Folch-Mallol, Jorge Luis

2016-01-01

Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus) sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc). To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor) from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation. PMID:26849129

Expression of a thermotolerant laccase from Pycnoporus sanguineus in Trichoderma reesei and its application in the degradation of bisphenol A.

PubMed

Zhao, Jie; Zeng, Shengquan; Xia, Ying; Xia, Liming

2018-04-01

The laccase gene from Pycnoporus sanguineus was cloned and inserted between the strong Pcbh1 promoter and the Tcbh1 terminator from Trichoderma reesei to form the recombinant plasmid pCH-lac. Using Agrobacterium-mediated technique, the pCH-lac was integrated into the chromosomes of T. reesei. Twenty positive transformants were obtained by employing hygromycin B as a selective agent. PCR was used to confirm that the laccase gene was integrated into the chromosomal DNA of T. reesei. Laccase production by recombinant transformants was performed in shaking flasks, and the activity of laccase reached 8.8 IU/mL after 96-h fermentation under a batch process, and 17.7 IU/mL after 144-h fermentation using a fed-batch process. SDS-PAGE analysis of the fermentation broth showed that the molecular mass of the protein was about 68 kDa, almost the same as that of the laccase produced by P. sanguineus, which indicated that laccase was successfully expressed in T. reesei and secreted out of the cells. The laccase produced by the recombinant T. reesei showed good thermal stability, and could degrade the toxic phenolic material bisphenol A efficiently, after 1-h reaction with 0.06 IU/mL laccase and 0.5 mmol/L ABTS as the mediator at 60 °C and pH 4.5, the degradation rate reached 95%, which demonstrated that it had great potential value in treating the household garbage and wastewater containing the bisphenol A. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability.

PubMed

Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong

2011-02-01

Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.

Repression of Meiotic Genes by Antisense Transcription and by Fkh2 Transcription Factor in Schizosaccharomyces pombe

PubMed Central

Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.

2012-01-01

In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the “unspliced” signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression. PMID:22238674

Automated chromatographic laccase-mediator-system activity assay.

PubMed

Anders, Nico; Schelden, Maximilian; Roth, Simon; Spiess, Antje C

2017-08-01

To study the interaction of laccases, mediators, and substrates in laccase-mediator systems (LMS), an on-line measurement was developed using high performance anion exchange chromatography equipped with a CarboPac™ PA 100 column coupled to pulsed amperometric detection (HPAEC-PAD). The developed method was optimized for overall chromatographic run time (45 to 120 min) and automated sample drawing. As an example, the Trametes versicolor laccase induced oxidation of 1-(3,4-dimethoxyphenyl)-2-(2-methoxyphenoxy)-1,3-dihydroxypropane (adlerol) using 1-hydroxybenzotriazole (HBT) as mediator was measured and analyzed on-line. Since the Au electrode of the PAD detects only hydroxyl group containing substances with a limit of detection being in the milligram/liter range, not all products are measureable. Therefore, this method was applied for the quantification of adlerol, and-based on adlerol conversion-for the quantification of the LMS activity at a specific T. versicolor laccase/HBT ratio. The automated chromatographic activity assay allowed for a defined reaction start of all laccase-mediator-system reactions mixtures, and the LMS reaction progress was automatically monitored for 48 h. The automatization enabled an integrated monitoring overnight and over-weekend and minimized all manual errors such as pipetting of solutions accordingly. The activity of the LMS based on adlerol consumption was determined to 0.47 U/mg protein for a laccase/mediator ratio of 1.75 U laccase/g HBT. In the future, the automated method will allow for a fast screening of combinations of laccases, mediators, and substrates which are efficient for lignin modification. In particular, it allows for a fast and easy quantification of the oxidizing activity of an LMS on a lignin-related substrate which is not covered by typical colorimetric laccase assays. ᅟ.

Induction of lcc2 expression and activity by Agaricus bisporus provides defence against Trichoderma aggressivum toxic extracts

PubMed Central

Sjaarda, Calvin P; Abubaker, Kamal S; Castle, Alan J

2015-01-01

Laccases are used by fungi for several functions including defence responses to stresses associated with attack by other fungi. Laccase activity changes and the induction of two laccase genes, lcc1 and lcc2, in Agaricus bisporus were measured in response to toxic extracts of medium in which Trichoderma aggressivum, the cause of green mould disease, was grown. A strain of A. bisporus that shows resistance to the extracts showed higher basal levels and greater enzymatic activity after extract exposure than did a sensitive strain. Furthermore, pre-incubation of T. aggressivum extract with laccases reduced toxicity. Faster induction and greater numbers of lcc2 transcripts in response to the extract were noted in the resistant strain than in the sensitive strain. The timing and increase in lcc2 transcript abundance mirrored changes in total laccase activity. No correlation between resistance and lcc1 transcription was apparent. Transcript abundance in transformants with a siRNA construct homologous to both genes varied widely. A strong negative correlation between transcript abundance and sensitivity of the transformant to toxic extract was observed in plate assays. These results indicated that laccase activity and in particular that encoded by lcc2 contributes to toxin metabolism and by extension green mould disease resistance. PMID:25824278

Transcriptional Coupling of Neighboring Genes and Gene Expression Noise: Evidence that Gene Orientation and Noncoding Transcripts Are Modulators of Noise

PubMed Central

Wang, Guang-Zhong; Lercher, Martin J.; Hurst, Laurence D.

2011-01-01

Abstract How is noise in gene expression modulated? Do mechanisms of noise control impact genome organization? In yeast, the expression of one gene can affect that of a very close neighbor. As the effect is highly regionalized, we hypothesize that genes in different orientations will have differing degrees of coupled expression and, in turn, different noise levels. Divergently organized gene pairs, in particular those with bidirectional promoters, have close promoters, maximizing the likelihood that expression of one gene affects the neighbor. With more distant promoters, the same is less likely to hold for gene pairs in nondivergent orientation. Stochastic models suggest that coupled chromatin dynamics will typically result in low abundance-corrected noise (ACN). Transcription of noncoding RNA (ncRNA) from a bidirectional promoter, we thus hypothesize to be a noise-reduction, expression-priming, mechanism. The hypothesis correctly predicts that protein-coding genes with a bidirectional promoter, including those with a ncRNA partner, have lower ACN than other genes and divergent gene pairs uniquely have correlated ACN. Moreover, as predicted, ACN increases with the distance between promoters. The model also correctly predicts ncRNA transcripts to be often divergently transcribed from genes that a priori would be under selection for low noise (essential genes, protein complex genes) and that the latter genes should commonly reside in divergent orientation. Likewise, that genes with bidirectional promoters are rare subtelomerically, cluster together, and are enriched in essential gene clusters is expected and observed. We conclude that gene orientation and transcription of ncRNAs are candidate modulators of noise. PMID:21402863

Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.

PubMed

Ausec, Luka; Črnigoj, Miha; Šnajder, Marko; Ulrih, Nataša Poklar; Mandic-Mulec, Ines

2015-12-01

Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6× His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20 °C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH 5.0 and pH 9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50 °C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general.

Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

PubMed

Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

2009-03-01

Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Biochemical and Molecular Characterization of a Laccase from Marasmius quercophilus

PubMed Central

Dedeyan, Boghos; Klonowska, Agnieszka; Tagger, Simone; Tron, Thierry; Iacazio, Gilles; Gil, Gérard; Le Petit, Jean

2000-01-01

The basidiomycete Marasmius quercophilus is commonly found during autumn on the decaying litter of the evergreen oak (Quercus ilex L.), a plant characteristic of Mediterranean forest. This white-rot fungus colonizes the leaf surface with rhizomorphs, causing a total bleaching of the leaf. In synthetic liquid media, this white-rot fungus has strong laccase activity. From a three-step chromatographic procedure, we purified a major isoform to homogeneity. The gene encodes a monomeric glycoprotein of approximately 63 kDa, with a 3.6 isoelectric point, that contains 12% carbohydrate. Spectroscopic analysis of the purified enzyme (UV/visible and electron paramagnetic resonance, atomic absorption) confirmed that it belongs to the “blue copper oxidase” family. With syringaldazine as the substrate, the enzyme's pH optimum was 4.5, the optimal temperature was 75°C, and the Km was 7.1 μM. The structural gene, lac1, was cloned and sequenced. This gene encodes a 517-amino-acid protein 99% identical to a laccase produced by PM1, an unidentified basidiomycete previously isolated from wastewater from a paper factory in Spain. This similarity may be explained by the ecological distribution of the evergreen oak in Mediterranean forest. PMID:10698753

Genes associated with lignin degradation in the polyphagous white-rot pathogen Heterobasidion irregulare show substrate-specific regulation.

PubMed

Yakovlev, Igor A; Hietala, Ari M; Courty, Pierre-Emmanuel; Lundell, Taina; Solheim, Halvor; Fossdal, Carl Gunnar

2013-07-01

The pathogenic white-rot basidiomycete Heterobasidion irregulare is able to remove lignin and hemicellulose prior to cellulose during the colonization of root and stem xylem of conifer and broadleaf trees. We identified and followed the regulation of expression of genes belonging to families encoding ligninolytic enzymes. In comparison with typical white-rot fungi, the H. irregulare genome has exclusively the short-manganese peroxidase type encoding genes (6 short-MnPs) and thereby a slight contraction in the pool of class II heme-containing peroxidases, but an expansion of the MCO laccases with 17 gene models. Furthermore, the genome shows a versatile set of other oxidoreductase genes putatively involved in lignin oxidation and conversion, including 5 glyoxal oxidases, 19 quinone-oxidoreductases and 12 aryl-alcohol oxidases. Their genetic multiplicity and gene-specific regulation patterns on cultures based on defined lignin, cellulose or Norway spruce lignocellulose substrates suggest divergent specificities and physiological roles for these enzymes. While the short-MnP encoding genes showed similar transcript levels upon fungal growth on heartwood and reaction zone (RZ), a xylem defense tissue rich in phenolic compounds unique to trees, a subset of laccases showed higher gene expression in the RZ cultures. In contrast, other oxidoreductases depending on initial MnP activity showed generally lower transcript levels on RZ than on heartwood. These data suggest that the rate of fungal oxidative conversion of xylem lignin differs between spruce RZ and heartwood. It is conceivable that in RZ part of the oxidoreductase activities of laccases are related to the detoxification of phenolic compounds involved in host-defense. Expression of the several short-MnP enzymes indicated an important role for these enzymes in effective delignification of wood by H. irregulare. Copyright © 2013 Elsevier Inc. All rights reserved.

Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors.

PubMed

Thiel, Gerald; Rössler, Oliver G

2017-03-01

Resveratrol (trans-3,4',5-trihydroxystilbene), a polyphenolic phytoalexin of grapes and other fruits and plants, is a common constituent of our diet and of dietary supplements. Many health-promoting benefits have been connected with resveratrol in the treatment of cardiovascular diseases, cancer, diabetes, inflammation, neurodegeneration, and diseases connected with aging. To explain the pleiotropic effects of resveratrol, the molecular targets of this compound have to be identified on the cellular level. Resveratrol induces intracellular signal transduction pathways which ultimately lead to changes in the gene expression pattern of the cells. Here, we review the effect of resveratrol on the activation of the stimulus-responsive transcription factors CREB, AP-1, Egr-1, Elk-1, and Nrf2. Following activation, these transcription factors induce transcription of delayed response genes. The gene products of these delayed response genes are ultimately responsible for the changes in the biochemistry and physiology of resveratrol-treated cells. The activation of stimulus-responsive transcription factors may explain many of the intracellular activities of resveratrol. However, results obtained in vitro may not easily be transferred to in vivo systems. Copyright © 2016 Elsevier Ltd. All rights reserved.

Laccases: Production, Expression Regulation, and Applications in Pharmaceutical Biodegradation

PubMed Central

Yang, Jie; Li, Wenjuan; Ng, Tzi Bun; Deng, Xiangzhen; Lin, Juan; Ye, Xiuyun

2017-01-01

Laccases are a family of copper-containing oxidases with important applications in bioremediation and other various industrial and biotechnological areas. There have been over two dozen reviews on laccases since 2010 covering various aspects of this group of versatile enzymes, from their occurrence, biochemical properties, and expression to immobilization and applications. This review is not intended to be all-encompassing; instead, we highlighted some of the latest developments in basic and applied laccase research with an emphasis on laccase-mediated bioremediation of pharmaceuticals, especially antibiotics. Pharmaceuticals are a broad class of emerging organic contaminants that are recalcitrant and prevalent. The recent surge in the relevant literature justifies a short review on the topic. Since low laccase yields in natural and genetically modified hosts constitute a bottleneck to industrial-scale applications, we also accentuated a genus of laccase-producing white-rot fungi, Cerrena, and included a discussion with regards to regulation of laccase expression. PMID:28559880

Engineering and Applications of fungal laccases for organic synthesis

PubMed Central

Kunamneni, Adinarayana; Camarero, Susana; García-Burgos, Carlos; Plou, Francisco J; Ballesteros, Antonio; Alcalde, Miguel

2008-01-01

Laccases are multi-copper containing oxidases (EC 1.10.3.2), widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product) and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed. PMID:19019256

Comparison of two laccases from Trametes versicolor for application in the decolorization of dyes.

PubMed

Li, Qi; Ge, Lin; Cai, Junli; Pei, Jianjun; Xie, Jingcong; Zhao, Linguo

2014-04-01

It has been previously demonstrated that laccases exhibit great potential for use in several industrial and environmental applications. In this paper, two laccase isoenzyme genes, lccB and lccC, were cloned and expressed in Pichia pastoris GS115. The sequence analysis indicated that the lccB and lccC genes consisted of 1,563 and 1,584 bp, and their open reading frames encoded 520 and 527 amino acids, respectively. They had 72.7% degree of identity in nucleotides and 86.7% in amino acids. The expression levels of LccB and LccC were up to 32,479 and 34,231 U/l, respectively. The recombinant laccases were purified by ultrafiltration and (NH4)2SO4 precipitation, showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimal pH and temperature for LccB were 2.0 and 55°C with 2,2'-azino-bis-[3-ethylbenzthiazolinesulfonic acid (ABTS) as a substrate, whereas LccC exhibited optimal pH and temperature at 3.0 and 60°C. The apparent kinetic parameters of LccB were 0.43 mM for ABTS with a Vmax value of 51.28 U/mg, and the Km and Vmax values for LccC were 0.29 mM and 62.89 U/mg. The recombinant laccases were able to decolorize five types of dyes. Acid Violet 43 (100 g/ml) was completely decolorized by LccB or LccC (2 U/ml), and the decolorization of Reactive Blue KN-R (100 g/ml) was 91.6% by LccC (2 U/ml). Thus, the study characterizes useful laccase isoenzymes from T. versicolor that have the capability of being incorporated into the treatment of similar azo and anthraquinone dyes from dyeing industries.

Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

PubMed Central

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Control of bacteriophage P2 gene expression: analysis of transcription of the ogr gene.

PubMed Central

Birkeland, N K; Lindqvist, B H; Christie, G E

1991-01-01

The bacteriophage P2 ogr gene encodes an 8.3-kDa protein that is a positive effector of P2 late gene transcription. The ogr gene is preceded by a promoter sequence (Pogr) resembling a normal Escherichia coli promoter and is located just downstream of a late transcription unit. We analyzed the kinetics and regulation of ogr gene transcription by using an ogr-specific antisense RNA probe in an S1 mapping assay. During a normal P2 infection, ogr gene transcription starts from Pogr at an intermediate time between the onset of early and late transcription. At late times after infection the ogr gene is cotranscribed with the late FETUD operon; the ogr gene product thus positively regulates its own synthesis from the P2 late promoter PF. Expression of the P2 late genes also requires P2 DNA replication. Complementation experiments and transcriptional analysis show that a nonreplicating P2 phage expresses the ogr gene from Pogr but is unable to transcribe the late genes. A P2 ogr-defective phage makes an increased level of ogr mRNA, consistent with autogenous control from Pogr. Transcription of the ogr gene in the prophage of a P2 heteroimmune lysogen is stimulated after infection with P2, suggesting that Pogr is under indirect immunity control and is activated by a yet-unidentified P2 early gene product during infection. Images FIG. 4 FIG. 5 FIG. 6 FIG. 7 FIG. 8 PMID:1938896

[Advance of heterologous expression study of eukaryote-origin laccases].

PubMed

Ning, Na; Tan, Huijun; Sun, Xinxin; Ni, Jinfeng

2017-04-25

Laccases are enzymes belonging to the group of multi-copper oxidases. These enzymes are widely distributed in insects, plants, fungi and bacteria. In general, laccases can oxidize an exceptionally high number of substrates, so they have broad applications in textile, pulp, food and the degradation of lignin. However, low yield, low activity and thermo-instability of laccase in nature limit the application of laccase. High efficient heterologous expression of the protein is an effective way for solving this problem. Here, we summarize the research advances of heterologous expression of eukaryote-origin laccases. We focus on the overexpression of eukaryote-origin laccases using different expression system and the method for improving the production yield and enzyme activity in yeast cells. Information provided in this review would be helpful for researchers in the field.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Synthesis of novel laccase-biotitania biocatalysts for malachite green decolorization.

PubMed

Zhang, Xinying; Wang, Meiyin; Lin, Linlin; Xiao, Gao; Tang, Zhenping; Zhu, Xuefeng

2018-07-01

Biomimetic mineralization has emerged as a novel tool for generating excellent supports for enzyme stabilization. In this work, protamine was used to induce titanium (IV) bis(ammonium lactato) dihydroxide (Ti-BALDH) into titania nanoparticles. This biomimetic titanification process was adopted for laccase immobilization. Laccase-biotitania biocatalyst was prepared and the effect of different parameters (buffer solution, titania precursor concentration, protamine concentration, and enzyme loading) on the encapsulation efficiency and recovery of laccase were evaluated. Compared with free laccase, the thermal and pH stability of immobilized laccase were improved significantly. In addition, laccase loaded on titania was effective at enhancing its storage stability. After seven consecutive cycles, the immobilized laccase still retained 51% of its original activity. Finally, laccase-biotitania biocatalysts showed good performance on decolorization of malachite green (MG), which can be attributed to an adsorption and degradation effect. The intermediates of the MG degradation were identified by gas chromatography-mass spectrometry (GC-MS) analysis, and the most probable degradation pathway was proposed. This study provides deeper understanding of the laccase-biotitania particles as a fast biocatalyst for MG decolorization. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Biochemical characterization and molecular evidence of a laccase from the bird's nest fungus Cyathus bulleri.

PubMed

Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander

2005-08-01

Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity.

Spore cells from BPA degrading bacteria Bacillus sp. GZB displaying high laccase activity and stability for BPA degradation.

PubMed

Das, Ranjit; Li, Guiying; Mai, Bixian; An, Taicheng

2018-06-04

Laccase has been applied extensively as a biocatalyst to remove different organic pollutants. This study characterized a spore-laccase from the bisphenol A (BPA)-degrading strain Bacillus sp. GZB. The spore-laccase was encoded with 513 amino acids, containing spore coat protein A (CotA). It showed optimal activity at 70 °C and pH = 7.2 in presence of 2, 6-dimethoxyphenol. At 60 °C, optimal activity was also seen at pH = 3.0 and pH = 6.8 with 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) and syringaldazine, respectively. The spore-laccase was stable at high temperature, at acidic to alkaline pH values, and in the presence of different organic solvents. Spore-laccase activity was increased by introducing Cu 2+ , Mg 2+ , and Na + , but was strongly inhibited by Fe 2+ , Ag + , l-cysteine, dithiothreitol, and NaN 3 . The cotA gene was cloned and expressed in E. coli BL21 (DE3); the purified protein was estimated as having a molecular weight of ~63 kDa. Different synthetic dyes and BPA were effectively decolorized or degraded both by the spore laccase and recombinant laccase. When BPA oxidation was catalyzed using laccase, there was an initial formation of phenoxy radicals and further oxidation or CC bond cleavage of the radicals produced different organic acids. Detailed reaction pathways were developed based on nine identified intermediates. The acute toxicity decreased gradually during BPA degradation by laccase. This study is the first report about a genus of Bacillus that can produce a highly active and stable laccase to degrade BPA. Copyright © 2018 Elsevier B.V. All rights reserved.

Production of laccase by Coriolus versicolor and its application in decolorization of dyestuffs: (I). Production of laccase by batch and repeated-batch processes.

PubMed

Lin, Jian-Ping; Wei, Lian; Xia, Li-Ming; Cen, Pei-Lin

2003-01-01

The production of laccase by Coriolus versicolor was studied. The effect of cultivation conditions on laccase production by Coriolus versicolor was examined to obtain optimal medium and cultivation conditions. Both batch and repeated-batch processes were performed for laccase production. In repeated-batch fermentation with self-immobilized mycelia, total of 14 cycles were performed with laccase activity in the range between 3.4 and 14.8 U/ml.

Engineering laccases: in search for novel catalysts.

PubMed

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-04-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases.

Engineering Laccases: In Search for Novel Catalysts

PubMed Central

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-01-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases. PMID:21966250

Mechanisms of specificity in neuronal activity-regulated gene transcription

PubMed Central

Lyons, Michelle R.; West, Anne E.

2011-01-01

The brain is a highly adaptable organ that is capable of converting sensory information into changes in neuronal function. This plasticity allows behavior to be accommodated to the environment, providing an important evolutionary advantage. Neurons convert environmental stimuli into long-lasting changes in their physiology in part through the synaptic activity-regulated transcription of new gene products. Since the neurotransmitter-dependent regulation of Fos transcription was first discovered nearly 25 years ago, a wealth of studies have enriched our understanding of the molecular pathways that mediate activity-regulated changes in gene transcription. These findings show that a broad range of signaling pathways and transcriptional regulators can be engaged by neuronal activity to sculpt complex programs of stimulus-regulated gene transcription. However, the shear scope of the transcriptional pathways engaged by neuronal activity raises the question of how specificity in the nature of the transcriptional response is achieved in order to encode physiologically relevant responses to divergent stimuli. Here we summarize the general paradigms by which neuronal activity regulates transcription while focusing on the molecular mechanisms that confer differential stimulus-, cell-type-, and developmental-specificity upon activity-regulated programs of neuronal gene transcription. In addition, we preview some of the new technologies that will advance our future understanding of the mechanisms and consequences of activity-regulated gene transcription in the brain. PMID:21620929

Fungal Laccases and Their Applications in Bioremediation

PubMed Central

Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

2014-01-01

Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

Heterologous expression of Trametes versicolor laccase in Saccharomyces cerevisiae.

PubMed

Iimura, Yosuke; Sonoki, Tomonori; Habe, Hiroshi

2018-01-01

Laccase is used in various industrial fields, and it has been the subject of numerous studies. Trametes versicolor laccase has one of the highest redox potentials among the various forms of this enzyme. In this study, we optimized the expression of laccase in Saccharomyces cerevisiae. Optimizing the culture conditions resulted in an improvement in the expression level, and approximately 45 U/L of laccase was functionally secreted in the culture. The recombinant laccase was found to be a heavily hypermannosylated glycoprotein, and the molecular weight of the carbohydrate chain was approximately 60 kDa. These hypermannosylated glycans lowered the substrate affinity, but the optimum pH and thermo-stability were not changed by these hypermannosylated glycans. This functional expression system described here will aid in molecular evolutionary studies conducted to generate new variants of laccase. Copyright © 2017 Elsevier Inc. All rights reserved.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

PubMed Central

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-01-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation

PubMed Central

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-01-01

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0–6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation. PMID:27775052

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation.

PubMed

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-10-24

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0-6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation.

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation

NASA Astrophysics Data System (ADS)

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-10-01

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0-6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation.

Production of Laccase by Recombinant Yarrowia lipolytica from Molasses: Bioprocess Development Using Statistical Modeling and Increase Productivity in Shake-Flask and Bioreactor Cultures.

PubMed

Darvishi, Farshad; Moradi, Marzieh; Madzak, Catherine; Jolivalt, Claude

2017-03-01

Laccases are used in numerous applications, from green degradation of various xenobiotic compounds, waste detoxification, textile dye bleaching, and delignification of lignocellulose materials to biofuel production. In this study, the recombinant Yarrowia lipolytica YL4 strain carrying the white-rot fungus Trametes versicolor laccase IIIb gene was used for laccase production from beet molasses as an agro-industrial residue. Response surface methodology was used to statistical optimization of the production of laccase by Y. lipolytica using an industrial medium containing molasses which allows a six times increase in laccase activity compared to primary medium contains glucose after 144 h. In bioreactor cultivation after 48 h, laccase production reached to 3.7- and 22.5-fold more than optimized and primary media in shake-flask cultures, respectively. Laccase productivity in bioreactor (0.0937 U/h) was higher than shake-flask culture (0.0084 U/h). The present study provides valuable information about statistical optimization of bioprocess development for cost-effective production of laccase and other heterologous proteins in Y. lipolytica from beet molasses as sole carbon source, thus allowing the valorization and decreasing environmental pollution of this agro-industrial waste.

Heterologous laccase production and its role in industrial applications

PubMed Central

Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

2010-01-01

Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

Lignin oxidation and pulp delignification by laccase and mediators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bourbonnais, R.; Paice, M.G.; Reid, I.D.

1996-10-01

The phenol oxidizing enzyme laccase is produced abundantly by the lignin-degrading fungus Trametes versicolor. We found previously that laccase can oxidize veratryl alcohol and other non-phenolic lignin model compounds when a mediator such as 2,2{prime}-azinobis(3-ethylbenzthiazoline-5-sulphonate) (ABTS) was present. The laccase/mediator couple was also shown to be effective for delignification of kraft pulps. Two different isozymes of laccase produced by this fungus were purified and their reactivities towards lignins and kraft pulps were studied. The mediator ABTS was shown to be essential for pulp delignification and to reverse the polymerization of kraft lignin by either laccase. Pulp delignification with laccase andmore » ABTS was also optimized. resulting in up to 55% lignin removal from kraft pulp following sequential enzyme treatments and alkaline extractions. Several variables were surveyed including enzyme and mediator dosage, oxygen pressure, temperature, reaction time, and pH.« less

Changes is genes coding for laccases 1 and 2 may contribute to deformation and reduction of wings in apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) from the isolated population in Pieniny National Park (Poland).

PubMed

Łukasiewicz, Kinga; Węgrzyn, Grzegorz

2016-01-01

An isolated population of apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) occurs in Pieniny National Park (Poland). Deformations and reductions of wings in a relatively large number of individuals from this population is found, yet the reasons for these defects are unknown. During studies devoted to identify cause(s) of this phenomenon, we found that specific regions of genes coding of enzymes laccases 1 and 2 could not be amplified from DNA samples isolated from large fractions of malformed insects while expected PCR products were detected in almost all (with one exception) normal butterflies. Laccases (p-diphenol:dioxygen oxidoreductases) are oxidases containing several copper atoms. They catalyse single-electron oxidations of phenolic or other compounds with concomitant reduction of oxygen to water. In insects, their enzymatic activities were found previously in epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Therefore, we suggest that defects in genes coding for laccases might contribute to deformation and reduction of wings in apollo butterflies, though it seems obvious that deficiency in these enzymes could not be the sole cause of these developmental improperties in P. apollo from Pieniny National Park.

Roles of small laccases from Streptomyces in lignin degradation.

PubMed

Majumdar, Sudipta; Lukk, Tiit; Solbiati, Jose O; Bauer, Stefan; Nair, Satish K; Cronan, John E; Gerlt, John A

2014-06-24

Laccases (EC 1.10.3.2) are multicopper oxidases that can oxidize a range of substrates, including phenols, aromatic amines, and nonphenolic substrates. To investigate the involvement of the small Streptomyces laccases in lignin degradation, we generated acid-precipitable polymeric lignin obtained in the presence of wild-type Streptomyces coelicolor A3(2) (SCWT) and its laccase-less mutant (SCΔLAC) in the presence of Miscanthus x giganteus lignocellulose. The results showed that strain SCΔLAC was inefficient in degrading lignin compared to strain SCWT, thereby supporting the importance of laccase for lignin degradation by S. coelicolor A3(2). We also studied the lignin degradation activity of laccases from S. coelicolor A3(2), Streptomyces lividans TK24, Streptomyces viridosporus T7A, and Amycolatopsis sp. 75iv2 using both lignin model compounds and ethanosolv lignin. All four laccases degraded a phenolic model compound (LM-OH) but were able to oxidize a nonphenolic model compound only in the presence of redox mediators. Their activities are highest at pH 8.0 with a low krel/Kapp for LM-OH, suggesting that the enzymes’ natural substrates must be different in shape or chemical nature. Crystal structures of the laccases from S. viridosporus T7A (SVLAC) and Amycolatopsis sp. 75iv2 were determined both with and without bound substrate. This is the first report of a crystal structure for any laccase bound to a nonphenolic β-O-4 lignin model compound. An additional zinc metal binding site in SVLAC was also identified. The ability to oxidize and/or rearrange ethanosolv lignin provides further evidence of the utility of laccase activity for lignin degradation and/or modification.

Uses of Laccases in the Food Industry

PubMed Central

Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana

2010-01-01

Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873

Comparison of laccase production levels in Pichia pastoris and Cryptococcus sp. S-2.

PubMed

Nishibori, Nahoko; Masaki, Kazuo; Tsuchioka, Hiroaki; Fujii, Tsutomu; Iefuji, Haruyuki

2013-04-01

The heterologous expression of the laccase gene from Trametes versicolor and Gaeumannomyces graminis was evaluated in the yeasts Pichia pastoris and Cryptococcus sp. S-2. The expression levels of both laccase genes in Cryptococcus sp. S-2 were considerably higher than those in P. pastoris. The codon usage of Cryptococcus sp. S-2 as well as the GC content were similar to those of T. versicolor and G. graminis. These results suggest that using a host with a similar codon usage for the expressed gene may improve protein expression. The use of Cryptococcus sp. S-2 as a host may be advantageous for the heterologous expression of genes with high GC content. Moreover, this yeast provides the same advantages as P. pastoris for the production of recombinant proteins, such as growth on minimal medium, capacity for high-density growth during fermentation, and capability for post-translational modifications. Therefore, we propose that Cryptococcus sp. S-2 be used as an expression host to improve enzyme production levels when other hosts have not yielded good results. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A novel Laccase Biosensor based on Laccase immobilized Graphene-Cellulose Microfiber Composite modified Screen-Printed Carbon Electrode for Sensitive Determination of Catechol

PubMed Central

Palanisamy, Selvakumar; Ramaraj, Sayee Kannan; Chen, Shen-Ming; Yang, Thomas C. K.; Yi-Fan, Pan; Chen, Tse-Wei; Velusamy, Vijayalakshmi; Selvam, Sonadevi

2017-01-01

In the present work, we demonstrate the fabrication of laccase biosensor to detect the catechol (CC) using laccase immobilized on graphene-cellulose microfibers (GR-CMF) composite modified screen printed carbon electrode (SPCE). The direct electrochemical behavior of laccase was investigated using laccase immobilized different modified SPCEs, such as GR/SPCE, CMF/SPCE and GR-CMF/SPCE. Compared with laccase immobilized GR and CMF modified SPCEs, a well-defined redox couple of CuI/CuII for laccase was observed at laccase immobilized GR-CMF composite modified SPCE. Cyclic voltammetry results show that the as-prepared biosensor has 7 folds higher catalytic activity with lower oxidation potential towards CC than SPCE modified with GR-CMF composite. Under optimized conditions, amperometric i-t method was used for the quantification of CC, and the amperometric response of the biosensor was linear over the concertation of CC ranging from 0.2 to 209.7 μM. The sensitivity, response time and the detection limit of the biosensor for CC is 0.932 μMμA−1 cm−2, 2 s and 0.085 μM, respectively. The biosensor has high selectivity towards CC in the presence of potentially active biomolecules and phenolic compounds. The biosensor also accessed for the detection of CC in different water samples and shows good practicality with an appropriate repea. PMID:28117357

[Enhancement of laccase activity by combining white rot fungal strains].

