Zhao, Qiao; Nakashima, Jin; Chen, Fang; Yin, Yanbin; Fu, Chunxiang; Yun, Jianfei; Shao, Hui; Wang, Xiaoqiang; Wang, Zeng-Yu; Dixon, Richard A.
2013-01-01
The evolution of lignin biosynthesis was critical in the transition of plants from an aquatic to an upright terrestrial lifestyle. Lignin is assembled by oxidative polymerization of two major monomers, coniferyl alcohol and sinapyl alcohol. Although two recently discovered laccases, LAC4 and LAC17, have been shown to play a role in lignin polymerization in Arabidopsis thaliana, disruption of both genes only leads to a relatively small change in lignin content and only under continuous illumination. Simultaneous disruption of LAC11 along with LAC4 and LAC17 causes severe plant growth arrest, narrower root diameter, indehiscent anthers, and vascular development arrest with lack of lignification. Genome-wide transcript analysis revealed that all the putative lignin peroxidase genes are expressed at normal levels or even higher in the laccase triple mutant, suggesting that lignin laccase activity is necessary and nonredundant with peroxidase activity for monolignol polymerization during plant vascular development. Interestingly, even though lignin deposition in roots is almost completely abolished in the lac11 lac4 lac17 triple mutant, the Casparian strip, which is lignified through the activity of peroxidase, is still functional. Phylogenetic analysis revealed that lignin laccase genes have no orthologs in lower plant species, suggesting that the monolignol laccase genes diverged after the evolution of seed plants. PMID:24143805
Insights into lignin degradation and its potential industrial applications.
Abdel-Hamid, Ahmed M; Solbiati, Jose O; Cann, Isaac K O
2013-01-01
Lignocellulose is an abundant biomass that provides an alternative source for the production of renewable fuels and chemicals. The depolymerization of the carbohydrate polymers in lignocellulosic biomass is hindered by lignin, which is recalcitrant to chemical and biological degradation due to its complex chemical structure and linkage heterogeneity. The role of fungi in delignification due to the production of extracellular oxidative enzymes has been studied more extensively than that of bacteria. The two major groups of enzymes that are involved in lignin degradation are heme peroxidases and laccases. Lignin-degrading peroxidases include lignin peroxidase (LiP), manganese peroxidase (MnP), versatile peroxidase (VP), and dye-decolorizing peroxidase (DyP). LiP, MnP, and VP are class II extracellular fungal peroxidases that belong to the plant and microbial peroxidases superfamily. LiPs are strong oxidants with high-redox potential that oxidize the major non-phenolic structures of lignin. MnP is an Mn-dependent enzyme that catalyzes the oxidation of various phenolic substrates but is not capable of oxidizing the more recalcitrant non-phenolic lignin. VP enzymes combine the catalytic activities of both MnP and LiP and are able to oxidize Mn(2+) like MnP, and non-phenolic compounds like LiP. DyPs occur in both fungi and bacteria and are members of a new superfamily of heme peroxidases called DyPs. DyP enzymes oxidize high-redox potential anthraquinone dyes and were recently reported to oxidize lignin model compounds. The second major group of lignin-degrading enzymes, laccases, are found in plants, fungi, and bacteria and belong to the multicopper oxidase superfamily. They catalyze a one-electron oxidation with the concomitant four-electron reduction of molecular oxygen to water. Fungal laccases can oxidize phenolic lignin model compounds and have higher redox potential than bacterial laccases. In the presence of redox mediators, fungal laccases can oxidize non-phenolic lignin model compounds. In addition to the peroxidases and laccases, fungi produce other accessory oxidases such as aryl-alcohol oxidase and the glyoxal oxidase that generate the hydrogen peroxide required by the peroxidases. Lignin-degrading enzymes have attracted the attention for their valuable biotechnological applications especially in the pretreatment of recalcitrant lignocellulosic biomass for biofuel production. The use of lignin-degrading enzymes has been studied in various applications such as paper industry, textile industry, wastewater treatment and the degradation of herbicides. Copyright © 2013 Elsevier Inc. All rights reserved.
2012-01-01
Background Use of crude ligninase of bacterial origin is one of the most promising ways to improve the practical biodegradation of lignocellulosic biomass. However, lignin is composed of diverse monolignols with different abundance levels in different plant biomass and requires different proportions of ligninase to realize efficient degradation. To improve activity and reduce cost, the simultaneous submerged fermentation of laccase and lignin peroxidase (LiP) from a new bacterial strain, Streptomyces cinnamomensis, was studied by adopting formulation design, principal component analysis, regression analysis and unconstrained mathematical programming. Results The activities of laccase and LiP from S. cinnamomensis cultured with the optimal medium formulations were improved to be five to eight folders of their initial activities, and the measured laccase:LiP activity ratios reached 0.1, 0.4 and 1.7 when cultured on medium with formulations designed to produce laccase:LiP complexes with theoretical laccase:LiP activity ratios of 0.05 to 0.1, 0.5 to 1 and 1.1 to 2. Conclusion Both the laccase and LiP activities and also the activity ratio of laccase to LiP could be controlled by the medium formulation as designed. Using a crude laccase-LiP complex with a specially designed laccase:LiP activity ratio has the potential to improve the degradation of various plant lignins composed of diverse monolignols with different abundance levels. PMID:22429569
Lignin degradation by selected fungal species.
Knežević, Aleksandar; Milovanović, Ivan; Stajić, Mirjana; Lončar, Nikola; Brčeski, Ilija; Vukojević, Jelena; Cilerdžić, Jasmina
2013-06-01
As biological decomposition of plant biomass represents a popular alternative environmental-friendly and economically justified process, screening of ligninolytic enzyme systems of various fungal species is a topical study area. The goal of the study was to obtain clear insight into the dynamics of laccase, Mn-dependent peroxidase, and Mn-independent peroxidase activity and levels of wheat straw lignin degradation in seven wood-rotting fungi. The best laccase producers were Pleurotus ostreatus and Pleurotus eryngii. Lenzites betulinus and Fomitopsis pinicola were the best Mn-dependent peroxidase producers, and P. ostreatus the weakest one. The peak of Mn-independent peroxidase was noted in Dichomytus squalens, and the minimum value in P. ostreatus. The profiles of the three enzymes, obtained by isoelectric focusing, were variable depending on the species and cultivation period. D. squalens was the best lignin degrader (34.1% of total lignin amount), and P. ostreatus and P. eryngii the weakest ones (7.1% and 14.5%, respectively). Copyright © 2013 Elsevier Ltd. All rights reserved.
A novel extracellular multicopper oxidase from Phanerochaete chrysosporium with ferroxidase activity
Luis F. Larrondo; Loreto Salas; Francisco Melo; Rafael Vicuna; Daniel Cullen
2003-01-01
Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified...
Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
D /Souza, T.M.; Merritt, C.S.; Reddy, C.A.
1999-12-01
Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units aremore » structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.« less
Pérez, J.; de la Rubia, T.; Hamman, O. Ben; Martínez, J.
1998-01-01
Lignin-degrading enzymes were partially purified from supernatant solutions obtained from Phanerochaete flavido-alba-decolorized olive oil mill wastewaters (OMW). The dominant enzymes, manganese peroxidases, exhibited different isoform patterns in decolorized OMW-containing cultures than in residue-free samples. Laccase induction was also detected in OMW-containing cultures but not in control cultures. PMID:9647858
Isolation of Thermophilic Lignin Degrading Bacteria from Oil-Palm Empty Fruit Bunch (EFB) Compost
NASA Astrophysics Data System (ADS)
Lai, C. M. T.; Chua, H. B.; Danquah, M. K.; Saptoro, A.
2017-06-01
Empty Fruit Bunch (EFB) is a potential and sustainable feedstock for bioethanol production due to its high cellulosic content and availability in Malaysia. Due to high lignin content of EFB and the lack of effective delignification process, commercial bioethanol production from EFB is presently not viable. Enzymatic delignification has been identified as one of the key steps in utilising EFB as a feedstock for bioethanol conversion. To date, limited work has been reported on the isolation of lignin degrading bacteria. Hence, there is a growing interest to search for new lignin degrading bacteria with greater tolerance to temperature and high level of ligninolytic enzymes for more effective lignin degradation. This study aimed to isolate and screen thermophilic ligninolytic microorganisms from EFB compost. Ten isolates were successfully isolated from EFB compost. Although they are not capable of decolorizing Methylene Blue (MB) dye under agar plate assay method, they are able to utilize lignin mimicked compound - guaiacol as a sole carbon on the agar plate assay. This infers that there is no correlation of ligninolytic enzymes with dye decolourization for all the isolates that have been isolated. However, they are able to produce ligninolytic enzymes (Lignin peroxidase, Manganese peroxidase, Laccase) in Minimal Salt Medium with Kraft Lignin (MSM-KL) with Lignin Peroxidase (LiP) as the predominant enzyme followed by Manganese Peroxidase (MnP) and Laccase (Lac). Among all the tested isolates, CLMT 29 has the highest LiP production up to 8.7673 U/mL following 24 h of growth.
Tekere, M; Zvauya, R; Read, J S
2001-01-01
Lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase activities in selected sub-tropical white rot fungal species from Zimbabwe were determined. The enzyme activities were assayed at varying concentrations of C, N and Mn2+. Manganese peroxidase and laccase activities were the only expressed activities in the fungi under the culture conditions tested. Trametes species, T. cingulata, T. elegans and T. pocas produced the highest manganese peroxidase activities in a medium containing high carbon and low nitrogen conditions. High nitrogen conditions favoured high manganese peroxidase activity in DSPM95, L. velutinus and Irpex spp. High manganese peroxidase activity was notable for T. versicolor when both carbon and nitrogen in the medium were present at high levels. Laccase production by the isolates was highest under conditions of high nitrogen and those conditions with both nitrogen and carbon at high concentration. Mn2+ concentrations between 11-25 ppm gave the highest manganese peroxidase activity compared to a concentration of 40 ppm or when there was no Mn2+ added. Laccase activity was less influenced by Mn2+ levels. While some laccase activity was produced in the absence of Mn2+, the enzyme levels were higher when Mn2+ was added to the culture medium.
Xu, Jian Z; Zhang, Jun L; Hu, Kai H; Zhang, Wei G
2013-01-01
Mushrooms are able to secrete lignin peroxidase (LiP) and manganese peroxidase (MnP), and able to use the cellulose as sources of carbon. This article focuses on the relation between peroxidase-secreting capacity and cultivation period of mushrooms with non-laccase activity. Methylene blue and methyl catechol qualitative assay and spectrophotometry quantitative assay show LiP secreting unvaryingly accompanies the MnP secreting in mushroom strains. The growth rates of hyphae are detected by detecting the dry hyphal mass. We link the peroxidase activities to growth rate of mushrooms and then probe into the relationship between them. The results show that there are close relationships between LiP- and/or MnP-secretory capacities and the cultivation periods of mushrooms. The strains with high LiP and MnP activities have short cultivation periods. However, those strains have long cultivation periods because of the low levels of secreted LiP and/or MnP, even no detectable LiP and/or MnP activity. This study provides the first evidence on the imitate relation between the level of secreted LiP and MnP activities and cultivation periods of mushrooms with non-laccase activity. Our study has significantly increased the understanding of the role of LiP and MnP in the growth and development of mushrooms with non-laccase activity. PMID:22966760
Mishra, Vartika; Jana, Asim K; Jana, Mithu Maiti; Gupta, Antriksh
2017-06-01
Sweet sorghum bagasse (SSB) from food processing and agricultural industry has attracted the attention for uses in production of biofuel, enzymes and other products. The alteration in lignocellulolytic enzymes by use of supplements in fungal pretreatment of SSB to achieve higher lignin degradation, selectivity value and enzymatic hydrolysis to fermentable sugar was studied. Fungal strain Coriolus versicolor was selected for pretreatment due to high ligninolytic and low cellulolytic enzyme production resulting in high lignin degradation and selectivity value. SSB was pretreated with supplements of veratryl alcohol, syringic acid, catechol, gallic acid, vanillin, guaiacol, CuSO 4 and MnSO 4 . The best results were obtained with CuSO 4 , gallic acid and syringic acid supplements. CuSO 4 increased the activities of laccase (4.9-fold) and polyphenol oxidase (1.9-fold); gallic acid increased laccase (3.5-fold) and manganese peroxidase (2.5-fold); and syringic acid increased laccase (5.6-fold), lignin peroxidase (13-fold) and arylalcohol oxidase (2.8-fold) resulting in enhanced lignin degradations and selectivity values than the control. Reduced cellulolytic enzyme activities resulted in high cellulose recovery. Enzymatic hydrolysis of pretreated SSB yielded higher sugar due to degradation of lignin and reduced the crystallinity of cellulose. The study showed that supplements could be used to improve the pretreatment process. The results were confirmed by scanning electron microscopy, X-ray diffraction, Fourier transform infrared spectroscopy and thermogravimetric/differential thermogravimetric analysis of SSB.
Xu, Jian Z; Zhang, Jun L; Hu, Kai H; Zhang, Wei G
2013-05-01
Mushrooms are able to secrete lignin peroxidase (LiP) and manganese peroxidase (MnP), and able to use the cellulose as sources of carbon. This article focuses on the relation between peroxidase-secreting capacity and cultivation period of mushrooms with non-laccase activity. Methylene blue and methyl catechol qualitative assay and spectrophotometry quantitative assay show LiP secreting unvaryingly accompanies the MnP secreting in mushroom strains. The growth rates of hyphae are detected by detecting the dry hyphal mass. We link the peroxidase activities to growth rate of mushrooms and then probe into the relationship between them. The results show that there are close relationships between LiP- and/or MnP-secretory capacities and the cultivation periods of mushrooms. The strains with high LiP and MnP activities have short cultivation periods. However, those strains have long cultivation periods because of the low levels of secreted LiP and/or MnP, even no detectable LiP and/or MnP activity. This study provides the first evidence on the imitate relation between the level of secreted LiP and MnP activities and cultivation periods of mushrooms with non-laccase activity. Our study has significantly increased the understanding of the role of LiP and MnP in the growth and development of mushrooms with non-laccase activity. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Fungal biodegradation and enzymatic modification of lignin
Dashtban, Mehdi; Schraft, Heidi; Syed, Tarannum A.; Qin, Wensheng
2010-01-01
Lignin, the most abundant aromatic biopolymer on Earth, is extremely recalcitrant to degradation. By linking to both hemicellulose and cellulose, it creates a barrier to any solutions or enzymes and prevents the penetration of lignocellulolytic enzymes into the interior lignocellulosic structure. Some basidiomycetes white-rot fungi are able to degrade lignin efficiently using a combination of extracellular ligninolytic enzymes, organic acids, mediators and accessory enzymes. This review describes ligninolytic enzyme families produced by these fungi that are involved in wood decay processes, their molecular structures, biochemical properties and the mechanisms of action which render them attractive candidates in biotechnological applications. These enzymes include phenol oxidase (laccase) and heme peroxidases [lignin peroxidase (LiP), manganese peroxidase (MnP) and versatile peroxidase (VP)]. Accessory enzymes such as H2O2-generating oxidases and degradation mechanisms of plant cell-wall components in a non-enzymatic manner by production of free hydroxyl radicals (·OH) are also discussed. PMID:21968746
Torres-Farradá, Giselle; Manzano León, Ana M.; Rineau, François; Ledo Alonso, Lucía L.; Sánchez-López, María I.; Thijs, Sofie; Colpaert, Jan; Ramos-Leal, Miguel; Guerra, Gilda; Vangronsveld, Jaco
2017-01-01
White-rot fungi (WRF) and their ligninolytic enzymes (laccases and peroxidases) are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba). All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR)-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains. PMID:28588565
Liers, Christiane; Arnstadt, Tobias; Ullrich, René; Hofrichter, Martin
2011-10-01
The degradation of lignocellulose and the secretion of extracellular oxidoreductases were investigated in beech-wood (Fagus sylvatica) microcosms using 11 representative fungi of four different ecophysiological and taxonomic groups causing: (1) classic white rot of wood (e.g. Phlebia radiata), (2) 'nonspecific' wood rot (e.g. Agrocybe aegerita), (3) white rot of leaf litter (Stropharia rugosoannulata) or (4) soft rot of wood (e.g. Xylaria polymorpha). All strong white rotters produced manganese-oxidizing peroxidases as the key enzymes of ligninolysis (75-2200 mU g(-1)), whereas lignin peroxidase activity was not detectable in the wood extracts. Interestingly, activities of two recently discovered peroxidases - aromatic peroxygenase and a manganese-independent peroxidase of the DyP-type - were detected in the culture extracts of A. aegerita (up to 125 mU g(-1)) and Auricularia auricula-judae (up to 400 mU g(-1)), respectively. The activity of classic peroxidases correlated to some extent with the removal of wood components (e.g. Klason lignin) and the release of small water-soluble fragments (0.5-1.0 kDa) characterized by aromatic constituents. In contrast, laccase activity correlated with the formation of high-molecular mass fragments (30-200 kDa). The differences observed in the degradation patterns allow to distinguish the rot types caused by basidiomycetes and ascomycetes and may be suitable for following the effects of oxidative key enzymes (ligninolytic peroxidases vs. laccases, role of novel peroxidases) during wood decay. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Achyuthan, Komandoor; Adams, Paul; Simmons, Blake
2011-07-13
Lignin composition (monolignol types of coniferyl, sinapyl or p-coumaryl alcohol) is causally related to biomass recalcitrance. We describe multiwavelength (220, 228, 240, 250, 260, 290, 295, 300, 310 or 320 nm) absorption spectroscopy of coniferyl alcohol and its laccase- or peroxidase-catalyzed products during real time kinetic, pseudo-kinetic and endpoint analyses, in optical turn on or turn off modes, under acidic or basic conditions. Reactions in microwell plates and 100 mu L volumes demonstrated assay miniaturization and high throughput screening capabilities. Bathochromic and hypsochromic shifts along with hyperchromicity or hypochromicity accompanied enzymatic oxidations by laccase or peroxidase. The limits of detectionmore » and quantitation of coniferyl alcohol averaged 2.4 and 7.1 mu M respectively, with linear trend lines over 3 to 4 orders of magnitude. Coniferyl alcohol oxidation was evident within 10 minutes or with 0.01 mu g/mL laccase and 2 minutes or 0.001 mu g/mL peroxidase. Detection limit improved to 1.0 mu M coniferyl alcohol with Km of 978.7 +/- 150.7 mu M when examined at 260 nm following 30 minutes oxidation with 1.0 mu g/mL laccase. Our assays utilized the intrinsic spectroscopic properties of coniferyl alcohol or its oxidation products for enabling detection, without requiring chemical synthesis or modification of the substrate or product(s). These studies facilitate lignin compositional analyses and augment pretreatment strategies for reducing biomass recalcitrance.« less
A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity
Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel
2003-01-01
Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2′-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 μM. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088
Xu, Zhaoxian; Qin, Ling; Cai, Mufeng; Hua, Wenbo; Jin, Mingjie
2018-05-01
Bacterial systems have drawn an increasing amount of attention on lignin valorization due to their rapid growth and powerful environmental adaptability. In this study, Klebsiella pneumoniae NX-1, Pseudomonas putida NX-1, and Ochrobactrum tritici NX-1 with ligninolytic potential were isolated from leaf mold samples. Their ligninolytic capabilities were determined by measuring (1) the cell growth on kraft lignin as the sole carbon source, (2) the decolorization of kraft lignin and lignin-mimicking dyes, (3) the micro-morphology changes and transformations of chemical groups in kraft lignin, and (4) the ligninolytic enzyme activities of these three isolates. To the best of our knowledge, this is the first report that Ochrobactrum tritici species can depolymerize and metabolize lignin. Moreover, laccase, lignin peroxidase, and Mn-peroxidase showed high activities in P. putida NX-1. Due to their excellent ligninolytic capabilities, these three bacteria are important supplements to ligninolytic bacteria library and could be valuable in lignin valorization.
Enzymatic Processes to Unlock the Lignin Value
Hämäläinen, Veera; Grönroos, Toni; Suonpää, Anu; Heikkilä, Matti Wilhem; Romein, Bastiaan; Ihalainen, Petri; Malandra, Sara; Birikh, Klara R.