PubMed

He, Rong-yu; Liu, Xiao-feng; Yan, Zhi-ying; Yuan, Yue-xiang; Liao, Yin-zhang; Li, Xu-dong

2010-02-01

The method of combining white rot fungal strains was used to enhance laccase activity, and the interaction mechanism between strains was also studied. The laccase activity of combined fungi of strain 55 (Trametes trogii) and strain m-6 (Trametes versicolor) were 24.13 and 4.07-fold higher than that of strain 55 and strain m-6, respectively. No inhibitory effect was observed when the two strains were co-cultivated. On plate cultivation, there was hyphal interference in the contact area, where laccase activity was the highest followed by brown pigmentation. In liquid cultivation, strain m-6 played much more important role on enhancement of laccase activity, and the laccase activity of strain 55 by adding strain m-6 was 7.03-fold higher than that of strain m-6 by adding strain 55, furthermore, filter sterilized- and high temperature autoclaved-extracellular substances of strain m-6 could also stimulate strain 55 to excrete more laccase, which led to 6.79-fold and 4. 60-fold increase in laccase activity by adding 20 mL, respectively. The native staining results of Native-PAGE showed that the types of laccase isozymes were not changed when strains were co-cultured, but the concentration of three types increased.

Light-induced inhibition of laccase in Pycnoporus sanguineus.

PubMed

Hernández, Christian A; Perroni, Yareni; Pérez, José Antonio García; Rivera, Beatriz Gutiérrez; Alarcón, Enrique

2016-03-01

The aim was to determine which specific regions of the visible light spectrum were responsible for the induction or inhibition of laccase in Pycnoporus sanguineus. Cultures were exposed to various bandwidth lights: blue (460 nm), green (525 nm), white (a combination of 460 and 560 nm), red (660 nm), and darkness. The results indicate that short wavelengths strongly inhibit the production of laccase: green (3.76 ± 1.12 U/L), blue (1.94 ± 0.36 U/L), and white (1.05 ± 0.21 U/L) in proportions of 85.8, 92.6, and 96.0%, respectively; whereas long wavelengths inhibit laccase production only partially i.e., red light (14.05 ± 4.79 U/L) in a proportion of 46.8%. Maximum activity was induced in absence of visible light (30 °C, darkness), i.e., 30.76 ± 4.0 U/L. It is concluded that the production of laccase in P. sanguineus responds to light stimuli [measured as wavelengths and lx] and that it does so inversely. This can be explained as an ecological mechanism of environmental recognition, given that P. sanguineus develops inside lignocellulose structures in conditions of darkness. The presence of short wavelength light (460-510 nm) would indicate that the organism finds itself in an external environment, unprovided of lignin, and that it is therefore unnecessary to secrete laccase. This possible new regulation in the laccase production in P. sanguineus has important biotechnological implications, for it would be possible to control the production of laccase using light stimuli.

Removal of acetaminophen in water by laccase immobilized in barium alginate.

PubMed

Ratanapongleka, Karnika; Punbut, Supot

2018-02-01

This research has focused on the optimization of immobilized laccase condition and utilization in degradation of acetaminophen contaminated in aqueous solution. Laccase from Lentinus polychrous was immobilized in barium alginate. The effects of laccase immobilization such as sodium alginate concentration, barium chloride concentration and gelation time were studied. The optimal conditions for immobilization were sodium alginate 5% (w/v), barium chloride 5% (w/v) and gelation time of 60 min. Immobilized laccase was then used for acetaminophen removal. Acetaminophen was removed quickly in the first 50 min. The degradation rate and percentage of removal increased when the enzyme concentration increased. Immobilized laccase at 0.57 U/g-alginate showed the maximum removal at 94% in 240 min. The removal efficiency decreased with increasing initial acetaminophen concentration. The K m value for immobilized laccase (98.86 µM) was lower than that of free laccase (203.56 µM), indicating that substrate affinity was probably enhanced by immobilization. The immobilized enzyme exhibited high activity and good acetaminophen removal at pH 7 and temperature of 35°C. The activation energies of free and immobilized laccase for degradation of acetaminophen were 8.08 and 17.70 kJ/mol, respectively. It was also found that laccase stability to pH and temperature increased after immobilization. Furthermore, immobilized laccase could be reused for five cycles. The capability of removal and enzyme activity were retained above 70%.

Spatially coordinated dynamic gene transcription in living pituitary tissue

PubMed Central

Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael RH; Davis, Julian RE

2016-01-01

Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary ‘on-off’ process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour. DOI: http://dx.doi.org/10.7554/eLife.08494.001 PMID:26828110

Laccase of Cyathus bulleri: structural, catalytic characterization and expression in Escherichia coli.

PubMed

Salony; Garg, N; Baranwal, R; Chhabra, M; Mishra, S; Chaudhuri, T K; Bisaria, V S

2008-02-01

Cyathus bulleri, a ligninolytic fungus, produces a single laccase the internal peptides (3) of which bear similarity to laccases of several white rot fungi. Comparison of the total amino acid composition of this laccase with several fungal laccases indicated dissimilarity in the proportion of some basic and hydrophobic amino acids. Analysis of the circular dichroism spectrum of the protein indicated 37% alpha-helical, 26% beta-sheet and 38% random coil content which differed significantly from that in the solved structures of other laccases, which contain higher beta-sheet structures. The critical role of the carboxylic group containing amino acids was demonstrated by determining the kinetic parameters at different pH and this was confirmed by the observation that a critical Asp is strongly conserved in both Ascomycete and Basidiomycete laccases. The enzyme was denatured in the presence of a number of denaturing agents and refolded back to functional state with copper. In the folding experiments under alkaline conditions, zinc could replace copper in restoring 100% of laccase activity indicating the non-essential role of copper in this laccase. The laccase was expressed in Escherichia coli by a modification of the ligation-anchored PCR approach making it the first fungal laccase to be expressed in a bacterial host. The laccase sequence was confirmed by way of analysis of a 435 bp sequence of the insert.

Molecular dynamics simulation studies suggests unconventional roles of non-secretary laccases from enteropathogenic gut bacteria and Cryptococcus neoformans serotype D.

PubMed

Sharma, Krishna Kant; Singh, Deepti; Rawat, Surender

2018-04-01

Laccase in Cryptococcus neoformans is covalently linked to the carbohydrate moiety of the cell wall, which allows it to get access to the different substrates for catalyzing their oxidation and therefore plays a vital role in the virulence. The laccase gene (3.0 kb) from C. neoformans serotype D was amplified, cloned and sequenced for protein modeling, docking and simulation studies. The three dimensional homology models of laccase protein from C. neoformans and other pathogenic gut bacteria were docked with selected biomolecules like prostaglandins (PG), membrane phospholipids, neurotransmitters (serotonin) using GOLD software. The GOLDscore values of laccase from C. neoformans docked with prostaglandinH 2 (59.76), prostaglandinG 2 (59.45), prostaglandinE 2 (60.99), phosphatidylinositol (54.95), phosphatidylcholine (46.26), phosphatidylserine (55.26), arachidonic acid (53.08) and serotonin (46.22) were similar to the laccase from enteropathogenic bacteria but showed a better binding affinity as compared to that of the non-pathogenic bacteria (e.g. Bacillus safensis, Bacillus pumilus and Bacillus subtilis). The RMSD of MD simulation study done for 25 ns using laccase protein from C. neoformans complexed with phosphatidylcholine was found to be highly stable, followed by the laccase-PGE 2 and laccase-serotonin complexes. Furthermore, the binding free energy results were found to support the docking and MD simulation results. The present study implies that few candidate ligands can be intermediate substrate in the catalysis of microbial laccases, which can further play some crucial role in the cell signaling and pathogenesis of enteropathogenic gut micro flora and C. neoformans. Copyright © 2018 Elsevier Ltd. All rights reserved.

Exploiting the oxidizing capabilities of laccases exploiting the oxidizing capabilities of laccases for sustainable chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cannatelli, Mark D.

Part one of this dissertation research has focused on harnessing the ability of laccases to generate reactive para-quinones in situ from the corresponding hydroquinones, followed by reaction with a variety of nucleophiles to perform novel carbon-carbon, carbon-nitrogen, and carbon-sulfur bond forming reactions for the synthesis of new and existing compounds. In part two of this dissertation, the fundamental laccase-catalyzed coupling chemistry developed in part one was applied to functionalize the surface of kraft lignin.

Bacterial versus fungal laccase: potential for micropollutant degradation

PubMed Central

2013-01-01

Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

Increased Transcript Complexity in Genes Associated with Chronic Obstructive Pulmonary Disease

PubMed Central

Lackey, Lela; McArthur, Evonne; Laederach, Alain

2015-01-01

Genome-wide association studies aim to correlate genotype with phenotype. Many common diseases including Type II diabetes, Alzheimer’s, Parkinson’s and Chronic Obstructive Pulmonary Disease (COPD) are complex genetic traits with hundreds of different loci that are associated with varied disease risk. Identifying common features in the genes associated with each disease remains a challenge. Furthermore, the role of post-transcriptional regulation, and in particular alternative splicing, is still poorly understood in most multigenic diseases. We therefore compiled comprehensive lists of genes associated with Type II diabetes, Alzheimer’s, Parkinson’s and COPD in an attempt to identify common features of their corresponding mRNA transcripts within each gene set. The SERPINA1 gene is a well-recognized genetic risk factor of COPD and it produces 11 transcript variants, which is exceptional for a human gene. This led us to hypothesize that other genes associated with COPD, and complex disorders in general, are highly transcriptionally diverse. We found that COPD-associated genes have a statistically significant enrichment in transcript complexity stemming from a disproportionately high level of alternative splicing, however, Type II Diabetes, Alzheimer’s and Parkinson’s disease genes were not significantly enriched. We also identified a subset of transcriptionally complex COPD-associated genes (~40%) that are differentially expressed between mild, moderate and severe COPD. Although the genes associated with other lung diseases are not extensively documented, we found preliminary data that idiopathic pulmonary disease genes, but not cystic fibrosis modulators, are also more transcriptionally complex. Interestingly, complex COPD transcripts are more often the product of alternative acceptor site usage. To verify the biological importance of these alternative transcripts, we used RNA-sequencing analyses to determine that COPD-associated genes are frequently

Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

PubMed Central

Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

2015-01-01

Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts

PubMed Central

De Fine Licht, Henrik H.; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J.

2013-01-01

Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non–leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya. PMID:23267060

Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts.

PubMed

De Fine Licht, Henrik H; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J

2013-01-08

Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non-leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya.

Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

PubMed Central

Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

2013-01-01

The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

Gene Transcription Profile of the Detached Retina (An AOS Thesis)

PubMed Central

Zacks, David N.

2009-01-01

Purpose: Separation of the neurosensory retina from the retinal pigment epithelium (RPE) yields many morphologic and functional consequences, including death of the photoreceptor cells, Müller cell hypertrophy, and inner retinal rewiring. Many of these changes are due to the separation-induced activation of specific genes. In this work, we define the gene transcription profile within the retina as a function of time after detachment. We also define the early activation of kinases that might be responsible for the detachment-induced changes in gene transcription. Methods: Separation of the retina from the RPE was induced in Brown-Norway rats by the injection of 1% hyaluronic acid into the subretinal space. Retinas were harvested at 1, 7, and 28 days after separation. Gene transcription profiles for each time point were determined using the Affymetrix Rat 230A gene microarray chip. Transcription levels in detached retinas were compared to those of nondetached retinas with the BRB-ArrayTools Version 3.6.0 using a random variance analysis of variance (ANOVA) model. Confirmation of the significant transcriptional changes for a subset of the genes was performed using microfluidic quantitative real-time polymerase chain reaction (qRT-PCR) assays. Kinase activation was explored using Western blot analysis to look for early phosphorylation of any of the 3 main families of mitogen-activated protein kinases (MAPK): the p38 family, the Janus kinase family, and the p42/p44 family. Results: Retinas separated from the RPE showed extensive alterations in their gene transcription profile. Many of these changes were initiated as early as 1 day after separation, with significant increases by 7 days. ANOVA analysis defined 144 genes that had significantly altered transcription levels as a function of time after separation when setting a false discovery rate at ≤0.1. Confirmatory RT-PCR was performed on 51 of these 144 genes. Differential transcription detected on the microarray

Post-transcriptional inducible gene regulation by natural antisense RNA.

PubMed

Nishizawa, Mikio; Ikeya, Yukinobu; Okumura, Tadayoshi; Kimura, Tominori

2015-01-01

Accumulating data indicate the existence of natural antisense transcripts (asRNAs), frequently transcribed from eukaryotic genes and do not encode proteins in many cases. However, their importance has been overlooked due to their heterogeneity, low expression level, and unknown function. Genes induced in responses to various stimuli are transcriptionally regulated by the activation of a gene promoter and post-transcriptionally regulated by controlling mRNA stability and translatability. A low-copy-number asRNA may post-transcriptionally regulate gene expression with cis-controlling elements on the mRNA. The asRNA itself may act as regulatory RNA in concert with trans-acting factors, including various RNA-binding proteins that bind to cis-controlling elements, microRNAs, and drugs. A novel mechanism that regulates mRNA stability includes the interaction of asRNA with mRNA by hybridization to loops in secondary structures. Furthermore, recent studies have shown that the functional network of mRNAs, asRNAs, and microRNAs finely tunes the levels of mRNA expression. The post-transcriptional mechanisms via these RNA-RNA interactions may play pivotal roles to regulate inducible gene expression and present the possibility of the involvement of asRNAs in various diseases.

Antisense transcriptional interference mediates condition-specific gene repression in budding yeast.

PubMed

Nevers, Alicia; Doyen, Antonia; Malabat, Christophe; Néron, Bertrand; Kergrohen, Thomas; Jacquier, Alain; Badis, Gwenael

2018-05-18

Pervasive transcription generates many unstable non-coding transcripts in budding yeast. The transcription of such noncoding RNAs, in particular antisense RNAs (asRNAs), has been shown in a few examples to repress the expression of the associated mRNAs. Yet, such mechanism is not known to commonly contribute to the regulation of a given class of genes. Using a mutant context that stabilized pervasive transcripts, we observed that the least expressed mRNAs during the exponential phase were associated with high levels of asRNAs. These asRNAs also overlapped their corresponding gene promoters with a much higher frequency than average. Interrupting antisense transcription of a subset of genes corresponding to quiescence-enriched mRNAs restored their expression. The underlying mechanism acts in cis and involves several chromatin modifiers. Our results convey that transcription interference represses up to 30% of the 590 least expressed genes, which includes 163 genes with quiescence-enriched mRNAs. We also found that pervasive transcripts constitute a higher fraction of the transcriptome in quiescence relative to the exponential phase, consistent with gene expression itself playing an important role to suppress pervasive transcription. Accordingly, the HIS1 asRNA, normally only present in quiescence, is expressed in exponential phase upon HIS1 mRNA transcription interruption.

The relationship between gene transcription and combinations of histone modifications

NASA Astrophysics Data System (ADS)

Cui, Xiangjun; Li, Hong; Luo, Liaofu

2012-09-01

Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

Reactivity of bacterial and fungal laccases with lignin under alkaline conditions.

PubMed

Moya, Raquel; Saastamoinen, Päivi; Hernández, Manuel; Suurnäkki, Anna; Arias, Enriqueta; Mattinen, Maija-Liisa

2011-11-01

The ability of Streptomyces ipomoea laccase to polymerize secoisolariciresinol lignan and technical lignins was assessed. The reactivity of S. ipomoea laccase was also compared to that of low redox fungal laccase from Melanocarpus albomyces using low molecular mass p-coumaric, ferulic and sinapic acid as well as natural (acetosyringone) and synthetic 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO) mediators as substrates. Oxygen consumption measurement, MALDI-TOF MS and SEC were used to follow the enzymatic reactions at pH 7, 8, 9 and 10 at 30°C and 50°C. Polymerization of lignins and lignan by S. ipomoea laccase under alkaline reaction conditions was observed, and was enhanced in the presence of acetosyringone almost to the level obtained with M. albomyces laccase without mediator. Reactivities of the enzymes towards acetosyringone and TEMPO were similar, suggesting exploitation of the compounds and low redox laccase in lignin valorization under alkaline conditions. The results have scientific impact on basic research of laccases. Copyright © 2011 Elsevier Ltd. All rights reserved.

Stabilized Laccases as Heterogeneous Bioelectrocatalysts (Postprint)

DTIC Science & Technology

2012-10-01

nature, with examples that range from bacterial species to fungi and plants.19·101 However, certain properties of laccases, such as their protein...identified, includ- ing examples of extremophilic enzymes,l11·121 but the extracellu- lar laccases from wood-rotting fungi , such as Trametes spp...biomolecules not only affects the stability and selectivity of an enzyme towards different substrates but also the charge trans- fer at the electrode

Assessment of reference genes for reliable analysis of gene transcription by RT-qPCR in ovine leukocytes.

PubMed

Mahakapuge, T A N; Scheerlinck, J-P Y; Rojas, C A Alvarez; Every, A L; Hagen, J

2016-03-01

With the availability of genetic sequencing data, quantitative reverse transcription PCR (RT-qPCR) is increasingly being used for the quantification of gene transcription across species. Too often there is little regard to the selection of reference genes and the impact that a poor choice has on data interpretation. Indeed, RT-qPCR provides a snapshot of relative gene transcription at a given time-point, and hence is highly dependent on the stability of the transcription of the reference gene(s). Using ovine efferent lymph cells and peripheral blood mono-nuclear cells (PBMCs), the two most frequently used leukocytes in immunological studies, we have compared the stability of transcription of the most commonly used ovine reference genes: YWHAZ, RPL-13A, PGK1, B2M, GAPDH, HPRT, SDHA and ACTB. Using established algorithms for reference gene normalization "geNorm" and "Norm Finder", PGK1, GAPDH and YWHAZ were deemed the most stably transcribed genes for efferent leukocytes and PGK1, YWHAZ and SDHA were optimal in PBMCs. These genes should therefore be considered for accurate and reproducible RT-qPCR data analysis of gene transcription in sheep. Copyright © 2016. Published by Elsevier B.V.

Induction of laccases in Trametes versicolor by aqueous wood extracts.

PubMed

Bertrand, Brandt; Martínez-Morales, Fernando; Tinoco, Raunel; Rojas-Trejo, Sonia; Serrano-Carreón, Leobardo; Trejo-Hernández, María R

2014-01-01

The induction of laccase isoforms in Trametes versicolor HEMIM-9 by aqueous extracts (AE) from softwood and hardwood was studied. Samples of sawdust of Pinus sp., Cedrela sp., and Quercus sp. were boiled in water to obtain AE. Different volumes of each AE were added to fungal cultures to determine the amount of AE needed for the induction experiments. Laccase activity was assayed every 24 h for 15 days. The addition of each AE (50 to 150 μl) to the fungal cultures increased laccase production compared to the control (0.42 ± 0.01 U ml(-1)). The highest laccase activities detected were 1.92 ± 0.15 U ml(-1) (pine), 1.87 ± 0.26 U ml(-1) (cedar), and 1.56 ± 0.34 U ml(-1) (oak); laccase productivities were also significantly increased. Larger volumes of any AE inhibited mycelial growth. Electrophoretic analysis revealed two laccase bands (lcc1 and lcc2) for all the treatments. However, when lcc2 was analyzed by isoelectric focusing, inducer-dependent isoform patterns composed of three (pine AE), four (oak AE), and six laccase bands (cedar AE) were observed. Thus, AE from softwood and hardwood had induction effects in T. versicolor HEMIM-9, as indicated by the increase in laccase activity and different isoform patterns. All of the enzymatic extracts were able to decolorize the dye Orange II. Dye decolorization was mainly influenced by pH. The optimum pH for decolorization was pH 5 (85%), followed by pH 7 (50%) and pH 3 (15%). No significant differences in the dye decolorizing capacity were detected between the control and the differentially induced laccase extracts (oak, pine and cedar). This could be due to the catalytic activities of isoforms with pI 5.4 and 5.8, which were detected under all induction conditions.

Microprocessor mediates transcriptional termination in long noncoding microRNA genes

PubMed Central

Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.

2015-01-01

MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776

Transcription factor trapping by RNA in gene regulatory elements.

PubMed

Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

2015-11-20

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

Recent developments and applications of immobilized laccase.

PubMed

Fernández-Fernández, María; Sanromán, M Ángeles; Moldes, Diego

2013-12-01

Laccase is a promising biocatalyst with many possible applications, including bioremediation, chemical synthesis, biobleaching of paper pulp, biosensing, textile finishing and wine stabilization. The immobilization of enzymes offers several improvements for enzyme applications because the storage and operational stabilities are frequently enhanced. Moreover, the reusability of immobilized enzymes represents a great advantage compared with free enzymes. In this work, we discuss the different methodologies of enzyme immobilization that have been reported for laccases, such as adsorption, entrapment, encapsulation, covalent binding and self-immobilization. The applications of laccase immobilized by the aforementioned methodologies are presented, paying special attention to recent approaches regarding environmental applications and electrobiochemistry. Copyright © 2012 Elsevier Inc. All rights reserved.

Polycomb repressive complex 1 modifies transcription of active genes

PubMed Central

Pherson, Michelle; Misulovin, Ziva; Gause, Maria; Mihindukulasuriya, Kathie; Swain, Amanda; Dorsett, Dale

2017-01-01

This study examines the role of Polycomb repressive complex 1 (PRC1) at active genes. The PRC1 and PRC2 complexes are crucial for epigenetic silencing during development of an organism. They are recruited to Polycomb response elements (PREs) and establish silenced domains over several kilobases. Recent studies show that PRC1 is also directly recruited to active genes by the cohesin complex. Cohesin participates broadly in control of gene transcription, but it is unknown whether cohesin-recruited PRC1 also plays a role in transcriptional control of active genes. We address this question using genome-wide RNA sequencing (RNA-seq) and chromatin immunoprecipitation sequencing (ChIP-seq). The results show that PRC1 influences transcription of active genes, and a significant fraction of its effects are likely direct. The roles of different PRC1 subunits can also vary depending on the gene. Depletion of PRC1 subunits by RNA interference alters phosphorylation of RNA polymerase II (Pol II) and occupancy by the Spt5 pausing-elongation factor at most active genes. These effects on Pol II phosphorylation and Spt5 are likely linked to changes in elongation and RNA processing detected by nascent RNA-seq, although the mechanisms remain unresolved. The experiments also reveal that PRC1 facilitates association of Spt5 with enhancers and PREs. Reduced Spt5 levels at these regulatory sequences upon PRC1 depletion coincide with changes in Pol II occupancy and phosphorylation. Our findings indicate that, in addition to its repressive roles in epigenetic gene silencing, PRC1 broadly influences transcription of active genes and may suppress transcription of nonpromoter regulatory sequences. PMID:28782042

Laccase-mediator catalyzed conversion of model lignin compounds

USDA-ARS?s Scientific Manuscript database

Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.

PubMed

Wang, J W; Wu, J H; Huang, W Y; Tan, R X

2006-03-01

The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.

Frequency Modulation of Transcriptional Bursting Enables Sensitive and Rapid Gene Regulation.

PubMed

Li, Congxin; Cesbron, François; Oehler, Michael; Brunner, Michael; Höfer, Thomas

2018-04-25

Gene regulation is a complex non-equilibrium process. Here, we show that quantitating the temporal regulation of key gene states (transcriptionally inactive, active, and refractory) provides a parsimonious framework for analyzing gene regulation. Our theory makes two non-intuitive predictions. First, for transcription factors (TFs) that regulate transcription burst frequency, as opposed to amplitude or duration, weak TF binding is sufficient to elicit strong transcriptional responses. Second, refractoriness of a gene after a transcription burst enables rapid responses to stimuli. We validate both predictions experimentally by exploiting the natural, optogenetic-like responsiveness of the Neurospora GATA-type TF White Collar Complex (WCC) to blue light. Further, we demonstrate that differential regulation of WCC target genes is caused by different gene activation rates, not different TF occupancy, and that these rates are tuned by both the core promoter and the distance between TF-binding site and core promoter. In total, our work demonstrates the relevance of a kinetic, non-equilibrium framework for understanding transcriptional regulation. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization

PubMed Central

Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R.

2014-01-01

In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria. PMID

Laccase-mediator catalyzed conversion of model lignin compounds

USDA-ARS?s Scientific Manuscript database

Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...

Laccase engineering: from rational design to directed evolution.

PubMed

Mate, Diana M; Alcalde, Miguel

2015-01-01

Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. Copyright © 2014 Elsevier Inc. All rights reserved.

Combined sequence and structure analysis of the fungal laccase family.

PubMed

Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P

2003-08-20

Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal

Characterization of C-terminally engineered laccases.

PubMed

Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry

2014-08-01

Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (CΔ) and its 6 His tagged counterpart (CΔ6H) were found active enzymes. The production of CΔ6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of CΔ6H noted CΔ6Hh. Properties of CΔ, CΔ6H and CΔ6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in CΔ for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of CΔ6H and CΔ6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. Copyright © 2014 Elsevier B.V. All rights reserved.

FTIR Spectroscopy Applied in Remazol Blue Dye Oxidation by Laccases

NASA Astrophysics Data System (ADS)

Juárez-Hernández, J.; Zavala-Soto, M. E.; Bibbins-Martínez, M.; Delgado-Macuil, R.; Díaz-Godinez, G.; Rojas-López, M.

2008-04-01

We have used FTIR with attenuated total reflectance (ATR) technique to analyze the decolourization process of Remazol Blue dye (RB19) caused by the oxidative activity of laccase enzyme. It is known that laccases catalyze the oxidation of a large range of phenolic compounds and aromatic amines carrying out one-electron oxidations, although also radicals could be formed which undergo subsequent nonenzymatic reactions. The enzyme laccase is a copper-containing polyphenol oxidase (EC 1.10.3.2) which has been tested as a potential alternative in detoxification of environmental pollutants such as dyes present in wastewaters generated for the textile industry. In order to ensure degradation or avoid formation of toxic compounds it is important to establish the mechanism by which laccase oxidizes dyes. In this research individual ATR-FTIR spectra have been recorded for several reaction times between 0 to 236 hours, and the temporal dependence of the reaction was analyzed through the relative diminution of the intensity of the infrared band at 1127 cm-1 (associated to C-N vibration), with respect to the intensity of the band at 1104 cm-1 (associated to S = O) from sulphoxide group. Decolourization process of this dye by laccase could be attributed to its accessibility on the secondary amino group, which is a potential point of attack of laccases, abstracting the hydrogen atom. This decolourization process of remazol blue dye by laccase enzyme might in a future replace the traditionally high chemical, energy and water consuming textile operations.

A New Laccase Based Biosensor for Tartrazine.

PubMed

Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu

2017-12-09

Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM ( R ² = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis.

A New Laccase Based Biosensor for Tartrazine

PubMed Central

Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu

2017-01-01

Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM (R2 = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis. PMID:29232842

Dynamical behavior of psb gene transcripts in greening wheat seedlings. I. Time course of accumulation of the pshA through psbN gene transcripts during light-induced greening.

PubMed

Kawaguchi, H; Fukuda, I; Shiina, T; Toyoshima, Y

1992-11-01

The time course of the accumulation of the transcripts from 13 psb genes encoding a major part of the proteins composing photosystem II during light-induced greening of dark-grown wheat seedlings was examined focusing on early stages of plastid development (0.5 h through 72 h). The 13 genes can be divided into three groups. (1) The psbA gene is transcribed as a single transcript of 1.3 kb in the dark-grown seedlings, but its level increases 5- to 7-fold in response to light due to selective increase in RNA stability as well as in transcription activity. (2) The psbE-F-L-J operon, psbM and psbN genes are transcribed as a single transcript of 1.1 kb, two transcripts of 0.5 and 0.7 kb and a single transcript of 0.3 kb, respectively, in the dark-grown seedlings. The levels of accumulation of every transcript remain unchanged or rather decrease during plastid development under illumination. (3) The psbK-I-D-C gene cluster and psbB-H operon exhibit fairly complicated northern hybridization patterns during the greening process. When a psbC or psbD gene probe was used for northern hybridization, five transcripts differing in length were detected in the etioplasts from 5-day old dark-grown seedlings. After 2 h illumination, two new transcripts of different length appeared. Light induction of new transcripts was also observed in the psbB-H operon.

Redox Chemistry in Laccase-Catalyzed Oxidation of N-Hydroxy Compounds

PubMed Central

Xu, Feng; Kulys, Juozas J.; Duke, Kyle; Li, Kaichang; Krikstopaitis, Kastis; Deussen, Heinz-Josef W.; Abbate, Eric; Galinyte, Vilija; Schneider, Palle

2000-01-01

1-Hydroxybenzotriazole, violuric acid, and N-hydroxyacetanilide are three N-OH compounds capable of mediating a range of laccase-catalyzed biotransformations, such as paper pulp delignification and degradation of polycyclic hydrocarbons. The mechanism of their enzymatic oxidation was studied with seven fungal laccases. The oxidation had a bell-shaped pH-activity profile with an optimal pH ranging from 4 to 7. The oxidation rate was found to be dependent on the redox potential difference between the N-OH substrate and laccase. A laccase with a higher redox potential or an N-OH compound with a lower redox potential tended to have a higher oxidation rate. Similar to the enzymatic oxidation of phenols, phenoxazines, phenothiazines, and other redox-active compounds, an “outer-sphere” type of single-electron transfer from the substrate to laccase and proton release are speculated to be involved in the rate-limiting step for N-OH oxidation. PMID:10788380

Laccase-catalyzed synthesis of 2,3-ethylenedithio-1,4-quinones

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2015-06-05

Laccases (benzenediol:oxygen oxidoreductase EC 1.10.3.2) are part of a family of multicopper oxidases. These environmentally friendly enzymes require O 2 as their only co-substrate and produce H 2O as their sole by-product. As a result, they have acquired increasing use in biotechnological applications, particularly in the field of organic synthesis. In the current study, laccases have been employed to successfully couple 1,2-ethanedithiol to various substituted hydroquinones to produce novel 2,3-ethylenedithio-1,4-quinones in good yields via an oxidation–addition–oxidation–addition–oxidation mechanism. The reactions proceeded in one-pot under mild conditions (room temperature, pH 5.0). This study further supports the use of laccases as green toolsmore » in organic chemistry. Furthermore, it provides evidence that laccase-catalyzed cross-coupling reactions involving small thiols are possible, in spite of research that suggests small thiols are potent inhibitors of laccases.« less

Heterologous expression of laccase cDNA from Ceriporiopsis subvermispora yields copper-activated apoprotein and complex isoform patterns

Treesearch

Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna

2003-01-01

Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...