2018-01-01
Main hurdles of lignin valorization are its diverse chemical composition, recalcitrance, and poor solubility due to high-molecular weight and branched structure. Controlled fragmentation of lignin could lead to its use in higher value products such as binders, coatings, fillers, etc. Oxidative enzymes (i.e., laccases and peroxidases) have long been proposed as a potentially promising tool in lignin depolymerization. However, their application was limited to ambient pH, where lignin is poorly soluble in water. A Finnish biotechnology company, MetGen Oy, that designs and supplies industrial enzymes, has developed and brought to market several lignin oxidizing enzymes, including an extremely alkaline lignin oxidase MetZyme® LIGNO™, a genetically engineered laccase of bacterial origin. This enzyme can function at pH values as high as 10–11 and at elevated temperatures, addressing lignin at its soluble state. In this article, main characteristics of this enzyme as well as its action on bulk lignin coming from an industrial process are demonstrated. Lignin modification by MetZyme® LIGNO™ was characterized by size exclusion chromatography, UV spectroscopy, and dynamic light scattering for monitoring particle size of solubilized lignin. Under highly alkaline conditions, laccase treatment not only decreased molecular weight of lignin but also increased its solubility in water and altered its dispersion properties. Importantly, organic solvent-free soluble lignin fragmentation allowed for robust industrially relevant membrane separation technologies to be applicable for product fractionation. These enzyme-based solutions open new opportunities for biorefinery lignin valorization thus paving the way for economically viable biorefinery business. PMID:29623274
Mishra, Vartika; Jana, Asim K
2017-09-01
Sweet sorghum (Sorghum sp.) has high biomass yield. Hydrolysis of lignocellulosic sweet sorghum bagasse (SSB) to fermentable sugar could be useful for manufacture of biofuel or other fermentation products. Pretreatment of lignocellulosic biomass to degrade lignin before enzymatic hydrolysis is a key step. Fungal pretreatment of SSB with combined CuSO 4 -gallic acid supplements in solid-state fermentation (SSF) to achieve higher lignin degradation, selectivity value (SV), and enzymatic hydrolysis to sugar was studied. Coriolus versicolor was selected due to high activities of ligninolytic enzymes laccase, lignin peroxidase (LiP), manganese peroxidase (MnP), polyphenol oxidase (PPO), and arylalcohol oxidase (AAO) and low activities of cellulolytic enzymes CMCase, FPase, and β-glucosidase with high lignin degradation and SV in 20 days. CuSO 4 /gallic acid increased the activities of ligninolytic enzymes resulting in enhanced lignin degradations and SVs. Cumulative/synergistic effect of combined supplements further increased the activities of laccase, LiP, MnP, PPO, and AAO by 7.6, 14.6, 2.67, 2.06, and 2.15-folds, respectively (than control), resulting in highest lignin degradation 31.1 ± 1.4% w/w (1.56-fold) and SV 2.33 (3.58-fold). Enzymatic hydrolysis of pretreated SSB yielded higher (~2.2 times) fermentable sugar. The study showed combined supplements can improve fungal pretreatment of lignocellulosic biomass. XRD, SEM, FTIR, and TGA/DTG of SSB confirmed the results.
Chen, Ming; Zeng, Guangming; Tan, Zhongyang; Jiang, Min; Li, Hui; Liu, Lifeng; Zhu, Yi; Yu, Zhen; Wei, Zhen; Liu, Yuanyuan; Xie, Gengxin
2011-01-01
Previous works have demonstrated that ligninolytic enzymes mediated effective degradation of lignin wastes. The degrading ability greatly relied on the interactions of ligninolytic enzymes with lignin. Ligninolytic enzymes mainly contain laccase (Lac), lignin peroxidase (LiP) and manganese peroxidase (MnP). In the present study, the binding modes of lignin to Lac, LiP and MnP were systematically determined, respectively. Robustness of these modes was further verified by molecular dynamics (MD) simulations. Residues GLU460, PRO346 and SER113 in Lac, residues ARG43, ALA180 and ASP183 in LiP and residues ARG42, HIS173 and ARG177 in MnP were most crucial in binding of lignin, respectively. Interactional analyses showed hydrophobic contacts were most abundant, playing an important role in the determination of substrate specificity. This information is an important contribution to the details of enzyme-catalyzed reactions in the process of lignin biodegradation, which can be used as references for designing enzyme mutants with a better lignin-degrading activity. PMID:21980516
Yakovlev, Igor A; Hietala, Ari M; Courty, Pierre-Emmanuel; Lundell, Taina; Solheim, Halvor; Fossdal, Carl Gunnar
2013-07-01
The pathogenic white-rot basidiomycete Heterobasidion irregulare is able to remove lignin and hemicellulose prior to cellulose during the colonization of root and stem xylem of conifer and broadleaf trees. We identified and followed the regulation of expression of genes belonging to families encoding ligninolytic enzymes. In comparison with typical white-rot fungi, the H. irregulare genome has exclusively the short-manganese peroxidase type encoding genes (6 short-MnPs) and thereby a slight contraction in the pool of class II heme-containing peroxidases, but an expansion of the MCO laccases with 17 gene models. Furthermore, the genome shows a versatile set of other oxidoreductase genes putatively involved in lignin oxidation and conversion, including 5 glyoxal oxidases, 19 quinone-oxidoreductases and 12 aryl-alcohol oxidases. Their genetic multiplicity and gene-specific regulation patterns on cultures based on defined lignin, cellulose or Norway spruce lignocellulose substrates suggest divergent specificities and physiological roles for these enzymes. While the short-MnP encoding genes showed similar transcript levels upon fungal growth on heartwood and reaction zone (RZ), a xylem defense tissue rich in phenolic compounds unique to trees, a subset of laccases showed higher gene expression in the RZ cultures. In contrast, other oxidoreductases depending on initial MnP activity showed generally lower transcript levels on RZ than on heartwood. These data suggest that the rate of fungal oxidative conversion of xylem lignin differs between spruce RZ and heartwood. It is conceivable that in RZ part of the oxidoreductase activities of laccases are related to the detoxification of phenolic compounds involved in host-defense. Expression of the several short-MnP enzymes indicated an important role for these enzymes in effective delignification of wood by H. irregulare. Copyright © 2013 Elsevier Inc. All rights reserved.
Szabo, Orsolya Erzsebet; Csiszar, Emilia; Toth, Karolina; Szakacs, George; Koczka, Bela
2015-01-01
Ligninolytic and hydrolytic enzymes were produced with six selected fungi on flax substrate by solid state fermentation (SSF). The extracellular enzyme production of the organisms in two SSF media was evaluated by measuring the soluble protein concentration and the filter paper, endoxylanase, 1,4-β-d-glucosidase, 1,4-β-d-endoglucanase, polygalacturonase, lignin peroxidase, manganese peroxidase and laccase activities of the clear culture solutions produced by conventional extraction from the SSF materials. The SSF material of the best enzyme producer (Trichoderma virens TUB F-498) was further investigated to enhance the enzyme recovery by low frequency ultrasound treatment. Performance of both the original and ultrasound macerated crude enzyme mixtures was evaluated in degradation of the colored lignin-containing and waxy materials of raw linen fabric. Results proved that sonication (at 40%, 60% and 80% amplitudes, for 60min) did not result in reduction in the filter paper, lignin peroxidase and laccase activities of the crude enzyme solution, but has a significant positive effect on the efficiency of enzyme extraction from the SSF material. Depending on the parameters of sonication, the enzyme activities in the extracts obtained can be increased up to 129-413% of the original activities measured in the control extracts recovered by a common magnetic stirrer. Sonication also has an effect on both the enzymatic removal of the lignin-containing color materials and hydrophobic surface layer from the raw linen. Copyright © 2014 Elsevier B.V. All rights reserved.
Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise
2011-01-01
Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792
Wang, Wenya; Zhang, Chao; Sun, Xinxiao; Su, Sisi; Li, Qiang; Linhardt, Robert J
2017-06-01
Lignin is the second most abundant bio-resource in nature. It is increasingly important to convert lignin into high value-added chemicals to accelerate the development of the lignocellulose biorefinery. Over the past several decades, physical and chemical methods have been widely explored to degrade lignin and convert it into valuable chemicals. Unfortunately, these developments have lagged because of several difficulties, of which high energy consumption and non-specific cleavage of chemical bonds in lignin remain the greatest challenges. A large number of enzymes have been discovered for lignin degradation and these are classified as radical lignolytic enzymes and non-radical lignolytic enzymes. Radical lignolytic enzymes, including laccases, lignin peroxidases, manganese peroxidases and versatile peroxidases, are radical-based bio-catalysts, which degrade lignins through non-specific cleavage of chemical bonds but can also catalyze the radical-based re-polymerization of lignin fragments. In contrast, non-radical lignolytic enzymes selectively cleave chemical bonds in lignin and lignin model compounds and, thus, show promise for use in the preparation of high value-added chemicals. In this mini-review, recent developments on non-radical lignolytic enzymes are discussed. These include recently discovered non-radical lignolytic enzymes, their metabolic pathways for lignin conversion, their recent application in the lignin biorefinery, and the combination of bio-catalysts with physical/chemical methods for industrial development of the lignin refinery.
Investigating the degradation process of kraft lignin by β-proteobacterium, Pandoraea sp. ISTKB.
Kumar, Madan; Singh, Jyoti; Singh, Manoj Kumar; Singhal, Anjali; Thakur, Indu Shekhar
2015-10-01
The present study investigates the kraft lignin (KL) degrading potential of novel alkalotolerant Pandoraea sp. ISTKB utilizing KL as sole carbon source. The results displayed 50.2 % reduction in chemical oxygen demand (COD) and 41.1 % decolorization after bacterial treatment. The maximum lignin peroxidase (LiP) and manganese peroxidase (MnP) activity detected was 2.73 and 4.33 U ml(-1), respectively, on day 3. The maximum extracellular and intracellular laccase activities observed were 1.32 U ml(-1) on day 5 and 4.53 U ml(-1) on day 4, respectively. The decolorization and degradation was maximum on day 2. Further, it registered an increase with the production of extracellular laccase. This unusual trend of decolorization and degradation was studied using various aromatic compounds and dyes. SEM and FTIR results indicated significant change in surface morphology and functional group composition during the course of degradation. Gas chromatography and mass spectroscopy (GC-MS) analysis confirmed KL degradation by emergence of new peaks and the identification of low molecular weight aromatic intermediates in treated sample. The degradation of KL progressed through the generation of phenolic intermediates. The identified intermediates implied the degradation of hydroxyphenyl, ferulic acid, guaiacyl, syringyl, phenylcoumarane, and pinoresinol components commonly found in lignin. The degradation, decolorization, and GC-MS analysis indicated potential application of the isolate Pandoraea sp. ISTKB in treatment of lignin-containing pollutants and KL valorization.
Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake
2015-12-01
The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.
Schroyen, Michel; Van Hulle, Stijn W H; Holemans, Sander; Vervaeren, Han; Raes, Katleen
2017-11-01
The impact of various phenolic compounds, vanillic acid, ferulic acid, p-coumaric acid and 4-hydroxybenzoic acid on anaerobic digestion of lignocellulosic biomass (hemp straw and miscanthus) was studied. Such phenolic compounds have been known to inhibit biogas production during anaerobic digestion. The different phenolic compounds were added in various concentrations: 0, 100, 500, 1000 and 2000mg/L. A difference in inhibition of biomethane production between the phenolic compounds was noted. Hydrolysis rate, during anaerobic digestion of miscanthus was inhibited up to 50% by vanillic acid, while vanillic acid had no influence on the initial rate of biogas production during the anaerobic digestion of hemp straw. Miscanthus has a higher lignin concentration (12-30g/100gDM) making it less accessible for degradation, and in combination with phenolic compounds released after harsh pretreatments, it can cause severe inhibition levels during the anaerobic digestion, lowering biogas production. To counter the inhibition, lignin degrading enzymes can be used to remove or degrade the inhibitory phenolic compounds. The interaction of laccase and versatile peroxidase individually with the different phenolic compounds was studied to have insight in the polymerization of inhibitory compounds or breakdown of lignocellulose. Hemp straw and miscanthus were incubated with 0, 100 and 500mg/L of the different phenolic compounds for 0, 6 and 24h and pretreated with the lignin degrading enzymes. A laccase pretreatment successfully detoxified the substrate, while versatile peroxidase however was inhibited by 100mg/L of each of the individual phenolic compounds. Finally a combination of enzymatic detoxification and subsequent biogas production showed that a decrease in phenolic compounds by laccase treatment can considerably lower the inhibition levels of the biogas production. Copyright © 2017 Elsevier Ltd. All rights reserved.
Granja-Travez, Rommel Santiago; Wilkinson, Rachael C; Persinoti, Gabriela Felix; Squina, Fabio M; Fülöp, Vilmos; Bugg, Timothy D H
2018-05-01
The identification of enzymes responsible for oxidation of lignin in lignin-degrading bacteria is of interest for biotechnological valorization of lignin to renewable chemical products. The genome sequences of two lignin-degrading bacteria, Ochrobactrum sp., and Paenibacillus sp., contain no B-type DyP peroxidases implicated in lignin degradation in other bacteria, but contain putative multicopper oxidase genes. Multi-copper oxidase CueO from Ochrobactrum sp. was expressed and reconstituted as a recombinant laccase-like enzyme, and kinetically characterized. Ochrobactrum CueO shows activity for oxidation of β-aryl ether and biphenyl lignin dimer model compounds, generating oxidized dimeric products, and shows activity for oxidation of Ca-lignosulfonate, generating vanillic acid as a low molecular weight product. The crystal structure of Ochrobactrum CueO (OcCueO) has been determined at 1.1 Å resolution (PDB: 6EVG), showing a four-coordinate mononuclear type I copper center with ligands His495, His434 and Cys490 with Met500 as an axial ligand, similar to that of Escherichia coli CueO and bacterial azurin proteins, whereas fungal laccase enzymes contain a three-coordinate type I copper metal center. A trinuclear type 2/3 copper cluster was modeled into the active site, showing similar structure to E. coli CueO and fungal laccases, and three solvent channels leading to the active site. Site-directed mutagenesis was carried out on amino acid residues found in the solvent channels, indicating the importance for residues Asp102, Gly103, Arg221, Arg223, and Asp462 for catalytic activity. The work identifies a new bacterial multicopper enzyme with activity for lignin oxidation, and implicates a role for bacterial laccase-like multicopper oxidases in some lignin-degrading bacteria. Structural data are available in the PDB under the accession number 6EVG. © 2018 Federation of European Biochemical Societies.
The emerging role for bacteria in lignin degradation and bio-product formation.
Bugg, Timothy D H; Ahmad, Mark; Hardiman, Elizabeth M; Singh, Rahul
2011-06-01
The microbial degradation of lignin has been well studied in white-rot and brown-rot fungi, but is much less well studied in bacteria. Recent published work suggests that a range of soil bacteria, often aromatic-degrading bacteria, are able to break down lignin. The enzymology of bacterial lignin breakdown is currently not well understood, but extracellular peroxidase and laccase enzymes appear to be involved. There are also reports of aromatic-degrading bacteria isolated from termite guts, though there are conflicting reports on the ability of termite gut micro-organisms to break down lignin. If biocatalytic routes for lignin breakdown could be developed, then lignin represents a potentially rich source of renewable aromatic chemicals. Copyright © 2010 Elsevier Ltd. All rights reserved.
Comparison of different fungal enzymes for bleaching high-quality paper pulps.
Sigoillot, Cécile; Camarero, Susana; Vidal, Teresa; Record, Eric; Asther, Michèle; Pérez-Boada, Marta; Martínez, María Jesús; Sigoillot, Jean-Claude; Asther, Marcel; Colom, José F; Martínez, Angel T
2005-02-23
Wild and recombinant hydrolases and oxidoreductases with a potential interest for environmentally sound bleaching of high-quality paper pulp (from flax) were incorporated into a totally chlorine free (TCF) sequence that also included a peroxide stage. The ability of feruloyl esterase (from Aspergillus niger) and Mn2+-oxidizing peroxidases (from Phanerochaete chrysosporium and Pleurotus eryngii) to decrease the final lignin content of flax pulp was shown. Laccase from Pycnoporus cinnabarinus (without mediator) also caused a slight improvement of pulp brightness that was increased in the presence of aryl-alcohol oxidase. However, the best results were obtained when the laccase treatment was performed in the presence of a mediator, 1-hydroxybenzotriazol (HBT), enabling strong delignification of pulps. The enzymatic removal of lignin resulted in high-final brightness values that are difficult to attain by chemical bleaching of this type of pulp. A partial inactivation of laccase by HBT was observed but this negative effect was strongly reduced in the presence of pulp. The good results obtained with the same laccase expressed in A. niger at bioreactor scale, revealed the feasibility of using recombinant laccase for bleaching high-quality non-wood pulps in the presence of a mediator.
Cong, Bailin; Wang, Nengfei; Liu, Shenghao; Liu, Feng; Yin, Xiaofei; Shen, Jihong
2017-05-30
With the growing demand for fossil fuels and the severe energy crisis, lignocellulose is widely regarded as a promising cost-effective renewable resource for ethanol production, and the use of lignocellulose residues as raw material is remarkable. Polar organisms have important value in scientific research and development for their novelty, uniqueness and diversity. In this study, a fungus Aspergillus sydowii MS-19, with the potential for lignocellulose degradation was screened out and isolated from an Antarctic region. The growth profile of Aspergillus sydowii MS-19 was measured, revealing that Aspergillus sydowii MS-19 could utilize lignin as a sole carbon source. Its ability to synthesize low-temperature lignin peroxidase (Lip) and manganese peroxidase (Mnp) enzymes was verified, and the properties of these enzymes were also investigated. High-throughput sequencing was employed to identify and characterize the transcriptome of Aspergillus sydowii MS-19. Carbohydrate-Active Enzymes (CAZyme)-annotated genes in Aspergillus sydowii MS-19 were compared with those in the brown-rot fungus representative species, Postia placenta and Penicillium decumbens. There were 701CAZymes annotated in Aspergillus sydowii MS-19, including 17 cellulases and 19 feruloyl esterases related to lignocellulose-degradation. Remarkably, one sequence annotated as laccase was obtained, which can degrade lignin. Three peroxidase sequences sharing a similar structure with typical lignin peroxidase and manganese peroxidase were also found and annotated as haem-binding peroxidase, glutathione peroxidase and catalase-peroxidase. In this study, the fungus Aspergillus sydowii MS-19 was isolated and shown to synthesize low-temperature lignin-degrading enzymes: lignin peroxidase (Lip) and manganese peroxidase (Mnp). These findings provide useful information to improve our understanding of low-temperature lignocellulosic enzyme production by polar microorganisms and to facilitate research and applications of the novel Antarctic Aspergillus sydowii strain MS-19 as a potential lignocellulosic enzyme source.
Lignin depolymerization by fungal secretomes and a microbial sink
DOE Office of Scientific and Technical Information (OSTI.GOV)
Salvachúa, Davinia; Katahira, Rui; Cleveland, Nicholas S.
In Nature, powerful oxidative enzymes secreted by white rot fungi and some bacteria catalyze lignin depolymerization and some microbes are able to catabolize the resulting aromatic compounds as carbon and energy sources. Taken together, these two processes offer a potential route for microbial valorization of lignin. However, many challenges remain in realizing this concept, including that oxidative enzymes responsible for lignin depolymerization also catalyze polymerization of low molecular weight (LMW) lignin. Here, multiple basidiomycete secretomes were screened for ligninolytic enzyme activities in the presence of a residual lignin solid stream from a corn stover biorefinery, dubbed DMR-EH (Deacetylation, Mechanical Refining,more » and Enzymatic Hydrolysis) lignin. Two selected fungal secretomes, with high levels of laccases and peroxidases, were utilized for DMR-EH lignin depolymerization assays. The secretome from Pleurotus eryngii, which exhibited the highest laccase activity, reduced the lignin average molecular weight by 63% and 75% at pH 7 compared to the Mw of the control treated at the same conditions and the initial DMR-EH lignin, respectively, and was applied in further depolymerization assays as a function of time. As repolymerization was observed after 3 days of incubation, an aromatic-catabolic microbe (Pseudomonas putida KT2440) was incubated with the fungal secretome and DMR-EH lignin. These experiments demonstrated that the presence of the bacterium enhances lignin depolymerization, likely due to bacterial catabolism of LMW lignin, which may partially prevent repolymerization. In addition, proteomics was also applied to the P. eryngii secretome to identify the enzymes present in the fungal cocktail utilized for the depolymerization assays, which highlighted a significant number of glucose/ methanol/choline (GMC) oxidoreductases and laccases. Overall, this study demonstrates that ligninolytic enzymes can be used to partially depolymerize a solid, high lignin content biorefinery stream and that the presence of an aromatic-catabolic bacterium as a “microbial sink” improves the extent of enzymatic lignin depolymerization.« less
Lignin depolymerization by fungal secretomes and a microbial sink
Salvachua, Davinia; Katahira, Rui; Cleveland, Nicholas S.; ...
2016-08-25
In Nature, powerful oxidative enzymes secreted by white rot fungi and some bacteria catalyze lignin depolymerization and some microbes are able to catabolize the resulting aromatic compounds as carbon and energy sources. Taken together, these two processes offer a potential route for microbial valorization of lignin. However, many challenges remain in realizing this concept, including that oxidative enzymes responsible for lignin depolymerization also catalyze polymerization of low molecular weight (LMW) lignin. Here, multiple basidiomycete secretomes were screened for ligninolytic enzyme activities in the presence of a residual lignin solid stream from a corn stover biorefinery, dubbed DMR-EH (Deacetylation, Mechanical Refining,more » and Enzymatic Hydrolysis) lignin. Two selected fungal secretomes, with high levels of laccases and peroxidases, were utilized for DMR-EH lignin depolymerization assays. The secretome from Pleurotus eryngii, which exhibited the highest laccase activity, reduced the lignin average molecular weight (M w) by 63% and 75% at pH 7 compared to the M w of the control treated at the same conditions and the initial DMR-EH lignin, respectively, and was applied in further depolymerization assays as a function of time. As repolymerization was observed after 3 days of incubation, an aromatic-catabolic microbe ( Pseudomonas putida KT2440) was incubated with the fungal secretome and DMR-EH lignin. These experiments demonstrated that the presence of the bacterium enhances lignin depolymerization, likely due to bacterial catabolism of LMW lignin, which may partially prevent repolymerization. In addition, proteomics was also applied to the P. eryngii secretome to identify the enzymes present in the fungal cocktail utilized for the depolymerization assays, which highlighted a significant number of glucose/methanol/choline (GMC) oxidoreductases and laccases. Altogether, this study demonstrates that ligninolytic enzymes can be used to partially depolymerize a solid, high lignin content biorefinery stream and that the presence of an aromatic-catabolic bacterium as a 'microbial sink' improves the extent of enzymatic lignin depolymerization.« less
Lignin depolymerization by fungal secretomes and a microbial sink
DOE Office of Scientific and Technical Information (OSTI.GOV)
Salvachua, Davinia; Katahira, Rui; Cleveland, Nicholas S.
In Nature, powerful oxidative enzymes secreted by white rot fungi and some bacteria catalyze lignin depolymerization and some microbes are able to catabolize the resulting aromatic compounds as carbon and energy sources. Taken together, these two processes offer a potential route for microbial valorization of lignin. However, many challenges remain in realizing this concept, including that oxidative enzymes responsible for lignin depolymerization also catalyze polymerization of low molecular weight (LMW) lignin. Here, multiple basidiomycete secretomes were screened for ligninolytic enzyme activities in the presence of a residual lignin solid stream from a corn stover biorefinery, dubbed DMR-EH (Deacetylation, Mechanical Refining,more » and Enzymatic Hydrolysis) lignin. Two selected fungal secretomes, with high levels of laccases and peroxidases, were utilized for DMR-EH lignin depolymerization assays. The secretome from Pleurotus eryngii, which exhibited the highest laccase activity, reduced the lignin average molecular weight (M w) by 63% and 75% at pH 7 compared to the M w of the control treated at the same conditions and the initial DMR-EH lignin, respectively, and was applied in further depolymerization assays as a function of time. As repolymerization was observed after 3 days of incubation, an aromatic-catabolic microbe ( Pseudomonas putida KT2440) was incubated with the fungal secretome and DMR-EH lignin. These experiments demonstrated that the presence of the bacterium enhances lignin depolymerization, likely due to bacterial catabolism of LMW lignin, which may partially prevent repolymerization. In addition, proteomics was also applied to the P. eryngii secretome to identify the enzymes present in the fungal cocktail utilized for the depolymerization assays, which highlighted a significant number of glucose/methanol/choline (GMC) oxidoreductases and laccases. Altogether, this study demonstrates that ligninolytic enzymes can be used to partially depolymerize a solid, high lignin content biorefinery stream and that the presence of an aromatic-catabolic bacterium as a 'microbial sink' improves the extent of enzymatic lignin depolymerization.« less
Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N
2015-09-01
Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase.
Scully, Erin D.; Hoover, Kelli; Carlson, John; Tien, Ming; Geib, Scott M.
2012-01-01
Wood is a highly intractable food source, yet many insects successfully colonize and thrive in this challenging niche. Overcoming the lignin barrier of wood is a key challenge in nutrient acquisition, but full depolymerization of intact lignin polymers has only been conclusively demonstrated in fungi and is not known to occur by enzymes produced by insects or bacteria. Previous research validated that lignocellulose and hemicellulose degradation occur within the gut of the wood boring insect, Anoplophora glabripennis (Asian longhorned beetle), and that a fungal species, Fusarium solani (ATCC MYA 4552), is consistently associated with the larval stage. While the nature of this relationship is unresolved, we sought to assess this fungal isolate's ability to degrade lignocellulose and cell wall polysaccharides and to extract nutrients from woody tissue. This gut-derived fungal isolate was inoculated onto a wood-based substrate and shotgun proteomics using Multidimensional Protein Identification Technology (MudPIT) was employed to identify 400 expressed proteins. Through this approach, we detected proteins responsible for plant cell wall polysaccharide degradation, including proteins belonging to 28 glycosyl hydrolase families and several cutinases, esterases, lipases, pectate lyases, and polysaccharide deacetylases. Proteinases with broad substrate specificities and ureases were observed, indicating that this isolate has the capability to digest plant cell wall proteins and recycle nitrogenous waste under periods of nutrient limitation. Additionally, several laccases, peroxidases, and enzymes involved in extracellular hydrogen peroxide production previously implicated in lignin depolymerization were detected. In vitro biochemical assays were conducted to corroborate MudPIT results and confirmed that cellulases, glycosyl hydrolases, xylanases, laccases, and Mn- independent peroxidases were active in culture; however, lignin- and Mn- dependent peroxidase activities were not detected While little is known about the role of filamentous fungi and their associations with insects, these findings suggest that this isolate has the endogenous potential to degrade lignocellulose and extract nutrients from woody tissue. PMID:22496740
Lignin Peroxidase from Streptomyces viridosporus T7A: Enzyme Concentration Using Ultrafiltration
NASA Astrophysics Data System (ADS)
Gottschalk, Leda M. F.; Bon, Elba P. S.; Nobrega, Ronaldo
It is well known that lignin degradation is a key step in the natural process of biomass decay whereby oxidative enzymes such as laccases and high redox potential ligninolytic peroxidases and oxidases play a central role. More recently, the importance of these enzymes has increased because of their prospective industrial use for the degradation of the biomass lignin to increase the accessibility of the cellulose and hemicellulose moieties to be used as renewable material for the production of fuels and chemicals. These biocatalysts also present potential application on environmental biocatalysis for the degradation of xenobiotics and recalcitrant pollutants. However, the cost for these enzymes production, separation, and concentration must be low to permit its industrial use. This work studied the concentration of lignin peroxidase (LiP), produced by Streptomyces viridosporus T7A, by ultrafiltration, in a laboratory-stirred cell, loaded with polysulfone (PS) or cellulose acetate (CA) membranes with molecular weight cutoffs (MWCO) of 10, 20, and 50 KDa. Experiments were carried out at 25 °C and pH 7.0 in accordance to the enzyme stability profile. The best process conditions and enzyme yield were obtained using a PS membrane with 10 KDa MWCO, whereby it was observed a tenfold LiP activity increase, reaching 1,000 U/L and 90% enzyme activity upholding.
Enzymatic saccharification of biologically pre-treated wheat straw with white-rot fungi.
Dias, Albino A; Freitas, Gil S; Marques, Guilhermina S M; Sampaio, Ana; Fraga, Irene S; Rodrigues, Miguel A M; Evtuguin, Dmitry V; Bezerra, Rui M F
2010-08-01
Wheat straw was submitted to a pre-treatment by the basidiomycetous fungi Euc-1 and Irpex lacteus, aiming to improve the accessibility of cellulose towards enzymatic hydrolysis via previous selective bio-delignification. This allowed the increase of substrate saccharification nearly four and three times while applying the basidiomycetes Euc-1 and I. lacteus, respectively. The cellulose/lignin ratio increased from 2.7 in the untreated wheat straw to 5.9 and 4.6 after the bio-treatment by the basidiomycetes Euc-1 and I. lacteus, respectively, thus evidencing the highly selective lignin biodegradation. The enzymatic profile of both fungi upon bio-treatment of wheat straw have been assessed including laccase, manganese-dependent peroxidase, lignin peroxidase, carboxymethylcellulase, xylanase, avicelase and feruloyl esterase activities. The difference in efficiency and selectivity of delignification within the two fungi treatments was interpreted in terms of specific lignolytic enzyme profiles and moderate xylanase and cellulolytic activities. (c) 2010 Elsevier Ltd. All rights reserved.
Adhesion improvement of lignocellulosic products by enzymatic pre-treatment.
Widsten, Petri; Kandelbauer, Andreas
2008-01-01
Enzymatic bonding methods, based on laccase or peroxidase enzymes, for lignocellulosic products such as medium-density fiberboard and particleboard are discussed with reference to the increasing costs of presently used petroleum-based adhesives and the health concerns associated with formaldehyde emissions from current composite products. One approach is to improve the self-bonding properties of the particles by oxidation of their surface lignin before they are fabricated into boards. Another method involves using enzymatically pre-treated lignins as adhesives for boards and laminates. The application of this technology to achieve wet strength characteristics in paper is also reviewed.
Roles of small laccases from Streptomyces in lignin degradation.
Majumdar, Sudipta; Lukk, Tiit; Solbiati, Jose O; Bauer, Stefan; Nair, Satish K; Cronan, John E; Gerlt, John A
2014-06-24
Laccases (EC 1.10.3.2) are multicopper oxidases that can oxidize a range of substrates, including phenols, aromatic amines, and nonphenolic substrates. To investigate the involvement of the small Streptomyces laccases in lignin degradation, we generated acid-precipitable polymeric lignin obtained in the presence of wild-type Streptomyces coelicolor A3(2) (SCWT) and its laccase-less mutant (SCΔLAC) in the presence of Miscanthus x giganteus lignocellulose. The results showed that strain SCΔLAC was inefficient in degrading lignin compared to strain SCWT, thereby supporting the importance of laccase for lignin degradation by S. coelicolor A3(2). We also studied the lignin degradation activity of laccases from S. coelicolor A3(2), Streptomyces lividans TK24, Streptomyces viridosporus T7A, and Amycolatopsis sp. 75iv2 using both lignin model compounds and ethanosolv lignin. All four laccases degraded a phenolic model compound (LM-OH) but were able to oxidize a nonphenolic model compound only in the presence of redox mediators. Their activities are highest at pH 8.0 with a low krel/Kapp for LM-OH, suggesting that the enzymes’ natural substrates must be different in shape or chemical nature. Crystal structures of the laccases from S. viridosporus T7A (SVLAC) and Amycolatopsis sp. 75iv2 were determined both with and without bound substrate. This is the first report of a crystal structure for any laccase bound to a nonphenolic β-O-4 lignin model compound. An additional zinc metal binding site in SVLAC was also identified. The ability to oxidize and/or rearrange ethanosolv lignin provides further evidence of the utility of laccase activity for lignin degradation and/or modification.
Lignin oxidation and pulp delignification by laccase and mediators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bourbonnais, R.; Paice, M.G.; Reid, I.D.
1996-10-01
The phenol oxidizing enzyme laccase is produced abundantly by the lignin-degrading fungus Trametes versicolor. We found previously that laccase can oxidize veratryl alcohol and other non-phenolic lignin model compounds when a mediator such as 2,2{prime}-azinobis(3-ethylbenzthiazoline-5-sulphonate) (ABTS) was present. The laccase/mediator couple was also shown to be effective for delignification of kraft pulps. Two different isozymes of laccase produced by this fungus were purified and their reactivities towards lignins and kraft pulps were studied. The mediator ABTS was shown to be essential for pulp delignification and to reverse the polymerization of kraft lignin by either laccase. Pulp delignification with laccase andmore » ABTS was also optimized. resulting in up to 55% lignin removal from kraft pulp following sequential enzyme treatments and alkaline extractions. Several variables were surveyed including enzyme and mediator dosage, oxygen pressure, temperature, reaction time, and pH.« less
Synergistic enzymatic and microbial lignin conversion
Zhao, Cheng; Xie, Shangxian; Pu, Yunqiao; ...
2015-10-02
We represent the utilization of lignin for fungible fuels and chemicals and it's one of the most imminent challenges in modern biorefineries. However, bioconversion of lignin is highly challenging due to its recalcitrant nature as a phenolic heteropolymer. This study addressed the challenges by revealing the chemical and biological mechanisms for synergistic lignin degradation by a bacterial and enzymatic system, which significantly improved lignin consumption, cell growth and lipid yield. The Rhodococcus opacus cell growth increased exponentially in response to the level of laccase treatment, indicating the synergy between laccase and bacterial cells in lignin degradation. Other treatments like ironmore » and hydrogen peroxide showed limited impact on cell growth. Chemical analysis of lignin under various treatments further confirmed the synergy between laccase and cells at the chemical level. 31P nuclear magnetic resonance (NMR) suggested that laccase, R. opacus cell and Fenton reaction reagents promoted the degradation of different types of lignin functional groups, elucidating the chemical basis for the synergistic effects. 31P NMR further revealed that laccase treatment had the most significant impact for degrading the abundant chemical groups. The results were further confirmed by the molecular weight analysis and lignin quantification by the Prussian blue assay. The cell–laccase fermentation led to a 17-fold increase of lipid production. Overall, the study indicated that laccase and R. opacus can synergize to degrade lignin efficiently, likely through rapid utilization of monomers generated by laccase to promote the reaction toward depolymerization. The study provided a potential path for more efficient lignin conversion and development of consolidated lignin conversion.« less
Synergistic enzymatic and microbial lignin conversion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Cheng; Xie, Shangxian; Pu, Yunqiao
We represent the utilization of lignin for fungible fuels and chemicals and it's one of the most imminent challenges in modern biorefineries. However, bioconversion of lignin is highly challenging due to its recalcitrant nature as a phenolic heteropolymer. This study addressed the challenges by revealing the chemical and biological mechanisms for synergistic lignin degradation by a bacterial and enzymatic system, which significantly improved lignin consumption, cell growth and lipid yield. The Rhodococcus opacus cell growth increased exponentially in response to the level of laccase treatment, indicating the synergy between laccase and bacterial cells in lignin degradation. Other treatments like ironmore » and hydrogen peroxide showed limited impact on cell growth. Chemical analysis of lignin under various treatments further confirmed the synergy between laccase and cells at the chemical level. 31P nuclear magnetic resonance (NMR) suggested that laccase, R. opacus cell and Fenton reaction reagents promoted the degradation of different types of lignin functional groups, elucidating the chemical basis for the synergistic effects. 31P NMR further revealed that laccase treatment had the most significant impact for degrading the abundant chemical groups. The results were further confirmed by the molecular weight analysis and lignin quantification by the Prussian blue assay. The cell–laccase fermentation led to a 17-fold increase of lipid production. Overall, the study indicated that laccase and R. opacus can synergize to degrade lignin efficiently, likely through rapid utilization of monomers generated by laccase to promote the reaction toward depolymerization. The study provided a potential path for more efficient lignin conversion and development of consolidated lignin conversion.« less
Laccase/Mediator Systems: Their Reactivity toward Phenolic Lignin Structures.
Hilgers, Roelant; Vincken, Jean-Paul; Gruppen, Harry; Kabel, Mirjam A
2018-02-05
Laccase-mediator systems (LMS) have been widely studied for their capacity to oxidize the nonphenolic subunits of lignin (70-90% of the polymer). The phenolic subunits (10-30% of the polymer), which can also be oxidized without mediators, have received considerably less attention. Consequently, it remains unclear to what extent the presence of a mediator influences the reactions of the phenolic subunits of lignin. To get more insight in this, UHPLC-MS was used to study the reactions of a phenolic lignin dimer (GBG), initiated by a laccase from Trametes versicolor , alone or in combination with the mediators HBT and ABTS. The role of HBT was negligible, as its oxidation by laccase occurred slowly in comparison to that of GBG. Laccase and laccase/HBT oxidized GBG at a comparable rate, resulting in extensive polymerization of GBG. In contrast, laccase/ABTS converted GBG at a higher rate, as GBG was oxidized both directly by laccase but also by ABTS radical cations, which were rapidly formed by laccase. The laccase/ABTS system resulted in Cα oxidation of GBG and coupling of ABTS to GBG, rather than polymerization of GBG. Based on these results, we propose reaction pathways of phenolic lignin model compounds with laccase/HBT and laccase/ABTS.
Pathways for degradation of lignin in bacteria and fungi.
Bugg, Timothy D H; Ahmad, Mark; Hardiman, Elizabeth M; Rahmanpour, Rahman
2011-11-01
Lignin is a heterogeneous aromatic polymer found as 10-35% of lignocellulose, found in plant cell walls. The bio-conversion of plant lignocellulose to glucose is an important part of second generation biofuel production, but the resistance of lignin to breakdown is a major obstacle in this process, hence there is considerable interest in the microbial breakdown of lignin. White-rot fungi are known to break down lignin with the aid of extracellular peroxidase and laccase enzymes. There are also reports of bacteria that can degrade lignin, and recent work indicates that bacterial lignin breakdown may be more significant than previously thought. The review will discuss the enzymes for lignin breakdown in fungi and bacteria, and the catabolic pathways for breakdown of the β-aryl ether, biphenyl and other components of lignin in bacteria and fungi. The review will also discuss small molecule phenolic breakdown products from lignin that have been identified from lignin-degrading microbes, and includes a bioinformatic analysis of the occurrence of known lignin-degradation pathways in Gram-positive and Gram-negative bacteria.
Bacterial enzymes involved in lignin degradation.
de Gonzalo, Gonzalo; Colpa, Dana I; Habib, Mohamed H M; Fraaije, Marco W
2016-10-20
Lignin forms a large part of plant biomass. It is a highly heterogeneous polymer of 4-hydroxyphenylpropanoid units and is embedded within polysaccharide polymers forming lignocellulose. Lignin provides strength and rigidity to plants and is rather resilient towards degradation. To improve the (bio)processing of lignocellulosic feedstocks, more effective degradation methods of lignin are in demand. Nature has found ways to fully degrade lignin through the production of dedicated ligninolytic enzyme systems. While such enzymes have been well thoroughly studied for ligninolytic fungi, only in recent years biochemical studies on bacterial enzymes capable of lignin modification have intensified. This has revealed several types of enzymes available to bacteria that enable them to act on lignin. Two major classes of bacterial lignin-modifying enzymes are DyP-type peroxidases and laccases. Yet, recently also several other bacterial enzymes have been discovered that seem to play a role in lignin modifications. In the present review, we provide an overview of recent advances in the identification and use of bacterial enzymes acting on lignin or lignin-derived products. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.
Kaur, Harsimran; Kapoor, Shammi; Kaur, Gaganjyot
2016-10-01
Lindane, a broad-spectrum organochlorine pesticide, has caused a widespread environmental contamination along with other pesticides due to wrong agricultural practices. The high efficiency, sustainability and eco-friendly nature of the bioremediation process provide an edge over traditional physico-chemical remediation for managing pesticide pollution. In the present study, lindane degradation was studied by using a white-rot fungus, Ganoderma lucidum GL-2 strain, grown on rice bran substrate for ligninolytic enzyme induction at 30 °C and pH 5.6 after incorporation of 4 and 40 ppm lindane in liquid as well as solid-state fermentation. The estimation of lindane residue was carried out by gas chromatography coupled to mass spectrometry (GC-MS) in the selected ion monitoring mode. In liquid-state fermentation, 100.13 U/ml laccase, 50.96 U/ml manganese peroxidase and 17.43 U/ml lignin peroxidase enzymes were obtained with a maximum of 75.50 % lindane degradation on the 28th day of incubation period, whereas under the solid-state fermentation system, 156.82 U/g laccase, 80.11 U/g manganese peroxidase and 18.61 U/g lignin peroxidase enzyme activities with 37.50 % lindane degradation were obtained. The lindane incorporation was inhibitory to the production of ligninolytic enzymes and its own degradation but was stimulatory for extracellular protein production. The dialysed crude enzyme extracts of ligninolytic enzymes were though efficient in lindane degradation during in vitro studies, but their efficiencies tend to decrease with an increase in the incubation period. Hence, lindane-degrading capabilities of G. lucidum GL-2 strain make it a potential candidate for managing lindane bioremediation at contaminated sites.
Fate of Residual Lignin during Delignification of Kraft Pulp by Trametes versicolor
Reid, Ian D.
1998-01-01
The fungus Trametes versicolor can delignify and brighten kraft pulps. To better understand the mechanism of this biological bleaching and the by-products formed, I traced the transformation of pulp lignin during treatment with the fungus. Hardwood and softwood kraft pulps containing 14C-labelled residual lignin were prepared by laboratory pulping of lignin-labelled aspen and spruce wood and then incubated with T. versicolor. After initially polymerizing the lignin, the fungus depolymerized it to alkali-extractable forms and then to soluble forms. Most of the labelled carbon accumulated in the water-soluble pool. The extractable and soluble products were oligomeric; single-ring aromatic products were not detected. The mineralization of the lignin carbon to CO2 varied between experiments, up to 22% in the most vigorous cultures. The activities of the known enzymes laccase and manganese peroxidase did not account for all of the lignin degradation that took place in the T. versicolor cultures. This fungus may produce additional enzymes that could be useful in enzyme bleaching systems. PMID:9603823
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica
Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We alsomore » observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.« less
Fernandez-Fueyo, Elena; Ruiz-Dueñas, Francisco J.; Ferreira, Patricia; Floudas, Dimitrios; Hibbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Rubén; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; St. John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavín, José L.; Oguiza, José A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kües, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan
2012-01-01
Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2+. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium. PMID:22434909
Modification of lignin for the production of new compounded materials.