Comparative transcriptional profiling-based identification of raphanusanin-inducible genes

PubMed Central

2010-01-01

Background Raphanusanin (Ra) is a light-induced growth inhibitor involved in the inhibition of hypocotyl growth in response to unilateral blue-light illumination in radish seedlings. Knowledge of the roles of Ra still remains elusive. To understand the roles of Ra and its functional coupling to light signalling, we constructed the Ra-induced gene library using the Suppression Subtractive Hybridisation (SSH) technique and present a comparative investigation of gene regulation in radish seedlings in response to short-term Ra and blue-light exposure. Results The predicted gene ontology (GO) term revealed that 55% of the clones in the Ra-induced gene library were associated with genes involved in common defence mechanisms, including thirty four genes homologous to Arabidopsis genes implicated in R-gene-triggered resistance in the programmed cell death (PCD) pathway. Overall, the library was enriched with transporters, hydrolases, protein kinases, and signal transducers. The transcriptome analysis revealed that, among the fifty genes from various functional categories selected from 88 independent genes of the Ra-induced library, 44 genes were up-regulated and 4 were down-regulated. The comparative analysis showed that, among the transcriptional profiles of 33 highly Ra-inducible genes, 25 ESTs were commonly regulated by different intensities and duration of blue-light irradiation. The transcriptional profiles, coupled with the transcriptional regulation of early blue light, have provided the functional roles of many genes expected to be involved in the light-mediated defence mechanism. Conclusions This study is the first comprehensive survey of transcriptional regulation in response to Ra. The results described herein suggest a link between Ra and cellular defence and light signalling, and thereby contribute to further our understanding of how Ra is involved in light-mediated mechanisms of plant defence. PMID:20553608

Laccase pretreatment for agrofood wastes valorization.

PubMed

Giacobbe, Simona; Pezzella, Cinzia; Lettera, Vincenzo; Sannia, Giovanni; Piscitelli, Alessandra

2018-06-01

Apple pomace, potato peels, and coffee silverskin are attractive agrofood wastes for the production of biofuels and chemicals, due to their abundance and carbohydrate content. As lignocellulosic biomasses, their conversion is challenged by the presence of lignin that prevents hydrolysis of polysaccharides, hence demanding a pretreatment step. In this work, the effectiveness of Pleurotus ostreatus laccases (with and without mediator) to remove lignin, improving the subsequent saccharification, was assessed. Optimized conditions for sequential protocol were set up for all agrofood wastes reaching delignification and detoxification yields correlated with high saccharification. Especially noteworthy were results for apple pomace and coffee silverskin for which 83% of and 73% saccharification yields were observed, by using laccase and laccase mediator system, respectively. The herein developed sequential protocol, saving soluble sugars and reducing the amount of wastewater, can improve the overall process for obtaining chemicals or fuels from agrofood wastes. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Bioinformatics approaches to predict target genes from transcription factor binding data.

PubMed

Essebier, Alexandra; Lamprecht, Marnie; Piper, Michael; Bodén, Mikael

2017-12-01

Transcription factors regulate gene expression and play an essential role in development by maintaining proliferative states, driving cellular differentiation and determining cell fate. Transcription factors are capable of regulating multiple genes over potentially long distances making target gene identification challenging. Currently available experimental approaches to detect distal interactions have multiple weaknesses that have motivated the development of computational approaches. Although an improvement over experimental approaches, existing computational approaches are still limited in their application, with different weaknesses depending on the approach. Here, we review computational approaches with a focus on data dependency, cell type specificity and usability. With the aim of identifying transcription factor target genes, we apply available approaches to typical transcription factor experimental datasets. We show that approaches are not always capable of annotating all transcription factor binding sites; binding sites should be treated disparately; and a combination of approaches can increase the biological relevance of the set of genes identified as targets. Copyright © 2017 Elsevier Inc. All rights reserved.

Gene end-like sequences within the 3' non-coding region of the Nipah virus genome attenuate viral gene transcription.

PubMed

Sugai, Akihiro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

2017-08-01

The regulation of transcription during Nipah virus (NiV) replication is poorly understood. Using a bicistronic minigenome system, we investigated the involvement of non-coding regions (NCRs) in the transcriptional re-initiation efficiency of NiV RNA polymerase. Reporter assays revealed that attenuation of NiV gene expression was not constant at each gene junction, and that the attenuating property was controlled by the 3' NCR. However, this regulation was independent of the gene-end, gene-start and intergenic regions. Northern blot analysis indicated that regulation of viral gene expression by the phosphoprotein (P) and large protein (L) 3' NCRs occurred at the transcription level. We identified uridine-rich tracts within the L 3' NCR that are similar to gene-end signals. These gene-end-like sequences were recognized as weak transcription termination signals by the viral RNA polymerase, thereby reducing downstream gene transcription. Thus, we suggest that NiV has a unique mechanism of transcriptional regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of the gene transcription repressor domain of Gli3.

PubMed

Tsanev, Robert; Tiigimägi, Piret; Michelson, Piret; Metsis, Madis; Østerlund, Torben; Kogerman, Priit

2009-01-05

Gli transcription factors are downstream targets of the Hedgehog signaling pathway. Two of the three Gli proteins harbor gene transcription repressor function in the N-terminal half. We have analyzed the sequences and identified a potential repressor domain in Gli2 and Gli3 and have tested this experimentally. Overexpression studies confirm that the N-terminal parts harbor gene repression activity and we mapped the minimal repressor to residues 106 till 236 in Gli3. Unlike other mechanisms that inhibit Gli induced gene transcription, the repressor domain identified here does not utilize Histone deacetylases (HDACs) to achieve repression, as confirmed by HDAC inhibition studies and pull-down assays. This distinguishes the identified domain from other regulatory parts with negative influence on transcription.

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composite for laccase immobilization

PubMed Central

Huang, Jun; Liu, Cheng; Xiao, Haiyan; Wang, Juntao; Jiang, Desheng; GU, Erdan

2007-01-01

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composites were prepared by organic-inorganic complex technology and characterized. It has been proved that the ZnTAPc dispersed randomly onto the surface of Fe3O4 nanoparticles to form molecular dispersion layer and there was a relatively strong bond between central zinc cation and oxygen. The nanoparticle composite took the shape of roundish spheres with the mean diameter of about 15 nm. Active amino groups of magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH for the activity of the immobilized laccases and free laccase were the same at pH 3.0 and the optimal temperature for laccase immobilization on ZnTAPc-Fe3O4 nanoparticle composite was 45°. The immobilization yields and Km value of the laccase immobilized on ZnTAPc-Fe3O4 nanoparticle composite were 25% and 20.1 μM, respectively. This kind of immobilized laccase has good thermal, storage and operation stability, and could be used as the sensing biocomponent for the fiber optic biosensor based on enzyme catalysis. PMID:18203444

Optimization of laccase production by Trametes versicolor cultivated on industrial waste.

PubMed

Tišma, Marina; Znidaršič-Plazl, Polona; Vasić-Rački, Durđa; Zelić, Bruno

2012-01-01

Laccases are very interesting biocatalysts for several industrial applications. Its production by different white-rot fungi can be stimulated by a variety of inducing substrates, and the use of lignocellulosic wastes or industrial by-products is one of the possible approaches to reduce production costs. In this work, various industrial wastes were tested for laccase production by Trametes versicolor MZKI G-99. Solid waste from chemomechanical treatment facility of a paper manufacturing plant showed the highest potential for laccase production. Enzyme production during submerged cultivation of T. versicolor on the chosen industrial waste has been further improved by medium optimization using genetic algorithm. Concentrations of five components in the medium were optimized within 60 shake-flasks experiments, where the highest laccase activity of 2,378 U dm(-3) was achieved. Waste from the paper industry containing microparticles of CaCO(3) was found to stimulate the formation of freely dispersed mycelium and laccase production during submerged cultivation of T. versicolor. It was proven to be a safe and inexpensive substrate for commercial production of laccase and might be more widely applicable for metabolite production by filamentous fungi.

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

PubMed Central

Rodríguez-Escribano, David; de Salas, Felipe; Camarero, Susana

2017-01-01

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin–Ciocalteau reagent (FCR), to detect the decrease in phenolic content produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). The method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates. PMID:28820431

Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications

PubMed Central

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

Laccase: microbial sources, production, purification, and potential biotechnological applications.

PubMed

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.

Ethidium bromide stimulated hyper laccase production from bird's nest fungus Cyathus bulleri.

PubMed

Dhawan, S; Lal, R; Kuhad, R C

2003-01-01

Effect of ethidium bromide, a DNA intercalating agent, on laccase production from Cyathus bulleri was studied. The bird's nest fungus, Cyathus bulleri was grown on 2% (w/v) malt extract agar (MEA) supplemented with 1.5 microg ml(-1) of the phenanthridine dye ethidium bromide (EtBr) for 7 d and when grown subsequently in malt extract broth (MEB), produced a 4.2-fold increase in laccase production as compared to the untreated fungus. The fungal cultures following a single EtBr treatment, when regrown on MEA devoid of EtBr, produced a sixfold increase in laccase in MEB. However, on subsequent culturing on MEA in the absence of EtBr, only a 2.5-fold increase in laccase production could be maintained. In another attempt, the initial EtBr-treated cultures, when subjected to a second EtBr treatment (1.5 microg ml(-1)) on MEA for 7 d, produced a 1.4-fold increase in laccase production in MEB. The white-rot fungus Cyathus bulleri, when treated with EtBr at a concentration of 1.5 microg ml(-1) and regrown on MEA devoid of EtBr, produced a sixfold increase in laccase production in MEB. The variable form of C. bulleri capable of hyper laccase production can improve the economic feasibility of environmentally benign processes involving use of fungal laccases in cosmetics (including hair dyes), food and beverages, clinical diagnostics, pulp and paper industry, industrial effluent treatment, animal biotechnology and biotransformations.

Profilin is associated with transcriptionally active genes

PubMed Central

Söderberg, Emilia; Hessle, Viktoria; von Euler, Anne; Visa, Neus

2012-01-01

We have raised antibodies against the profilin of Chironomus tentans to study the location of profilin relative to chromatin and to active genes in salivary gland polytene chromosomes. We show that a fraction of profilin is located in the nucleus, where profilin is highly concentrated in the nucleoplasm and at the nuclear periphery. Moreover, profilin is associated with multiple bands in the polytene chromosomes. By staining salivary glands with propidium iodide, we show that profilin does not co-localize with dense chromatin. Profilin associates instead with protein-coding genes that are transcriptionally active, as revealed by co-localization with hnRNP and snRNP proteins. We have performed experiments of transcription inhibition with actinomycin D and we show that the association of profilin with the chromosomes requires ongoing transcription. However, the interaction of profilin with the gene loci does not depend on RNA. Our results are compatible with profilin regulating actin polymerization in the cell nucleus. However, the association of actin with the polytene chromosomes of C. tentans is sensitive to RNase, whereas the association of profilin is not, and we propose therefore that the chromosomal location of profilin is independent of actin. PMID:22572953

Gene length as a biological timer to establish temporal transcriptional regulation

PubMed Central

Kirkconnell, Killeen S.; Magnuson, Brian; Paulsen, Michelle T.; Lu, Brian; Bedi, Karan; Ljungman, Mats

2017-01-01

ABSTRACT Transcriptional timing is inherently influenced by gene length, thus providing a mechanism for temporal regulation of gene expression. While gene size has been shown to be important for the expression timing of specific genes during early development, whether it plays a role in the timing of other global gene expression programs has not been extensively explored. Here, we investigate the role of gene length during the early transcriptional response of human fibroblasts to serum stimulation. Using the nascent sequencing techniques Bru-seq and BruUV-seq, we identified immediate genome-wide transcriptional changes following serum stimulation that were linked to rapid activation of enhancer elements. We identified 873 significantly induced and 209 significantly repressed genes. Variations in gene size allowed for a large group of genes to be simultaneously activated but produce full-length RNAs at different times. The median length of the group of serum-induced genes was significantly larger than the median length of all expressed genes, housekeeping genes, and serum-repressed genes. These gene length relationships were also observed in corresponding mouse orthologs, suggesting that relative gene size is evolutionarily conserved. The sizes of transcription factor and microRNA genes immediately induced after serum stimulation varied dramatically, setting up a cascade mechanism for temporal expression arising from a single activation event. The retention and expansion of large intronic sequences during evolution have likely played important roles in fine-tuning the temporal expression of target genes in various cellular response programs. PMID:28055303

Laccases as palladium oxidases.

PubMed

Mekmouche, Yasmina; Schneider, Ludovic; Rousselot-Pailley, Pierre; Faure, Bruno; Simaan, A Jalila; Bochot, Constance; Réglier, Marius; Tron, Thierry

2015-02-01

The first example of a coupled catalytic system involving an enzyme and a palladium(ii) catalyst competent for the aerobic oxidation of alcohol in mild conditions is described. In the absence of dioxygen, the fungal laccase LAC3 is reduced by a palladium(0) species as evidenced by the UV/VIS and ESR spectra of the enzyme. During the oxidation of veratryl alcohol performed in water, at room temperature and atmospheric pressure, LAC3 regenerates the palladium catalyst, is reduced and catalyzes the four-electron reduction of dioxygen into water with no loss of enzyme activity. The association of a laccase with a water-soluble palladium complex results in a 7-fold increase in the catalytic efficiency of the complex. This is the first step in the design of a family of renewable palladium catalysts for aerobic oxidation.

Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.

PubMed

Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

2014-02-01

Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

Identifying Novel Transcriptional and Epigenetic Features of Nuclear Lamina-associated Genes.

PubMed

Wu, Feinan; Yao, Jie

2017-03-07

Because a large portion of the mammalian genome is associated with the nuclear lamina (NL), it is interesting to study how native genes resided there are transcribed and regulated. In this study, we report unique transcriptional and epigenetic features of nearly 3,500 NL-associated genes (NL genes). Promoter regions of active NL genes are often excluded from NL-association, suggesting that NL-promoter interactions may repress transcription. Active NL genes with higher RNA polymerase II (Pol II) recruitment levels tend to display Pol II promoter-proximal pausing, while Pol II recruitment and Pol II pausing are not correlated among non-NL genes. At the genome-wide scale, NL-association and H3K27me3 distinguishes two large gene classes with low transcriptional activities. Notably, NL-association is anti-correlated with both transcription and active histone mark levels among genes not significantly enriched with H3K9me3 or H3K27me3, suggesting that NL-association may represent a novel gene repression pathway. Interestingly, an NL gene subgroup is not significantly enriched with H3K9me3 or H3K27me3 and is transcribed at higher levels than the rest of NL genes. Furthermore, we identified distal enhancers associated with active NL genes and reported their epigenetic features.

Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

PubMed

Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

2015-01-01

Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

The transcriptional terminator sequences downstream of the covR gene terminate covR/S operon transcription to generate covR monocistronic transcripts in Streptococcus pyogenes.

PubMed

Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong

2008-12-31

CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.

Inactivation of Laccase by the Attack of As (III) Reaction in Water.

PubMed

Hu, Jinyuan; Lu, Kun; Dong, Shipeng; Huang, Qingguo; Mao, Liang

2018-03-06

Laccase is a multicopper oxidase containing four coppers as reaction sites, including one type 1, one type 2, and two type 3. We here provide the first experimental data showing that As (III) can be effectively removed from water and transformed to As (V) through reactions mediated by laccase with the presence of oxygen. To this end, the As (III) removal, As (V) yields, total protein, active laccase, and copper concentrations in the aqueous phase were determined, respectively. Additionally, electron paramagnetic resonance spectra and UV-vis spectra were applied to probe possible structural changes of the laccase during the reaction. The data offer the first evidence that laccase can be inactivated by As (III) attack thus leading to the release of type 2 copper. The released copper has no reactivity with the As (III). These findings provide new ideas into a significant pathway likely to master the environmental transformation of arsenite, and advance the understanding of laccase inactivation mechanisms, thus providing a foundation for optimization of enzyme-based processes and potential development for removal and remediation of arsenite contamination in the environment.

Influence of nutrients on enhancing laccase production by Botryosphaeria rhodina MAMB-05.

PubMed

Dekker, Robert F H; Barbosa, Aneli M; Giese, Ellen C; Godoy, Saulo D S; Covizzi, Luiz G

2007-09-01

The physiological requirements needed to enhance the production of laccases by the ascomycete Botryosphaeria rhodina MAMB-05 in submerged cultivation were examined under non-induced and induced (veratryl alcohol, VA) conditions. Under non-induced conditions (-VA), the initial pH, C:N ratio, and inorganic N source did not influence laccase production, in contrast to Tween 80, soybean oil, and copper, which significantly increased laccase production, and proline and urea, which suppressed laccase formation. In addition, Tween 60 could serve as the sole carbon source for the production of these enzymes. Under VA-induced conditions of fungal growth, factors such as inoculum type, time-point of addition of inducer, initial pH, C:N ratio, and type of N source, influenced the production of laccases; however, unlike the non-induced conditions, proline and urea did not act as suppressors. Each of these physiological conditions exerted different effects on biomass production. The nutritional conditions examined for B. rhodina MAMB-05 are discussed in relation to their influence on fungal growth and laccase production.

Immobilization of laccase of Pycnoporus sanguineus CS43.

PubMed

Gonzalez-Coronel, Luis A; Cobas, Marta; Rostro-Alanis, Magdalena de J; Parra-Saldívar, Roberto; Hernandez-Luna, Carlos; Pazos, Marta; Sanromán, M Ángeles

2017-10-25

Laccase from Pycnoporus sanguineus CS43 was successfully immobilized onto Immobead-150 and Eupergit-C by covalent binding and by entrapment in LentiKats. The highest immobilization was onto Immobead-150 (97.1±1.2%) compared to the other supports, LentiKats (89±1.1%) and Eupergit-C (83.2±1.4%). All three immobilized enzyme systems showed increased thermostability and better mechanical properties than free laccase. Moreover, after 5 cycles of reuse of these systems, 90% of initial laccase activity was retained. Immobead-150 and LentiKats systems exhibited the highest efficiencies in removal of m-cresol under the combined actions of biodegradation and adsorption, while laccase entrapped in LentiKats showed a high ability for degradation of m-cresol within 24h. In addition, the typical Michaelis-Menten enzymatic model effectively described the kinetic profile of m-cresol degradation by the enzyme entrapped in LentiKats. Based on the results obtained in the present study, it can be established that the immobilized biocatalysts developed here possess significant potential for wastewater treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Potential of acetylacetone as a mediator for Trametes versicolor laccase in enzymatic transformation of organic pollutants.

PubMed

Yang, Hua; Sun, Hongfei; Zhang, Shujuan; Wu, Bingdang; Pan, Bingcai

2015-07-01

Low-cost and environmentally friendly mediators could facilitate the application of laccase (EC 1.10.3.2) in variant biotechnological processes. Acetylacetone (AA) represents an inexpensive and low toxic small molecular diketone that has been proven as an effective mediator for laccase in free radical polymerization. However, the potential of AA as a mediator for laccase in pollutant detoxification and/or degradation is still unknown. In this work, the roles of AA in laccase-induced polymerization and transformation were investigated. AA was demonstrated to be a highly efficient mediator in the laccase-induced grafting copolymerization of acrylamide and chitosan. The efficacy of AA in the laccase-induced decoloration of malachite green (MG) was compared with that of the widely used 1-hydroxybenzotriazole (HBT). The laccase-AA system had the highest turnover number (TON, 39.1 μmol/U), followed by the laccase-only system (28.5 μmol/U), while the TON of the laccase-HBT system was the lowest (14.9 μmol/U). The pseudo-first-order transformation rate constant (k 1) of MG in the laccase-AA system was up to 0.283 h(-1) under the given conditions, while the k 1 of AA caused by laccase was only 0.008 h(-1). In the five-cycle run, the concentration of AA remained stable. The larger TON of the laccase-AA system and the stability of AA in the cycling runs demonstrate that AA was more recyclable than HBT in the LMS, leading to a prolonged serving life of laccase. These results suggest that AA might be a potential redox mediator for laccase.

Laccase-catalyzed oxidation of oxybenzone in municipal wastewater primary effluent.

PubMed

Garcia, Hector A; Hoffman, Catherine M; Kinney, Kerry A; Lawler, Desmond F

2011-02-01

Pharmaceuticals and personal care products (PPCPs) are now routinely detected in raw and treated municipal wastewater. Since conventional wastewater treatment processes are not particularly effective for PPCP removal, treated wastewater discharges are the main entry points for PPCPs into the environment, and eventually into our drinking water. This study investigates the use of laccase-catalyzed oxidation for removing low concentrations of PPCPs from municipal wastewater primary effluent. Oxybenzone was selected as a representative PPCP. Like many other PPCPs, it is not recognized directly by the laccase enzyme. Therefore, mediators were used to expand the oxidative range of laccase, and the efficacy of this laccase-mediator system in primary effluent was evaluated. Eight potential mediators were investigated, and 2,2'-Azino-bis(3-ethylbenzthiazoline-6sulphonic acid) diammonium salt (ABTS), a synthetic mediator, and acetosyringone (ACE), a natural mediator, provided the greatest oxybenzone removal efficiencies. An environmentally relevant concentration of oxybenzone (43.8 nM, 10 μg/L) in primary effluent was completely removed (below the detection limit) after two hours of treatment with ABTS, and 95% was removed after two hours of treatment with ACE. Several mediator/oxybenzone molar ratios were investigated at two different initial oxybenzone concentrations. Higher mediator/oxybenzone molar ratios were required at the lower (environmentally relevant) oxybenzone concentration, and ACE required higher molar ratios than ABTS to achieve comparable oxybenzone removal. Oxybenzone oxidation byproducts generated by the laccase-mediator system were characterized and compared to those generated during ozonation. Enzymatic treatment generated byproducts with higher mass to charge (m/z) ratios, likely due to oxidative coupling reactions. The results of this study suggest that, with further development, the laccase-mediator system has the potential to extend the treatment

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

DOE PAGES

Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel; ...

2017-08-18

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less

Multiple circadian transcriptional elements cooperatively regulate cell-autonomous transcriptional oscillation of Period3, a mammalian clock gene.

PubMed

Matsumura, Ritsuko; Akashi, Makoto

2017-09-29

Cell-autonomous oscillation in clock gene expression drives circadian rhythms. The development of comprehensive analytical techniques, such as bioinformatics and ChIP-sequencing, has enabled the genome-wide identification of potential circadian transcriptional elements that regulate the transcriptional oscillation of clock genes. However, detailed analyses using traditional biochemical and molecular-biological approaches, such as binding and reporter assays, are still necessary to determine whether these potential circadian transcriptional elements are actually functional and how significantly they contribute to driving transcriptional oscillation. Here, we focused on the molecular mechanism of transcriptional oscillations in the mammalian clock gene Period3 ( Per3 ). The PER3 protein is essential for robust peripheral clocks and is a key component in circadian output processes. We found three E box-like elements located upstream of human Per3 transcription start sites that additively contributed to cell-autonomous transcriptional oscillation. However, we also found that Per3 is still expressed in a circadian manner when all three E box-like elements are functionally impaired. We noted that Per3 transcription was activated by the synergistic actions of two D box-like elements and the three E box-like elements, leading to a drastic increase in circadian amplitude. Interestingly, circadian expression of Per3 was completely disrupted only when all five transcriptional elements were functionally impaired. These results indicate that three E box-like and two D box-like elements cooperatively and redundantly regulate cell-autonomous transcriptional oscillation of Per3 . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Modeling leaderless transcription and atypical genes results in more accurate gene prediction in prokaryotes.

PubMed

Lomsadze, Alexandre; Gemayel, Karl; Tang, Shiyuyun; Borodovsky, Mark

2018-05-17

In a conventional view of the prokaryotic genome organization, promoters precede operons and ribosome binding sites (RBSs) with Shine-Dalgarno consensus precede genes. However, recent experimental research suggesting a more diverse view motivated us to develop an algorithm with improved gene-finding accuracy. We describe GeneMarkS-2, an ab initio algorithm that uses a model derived by self-training for finding species-specific (native) genes, along with an array of precomputed "heuristic" models designed to identify harder-to-detect genes (likely horizontally transferred). Importantly, we designed GeneMarkS-2 to identify several types of distinct sequence patterns (signals) involved in gene expression control, among them the patterns characteristic for leaderless transcription as well as noncanonical RBS patterns. To assess the accuracy of GeneMarkS-2, we used genes validated by COG (Clusters of Orthologous Groups) annotation, proteomics experiments, and N-terminal protein sequencing. We observed that GeneMarkS-2 performed better on average in all accuracy measures when compared with the current state-of-the-art gene prediction tools. Furthermore, the screening of ∼5000 representative prokaryotic genomes made by GeneMarkS-2 predicted frequent leaderless transcription in both archaea and bacteria. We also observed that the RBS sites in some species with leadered transcription did not necessarily exhibit the Shine-Dalgarno consensus. The modeling of different types of sequence motifs regulating gene expression prompted a division of prokaryotic genomes into five categories with distinct sequence patterns around the gene starts. © 2018 Lomsadze et al.; Published by Cold Spring Harbor Laboratory Press.

CotA of Bacillus subtilis Is a Copper-Dependent Laccase

PubMed Central

Hullo, Marie-Françoise; Moszer, Ivan; Danchin, Antoine; Martin-Verstraete, Isabelle

2001-01-01

The spore coat protein CotA of Bacillus subtilis displays similarities with multicopper oxidases, including manganese oxidases and laccases. B. subtilis is able to oxidize manganese, but neither CotA nor other sporulation proteins are involved. We demonstrate that CotA is a laccase. Syringaldazine, a specific substrate of laccases, reacted with wild-type spores but not with ΔcotA spores. CotA may participate in the biosynthesis of the brown spore pigment, which appears to be a melanin-like product and to protect against UV light. PMID:11514528

Dehalogenation of Chlorinated Hydroxybiphenyls by Fungal Laccase

PubMed Central

Schultz, Asgard; Jonas, Ulrike; Hammer, Elke; Schauer, Frieder

2001-01-01

We have investigated the transformation of chlorinated hydroxybiphenyls by laccase produced by Pycnoporus cinnabarinus. The compounds used were transformed to sparingly water-soluble colored precipitates which were identified by gas chromatography-mass spectrometry as oligomerization products of the chlorinated hydroxybiphenyls. During oligomerization of 2-hydroxy-5-chlorobiphenyl and 3-chloro-4-hydroxybiphenyl, dechlorinated C—C-linked dimers were formed, demonstrating the dehalogenation ability of laccase. In addition to these nonhalogenated dimers, both monohalogenated and dihalogenated dimers were identified. PMID:11526052

Location of laccase in ordered mesoporous materials

NASA Astrophysics Data System (ADS)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Laccase-13 Regulates Seed Setting Rate by Affecting Hydrogen Peroxide Dynamics and Mitochondrial Integrity in Rice.

PubMed

Yu, Yang; Li, Quan-Feng; Zhang, Jin-Ping; Zhang, Fan; Zhou, Yan-Fei; Feng, Yan-Zhao; Chen, Yue-Qin; Zhang, Yu-Chan

2017-01-01

Seed setting rate is one of the most important components of rice grain yield. To date, only several genes regulating setting rate have been identified in plant. In this study, we showed that laccase-13 ( OsLAC13 ), a member of laccase family genes which are known for their roles in modulating phenylpropanoid pathway and secondary lignification in cell wall, exerts a regulatory function in rice seed setting rate. OsLAC13 expressed in anthers and promotes hydrogen peroxide production both in vitro and in the filaments and anther connectives. Knock-out of OsLAC13 showed significantly increased seed setting rate, while overexpression of this gene exhibited induced mitochondrial damage and suppressed sugar transportation in anthers, which in turn affected seed setting rate. OsLAC13 also induced H 2 O 2 production and mitochondrial damage in the root tip cells which caused the lethal phenotype. We also showed that high abundant of OsmiR397, the suppressor of OsLAC13 mRNA, increased the seed setting rate of rice plants, and restrains H 2 O 2 accumulation in roots during oxidative stress. Our results suggested a novel regulatory role of OsLAC13 gene in regulating seed setting rate by affecting H 2 O 2 dynamics and mitochondrial integrity in rice.

A designed bifunctional laccase/β-1,3-1,4-glucanase enzyme shows synergistic sugar release from milled sugarcane bagasse.

PubMed

Furtado, G P; Ribeiro, L F; Lourenzoni, M R; Ward, R J

2013-01-01

A bifunctional enzyme has been created by fusing two Bacillus subtilis enzymes: the β-1,3-1,4-glucanase (BglS, EC 3.2.1.73) that hydrolyzes plant cell wall β-glucans and the copper-dependent oxidase laccase (CotA, EC 1.10.3.2) that catalyzes the oxidation of aromatic compounds with simultaneous reduction of oxygen to water. The chimeric laccase/β-1,3-1,4-glucanase was created by insertion fusion of the bglS and cotA genes, and expressed in Escherichia coli. The affinity-purified recombinant chimeric enzyme showed both laccase and glucanase activities, with a maximum laccase activity at pH 4.5 and 75°C that showed a V(max) 30% higher than observed for the parental laccase. The maximum glucanase activity in the chimeric enzyme was at pH 6.0 and 50°C, with a slight reduction in V(max) by ∼10% compared with the parental glucanase. A decreased K(M) resulted in an overall increase in the K(cat)/K(M) value for the glucanase activity of the chimeric enzyme. The hydrolytic activity of the chimera was 20% higher against natural milled sugarcane bagasse as compared with equimolar mixtures of the separate parental enzymes. Molecular dynamics simulations indicated the approximation of the two catalytic domains in the chimeric enzyme, and the formation of an inter-domain interface may underlie the improved catalytic function.

Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.

2007-09-15

Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. Inmore » the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.« less

Synaptic, transcriptional and chromatin genes disrupted in autism.

PubMed

De Rubeis, Silvia; He, Xin; Goldberg, Arthur P; Poultney, Christopher S; Samocha, Kaitlin; Cicek, A Erucment; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarinder; Klei, Lambertus; Kosmicki, Jack; Shih-Chen, Fu; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F; Brownfeld, Jessica M; Cai, Jinlu; Campbell, Nicholas G; Carracedo, Angel; Chahrour, Maria H; Chiocchetti, Andreas G; Coon, Hilary; Crawford, Emily L; Curran, Sarah R; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A; Gallagher, Louise; Geller, Evan; Guter, Stephen J; Hill, R Sean; Ionita-Laza, Juliana; Jimenz Gonzalez, Patricia; Kilpinen, Helena; Klauck, Sabine M; Kolevzon, Alexander; Lee, Irene; Lei, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R; McInnes, Alison L; Neale, Benjamin; Owen, Michael J; Ozaki, Noriio; Parellada, Mara; Parr, Jeremy R; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Li-San, Wang; Weiss, Lauren A; Willsey, A Jeremy; Yu, Timothy W; Yuen, Ryan K C; Cook, Edwin H; Freitag, Christine M; Gill, Michael; Hultman, Christina M; Lehner, Thomas; Palotie, Aaarno; Schellenberg, Gerard D; Sklar, Pamela; State, Matthew W; Sutcliffe, James S; Walsh, Christiopher A; Scherer, Stephen W; Zwick, Michael E; Barett, Jeffrey C; Cutler, David J; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J; Buxbaum, Joseph D

2014-11-13

The genetic architecture of autism spectrum disorder involves the interplay of common and rare variants and their impact on hundreds of genes. Using exome sequencing, here we show that analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, plus a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic formation, transcriptional regulation and chromatin-remodelling pathways. These include voltage-gated ion channels regulating the propagation of action potentials, pacemaking and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodellers-most prominently those that mediate post-translational lysine methylation/demethylation modifications of histones.

Post-transcriptional bursting in genes regulated by small RNA molecules

NASA Astrophysics Data System (ADS)

Rodrigo, Guillermo

2018-03-01

Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.

Role of laccase from Coriolus versicolor MTCC-138 in selective oxidation of aromatic methyl group.

PubMed

Chaurasia, Pankaj Kumar; Singh, Sunil Kumar; Bharati, Shashi Lata

2014-01-01

Now a day, laccases are the most promising enzymes in the area of biotechnology and synthesis. One of the best applications of laccases is the selective oxidation of aromatic methyl group to aldehyde group. Such transformations are valuable because it is difficult to stop the reaction at aldehyde stage. Chemical methods used for such biotransformations areexpensive and give poor yields. But, the laccase-catalyzed biotransformations of such type are non-expensive and yield is excellent. Authors have used crude laccase obtained from the liquid culture growth medium of fungal strain Coriolus versicolor MTCC-138 for the biotransformations of toluene, 3-nitrotoluene, and 4-chlorotoluene to benzaldehyde, 3-nitrobenzaldehyde, and 4-chlorobenzaldehyde, respectively, instead of purified laccase because purification process requires much time and cost. This communication reports that crude laccase can also be used in the place of purified laccase as effective biocatalyst.

Molecular modeling and simulation studies of recombinant laccase from Yersinia enterocolitica suggests significant role in the biotransformation of non-steroidal anti-inflammatory drugs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Deepti; Rawat, Surender; Waseem, Mohd

The YacK gene from Yersinia enterocolitica strain 7, cloned in pET28a vector and expressed in Escherichia coli BL21 (DE3), showed laccase activity when oxidized with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and guaiacol. The recombinant laccase protein was purified and characterized biochemically with a molecular mass of ≈58 KDa on SDS-PAGE and showed positive zymogram with ABTS. The protein was highly robust with optimum pH 9.0 and stable at 70 °C upto 12 h with residual activity of 70%. Kinetic constants, K{sub m} values, for ABTS and guaiacol were 675 μM and 2070 μM, respectively, with corresponding Vmax values of 0.125 μmol/ml/min and 6500 μmol/ml/min. It also possess antioxidative propertymore » against BSA and Cu{sup 2+}/H{sub 2}O{sub 2} model system. Constant pH MD simulation studies at different protonation states of the system showed ABTS to be most stable at acidic pH, whereas, diclofenac at neutral pH. Interestingly, aspirin drifted out of the binding pocket at acidic and neutral pH, but showed stable binding at alkaline pH. The biotransformation of diclofenac and aspirin by laccase also corroborated the in silico results. This is the first report on biotransformation of non-steroidal anti-inflammatory drugs (NSAIDs) using recombinant laccase from gut bacteria, supported by in silico simulation studies. - Highlights: • Laccase from Yersinia enterocolitica strain 7 was expressed in Escherichia coli BL21 (DE3). • Recombinant laccase was found to be thermostable and alkali tolerant. • The in silico and experimental studied proves the biotransformation of NSAIDs. • Laccase binds to ligands differentially under different protonation state. • Laccase also possesses free radical scavenging property.« less

Imaging Transcriptional Regulation of Eukaryotic mRNA Genes: Advances and Outlook.

PubMed

Yao, Jie

2017-01-06

Regulation of eukaryotic transcription in vivo occurs at distinct stages. Previous research has identified many active or repressive transcription factors (TFs) and core transcription components and studied their functions in vitro and in vivo. Nonetheless, how individual TFs act in concert to regulate mRNA gene expression in a single cell remains poorly understood. Direct observation of TF assembly and disassembly and various biochemical reactions during transcription of a single-copy gene in vivo is the ideal approach to study this problem. Research in this area requires developing novel techniques for single-cell transcription imaging and integrating imaging studies into understanding the molecular biology of transcription. In the past decade, advanced cell imaging has enabled unprecedented capabilities to visualize individual TF molecules, to track single transcription sites, and to detect individual mRNA in fixed and living cells. These studies have raised several novel insights on transcriptional regulation such as the "hit-and-run" model and transcription bursting that could not be obtained by in vitro biochemistry analysis. At this point, the key question is how to achieve deeper understandings or discover novel mechanisms of eukaryotic transcriptional regulation by imaging transcription in single cells. Meanwhile, further technical advancements are likely required for visualizing distinct kinetic steps of transcription on a single-copy gene in vivo. This review article summarizes recent progress in the field and describes the challenges and opportunities ahead. Copyright © 2016 Elsevier Ltd. All rights reserved.

Upgrading Laccase Production and Biochemical Properties: Strategies and Challenges.

PubMed

Bertrand, Brandt; Martínez-Morales, Fernando; Trejo-Hernández, María R

2017-07-01

Improving laccases continues to be crucial in novel biotechnological developments and industrial applications, where they are concerned. This review breaks down and explores the potential of the strategies (conventional and modern) that can be used for laccase enhancement (increased production and upgraded biochemical properties such as stability and catalytic efficiency). The challenges faced with these approaches are briefly discussed. We also shed light on how these strategies merge and give rise to new options and advances in this field of work. Additionally, this article seeks to serve as a guide for students and academic researchers interested in laccases. This document not only gives basic information on laccases, but also provides updated information on the state of the art of various technologies that are used in this line of investigation. It also gives the readers an idea of the areas extensively studied and the areas where there is still much left to be done. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1015-1034, 2017. © 2017 American Institute of Chemical Engineers.

Laccase/mediator assisted degradation of triarylmethane dyes in a continuous membrane reactor.

PubMed

Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

2009-08-10

Laccase/mediator systems are important bioremediation agents as the rates of reactions can be enhanced in the presence of the mediators. The decolorization mechanism of two triarylmethane dyes, namely, Basic Green 4 and Acid Violet 17 is reported using Cyathus bulleri laccase. Basic Green 4 was decolorized through N-demethylation by laccase alone, while in mediator assisted reactions, dye breakdown was initiated from oxidation of carbinol form of the dye. Benzaldehyde and N,N-dimethyl aniline were the major end products. With Acid Violet 17, laccase carried out N-deethylation and in mediator assisted reactions, oxidation of the carbinol form of the dye occurred resulting in formation of formyl benzene sulfonic acid, carboxy benzene sulfonic acid and benzene sulfonic acid. Toxicity analysis revealed that Basic Green 4 was toxic and treatment with laccase/mediators resulted in 80-100% detoxification. The treatment of the textile dye solution using laccase and 2,2'-azino-di-(-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was demonstrated in an enzyme membrane reactor. At a hydraulic retention time of 6h, the process was operated for a period of 15 days with nearly 95% decolorization, 10% reduction in flux and 70% recovery of active ABTS.

Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta

PubMed Central

Abadulla, Elias; Tzanov, Tzanko; Costa, Silgia; Robra, Karl-Heinz; Cavaco-Paulo, Artur; Gübitz, Georg M.

2000-01-01

Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC50) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (ΔE*) below 1.1 were measured for most dyes. PMID:10919791

Pycnoporus cinnabarinus laccases: an interesting tool for food or non-food applications.

PubMed

Georis, J; Lomascolo, A; Camarero, S; Dorgeo, V; Herpoël, I; Asther, M; Martinez, A T; Dauvrin, T

2003-01-01

The effects of the addition of ferulic acid and ethanol in P. cinnabarinus ss3 culture medium in fermentor were compared in 15-L fermentor. In the presence of 30 g l(-1) ethanol, laccase activity (270,000 U/L1) was 3-fold higher as compared with ferulic acid-induced cultures, and 150-fold higher as compared with non-induced cultures, respectively. High-quality flax pulp was bleached in a totally-chlorine free (TCF) sequence using a laccase-mediator system constituted by laccase from Pycnoporus cinnabarinus and 1-hydroxybenzotriazole (HBT) as mediator. Up to 90% delignification and strong brightness increase were attained after the laccase-mediator treatment followed by H2O2 bleaching. This TCF sequence was further improved by applying H2O2 under pressurized O2. In this way, up to 82% ISO brightness was obtained (compared with 37% in the initial pulp and 60% in the peroxide-bleached control) as well as very low kappa number. A positive evaluation of the laccase has been also performed in a food application. The colour of a tea-based beverage was significantly improved by incubating an infusion of green tea with the Pycnoporus laccase.

Location of laccase in ordered mesoporous materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Thermokinetic comparison of trypan blue decolorization by free laccase and fungal biomass.

PubMed

Razak, N N A; Annuar, M S M

2014-03-01

Free laccase and fungal biomass from white-rot fungi were compared in the thermokinetics study of the laccase-catalyzed decolorization of an azo dye, i.e., Trypan Blue. The decolorization in both systems followed a first-order kinetics. The apparent first-order rate constant, k1', value increases with temperature. Apparent activation energy of decolorization was similar for both systems at ∼ 22 kJ mol(-1), while energy for laccase inactivation was 18 kJ mol(-1). Although both systems were endothermic, fungal biomass showed higher enthalpy, entropy, and Gibbs free energy changes for the decolorization compared to free laccase. On the other hand, free laccase showed reaction spontaneity over a wider range of temperature (ΔT = 40 K) as opposed to fungal biomass (ΔT = 15 K). Comparison of entropy change (ΔS) values indicated metabolism of the dye by the biomass.

Media optimization for laccase production by Trichoderma harzianum ZF-2 using response surface methodology.

PubMed

Gao, Huiju; Chu, Xiang; Wang, Yanwen; Zhou, Fei; Zhao, Kai; Mu, Zhimei; Liu, Qingxin

2013-12-01

Trichoderma harzianum ZF-2 producing laccase was isolated from decaying samples from Shandong, China, and showed dye decolorization activities. The objective of this study was to optimize its culture conditions using a statistical analysis of its laccase production. The interactions between different fermentation parameters for laccase production were characterized using a Plackett-Burman design and the response surface methodology. The different media components were initially optimized using the conventional one-factor-at-a-time method and an orthogonal test design, and a Plackett-Burman experiment was then performed to evaluate the effects on laccase production. Wheat straw powder, soybean meal, and CuSO4 were all found to have a significant influence on laccase production, and the optimal concentrations of these three factors were then sequentially investigated using the response surface methodology with a central composite design. The resulting optimal medium components for laccase production were determined as follows: wheat straw powder 7.63 g/l, soybean meal 23.07 g/l, (NH4)2SO4 1 g/l, CuSO4 0.51 g/l, Tween-20 1 g/l, MgSO4 1 g/l, and KH2PO4 0.6 g/l. Using this optimized fermentation method, the yield of laccase was increased 59.68 times to 67.258 U/ml compared with the laccase production with an unoptimized medium. This is the first report on the statistical optimization of laccase production by Trichoderma harzianum ZF-2.

Circadian enhancers coordinate multiple phases of rhythmic gene transcription in vivo.

PubMed

Fang, Bin; Everett, Logan J; Jager, Jennifer; Briggs, Erika; Armour, Sean M; Feng, Dan; Roy, Ankur; Gerhart-Hines, Zachary; Sun, Zheng; Lazar, Mitchell A

2014-11-20

Mammalian transcriptomes display complex circadian rhythms with multiple phases of gene expression that cannot be accounted for by current models of the molecular clock. We have determined the underlying mechanisms by measuring nascent RNA transcription around the clock in mouse liver. Unbiased examination of enhancer RNAs (eRNAs) that cluster in specific circadian phases identified functional enhancers driven by distinct transcription factors (TFs). We further identify on a global scale the components of the TF cistromes that function to orchestrate circadian gene expression. Integrated genomic analyses also revealed mechanisms by which a single circadian factor controls opposing transcriptional phases. These findings shed light on the diversity and specificity of TF function in the generation of multiple phases of circadian gene transcription in a mammalian organ.

Identification of a Novel Reference Gene for Apple Transcriptional Profiling under Postharvest Conditions

PubMed Central

Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

2015-01-01

Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference—ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)—along with two novel candidates—HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest. PMID:25774904

Identification of a novel reference gene for apple transcriptional profiling under postharvest conditions.

PubMed

Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

2015-01-01

Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference--ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)--along with two novel candidates--HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest.

Transcriptional regulation of genes related to progesterone production.

PubMed

Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru

2015-01-01

Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production.

Laccase-catalyzed oxidation of iodide and formation of organically bound iodine in soils.

PubMed

Seki, Miharu; Oikawa, Jun-ichi; Taguchi, Taro; Ohnuki, Toshihiko; Muramatsu, Yasuyuki; Sakamoto, Kazunori; Amachi, Seigo

2013-01-02

Laccase oxidizes iodide to molecular iodine or hypoiodous acid, both of which are easily incorporated into natural soil organic matter. In this study, iodide sorption and laccase activity in 2 types of Japanese soil were determined under various experimental conditions to evaluate possible involvement of this enzyme in the sorption of iodide. Batch sorption experiment using radioactive iodide tracer ((125)I(-)) revealed that the sorption was significantly inhibited by autoclaving (121 °C, 40 min), heat treatment (80 and 100 °C, 10 min), γ-irradiation (30 kGy), N(2) gas flushing, and addition of reducing agents and general laccase inhibitors (KCN and NaN(3)). Interestingly, very similar tendency of inhibition was observed in soil laccase activity, which was determined using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a substrate. The partition coefficient (K(d): mL g(-1)) for iodide and specific activity of laccase in soils (Unit g(-1)) showed significant positive correlation in both soil samples. Addition of a bacterial laccase with an iodide-oxidizing activity to the soils strongly enhanced the sorption of iodide. Furthermore, the enzyme addition partially restored iodide sorption capacity of the autoclaved soil samples. These results suggest that microbial laccase is involved in iodide sorption on soils through the oxidation of iodide.

One-pot synthesis of active copper-containing carbon dots with laccase-like activities

NASA Astrophysics Data System (ADS)

Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

2015-11-01

Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching

Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal

Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable themore » differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

A meiotic gene regulatory cascade driven by alternative fates for newly synthesized transcripts

PubMed Central

Cremona, Nicole; Potter, Kristine; Wise, Jo Ann

2011-01-01

To determine the relative importance of transcriptional regulation versus RNA processing and turnover during the transition from proliferation to meiotic differentiation in the fission yeast Schizosaccharomyces pombe, we analyzed temporal profiles and effects of RNA surveillance factor mutants on expression of 32 meiotic genes. A comparison of nascent transcription with steady-state RNA accumulation reveals that the vast majority of these genes show a lag between maximal RNA synthesis and peak RNA accumulation. During meiosis, total RNA levels parallel 3′ processing, which occurs in multiple, temporally distinct waves that peak from 3 to 6 h after meiotic induction. Most early genes and one middle gene, mei4, share a regulatory mechanism in which a specialized RNA surveillance factor targets newly synthesized transcripts for destruction. Mei4p, a member of the forkhead transcription factor family, in turn regulates a host of downstream genes. Remarkably, a spike in transcription is observed for less than one-third of the genes surveyed, and even these show evidence of RNA-level regulation. In aggregate, our findings lead us to propose that a regulatory cascade driven by changes in processing and stability of newly synthesized transcripts operates alongside the well-known transcriptional cascade as fission yeast cells enter meiosis. PMID:21148298

Enhanced laccase production by Trametes versicolor using corn steep liquor as both nitrogen source and inducer.

PubMed

Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2014-08-01

A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. Copyright © 2014 Elsevier Ltd. All rights reserved.

Assessment of Anaerobic Toluene Biodegradation Activity by bssA Transcript/Gene Ratios

PubMed Central

Brow, Christina N.; O'Brien Johnson, Reid; Johnson, Richard L.

2013-01-01

Benzylsuccinate synthase (bssA) genes associated with toluene degradation were profiled across a groundwater contaminant plume under nitrate-reducing conditions and were detected in significant numbers throughout the plume. However, differences between groundwater and core sediment samples suggested that microbial transport, rather than local activity, was the underlying cause of the high copy numbers within the downgradient plume. Both gene transcript and reactant concentrations were consistent with this hypothesis. Expression of bssA genes from denitrifying toluene degraders was induced by toluene but only in the presence of nitrate, and transcript abundance dropped rapidly following the removal of either toluene or nitrate. The drop in bssA transcripts following the removal of toluene could be described by an exponential decay function with a half-life on the order of 1 h. Interestingly, bssA transcripts never disappeared completely but were always detected at some level if either inducer was present. Therefore, the detection of transcripts alone may not be sufficient evidence for contaminant degradation. To avoid mistakenly associating basal-level gene expression with actively degrading microbial populations, an integrated approach using the ratio of functional gene transcripts to gene copies is recommended. This approach minimizes the impact of microbial transport on activity assessment and allows reliable assessments of microbial activity to be obtained from water samples. PMID:23811506

Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.

PubMed

Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

2010-12-01

Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. 2010 Elsevier Ltd. All rights reserved.

Laccase-conjugated amino-functionalized nanosilica for efficient degradation of Reactive Violet 1 dye

NASA Astrophysics Data System (ADS)

Gahlout, Mayur; Rudakiya, Darshan M.; Gupte, Shilpa; Gupte, Akshaya

2017-08-01

Immobilization of enzyme with nanostructures enhances its ideal characteristics, which may allow the enzyme to become more stable and resistant. The present investigation deals with the formulation of laccase nanosilica conjugates to overcome the problems associated with its stability and reusability. Synthesized nanosilica and laccase nanoparticles were spherical shaped, with the mean size of 220 and 615 nm, respectively. Laccase nanoparticles had an optimum temperature of 55 °C and pH 4.0 for the oxidation of ABTS. Laccase nanoparticle retained 79% of residual activity till 20th cycle. It also showed 91% of its initial activity at lower temperatures even after 60 days. Laccase nanoparticles were applied for Reactive Violet 1 degradation wherein 96.76% of decolourization was obtained at pH 5.0 and 30 °C within 12 h. Toxicity studies on microbes and plants suggested that the degraded metabolites were less toxic than control dye. Thus, the method applied for immobilization increased storage stability and reusability of laccase, and therefore, it can be utilized for efficient degradation of azo dyes.

Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

PubMed

Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

2014-10-17

The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

Immobilization of fungal laccase onto a nonionic surfactant-modified clay material: application to PAH degradation.

PubMed

Chang, Yi-Tang; Lee, Jiunn-Fwu; Liu, Keng-Hua; Liao, Yi-Fen; Yang, Vivian

2016-03-01

Nonionic surfactant-modified clay is a useful absorbent material that effectively removes hydrophobic organic compounds from soil/groundwater. We developed a novel material by applying an immobilized fungal laccase onto nonionic surfactant-modified clay. Low-water-solubility polycyclic aromatic hydrocarbons (PAHs) (naphthalene/phenanthrene) were degraded in the presence of this bioactive material. PAH degradation by free laccase was higher than degradation by immobilized laccase when the surfactant concentration was allowed to form micelles. PAH degradation by immobilized laccase on TX-100-modified clay was higher than on Brij35-modified clay. Strong laccase degradation of PAH can be maintained by adding surfactant monomers or micelles. The physical adsorption of nonionic surfactants onto clay plays an important role in PAH degradation by laccase, which can be explained by the structure and molecular interactions of the surfactant with the clay and enzyme. A system where laccase is immobilized onto TX-100-monomer-modified clay is a good candidate bioactive material for in situ PAHs bioremediation.

Effect of regulatory peptides on gene transcription.

PubMed

Khavinson, V Kh; Shataeva, L K; Chernova, A A

2003-09-01

Experimental studies of geroprotective activity of synthetic oligopeptides and conformational analysis of the tetrapeptide Epithalon allowed us to hypothesize that regulatory oligopeptides directly initiate transcription of genes for vitally important proteins. Sequences of nucleotide pairs that can serve as binding sites for tetrapeptide Epithalon were identified in the promoter regions of retinal genes F379, telomerase, and RNA polymerase II.

Circadian Enhancers Coordinate Multiple Phases of Rhythmic Gene Transcription In Vivo

PubMed Central

Fang, Bin; Everett, Logan J.; Jager, Jennifer; Briggs, Erika; Armour, Sean M.; Feng, Dan; Roy, Ankur; Gerhart-Hines, Zachary; Sun, Zheng; Lazar, Mitchell A.

2014-01-01

SUMMARY Mammalian transcriptomes display complex circadian rhythms with multiple phases of gene expression that cannot be accounted for by current models of the molecular clock. We have determined the underlying mechanisms by measuring nascent RNA transcription around the clock in mouse liver. Unbiased examination of eRNAs that cluster in specific circadian phases identified functional enhancers driven by distinct transcription factors (TFs). We further identify on a global scale the components of the TF cistromes that function to orchestrate circadian gene expression. Integrated genomic analyses also revealed novel mechanisms by which a single circadian factor controls opposing transcriptional phases. These findings shed new light on the diversity and specificity of TF function in the generation of multiple phases of circadian gene transcription in a mammalian organ. PMID:25416951

Effect of antibiotics on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus.

PubMed

Dhawan, Shikha; Lal, Rup; Hanspal, Manjit; Kuhad, Ramesh Chander

2005-08-01

The effect of nine different antibiotics (chloramphenicol, ampicillin trihydrate, kanamycin A monosulfate, neomycin sulfate, erythromycin, thiostrepton, tetracycline, apramycin sulfate and streptomycin sulfate) on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus has been investigated. All the antibiotics tested at a concentration of 200 mg/l affected the fungal growth, release of protein and laccase production to different extent. Inhibition in fungal growth was found to be positively correlated with increase in laccase production. Interestingly, apramycin sulfate inhibited biomass production (14.9-26.2%), nevertheless, it stimulated maximum laccase production (18.2 U/ml) in both the fungi. Increasing concentrations of apramycin sulfate enhanced laccase production from P. cinnabarinus but not from C. bulleri.

Controlling the simultaneous production of laccase and lignin peroxidase from Streptomyces cinnamomensis by medium formulation

PubMed Central

2012-01-01

Background Use of crude ligninase of bacterial origin is one of the most promising ways to improve the practical biodegradation of lignocellulosic biomass. However, lignin is composed of diverse monolignols with different abundance levels in different plant biomass and requires different proportions of ligninase to realize efficient degradation. To improve activity and reduce cost, the simultaneous submerged fermentation of laccase and lignin peroxidase (LiP) from a new bacterial strain, Streptomyces cinnamomensis, was studied by adopting formulation design, principal component analysis, regression analysis and unconstrained mathematical programming. Results The activities of laccase and LiP from S. cinnamomensis cultured with the optimal medium formulations were improved to be five to eight folders of their initial activities, and the measured laccase:LiP activity ratios reached 0.1, 0.4 and 1.7 when cultured on medium with formulations designed to produce laccase:LiP complexes with theoretical laccase:LiP activity ratios of 0.05 to 0.1, 0.5 to 1 and 1.1 to 2. Conclusion Both the laccase and LiP activities and also the activity ratio of laccase to LiP could be controlled by the medium formulation as designed. Using a crude laccase-LiP complex with a specially designed laccase:LiP activity ratio has the potential to improve the degradation of various plant lignins composed of diverse monolignols with different abundance levels. PMID:22429569

Characterization and immobilization of Trametes versicolor laccase on magnetic chitosan-clay composite beads for phenol removal.

PubMed

Aydemir, Tülin; Güler, Semra

2015-01-01

Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h.

Transcriptional regulation of defence genes and involvement of the WRKY transcription factor in arbuscular mycorrhizal potato root colonization.

PubMed

Gallou, Adrien; Declerck, Stéphane; Cranenbrouck, Sylvie

2012-03-01

The establishment of arbuscular mycorrhizal associations causes major changes in plant roots and affects significantly the host in term of plant nutrition and resistance against biotic and abiotic stresses. As a consequence, major changes in root transcriptome, especially in plant genes related to biotic stresses, are expected. Potato microarray analysis, followed by real-time quantitative PCR, was performed to detect the wide transcriptome changes induced during the pre-, early and late stages of potato root colonization by Glomus sp. MUCL 41833. The microarray analysis revealed 526 up-regulated and 132 down-regulated genes during the pre-stage, 272 up-regulated and 109 down-regulated genes during the early stage and 734 up-regulated and 122 down-regulated genes during the late stage of root colonization. The most important class of regulated genes was associated to plant stress and in particular to the WRKY transcription factors genes during the pre-stage of root colonization. The expression profiling clearly demonstrated a wide transcriptional change during the pre-, early and late stages of root colonization. It further suggested that the WRKY transcription factor genes are involved in the mechanisms controlling the arbuscular mycorrhizal establishment by the regulation of plant defence genes.

Transcriptional enhancer from milk protein genes

DOEpatents

Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.

1999-01-01

The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

The Role of Multiple Transcription Factors In Archaeal Gene Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Charles J. Daniels

2008-09-23

Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcaniimore » was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

PubMed Central

Ronander, Elena; Bengtsson, Dominique C.; Joergensen, Louise; Jensen, Anja T. R.; Arnot, David E.

2012-01-01

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1. Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types. PMID:23070076

Increased mitochondrial-encoded gene transcription in immortal DF-1 cells.

PubMed

Kim, H; You, S; Kim, I J; Farris, J; Foster, L K; Foster, D N

2001-05-01

We have established, in continuous cell culture, a spontaneously immortalized chicken embryo fibroblast (CEF) cell line (DF-1) as well as several other immortal CEF cell lines. The immortal DF-1 cells divided more rapidly than primary and other immortal CEF cells. To identify the genes involved in rapidly dividing DF-1 cells, we have used differential display RT-PCR. Of the numerous genes analyzed, three mitochondrial-encoded genes (ATPase 8/6, 16S rRNA, and cytochrome b) were shown to express at higher levels in DF-1 cells compared to primary and other immortal CEF cells. The inhibition of mitochondrial translation by treatment with chloramphenicol markedly decreased ATP production and cell proliferation in DF-1 cells, while not affecting growth in either primary or other immortal CEF cells. This result suggests a correlation between rapid cell proliferation and the increased mitochondrial respiratory functions. We also determined that the increased transcription of mitochondrial-encoded genes in DF-1 cells is due to increased de novo transcript synthesis as shown by mitochondrial run-on assays, and not the result of either increased mitochondrial biogenesis or mitochondrial transcript half-lives. Together, the present studies suggest that the transcriptional activation of mitochondrial-encoded genes and the elevated respiratory function should be one of the characteristics of rapidly dividing immortal cells. Copyright 2001 Academic Press.

Identification of Primary Transcriptional Regulation of Cell Cycle-Regulated Genes upon DNA Damage

PubMed Central

Zhou, Tong; Chou, Jeff; Mullen, Thomas E.; Elkon, Rani; Zhou, Yingchun; Simpson, Dennis A.; Bushel, Pierre R.; Paules, Richard S.; Lobenhofer, Edward K.; Hurban, Patrick; Kaufmann, William K.

2007-01-01

The changes in global gene expression in response to DNA damage may derive from either direct induction or repression by transcriptional regulation or indirectly by synchronization of cells to specific cell cycle phases, such as G1 or G2. We developed a model that successfully estimated the expression levels of >400 cell cycle-regulated genes in normal human fibroblasts based on the proportions of cells in each phase of the cell cycle. By isolating effects on the gene expression associated with the cell cycle phase redistribution after genotoxin treatment, the direct transcriptional target genes were distinguished from genes for which expression changed secondary to cell synchronization. Application of this model to ionizing radiation (IR)-treated normal human fibroblasts identified 150 of 406 cycle-regulated genes as putative direct transcriptional targets of IR-induced DNA damage. Changes in expression of these genes after IR treatment derived from both direct transcriptional regulation and cell cycle synchronization. PMID:17404513

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

FOXM1 promotes the progression of prostate cancer by regulating PSA gene transcription.

PubMed

Liu, Youhong; Liu, Yijun; Yuan, Bowen; Yin, Linglong; Peng, Yuchong; Yu, Xiaohui; Zhou, Weibing; Gong, Zhicheng; Liu, Jianye; He, Leye; Li, Xiong

2017-03-07

Androgen/AR is the primary contributor to prostate cancer (PCa) progression by regulating Prostate Specific Antigen (PSA) gene transcription. The disease inevitably evolves to androgen-independent (AI) status. Other mechanisms by which PSA is regulated and develops to AI have not yet been fully determined. FOXM1 is a cell proliferation-specific transcription factor highly expressed in PCa cells compared to non-malignant prostate epithelial cells, suggesting that the aberrant overexpression of FOXM1 contributes to PCa development. In addition to regulating AR gene transcription and cell cycle-regulatory genes, FOXM1 selectively regulates the gene transcription of KLK2 and PSA, typical androgen responsive genes. Screening the potential FOXM1-binding sites by ChIP-PCR, we found that FOXM1 directly binds to the FHK binding motifs in the PSA promoter/enhancer regions. AI C4-2 cells have more FOXM1 binding sites than androgen dependent LNCaP cells. The depletion of FOXM1 by small molecular inhibitors significantly improves the suppression of PSA gene transcription by the anti-AR agent Cadosax. This is the first report showing that FOXM1 promotes PCa progression by regulating PSA gene transcription, particularly in AI PCa cells. The combination of anti-AR agents and FOXM1 inhibitors has the potential to greatly improve therapy for late-stage PCa patients by suppressing PSA levels.

The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karen S. Browning; Marie Petrocek; Bonnie Bartel

2006-06-01

The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional genemore » expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.« less

[Decolorization of dyestuff and dying waste water by laccase solution with self-flocculent mycelial pellets of Coriolus versicolor].

PubMed

Wu, Mianbin; Xia, Liming

2002-06-01

Both laccase production by the white-rot fungus Coriolus versicolor and decolorization of dyestuff and dying waste water with crude solution of laccase were studied in this work. Laccase production meets the definition of secondary metabolism. For laccase production the optimum initial pH is 4.5. Addition of veratryl alcohol or elevated trace metals could both enhance the laccase activity, while Tween80 showed some inhibition. The immobilized mycelia of C. versicolor in polyurethane foam had less laccase production ability than mycelial pellets. A repeated batch cultivation process was found to be a very economical way for laccase harvest. The same pellets could be used for at least 14 times and average laccase activity of each batch could maintain 6.72 IU/mL. This method reduces the enzyme production course, medium consumption and the possibility of contamination, showing high efficient and great economic benefit. Good results were also obtained in decolorization experiments with the crude solution of laccase. With 3.3 IU/mL initial laccase activity, color removal of Acid Orange reached 98.5% after 24 h reaction. Also with 2.6 IU/mL initial laccase activity, color removal of dying waste water reached 93% after 24 h reaction.

Purification of a thermostable alkaline laccase from papaya (Carica papaya) using affinity chromatography.