Hüttermann, A; Mai, C; Kharazipour, A
2001-05-01
The cell walls of woody plants are compounded materials made by in situ polymerization of a polyphenolic matrix (lignin) into a web of fibers (cellulose), a process that is catalysed by polyphenoloxidases (laccases) or peroxidases. The first attempt to transform the basic strategy of this natural process for use in human craftsmanship was the ancient lacquer method. The sap of the lacquer tree (Rhus verniciflua) contains large amounts of a phenol (urushiol), a polysaccharide and the enzyme laccase. This oil-in-water emulsion solidifies in the presence of oxygen. The Chinese began using this phenomenon for the production of highly creative artwork more than 6,000 years ago. It was the first example of an isolated enzyme being used as a catalyst to create an artificial plastic compound. In order to apply this process to the production of products on an industrial scale, an inexpensive phenol must be used, which is transferred by an enzyme to active radicals that react with different components to form a compounded material. At present, the following approaches have been studied: (1) In situ polymerization of lignin for the production of particle boards. Adhesive cure is based on the oxidative polymerization of lignin using phenoloxidases (laccase) as radical donors. This lignin-based bio-adhesive can be applied under conventional pressing conditions. The resulting particle boards meet German performance standards. By this process, 80% of the petrochemical binders in the wood-composite industry can be replaced by materials from renewable resources. (2) Enzymatic copolymerization of lignin and alkenes. In the presence of organic hydroperoxides, laccase catalyses the reaction between lignin and olefins. Detailed studies on the reaction between lignin and acrylate monomers showed that chemo-enzymatic copolymerization offers the possibility to produce defined lignin-acrylate copolymers. The system allows control of the molecular weights of the products in a way that has not been possible with chemical catalysts. This is a novel attempt to enzymatically induce grafting of polymeric side chains onto the lignin backbone, and it enables the utilization of lignin as part of new engineering materials. (3) Enzymatic activation of the middle-lamella lignin of wood fibers for the production of wood composites. The incubation of wood fibers with a phenol oxidizing enzyme results in oxidative activation of the lignin crust on the fiber surface. When such fibers are pressed together, boards are obtained which meet the German standards for medium-density fiber boards (MDF). The fibers are bound together in a way that comes close to that by which wood fibers are bound together in naturally grown wood. This process will, for the first time, yield wood composites that are produced solely from naturally grown products without any addition of resins.
Oxidative polymerization of lignins by laccase in water-acetone mixture.
Fiţigău, Ionița Firuța; Peter, Francisc; Boeriu, Carmen Gabriela
2013-01-01
The enzymatic oxidative polymerization of five technical lignins with different molecular properties, i.e. Soda Grass/Wheat straw Lignin, Organosolv Hardwood Lignin, Soda Wheat straw Lignin, Alkali pretreated Wheat straw Lignin, and Kraft Softwood was studied. All lignins were previously fractionated by acetone/water 50:50 (v/v) and the laccase-catalyzed polymerization of the low molecular weight fractions (Mw < 4000 g/mol) was carried out in the same solvent system. Reactivity of lignin substrates in laccase-catalyzed reactions was determined by monitoring the oxygen consumption. The oxidation reactions in 50% acetone in water mixture proceed with high rate for all tested lignins. Polymerization products were analyzed by size exclusion chromatography, FT-IR, and (31)P-NMR and evidence of important lignin modifications after incubation with laccase. Lignin polymers with higher molecular weight (Mw up to 17500 g/mol) were obtained. The obtained polymers have potential for applications in bioplastics, adhesives and as polymeric dispersants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Irvine, R.L.
1995-07-24
To test the hypothesis that coal (leonardite) Solubilization and the subsequent depolymerization of the solubilized coal macromolecules are distinct events in lignin degrading fungi. In addition to T versicolor, Phanerochaete chrysosporium, another lignin degrading fungus that also has the ability to solubilize coal, will be studied. To test the hypothesis that the processes of coal (leonardite) solubilization and coal macro molecule depolymerization in lignin degrading fungi can be regulated by altering the nutritional status of the microorganism. Coal solubilization is expected to occur in nutrient rich media whereas depolymerization of solubilized coal macromolecules is expected to occur in nutrient limitedmore » media. To determine the role of extracellular enzymes (laccases, lignin peroxidases and Mn peroxidases) that are secreted by lignin degrading fungi during coal solubilization or coal macro molecule depolymerization. To assess the role of enzymatically generated oxygen radicals, non-radical active oxygen species, veratryl alcohol radicals and Mn{sup +++} complexes in coal macro molecule depolymerization. To characterize products of coal solubilization and coal macro molecule depolymerization that are formed by T. versicolor and P. chrysosporium and their respective extracellular enzymes. Solubilization products formed using oxalic acid and other metal chelators will also be characterized and compared.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Chien-Yuan; Li, Quanzi; Tunlaya-Anukit, Sermsawat
2016-03-11
Class III peroxidases are members of a large plant-specific sequence-heterogeneous protein family. Several sequence-conserved homologs have been associated with lignin polymerization in Arabidopsis thaliana, Oryza sativa, Nicotiana tabacum, Zinnia elegans, Picea abies, and Pinus sylvestris. In Populus trichocarpa, a model species for studies of wood formation, the peroxidases involved in lignin biosynthesis have not yet been identified. To do this, we retrieved sequences of all PtrPOs from Peroxibase and conducted RNA-seq to identify candidates. Transcripts from 42 PtrPOs were detected in stem differentiating xylem (SDX) and four of them are the most xylem-abundant (PtrPO12, PtrPO21, PtrPO42, and PtrPO64). PtrPO21 showsmore » xylem-specific expression similar to that of genes encoding the monolignol biosynthetic enzymes. Using protein cleavage-isotope dilution mass spectrometry, PtrPO21 is detected only in the cell wall fraction and not in the soluble fraction. Downregulated transgenics of PtrPO21 have a lignin reduction of ~20% with subunit composition (S/G ratio) similar to wild type. The transgenics show a growth reduction and reddish color of stem wood. The modulus of elasticity (MOE) of the stems of the downregulated PtrPO21-line 8 can be reduced to ~60% of wild type. Differentially expressed gene (DEG) analysis of PtrPO21 downregulated transgenics identified a significant overexpression of PtPrx35, suggesting a compensatory effect within the peroxidase family. No significant changes in the expression of the 49 P. trichocarpa laccases (PtrLACs) were observed.« less
Characterization of lignocellulolytic enzymes from white-rot fungi.
Manavalan, Tamilvendan; Manavalan, Arulmani; Heese, Klaus
2015-04-01
The development of alternative energy sources by applying lignocellulose-based biofuel technology is critically important because of the depletion of fossil fuel resources, rising fossil fuel prices, security issues regarding the fossil fuel supply, and environmental issues. White-rot fungi have received much attention in recent years for their valuable enzyme systems that effectively degrade lignocellulosic biomasses. These fungi have powerful extracellular oxidative and hydrolytic enzymes that degrade lignin and cellulose biopolymers, respectively. Lignocellulosic biomasses from either agricultural or forestry wastes are abundant, low-cost feedstock alternatives in nature but require hydrolysis into simple sugars for biofuel production. This review provides a complete overview of the different lignocellulose biomasses and their chemical compositions. In addition, a complete list of the white-rot fungi-derived lignocellulolytic enzymes that have been identified and their molecular structures, mechanism of action in lignocellulose hydrolysis, and biochemical properties is summarized in detail. These enzymes include ligninolytic enzymes (laccase, manganese peroxidase, lignin peroxidase, and versatile peroxidase) and cellulolytic enzymes (endo-glucanase, cellobiohydrolase, and beta-glucosidase). The use of these fungi for low-cost lignocellulolytic enzyme production might be attractive for biofuel production.
Complete genome sequence of “Enterobacter lignolyticus” SCF1
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeAngelis, Kristen M.; D'Haeseleer, Patrik; Chivian, Dylan
2011-09-23
In an effort to discover anaerobic bacteria capable of lignin degradation, we isolated 'Ente-robacter lignolyticus' SCF1 on minimal media with alkali lignin as the sole source of carbon. This organism was isolated anaerobically from tropical forest soils collected from the Short Cloud Forest site in the El Yunque National Forest in Puerto Rico, USA, part of the Luquillo Long-Term Ecological Research Station. At this site, the soils experience strong fluctuations in redox potential and are net methane producers. Because of its ability to grow on lignin anae-robically, we sequenced the genome. The genome of 'E. lignolyticus' SCF1 is 4.81 Mbpmore » with no detected plasmids, and includes a relatively small arsenal of lignocellulolytic carbohy-drate active enzymes. Lignin degradation was observed in culture, and the genome revealed two putative laccases, a putative peroxidase, and a complete 4-hydroxyphenylacetate degra-dation pathway encoded in a single gene cluster.« less
Blánquez, Alba; Ball, Andrew S.; González-Pérez, José Antonio; Jiménez-Morillo, Nicasio T.; González-Vila, Francisco; Arias, M. Enriqueta
2017-01-01
The role of laccase SilA produced by Streptomyces ipomoeae CECT 3341 in lignocellulose degradation was investigated. A comparison of the properties and activities of a laccase-negative mutant strain (SilA−) with that of the wild-type was studied in terms of their ability to degrade lignin from grass lignocellulose. The yields of solubilized lignin (acid precipitable polymeric lignin, APPL) obtained from wheat straw by both strains in Solid State Fermentation (SSF) conditions demonstrated the importance of SilA laccase in lignin degradation with the wild-type showing 5-fold more APPL produced compared with the mutant strain (SilA−). Analytical pyrolysis and FT-IR (Fourier Transform Infrared Spectroscopy) confirmed that the APPL obtained from the substrate fermented by wild-type strain was dominated by lignin derived methoxyphenols whereas those from SilA− and control APPLs were composed mainly of polysaccharides. This is the first report highlighting the role of this laccase in lignin degradation. PMID:29112957
Blánquez, Alba; Ball, Andrew S; González-Pérez, José Antonio; Jiménez-Morillo, Nicasio T; González-Vila, Francisco; Arias, M Enriqueta; Hernández, Manuel
2017-01-01
The role of laccase SilA produced by Streptomyces ipomoeae CECT 3341 in lignocellulose degradation was investigated. A comparison of the properties and activities of a laccase-negative mutant strain (SilA-) with that of the wild-type was studied in terms of their ability to degrade lignin from grass lignocellulose. The yields of solubilized lignin (acid precipitable polymeric lignin, APPL) obtained from wheat straw by both strains in Solid State Fermentation (SSF) conditions demonstrated the importance of SilA laccase in lignin degradation with the wild-type showing 5-fold more APPL produced compared with the mutant strain (SilA-). Analytical pyrolysis and FT-IR (Fourier Transform Infrared Spectroscopy) confirmed that the APPL obtained from the substrate fermented by wild-type strain was dominated by lignin derived methoxyphenols whereas those from SilA- and control APPLs were composed mainly of polysaccharides. This is the first report highlighting the role of this laccase in lignin degradation.
Watharkar, Anuprita D; Jadhav, Jyoti P
2014-05-01
In vitro grown Petunia grandiflora and Gaillardia grandiflora plantlets showed 76 percent and 62 percent American Dye Manufacturers Institute value (color) removal from a simulated dyes mixture within 36h respectively whereas their consortium gave 94 percent decolorization. P. grandiflora, G. grandiflora and their consortium could reduce BOD by 44 percent, 31 percent and, 69 percent and COD by 58 percent, 37 percent and 73 percent respectively. Individually, root cells of P. grandiflora showed 74 and 24 percent induction in the activities of veratryl alcohol oxidase and laccase respectively; whereas G. grandiflora root cells showed 379 percent, 142 percent and 77 percent induction in the activities of tyrosinase, riboflavin reductase and lignin peroxidase respectively. In the consortium set, entirely a different enzymatic pattern was observed, where P. grandiflora root cells showed 231 percent, 12 percent and 65 percent induction in the activities of veratryl alcohol oxidase, laccase and 2, 6-dichlorophenol-indophenol reductase respectively, while G. grandiflora root cells gave 300 percent, 160 percent, 79 percent and 55 percent inductions in the activities of lignin peroxidase, riboflavin reductase, tyrosinase and laccase respectively. Because of the synergistic effect of the enzymes from both the plants, the consortium was found to be more effective for the degradation of dyes from the mixture. Preferential dye removal was confirmed by analyzing metabolites of treated dye mixture using UV-vis spectroscopy, FTIR and biotransformation was visualized using HPTLC. Metabolites formed after the degradation of dyes revealed the reduced cytogenotoxicity on Allium cepa roots cells when compared with untreated dye mixture solution. Phytotoxicity study exhibited the less toxic nature of the metabolites. Copyright © 2014 Elsevier Inc. All rights reserved.
Gomes, Eleni; Aguiar, Ana Paula; Carvalho, Caio César; Bonfá, Maricy Raquel B.; da Silva, Roberto; Boscolo, Mauricio
2009-01-01
Wood rotting Basidiomycetes collected in the “Estação Ecológica do Noroeste Paulista”, São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF) using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1) and Lentinus sp produced the highest activities of manganese peroxidase (MnP) and lignin peroxidase (LiP) (7 and 8 U mL-1, respectively), when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60ºC while the peroxidases presented maximum activity at temperatures of 30 to 55ºC. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes. PMID:24031314
Reactivity of bacterial and fungal laccases with lignin under alkaline conditions.
Moya, Raquel; Saastamoinen, Päivi; Hernández, Manuel; Suurnäkki, Anna; Arias, Enriqueta; Mattinen, Maija-Liisa
2011-11-01
The ability of Streptomyces ipomoea laccase to polymerize secoisolariciresinol lignan and technical lignins was assessed. The reactivity of S. ipomoea laccase was also compared to that of low redox fungal laccase from Melanocarpus albomyces using low molecular mass p-coumaric, ferulic and sinapic acid as well as natural (acetosyringone) and synthetic 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO) mediators as substrates. Oxygen consumption measurement, MALDI-TOF MS and SEC were used to follow the enzymatic reactions at pH 7, 8, 9 and 10 at 30°C and 50°C. Polymerization of lignins and lignan by S. ipomoea laccase under alkaline reaction conditions was observed, and was enhanced in the presence of acetosyringone almost to the level obtained with M. albomyces laccase without mediator. Reactivities of the enzymes towards acetosyringone and TEMPO were similar, suggesting exploitation of the compounds and low redox laccase in lignin valorization under alkaline conditions. The results have scientific impact on basic research of laccases. Copyright © 2011 Elsevier Ltd. All rights reserved.
Kraft lignin biodegradation by Novosphingobium sp. B-7 and analysis of the degradation process.
Chen, Yuehui; Chai, Liyuan; Tang, Chongjian; Yang, Zhihui; Zheng, Yu; Shi, Yan; Zhang, Huan
2012-11-01
This study focused on the biodegradation of kraft lignin (KL) by Novosphingobium sp. B-7 using KL as sole carbon source. Results revealed that Novosphingobium sp. B-7 reduced the chemical oxygen demand (COD) by 34.7% in KL mineral salt medium after 7days of incubation. Additionally, the maximum activities of manganese peroxidase (MnP) of 3229.8Ul(-1) and laccase (Lac) of 1275Ul(-1) were observed at 4th and 5th day, respectively. GC-MS analysis indicated that after incubated with Novosphingobium sp. B-7, low molecular weight alcohols and lignin-related monomer compounds such as ethanediol, p-hydroxy benzoic acid and vanillic acid were formed in the system, which strongly confirmed the degradation of KL by Novosphingobium sp. B-7. Copyright © 2012 Elsevier Ltd. All rights reserved.
Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan
2013-06-01
The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.
Zhao, Yunchen; Li, Jianlong; Chen, Yuru; Huang, Haixia; Yu, Zui
2009-08-01
To study the effect of exogenous oxygen, we added water solution of paraquat to 7 d cultures of Coriolus versicolor for the next 148 h. Enzyme exudation and biochemical process were investigated on the addition of paraquat. We found that compared with the control (without paraquat), the addition of 30 micromol/L paraquat stimulated the activity of manganese dependent peroxidase (MnP), lignin peroxidase (LiP), and laccases (Lac) 7, 2.5 and 1.3 times, respectively. Also, addition of paraquat enhanced activity of superoxide dismutase (SOD) and catalase (CAT) in the first 48 h. Impact of paraquat on ligninolytic enzymes was significant than that on antioxidant enzyme. Addition of paraquat enhanced phenolic compounds and formaldehyde of cultures too. And concentration of malondialdehyde was increased in the first 24 h. The results showed that addition of paraquat promoted oxidative stress, but the antioxidant systems of the fungal strain are sufficient to prevent mycelia from oxidative stress. As exogenous oxygen, paraquat might be a useful substrate in degradation of lignocellulose.
Screening of Biodegradable Function of Indigenous Ligno-degrading Mushroom Using Dyes
Cho, Soo-Muk; Seok, Soon-Ja; Kong, Won-Sik; Kim, Gyu-Hyun; Sung, Jae-Mo
2009-01-01
The process of biodegradation in lingo-cellulosic materials is critically relevant to biospheric carbon. The study of this natural process has largely involved laboratory investigations, focused primarily on the biodegradation and recycling of agricultural by-products, generally using basidiomycetes species. In order to collect super white rot fungi and evaluate its ability to degrade lingo-cellulosic material, 35 fungal strains, collected from forests, humus soil, livestock manure, and dead trees, were screened for enzyme activities and their potential to decolorize the commercially used Poly-R 478 dye. In the laccase enzymatic analysis chemical test, 33 white rot fungi and 2 brown rot fungi were identified. The degradation ability of polycyclic aromatic hydrocarbons (PAHs) according to the utilized environmental conditions was higher in the mushrooms grown in dead trees and fallen leaves than in the mushrooms grown in humus soil and livestock manure. Using Poly-R 478 dye to assess the PAH-degradation activity of the identified strains, four strains, including Agrocybe pediades, were selected. The activities of laccase, MnP, and Lip of the four strains with PAH-degrading ability were highest in Pleurotus incarnates. 87 fungal strains, collected from forests, humus soil, livestock manure, and dead trees, were screened for enzyme activities and their potential to decolorize the commercially used Poly-R 478 dye on solid media. Using Poly-R 478 dye to assess the PAHdegrading activity of the identified strains, it was determined that MKACC 51632 and 52492 strains evidenced superior activity in static and shaken liquid cultures. Subsequent screening on plates containing the polymeric dye poly R-478, the decolorization of which is correlated with lignin degradation, resulted in the selection of a strain of Coriolus versicolor, MKACC52492, for further study, primarily due to its rapid growth rate and profound ability to decolorize poly R-478 on solid media. Considering our findings using Poly-R 478 dye to evaluate the PAH-degrading activity of the identified strains, Coriolus versicolor, MKACC 52492 was selected as a favorable strain. Coriolus versicolor, which was collected from Mt. Yeogi in Suwon, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). PMID:23983508
Decolorization of acid, disperse and reactive dyes by Trametes versicolor CBR43.
Yang, Seung-Ok; Sodaneath, Hong; Lee, Jung-In; Jung, Hyekyeng; Choi, Jin-Hee; Ryu, Hee Wook; Cho, Kyung-Suk
2017-07-29
The mycoremediation has been considered as a promising method for decolorizing dye wastewater. To explore new bioresource for mycoremediation, a new white-rot fungus that could decolorize various dyes commonly used in textile industries was isolated, and its ligninolytic enzyme activity and decolorization capacity were characterized. The isolated CBR43 was identified as Trametes versicolor based on the morphological properties of its fruit body and spores, as well as through partial 18S rDNA gene sequences. Isolated CBR43 displayed high activities of laccase and Mn-dependent peroxidase, whereas its lignin peroxidase activity was relatively low. These ligninolytic enzyme activities in potato dextrose broth (PDB) medium were enhanced by the addition of yeast extract (1-10 g L -1 ). In particular, lignin peroxidase activity was increased more than 5 times in the PDB medium amended with 10 g L -1 of yeast extract. The CBR43 decolorized more than 90% of 200 mg L -1 acid dyes (red 114, blue 62 and black 172) and reactive dyes (red 120, blue 4, orange 16 and black 5) within 6 days in the PDB medium. CBR43 decolorized 67% of 200 mg L -1 acid orange 7 within 9 days. The decolorization efficiencies for disperse dyes (red 1, orange 3 and black 1) were 51-80% within 9 days. The CBR43 could effectively decolorize high concentrations of acid blue 62 and acid black 172 (500-700 mg L -1 ). The maximum dye decolorization rate was obtained at 28°C, pH 5, and 150 rpm in the PDB medium. T. versicolor CBR43 had high laccase and Mn-dependent peroxidase activities, and could decolorize a wide variety of dyes such as acid, disperse and reactive textile dyes. This fungus had decolorizing activities of azo-type dyes as well as anthraquinone-type dyes. T. versicolor CBR43 is one of promising bioresources for the decolorization of textile wastewater including various dyes.
Laccase-mediator catalyzed conversion of model lignin compounds
USDA-ARS?s Scientific Manuscript database
Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...
Effects of Kraft Pulp and Lignin on Trametes versicolor Carbon Metabolism
Roy, Brian P.; Archibald, Frederick
1993-01-01
The white rot basidiomycete Trametes (Coriolus) versicolor can substantially increase the brightness and decrease the lignin content of washed, unbleached hardwood kraft pulp (HWKP). Monokaryotic strain 52J was used to study how HWKP and the lignin in HWKP affect the carbon metabolism and secretions of T. versicolor. Earlier work indicated that a biobleaching culture supernatant contained all components necessary for HWKP biobleaching and delignification, but the supernatant needed frequent contact with the fungus to maintain these activities. Thus, labile small fungal metabolites may be the vital biobleaching system components renewed or replaced by the fungus. Nearly all of the CO2 evolved by HWKP-containing cultures came from the added glucose, indicating that HWKP is not an important source of carbon or energy during biobleaching. Carbon dioxide appeared somewhat earlier in the absence of HWKP, but the culture partial O2 pressure was little affected by the presence of pulp. The presence of HWKP in a culture markedly increased the culture's production of a number of acidic metabolites, including 2-phenyllactate, oxalate, adipate, glyoxylate, fumarate, mandelate, and glycolate. Although the total concentration of these pulp-induced metabolites was only 4.3 mM, these compounds functioned as effective manganese-complexing agents for the manganese peroxidase-mediated oxidation of phenol red, propelling the reaction at 2.4 times the rate of 50 mM sodium malonate, the standard chelator-buffer. The presence of HWKP in a culture also markedly stimulated fungal secretion of the enzymes manganese peroxidase, cellulase, and cellobiose-quinone oxidoreductase, but not laccase (phenol oxidase) or lignin peroxidase. PMID:16348963
Laccase-mediator catalyzed conversion of model lignin compounds
USDA-ARS?s Scientific Manuscript database
Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...