PubMed

Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

2015-01-01

A laccase from papaya leaves was purified to homogeneity by a two step procedure namely, heat treatment (at 70 °C) and Con-A affinity chromatography. The procedure resulted in 1386.7-fold purification of laccase with a specific activity of 41.3 units mg(-1) and an overall yield of 61.5%. The native purified laccase was found to be a hexameric protein of ∼ 260 kDa. The purified enzyme exhibited acidic and alkaline pH optima of 6.0 and 8.0 with the non-phenolic substrate (ABTS) and phenolic substrate (catechol), respectively. The purified laccase was found to be thermostable up to 70 °C such that it retained ∼ 80% activity upon 30 min incubation at 70 °C. The Arrhenius energy of activation for purified laccase was found to be 7.7 kJ mol(-1). The enzyme oxidized various phenolic and non-phenolic substrates having catalytic efficiency (K(cat)/K(m)) in the order of 7.25>0.67>0.27 mM(-1) min(-1) for ABTS, catechol and hydroquinone, respectively. The purified laccase was found to be activated by Mn(2+), Cd(2+), Ca(2+), Na(+), Fe(2+), Co(2+) and Cu(2+) while weakly inhibited by Hg(2+). The properties such as thermostability, alkaline pH optima and metal tolerance exhibited by the papaya laccase make it a promising candidate enzyme for industrial exploitation. Copyright © 2014 Elsevier B.V. All rights reserved.

Butyric acid stimulates bone sialoprotein gene transcription.

PubMed

Yang, Li; Li, Zhengyang; Li, Xinyue; Wang, Zhitao; Wang, Shuang; Sasaki, Yoko; Takai, Hideki; Ogata, Yorimasa

2010-06-01

Butyric acid (sodium butyrate; BA) is an extracellular metabolite secreted from periodontopathic bacteria present in subgingival plaque. BA induces apoptosis of T and B cells, and acts as a potent inhibitor of histone deacetylases. Bone sialoprotein (BSP) is thought to function in the initial mineralization of bone, and may be crucial for osteoblast differentiation, bone matrix mineralization and tumor metastasis. In the present study we investigated the regulation of BSP transcription by BA in rat osteoblast-like ROS17/2.8 cells. At 12 h, BA (10(-4) M) increased the level of BSP mRNA, and enhanced the luciferase activity of the construct pLUC3, which includes the promoter sequence between nucleotides -116 and +60. Transcriptional stimulation by BA was abrogated in the pLUC3 construct which containing a 2-bp mutation in the fibroblast growth factor 2 response element (FRE). Gel shift analyses showed that BA increased the binding of nuclear protein to FRE. These data suggest that BA increases the transcription of the BSP gene mediated through FRE in the rat BSP gene promoter, and induces osteoblast activity in the early stage of bone formation.

A Comprehensive Analysis of Transcript-Supported De Novo Genes in Saccharomyces sensu stricto Yeasts

PubMed Central

Lu, Tzu-Chiao; Leu, Jun-Yi; Lin, Wen-Chang

2017-01-01

Abstract Novel genes arising from random DNA sequences (de novo genes) have been suggested to be widespread in the genomes of different organisms. However, our knowledge about the origin and evolution of de novo genes is still limited. To systematically understand the general features of de novo genes, we established a robust pipeline to analyze >20,000 transcript-supported coding sequences (CDSs) from the budding yeast Saccharomyces cerevisiae. Our analysis pipeline combined phylogeny, synteny, and sequence alignment information to identify possible orthologs across 20 Saccharomycetaceae yeasts and discovered 4,340 S. cerevisiae-specific de novo genes and 8,871 S. sensu stricto-specific de novo genes. We further combine information on CDS positions and transcript structures to show that >65% of de novo genes arose from transcript isoforms of ancient genes, especially in the upstream and internal regions of ancient genes. Fourteen identified de novo genes with high transcript levels were chosen to verify their protein expressions. Ten of them, including eight transcript isoform-associated CDSs, showed translation signals and five proteins exhibited specific cytosolic localizations. Our results suggest that de novo genes frequently arise in the S. sensu stricto complex and have the potential to be quickly integrated into ancient cellular network. PMID:28981695

Thermodynamics-based models of transcriptional regulation with gene sequence.

PubMed

Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

2015-12-01

Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

Transcriptional oscillation of canonical clock genes in mouse peripheral tissues

PubMed Central

Yamamoto, Takuro; Nakahata, Yasukazu; Soma, Haruhiko; Akashi, Makoto; Mamine, Takayoshi; Takumi, Toru

2004-01-01

Background The circadian rhythm of about 24 hours is a fundamental physiological function observed in almost all organisms from prokaryotes to humans. Identification of clock genes has allowed us to study the molecular bases for circadian behaviors and temporal physiological processes such as hormonal secretion, and has prompted the idea that molecular clocks reside not only in a central pacemaker, the suprachiasmatic nuclei (SCN) of hypothalamus in mammals, but also in peripheral tissues, even in immortalized cells. Furthermore, previous molecular dissection revealed that the mechanism of circadian oscillation at a molecular level is based on transcriptional regulation of clock and clock-controlled genes. Results We systematically analyzed the mRNA expression of clock and clock-controlled genes in mouse peripheral tissues. Eight genes (mBmal1, mNpas2, mRev-erbα, mDbp, mRev-erbβ, mPer3, mPer1 and mPer2; given in the temporal order of the rhythm peak) showed robust circadian expressions of mRNAs in all tissues except testis, suggesting that these genes are core molecules of the molecular biological clock. The bioinformatics analysis revealed that these genes have one or a combination of 3 transcriptional elements (RORE, DBPE, and E-box), which are conserved among human, mouse, and rat genome sequences, and indicated that these 3 elements may be responsible for the biological timing of expression of canonical clock genes. Conclusions The observation of oscillatory profiles of canonical clock genes is not only useful for physiological and pathological examination of the circadian clock in various organs but also important for systematic understanding of transcriptional regulation on a genome-wide basis. Our finding of the oscillatory expression of canonical clock genes with a temporal order provides us an interesting hypothesis, that cyclic timing of all clock and clock-controlled genes may be dependent on several transcriptional elements including 3 known elements

One-pot synthesis of active copper-containing carbon dots with laccase-like activities.

PubMed

Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

2015-12-14

Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.

Simultaneous production of laccase and degradation of bisphenol A with Trametes versicolor cultivated on agricultural wastes.

PubMed

Zeng, Shengquan; Zhao, Jie; Xia, Liming

2017-08-01

Solid state fermentation with Trametes versicolor was carried out on agricultural wastes containing bisphenol A (BPA). It was found that BPA degradation was along with the occurrence of laccase production, and wheat bran and corn straw were identified as suitable mixed substrates for laccase production. In the process of BPA degradation with T. versicolor, laccase activity increased rapidly at the 6th-10th day after inoculation. Moreover, BPA can enhance the production of laccase. After 10 days of fermentation, degradation rate of BPA exceeded 90% without the usage of mediators ABTS and acetosyringone at pH 4.0-8.0. In addition, metal ions did not affect the BPA degradation with T. versicolor. In vitro, the optimum pH range of BPA degradation with laccase was in the acidic region with the optimal performance of pH 5.0. Metal ions Cu 2+ , Zn 2+ , and Co 2+ showed little effect on BPA degradation. However, Fe 3+ and Fe 2+ substantially inhibited the BPA degradation. Natural mediator acetosyringone showed optimum enhancement on BPA degradation. Greater than 90% of the estrogenic activity of BPA was removed by T. versicolor and its laccase. Compared to in vitro degradation with laccase, this study shows that the process of simultaneous laccase production and BPA degradation with T. versicolor was more advantageous since BPA can enhance the laccase production, mediators were unnecessary, degradation rate was not affected by metal ions, and the applicable pH range was broader. This study concludes that T. versicolor and laccase have great potential to treat industrial wastewater containing BPA.

Landscape of post-transcriptional gene regulation during hepatitis C virus infection

PubMed Central

Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram

2015-01-01

Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065

Functional expression, production, and biochemical characterization of a laccase using yeast surface display technology.

PubMed

Bertrand, Brandt; Trejo-Hernández, María R; Morales-Guzmán, Daniel; Caspeta, Luis; Suárez Rodríguez, Ramón; Martínez-Morales, Fernando

2016-12-01

A Trametes versicolor laccase was functionally expressed on the membrane surface of Saccharomyces cerevisiae EBY100. Laccase expression was increased 6.57-fold by medium optimization and surpassed production by the native strain. Maximal laccase and biomass production reached 19 735 ± 1719 Ug -1 and 6.22 ± 0.53 gL -1 respectively, after 2 d of culture. Optimum oxidization of all substrates by laccase was observed at pH 3. Laccase showed high affinity towards substrates used with Km (mM) and Vmax (μmol min -1 ) values of 0.57 ± 0.0047 and 24.55 ± 0.64, 1.52 ± 0.52 and 9.25 ± 1.78, and 2.67 ± 0.12 and 11.26 ± 0.75, were reported for ABTS, 2, 6-DMP and GUA, respectively. EDTA and NaN 3 displayed none competitive inhibition towards laccase activity. The optimum temperature for activity was 50 °C; however, the enzyme was stable over a wide range of temperatures (25-70 °C). The biologically immobilized laccase showed high reusability towards phenolic substrates and low reusability with non-phenolic substrates. High affinity for a diversity phenolic compounds and great ethanol tolerance substantiates this laccase/yeast biocatalyst potential for application in the production of bioethanol. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination

PubMed Central

Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

2012-01-01

In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

Transcriptional Regulation in Ebola Virus: Effects of Gene Border Structure and Regulatory Elements on Gene Expression and Polymerase Scanning Behavior

PubMed Central

Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena

2015-01-01

ABSTRACT The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. IMPORTANCE Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set

Transcriptional Regulation in Ebola Virus: Effects of Gene Border Structure and Regulatory Elements on Gene Expression and Polymerase Scanning Behavior.

PubMed

Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke

2016-02-15

The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis

Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

EPA Science Inventory

Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology.

PubMed

D'Souza-Ticlo, Donna; Garg, Sandeep; Raghukumar, Chandralata

2009-11-25

The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159. Inducible laccases were produced in the idiophase only after addition of an inducer such as CuSO(4). Concentration of carbon and nitrogen acted antagonistically with respect to laccase production. A combination of low nitrogen and high carbon concentration favored both biomass and laccase production. The most favorable combination resulted in 917 U L(-1) of laccase. After sufficient growth had occurred, addition of a surfactant such as Tween 80 positively impacted biomass and increased the laccase activity to around 1,300 U L(-1). Increasing the surface to volume ratio of the culture vessel further increased its activity to almost 2,000 U L(-1).

Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.

PubMed

Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C

2015-01-01

MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice

Reference Genes for Accurate Transcript Normalization in Citrus Genotypes under Different Experimental Conditions

PubMed Central

Mafra, Valéria; Kubo, Karen S.; Alves-Ferreira, Marcio; Ribeiro-Alves, Marcelo; Stuart, Rodrigo M.; Boava, Leonardo P.; Rodrigues, Carolina M.; Machado, Marcos A.

2012-01-01

Real-time reverse transcription PCR (RT-qPCR) has emerged as an accurate and widely used technique for expression profiling of selected genes. However, obtaining reliable measurements depends on the selection of appropriate reference genes for gene expression normalization. The aim of this work was to assess the expression stability of 15 candidate genes to determine which set of reference genes is best suited for transcript normalization in citrus in different tissues and organs and leaves challenged with five pathogens (Alternaria alternata, Phytophthora parasitica, Xylella fastidiosa and Candidatus Liberibacter asiaticus). We tested traditional genes used for transcript normalization in citrus and orthologs of Arabidopsis thaliana genes described as superior reference genes based on transcriptome data. geNorm and NormFinder algorithms were used to find the best reference genes to normalize all samples and conditions tested. Additionally, each biotic stress was individually analyzed by geNorm. In general, FBOX (encoding a member of the F-box family) and GAPC2 (GAPDH) was the most stable candidate gene set assessed under the different conditions and subsets tested, while CYP (cyclophilin), TUB (tubulin) and CtP (cathepsin) were the least stably expressed genes found. Validation of the best suitable reference genes for normalizing the expression level of the WRKY70 transcription factor in leaves infected with Candidatus Liberibacter asiaticus showed that arbitrary use of reference genes without previous testing could lead to misinterpretation of data. Our results revealed FBOX, SAND (a SAND family protein), GAPC2 and UPL7 (ubiquitin protein ligase 7) to be superior reference genes, and we recommend their use in studies of gene expression in citrus species and relatives. This work constitutes the first systematic analysis for the selection of superior reference genes for transcript normalization in different citrus organs and under biotic stress. PMID:22347455

Internal control regions for transcription of eukaryotic tRNA genes.

PubMed Central

Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D

1981-01-01

We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245

Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean

NASA Astrophysics Data System (ADS)

Pedneault, Estelle; Galand, Pierre E.; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie

2014-04-01

Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean.

Alternative splicing of the tyrosinase gene transcript in normal human melanocytes and lymphocytes.

PubMed

Fryer, J P; Oetting, W S; Brott, M J; King, R A

2001-11-01

We have identified and isolated ectopically expressed tyrosinase transcripts in normal human melanocytes and lymphocytes and in a human melanoma (MNT-1) cell line to establish a baseline for the expression pattern of this gene in normal tissue. Tyrosinase mRNA from human lymphoblastoid cell lines was reverse transcribed and amplified using specific "nested" primers. This amplification yielded eight identifiable transcripts; five that resulted from alternative splicing patterns arising from the utilization of normal and alternative splice sequences. Identical splicing patterns were found in transcripts from human primary melanocytes in culture and a melanoma cell line, indicating that lymphoblastoid cell lines provide an accurate reflection of transcript processing in melanocytes. Similar splicing patterns have also been found with murine melanocyte tyrosinase transcripts. Our results demonstrate that alternative splicing of human tyrosinase gene transcript produces a number of predictable and identifiable transcripts, and that human lymphoblastoid cell lines provide a source of ectopically expressed transcripts that can be used to study the biology of tyrosinase gene expression in humans.

Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.

PubMed

Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong

2018-04-01

Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.

Sequential Logic Model Deciphers Dynamic Transcriptional Control of Gene Expressions

PubMed Central

Yeo, Zhen Xuan; Wong, Sum Thai; Arjunan, Satya Nanda Vel; Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar; Giuliani, Alessandro; Tsuchiya, Masa

2007-01-01

Background Cellular signaling involves a sequence of events from ligand binding to membrane receptors through transcription factors activation and the induction of mRNA expression. The transcriptional-regulatory system plays a pivotal role in the control of gene expression. A novel computational approach to the study of gene regulation circuits is presented here. Methodology Based on the concept of finite state machine, which provides a discrete view of gene regulation, a novel sequential logic model (SLM) is developed to decipher control mechanisms of dynamic transcriptional regulation of gene expressions. The SLM technique is also used to systematically analyze the dynamic function of transcriptional inputs, the dependency and cooperativity, such as synergy effect, among the binding sites with respect to when, how much and how fast the gene of interest is expressed. Principal Findings SLM is verified by a set of well studied expression data on endo16 of Strongylocentrotus purpuratus (sea urchin) during the embryonic midgut development. A dynamic regulatory mechanism for endo16 expression controlled by three binding sites, UI, R and Otx is identified and demonstrated to be consistent with experimental findings. Furthermore, we show that during transition from specification to differentiation in wild type endo16 expression profile, SLM reveals three binary activities are not sufficient to explain the transcriptional regulation of endo16 expression and additional activities of binding sites are required. Further analyses suggest detailed mechanism of R switch activity where indirect dependency occurs in between UI activity and R switch during specification to differentiation stage. Conclusions/Significance The sequential logic formalism allows for a simplification of regulation network dynamics going from a continuous to a discrete representation of gene activation in time. In effect our SLM is non-parametric and model-independent, yet providing rich biological

Middle-redox potential laccase from Ganoderma sp.: its application in improvement of feed for monogastric animals

PubMed Central

Sharma, Krishna Kant; Shrivastava, Bhuvnesh; Sastry, V. R. B.; Sehgal, Neeta; Kuhad, Ramesh Chander

2013-01-01

The variables influencing laccase production by white-rot fungus Ganoderma sp. rckk-02 were optimized employing response surface methodology. Malt extract (6.0% w/v), lignin (0.5% w/v) and pH (5.5) were found to be the most significant factors for enhanced laccase production by 7 fold (226.0 U/ml) as compared to unoptimized growth conditions (32.0 U/ml). The N-terminal sequence of laccase revealed its distinct amino acid profile (S- I- R- N- S- G), which suggested it as a novel enzyme. The Far-UV CD spectrum of the laccase showed single broad negative trough at around 213 nm, a typical signature of all β proteins. The laccase was found to fall in the range of middle redox potential laccases. Purified laccase at dosage of 2.5 Ug−1 body weight when supplemented with pelleted diet of rats, a significant improvement (p < 0.05) in nutrients digestibility without causing any elevation of blood stress enzymes was observed. PMID:23416696

Continuous adsorption and biotransformation of micropollutants by granular activated carbon-bound laccase in a packed-bed enzyme reactor.

PubMed

Nguyen, Luong N; Hai, Faisal I; Dosseto, Anthony; Richardson, Christopher; Price, William E; Nghiem, Long D

2016-06-01

Laccase was immobilized on granular activated carbon (GAC) and the resulting GAC-bound laccase was used to degrade four micropollutants in a packed-bed column. Compared to the free enzyme, the immobilized laccase showed high residual activities over a broad range of pH and temperature. The GAC-bound laccase efficiently removed four micropollutants, namely, sulfamethoxazole, carbamazepine, diclofenac and bisphenol A, commonly detected in raw wastewater and wastewater-impacted water sources. Mass balance analysis showed that these micropollutants were enzymatically degraded following adsorption onto GAC. Higher degradation efficiency of micropollutants by the immobilized compared to free laccase was possibly due to better electron transfer between laccase and substrate molecules once they have adsorbed onto the GAC surface. Results here highlight the complementary effects of adsorption and enzymatic degradation on micropollutant removal by GAC-bound laccase. Indeed laccase-immobilized GAC outperformed regular GAC during continuous operation of packed-bed columns over two months (a throughput of 12,000 bed volumes). Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcription factor clusters regulate genes in eukaryotic cells

PubMed Central

Hedlund, Erik G; Friemann, Rosmarie; Hohmann, Stefan

2017-01-01

Transcription is regulated through binding factors to gene promoters to activate or repress expression, however, the mechanisms by which factors find targets remain unclear. Using single-molecule fluorescence microscopy, we determined in vivo stoichiometry and spatiotemporal dynamics of a GFP tagged repressor, Mig1, from a paradigm signaling pathway of Saccharomyces cerevisiae. We find the repressor operates in clusters, which upon extracellular signal detection, translocate from the cytoplasm, bind to nuclear targets and turnover. Simulations of Mig1 configuration within a 3D yeast genome model combined with a promoter-specific, fluorescent translation reporter confirmed clusters are the functional unit of gene regulation. In vitro and structural analysis on reconstituted Mig1 suggests that clusters are stabilized by depletion forces between intrinsically disordered sequences. We observed similar clusters of a co-regulatory activator from a different pathway, supporting a generalized cluster model for transcription factors that reduces promoter search times through intersegment transfer while stabilizing gene expression. PMID:28841133

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus) Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

PubMed Central

Teixeira, Ricardo Sposina S.; Pereira, Patrícia Maia; Ferreira-Leitão, Viridiana S.

2010-01-01

Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR), Drimaren Blue X-BLN (DMBBLN), Drimaren Rubinol X-3LR (DMR), and Drimaren Blue C-R (RBBR). The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h) and RBBR (80–90%, 24 h) with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h) and DMBBLN (63–84%, 24 h). The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h. PMID:21052547

Electron beam-induced immobilization of laccase on porous supports for waste water treatment applications.

PubMed

Jahangiri, Elham; Reichelt, Senta; Thomas, Isabell; Hausmann, Kristin; Schlosser, Dietmar; Schulze, Agnes

2014-08-08

The versatile oxidase enzyme laccase was immobilized on porous supports such as polymer membranes and cryogels with a view of using such biocatalysts in bioreactors aiming at the degradation of environmental pollutants in wastewater. Besides a large surface area for supporting the biocatalyst, the aforementioned porous systems also offer the possibility for simultaneous filtration applications in wastewater treatment. Herein a "green" water-based, initiator-free, and straightforward route to highly reactive membrane and cryogel-based bioreactors is presented, where laccase was immobilized onto the porous polymer supports using a water-based electron beam-initiated grafting reaction. In a second approach, the laccase redox mediators 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and syringaldehyde were cross-linked instead of the enzyme via electron irradiation in a frozen aqueous poly(acrylate) mixture in a one pot set-up, yielding a mechanical stable macroporous cryogel with interconnected pores ranging from 10 to 50 µm in size. The membranes as well as the cryogels were characterized regarding their morphology, chemical composition, and catalytic activity. The reactivity towards waste- water pollutants was demonstrated by the degradation of the model compound bisphenol A (BPA). Both membrane- and cryogel-immobilized laccase remained highly active after electron beam irradiation. Apparent specific BPA removal rates were higher for cryogel- than for membrane-immobilized and free laccase, whereas membrane-immobilized laccase was more stable with respect to maintenance of enzymatic activity and prevention of enzyme leakage from the carrier than cryogel-immobilized laccase. Cryogel-immobilized redox mediators remained functional in accelerating the laccase-catalyzed BPA degradation, and especially ABTS was found to act more efficiently in immobilized than in freely dissolved state.

Immobilized laccase mediated dye decolorization and transformation pathway of azo dye acid red 27.

PubMed

Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

2015-01-01

Laccases have good potential as bioremediating agents and can be used continuously in the immobilized form like many other enzymes. In the present study, laccase from Cyathus bulleri was immobilized by entrapment in Poly Vinyl Alcohol (PVA) beads cross-linked with either nitrate or boric acid. Immobilized laccase was used for dye decolorization in both batch and continuous mode employing a packed bed column. The products of degradation of dye Acid Red 27 were identified by LC MS/MS analysis. The method led to very effective (90%) laccase immobilization and also imparted significant stability to the enzyme (more than 70% after 5 months of storage at 4°C). In batch decolorization, 90-95% decolorization was achieved of the simulated dye effluent for up to 10-20 cycles. Continuous decolorization in a packed bed bioreactor led to nearly 90% decolorization for up to 5 days. The immobilized laccase was also effective in decolorization and degradation of Acid Red 27 in the presence of a mediator. Four products of degradation were identified by LC-MS/MS analysis. The immobilized laccase in PVA-nitrate was concluded to be an effective agent in treatment of textile dye effluents.

Engineering synthetic TALE and CRISPR/Cas9 transcription factors for regulating gene expression.

PubMed

Kabadi, Ami M; Gersbach, Charles A

2014-09-01

Engineered DNA-binding proteins that can be targeted to specific sites in the genome to manipulate gene expression have enabled many advances in biomedical research. This includes generating tools to study fundamental aspects of gene regulation and the development of a new class of gene therapies that alter the expression of endogenous genes. Designed transcription factors have entered clinical trials for the treatment of human diseases and others are in preclinical development. High-throughput and user-friendly platforms for designing synthetic DNA-binding proteins present innovative methods for deciphering cell biology and designing custom synthetic gene circuits. We review two platforms for designing synthetic transcription factors for manipulating gene expression: Transcription activator-like effectors (TALEs) and the RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. We present an overview of each technology and a guide for designing and assembling custom TALE- and CRISPR/Cas9-based transcription factors. We also discuss characteristics of each platform that are best suited for different applications. Copyright © 2014 Elsevier Inc. All rights reserved.

Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

PubMed

Boyer, S K; Mullet, J E

1988-07-01

The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.

PubMed

Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu

2014-09-15

In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum μ(ap) was 2.7×10(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high α-helical content (68%). The MW of the purified EPS was determined to be 1.8×10(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). Copyright © 2014 Elsevier Ltd. All rights reserved.

Transcriptional interference networks coordinate the expression of functionally related genes clustered in the same genomic loci

PubMed Central

Boldogköi, Zsolt

2012-01-01

The regulation of gene expression is essential for normal functioning of biological systems in every form of life. Gene expression is primarily controlled at the level of transcription, especially at the phase of initiation. Non-coding RNAs are one of the major players at every level of genetic regulation, including the control of chromatin organization, transcription, various post-transcriptional processes, and translation. In this study, the Transcriptional Interference Network (TIN) hypothesis was put forward in an attempt to explain the global expression of antisense RNAs and the overall occurrence of tandem gene clusters in the genomes of various biological systems ranging from viruses to mammalian cells. The TIN hypothesis suggests the existence of a novel layer of genetic regulation, based on the interactions between the transcriptional machineries of neighboring genes at their overlapping regions, which are assumed to play a fundamental role in coordinating gene expression within a cluster of functionally linked genes. It is claimed that the transcriptional overlaps between adjacent genes are much more widespread in genomes than is thought today. The Waterfall model of the TIN hypothesis postulates a unidirectional effect of upstream genes on the transcription of downstream genes within a cluster of tandemly arrayed genes, while the Seesaw model proposes a mutual interdependence of gene expression between the oppositely oriented genes. The TIN represents an auto-regulatory system with an exquisitely timed and highly synchronized cascade of gene expression in functionally linked genes located in close physical proximity to each other. In this study, we focused on herpesviruses. The reason for this lies in the compressed nature of viral genes, which allows a tight regulation and an easier investigation of the transcriptional interactions between genes. However, I believe that the same or similar principles can be applied to cellular organisms too. PMID

Transcriptional interference networks coordinate the expression of functionally related genes clustered in the same genomic loci.

PubMed

Boldogköi, Zsolt

2012-01-01

The regulation of gene expression is essential for normal functioning of biological systems in every form of life. Gene expression is primarily controlled at the level of transcription, especially at the phase of initiation. Non-coding RNAs are one of the major players at every level of genetic regulation, including the control of chromatin organization, transcription, various post-transcriptional processes, and translation. In this study, the Transcriptional Interference Network (TIN) hypothesis was put forward in an attempt to explain the global expression of antisense RNAs and the overall occurrence of tandem gene clusters in the genomes of various biological systems ranging from viruses to mammalian cells. The TIN hypothesis suggests the existence of a novel layer of genetic regulation, based on the interactions between the transcriptional machineries of neighboring genes at their overlapping regions, which are assumed to play a fundamental role in coordinating gene expression within a cluster of functionally linked genes. It is claimed that the transcriptional overlaps between adjacent genes are much more widespread in genomes than is thought today. The Waterfall model of the TIN hypothesis postulates a unidirectional effect of upstream genes on the transcription of downstream genes within a cluster of tandemly arrayed genes, while the Seesaw model proposes a mutual interdependence of gene expression between the oppositely oriented genes. The TIN represents an auto-regulatory system with an exquisitely timed and highly synchronized cascade of gene expression in functionally linked genes located in close physical proximity to each other. In this study, we focused on herpesviruses. The reason for this lies in the compressed nature of viral genes, which allows a tight regulation and an easier investigation of the transcriptional interactions between genes. However, I believe that the same or similar principles can be applied to cellular organisms too.

Hyperforin activates gene transcription involving transient receptor potential C6 channels.

PubMed

Thiel, Gerald; Rössler, Oliver G

2017-04-01

Hypericum perforatum is one of the most prominent medical plants. Hyperforin, a main ingredient of H. perforatum, has been shown to activate transient receptor potential canonical C6 (TRPC6) channels. Alternatively, it has been proposed that hyperforin functions as a protonophore in a TRPC6-independent manner. Here, we show that hyperforin stimulation activates the transcription factor AP-1 in HEK293 cells expressing TRPC6 (T6.11 cells), but did not substantially change the AP-1 activity in HEK293 cells lacking TRPC6. We identified the AP-1 binding site as a hyperforin-responsive element. AP-1 is composed of the transcription factors c-Jun and c-Fos, or other members of the c-Jun and c-Fos families of proteins. Hyperforin stimulation increased c-Jun and c-Fos promoter activities in T6.11 cells and induced an upregulation of c-Jun and c-Fos biosynthesis. The analysis of the c-Fos promoter revealed that the cAMP-response element also functions as a hyperforin-responsive element. Hyperforin-induced upregulation of AP-1 in T6.11 cells was attenuated by preincubation of the cells with either pregnenolone or progesterone, indicating that gene regulation via TRPC6 is under control of hormones or hormonal precursors. The signal transduction of hyperforin-induced AP-1 gene transcription required an influx of Ca 2+ ions into the cells, the activation of MAP kinases, and the activation of the transcription factors c-Jun and ternary complex factor. We conclude that hyperforin regulates gene transcription via activation of TRPC6 channels, involving stimulus-regulated protein kinases and stimulus-responsive transcription factors. The fact that hyperforin regulates gene transcription may explain many of the intracellular alterations induced by this compound. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA context represents transcription regulation of the gene in mouse embryonic stem cells

NASA Astrophysics Data System (ADS)

Ha, Misook; Hong, Soondo

2016-04-01

Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

DNA context represents transcription regulation of the gene in mouse embryonic stem cells.

PubMed

Ha, Misook; Hong, Soondo

2016-04-14

Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

Evaluation of laccase-mediator system (LMS) in the oxidation of veratryl alcohol

USDA-ARS?s Scientific Manuscript database

Identifying suitable reaction conditions remains an important task in the development of enzyme catalysis. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially...

Cost analysis in laccase production.

PubMed

Osma, Johann F; Toca-Herrera, José L; Rodríguez-Couto, Susana

2011-11-01

In this paper the cost of producing the enzyme laccase by the white-rot fungus Trametes pubescens under both submerged (SmF) and solid-state fermentation (SSF) conditions was studied. The fungus was cultured using more than 45 culture medium compositions. The cost of production was estimated by analyzing the cost of the culture medium, the cost of equipment and the operating costs. The cost of the culture medium represented, in all cases, the highest contribution to the total cost, while, the cost of equipment was significantly low, representing less than 2% of the total costs. The cultivation under SSF conditions presented a final cost 50-fold lower than the one obtained when culturing under SmF conditions at flask scale. In addition, the laccase production under SSF conditions in tray bioreactors reduced the final cost 4-fold compared to the one obtained under SSF conditions at flask scale, obtaining a final price of 0.04 cent €/U. Copyright © 2011 Elsevier Ltd. All rights reserved.

Characterization of a novel laccase produced by the wood-rotting fungus Phellinus ribis.

PubMed

Min, K L; Kim, Y H; Kim, Y W; Jung, H S; Hah, Y C

2001-08-15

The white-rot fungus Phellinus ribis produced a single form of laccase, which was purified to apparent electrophoretic homogeneity from cultures induced with 2,5-xylidine. This protein was a dimer, consisting of two subunits of 76 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Carbohydrate analysis revealed that the enzyme contained about 28% carbohydrate content. The laccase appeared to be different from other known laccases by the UV-visible absorption spectrum analysis. One enzyme molecule contained one copper, one manganese, and two zinc atoms. The laccase showed optimal activity at pH 4.0-6.0, 5.0, and 6.0 with 2,6-dimethoxyphenol, ABTS [2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)], and syringaldazine, respectively. The enzyme preferably oxidized dimethoxyphenol and aromatic amine compounds. The stability of the laccase was low at acidic pH, whereas it showed high stability at neutral pH and mild temperature. The N-terminal amino acid sequence revealed a very low homology with other microbial laccases. With some substrates, the addition of manganese and H2O2 resulted in a remarkable increase in the oxidation rate. Without an appropriate phenolic substrate, the enzyme could not oxidize Mn(II) in the presence of H2O2 or pyrophosphate. Copyright 2001 Academic Press.

Reactivities of various mediators and laccases with kraft pulp and lignin model compounds.

PubMed

Bourbonnais, R; Paice, M G; Freiermuth, B; Bodie, E; Borneman, S

1997-12-01

Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification.

Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

PubMed Central

Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

2018-01-01

In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

Central metabolism controls transcription of a virulence gene regulator in Vibrio cholerae

PubMed Central

Minato, Yusuke; Fassio, Sara R.; Wolfe, Alan J.

2013-01-01

ToxT is the central regulatory protein involved in activation of the main virulence genes in Vibrio cholerae. We have identified transposon insertions in central metabolism genes, whose disruption increases toxT transcription. These disrupted genes encode the primary respiration-linked sodium pump (NADH : ubiquinone oxidoreductase or NQR) and certain tricarboxylic acid (TCA) cycle enzymes. Observations made following stimulation of respiration in the nqr mutant or chemical inhibition of NQR activity in the TCA cycle mutants led to the hypothesis that NQR affects toxT transcription via the TCA cycle. That toxT transcription increased when the growth medium was supplemented with citrate, but decreased with oxaloacetate, focused our attention on the TCA cycle substrate acetyl-CoA and its non-TCA cycle metabolism. Indeed, both the nqr and the TCA cycle mutants increased acetate excretion. A similar correlation between acetate excretion and toxT transcription was observed in a tolC mutant and upon amino acid (NRES) supplementation. As acetate and its tendency to decrease pH exerted no strong effect on toxT transcription, and because disruption of the major acetate excretion pathway increased toxT transcription, we propose that toxT transcription is regulated by either acetyl-CoA or some close derivative. PMID:23429745

Gene-specific changes in alpha-tubulin transcript accumulation in developing cotton fibers.

PubMed

Whittaker, D J; Triplett, B A

1999-09-01

The fibers of cotton (Gossypium hirsutum) are single-cell trichomes that undergo rapid and synchronous elongation. Cortical microtubules provide spatial information necessary for the alignment of cellulose microfibrils that confine and regulate cell elongation. We used gene-specific probes to investigate alpha-tubulin transcript levels in elongating cotton fibers. Two discrete patterns of transcript accumulation were observed. Whereas transcripts of alpha-tubulin genes GhTua2/3 and GhTua4 increased in abundance from 10 to 20 d post anthesis (DPA), GhTua1 and GhTua5 transcripts were abundant only through to 14 DPA, and dropped significantly at 16 DPA with the onset of secondary wall synthesis. This is the first report, to our knowledge, of gene-specific changes in tubulin transcript levels during the development of a terminally differentiated plant cell. The decrease in abundance of GhTua1 and GhTua5 transcripts was correlated with pronounced changes in cell wall structure, suggesting that alpha-tubulin isoforms may be functionally distinct in elongating fiber cells. Although total alpha-tubulin transcript levels were much higher in fiber than several other tissues, including the hypocotyl and pollen, none of the alpha-tubulins was specific to fiber cells.

Analysis of Ly49 gene transcripts in mature NK cells supports a role for the Pro1 element in gene activation, not gene expression.

PubMed

McCullen, M V; Li, H; Cam, M; Sen, S K; McVicar, D W; Anderson, S K

2016-09-01

The variegated expression of murine Ly49 loci has been associated with the probabilistic behavior of an upstream promoter active in immature cells, the Pro1 element. However, recent data suggest that Pro1 may be active in mature natural killer (NK) cells and function as an enhancer element. To assess directly if Pro1 transcripts are present in mature Ly49-expressing NK cells, RNA-sequencing of the total transcript pool was performed on freshly isolated splenic NK cells sorted for expression of either Ly49G or Ly49I. No Pro1 transcripts were detected from the Ly49a, Ly49c or Ly49i genes in mature Ly49(+) NK cells that contained high levels of Pro2 transcripts. Low levels of Ly49g Pro1 transcripts were found in both Ly49G(+) and Ly49G(-) populations, consistent with the presence of a small population of mature NK cells undergoing Ly49g gene activation, as previously demonstrated by culture of splenic NK cells in interleukin-2. Ly49 gene reporter constructs containing Pro1 failed to show any enhancer activity of Pro1 on Pro2 in a mature Ly49-expressing cell line. Taken together, the results are consistent with Pro1 transcription having a role in gene activation in developing NK, and argue against a role for Pro1 in Ly49 gene transcription by mature NK cells.

Suppression of Laccase 2 severely impairs cuticle tanning and pathogen resistance during the pupal metamorphosis of Anopheles sinensis (Diptera: Culicidae).

PubMed

Du, Ming-Hui; Yan, Zheng-Wen; Hao, You-Jin; Yan, Zhen-Tian; Si, Feng-Ling; Chen, Bin; Qiao, Liang

2017-04-04

Phenol oxidases (POs) catalyze the oxidation of dopa and dopamine to melanin, which is crucial for cuticle formation and innate immune maintenance in insects. Although, Laccase 2, a member of the PO family, has been reported to be a requirement for melanin-mediated cuticle tanning in the development stages of some insects, whether it participates in cuticle construction and other physiological processes during the metamorphosis of mosquito pupae is unclear. The association between the phenotype and the expression profile of Anopheles sinensis Laccase 2 (AsLac2) was assessed from pupation to adult eclosion. Individuals showing an expression deficiency of AsLac2 that was produced by RNAi and their phenotypic defects and physiological characterizations were compared in detail with the controls. During the dominant expression period, knockdown of AsLac2 in pupae caused the cuticle to be unpigmented, and produced thin and very soft cuticles, which further impeded the eclosion rate of adults as well as their fitness. Moreover, melanization immune responses in the pupae were sharply decreased, leading to poor resistance to microorganism infection. Both the high conservation among Laccase 2 homologs and a very similar genomic synteny of the neighborhood in Anopheles genus implies a conservative function in the pupal stage. To our knowledge, this is the first study to report the serious phenotypic defects in mosquito pupae caused by the dysfunction of Laccase 2. Our findings strongly suggest that Laccase 2 is crucial for Anopheles cuticle construction and melanization immune responses to pathogen infections during pupal metamorphosis. This irreplaceability provides valuable information on the application of Lacccase 2 and/or other key genes in the melanin metabolism pathway for developing mosquito control strategies.

Environmental conditions affect transcription of the pectinase genes of Erwinia chrysanthemi 3937.

PubMed Central

Hugouvieux-Cotte-Pattat, N; Dominguez, H; Robert-Baudouy, J

1992-01-01

To depolymerize plant pectin, the phytopathogenic enterobacterium Erwinia chrysanthemi produces a series of enzymes which include a pectin-methyl-esterase encoded by the pem gene and five isoenzymes of pectate lyases encoded by the five genes pelA, pelB, pelC, pelD, and pelE. We have constructed transcriptional fusions between the pectinase gene promoters and the uidA gene, encoding beta-glucuronidase, to study the regulation of these E. chrysanthemi pectinase genes individually. The transcription of the pectinase genes is dependent on many environmental conditions. All the fusions were induced by pectic catabolic products and responded, to different degrees, to growth phase, catabolite repression, temperature, and nitrogen starvation. Transcription of pelA, pelD, and pelE was also increased in anaerobic growth conditions. High osmolarity of the culture medium increased expression of pelE but decreased that of pelD; the other pectinase genes were not affected. The level of expression of each gene was different. Transcription of pelA was very low under all growth conditions. The expression of the pelB, pelC, and pem genes was intermediate. The pelE gene had a high basal level of expression. Expression of pelD was generally the most affected by changes in culture conditions and showed a low basal level but very high induced levels. These differences in the expression of the pectinase genes of E. chrysanthemi 3937 presumably reflect their role during infection of plants, because the degradation of pectic polymers of the plant cell walls is the main determinant of tissue maceration caused by soft rot erwiniae. PMID:1447147

Laccase produced by a thermotolerant strain of Trametes trogii LK13

PubMed Central

Yan, Jinping; Chen, Yuhui; Niu, Jiezhen; Chen, Daidi; Chagan, Irbis

2015-01-01

Thermophilic and thermotolerant micro-organisms strains have served as the natural source of industrially relevant and thermostable enzymes. Although some strains of the Trametes genus are thermotolerant, few Trametes strains were studied at the temperature above 30 °C until now. In this paper, the laccase activity and the mycelial growth rate for Trametes trogii LK13 are superior at 37 °C. Thermostability and organic cosolvent tolerance assays of the laccase produced at 37 °C indicated that the enzyme possessed fair thermostability with 50% of its initial activity at 80 °C for 5 min, and could remain 50% enzyme activity treated with organic cosolvent at the concentration range of 25%–50% (v/v). Furthermore, the test on production of laccase and lignocellulolytic enzymes showed the crude enzymes possessed high laccase level (1000 U g −1 ) along with low cellulose (2 U g −1 ) and xylanase (140 U g −1 ) activity. Thus, T. trogii LK13 is a potential strain to be applied in many biotechnological processes. PMID:26221089

Unraveling the effects of laccase treatment on enzymatic hydrolysis of steam-exploded wheat straw.

PubMed

Oliva-Taravilla, Alfredo; Moreno, Antonio D; Demuez, Marie; Ibarra, David; Tomás-Pejó, Elia; González-Fernández, Cristina; Ballesteros, Mercedes

2015-01-01

Laccase enzymes are promising detoxifying agents during lignocellulosic bioethanol production from wheat straw. However, they affect the enzymatic hydrolysis of this material by lowering the glucose recovery yields. This work aimed at explaining the negative effects of laccase on enzymatic hydrolysis. Relative glucose recovery in presence of laccase (10IU/g substrate) with model cellulosic substrate (Sigmacell) at 10% (w/v) was almost 10% points lower (P<0.01) than in the absence of laccase. This fact could be due to an increase in the competition of cellulose binding sites between the enzymes and a slight inhibition of β-glucosidase activity. However, enzymatic hydrolysis and infrared spectra of laccase-treated and untreated wheat straw filtered pretreated residue (WS-FPR), revealed that a grafting process of phenoxy radicals onto the lignin fiber could be the cause of diminished accessibility of cellulases to cellulose in pretreated wheat straw. Copyright © 2014 Elsevier Ltd. All rights reserved.

Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination

PubMed Central

Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

2009-01-01

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities

PubMed Central

Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.

2017-01-01

Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552

An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp.

PubMed

Fang, Fang; Zhang, Xue-lian; Luo, Hong-hui; Zhou, Jia-jian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi; Pang, Xue-qun

2015-12-01

In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. © 2015 American Society of Plant Biologists. All Rights Reserved.

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

PubMed Central

2010-01-01

Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

PubMed

Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

2010-06-09

Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be

Structural and transcriptional analysis of plant genes encoding the bifunctional lysine ketoglutarate reductase saccharopine dehydrogenase enzyme.

PubMed

Anderson, Olin D; Coleman-Derr, Devin; Gu, Yong Q; Heath, Sekou

2010-06-16

Among the dietary essential amino acids, the most severely limiting in the cereals is lysine. Since cereals make up half of the human diet, lysine limitation has quality/nutritional consequences. The breakdown of lysine is controlled mainly by the catabolic bifunctional enzyme lysine ketoglutarate reductase - saccharopine dehydrogenase (LKR/SDH). The LKR/SDH gene has been reported to produce transcripts for the bifunctional enzyme and separate monofunctional transcripts. In addition to lysine metabolism, this gene has been implicated in a number of metabolic and developmental pathways, which along with its production of multiple transcript types and complex exon/intron structure suggest an important node in plant metabolism. Understanding more about the LKR/SDH gene is thus interesting both from applied standpoint and for basic plant metabolism. The current report describes a wheat genomic fragment containing an LKR/SDH gene and adjacent genes. The wheat LKR/SDH genomic segment was found to originate from the A-genome of wheat, and EST analysis indicates all three LKR/SDH genes in hexaploid wheat are transcriptionally active. A comparison of a set of plant LKR/SDH genes suggests regions of greater sequence conservation likely related to critical enzymatic functions and metabolic controls. Although most plants contain only a single LKR/SDH gene per genome, poplar contains at least two functional bifunctional genes in addition to a monofunctional LKR gene. Analysis of ESTs finds evidence for monofunctional LKR transcripts in switchgrass, and monofunctional SDH transcripts in wheat, Brachypodium, and poplar. The analysis of a wheat LKR/SDH gene and comparative structural and functional analyses among available plant genes provides new information on this important gene. Both the structure of the LKR/SDH gene and the immediately adjacent genes show lineage-specific differences between monocots and dicots, and findings suggest variation in activity of LKR/SDH genes

Degradation of phenanthrene by Trametes versicolor and its laccase.

PubMed

Han, Mun-Jung; Choi, Hyoung-Tae; Song, Hong-Gyu

2004-06-01

Phenanthrene is a three-ring polycyclic aromatic hydrocarbon and commonly found as a pollutant in various environments. Degradation of phenanthrene by white rot fungus Trametes versicolor 951022 and its laccase, isolated in Korea, was investigated. After 36 h of incubation, about 46% and 65% of 100 mg/l of phenanthrene added in shaken and static fungal cultures were removed, respectively. Phenanthrene degradation was maximal at pH 6 and the optimal temperature for phenanthrene removal was 30 degrees C. Although the removal percentage of phenanthrene was highest (76.7%) at 10 mg/l of phenanthrene concentration, the transformation rate was maximal (0.82 mg/h) at 100 mg/L of phenanthrene concentration in the fungal culture. When the purified laccase of T versicolor 951022 reacted with phenanthrene, phenanthrene was not transformed. The addition of redox mediator, 2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) or 1-hydroxybenzotriazole (HBT) to the reaction mixture increased oxidation of phenanthrene by laccase about 40% and 30%, respectively.

Functional analysis of a WRKY transcription factor involved in transcriptional activation of the DBAT gene in Taxus chinensis.

PubMed

Li, S; Zhang, P; Zhang, M; Fu, C; Yu, L

2013-01-01

Although the regulation of taxol biosynthesis at the transcriptional level remains unclear, 10-deacetylbaccatin III-10 β-O-acetyl transferase (DBAT) is a critical enzyme in the biosynthesis of taxol. The 1740 bp fragment 5'-flanking sequence of the dbat gene was cloned from Taxus chinensis cells. Important regulatory elements needed for activity of the dbat promoter were located by deletion analyses in T. chinensis cells. A novel WRKY transcription factor, TcWRKY1, was isolated with the yeast one-hybrid system from a T. chinensis cell cDNA library using the important regulatory elements as bait. The gene expression of TcWRKY1 in T. chinensis suspension cells was specifically induced by methyl jasmonate (MeJA). Biochemical analysis indicated that TcWRKY1 protein specifically interacts with the two W-box (TGAC) cis-elements among the important regulatory elements. Overexpression of TcWRKY1 enhanced dbat expression in T. chinensis suspension cells, and RNA interference (RNAi) reduced the level of transcripts of dbat. These results suggest that TcWRKY1 participates in regulation of taxol biosynthesis in T. chinensis cells, and that dbat is a target gene of this transcription factor. This research also provides a potential candidate gene for engineering increased taxol accumulation in Taxus cell cultures. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

Gel-Based Purification and Biochemical Study of Laccase Isozymes from Ganoderma sp. and Its Role in Enhanced Cotton Callogenesis

PubMed Central

Kumar, Amit; Singh, Deepti; Sharma, Krishna K.; Arora, Sakshi; Singh, Amarjeet K.; Gill, Sarvajeet S.; Singhal, Barkha

2017-01-01

Basidiomycetous fungi, Ganoderma lucidum MDU-7 and Ganoderma sp. kk-02 secreted multiple laccase isozymes under diverse growth condition. Aromatic compounds and metal salts were also found to regulate the differential expression of laccase isozymes from both the Ganoderma sp. Laccase isozymes induced in the presence of copper from G. lucidum MDU-7 were purified by gel-based (native-PAGE) purification method. The purity of laccase isozymes was checked by zymogram and SDS-PAGE. The SDS-PAGE of purified proteins confirmed the multimeric nature of laccase isozymes. The molecular mass of isozymes was found to be in the range of 40–66 kDa. Further, the purified laccase isozymes and their peptides were confirmed with the help of MALDI-TOF peptide fingerprinting. The biochemical characterization of laccase isozymes viz. Glac L2, Glac L3, Glac L4, and Glac L5 have shown the optimum temperature in the range of 30°–45°C and pH 3.0. The Km values of all the laccase isozymes determined for guaiacol were (96–281 μM), ABTS (15–83 μM) and O-tolidine (78–724 μM). Further, laccase isozymes from G. lucidum whole genome were studied using bioinformatics tools. The molecular modeling and docking of laccase isozymes with different substrates showed a significant binding affinity, which further validates our experimental results. Interestingly, copper induced laccase of 40 U/ml in culture medium was found to significantly induce cotton callogenesis. Interestingly, all the laccase isozymes were found to have an antioxidative role and therefore capable in free radicals scavenging during callogenesis. This is the first detailed study on the biochemical characterization of all the laccase isozymes purified by a gel-based novel method. PMID:28473815

Laccase isoenzymes of Pleurotus eryngii: characterization, catalytic properties, and participation in activation of molecular oxygen and Mn2+ oxidation.

PubMed Central

Muñoz, C; Guillén, F; Martínez, A T; Martínez, M J

1997-01-01

Two laccase isoenzymes produced by Pleurotus eryngii were purified to electrophoretic homogeneity (42- and 43-fold) with an overall yield of 56.3%. Laccases I and II from this fungus are monomeric glycoproteins with 7 and 1% carbohydrate content, molecular masses (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 65 and 61 kDa, and pIs of 4.1 and 4.2, respectively. The highest rate of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) oxidation for laccase I was reached at 65 degrees C and pH 4, and that for laccase II was reached at 55 degrees C and pH 3.5. Both isoenzymes are stable at high pH, retaining 60 to 70% activity after 24 h from pH 8 to 12. Their amino acid compositions and N-terminal sequences were determined, the latter strongly differing from those of laccases of other basidiomycetes. Antibodies against laccase I reacted with laccase II, as well as with laccases from Pleurotus ostreatus, Pleurotus pulmonarius, and Pleurotus floridanus. Different hydroxy- and methoxy-substituted phenols and aromatic amines were oxidized by the two laccase isoenzymes from P. eryngii, and the influence of the nature, number, and disposition of aromatic-ring substituents on kinetic constants is discussed. Although both isoenzymes presented similar substrate affinities, the maximum rates of reactions catalyzed by laccase I were higher than those of laccase II. In reactions with hydroquinones, semiquinones produced by laccase isoenzymes were in part converted into quinones via autoxidation. The superoxide anion radical produced in the latter reaction dismutated, producing hydrogen peroxide. In the presence of manganous ion, the superoxide union was reduced to hydrogen peroxide with the concomitant production of manganic ion. These results confirmed that laccase in the presence of hydroquinones can participate in the production of both reduced oxygen species and manganic ions. PMID:9172335

Production of laccase by Pynoporus sanguineus using 2,5 - Xylidine and ethanol

PubMed Central

Valeriano, Viviane S.; Silva, Anna Maria F.; Santiago, Mariângela F.; Bara, Maria T. F.; Garcia, Telma A.

2009-01-01

Enzyme application in biotechnological and environmental processes has had increasing interest due to its efficiency, selectivity and mainly for being environmentally healthful, but these applications require a great volume of enzymes. In this work the effect of different concentrations of ethanol and 2,5-xylidine on growth and production of laccase by Pycnoporus sanguineus was investigated. In a medium containing 200 mg.L-1 of 2,5-xylidine or 50 g.L-1 of ethanol, the maximum activity of laccase was 2019 U.L-1 and 1035 U.L-1, respectively. No direct correlation between biomass and activity of laccase was observed for any of the inducers used during the tests. Ethanol concentrations, larger than or equal to 20 g.L-1, inhibited the radial growth of P. sanguineus. This study showed that ethanol, which has less toxicity and cost than the majority of the studied inducers, presents promising perspectives for laccase production by P. sanguineus. PMID:24031426

Zinc-dependent global transcriptional control, transcriptional deregulation, and higher gene copy number for genes in metal homeostasis of the hyperaccumulator Arabidopsis halleri.

PubMed

Talke, Ina N; Hanikenne, Marc; Krämer, Ute

2006-09-01

The metal hyperaccumulator Arabidopsis halleri exhibits naturally selected zinc (Zn) and cadmium (Cd) hypertolerance and accumulates extraordinarily high Zn concentrations in its leaves. With these extreme physiological traits, A. halleri phylogenetically belongs to the sister clade of Arabidopsis thaliana. Using a combination of genome-wide cross species microarray analysis and real-time reverse transcription-PCR, a set of candidate genes is identified for Zn hyperaccumulation, Zn and Cd hypertolerance, and the adjustment of micronutrient homeostasis in A. halleri. Eighteen putative metal homeostasis genes are newly identified to be more highly expressed in A. halleri than in A. thaliana, and 11 previously identified candidate genes are confirmed. The encoded proteins include HMA4, known to contribute to root-shoot transport of Zn in A. thaliana. Expression of either AtHMA4 or AhHMA4 confers cellular Zn and Cd tolerance to yeast (Saccharomyces cerevisiae). Among further newly implicated proteins are IRT3 and ZIP10, which have been proposed to contribute to cytoplasmic Zn influx, and FRD3 required for iron partitioning in A. thaliana. In A. halleri, the presence of more than a single genomic copy is a hallmark of several highly expressed candidate genes with possible roles in metal hyperaccumulation and metal hypertolerance. Both A. halleri and A. thaliana exert tight regulatory control over Zn homeostasis at the transcript level. Zn hyperaccumulation in A. halleri involves enhanced partitioning of Zn from roots into shoots. The transcriptional regulation of marker genes suggests that in the steady state, A. halleri roots, but not the shoots, act as physiologically Zn deficient under conditions of moderate Zn supply.

Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity

PubMed Central

Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

2014-01-01

Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp1[OPEN

PubMed Central

Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi

2015-01-01

In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

Integrating Gene Transcription-Based Biomarkers to Understand Desert Tortoise and Ecosystem Health.

PubMed

Bowen, Lizabeth; Miles, A Keith; Drake, K Kristina; Waters, Shannon C; Esque, Todd C; Nussear, Kenneth E

2015-09-01

Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal's habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcription C T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.

Regulation of gene transcription by Polycomb proteins

PubMed Central

Aranda, Sergi; Mas, Gloria; Di Croce, Luciano

2015-01-01

The Polycomb group (PcG) of proteins defines a subset of factors that physically associate and function to maintain the positional identity of cells from the embryo to adult stages. PcG has long been considered a paradigmatic model for epigenetic maintenance of gene transcription programs. Despite intensive research efforts to unveil the molecular mechanisms of action of PcG proteins, several fundamental questions remain unresolved: How many different PcG complexes exist in mammalian cells? How are PcG complexes targeted to specific loci? How does PcG regulate transcription? In this review, we discuss the diversity of PcG complexes in mammalian cells, examine newly identified modes of recruitment to chromatin, and highlight the latest insights into the molecular mechanisms underlying the function of PcGs in transcription regulation and three-dimensional chromatin conformation. PMID:26665172

Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

PubMed

Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

2015-02-01

Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription.

PubMed

Stavreva, Diana A; Wiench, Malgorzata; John, Sam; Conway-Campbell, Becky L; McKenna, Mervyn A; Pooley, John R; Johnson, Thomas A; Voss, Ty C; Lightman, Stafford L; Hager, Gordon L

2009-09-01

Studies on glucocorticoid receptor (GR) action typically assess gene responses by long-term stimulation with synthetic hormones. As corticosteroids are released from adrenal glands in a circadian and high-frequency (ultradian) mode, such treatments may not provide an accurate assessment of physiological hormone action. Here we demonstrate that ultradian hormone stimulation induces cyclic GR-mediated transcriptional regulation, or gene pulsing, both in cultured cells and in animal models. Equilibrium receptor-occupancy of regulatory elements precisely tracks the ligand pulses. Nascent RNA transcripts from GR-regulated genes are released in distinct quanta, demonstrating a profound difference between the transcriptional programs induced by ultradian and constant stimulation. Gene pulsing is driven by rapid GR exchange with response elements and by GR recycling through the chaperone machinery, which promotes GR activation and reactivation in response to the ultradian hormone release, thus coupling promoter activity to the naturally occurring fluctuations in hormone levels. The GR signalling pathway has been optimized for a prompt and timely response to fluctuations in hormone levels, indicating that biologically accurate regulation of gene targets by GR requires an ultradian mode of hormone stimulation.

Reactivities of Various Mediators and Laccases with Kraft Pulp and Lignin Model Compounds

PubMed Central

Bourbonnais, R.; Paice, M. G.; Freiermuth, B.; Bodie, E.; Borneman, S.

1997-01-01

Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification. PMID:16535747

Transcription factor REST negatively influences the protein kinase C-dependent up-regulation of human mu-opioid receptor gene transcription.

PubMed

Bedini, Andrea; Baiula, Monica; Carbonari, Gioia; Spampinato, Santi

2010-01-01

Mu-opioid receptor expression increases during neurogenesis, regulates the survival of maturing neurons and is implicated in ischemia-induced neuronal death. The repressor element 1 silencing transcription factor (REST), a regulator of a subset of genes in differentiating and post-mitotic neurons, is involved in its transcriptional repression. Extracellular signaling molecules and mechanisms that control the human mu-opioid receptor (hMOR) gene transcription are not clearly understood. We examined the role of protein kinase C (PKC) on hMOR transcription in a model of neuronal cells and in the context of the potential influence of REST. In native SH-SY5Y neuroblastoma cells, PKC activation with phorbol 12-myristate 13-acetate (PMA, 16 nM, 24h) down-regulated hMOR transcription and concomitantly elevated the REST binding activity to repressor element 1 of the hMOR promoter. In contrast, PMA activated hMOR gene transcription when REST expression was knocked down by an antisense strategy or by retinoic acid-induced cell differentiation. PMA acts through a PKC-dependent pathway requiring downstream MAP kinases and the transcription factor AP-1. In a series of hMOR-luciferase promoter/reporter constructs transfected into SH-SY5Y cells and PC12 cells, PMA up-regulated hMOR transcription in PC12 cells lacking REST, and in SH-SY5Y cells either transfected with constructs deficient in the REST DNA binding element or when REST was down-regulated in retinoic acid-differentiated cells. These findings help explain how hMOR transcription is regulated and may clarify its contribution to epigenetic modifications and reprogramming of differentiated neuronal cells exposed to PKC-activating agents. Copyright 2009 Elsevier Ltd. All rights reserved.

VITELLOGENIN GENE TRANSCRIPTION: A RELATIVE QUANTITATIVE EXPOSURE INDICATOR OF ENVIRONMENTAL ESTROGENS

EPA Science Inventory

We report the development of a quantifiable exposure indicator for measuring the presence of environmental estrogens in aquatic systems. Synthetic oligonucleotides, designed specifically for the vitellogenin gene (Vg) transcription product, were used in a Reverse Transcription Po...

Nonproteolytic Roles of 19S ATPases in Transcription of CIITApIV Genes

PubMed Central

Maganti, Nagini; Moody, Tomika D.; Truax, Agnieszka D.; Thakkar, Meghna; Spring, Alexander M.; Germann, Markus W.; Greer, Susanna F.

2014-01-01

Accumulating evidence shows the 26S proteasome is involved in the regulation of gene expression. We and others have demonstrated that proteasome components bind to sites of gene transcription, regulate covalent modifications to histones, and are involved in the assembly of activator complexes in mammalian cells. The mechanisms by which the proteasome influences transcription remain unclear, although prior observations suggest both proteolytic and non-proteolytic activities. Here, we define novel, non-proteolytic, roles for each of the three 19S heterodimers, represented by the 19S ATPases Sug1, S7, and S6a, in mammalian gene expression using the inflammatory gene CIITApIV. These 19S ATPases are recruited to induced CIITApIV promoters and also associate with CIITA coding regions. Additionally, these ATPases interact with elongation factor PTEFb complex members CDK9 and Hexim-1 and with Ser5 phosphorylated RNA Pol II. Both the generation of transcripts from CIITApIV and efficient recruitment of RNA Pol II to CIITApIV are negatively impacted by siRNA mediated knockdown of these 19S ATPases. Together, these results define novel roles for 19S ATPases in mammalian gene expression and indicate roles for these ATPases in promoting transcription processes. PMID:24625964

The context of transcription start site regions is crucial for transcription of a plant tRNA(Lys)(UUU) gene group both in vitro and in vivo.

PubMed

Yukawa, Yasushi; Akama, Kazuhito; Noguchi, Kanta; Komiya, Masaaki; Sugiura, Masahiro

2013-01-10

Nuclear tRNA genes are transcribed by RNA polymerase III. The A- and B-boxes located within the transcribed regions are essential promoter elements for nuclear tRNA gene transcription. The Arabidopsis genome contains ten annotated genes encoding identical tRNA(Lys)(UUU) molecules, which are scattered on the five chromosomes. In this study, we prepared ten tDNA constructs including each of the tRNA(Lys)(UUU) coding sequences with their individual 5' and 3' flanking sequences, and assayed tRNA expression using an in vitro RNA polymerase III-dependent transcription system. Transcription levels differed significantly among the ten genes and two of the tRNA genes were transcribed at a very low level, despite possessing A- and B-boxes identical to those of the other tRNA genes. To examine whether the in vitro results were reproducible in vivo, the 5' flanking sequence of an amber suppressor tRNA gene was then replaced with those of the ten tRNA(Lys) genes. An in vivo experiment based on an amber suppressor tRNA that mediates suppression of a premature amber codon in a β-glucuronidase (GUS) reporter gene in plant tissues generated nearly identical results to those obtained in vitro. Analysis of mutated versions of the amber suppressor tRNA gene, which contained base substitutions around the transcription start site (TSS), showed that the context around the transcription start sites is a crucial determinant for transcription of plant tRNA(Lys)(UUU) both in vitro and in vivo. The above transcription regulation by context around TSS differed between tRNA genes and other Pol III-dependent genes. Copyright © 2012 Elsevier B.V. All rights reserved.

Diversity of Ligninolytic Enzymes and Their Genes in Strains of the Genus Ganoderma: Applicable for Biodegradation of Xenobiotic Compounds?

PubMed Central

Torres-Farradá, Giselle; Manzano León, Ana M.; Rineau, François; Ledo Alonso, Lucía L.; Sánchez-López, María I.; Thijs, Sofie; Colpaert, Jan; Ramos-Leal, Miguel; Guerra, Gilda; Vangronsveld, Jaco

2017-01-01

White-rot fungi (WRF) and their ligninolytic enzymes (laccases and peroxidases) are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba). All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR)-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains. PMID:28588565

Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

PubMed

Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

2016-06-01

Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.

Distinct modes of gene regulation by a cell-specific transcriptional activator.

PubMed

Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J

2009-03-17

The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.