Function of the iron-binding chelator produced by Coriolus versicolor in lignin biodegradation.
Wang, Lu; Yan, WenChao; Chen, JiaChuan; Huang, Feng; Gao, PeiJi
2008-03-01
An ultrafiltered low-molecular-weight preparation of chelating compounds was isolated from a wood-containing culture of the white-rot basidiomycete Coriolus versicolor. This preparation could chelate Fe3+ and reduce Fe3+ to Fe2+, demonstrating that the substance may serve as a ferric chelator, oxygen-reducing agent, and redox-cycling molecule, which would include functioning as the electron transport carrier in Fenton reaction. Lignin was treated with the iron-binding chelator and the changes in structure were investigated by 1H-NMR, 13C-NMR, difference spectrum caused by ionization under alkaline conditions and nitrobenzene oxidation. The results indicated that the iron-binding chelator could destroy the beta-O-4 bonds in etherified lignin units and insert phenolic hydroxyl groups. The low-molecular-weight chelator secreted by C. versicolor resulted in new phenolic substructures in the lignin polymer, making it susceptible to attack by laccase or manganese peroxidase. Thus, the synergic action of the iron-binding chelator and the lignocellulolytic enzymes made the substrate more accessible to degradation.
Molecular analysis of the biological bleaching of kraft pulps by Trametes versicolor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dumonceaux, T.J.; Archibald, F.S.
1996-10-01
Biological bleaching of kraft pulps by the fungus Trametes versicolor, based on the biodegradation of the recalcitrant polymer, lignin, could replace chlorine-based bleaching in Canadian pulp and paper mills. Enzymes that may be involved in lignin degradation include manganese peroxidase (MnP), laccase, and cellobiose-quinone oxidoreductase (CBQase). All three of these enzymatic activities are thought to interact extensively in cyclic oxidation/reduction reactions which ultimately bring about the degradation of lignin. We have constructed a cDNA library from T versicolor with the aim of isolating clones encoding factors that are relevant to biobleaching. We first determined the optimum growth conditions for expressionmore » of bleaching-related mRNA. A clear induction of bleaching ability was observed when the fungus was preincubated with 0.25% acid-washed pulp; the augmentation of bleaching was not explained by differences in MnP or laccase levels, suggesting that the expression of either CBQase or unidentified biobleaching factors was responsible for the increased pulp brightness. mRNA isolated from induced cultures was used to construct a cDNA library in a XZAP vector. This library has been probed with a degenerate oligonucleotide probe based upon a peptide sequence derived from purified CBQase, resulting in the identification of several hybridizing cDNA molecules. The CBQase clone will be used to examine in further detail the potential role of this enzyme in pulp biobleaching and lignin degradation.« less
USDA-ARS?s Scientific Manuscript database
Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...
Shukla, Dharmendra; Patel, Bhavesh; Modi, Hasmukh; Vyas, Bharat Rajiv Manuel
2011-11-01
Solid-state fermentation of wheat straw was carried out by a native white rot basidiomycete Daedaleopsis flavida strain 5A. Extract prepared from the 12-day decayed wheat straw contained extracellular ligninolytic enzymes like manganese peroxidase (MnP), manganese-independent peroxidase (MIP), lignin peroxidase (LiP) and laccase along with straw-degraded products and pigments. Sephacryl S-200 size exclusion chromatography in 16/100 column was used for the separation of these ligninolytic enzymes and straw-degraded products and pigments. Recovery of pigment-free ligninolytic enzyme activities as protein was 40% of the total proteins loaded and specific LiP activity increased 34 fold after size exclusion chromatography. Thus accurate estimation of LiP by veratryl alcohol oxidation assay was possible only after the removal of interfering pigments. The reproducibility of size exclusion chromatography is adjudged satisfactory from the consistent results obtained after seven repetitive uses of matrices.
Elegir, G; Bussini, D; Antonsson, S; Lindström, M E; Zoia, L
2007-12-01
In this work, the effect of Trametes pubescens laccase (TpL) used in combination with a low-molecular-weight ultra-filtered lignin (UFL) to improve mechanical properties of kraft liner pulp and chemi-thermo-mechanical pulp was studied. UFL was isolated by ultra-filtration from the kraft cooking black liquor obtained from softwood pulping. This by-product from the pulp industry contains an oligomeric lignin with almost twice the amount of free phenolic moieties than residual kraft pulp lignin. The reactivity of TpL on UFL and kraft pulp was studied by nuclear magnetic resonance spectroscopy and size exclusion chromatography. Laccase was shown to polymerise UFL and residual kraft pulp lignin in the fibres, seen by the increase in their average molecular weight and in the case of UFL as a decrease in the amount of phenolic hydroxyls. The laccase initiated cross-linking of lignin, mediated by UFL, which gives rise to more than a twofold increase in wet strength of kraft liner pulp handsheets without loosing other critical mechanical properties. Hence, this could be an interesting path to decrease mechano-sorptive creep that has been reported to lessen in extent as wet strength is given to papers. The laccase/2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) mediator system showed a greater increase in wet tensile strength of the resulting pulp sheets than the laccase/UFL system. However, other mechanical properties such as dry tensile strength, compression strength and Scott Bond internal strength were negatively affected by the laccase/ABTS system.
Evaluating the potential of immobilized bacterial consortium for black liquor biodegradation.
Paliwal, Rashmi; Uniyal, Shivani; Rai, J P N
2015-05-01
Two indigenous bacterial strains, Bacillus megaterium ETLB-1 (accession no. KC767548) and Pseudomonas plecoglossicida ETLB-3 (accession no. KC767547), isolated from soil contaminated with paper mill effluent, were co-immobilized on corncob cubes to investigate their biodegradation potential against black liquor (BL). Results exhibit conspicuous reduction in color and lignin of BL upto 913.46 Co-Pt and 531.45 mg l(-1), respectively. Reduction in chlorophenols up to 12 mg l(-1) was recorded with highest release of chloride ions, i.e., 1290 mg l(-1). Maximum enzyme activity for lignin peroxidase (LiP), manganese peroxidase (MnP), and laccase (LAC) was recorded as 5.06, 8.13, and 8.23 U ml(-1), respectively, during the treatment. Scanning electron microscopy (SEM) revealed successful immobilization of bacterial strains in porous structures of biomaterial. Gas chromatography/mass spectroscopy (GC/MS) showed formation of certain low molecular weight metabolites such as 4-hydroxy-benzoic acid, 3-hydroxy-4-methoxybenzaldehyde, ferulic acid, and t-cinnamic acid and removal of majority of the compounds (such as teratogenic phthalate derivatives) during the period of treatment. Results demonstrated that the indigenous bacterial consortium possesses excellent decolorization and lignin degradation capability which enables its commercial utilization in effluents treatment system.
Use of bacteria for improving the lignocellulose biorefinery process: importance of pre-erosion.
Zhuo, Shengnan; Yan, Xu; Liu, Dan; Si, Mengying; Zhang, Kejing; Liu, Mingren; Peng, Bing; Shi, Yan
2018-01-01
Biological pretreatment is an important alternative strategy for biorefining lignocellulose and has attracted increasing attention in recent years. However, current designs for this pretreatment mainly focus on using various white rot fungi, overlooking the bacteria. To the best of our knowledge, for the first time, we evaluated the potential contribution of bacteria to lignocellulose pretreatment, with and without a physicochemical process, based on the bacterial strain Pandoraea sp. B-6 (hereafter B-6) that was isolated from erosive bamboo slips. Moreover, the mechanism of the improvement of reducing sugar yield by bacteria was elucidated via analyses of the physicochemical changes of corn stover (CS) before and after pretreatment. The digestibility of CS pretreated with B-6 was equivalent to that of untreated CS. The recalcitrant CS surface provided fewer mediators for contact with the extracellular enzymes of B-6. A pre-erosion strategy using a tetrahydrofuran-water co-solvent system was shown to destroy the recalcitrant CS surface. The optimal condition for pre-erosion showed a 6.5-fold increase in enzymatic digestibility compared with untreated CS. The pre-erosion of CS can expose more phenolic compounds that were chelated to oxidized Mn 3+ and also provided mediators for combination with laccase, which was attributable to B-6 pretreatment. B-6 pretreatment following pre-erosion exhibited a sugar yield that was 91.2 mg/g greater than that of pre-erosion alone and 7.5-fold higher than that of untreated CS. This pre-erosion application was able to destroy the recalcitrant CS surface, thus leading to a rough and porous architecture that better facilitated the diffusion and transport of lignin derivatives. This enhanced the ability of laccase and manganese peroxidase secreted by B-6 to improve the efficiency of this biological pretreatment. Bacteria were not found useful alone as a biological pretreatment, but they significantly improved enzymatic digestion after lignocellulose breakdown via other physicochemical methods. Nonetheless, phenyl or phenoxy radicals were used by laccase and manganese peroxidase in B-6 for lignin attack or lignin depolymerization. These particular mediators released from the recalcitrance network of lignocellulose openings are important for the efficacy of this bacterial pretreatment. Our findings thus offer a novel perspective on the effective design of biological pretreatment methods for lignocellulose.
Azo Dye Biodecolorization Enhanced by Echinodontium taxodii Cultured with Lignin
Meng, Jing; Yu, Hongbo; Zhang, Xiaoyu
2014-01-01
Lignocellulose facilitates the fungal oxidization of recalcitrant organic pollutants through the extracellular ligninolytic enzymes induced by lignin in wood or other plant tissues. However, available information on this phenomenon is insufficient. Free radical chain reactions during lignin metabolism are important in xenobiotic removal. Thus, the effect of lignin on azo dye decolorization in vivo by Echinodontium taxodii was evaluated. In the presence of lignin, optimum decolorization percentages for Remazol Brilliant Violet 5R, Direct Red 5B, Direct Black 38, and Direct Black 22 were 91.75% (control, 65.96%), 76.89% (control, 43.78%), 43.44% (control, 17.02%), and 44.75% (control, 12.16%), respectively, in the submerged cultures. Laccase was the most important enzyme during biodecolorization. Aside from the stimulating of laccase activity, lignin might be degraded by E. taxodii, and then these degraded low-molecular-weight metabolites could act as redox mediators promoting decolorization of azo dyes. The relationship between laccase and lignin degradation was investigated through decolorization tests in vitro with purified enzyme and dozens of aromatics, which can be derivatives of lignin and can function as laccase mediators or inducers. Dyes were decolorized at triple or even higher rates in certain laccase–aromatic systems at chemical concentrations as low as 10 µM. PMID:25285777
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pandey, Jyotsna L.; Kiemle, Sarah N.; Richard, Tom L.
Lignin is a key structural component of plant cell walls that provides rigidity, strength, and resistance against microbial attacks. This hydrophobic polymer also serves a crucial role in water transport. Despite its abundance and essential functions, several aspects of lignin biosynthesis and deposition remain cryptic. Lignin precursors are known to be synthesized in the cytoplasm by complex biosynthetic pathways, after which they are transported to the apoplastic space, where they are polymerized via free radical coupling reactions into polymeric lignin. However, the lignin deposition process and the factors controlling it are unclear. In this study, the biochemical and developmental dependenciesmore » of lignification were investigated using a click-compatible monolignol analog, 3-O-propargylcaffeyl alcohol (3-OPC), which can incorporate into both in vitro polymerized lignin and Arabidopsis thaliana tissues. Fluorescence labeling of 3-OPC using click chemistry followed by confocal fluorescence microscopy enabled the detection and imaging of 3-OPC incorporation patterns. These patterns were consistent with endogenous lignification observed in different developmental stages of Arabidopsis stems. However, the concentration of supplied monolignols influenced where lignification occurred at the subcellular level, with low concentrations being deposited in cell corners and middle lamellae and high concentrations also being deposited in secondary walls. Experimental inhibition of multiple lignification factors confirmed that 3-OPC incorporation proceeds via a free radical coupling mechanism involving peroxidases/laccases and reactive oxygen species (ROS). Finally, the presence of peroxide-producing enzymes determined which cell walls lignified: adding exogenous peroxide and peroxidase caused cells that do not naturally lignify in Arabidopsis stems to lignify. In conclusion, 3-OPC accurately mimics natural lignification patterns in different developmental stages of Arabidopsis stems and allows for the dissection of key biochemical and enzymatic factors controlling lignification.« less
Pandey, Jyotsna L.; Kiemle, Sarah N.; Richard, Tom L.; Zhu, Yimin; Cosgrove, Daniel J.; Anderson, Charles T.
2016-01-01
Lignin is a key structural component of plant cell walls that provides rigidity, strength, and resistance against microbial attacks. This hydrophobic polymer also serves a crucial role in water transport. Despite its abundance and essential functions, several aspects of lignin biosynthesis and deposition remain cryptic. Lignin precursors are known to be synthesized in the cytoplasm by complex biosynthetic pathways, after which they are transported to the apoplastic space, where they are polymerized via free radical coupling reactions into polymeric lignin. However, the lignin deposition process and the factors controlling it are unclear. In this study, the biochemical and developmental dependencies of lignification were investigated using a click-compatible monolignol analog, 3-O-propargylcaffeyl alcohol (3-OPC), which can incorporate into both in vitro polymerized lignin and Arabidopsis thaliana tissues. Fluorescence labeling of 3-OPC using click chemistry followed by confocal fluorescence microscopy enabled the detection and imaging of 3-OPC incorporation patterns. These patterns were consistent with endogenous lignification observed in different developmental stages of Arabidopsis stems. However, the concentration of supplied monolignols influenced where lignification occurred at the subcellular level, with low concentrations being deposited in cell corners and middle lamellae and high concentrations also being deposited in secondary walls. Experimental inhibition of multiple lignification factors confirmed that 3-OPC incorporation proceeds via a free radical coupling mechanism involving peroxidases/laccases and reactive oxygen species (ROS). Finally, the presence of peroxide-producing enzymes determined which cell walls lignified: adding exogenous peroxide and peroxidase caused cells that do not naturally lignify in Arabidopsis stems to lignify. In summary, 3-OPC accurately mimics natural lignification patterns in different developmental stages of Arabidopsis stems and allows for the dissection of key biochemical and enzymatic factors controlling lignification. PMID:27630649
Pandey, Jyotsna L.; Kiemle, Sarah N.; Richard, Tom L.; ...
2016-08-31
Lignin is a key structural component of plant cell walls that provides rigidity, strength, and resistance against microbial attacks. This hydrophobic polymer also serves a crucial role in water transport. Despite its abundance and essential functions, several aspects of lignin biosynthesis and deposition remain cryptic. Lignin precursors are known to be synthesized in the cytoplasm by complex biosynthetic pathways, after which they are transported to the apoplastic space, where they are polymerized via free radical coupling reactions into polymeric lignin. However, the lignin deposition process and the factors controlling it are unclear. In this study, the biochemical and developmental dependenciesmore » of lignification were investigated using a click-compatible monolignol analog, 3-O-propargylcaffeyl alcohol (3-OPC), which can incorporate into both in vitro polymerized lignin and Arabidopsis thaliana tissues. Fluorescence labeling of 3-OPC using click chemistry followed by confocal fluorescence microscopy enabled the detection and imaging of 3-OPC incorporation patterns. These patterns were consistent with endogenous lignification observed in different developmental stages of Arabidopsis stems. However, the concentration of supplied monolignols influenced where lignification occurred at the subcellular level, with low concentrations being deposited in cell corners and middle lamellae and high concentrations also being deposited in secondary walls. Experimental inhibition of multiple lignification factors confirmed that 3-OPC incorporation proceeds via a free radical coupling mechanism involving peroxidases/laccases and reactive oxygen species (ROS). Finally, the presence of peroxide-producing enzymes determined which cell walls lignified: adding exogenous peroxide and peroxidase caused cells that do not naturally lignify in Arabidopsis stems to lignify. In conclusion, 3-OPC accurately mimics natural lignification patterns in different developmental stages of Arabidopsis stems and allows for the dissection of key biochemical and enzymatic factors controlling lignification.« less
Erden, Emre; Ucar, M. Cigdem; Gezer, Tekin; Pazarlioglu, Nurdan Kasikara
2009-01-01
This study presents new and alternative fungal strains for the production of ligninolytic enzymes which have great potential to use in industrial and biotechnological processes. Thirty autochthonous fungal strains were harvested from Bornova-Izmir in Turkiye. In the fresh fruitbody extracts laccase, manganese peroxidase and lignin peroxidase activities, which are the principal enzymes responsible for ligninocellulose degradation by Basidiomycetes, were screened. Spores of some of the basidiomycetes species such as Cortinarius sp., Trametes versicolor, Pleurotus ostreatus, Abortiporus biennis, Lyophyllum subglobisporium, Ramaria stricta, Ganoderma carnosum, Lactarius delicious ve Lepista nuda were isolated and investigated optimum cultivation conditions in submerged fermentation for high yields of ligninolytic enzyme production. In addition, isolated fungal strains were monitored on agar plates whether having the capability of decolorization of a textile dye Remazol Marine Blue. PMID:24031371
Effects of laccase on lignin depolymerization and enzymatic hydrolysis of ensiled corn stover.
Chen, Qin; Marshall, Megan N; Geib, Scott M; Tien, Ming; Richard, Tom L
2012-08-01
The aim of this study was to explore the synergies of laccase, a ligninolytic enzyme, with cellulose and hemicellulase amendments on ensiled corn stover. Molecular signals of lignin decomposition were observed by tetramethylammonium hydroxide thermochemolysis and gas chromatography-mass spectroscopy (TMAH-GC-MS) analysis. The significant findings suggest that ensilage might provide a platform for biological pretreatment. By partially hydrolyzing cellulose and hemicellulose into soluble sugars, ensilage facilitates laccase penetration into the lignocellulose complex to enhance lignin degradation. Downstream cellulose hydrolysis was improved 7% with increasing laccase loading rate. These results demonstrate the potential of enzymes, either directly amended or expressed by microbes during ensilage, to maximize utilization of corn stover for cellulosic biofuels and other downstream fermentations. Copyright © 2012. Published by Elsevier Ltd.
Lv, Yuancai; Chen, Yuancai; Sun, Shiying; Hu, Yongyou
2014-03-01
The mutual interactions among the consortium constructed by four indigenous bacteria and five inter-kingdom fusants and the effects of nitrogen and carbon supplementations on lignin degradation and laccase activity were investigated. Analyzed by Plackett-Burman and central composite design, the microbial consortium were optimized, Bacillus sp. (B) and PE-9 and Pseudomonas putida (Pp) and PE-9 had significant interactions on lignin degradation based on a 5% level of significance. The nitrogen and carbon supplementations played an important role in lignin degradation and laccase production. The ultimate lignin degradation efficiency of 96.0% and laccase activity of 268U/L were obtained with 0.5g/L of ammonium chloride and 2g/L of sucrose. Results suggested that a stable and effective microbial consortium in alkalescent conditions was successfully achieved through the introduction of fusants, which was significant for its industrial application. Copyright © 2013 Elsevier Ltd. All rights reserved.
Bilal, Muhammad; Asgher, Muhammad; Parra-Saldivar, Roberto; Hu, Hongbo; Wang, Wei; Zhang, Xuehong; Iqbal, Hafiz M N
2017-01-15
In the twenty-first century, chemical and associated industries quest a transition prototype from traditional chemical-based concepts to a greener, sustainable and environmentally-friendlier catalytic alternative, both at the laboratory and industrial scale. In this context, bio-based catalysis offers numerous benefits along with potential biotechnological and environmental applications. The bio-based catalytic processes are energy efficient than conventional methodologies under moderate processing, generating no and negligible secondary waste pollution. Thanks to key scientific advances, now, solid-phase biocatalysts can be economically tailored on a large scale. Nevertheless, it is mandatory to recover and reprocess the enzyme for their commercial feasibility, and immobilization engineering can efficiently accomplish this challenge. The first part of the present review work briefly outlines the immobilization of lignin-modifying enzymes (LMEs) including lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase of white-rot fungi (WRF). Whereas, in the second part, a particular emphasis has been given on the recent achievements of carrier-immobilized LMEs for the degradation, decolorization, or detoxification of industrial dyes and dye-based industrial wastewater effluents. Copyright © 2016 Elsevier B.V. All rights reserved.
The ability of white-rot fungi to degrade the endocrine-disrupting compound nonylphenol.