Laccase modification of the physical properties of bark and pulp of loblolly pine and spruce pulp

Treesearch

William Kenealy; John Klungness; Mandla Tshabalala; Eric Horn; Masood Akhtar; Roland Gleisner; Gisela Buschle-Diller

2004-01-01

Pine bark, pine pulp, and spruce pulp were reacted with laccase in the presence of phenolic laccase substrates to modify the fiber surface properties. The acid-base and dispersive characteristics of these modified steam-treated thermomechanical loblolly pine pulps were determined by inverse gas chromatography. Different combinations of substrates with laccase modified...

Neurotoxocarosis alters myelin protein gene transcription and expression.

PubMed

Heuer, Lea; Beyerbach, Martin; Lühder, Fred; Beineke, Andreas; Strube, Christina

2015-06-01

Neurotoxocarosis is an infection of the central nervous system caused by migrating larvae of the common dog and cat roundworms (Toxocara canis and Toxocara cati), which are zoonotic agents. As these parasites are prevalent worldwide and neuropathological and molecular investigations on neurotoxocarosis are scare, this study aims to characterise nerve fibre demyelination associated with neurotoxocarosis on a molecular level. Transcription of eight myelin-associated genes (Cnp, Mag, Mbp, Mog, Mrf-1, Nogo-A, Plp1, Olig2) was determined in the mouse model during six time points of the chronic phase of infection using qRT-PCR. Expression of selected proteins was analysed by Western blotting or immunohistochemistry. Additionally, demyelination and neuronal damage were investigated histologically. Significant differences (p ≤ 0.05) between transcription rates of T. canis-infected and uninfected control mice were detected for all analysed genes while T. cati affected five of eight investigated genes. Interestingly, 2', 3 ´-cyclic nucleotide 3'-phosphodiesterase (Cnp) and myelin oligodendrocyte glycoprotein (Mog) were upregulated in both T. canis- and T. cati-infected mice preceding demyelination. Later, CNPase expression was additionally enhanced. As expected, myelin basic protein (Mbp) was downregulated in cerebra and cerebella of T. canis-infected mice when severe demyelination was present 120 days post infectionem (dpi). The transcriptional pattern observed in the present study appears to reflect direct traumatic and hypoxic effects of larval migration as well as secondary processes including host immune reactions, demyelination and attempts to remyelinate damaged areas.

Divergent transcription is associated with promoters of transcriptional regulators

PubMed Central

2013-01-01

Background Divergent transcription is a wide-spread phenomenon in mammals. For instance, short bidirectional transcripts are a hallmark of active promoters, while longer transcripts can be detected antisense from active genes in conditions where the RNA degradation machinery is inhibited. Moreover, many described long non-coding RNAs (lncRNAs) are transcribed antisense from coding gene promoters. However, the general significance of divergent lncRNA/mRNA gene pair transcription is still poorly understood. Here, we used strand-specific RNA-seq with high sequencing depth to thoroughly identify antisense transcripts from coding gene promoters in primary mouse tissues. Results We found that a substantial fraction of coding-gene promoters sustain divergent transcription of long non-coding RNA (lncRNA)/mRNA gene pairs. Strikingly, upstream antisense transcription is significantly associated with genes related to transcriptional regulation and development. Their promoters share several characteristics with those of transcriptional developmental genes, including very large CpG islands, high degree of conservation and epigenetic regulation in ES cells. In-depth analysis revealed a unique GC skew profile at these promoter regions, while the associated coding genes were found to have large first exons, two genomic features that might enforce bidirectional transcription. Finally, genes associated with antisense transcription harbor specific H3K79me2 epigenetic marking and RNA polymerase II enrichment profiles linked to an intensified rate of early transcriptional elongation. Conclusions We concluded that promoters of a class of transcription regulators are characterized by a specialized transcriptional control mechanism, which is directly coupled to relaxed bidirectional transcription. PMID:24365181

Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

PubMed Central

Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

2016-01-01

In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

PubMed

Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

2016-01-01

In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

A chloride tolerant laccase from the plant pathogen ascomycete Botrytis aclada expressed at high levels in Pichia pastoris.

PubMed

Kittl, Roman; Mueangtoom, Kitti; Gonaus, Christoph; Khazaneh, Shima Tahvilda; Sygmund, Christoph; Haltrich, Dietmar; Ludwig, Roland

2012-01-20

Fungal laccases from basidiomycetous fungi are thoroughly investigated in respect of catalytic mechanism and industrial applications, but the number of reported and well characterized ascomycetous laccases is much smaller although they exhibit interesting catalytic properties. We report on a highly chloride tolerant laccase produced by the plant pathogen ascomycete Botrytis aclada, which was recombinantly expressed in Pichia pastoris with an extremely high yield and purified to homogeneity. In a fed-batch fermentation, 495 mg L(-1) of laccase was measured in the medium, which is the highest concentration obtained for a laccase by a yeast expression system. The recombinant B. aclada laccase has a typical molecular mass of 61,565 Da for the amino acid chain. The pI is approximately 2.4, a very low value for a laccase. Glycosyl residues attached to the recombinant protein make up for approximately 27% of the total protein mass. B. aclada laccase exhibits very low K(M) values and high substrate turnover numbers for phenolic and non-phenolic substrates at acidic and near neutral pH. The enzyme's stability increases in the presence of chloride ions and, even more important, its substrate turnover is only weakly inhibited by chloride ions (I(50)=1.4M), which is in sharp contrast to most other described laccases. This high chloride tolerance is mandatory for some applications such as implantable biofuel cells and laccase catalyzed reactions, which suffer from the presence of chloride ions. The high expression yield permits fast and easy production for further basic and applied research. Copyright © 2011 Elsevier B.V. All rights reserved.

Conservation of Transcription Start Sites within Genes across a Bacterial Genus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.

Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less

Structure of the 5' region of the Hst70 gene transcription unit: presence of an intron and multiple transcription initiation sites.

PubMed Central

Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z

2001-01-01

The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976

Changes in transcriptional orientation are associated with increases in evolutionary rates of enterobacterial genes.

PubMed

Lin, Chieh-Hua; Lian, Chun-Yi; Hsiung, Chao Agnes; Chen, Feng-Chi

2011-10-05

Changes in transcriptional orientation ("CTOs") occur frequently in prokaryotic genomes. Such changes usually result from genomic inversions, which may cause a conflict between the directions of replication and transcription and an increase in mutation rate. However, CTOs do not always lead to the replication-transcription confrontation. Furthermore, CTOs may cause deleterious disruptions of operon structure and/or gene regulations. The currently existing CTOs may indicate relaxation of selection pressure. Therefore, it is of interest to investigate whether CTOs have an independent effect on the evolutionary rates of the affected genes, and whether these genes are subject to any type of selection pressure in prokaryotes. Three closely related enterbacteria, Escherichia coli, Klebsiella pneumoniae and Salmonella enterica serovar Typhimurium, were selected for comparisons of synonymous (dS) and nonsynonymous (dN) substitution rate between the genes that have experienced changes in transcriptional orientation (changed-orientation genes, "COGs") and those that do not (same-orientation genes, "SOGs"). The dN/dS ratio was also derived to evaluate the selection pressure on the analyzed genes. Confounding factors in the estimation of evolutionary rates, such as gene essentiality, gene expression level, replication-transcription confrontation, and decreased dS at gene terminals were controlled in the COG-SOG comparisons. We demonstrate that COGs have significantly higher dN and dS than SOGs when a series of confounding factors are controlled. However, the dN/dS ratios are similar between the two gene groups, suggesting that the increase in dS can sufficiently explain the increase in dN in COGs. Therefore, the increases in evolutionary rates in COGs may be mainly mutation-driven. Here we show that CTOs can increase the evolutionary rates of the affected genes. This effect is independent of the replication-transcription confrontation, which is suggested to be the major cause

Changes in transcriptional orientation are associated with increases in evolutionary rates of enterobacterial genes

PubMed Central

2011-01-01

Background Changes in transcriptional orientation (“CTOs”) occur frequently in prokaryotic genomes. Such changes usually result from genomic inversions, which may cause a conflict between the directions of replication and transcription and an increase in mutation rate. However, CTOs do not always lead to the replication-transcription confrontation. Furthermore, CTOs may cause deleterious disruptions of operon structure and/or gene regulations. The currently existing CTOs may indicate relaxation of selection pressure. Therefore, it is of interest to investigate whether CTOs have an independent effect on the evolutionary rates of the affected genes, and whether these genes are subject to any type of selection pressure in prokaryotes. Methods Three closely related enterbacteria, Escherichia coli, Klebsiella pneumoniae and Salmonella enterica serovar Typhimurium, were selected for comparisons of synonymous (dS) and nonsynonymous (dN) substitution rate between the genes that have experienced changes in transcriptional orientation (changed-orientation genes, “COGs”) and those that do not (same-orientation genes, “SOGs”). The dN/dS ratio was also derived to evaluate the selection pressure on the analyzed genes. Confounding factors in the estimation of evolutionary rates, such as gene essentiality, gene expression level, replication-transcription confrontation, and decreased dS at gene terminals were controlled in the COG-SOG comparisons. Results We demonstrate that COGs have significantly higher dN and dS than SOGs when a series of confounding factors are controlled. However, the dN/dS ratios are similar between the two gene groups, suggesting that the increase in dS can sufficiently explain the increase in dN in COGs. Therefore, the increases in evolutionary rates in COGs may be mainly mutation-driven. Conclusions Here we show that CTOs can increase the evolutionary rates of the affected genes. This effect is independent of the replication-transcription

Immobilization of laccase on a novel ZnO/SiO2 nano-composited support for dye decolorization

NASA Astrophysics Data System (ADS)

Li, Wei-Xun; Sun, Huai-Yan; Zhang, Rui-Feng

2015-07-01

ZnO nanowires were introduced into macroporous SiO2 by means of in situ hydrothermal growth. The obtained nano-composite was then used to immobilize laccase (secured from Trametes versicolor) through the process of static adsorption. The average loading amount was as high as 193.4 μmol-g-1. The immobilized laccase was proven to be an effective biocatalyst in the decolorization of two dyes: Remazol Brilliant Blue B, and Acid Blue 25. The decolorization percentage of Remazol Brilliant Blue B and Acid Blue 25 reached 93% and 82% respectively. The immobilized laccase exhibited enhanced thermal stability and pH adaptability compared to free laccase. After ten recycles, the immobilized laccase retained 42% decolorization catalytic activity.

Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri.

PubMed

Dhawan, Shikha; Kuhad, Ramesh Chander

2002-08-01

Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production.

Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor.

PubMed Central

Kroes, R A; Abravaya, K; Seidenfeld, J; Morimoto, R I

1991-01-01

Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or beta-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes. Images PMID:2052560

Improved methods and resources for paramecium genomics: transcription units, gene annotation and gene expression.

PubMed

Arnaiz, Olivier; Van Dijk, Erwin; Bétermier, Mireille; Lhuillier-Akakpo, Maoussi; de Vanssay, Augustin; Duharcourt, Sandra; Sallet, Erika; Gouzy, Jérôme; Sperling, Linda

2017-06-26

The 15 sibling species of the Paramecium aurelia cryptic species complex emerged after a whole genome duplication that occurred tens of millions of years ago. Given extensive knowledge of the genetics and epigenetics of Paramecium acquired over the last century, this species complex offers a uniquely powerful system to investigate the consequences of whole genome duplication in a unicellular eukaryote as well as the genetic and epigenetic mechanisms that drive speciation. High quality Paramecium gene models are important for research using this system. The major aim of the work reported here was to build an improved gene annotation pipeline for the Paramecium lineage. We generated oriented RNA-Seq transcriptome data across the sexual process of autogamy for the model species Paramecium tetraurelia. We determined, for the first time in a ciliate, candidate P. tetraurelia transcription start sites using an adapted Cap-Seq protocol. We developed TrUC, multi-threaded Perl software that in conjunction with TopHat mapping of RNA-Seq data to a reference genome, predicts transcription units for the annotation pipeline. We used EuGene software to combine annotation evidence. The high quality gene structural annotations obtained for P. tetraurelia were used as evidence to improve published annotations for 3 other Paramecium species. The RNA-Seq data were also used for differential gene expression analysis, providing a gene expression atlas that is more sensitive than the previously established microarray resource. We have developed a gene annotation pipeline tailored for the compact genomes and tiny introns of Paramecium species. A novel component of this pipeline, TrUC, predicts transcription units using Cap-Seq and oriented RNA-Seq data. TrUC could prove useful beyond Paramecium, especially in the case of high gene density. Accurate predictions of 3' and 5' UTR will be particularly valuable for studies of gene expression (e.g. nucleosome positioning, identification of cis

Dynamic regulation of VEGF-inducible genes by an ERK/ERG/p300 transcriptional network.

PubMed

Fish, Jason E; Cantu Gutierrez, Manuel; Dang, Lan T; Khyzha, Nadiya; Chen, Zhiqi; Veitch, Shawn; Cheng, Henry S; Khor, Melvin; Antounians, Lina; Njock, Makon-Sébastien; Boudreau, Emilie; Herman, Alexander M; Rhyner, Alexander M; Ruiz, Oscar E; Eisenhoffer, George T; Medina-Rivera, Alejandra; Wilson, Michael D; Wythe, Joshua D

2017-07-01

The transcriptional pathways activated downstream of vascular endothelial growth factor (VEGF) signaling during angiogenesis remain incompletely characterized. By assessing the signals responsible for induction of the Notch ligand delta-like 4 (DLL4) in endothelial cells, we find that activation of the MAPK/ERK pathway mirrors the rapid and dynamic induction of DLL4 transcription and that this pathway is required for DLL4 expression. Furthermore, VEGF/ERK signaling induces phosphorylation and activation of the ETS transcription factor ERG, a prerequisite for DLL4 induction. Transcription of DLL4 coincides with dynamic ERG-dependent recruitment of the transcriptional co-activator p300. Genome-wide gene expression profiling identified a network of VEGF-responsive and ERG-dependent genes, and ERG chromatin immunoprecipitation (ChIP)-seq revealed the presence of conserved ERG-bound putative enhancer elements near these target genes. Functional experiments performed in vitro and in vivo confirm that this network of genes requires ERK, ERG and p300 activity. Finally, genome-editing and transgenic approaches demonstrate that a highly conserved ERG-bound enhancer located upstream of HLX (which encodes a transcription factor implicated in sprouting angiogenesis) is required for its VEGF-mediated induction. Collectively, these findings elucidate a novel transcriptional pathway contributing to VEGF-dependent angiogenesis. © 2017. Published by The Company of Biologists Ltd.

oPOSSUM: identification of over-represented transcription factor binding sites in co-expressed genes

PubMed Central

Ho Sui, Shannan J.; Mortimer, James R.; Arenillas, David J.; Brumm, Jochen; Walsh, Christopher J.; Kennedy, Brian P.; Wasserman, Wyeth W.

2005-01-01

Targeted transcript profiling studies can identify sets of co-expressed genes; however, identification of the underlying functional mechanism(s) is a significant challenge. Established methods for the analysis of gene annotations, particularly those based on the Gene Ontology, can identify functional linkages between genes. Similar methods for the identification of over-represented transcription factor binding sites (TFBSs) have been successful in yeast, but extension to human genomics has largely proved ineffective. Creation of a system for the efficient identification of common regulatory mechanisms in a subset of co-expressed human genes promises to break a roadblock in functional genomics research. We have developed an integrated system that searches for evidence of co-regulation by one or more transcription factors (TFs). oPOSSUM combines a pre-computed database of conserved TFBSs in human and mouse promoters with statistical methods for identification of sites over-represented in a set of co-expressed genes. The algorithm successfully identified mediating TFs in control sets of tissue-specific genes and in sets of co-expressed genes from three transcript profiling studies. Simulation studies indicate that oPOSSUM produces few false positives using empirically defined thresholds and can tolerate up to 50% noise in a set of co-expressed genes. PMID:15933209

Genome-Wide Identification and Testing of Superior Reference Genes for Transcript Normalization in Arabidopsis1[w

PubMed Central

Czechowski, Tomasz; Stitt, Mark; Altmann, Thomas; Udvardi, Michael K.; Scheible, Wolf-Rüdiger

2005-01-01

Gene transcripts with invariant abundance during development and in the face of environmental stimuli are essential reference points for accurate gene expression analyses, such as RNA gel-blot analysis or quantitative reverse transcription-polymerase chain reaction (PCR). An exceptionally large set of data from Affymetrix ATH1 whole-genome GeneChip studies provided the means to identify a new generation of reference genes with very stable expression levels in the model plant species Arabidopsis (Arabidopsis thaliana). Hundreds of Arabidopsis genes were found that outperform traditional reference genes in terms of expression stability throughout development and under a range of environmental conditions. Most of these were expressed at much lower levels than traditional reference genes, making them very suitable for normalization of gene expression over a wide range of transcript levels. Specific and efficient primers were developed for 22 genes and tested on a diverse set of 20 cDNA samples. Quantitative reverse transcription-PCR confirmed superior expression stability and lower absolute expression levels for many of these genes, including genes encoding a protein phosphatase 2A subunit, a coatomer subunit, and an ubiquitin-conjugating enzyme. The developed PCR primers or hybridization probes for the novel reference genes will enable better normalization and quantification of transcript levels in Arabidopsis in the future. PMID:16166256

Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

PubMed Central

Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

2011-01-01

Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

Different gene-specific mechanisms determine the 'revised-response' memory transcription patterns of a subset of A. thaliana dehydration stress responding genes.

PubMed

Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya

2014-05-01

Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

PubMed Central

Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

2016-01-01

The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.

2006-10-01

The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccasemore » structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.« less

Transcriptional deregulation of homeobox gene ZHX2 in Hodgkin lymphoma.

PubMed

Nagel, Stefan; Schneider, Björn; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; Macleod, Roderick A F

2012-05-01

Recently, we identified a novel chromosomal rearrangement in Hodgkin lymphoma (HL), t(4;8)(q27;q24), which targets homeobox gene ZHX2 at the recurrent breakpoint 8q24. This aberration deletes the far upstream region of ZHX2 and results in silenced transcription pinpointing loss of activatory elements. Here, we have looked for potential binding sites within this deleted region to analyze the transcriptional deregulation of this tumor suppressor gene in B-cell malignancies. SiRNA-mediated knockdown and reporter gene analyses identified two transcription factors, homeodomain protein MSX1 and bZIP protein XBP1, directly regulating ZHX2 expression. Furthermore, MSX1-cofactor histone H1C mediated repression of ZHX2 and showed enhanced expression levels in cell line L-1236. As demonstrated by fluorescence in situ hybridization and genomic array analysis, the gene loci of MSX1 at 4p16 and H1C at 6p22 were rearranged in several HL cell lines, correlating with their altered expression activity. The expression of XBP1 was reduced in 6/7 HL cell lines as compared to primary hematopoietic cells. Taken together, our results demonstrate multiple mechanisms decreasing expression of tumor suppressor gene ZHX2 in HL cell lines: loss of enhancing binding sites, reduced expression of activators MSX1 and XBP1, and overexpression of MSX1-corepressor H1C. Moreover, chromosomal deregulations of genes involved in this regulative network highlight their role in development and malignancy of B-cells. Copyright © 2011 Elsevier Ltd. All rights reserved.

Integrating gene transcription-based biomarkers to understand desert tortoise and ecosystem health

USGS Publications Warehouse

Bowen, Lizabeth; Miles, A. Keith; Drake, Karla K.; Waters, Shannon C.; Esque, Todd C.; Nussear, Kenneth E.

2015-01-01

Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal’s habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcriptionC T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.

Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

PubMed

Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

2016-04-01

Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

Modulation of DNA binding by gene-specific transcription factors.

PubMed

Schleif, Robert F

2013-10-01

The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

MEF2 Transcription Factors Regulate Distinct Gene Programs in Mammalian Skeletal Muscle Differentiation*

PubMed Central

Estrella, Nelsa L.; Desjardins, Cody A.; Nocco, Sarah E.; Clark, Amanda L.; Maksimenko, Yevgeniy; Naya, Francisco J.

2015-01-01

Skeletal muscle differentiation requires precisely coordinated transcriptional regulation of diverse gene programs that ultimately give rise to the specialized properties of this cell type. In Drosophila, this process is controlled, in part, by MEF2, the sole member of an evolutionarily conserved transcription factor family. By contrast, vertebrate MEF2 is encoded by four distinct genes, Mef2a, -b, -c, and -d, making it far more challenging to link this transcription factor to the regulation of specific muscle gene programs. Here, we have taken the first step in molecularly dissecting vertebrate MEF2 transcriptional function in skeletal muscle differentiation by depleting individual MEF2 proteins in myoblasts. Whereas MEF2A is absolutely required for proper myoblast differentiation, MEF2B, -C, and -D were found to be dispensable for this process. Furthermore, despite the extensive redundancy, we show that mammalian MEF2 proteins regulate a significant subset of nonoverlapping gene programs. These results suggest that individual MEF2 family members are able to recognize specific targets among the entire cohort of MEF2-regulated genes in the muscle genome. These findings provide opportunities to modulate the activity of MEF2 isoforms and their respective gene programs in skeletal muscle homeostasis and disease. PMID:25416778

The yeast Hot1 transcription factor is critical for activating a single target gene, STL1

PubMed Central

Bai, Chen; Tesker, Masha; Engelberg, David

2015-01-01

Transcription factors are commonly activated by signal transduction cascades and induce expression of many genes. They therefore play critical roles in determining the cell's fate. The yeast Hog1 MAP kinase pathway is believed to control the transcription of hundreds of genes via several transcription factors. To identify the bona fide target genes of Hog1, we inducibly expressed the spontaneously active variant Hog1D170A+F318L in cells lacking the Hog1 activator Pbs2. This system allowed monitoring the effects of Hog1 by itself. Expression of Hog1D170A+F318L in pbs2∆ cells imposed induction of just 105 and suppression of only 26 transcripts by at least twofold. We looked for the Hog1-responsive element within the promoter of the most highly induced gene, STL1 (88-fold). A novel Hog1 responsive element (HoRE) was identified and shown to be the direct target of the transcription factor Hot1. Unexpectedly, we could not find this HoRE in any other yeast promoter. In addition, the only gene whose expression was abolished in hot1∆ cells was STL1. Thus Hot1 is essential for transcription of just one gene, STL1. Hot1 may represent a class of transcription factors that are essential for transcription of a very few genes or even just one. PMID:25904326

Activation of endothelial-leukocyte adhesion molecule 1 (ELAM-1) gene transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montgomery, K.F.; Tarr, P.I.; Bomsztyk, K.

1991-08-01

Leukocyte adherence to endothelium is in part mediated by the transient expression of endothelial-leukocyte adhesion molecule 1 (ELAM-1) on endothelial surfaces stimulated by tumor necrosis factor {alpha} (TNF), interleukin (IL) 1, or bacterial lipopolysaccharide (LPS). The intracellular factors controlling induction of ELAM-1 mRNA and protein are unknown. In nuclear runoff experiments with cultured human umbilical vein endothelial cells (HUVEC), the authors demonstrate that transcriptional activation of the ELAM-1 gene occurs following stimulation with TNF. Sequence analysis of the 5{prime} flanking region of the ELAM-1 gene reveals consensus DNA-binding sequences for two known transcription factors, NF-{kappa}B and AP-1. Gel mobility shiftmore » assays demonstrate that TNF, IL-1, or LPS induces activation of NF-{kappa}B-like DNA binding activity in HUVEC. Phorbol 12-myristate 13-acetate, a known activator of protein kinase C (PKC), weakly induces NF-{kappa}B-like activity, ELAM-1 mRNA, and ELAM-1 surface expression in HUVEC. However, TNF, IL-1, and LPS do not activate PKC in HUVEC at doses that strongly induce NF-{kappa}B-like protein activation and ELAM-1 gene expression. PKC blockade with H7 does not inhibit activation of these NF-kB-like proteins but does inhibit ELAM-1 gene transcription. They conclude that PKC-independent activation of NF-{kappa}B in HUVEC with TNF, IL-1, or LPS is associated with, but not sufficient for, activation of ELAM-1 gene transcription.« less

Coordinating Regulation of Gene Expression in Cardiovascular Disease: Interactions between Chromatin Modifiers and Transcription Factors

PubMed Central

Bauer, Ashley J.; Martin, Kathleen A.

2017-01-01

Cardiovascular disease is a leading cause of death with increasing economic burden. The pathogenesis of cardiovascular diseases is complex, but can arise from genetic and/or environmental risk factors. This can lead to dysregulated gene expression in numerous cell types including cardiomyocytes, endothelial cells, vascular smooth muscle cells, and inflammatory cells. While initial studies addressed transcriptional control of gene expression, epigenetics has been increasingly appreciated to also play an important role in this process through alterations in chromatin structure and gene accessibility. Chromatin-modifying proteins including enzymes that modulate DNA methylation, histone methylation, and histone acetylation can influence gene expression in numerous ways. These chromatin modifiers and their marks can promote or prevent transcription factor recruitment to regulatory regions of genes through modifications to DNA, histones, or the transcription factors themselves. This review will focus on the emerging question of how epigenetic modifiers and transcription factors interact to coordinately regulate gene expression in cardiovascular disease. While most studies have addressed the roles of either epigenetic or transcriptional control, our understanding of the integration of these processes is only just beginning. Interrogating these interactions is challenging, and improved technical approaches will be needed to fully dissect the temporal and spatial relationships between transcription factors, chromatin modifiers, and gene expression in cardiovascular disease. We summarize the current state of the field and provide perspectives on limitations and future directions. Through studies of epigenetic and transcriptional interactions, we can advance our understanding of the basic mechanisms of cardiovascular disease pathogenesis to develop novel therapeutics. PMID:28428957

Evolved α-factor prepro-leaders for directed laccase evolution in Saccharomyces cerevisiae.

PubMed

Mateljak, Ivan; Tron, Thierry; Alcalde, Miguel

2017-11-01

Although the functional expression of fungal laccases in Saccharomyces cerevisiae has proven to be complicated, the replacement of signal peptides appears to be a suitable approach to enhance secretion in directed evolution experiments. In this study, twelve constructs were prepared by fusing native and evolved α-factor prepro-leaders from S. cerevisiae to four different laccases with low-, medium- and high-redox potential (PM1L from basidiomycete PM1; PcL from Pycnoporus cinnabarinus; TspC30L from Trametes sp. strain C30; and MtL from Myceliophthora thermophila). Microcultures of the prepro-leader:laccase fusions were grown in selective expression medium that used galactose as both the sole carbon source and as the inducer of expression so that the secretion and activity were assessed with low- and high-redox potential mediators in a high-throughput screening context. With total activity improvements as high as sevenfold over those obtained with the native α-factor prepro-leader, the evolved prepro-leader from PcL (α PcL ) most strongly enhanced secretion of the high- and medium-redox potential laccases PcL, PM1L and TspC30L in the microtiter format with an expression pattern driven by prepro-leaders in the order α PcL  > α PM 1L  ~ α native . By contrast, the pattern of the low-redox potential MtL was α native  > α PcL  > α PM 1L . When produced in flask with rich medium, the evolved prepro-leaders outperformed the α native signal peptide irrespective of the laccase attached, enhancing secretion over 50-fold. Together, these results highlight the importance of using evolved α-factor prepro-leaders for functional expression of fungal laccases in directed evolution campaigns. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Simultaneous live imaging of the transcription and nuclear position of specific genes

PubMed Central

Ochiai, Hiroshi; Sugawara, Takeshi; Yamamoto, Takashi

2015-01-01

The relationship between genome organization and gene expression has recently been established. However, the relationships between spatial organization, dynamics, and transcriptional regulation of the genome remain unknown. In this study, we developed a live-imaging method for simultaneous measurements of the transcriptional activity and nuclear position of endogenous genes, which we termed the ‘Real-time Observation of Localization and EXpression (ROLEX)’ system. We demonstrated that ROLEX is highly specific and does not affect the expression level of the target gene. ROLEX enabled detection of sub-genome-wide mobility changes that depended on the state of Nanog transactivation in embryonic stem cells. We believe that the ROLEX system will become a powerful tool for exploring the relationship between transcription and nuclear dynamics in living cells. PMID:26092696

Immobilization of Trametes versicolor cultures for improving laccase production in bubble column reactor intensified by sonication.

PubMed

Wang, Feng; Guo, Chen; Liu, Chun-Zhao

2013-01-01

The mycelia of Trametes versicolor immobilized in alginate beads provided higher laccase production than that in pelleted form. An efficient ultrasonic treatment enhanced laccase production from the immobilized T. versicolor cultures. The optimized treatment process consisted of exposing 36-h-old bead cultures to 7-min ultrasonic treatments twice with a 12-h interval using a fixed ultrasonic power and frequency (120 W, 40 kHz). Using the intensification strategy with sonication, laccase production increased by more than 2.1-fold greater than the untreated control in both flasks and bubble column reactors. The enhancement of laccase production by ultrasonic treatment is related to the improved mass transfer of nutrients and product between the liquid medium and the gel matrix. These results provide a basis for the large-scale and highly-efficient production of laccase using sonobioreactors.

Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, P.J.; Dobson, A.D.W.; Kotterman, M.J.J.

1996-12-01

Polycyclic aromatic hydrocarbons, particularly benzene homologs, are highly toxic organic pollutants. One of the three major groups of extracellular oxidative enzymes involved in the white rot fungal lignin degradative process are laccases. This study presents evidence indicating that laccase has a role in PAH oxidation by white rot fungi. 36 refs., 5 figs., 1 tab.

Stochastic model for gene transcription on Drosophila melanogaster embryos

NASA Astrophysics Data System (ADS)

Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.

2016-02-01

We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

KLF15 promotes transcription of KLF3 gene in bovine adipocytes.

PubMed

Guo, Hongfang; Khan, Rajwali; Raza, Sayed Haidar Abbas; Ning, Yue; Wei, Dawei; Wu, Sen; Hosseini, Seyed Mahdi; Ullah, Irfan; Garcia, Matthew D; Zan, Linsen

2018-06-15

The Krüppel-like factors (KLF) family plays an important role in adipogenesis, which is subject to internal hierarchical regulation. KLF3 is a member of KLF family, mainly responsible for adipocyte differentiation and fat deposition. However, the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15 gene remains unclear during bovine adipogenesis. Here, we report that the expression pattern of KLF3 and KLF15 genes during bovine adipogenesis, when KLF15 gene was overexpressed through adenoviral vector (Ad-KLF15) in bovine adipocytes the expression level of KLF3 gene was increased, similarly when KLF15 was down regulated through siRNA the expression level of KLF3 was also reduced. To explore the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15, serial deletion constructs of the 5'flanking region of bovine KLF3gene revealed through dual-luciferase reporter assay that the core promoter is located in -264 to -76 regions. The most proximal GGGG element in the promoter of the bovine KLF3 gene (located in -264 to -76 regions) is required for promotion by KLF15. Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays further confirmed that KLF15 gene binds to the KLF3 gene core promoter region in bovine adipocytes. These findings conclude that KLF15 promotes the transcriptional activity of KLF3 in bovine adipocytes. This mechanism to provides a new direction for further study of adipogenesis by internal regulation of members within KLF family. Copyright © 2018 Elsevier B.V. All rights reserved.

A high effective NADH-ferricyanide dehydrogenase coupled with laccase for NAD(+) regeneration.

PubMed

Wang, Jizhong; Yang, Chengli; Chen, Xing; Bao, Bingxin; Zhang, Xuan; Li, Dali; Du, Xingfan; Shi, Ruofu; Yang, Junfang; Zhu, Ronghui

2016-08-01

To find an efficient and cheap system for NAD(+) regeneration A NADH-ferricyanide dehydrogenase was obtained from an isolate of Escherichia coli. Optimal activity of the NADH dehydrogenase was at 45 °C and pH 7.5, with a K m value for NADH of 10 μM. By combining the NADH dehydrogenase, potassium ferricyanide and laccase, a bi-enzyme system for NAD(+) regeneration was established. The system is attractive in that the O2 consumed by laccase is from air and the sole byproduct of the reaction is water. During the reaction process, 10 mM NAD(+) was transformed from NADH in less than 2 h under the condition of 0.5 U NADH dehydrogenase, 0.5 U laccase, 0.1 mM potassium ferricyanide at pH 5.6, 30 °C CONCLUSION: The bi-enzyme system employed the NADH-ferricyanide dehydrogenase and laccase as catalysts, and potassium ferricyanide as redox mediator, is a promising alternative for NAD(+) regeneration.

Modeling of growth and laccase production by Pycnoporus sanguineus.

PubMed

Saat, Muhammad Naziz; Annuar, Mohamad Suffian Mohamad; Alias, Zazali; Chuan, Ling Tau; Chisti, Yusuf

2014-05-01

Production of extracellular laccase by the white-rot fungus Pycnoporus sanguineus was examined in batch submerged cultures in shake flasks, baffled shake flasks and a stirred tank bioreactor. The biomass growth in the various culture systems closely followed a logistic growth model. The production of laccase followed a Luedeking-Piret model. A modified Luedeking-Piret model incorporating logistic growth effectively described the consumption of glucose. Biomass productivity, enzyme productivity and substrate consumption were enhanced in baffled shake flasks relative to the cases for the conventional shake flasks. This was associated with improved oxygen transfer in the presence of the baffles. The best results were obtained in the stirred tank bioreactor. At 28 °C, pH 4.5, an agitation speed of 600 rpm and a dissolved oxygen concentration of ~25 % of air saturation, the laccase productivity in the bioreactor exceeded 19 U L(-1 )days(-1), or 1.5-fold better than the best case for the baffled shake flask. The final concentration of the enzyme was about 325 U L(-1).

Constitutive expression of Botrytis aclada laccase in Pichia pastoris

PubMed Central

Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland

2012-01-01

The heterologous expression of laccases is important for their large-scale production and genetic engineering—a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL-1) and the AOX1 system (495 mgL-1) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg-1 GAP, 14.2 Umg-1 AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842

Plasticity of laccase generated by homeologous recombination in yeast.

PubMed

Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry

2009-10-01

Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.

Kraft Pulp Biobleaching and Mediated Oxidation of a Nonphenolic Substrate by Laccase from Streptomyces cyaneus CECT 3335

PubMed Central

Arias, M. Enriqueta; Arenas, María; Rodríguez, Juana; Soliveri, Juan; Ball, Andrew S.; Hernández, Manuel

2003-01-01

A new laccase (EC 1.10.3.2) produced by Streptomyces cyaneus CECT 3335 in liquid media containing soya flour (20 g per liter) was purified to homogeneity. The physicochemical, catalytic, and spectral characteristics of this enzyme, as well as its suitability for biobleaching of eucalyptus kraft pulps, were assessed. The purified laccase had a molecular mass of 75 kDa and an isoelectric point of 5.6, and its optimal pH and temperature were 4.5 and 70°C, respectively. The activity was strongly enhanced in the presence of Cu2+, Mn2+, and Mg2+ and was completely inhibited by EDTA and sodium azide. The purified laccase exhibited high levels of activity against 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and 2,6-dimethoxyphenol and no activity against tyrosine. The UV-visible spectrum of the purified laccase was the typical spectrum of the blue laccases, with an absorption peak at 600 nm and a shoulder around 330 to 340 nm. The ability of the purified laccase to oxidize a nonphenolic compound, such as veratryl alcohol, in the presence of ABTS opens up new possibilities for the use of bacterial laccases in the pulp and paper industry. We demonstrated that application of the laccase from S. cyaneus in the presence of ABTS to biobleaching of eucalyptus kraft pulps resulted in a significant decrease in the kappa number (2.3 U) and an important increase in the brightness (2.2%, as determined by the International Standard Organization test) of pulps, showing the suitability of laccases produced by streptomycetes for industrial purposes. PMID:12676669

Epigenetic regulation of intragenic transposable elements impacts gene transcription in Arabidopsis thaliana

PubMed Central

Le, Tu N.; Miyazaki, Yuji; Takuno, Shohei; Saze, Hidetoshi

2015-01-01

Genomes of higher eukaryotes, including plants, contain numerous transposable elements (TEs), that are often silenced by epigenetic mechanisms, such as histone modifications and DNA methylation. Although TE silencing adversely affects expression of nearby genes, recent studies reveal the presence of intragenic TEs marked by repressive heterochromatic epigenetic marks within transcribed genes. However, even for the well-studied plant model Arabidopsis thaliana, the abundance of intragenic TEs, how they are epigenetically regulated, and their potential impacts on host gene expression, remain unexplored. In this study, we comprehensively analyzed genome-wide distribution and epigenetic regulation of intragenic TEs in A. thaliana. Our analysis revealed that about 3% of TEs are located within gene bodies, dominantly at intronic regions. Most of them are shorter and less methylated than intergenic TEs, but they are still targeted by RNA-directed DNA methylation-dependent and independent pathways. Surprisingly, the heterochromatic epigenetic marks at TEs are maintained within actively transcribed genes. Moreover, the heterochromatic state of intronic TEs is critical for proper transcription of associated genes. Our study provides the first insight into how intragenic TEs affect the transcriptional landscape of the A. thaliana genome, and suggests the importance of epigenetic mechanisms for regulation of TEs within transcriptional gene units. PMID:25813042

Copper and dyes enhance laccase production in gamma-proteobacterium JB.

PubMed

Malhotra, Kanam; Sharma, Prince; Capalash, Neena

2004-07-01

Laccase production in gamma-proteobacterium JB was enhanced 13-fold by adding 0.1 mM CuSO(4) 24 h after the onset of growth. Ethidium bromide (2.5 microM), Malachite Green, Phenol Red and Thymol Blue (10 microM each) enhanced laccase production 17-, 19-, 4- and 2-fold, respectively. Among the fourteen aromatic/organic compounds tried, p-aminobenzoic acid and an industrial effluent, from where the organism was isolated, showed 1.2- and 1.26-fold increases in production.

A functional promoter shift of a chloroplast gene: a transcriptional fusion between a novel psbA gene copy and the trnK (UUU) gene in Pinus contorta.

PubMed

Lidholm, J; Gustafsson, P

1992-11-01

A comparative transcription analysis of the chloroplast trnK-psbA-trnH region of the two pine species Pinus contorta and Pinus sylvestris is reported. The chloroplast genome of P. contorta has previously been shown to contain a duplicated psbA gene copy integrated closely upstream of the split trnK gene. This rearrangement has resulted in the gene order psbAI-trnK-psbAII-trnH, where psbAII is the ancestral psbA gene copy. In P. sylvestris, a species which lacks the psbA duplication, transcription of the trnK gene originates from a position 291 bp upstream of the trnK 5' exon, adjacent to a canonical promoter structure. In P. contorta, the corresponding promoter structure has been separated from the trnK gene by the insertion of psbAI, and has, in addition, been partially deleted. Analysis of the transcriptional organization of the trnK-psbA-trnH region of the two pine species revealed that the trnK gene in P. contorta is transcriptionally fused to the inserted psbAI gene copy. As a result, trnK is under the control of the psbA promoter in this species and has therefore acquired psbA-like expression characteristics. In P. sylvestris, accumulation of trnK transcripts is not significantly higher in light-grown than in dark-grown seedlings. In contrast, the level of trnK transcripts in P. contorta is approximately 12-fold higher in the light than in the dark. When light-grown seedlings of the two pine species were compared, an approximately 20-fold higher level of trnK RNAs was found in P. contorta. In both pine species, evidence was obtained for trnK-psbA and psbA-trnH co-transcription.

Arabidopsis ensemble reverse-engineered gene regulatory network discloses interconnected transcription factors in oxidative stress.

PubMed

Vermeirssen, Vanessa; De Clercq, Inge; Van Parys, Thomas; Van Breusegem, Frank; Van de Peer, Yves

2014-12-01

The abiotic stress response in plants is complex and tightly controlled by gene regulation. We present an abiotic stress gene regulatory network of 200,014 interactions for 11,938 target genes by integrating four complementary reverse-engineering solutions through average rank aggregation on an Arabidopsis thaliana microarray expression compendium. This ensemble performed the most robustly in benchmarking and greatly expands upon the availability of interactions currently reported. Besides recovering 1182 known regulatory interactions, cis-regulatory motifs and coherent functionalities of target genes corresponded with the predicted transcription factors. We provide a valuable resource of 572 abiotic stress modules of coregulated genes with functional and regulatory information, from which we deduced functional relationships for 1966 uncharacterized genes and many regulators. Using gain- and loss-of-function mutants of seven transcription factors grown under control and salt stress conditions, we experimentally validated 141 out of 271 predictions (52% precision) for 102 selected genes and mapped 148 additional transcription factor-gene regulatory interactions (49% recall). We identified an intricate core oxidative stress regulatory network where NAC13, NAC053, ERF6, WRKY6, and NAC032 transcription factors interconnect and function in detoxification. Our work shows that ensemble reverse-engineering can generate robust biological hypotheses of gene regulation in a multicellular eukaryote that can be tested by medium-throughput experimental validation. © 2014 American Society of Plant Biologists. All rights reserved.

Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

PubMed

Kim, Kihoon; Kim, AeRi

2010-09-01

Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

The "fourth dimension" of gene transcription.

PubMed

O'Malley, Bert W

2009-05-01

The three dimensions of space provide our relationship to position on the earth, but the fourth dimension of time has an equally profound influence on our lives. Everything from light and sound to weather and biology operate on the principle of measurable temporal periodicity. Consequently, a wide variety of time clocks affect all aspects of our existence. The annual (and biannual) cycles of activity, metabolism, and mating, the monthly physiological clocks of women and men, and the 24-h diurnal rhythms of humans are prime examples. Should it be surprising to us that the fourth dimension also impinges upon gene expression and that the genome itself is regulated by the fastest running of all biological clocks? Recent evidence substantiates the existence of such a ubiquitin-dependent transcriptional clock that is based upon the activation and destruction of transcriptional coactivators.

Optimization of media components for laccase production by litter dwelling fungal isolate Fusarium incarnatum LD-3.

PubMed

Chhaya, Urvish; Gupte, Akshaya

2010-02-01

Laccase production by solid state fermentation (SSF) using an indigenously isolated litter dwelling fungus Fusarium incarnatum LD-3 was optimized. Fourteen medium components were screened by the initial screening method of Plackett-Burman. Each of the components was screened on the basis of 'p' (probability value) which was above 95% confidence level. Ortho-dianisidine, thiamine HCl and CuSO(4) . 5 H(2)O were identified as significant components for laccase production. The Central Composite Design response surface methodology was then applied to further optimize the laccase production. The optimal concentration of these three medium components for higher laccase production were (g/l): CuSO(4) . 5 H(2)O, 0.01; thiamine HCl, 0.0136 and ortho-dianisidine, 0.388 mM served as an inducer. Wheat straw, 5.0 g was used as a solid substrate. Using this statistical optimization method the laccase production was found to increase from 40 U/g to 650 U/g of wheat straw, which was sixteen times higher than non optimized medium. This is the first report on statistical optimization of laccase production from Fusarium incarnatum LD-3.

Validation of reference genes aiming accurate normalization of qRT-PCR data in Dendrocalamus latiflorus Munro.

PubMed

Liu, Mingying; Jiang, Jing; Han, Xiaojiao; Qiao, Guirong; Zhuo, Renying

2014-01-01

Dendrocalamus latiflorus Munro distributes widely in subtropical areas and plays vital roles as valuable natural resources. The transcriptome sequencing for D. latiflorus Munro has been performed and numerous genes especially those predicted to be unique to D. latiflorus Munro were revealed. qRT-PCR has become a feasible approach to uncover gene expression profiling, and the accuracy and reliability of the results obtained depends upon the proper selection of stable reference genes for accurate normalization. Therefore, a set of suitable internal controls should be validated for D. latiflorus Munro. In this report, twelve candidate reference genes were selected and the assessment of gene expression stability was performed in ten tissue samples and four leaf samples from seedlings and anther-regenerated plants of different ploidy. The PCR amplification efficiency was estimated, and the candidate genes were ranked according to their expression stability using three software packages: geNorm, NormFinder and Bestkeeper. GAPDH and EF1α were characterized to be the most stable genes among different tissues or in all the sample pools, while CYP showed low expression stability. RPL3 had the optimal performance among four leaf samples. The application of verified reference genes was illustrated by analyzing ferritin and laccase expression profiles among different experimental sets. The analysis revealed the biological variation in ferritin and laccase transcript expression among the tissues studied and the individual plants. geNorm, NormFinder, and BestKeeper analyses recommended different suitable reference gene(s) for normalization according to the experimental sets. GAPDH and EF1α had the highest expression stability across different tissues and RPL3 for the other sample set. This study emphasizes the importance of validating superior reference genes for qRT-PCR analysis to accurately normalize gene expression of D. latiflorus Munro.

Oxidative polymerization of lignins by laccase in water-acetone mixture.

PubMed

Fiţigău, Ionița Firuța; Peter, Francisc; Boeriu, Carmen Gabriela

2013-01-01

The enzymatic oxidative polymerization of five technical lignins with different molecular properties, i.e. Soda Grass/Wheat straw Lignin, Organosolv Hardwood Lignin, Soda Wheat straw Lignin, Alkali pretreated Wheat straw Lignin, and Kraft Softwood was studied. All lignins were previously fractionated by acetone/water 50:50 (v/v) and the laccase-catalyzed polymerization of the low molecular weight fractions (Mw < 4000 g/mol) was carried out in the same solvent system. Reactivity of lignin substrates in laccase-catalyzed reactions was determined by monitoring the oxygen consumption. The oxidation reactions in 50% acetone in water mixture proceed with high rate for all tested lignins. Polymerization products were analyzed by size exclusion chromatography, FT-IR, and (31)P-NMR and evidence of important lignin modifications after incubation with laccase. Lignin polymers with higher molecular weight (Mw up to 17500 g/mol) were obtained. The obtained polymers have potential for applications in bioplastics, adhesives and as polymeric dispersants.

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Pleiotropic biological activities of alternatively spliced TMPRSS2/ERG fusion gene transcripts

PubMed Central

Wang, Jianghua; Cai, Yi; Yu, Wendong; Ren, Chengxi; Spencer, David M.; Ittmann, Michael

2008-01-01

TMPRSS2/ERG gene fusions are found in the majority of prostate cancers; however, there is significant heterogeneity in the 5′ region of the alternatively spliced fusion gene transcripts. We have found that there is also significant heterogeneity within the coding exons as well. There is variable inclusion of a 72-bp exon and other novel alternatively spliced isoforms. To assess the biological significance of these alternatively spliced transcripts, we expressed various transcripts in primary prostatic epithelial cells and in an immortalized prostatic epithelial cell line, PNT1a. The fusion gene transcripts promoted proliferation, invasion and motility with variable activities that depended on the structure of the 5′ region encoding the TMPRSS2/ERG fusion and the presence of the 72-bp exon. Cotransfection of different isoforms further enhanced biological activity, mimicking the situation in vivo, in which multiple isoforms are expressed. Finally, knockdown of the fusion gene in VCaP cells resulted in inhibition of proliferation in vitro and tumor progression in an in vivo orthotopic mice model. Our results indicate that TMPRSS2/ERG fusion isoforms have variable biological activities promoting tumor initiation and progression and are consistent with our previous clinical observations indicating that certain TMPRSS2/ERG fusion isoforms are significantly correlated with more aggressive disease. PMID:18922926

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

Histone deacetylase inhibition modulates histone acetylation at gene promoter regions and affects genome-wide gene transcription in Schistosoma mansoni

PubMed Central

Anderson, Letícia; Gomes, Monete Rajão; daSilva, Lucas Ferreira; Pereira, Adriana da Silva Andrade; Mourão, Marina M.; Romier, Christophe; Pierce, Raymond

2017-01-01

Background Schistosomiasis is a parasitic disease infecting hundreds of millions of people worldwide. Treatment depends on a single drug, praziquantel, which kills the Schistosoma spp. parasite only at the adult stage. HDAC inhibitors (HDACi) such as Trichostatin A (TSA) induce parasite mortality in vitro (schistosomula and adult worms), however the downstream effects of histone hyperacetylation on the parasite are not known. Methodology/Principal findings TSA treatment of adult worms in vitro increased histone acetylation at H3K9ac and H3K14ac, which are transcription activation marks, not affecting the unrelated transcription repression mark H3K27me3. We investigated the effect of TSA HDACi on schistosomula gene expression at three different time points, finding a marked genome-wide change in the transcriptome profile. Gene transcription activity was correlated with changes on the chromatin acetylation mark at gene promoter regions. Moreover, combining expression data with ChIP-Seq public data for schistosomula, we found that differentially expressed genes having the H3K4me3 mark at their promoter region in general showed transcription activation upon HDACi treatment, compared with those without the mark, which showed transcription down-regulation. Affected genes are enriched for DNA replication processes, most of them being up-regulated. Twenty out of 22 genes encoding proteins involved in reducing reactive oxygen species accumulation were down-regulated. Dozens of genes encoding proteins with histone reader motifs were changed, including SmEED from the PRC2 complex. We targeted SmEZH2 methyltransferase PRC2 component with a new EZH2 inhibitor (GSK343) and showed a synergistic effect with TSA, significantly increasing schistosomula mortality. Conclusions/Significance Genome-wide gene expression analyses have identified important pathways and cellular functions that were affected and may explain the schistosomicidal effect of TSA HDACi. The change in expression

Sonochemical and hydrodynamic cavitation reactors for laccase/hydrogen peroxide cotton bleaching.

PubMed

Gonçalves, Idalina; Martins, Madalena; Loureiro, Ana; Gomes, Andreia; Cavaco-Paulo, Artur; Silva, Carla

2014-03-01

The main goal of this work is to develop a novel and environmental-friendly technology for cotton bleaching with reduced processing costs. This work exploits a combined laccase-hydrogen peroxide process assisted by ultrasound. For this purpose, specific reactors were studied, namely ultrasonic power generator type K8 (850 kHz) and ultrasonic bath equipment Ultrasonic cleaner USC600TH (45 kHz). The optimal operating conditions for bleaching were chosen considering the highest levels of hydroxyl radical production and the lowest energy input. The capacity to produce hydroxyl radicals by hydrodynamic cavitation was also assessed in two homogenizers, EmulsiFlex®-C3 and APV-2000. Laccase nanoemulsions were produced by high pressure homogenization using BSA (bovine serum albumin) as emulsifier. The bleaching efficiency of these formulations was tested and the results showed higher whiteness values when compared to free laccase. The combination of laccase-hydrogen peroxide process with ultrasound energy produced higher whiteness levels than those obtained by conventional methods. The amount of hydrogen peroxide was reduced 50% as well as the energy consumption in terms of temperature (reduction of 40 °C) and operating time (reduction of 90 min). Copyright © 2013 Elsevier Inc. All rights reserved.

Transcription factor MBF-I interacts with metal regulatory elements of higher eucaryotic metallothionein genes.

PubMed Central

Imbert, J; Zafarullah, M; Culotta, V C; Gedamu, L; Hamer, D

1989-01-01

Metallothionein (MT) gene promoters in higher eucaryotes contain multiple metal regulatory elements (MREs) that are responsible for the metal induction of MT gene transcription. We identified and purified to near homogeneity a 74-kilodalton mouse nuclear protein that specifically binds to certain MRE sequences. This protein, MBF-I, was purified employing as an affinity reagent a trout MRE that is shown to be functional in mouse cells but which lacks the G+C-rich and SP1-like sequences found in many mammalian MT gene promoters. Using point-mutated MREs, we showed that there is a strong correlation between DNA binding in vitro and MT gene regulation in vivo, suggesting a direct role of MBF-I in MT gene transcription. We also showed that MBF-I can induce MT gene transcription in vitro in a mouse extract and that this stimulation requires zinc. Images PMID:2586522

p21 as a Transcriptional Co-Repressor of S-Phase and Mitotic Control Genes

PubMed Central

Ferrándiz, Nuria; Caraballo, Juan M.; García-Gutierrez, Lucía; Devgan, Vikram; Rodriguez-Paredes, Manuel; Lafita, M. Carmen; Bretones, Gabriel; Quintanilla, Andrea; Muñoz-Alonso, M. Jose; Blanco, Rosa; Reyes, Jose C.; Agell, Neus; Delgado, M. Dolores; Dotto, G. Paolo; León, Javier

2012-01-01

It has been previously described that p21 functions not only as a CDK inhibitor but also as a transcriptional co-repressor in some systems. To investigate the roles of p21 in transcriptional control, we studied the gene expression changes in two human cell systems. Using a human leukemia cell line (K562) with inducible p21 expression and human primary keratinocytes with adenoviral-mediated p21 expression, we carried out microarray-based gene expression profiling. We found that p21 rapidly and strongly repressed the mRNA levels of a number of genes involved in cell cycle and mitosis. One of the most strongly down-regulated genes was CCNE2 (cyclin E2 gene). Mutational analysis in K562 cells showed that the N-terminal region of p21 is required for repression of gene expression of CCNE2 and other genes. Chromatin immunoprecipitation assays indicated that p21 was bound to human CCNE2 and other p21-repressed genes gene in the vicinity of the transcription start site. Moreover, p21 repressed human CCNE2 promoter-luciferase constructs in K562 cells. Bioinformatic analysis revealed that the CDE motif is present in most of the promoters of the p21-regulated genes. Altogether, the results suggest that p21 exerts a repressive effect on a relevant number of genes controlling S phase and mitosis. Thus, p21 activity as inhibitor of cell cycle progression would be mediated not only by the inhibition of CDKs but also by the transcriptional down-regulation of key genes. PMID:22662213

A novel multicopper oxidase (laccase) from cyanobacteria: Purification, characterization with potential in the decolorization of anthraquinonic dye.

PubMed

Afreen, Sumbul; Shamsi, Tooba Naz; Baig, Mohd Affan; Ahmad, Nadeem; Fatima, Sadaf; Qureshi, M Irfan; Hassan, Md Imtaiyaz; Fatma, Tasneem

2017-01-01

A novel extracellular laccase enzyme produced from Spirulina platensis CFTRI was purified by ultrafiltration, cold acetone precipitation, anion exchange and size exclusion chromatography with 51.5% recovery and 5.8 purification fold. The purified laccase was a monomeric protein with molecular mass of ~66 kDa that was confirmed by zymogram analysis and peptide mass fingerprinting. The optimum pH and temperature of the enzyme activity was found at 3.0 and 30°C using ABTS as substrate but the enzyme was quite stable at high temperature and alkaline pH. The laccase activity was enhanced by Cu+2, Zn+2 and Mn+2. In addition, the dye decolorization potential of purified laccase was much higher in terms of extent as well as time. The purified laccase decolorized (96%) of anthraquinonic dye Reactive blue- 4 within 4 h and its biodegradation studies was monitored by UV visible spectra, FTIR and HPLC which concluded that cyanobacterial laccase can be efficiently used to decolorize synthetic dye and help in waste water treatment.

A novel multicopper oxidase (laccase) from cyanobacteria: Purification, characterization with potential in the decolorization of anthraquinonic dye

PubMed Central

Afreen, Sumbul; Shamsi, Tooba Naz; Baig, Mohd Affan; Ahmad, Nadeem; Fatima, Sadaf; Qureshi, M. Irfan; Hassan, Md. Imtaiyaz

2017-01-01

A novel extracellular laccase enzyme produced from Spirulina platensis CFTRI was purified by ultrafiltration, cold acetone precipitation, anion exchange and size exclusion chromatography with 51.5% recovery and 5.8 purification fold. The purified laccase was a monomeric protein with molecular mass of ~66 kDa that was confirmed by zymogram analysis and peptide mass fingerprinting. The optimum pH and temperature of the enzyme activity was found at 3.0 and 30°C using ABTS as substrate but the enzyme was quite stable at high temperature and alkaline pH. The laccase activity was enhanced by Cu+2, Zn+2 and Mn+2. In addition, the dye decolorization potential of purified laccase was much higher in terms of extent as well as time. The purified laccase decolorized (96%) of anthraquinonic dye Reactive blue- 4 within 4 h and its biodegradation studies was monitored by UV visible spectra, FTIR and HPLC which concluded that cyanobacterial laccase can be efficiently used to decolorize synthetic dye and help in waste water treatment. PMID:28384218

Mechanical control of cyclic AMP signalling and gene transcription through integrins

NASA Technical Reports Server (NTRS)

Meyer, C. J.; Alenghat, F. J.; Rim, P.; Fong, J. H.; Fabry, B.; Ingber, D. E.

2000-01-01

This study was carried out to discriminate between two alternative hypotheses as to how cells sense mechanical forces and transduce them into changes in gene transcription. Do cells sense mechanical signals through generalized membrane distortion or through specific transmembrane receptors, such as integrins? Here we show that mechanical stresses applied to the cell surface alter the cyclic AMP signalling cascade and downstream gene transcription by modulating local release of signals generated by activated integrin receptors in a G-protein-dependent manner, whereas distortion of integrins in the absence of receptor occupancy has no effect.

Ethylene and pollination decrease transcript abundance of an ethylene receptor gene in Dendrobium petals.

PubMed

Thongkum, Monthathip; Burns, Parichart; Bhunchoth, Anjana; Warin, Nuchnard; Chatchawankanphanich, Orawan; van Doorn, Wouter G

2015-03-15

We studied the expression of a gene encoding an ethylene receptor, called Ethylene Response Sensor 1 (Den-ERS1), in the petals of Dendrobium orchid flowers. Transcripts accumulated during the young floral bud stage and declined by the time the flowers had been open for several days. Pollination or exposure to exogenous ethylene resulted in earlier flower senescence, an increase in ethylene production and a lower Den-ERS1 transcript abundance. Treatment with 1-methylcyclopropene (1-MCP), an inhibitor of the ethylene receptor, decreased ethylene production and resulted in high transcript abundance. The literature indicates two kinds of ethylene receptor genes with regard to the effects of ethylene. One group shows ethylene-induced down-regulated transcription, while the other has ethylene-induced up-regulation. The present gene is an example of the first group. The 5' flanking region showed binding sites for Myb and myb-like, homeodomain, MADS domain, NAC, TCP, bHLH and EIN3-like transcription factors. The binding site for the EIN3-like factor might explain the ethylene effect on transcription. A few other transcription factors (RAV1 and NAC) seem also related to ethylene effects. Copyright © 2015 Elsevier GmbH. All rights reserved.

Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipov, E. M., E-mail: e.m.osipov@gmail.com; Polyakov, K. M.; Engelhardt Institute of Molecular Biology, Vavilova str. 32, Moscow 119991

2015-11-18

The restoration of the native form of laccase from B. aclada from the type 2 copper-depleted form of the enzyme was investigated. Copper ions were found to be incorporated into the active site after soaking the depleted enzyme in a Cu{sup +}-containing solution. Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. Withmore » the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu{sup +}- and Cu{sup 2+}-containing solutions. Copper ions were found to be incorporated into the active site only when Cu{sup +} was used. A comparative analysis of the native and depleted forms of the enzymes was performed.« less

Aldehyde PEGylation of laccase from Trametes versicolor in route to increase its stability: effect on enzymatic activity.

PubMed

Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco

2015-03-01

Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12 mg/ml), reaction time (4 and 17 h), molecular weight, and type of mPEG (20, 30, 40 kDa and 40 kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12 mg/ml of laccase, molar ratio 1:4, and 4 h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. Copyright © 2015 John Wiley & Sons, Ltd.

Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.

PubMed

Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

2015-09-01

Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase.

Sumoylation of Rap1 mediates the recruitment of TFIID to promote transcription of ribosomal protein genes

PubMed Central

Chymkowitch, Pierre; Nguéa P, Aurélie; Aanes, Håvard; Koehler, Christian J.; Thiede, Bernd; Lorenz, Susanne; Meza-Zepeda, Leonardo A.; Klungland, Arne; Enserink, Jorrit M.

2015-01-01

Transcription factors are abundant Sumo targets, yet the global distribution of Sumo along the chromatin and its physiological relevance in transcription are poorly understood. Using Saccharomyces cerevisiae, we determined the genome-wide localization of Sumo along the chromatin. We discovered that Sumo-enriched genes are almost exclusively involved in translation, such as tRNA genes and ribosomal protein genes (RPGs). Genome-wide expression analysis showed that Sumo positively regulates their transcription. We also discovered that the Sumo consensus motif at RPG promoters is identical to the DNA binding motif of the transcription factor Rap1. We demonstrate that Rap1 is a molecular target of Sumo and that sumoylation of Rap1 is important for cell viability. Furthermore, Rap1 sumoylation promotes recruitment of the basal transcription machinery, and sumoylation of Rap1 cooperates with the target of rapamycin kinase complex 1 (TORC1) pathway to promote RPG transcription. Strikingly, our data reveal that sumoylation of Rap1 functions in a homeostatic feedback loop that sustains RPG transcription during translational stress. Taken together, Sumo regulates the cellular translational capacity by promoting transcription of tRNA genes and RPGs. PMID:25800674

Control of transcription of the Bacillus subtilis spoIIIG gene, which codes for the forespore-specific transcription factor sigma G.

PubMed

Sun, D X; Cabrera-Martinez, R M; Setlow, P

1991-05-01

The Bacillus subtilis spoIIIG gene codes for a sigma factor termed sigma G which directs transcription of genes expressed only in the forespore compartment of the sporulating cell. Use of spoIIIG-lacZ transcriptional fusions showed that spoIIIG is cotranscribed with the spoIIG operon beginning at t0.5-1 of sporulation. However, this large mRNA produced little if any sigma G, and transferring the spoIIIG gene without the spoIIG promoter into the amyE locus resulted in a Spo+ phenotype. Significant translation of spoIIIG began at t2.5-3 with use of an mRNA whose 5' end is just upstream of the spoIIIG coding sequence. Synthesis of this spoIIIG-specific mRNA was not abolished by a deletion in spoIIIG itself. Similar results were obtained when a spoIIIG-lacZ translational fusion lacking the spoIIG promoter was integrated at the amyE locus. These data suggest that synthesis of sigma G is dependent neither on transcription from the spoIIG promoter nor on sigma G itself but can be due to another transcription factor. This transcription factor may be sigma F, the product of the spoIIAC locus, since a spoIIAC mutation blocked spoIIIG expression, and sequences upstream of the 5' end of the spoIIIG-specific mRNA agree well with the recognition sequence for sigma F. RNA polymerase containing sigma F (E sigma F) initiated transcription in vitro on a spoIIIG template at the 5' end found in vivo, as did E sigma G. However, E sigma F showed a greater than 20-fold preference for spoIIIG over a known sigma G-dependent gene compared with the activity of E sigma G.