Soares, Ana; Jonasson, Karin; Terrazas, Enrique; Guieysse, Benoit; Mattiasson, Bo
2005-03-01
Phanerochaete chrysosporium, Pleurotus ostreatus, Trametes versicolor and Bjerkandera sp. BOL13 were tested for their ability to degrade the endocrine-disrupting compound nonylphenol at an initial concentration of 100 mg l-1. The highest removals were achieved with T. versicolor and Bjerkandera sp. BOL13, which were able to degrade 97 mg l-1 and 99 mg l-1 of nonylphenol in 25 days of incubation, respectively. Nonylphenol removal was associated with the production of laccase by T. versicolor, but the levels of laccase, manganese peroxidase and lignin peroxidase produced by Bjerkandera sp. BOL13 were very low. At 14 degrees C, T. versicolor and Bjerkandera sp. BOL13 sustained the removal of 88 mg l-1 and 79 mg l-1 of nonylphenol, respectively. No pollutant removal was recorded at 4 degrees C, although both fungi could grow at this temperature in the absence of nonylphenol. A microtoxicity assay showed that the fungi produced compounds that were toxic to Vibrio fischerii; and thus a reduction in toxicity could not be correlated with nonylphenol metabolism. T. versicolor and Bjerkandera sp. BOL13 were capable of colonizing soil artificially contaminated with 430 mg kg-1 of nonylphenol. Only 1.3+/-0.1% of nonylphenol remained in the soil after 5 weeks of incubation.
Moraes, Eduardo C; Alvarez, Thabata M; Persinoti, Gabriela F; Tomazetto, Geizecler; Brenelli, Livia B; Paixão, Douglas A A; Ematsu, Gabriela C; Aricetti, Juliana A; Caldana, Camila; Dixon, Neil; Bugg, Timothy D H; Squina, Fabio M
2018-01-01
Lignin is a heterogeneous polymer representing a renewable source of aromatic and phenolic bio-derived products for the chemical industry. However, the inherent structural complexity and recalcitrance of lignin makes its conversion into valuable chemicals a challenge. Natural microbial communities produce biocatalysts derived from a large number of microorganisms, including those considered unculturable, which operate synergistically to perform a variety of bioconversion processes. Thus, metagenomic approaches are a powerful tool to reveal novel optimized metabolic pathways for lignin conversion and valorization. The lignin-degrading consortium (LigMet) was obtained from a sugarcane plantation soil sample. The LigMet taxonomical analyses (based on 16S rRNA) indicated prevalence of Proteobacteria , Actinobacteria and Firmicutes members, including the Alcaligenaceae and Micrococcaceae families, which were enriched in the LigMet compared to sugarcane soil. Analysis of global DNA sequencing revealed around 240,000 gene models, and 65 draft bacterial genomes were predicted. Along with depicting several peroxidases, dye-decolorizing peroxidases, laccases, carbohydrate esterases, and lignocellulosic auxiliary (redox) activities, the major pathways related to aromatic degradation were identified, including benzoate (or methylbenzoate) degradation to catechol (or methylcatechol), catechol ortho-cleavage, catechol meta-cleavage, and phthalate degradation. A novel Paenarthrobacter strain harboring eight gene clusters related to aromatic degradation was isolated from LigMet and was able to grow on lignin as major carbon source. Furthermore, a recombinant pathway for vanillin production was designed based on novel gene sequences coding for a feruloyl-CoA synthetase and an enoyl-CoA hydratase/aldolase retrieved from the metagenomic data set. The enrichment protocol described in the present study was successful for a microbial consortium establishment towards the lignin and aromatic metabolism, providing pathways and enzyme sets for synthetic biology engineering approaches. This work represents a pioneering study on lignin conversion and valorization strategies based on metagenomics, revealing several novel lignin conversion enzymes, aromatic-degrading bacterial genomes, and a novel bacterial strain of potential biotechnological interest. The validation of a biosynthetic route for vanillin synthesis confirmed the applicability of the targeted metagenome discovery approach for lignin valorization strategies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orellana, Roberto; Chaput, Gina; Markillie, Lye Meng
The production of lignocellulosic-derived biofuels is a highly promising source of alternative energy, but it has been constrained by the lack of a microbial platform capable to efficiently degrade this recalcitrant material and cope with by-products that can be toxic to cells. Species that naturally grow in environments where carbon is mainly available as lignin are promising for finding new ways of removing the lignin that protects cellulose for improved conversion of lignin to fuel precursors. Enterobacter lignolyticus SCF1 is a facultative anaerobic Gammaproteobacteria isolated from tropical rain forest soil collected in El Yunque forest, Puerto Rico under anoxic growthmore » conditions with lignin as sole carbon source. Whole transcriptome analysis of SCF1 during E.lignolyticus SCF1 lignin degradation was conducted on cells grown in the presence (0.1%, w/w) and the absence of lignin, where samples were taken at three different times during growth, beginning of exponential phase, mid-exponential phase and beginning of stationary phase. Lignin-amended cultures achieved twice the cell biomass as unamended cultures over three days, and in this time degraded 60% of lignin. Transcripts in early exponential phase reflected this accelerated growth. A complement of laccases, aryl-alcohol dehydrogenases, and peroxidases were most up-regulated in lignin amended conditions in mid-exponential and early stationary phases compared to unamended growth. The association of hydrogen production by way of the formate hydrogenlyase complex with lignin degradation suggests a possible value added to lignin degradation in the future.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Orellana, Roberto; Chaput, Gina; Markillie, Lye Meng
The production of lignocellulosic-derived biofuels is a highly promising source of alternative energy, but it has been constrained by the lack of a microbial platform capable to efficiently degrade this recalcitrant material and cope with by-products that can be toxic to cells. Species that naturally grow in environments where carbon is mainly available as lignin are promising for finding new ways of removing the lignin that protects cellulose for improved conversion of lignin to fuel precursors. Enterobacter lignolyticus SCF1 is a facultative anaerobic Gammaproteobacteria isolated from tropical rain forest soil collected in El Yunque forest, Puerto Rico under anoxic growthmore » conditions with lignin as sole carbon source. Whole transcriptome analysis of SCF1 during E.lignolyticus SCF1 lignin degradation was conducted on cells grown in the presence (0.1%, w/w) and the absence of lignin, where samples were taken at three different times during growth, beginning of exponential phase, midexponential phase and beginning of stationary phase. Lignin-amended cultures achieved twice the cell biomass as unamended cultures over three days, and in this time degraded 60% of lignin. Transcripts in early exponential phase reflected this accelerated growth. A complement of laccases, aryl-alcohol dehydrogenases, and peroxidases were most up-regulated in lignin amended conditions in mid-exponential and early stationary phases compared to unamended growth. The association of hydrogen production by way of the formate hydrogenlyase complex with lignin degradation suggests a possible value added to lignin degradation in the future.« less
Orellana, Roberto; Chaput, Gina; Markillie, Lye Meng; Mitchell, Hugh; Gaffrey, Matt; Orr, Galya; DeAngelis, Kristen M
2017-01-01
The production of lignocellulosic-derived biofuels is a highly promising source of alternative energy, but it has been constrained by the lack of a microbial platform capable to efficiently degrade this recalcitrant material and cope with by-products that can be toxic to cells. Species that naturally grow in environments where carbon is mainly available as lignin are promising for finding new ways of removing the lignin that protects cellulose for improved conversion of lignin to fuel precursors. Enterobacter lignolyticus SCF1 is a facultative anaerobic Gammaproteobacteria isolated from tropical rain forest soil collected in El Yunque forest, Puerto Rico under anoxic growth conditions with lignin as sole carbon source. Whole transcriptome analysis of SCF1 during E.lignolyticus SCF1 lignin degradation was conducted on cells grown in the presence (0.1%, w/w) and the absence of lignin, where samples were taken at three different times during growth, beginning of exponential phase, mid-exponential phase and beginning of stationary phase. Lignin-amended cultures achieved twice the cell biomass as unamended cultures over three days, and in this time degraded 60% of lignin. Transcripts in early exponential phase reflected this accelerated growth. A complement of laccases, aryl-alcohol dehydrogenases, and peroxidases were most up-regulated in lignin amended conditions in mid-exponential and early stationary phases compared to unamended growth. The association of hydrogen production by way of the formate hydrogenlyase complex with lignin degradation suggests a possible value added to lignin degradation in the future.
Chaput, Gina; Markillie, Lye Meng; Mitchell, Hugh; Gaffrey, Matt; Orr, Galya; DeAngelis, Kristen M.
2017-01-01
The production of lignocellulosic-derived biofuels is a highly promising source of alternative energy, but it has been constrained by the lack of a microbial platform capable to efficiently degrade this recalcitrant material and cope with by-products that can be toxic to cells. Species that naturally grow in environments where carbon is mainly available as lignin are promising for finding new ways of removing the lignin that protects cellulose for improved conversion of lignin to fuel precursors. Enterobacter lignolyticus SCF1 is a facultative anaerobic Gammaproteobacteria isolated from tropical rain forest soil collected in El Yunque forest, Puerto Rico under anoxic growth conditions with lignin as sole carbon source. Whole transcriptome analysis of SCF1 during E.lignolyticus SCF1 lignin degradation was conducted on cells grown in the presence (0.1%, w/w) and the absence of lignin, where samples were taken at three different times during growth, beginning of exponential phase, mid-exponential phase and beginning of stationary phase. Lignin-amended cultures achieved twice the cell biomass as unamended cultures over three days, and in this time degraded 60% of lignin. Transcripts in early exponential phase reflected this accelerated growth. A complement of laccases, aryl-alcohol dehydrogenases, and peroxidases were most up-regulated in lignin amended conditions in mid-exponential and early stationary phases compared to unamended growth. The association of hydrogen production by way of the formate hydrogenlyase complex with lignin degradation suggests a possible value added to lignin degradation in the future. PMID:29049419
Orellana, Roberto; Chaput, Gina; Markillie, Lye Meng; ...
2017-10-19
The production of lignocellulosic-derived biofuels is a highly promising source of alternative energy, but it has been constrained by the lack of a microbial platform capable to efficiently degrade this recalcitrant material and cope with by-products that can be toxic to cells. Species that naturally grow in environments where carbon is mainly available as lignin are promising for finding new ways of removing the lignin that protects cellulose for improved conversion of lignin to fuel precursors. Enterobacter lignolyticus SCF1 is a facultative anaerobic Gammaproteobacteria isolated from tropical rain forest soil collected in El Yunque forest, Puerto Rico under anoxic growthmore » conditions with lignin as sole carbon source. Whole transcriptome analysis of SCF1 during E.lignolyticus SCF1 lignin degradation was conducted on cells grown in the presence (0.1%, w/w) and the absence of lignin, where samples were taken at three different times during growth, beginning of exponential phase, mid-exponential phase and beginning of stationary phase. Lignin-amended cultures achieved twice the cell biomass as unamended cultures over three days, and in this time degraded 60% of lignin. Transcripts in early exponential phase reflected this accelerated growth. A complement of laccases, aryl-alcohol dehydrogenases, and peroxidases were most up-regulated in lignin amended conditions in mid-exponential and early stationary phases compared to unamended growth. The association of hydrogen production by way of the formate hydrogenlyase complex with lignin degradation suggests a possible value added to lignin degradation in the future.« less
Meehnian, Harmanpreet; Jana, Asim K
2017-04-01
Lignocellulolytic enzyme activities of selective fungi Daedalea flavida MTCC 145 (DF-2), Phlebia radiata MTCC 2791 (PR), and non-selective fungus Flavodon flavus MTCC 168 (FF) were studied for pretreatment of cotton stalks. Simultaneous productions of high LiP and laccase activities by DF-2 during early phase of growth were effective for lignin degradation 27.83 ± 1.25 % (w/w of lignin) in 20-day pretreatment. Production of high MnP activity without laccase in the early growth phase of PR was ineffective and delayed lignin degradation 24.93 ± 1.53 % in 25 days due to laccase production at later phase. With no LiP activity, low activities of MnP and laccase by FF yielded poor lignin degradation 15.09 ± 0.6 % in 20 days. Xylanase was predominant cellulolytic enzyme produced by DF-2, resulting hemicellulose as main carbon and energy source with 83 % of cellulose recovery after 40 days of pretreatment. The glucose yield improved more than two fold from 20-day DF-2 pretreated cotton stalks after enzymatic saccharification.
Kraft Pulp Bleaching and Delignification by Dikaryons and Monokaryons of Trametes versicolor
Addleman, Katherine; Archibald, Frederick
1993-01-01
The ability of 10 dikaryotic and 20 monokaryotic strains of Trametes (Coriolus) versicolor to bleach and delignify hardwood and softwood kraft pulps was assessed. A dikaryon (52P) and two of its mating-compatible monokaryons (52J and 52D) derived via protoplasting were compared. All three regularly bleached hardwood kraft pulp more than 20 brightness points (International Standards Organization) in 5 days and softwood kraft pulp the same amount in 12 days. Delignification (kappa number reduction) by the dikaryon and the monokaryons was similar, but the growth of the monokaryons was slower. Insoluble dark pigments were commonly found in the mycelium, medium, and pulp of the dikaryon only. Laccase and manganese peroxidase (MnP) but not lignin peroxidase activities were secreted during bleaching by all three strains. Their laccase and MnP isozyme patterns were compared on native gels. No segregation of isozyme bands between the monokaryons was found. Hardwood kraft pulp appeared to adsorb several laccase isozyme bands. One MnP isozyme (pI, 3.2) was secreted in the presence of pulp by all three strains, but a second (pI, 4.9) was produced only by 52P. A lower level of soluble MnP activity in one monokaryon (52D) was associated with reduced bleaching ability and a lower level of methanol production. Since monokaryon 52J bleached pulp better than its parent dikaryon 52P, especially per unit of biomass, this genetically simpler monokaryon will be the preferred subject for further genetic manipulation and improvement of fungal pulp biological bleaching. Images PMID:16348851
Goacher, Robyn E; Braham, Erick J; Michienzi, Courtney L; Flick, Robert M; Yakunin, Alexander F; Master, Emma R
2017-12-29
The modification and degradation of lignin play a vital role in carbon cycling as well as production of biofuels and bioproducts. The possibility of using bacterial laccases for the oxidation of lignin offers a route to utilize existing industrial protein expression techniques. However, bacterial laccases are most frequently studied on small model compounds that do not capture the complexity of lignocellulosic materials. This work studied the action of laccases from Bacillus subtilis and Salmonella typhimurium (EC 1.10.3.2) on ground wood samples from yellow birch (Betula alleghaniensis) and red spruce (Picea rubens). The ability of bacterial laccases to modify wood can be facilitated by small molecule mediators. Herein, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), gallic acid and sinapic acid mediators were tested. Direct analysis of the wood samples was achieved by time-of-flight secondary ion mass spectrometry (ToF-SIMS), a surface sensitive mass spectrometry technique that has characteristic peaks for H, G and S lignin. The action of the bacterial laccases on both wood samples was demonstrated and revealed a strong mediator influence. The ABTS mediator led to delignification, evident in an overall increase of polysaccharide peaks in the residual solid, along with equal loss of G and S-lignin peaks. The gallic acid mediator demonstrated minimal laccase activity. Meanwhile, the sinapic acid mediator altered the S/G peak ratio consistent with mediator attaching to the wood solids. The current investigation demonstrates the action of bacterial laccase-mediator systems directly on woody materials, and the potential of using ToF-SIMS to uncover the fundamental and applied role of bacterial enzymes in lignocellulose conversion. © 2017 Scandinavian Plant Physiology Society.
Oxidoreductases on their way to industrial biotransformations.
Martínez, Angel T; Ruiz-Dueñas, Francisco J; Camarero, Susana; Serrano, Ana; Linde, Dolores; Lund, Henrik; Vind, Jesper; Tovborg, Morten; Herold-Majumdar, Owik M; Hofrichter, Martin; Liers, Christiane; Ullrich, René; Scheibner, Katrin; Sannia, Giovanni; Piscitelli, Alessandra; Pezzella, Cinzia; Sener, Mehmet E; Kılıç, Sibel; van Berkel, Willem J H; Guallar, Victor; Lucas, Maria Fátima; Zuhse, Ralf; Ludwig, Roland; Hollmann, Frank; Fernández-Fueyo, Elena; Record, Eric; Faulds, Craig B; Tortajada, Marta; Winckelmann, Ib; Rasmussen, Jo-Anne; Gelo-Pujic, Mirjana; Gutiérrez, Ana; Del Río, José C; Rencoret, Jorge; Alcalde, Miguel
2017-11-01
Fungi produce heme-containing peroxidases and peroxygenases, flavin-containing oxidases and dehydrogenases, and different copper-containing oxidoreductases involved in the biodegradation of lignin and other recalcitrant compounds. Heme peroxidases comprise the classical ligninolytic peroxidases and the new dye-decolorizing peroxidases, while heme peroxygenases belong to a still largely unexplored superfamily of heme-thiolate proteins. Nevertheless, basidiomycete unspecific peroxygenases have the highest biotechnological interest due to their ability to catalyze a variety of regio- and stereo-selective monooxygenation reactions with H 2 O 2 as the source of oxygen and final electron acceptor. Flavo-oxidases are involved in both lignin and cellulose decay generating H 2 O 2 that activates peroxidases and generates hydroxyl radical. The group of copper oxidoreductases also includes other H 2 O 2 generating enzymes - copper-radical oxidases - together with classical laccases that are the oxidoreductases with the largest number of reported applications to date. However, the recently described lytic polysaccharide monooxygenases have attracted the highest attention among copper oxidoreductases, since they are capable of oxidatively breaking down crystalline cellulose, the disintegration of which is still a major bottleneck in lignocellulose biorefineries, along with lignin degradation. Interestingly, some flavin-containing dehydrogenases also play a key role in cellulose breakdown by directly/indirectly "fueling" electrons for polysaccharide monooxygenase activation. Many of the above oxidoreductases have been engineered, combining rational and computational design with directed evolution, to attain the selectivity, catalytic efficiency and stability properties required for their industrial utilization. Indeed, using ad hoc software and current computational capabilities, it is now possible to predict substrate access to the active site in biophysical simulations, and electron transfer efficiency in biochemical simulations, reducing in orders of magnitude the time of experimental work in oxidoreductase screening and engineering. What has been set out above is illustrated by a series of remarkable oxyfunctionalization and oxidation reactions developed in the frame of an intersectorial and multidisciplinary European RTD project. The optimized reactions include enzymatic synthesis of 1-naphthol, 25-hydroxyvitamin D 3 , drug metabolites, furandicarboxylic acid, indigo and other dyes, and conductive polyaniline, terminal oxygenation of alkanes, biomass delignification and lignin oxidation, among others. These successful case stories demonstrate the unexploited potential of oxidoreductases in medium and large-scale biotransformations. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Transcriptional response of lignin-degrading enzymes to 17α-ethinyloestradiol in two white rots
Přenosilová, L; Křesinová, Z; Amemori, A Slavíková; Cajthaml, T; Svobodová, K
2013-01-01
Fungal, ligninolytic enzymes have attracted a great attention for their bioremediation capabilities. A deficient knowledge of regulation of enzyme production, however, hinders the use of ligninolytic fungi in bioremediation applications. In this work, a transcriptional analyses of laccase and manganese peroxidase (MnP) production by two white rots was combined with determination of pI of the enzymes and the evaluation of 17α-ethinyloestradiol (EE2) degradation to study regulation mechanisms used by fungi during EE2 degradation. In the cultures of Trametes versicolor the addition of EE2 caused an increase in laccase activity with a maximum of 34.2 ± 6.7 U g−1 of dry mycelia that was observed after 2 days of cultivation. It corresponded to a 4.9 times higher transcription levels of a laccase-encoding gene (lacB) that were detected in the cultures at the same time. Simultaneously, pI values of the fungal laccases were altered in response to the EE2 treatment. Like T. versicolor, Irpex lacteus was also able to remove 10 mg l−1 EE2 within 3 days of cultivation. While an increase to I. lacteus MnP activity and MnP gene transcription levels was observed at the later phase of the cultivation. It suggests another metabolic role of MnP but EE2 degradation. PMID:23170978
Lignin-degrading Peroxidases from Genome of Selective Ligninolytic Fungus Ceriporiopsis subverispora
Elena Fernandez-Fueyo; Francisco J. Ruiz-Duenas; Yuta Miki; Marta Jesus Martinez; Kenneth E. Hammel; Angel T. Martinez
2012-01-01
Background: The first genome of a selective lignin degrader is available. Results: Its screening shows 26 peroxidase genes, and 5 genes were heterologously expressed and the catalytic properties investigated. Conclusion: Two new peroxidases oxidize simple and dimeric lignin models and efficiently depolymerize lignin. Significance: Although lignin peroxidase and...
Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.
2007-01-01
The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.
Cancel, A M; Orth, A B; Tien, M
1993-01-01
Phanerochaete chrysosporium is a white rot fungus which secretes a family of lignin-degrading enzymes under nutrient limitation. In this work, we investigated the roles of veratryl alcohol and lignin in the ligninolytic system of P. chrysosporium BKM-F-1767 cultures grown under nitrogen-limited conditions. Cultures supplemented with 0.4 to 2 mM veratryl alcohol showed increased lignin peroxidase activity. Addition of veratryl alcohol had no effect on Mn-dependent peroxidase activity and inhibited glyoxal oxidase activity. Azure-casein analysis of acidic proteases in the extracellular fluid showed that protease activity decreased during the early stages of secondary metabolism while lignin peroxidase activity was at its peak, suggesting that proteolysis was not involved in the regulation of lignin peroxidase activity during early secondary metabolism. In cultures supplemented with lignin or veratryl alcohol, no induction of mRNA coding for lignin peroxidase H2 or H8 was observed. Veratryl alcohol protected lignin peroxidase isozymes H2 and H8 from inactivation by H2O2. We conclude that veratryl alcohol acts as a stabilizer of lignin peroxidase activity and not as an inducer of lignin peroxidase synthesis. Images PMID:8215363
Kumar, Vidya Pradeep; Kolte, Atul P; Dhali, Arindam; Naik, Chandrashekar; Sridhar, Manpal
2018-04-25
Utilization of energy-rich crop residues by ruminants is restricted by the presence of lignin, which is recalcitrant to digestion. Application of lignin degrading enzymes on the lignocellulosic biomass exposes the cellulose for easy digestion by ruminants. Laccases have been found to be considerably effective in improving the digestibility by way of delignification. However, laccase yields from natural hosts are not sufficient for industrial scale applications, which restricts their use. A viable option would be to express the laccase gene in compatible hosts to achieve higher production yields. A codon-optimized synthetic variant of Schizophyllum commune laccase gene was cloned into a pPIC9K vector and expressed in P. pastoris GS115 (his4) under the control of an alcohol oxidase promoter. Colonies were screened for G418 resistance and the methanol utilization phenotype was established. The transformant yielded a laccase activity of 344 U·mL -1 after 5 days of growth at 30°C (0.019 g·mL -1 wet cell weight). The laccase protein produced by the recombinant Pichia clone was detected as two bands with apparent molecular weights of 55 kDa and 70 kDa on SDS-PAGE. Activity staining on native PAGE confirmed the presence of bioactive laccase. Treatment of five common crop residues with recombinant laccase recorded a lignin loss ranging between 1.64% in sorghum stover, to 4.83% in finger millet, with an enhancement in digestibility ranging between 8.71% in maize straw to 24.61% in finger millet straw. Treatment with recombinant laccase was effective in enhancing the digestibility of lignocellulosic biomass for ruminant feeding through delignification. To date, a number of hosts have been adventured to produce laccase in large quantities, but, to our knowledge, there are no reports of the expression of laccase protein from Schizophyllum commune in Pichia pastoris, and also on the treatment of crop residues using recombinant laccase for ruminant feeding.
High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization
Rodríguez-Escribano, David; de Salas, Felipe; Camarero, Susana
2017-01-01
Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin–Ciocalteau reagent (FCR), to detect the decrease in phenolic content produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). The method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates. PMID:28820431
High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel
Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less
High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization
Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel; ...
2017-08-18
Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less
Draelos, Zoe Diana
2015-01-01
Lignin peroxidase is a cosmetic skin-lightening alternative that breaks down plant cell walls and melanin. This research examined the topical efficacy of lignin peroxidase in pigment lightening. Sixty women aged 18 to 65 years with mild to moderate facial dyspigmentation were enrolled for 12 weeks in 2 cohorts. Cohort 1 applied lignin peroxidase to 1 randomized side of the face and nothing to the opposite side. Cohort 2 applied lignin peroxidase to 1 facial side and generic hydroquinone to the other. Investigator, subject, and dermospectrophotometer measurements were obtained. In cohort 1, improved skin texture (P < .001), roughness (P < .001), and overall appearance (P = .002) was noted at week 2 with lignin peroxidase versus no treatment. By week 12, there was a decrease in spot size with lignin peroxidase versus no treatment (P = .014). This was confirmed by a statistically significant reduction in melanin scores with the dermospectrophotometer on lignin peroxidase-treated side at weeks 4, 8, and 12 (P = .003) and a similar reduction in Melasma Area Severity Index score. Cohort 2 demonstrated parity between lignin peroxidase and hydroquinone, but lignin peroxidase was statistically superior in skin texture and roughness. The sample size was limited. Lignin peroxidase might be an over-the-counter skin-lightening preparation with efficacy parity to hydroquinone. Copyright © 2014 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.
Lebrun, Jérémie D; Trinsoutrot-Gattin, Isabelle; Laval, Karine; Mougin, Christian
2010-04-01
The relationship between the physiological state of fungi and the response of their functional system to metals is not known, limiting the use of fungal enzymes as tools for assessing metal ecotoxicity in terrestrial ecosystems. The present study attempts to establish how the development phases modulate the secretion of enzymes in the filamentous fungus Trametes versicolor after exposure to Cu. For that purpose, extracellular hydrolases (acid and alkaline phosphatases, aryl-sulfatase, beta-glucosidase, beta-galactosidase, and N-acetyl-beta-glucosaminidase) and oxidoreductases (laccase, manganese and lignin peroxidases) were monitored in liquid cultures for 2 weeks. Copper was added during either the growth or the stationary phases at 20 or 200 ppm. Results of the present study showed that Cu at the highest concentration modifies the secretion of enzymes, regardless of the development phase to which the fungus was exposed. However, the sensitivity of enzyme responses to Cu depended on the phase development and the type of secreted enzyme. In a general way, the production of hydrolases was decreased by Cu, whereas that of oxidoreductases was highly increased. Furthermore, lignin peroxidase was not detected in control cultures and was specifically produced in the presence of Cu. In conclusion, fungal oxidoreductases may be enzymatic biomarkers of copper exposure for ecotoxicity assessment. (c) 2009 SETAC.
Overproduction of recombinant laccase using a homologous expression system in Coriolus versicolor.
Kajita, Shinya; Sugawara, Shinsuke; Miyazaki, Yasumasa; Nakamura, Masaya; Katayama, Yoshihiro; Shishido, Kazuo; Iimura, Yosuke
2004-12-01
One of the major extracellular enzymes of the white-rot fungus Coriolus versicolor is laccase, which is involved in the degradation of lignin. We constructed a homologous system for the expression of a gene for laccase III (cvl3) in C. versicolor, using a chimeric laccase gene driven by the promoter of a gene for glyceraldehyde-3-phosphate dehydrogenase (gpd) from this fungus. We transformed C. versicolor successfully by introducing both a gene for hygromycin B phosphotransferase (hph) and the chimeric laccase gene. In three independent experiments, we recovered 47 hygromycin-resistant transformants at a transformation frequency of 13 transformants microg(-1) of plasmid DNA. We confirmed the introduction of the chimeric laccase gene into the mycelia of transformants by a polymerase chain reaction in nine randomly selected transformants. Overproduction of extracellular laccase by the transformants was revealed by a colorimetric assay for laccase activity. We examined the transformant (T2) that had the highest laccase activity and found that its activity was significantly higher than that of the wild type, particularly in the presence of copper (II). Our transformation system should contribute to the efficient production of the extracellular proteins of C. versicolor for the accelerated degradation of lignin and aromatic pollutants.
Laccases from Aureobasidium pullulans
USDA-ARS?s Scientific Manuscript database
Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...
Xu, Hui; Guo, Meng-Yuan; Gao, Yan-Hua; Bai, Xiao-Hui; Zhou, Xuan-Wei
2017-02-23
Manganese peroxidase (MnP) of white rot basidiomycetes, an extracellular heme enzyme, is part of a peroxidase superfamily that is capable of degrading the different phenolic compounds. Ganoderma, a white rot basidiomycete widely distributed worldwide, could secrete lignin-modifying enzymes (LME), including laccase (Lac), lignin peroxidases (LiP) and MnP. After the selection of a G. lucidum strain from five Ganoderma strains, the 1092 bp full-length cDNA of the MnP gene, designated as G. lucidum MnP (GluMnP1), was cloned from the selected strain. We subsequently constructed an eukaryotic expression vector, pAO815:: GlMnP, and transferred it into Pichia pastoris SMD116. Recombinant GluMnP1 (rGluMnP1) was with a yield of 126 mg/L and a molecular weight of approximately 37.72 kDa and a specific enzyme activity of 524.61 U/L. The rGluMnP1 could be capable of the decolorization of four types of dyes and the degradation of phenol. Phenol and its principal degradation products including hydroquinone, pyrocatechol, resorcinol, benzoquinone, were detected successfully in the experiments. The rGluMnP1 could be effectively expressed in Pichia pastoris and with a higher oxidation activity. We infer that, in the initial stages of the reaction, the catechol-mediated cycle should be the principal route of enzymatic degradation of phenol and its oxidation products. This study highlights the potential industrial applications associated with the production of MnP by genetic engineering methods, and the application of industrial wastewater treatment.
Bacterial extracellular lignin peroxidase
Crawford, Donald L.; Ramachandra, Muralidhara
1993-01-01
A newly discovered lignin peroxidase enzyme is provided. The enzyme is obtained from a bacterial source and is capable of degrading the lignin portion of lignocellulose in the presence of hydrogen peroxide. The enzyme is extracellular, oxidative, inducible by lignin, larch wood xylan, or related substrates and capable of attacking certain lignin substructure chemical bonds that are not degradable by fungal lignin peroxidases.
Conversion of lignin into value-added materials and chemicals via laccase-assisted copolymerization
Cannatelli, Mark D.; Ragauskas, Arthur J.
2016-09-19
With today’s environmental concerns and the diminishing supply of the world’s petroleum-based chemicals and materials, much focus has been directed toward alternative sources. Woody biomass presents a promising option due to its sheer abundance, renewability, and biodegradability. Lignin, a highly irregular polyphenolic compound, is one of the major chemical constituents of woody biomass and is the second most abundant biopolymer on Earth, surpassed only by cellulose. The pulp and paper and cellulosic ethanol industries produce lignin on the scale of millions of tons each year as a by-product. Traditionally, lignin has been viewed as a waste material and burned asmore » an inefficient fuel. However, in recent decades, research has focused on more economical ways to convert lignin into value-added commodities, such as biofuels, biomaterials, and biochemicals, thus developing and strengthening the concept of fully integrated biorefineries. Owing to the phenolic structure of lignin, it is possible to enzymatically graft molecules onto its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) to create exciting novel biomaterials. These environmentally friendly enzymes use oxygen as their only co-substrate and produce water as their sole by-product, and have thus found great industrial application. Furthermore, this mini-review highlights recent advances in the field of laccase-facilitated functionalization of lignin as well as promising future directions for lignin-based polymers.« less
Conversion of lignin into value-added materials and chemicals via laccase-assisted copolymerization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cannatelli, Mark D.; Ragauskas, Arthur J.
With today’s environmental concerns and the diminishing supply of the world’s petroleum-based chemicals and materials, much focus has been directed toward alternative sources. Woody biomass presents a promising option due to its sheer abundance, renewability, and biodegradability. Lignin, a highly irregular polyphenolic compound, is one of the major chemical constituents of woody biomass and is the second most abundant biopolymer on Earth, surpassed only by cellulose. The pulp and paper and cellulosic ethanol industries produce lignin on the scale of millions of tons each year as a by-product. Traditionally, lignin has been viewed as a waste material and burned asmore » an inefficient fuel. However, in recent decades, research has focused on more economical ways to convert lignin into value-added commodities, such as biofuels, biomaterials, and biochemicals, thus developing and strengthening the concept of fully integrated biorefineries. Owing to the phenolic structure of lignin, it is possible to enzymatically graft molecules onto its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) to create exciting novel biomaterials. These environmentally friendly enzymes use oxygen as their only co-substrate and produce water as their sole by-product, and have thus found great industrial application. Furthermore, this mini-review highlights recent advances in the field of laccase-facilitated functionalization of lignin as well as promising future directions for lignin-based polymers.« less
Conversion of lignin into value-added materials and chemicals via laccase-assisted copolymerization.
Cannatelli, Mark D; Ragauskas, Arthur J
2016-10-01
With today's environmental concerns and the diminishing supply of the world's petroleum-based chemicals and materials, much focus has been directed toward alternative sources. Woody biomass presents a promising option due to its sheer abundance, renewability, and biodegradability. Lignin, a highly irregular polyphenolic compound, is one of the major chemical constituents of woody biomass and is the second most abundant biopolymer on Earth, surpassed only by cellulose. The pulp and paper and cellulosic ethanol industries produce lignin on the scale of millions of tons each year as a by-product. Traditionally, lignin has been viewed as a waste material and burned as an inefficient fuel. However, in recent decades, research has focused on more economical ways to convert lignin into value-added commodities, such as biofuels, biomaterials, and biochemicals, thus developing and strengthening the concept of fully integrated biorefineries. Owing to the phenolic structure of lignin, it is possible to enzymatically graft molecules onto its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) to create exciting novel biomaterials. These environmentally friendly enzymes use oxygen as their only co-substrate and produce water as their sole by-product, and have thus found great industrial application. This mini-review highlights recent advances in the field of laccase-facilitated functionalization of lignin as well as promising future directions for lignin-based polymers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kerem, Z.; Friesem, D.; Hadar, Y.
Lignocellulose degradation and activities related to lignin degradation were studied in the solid-state fermentation of cotton stalks by comparison two white rot fungi, Pleurotus ostreatus and Phanerochaete chrysosporium. P. chrysosporium grew vigorously, resulting in rapid, nonselective degradation of 55% of the organic components of the cotton stalks within 15 days. In contrast, P. ostreatus grew more slowly with obvious selectivity for lignin degradation and resulting in the degradation of only 20% of the organic matter after 30 days of incubation. The kinetics of {sup 14}C-lignin mineralization exhibited similar differences. In cultures of P. chrysosporium, mineralization ceased after 18 days, resultingmore » in the release of 12% of the total radioactivity as {sup 14}CO{sub 2}. In P. ostreatus, on the other hand, 17% of the total radioactivity was released in a steady rate throughout a period of 60 days of incubation. Laccase activity was only detected in water extracts of the P. ostreatus fermentation. No lignin peroxidase activity was detected in either the water extract or liquid cultures of this fungus. 2-Keto-4-thiomethyl butyric acid cleavage to ethylene correlated to lignin degradation in both fungi. A study of fungal activity under solid-state conditions, in contrast to those done under defined liquid culture, may help to better understand the mechanism involved in lignocellulose degradation.« less
Transcriptional response of lignin-degrading enzymes to 17α-ethinyloestradiol in two white rots.
Přenosilová, L; Křesinová, Z; Amemori, A Slavíková; Cajthaml, T; Svobodová, K
2013-05-01
Fungal, ligninolytic enzymes have attracted a great attention for their bioremediation capabilities. A deficient knowledge of regulation of enzyme production, however, hinders the use of ligninolytic fungi in bioremediation applications. In this work, a transcriptional analyses of laccase and manganese peroxidase (MnP) production by two white rots was combined with determination of pI of the enzymes and the evaluation of 17α-ethinyloestradiol (EE2) degradation to study regulation mechanisms used by fungi during EE2 degradation. In the cultures of Trametes versicolor the addition of EE2 caused an increase in laccase activity with a maximum of 34.2 ± 6.7 U g⁻¹ of dry mycelia that was observed after 2 days of cultivation. It corresponded to a 4.9 times higher transcription levels of a laccase-encoding gene (lacB) that were detected in the cultures at the same time. Simultaneously, pI values of the fungal laccases were altered in response to the EE2 treatment. Like T. versicolor, Irpex lacteus was also able to remove 10 mg l⁻¹ EE2 within 3 days of cultivation. While an increase to I. lacteus MnP activity and MnP gene transcription levels was observed at the later phase of the cultivation. It suggests another metabolic role of MnP but EE2 degradation. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Kudanga, Tukayi; Prasetyo, Endry Nugroho; Sipilä, Jussi; Guebitz, Georg M; Nyanhongo, Gibson S
2010-08-20
Enzymatic processes provide new perspectives for modification of lignocellulose materials. In the current study, laccase catalyzed coupling of long chain alkylamines to lignin model molecules and lignocellulose was investigated. Up to two molecules of dodecylamine (DA) and dihexylamine (DHA) were successfully coupled with lignin monomers (guaiacol, catechol and ferulic acid) while coupling onto complex lignin model compounds (syringylglycerol beta-guaiacyl ether, guaiacylglycerol beta-guaiacyl ether and dibenzodioxocin) yielded 1:1 coupling products. Surface analysis of beech veneers enzymatically grafted with DA showed an increase in nitrogen content of 3.18% compared to 0.71% in laccase only treated controls while the O/C ratio decreased from 0.52 to 0.46. Concomitantly the grafting of DHA or DA onto beech veneers resulted in a 53.8% and 84.2% increase in hydrophobicity, respectively when compared to simple adsorption. Therefore, laccase-mediated grafting of long chain alkylamines onto lignocellulose materials can be potentially exploited for improving their hydrophobicity. Copyright 2010 Elsevier B.V. All rights reserved.
Shi, Yan; Chai, Liyuan; Tang, Chongjian; Yang, Zhihui; Zheng, Yu; Chen, Yuehui; Jing, Qingxiu
2013-12-01
Kraft lignin (KL) is the major pollutant in black liquor. The bacterial strain Pandoraea sp. B-6 was able to degrade KL without any co-substrate under high alkaline conditions. At least 38.2 % of chemical oxygen demand and 41.6 % of color were removed in 7 days at concentrations from 1 to 6 g L(-1). The optimum pH for KL degradation was 10 and the optimum temperature was 30 °C. The greatest activities of 2,249.2 U L(-1) for manganese peroxidase and 1,120.6 U L(-1) for laccase were detected on the third and fifth day at pH 10, respectively. Many small molecules, such as cinnamic acid, ferulic acid, 2-hydroxy benzyl alcohol, and vanillyl methyl ketone, were formed during the period of KL degradation based on GC-MS analysis. These results indicate that this strain has great potential for biotreatment of black liquor.
Daniel, G; Volc, J; Kubatova, E
1994-07-01
The production of the H(2)O(2)-generating enzyme pyranose oxidase (POD) (EC 1.1.3.10) (synonym, glucose 2-oxidase), two ligninolytic peroxidases, and laccase in wood decayed by three white rot fungi was investigated by correlated biochemical, immunological, and transmission electron microscopic techniques. Enzyme activities were assayed in extracts from decayed birch wood blocks obtained by a novel extraction procedure. With the coupled peroxidase-chromogen (3-dimethylaminobenzoic acid plus 3-methyl-2-benzothiazolinone hydrazone hydrochloride) spectrophotometric assay, the highest POD activities were detected in wood blocks degraded for 4 months and were for Phanerochaete chrysosporium (149 mU g [dry weight] of decayed wood), Trametes versicolor (45 mU g), and Oudemansiella mucida (1.2 mU g), corresponding to wood dry weight losses of 74, 58, and 13%, respectively. Mn-dependent peroxidase activities in the same extracts were comparable to those of POD, while lignin peroxidase activity was below the detection limit for all fungi with the veratryl alcohol assay. Laccase activity was high with T. versicolor (422 mU g after 4 months), in trace levels with O. mucida, and undetectable in P. chrysosporium extracts. Evidence for C-2 specificity of POD was shown by thin-layer chromatography detection of 2-keto-d-glucose as the reaction product. By transmission electron microscopy-immunocytochemistry, POD was found to be preferentially localized in the hyphal periplasmic space of P. chrysosporium and O. mucida and associated with membranous materials in hyphae growing within the cell lumina or cell walls of partially and highly degraded birch fibers. An extracellular distribution of POD associated with slime coating wood cell walls was also noted. The periplasmic distribution in hyphae and extracellular location of POD are consistent with the reported ultrastructural distribution of H(2)O(2)-dependent Mn-dependent peroxidases. This fact and the dominant presence of POD and Mn-dependent peroxidase in extracts from degraded wood suggest a cooperative role of the two enzymes during white rot decay by the test fungi.
Evaluation of laccase-mediator system (LMS) in the oxidation of veratryl alcohol
USDA-ARS?s Scientific Manuscript database
Identifying suitable reaction conditions remains an important task in the development of enzyme catalysis. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially...
Yuta Miki; Rebecca Pogni; Sandra Acebes; Fatima Lucas; Elena Fernandez-Fueyo; Maria Camilla Baratto; Maria I. Fernandez; Vivian De Los Rios; Francisco J. Ruiz-duenas; Adalgisa Sinicropi; Riccardo Basosi; Kenneth E. Hammel; Victor Guallar; Angel T. Martinez
2013-01-01
LiP (lignin peroxidase) from Trametopsis cervina has an exposed catalytic tyrosine residue (Tyr181) instead of the tryptophan conserved in other lignin-degrading peroxidases. Pristine LiP showed a lag period in VA (veratryl alcohol) oxidation. However, VA-LiP (LiP after treatment with H2O2...
Laccase-mediated synthesis of lignin-core hyperbranched copolymers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cannatelli, Mark D.; Ragauskas, Arthur J.
Lignin, one of the major chemical constituents of woody biomass, is the second most abundant biopolymer found in nature. The pulp and paper industry has long produced lignin on the scale of millions of tons annually as a by-product of the pulping process, and the dawn of cellulosic ethanol production has further contributed to this amount. Historically, lignin has been perceived as a waste material and burned as a fuel for the pulping process. But, recent research has been geared toward developing cost-effective technologies to convert lignin into valuable commodities. Attributing to the polyphenolic structure of lignin, enzymatic modification ofmore » its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) has demonstrated to be highly successful. The current study aims at developing lignin-core hyperbranched copolymers via the laccase-assisted copolymerization of kraft lignin with methylhydroquinone and a trithiol. Based on the physical properties of the resulting material, it is likely that crosslinking reactions have taken place during the drying process to produce a copolymeric network rather than discrete hyperbranched copolymers, with NMR data providing evidence of covalent bonding between monomers. A preliminary thermal analysis data reveals that the copolymeric material possesses a moderate glass transition temperature and exhibits good thermostability, thus may have potential application as a lignin-based thermoplastic. Scanning electron microscopy images confirm the smooth, glossy surface of the material and that it is densely packed. Our results are a sustainable, ecofriendly, economic method to create an exciting novel biomaterial from a renewable feedstock while further enhancing lignin valorization.« less
Laccase-mediated synthesis of lignin-core hyperbranched copolymers
Cannatelli, Mark D.; Ragauskas, Arthur J.
2017-06-06
Lignin, one of the major chemical constituents of woody biomass, is the second most abundant biopolymer found in nature. The pulp and paper industry has long produced lignin on the scale of millions of tons annually as a by-product of the pulping process, and the dawn of cellulosic ethanol production has further contributed to this amount. Historically, lignin has been perceived as a waste material and burned as a fuel for the pulping process. But, recent research has been geared toward developing cost-effective technologies to convert lignin into valuable commodities. Attributing to the polyphenolic structure of lignin, enzymatic modification ofmore » its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) has demonstrated to be highly successful. The current study aims at developing lignin-core hyperbranched copolymers via the laccase-assisted copolymerization of kraft lignin with methylhydroquinone and a trithiol. Based on the physical properties of the resulting material, it is likely that crosslinking reactions have taken place during the drying process to produce a copolymeric network rather than discrete hyperbranched copolymers, with NMR data providing evidence of covalent bonding between monomers. A preliminary thermal analysis data reveals that the copolymeric material possesses a moderate glass transition temperature and exhibits good thermostability, thus may have potential application as a lignin-based thermoplastic. Scanning electron microscopy images confirm the smooth, glossy surface of the material and that it is densely packed. Our results are a sustainable, ecofriendly, economic method to create an exciting novel biomaterial from a renewable feedstock while further enhancing lignin valorization.« less
Laccase-mediated synthesis of lignin-core hyperbranched copolymers.
Cannatelli, Mark D; Ragauskas, Arthur J
2017-08-01
Lignin, one of the major chemical constituents of woody biomass, is the second most abundant biopolymer found in nature. The pulp and paper industry has long produced lignin on the scale of millions of tons annually as a by-product of the pulping process, and the dawn of cellulosic ethanol production has further contributed to this amount. Historically, lignin has been perceived as a waste material and burned as a fuel for the pulping process. However, recent research has been geared toward developing cost-effective technologies to convert lignin into valuable commodities. Attributing to the polyphenolic structure of lignin, enzymatic modification of its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) has demonstrated to be highly successful. The current study aims at developing lignin-core hyperbranched copolymers via the laccase-assisted copolymerization of kraft lignin with methylhydroquinone and a trithiol. Based on the physical properties of the resulting material, it is likely that crosslinking reactions have taken place during the drying process to produce a copolymeric network rather than discrete hyperbranched copolymers, with NMR data providing evidence of covalent bonding between monomers. Preliminary thermal analysis data reveals that the copolymeric material possesses a moderate glass transition temperature and exhibits good thermostability, thus may have potential application as a lignin-based thermoplastic. Scanning electron microscopy images confirm the smooth, glossy surface of the material and that it is densely packed. The presented results are a sustainable, ecofriendly, economic method to create an exciting novel biomaterial from a renewable feedstock while further enhancing lignin valorization.
Singh, Rajender; Ahlawat, O P; Rajor, Anita
2012-12-01
The study presents variation in microbial population of Agaricus bisporus, Pleurotus sajor-caju and Volvariella volvacea spent substrates (SMS) along with ligninolytic enzymes activity and textile effluent decolorization potential of microorganisms isolated from these. The effect of temperature, pH, carbon sources and immobilizing agents on effluent decolorization using different combinations of these microorganisms has also been studied. SMS of P. sajor-caju harbored highest population and diversity of bacteria and fungi compared to other SMSs. Schizophyllum commune and Pezizomycotina sp. from P. sajor-caju SMS, exhibited highest activities of laccase (11.8 and 8.32U mL(-1)) and lignin peroxidase (339 and 318 UL(-1)), while Pseudomonas fluorescens of Manganese peroxidase. Highest decolorization was in presence of glucose and sucrose at 30°C, and microbial consortium comprised of the immobilized forms of S. commune and Pezizomycotina sp. on wheat straw and broth cultures of P. fluorescens, Bacillus licheniformis and Bacillus pumilus. Copyright © 2012 Elsevier Ltd. All rights reserved.
Miranda, Rita de Cássia M de; Gomes, Edelvio de Barros; Pereira, Nei; Marin-Morales, Maria Aparecida; Machado, Katia Maria Gomes; Gusmão, Norma Buarque de
2013-08-01
Investigations on biodegradation of textile effluent by filamentous fungi strains Curvularia lunata URM 6179 and Phanerochaete chrysosporium URM 6181 were performed in static bioreactors under aerated and non-aerated conditions. Spectrophotometric, HPLC/UV and LC-MS/MS analysis were performed as for to confirm, respectively, decolourisation, biodegradation and identity of compounds in the effluent. Enzymatic assays revealed higher production of enzymes laccase (Lac), lignin peroxidase (LiP) and manganese-dependent peroxidase (MnP) by P. chrysosporium URM 6181 in aerated bioreactor (2020; 39 and 392 U/l, respectively). Both strains decolourised completely the effluent after ten days and biodegradation of the most predominant indigo dye was superior in aerated bioreactor (96%). Effluent treated by P. chrysosporium URM 6181 accumulated a mutagenic metabolite derived from indigo. The C. lunata URM 6179 strain, showed to be more successful for assure the environmental quality of treated effluent. These systems were found very effective for efficient fungal treatment of textile effluent. Copyright © 2013 Elsevier Ltd. All rights reserved.
Induction of wheat straw delignification by Trametes species
Knežević, Aleksandar; Stajić, Mirjana; Jovanović, Vladimir M.; Kovačević, Višnja; Ćilerdžić, Jasmina; Milovanović, Ivan; Vukojević, Jelena
2016-01-01
Wheat straw is the major crop residue in European countries which makes it the most promising material for bioconversion into biofuels. However, cellulose and hemicellulose are protected with lignin, so delignification is an inevitable phase in lignocellulose processing. The organisms predominantly responsible for its degradation are white-rot fungi and among them Trametes species represent promising degraders due to a well-developed ligninolytic enzyme system. Although numerous studies have confirmed that low molecular weight compounds can induce the production and activity of ligninolytic enzymes it is not clear how this reflects on the extent of delignification. The aim of the study was to assess the capacity of p-anisidine and veratryl alcohol to induce the production and activity of Mn-oxidizing peroxidases and laccases, and wheat straw delignification by six Trametes species. Significant inter- and intraspecific variations in activity and features of these enzymes were found, as well as differences in the potential of lignocellulose degradation in the presence or absence of inducers. Differences in the catalytic properties of synthesized enzyme isoforms strongly affected lignin degradation. Apart from enhanced lignin degradation, the addition of p-anisidine could significantly improve the selectivity of wheat straw ligninolysis, which was especially evident for T. hirsuta strains. PMID:27216645
Combinatorial evaluation of the laccase-mediator system (LMS) in the oxidation of veratryl alcohol
USDA-ARS?s Scientific Manuscript database
Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both co...
Carabajal, Maira; Kellner, Harald; Levin, Laura; Jehmlich, Nico; Hofrichter, Martin; Ullrich, René
2013-10-10
The present work was carried out with the aim to analyze the secretome of Trametes versicolor BAFC 2234 grown on tomato juice medium supplemented with copper and manganese. T. versicolor BAFC 2234 was selected among diverse wood dwelling agaricomycetes from Argentina by its ability to cause a strong white rot on hardwood and in addition to show high tolerance toward phenolic compounds. A considerable number of the identified proteins were related to the degradation/modification of lignocelluloses. Hydrolases, peroxidases and phenoloxidases were the most abundant enzymes produced under the above-mentioned culture conditions. The lignin-modifying oxidoreductases laccase, manganese peroxidase (MnP) and versatile peroxidase (VP) were successfully purified - the latter for the first time from T. versicolor. The native VP protein has a molecular mass of 45kDa and an isoelectric point of pH 3.7. The study clearly shows that complex plant-based media being rich in phenolics, such as tomato juice, can stimulate the secretion of a broad set of extracellular lignocellulolytic enzymes. Using such natural products as fungal culture media may give the opportunity to investigate plant biomass decomposition as well as the biodegradation of organic pollutants in an environment close to nature. Copyright © 2013 Elsevier B.V. All rights reserved.
Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël
2014-01-01
Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Advanced Chemical Design for Efficient Lignin Bioconversion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Shangxian; Sun, Qining; Pu, Yunqiao
Here, lignin depolymerization mainly involves redox reactions relying on the effective electron transfer. Even though electron mediators were previously used for delignification of paper pulp, no study has established a bioprocess to fragment and solubilize the lignin with an effective laccase–mediator system, in particular, for subsequent microbial bioconversion. Efficient lignin depolymerization was achieved by screening proper electron mediators with laccase to attain a nearly 6-fold increase of kraft lignin solubility compared to the control kraft lignin without laccase treatment. Chemical analysis suggested the release of a low molecular weight fraction of kraft lignin into the solution phase. Moreover, NMR analysismore » revealed that an efficient enzyme–mediator system can promote the lignin degradation. More importantly, the fundamental mechanisms guided the development of an efficient lignin bioconversion process, where solubilized lignin from laccase–HBT treatment served as a superior substrate for bioconversion by Rhodococcus opacus PD630. The cell growth was increased by 10 6 fold, and the lipid titer reached 1.02 g/L. Overall, the study has manifested that an efficient enzyme–mediator–microbial system can be exploited to establish a bioprocess to solubilize lignin, cleave lignin linkages, modify the structure, and produce substrates amenable to bioconversion.« less
Advanced Chemical Design for Efficient Lignin Bioconversion
Xie, Shangxian; Sun, Qining; Pu, Yunqiao; ...
2017-01-30
Here, lignin depolymerization mainly involves redox reactions relying on the effective electron transfer. Even though electron mediators were previously used for delignification of paper pulp, no study has established a bioprocess to fragment and solubilize the lignin with an effective laccase–mediator system, in particular, for subsequent microbial bioconversion. Efficient lignin depolymerization was achieved by screening proper electron mediators with laccase to attain a nearly 6-fold increase of kraft lignin solubility compared to the control kraft lignin without laccase treatment. Chemical analysis suggested the release of a low molecular weight fraction of kraft lignin into the solution phase. Moreover, NMR analysismore » revealed that an efficient enzyme–mediator system can promote the lignin degradation. More importantly, the fundamental mechanisms guided the development of an efficient lignin bioconversion process, where solubilized lignin from laccase–HBT treatment served as a superior substrate for bioconversion by Rhodococcus opacus PD630. The cell growth was increased by 10 6 fold, and the lipid titer reached 1.02 g/L. Overall, the study has manifested that an efficient enzyme–mediator–microbial system can be exploited to establish a bioprocess to solubilize lignin, cleave lignin linkages, modify the structure, and produce substrates amenable to bioconversion.« less
A Tomato Peroxidase Involved in the Synthesis of Lignin and Suberin1
Quiroga, Mónica; Guerrero, Consuelo; Botella, Miguel A.; Barceló, Araceli; Amaya, Iraida; Medina, María I.; Alonso, Francisco J.; de Forchetti, Silvia Milrad; Tigier, Horacio; Valpuesta, Victoriano
2000-01-01
The last step in the synthesis of lignin and suberin has been proposed to be catalyzed by peroxidases, although other proteins may also be involved. To determine which peroxidases are involved in the synthesis of lignin and suberin, five peroxidases from tomato (Lycopersicon esculentum) roots, representing the majority of the peroxidase activity in this organ, have been partially purified and characterized kinetically. The purified peroxidases with isoelectric point (pI) values of 3.6 and 9.6 showed the highest catalytic efficiency when the substrate used was syringaldazine, an analog of lignin monomer. Using a combination of transgenic expression and antibody recognition, we now show that the peroxidase pI 9.6 is probably encoded by TPX1, a tomato peroxidase gene we have previously isolated. In situ RNA hybridization revealed that TPX1 expression is restricted to cells undergoing synthesis of lignin and suberin. Salt stress has been reported to induce the synthesis of lignin and/or suberin. This stress applied to tomato caused changes in the expression pattern of TPX1 and induced the TPX1 protein. We propose that the TPX1 product is involved in the synthesis of lignin and suberin. PMID:10759507
Fungal Laccases and Their Applications in Bioremediation
Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla
2014-01-01
Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348
Mishra, Vartika; Jana, Asim K; Jana, Mithu Maiti; Gupta, Antriksh
2017-07-01
The objective of this work was to study the increase in multiple lignolytic enzyme productions through the use of supplements in combination in pretreatment of sweet sorghum bagasse (SSB) by Coriolus versicolor such that enzymes act synergistically to maximize the lignin degradation and selectivity. Enzyme activities were enhanced by metallic salts and phenolic compound supplements in SSF. Supplement of syringic acid increased the activities of LiP, AAO and laccase; gallic acid increased MnP; CuSO 4 increased laccase and PPO to improve the lignin degradations and selectivity individually, higher than control. Combination of supplements optimized by RSM increased the production of laccase, LiP, MnP, PPO and AAO by 17.2, 45.5, 3.5, 2.4 and 3.6 folds respectively for synergistic action leading to highest lignin degradation (2.3 folds) and selectivity (7.1 folds). Enzymatic hydrolysis of pretreated SSB yielded ∼2.43 times fermentable sugar. This technique could be widely applied for pretreatment and enzyme productions. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bryan, Anthony C.; Jawdy, Sara; Gunter, Lee; ...
2016-04-15
Plant laccases are thought to function in the oxidation of monolignols which leads to higher order lignin formation. Only a hand-full of laccases in plants have been functionally evaluated and as such little is known about the breadth of their impact on cell wall chemistry or structure. Here we describe a previously uncharacterized laccase from Populus, encoded by locus Potri.008G06400, whose reduced expression resulted in transgenic Populus trees with changes in syringyl/guaiacyl (S/G) ratios as well as altered sugar release phenotypes. These phenotypes are consistent with plant biomass exhibiting reduced recalcitrance. Interestingly, the transgene effect on recalcitrance is dependent onmore » a mild pretreatment prior to chemical extraction of sugars. Metabolite profiling suggests the transgene modulates phenolics that are associated with the cell wall structure. Finally, we propose a model in which this particular laccase has a range of functions related to oxidation of phenolics that interact with lignin in the cell wall.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bryan, Anthony C.; Jawdy, Sara; Gunter, Lee
Plant laccases are thought to function in the oxidation of monolignols which leads to higher order lignin formation. Only a hand-full of laccases in plants have been functionally evaluated and as such little is known about the breadth of their impact on cell wall chemistry or structure. Here we describe a previously uncharacterized laccase from Populus, encoded by locus Potri.008G06400, whose reduced expression resulted in transgenic Populus trees with changes in syringyl/guaiacyl (S/G) ratios as well as altered sugar release phenotypes. These phenotypes are consistent with plant biomass exhibiting reduced recalcitrance. Interestingly, the transgene effect on recalcitrance is dependent onmore » a mild pretreatment prior to chemical extraction of sugars. Metabolite profiling suggests the transgene modulates phenolics that are associated with the cell wall structure. Finally, we propose a model in which this particular laccase has a range of functions related to oxidation of phenolics that interact with lignin in the cell wall.« less
Enzymatically and chemically oxidized lignin nanoparticles for biomaterial applications.
Mattinen, Maija-Liisa; Valle-Delgado, Juan José; Leskinen, Timo; Anttila, Tuomas; Riviere, Guillaume; Sipponen, Mika; Paananen, Arja; Lintinen, Kalle; Kostiainen, Mauri; Österberg, Monika
2018-04-01
Cross-linked and decolorized lignin nanoparticles (LNPs) were prepared enzymatically and chemically from softwood Kraft lignin. Colloidal lignin particles (CLPs, ca. 200 nm) in a non-malodorous aqueous dispersion could be dried and redispersed in tetrahydrofuran (THF) or in water retaining their stability i.e. spherical shape and size. Two fungal laccases, Trametes hirsuta (ThL) and Melanocarpus albomyces (MaL) were used in the cross-linking reactions. Reactivity of ThL and MaL on Lignoboost™ lignin and LNPs was confirmed by high performance size exclusion chromatography (HPSEC) and oxygen consumption measurements with simultaneous detection of red-brown color due to the formation of quinones. Zeta potential measurements verified oxidation of LNPs via formation of surface-oriented carboxylic acid groups. Dynamic light scattering (DLS) revealed minor changes in the particle size distributions of LNPs after laccase catalyzed radicalization, indicating preferably covalent intraparticular cross-linking over polymerization. Changes in the surface morphology of laccase treated LNPs were imaged by atomic force (AFM) and transmission emission (TEM) microscopy. Furthermore, decolorization of LNPs without degradation was obtained using ultrasonication with H 2 O 2 in alkaline reaction conditions. The research results have high impact for the utilization of Kraft lignin as nanosized colloidal particles in advanced bionanomaterial applications in medicine, foods and cosmetics including different sectors from chemical industry. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collins, P.J.; Dobson, A.D.W.; Kotterman, M.J.J.
1996-12-01
Polycyclic aromatic hydrocarbons, particularly benzene homologs, are highly toxic organic pollutants. One of the three major groups of extracellular oxidative enzymes involved in the white rot fungal lignin degradative process are laccases. This study presents evidence indicating that laccase has a role in PAH oxidation by white rot fungi. 36 refs., 5 figs., 1 tab.
Laccase pretreatment for agrofood wastes valorization.
Giacobbe, Simona; Pezzella, Cinzia; Lettera, Vincenzo; Sannia, Giovanni; Piscitelli, Alessandra
2018-06-01
Apple pomace, potato peels, and coffee silverskin are attractive agrofood wastes for the production of biofuels and chemicals, due to their abundance and carbohydrate content. As lignocellulosic biomasses, their conversion is challenged by the presence of lignin that prevents hydrolysis of polysaccharides, hence demanding a pretreatment step. In this work, the effectiveness of Pleurotus ostreatus laccases (with and without mediator) to remove lignin, improving the subsequent saccharification, was assessed. Optimized conditions for sequential protocol were set up for all agrofood wastes reaching delignification and detoxification yields correlated with high saccharification. Especially noteworthy were results for apple pomace and coffee silverskin for which 83% of and 73% saccharification yields were observed, by using laccase and laccase mediator system, respectively. The herein developed sequential protocol, saving soluble sugars and reducing the amount of wastewater, can improve the overall process for obtaining chemicals or fuels from agrofood wastes. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production
NASA Astrophysics Data System (ADS)
Slavens, Shelyn Gehle
Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass were increased significantly by fungal pretreatment.
Leite, Oldair D; Lupetti, Karina O; Fatibello-Filho, Orlando; Vieira, Iolanda C; Barbosa, Aneli de M
2003-04-10
Several bi-enzymatic carbon paste biosensors modified with enzymes laccase from Pleurotus ostreatus fungi and peroxidase from zucchini (Cucurbita pepo) were constructed for evaluating the synergic effect of the two enzymes on the voltammetric biosensor response for various catecholamines. Initially was investigated the effect of pH from 5.0 to 7.5, temperature from 25 to 50 degrees C, initial stirring time from 30 to 150 s, scan rate from 10 to 60 mVs(-1) and potential pulse amplitude from 10 to 60 mV on the biosensor response for several catecholamines such as dopamine, adrenaline, isoprenaline and l-dopa. It was observed a biosensor signal increase employing both enzymes, indicating thus there is a synergic effect between laccase and peroxidase, verified also in spectrophotometric studies, in the determination of these catecholamines.
MacDonald, Jacqueline; Goacher, Robyn E; Abou-Zaid, Mamdouh; Master, Emma R
2016-09-01
White-rot fungi are distinguished by their ability to efficiently degrade lignin via lignin-modifying type II peroxidases, including manganese peroxidase (MnP) and lignin peroxidase (LiP). In the present study, time-of flight secondary ion mass spectrometry (ToF-SIMS) was used to evaluate lignin modification in three coniferous and three deciduous wood preparations following treatment with commercial preparations of LiP and MnP from two different white-rot fungi. Percent modification of lignin was calculated as a loss of intact methoxylated lignin over nonfunctionalized aromatic rings, which is consistent with oxidative cleavage of methoxy moieties within the lignin structure. Exposure to MnP resulted in greater modification of lignin in coniferous compared to deciduous wood (28 vs. 18 % modification of lignin); and greater modification of G-lignin compared to S-lignin within the deciduous wood samples (21 vs. 12 %). In contrast, exposure to LiP resulted in similar percent modification of lignin in all wood samples (21 vs 22 %), and of G- and S-lignin within the deciduous wood (22 vs. 23 %). These findings suggest that the selected MnP and LiP may particularly benefit delignification of coniferous and deciduous wood, respectively. Moreover, the current analysis further demonstrates the utility of ToF-SIMS for characterizing enzymatic modification of lignin in wood fibre along with potential advantages over UV and HPCL-MS detection of solubilized delignification products.
Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal
2016-01-01
The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939
Expression and characterization of novel laccase gene from Pandoraea sp. ISTKB and its application.
Kumar, Madan; Mishra, Arti; Singh, Shashi Shekhar; Srivastava, Shaili; Thakur, Indu Shekhar
2018-04-14
In the present study, a non-blue laccase gene from previously reported lignin degrading bacterium, Pandoraea sp. ISTKB, was isolated, cloned and expressed in E. coli. Bioinformatics analysis of sequence discovered twin-arginine translocation signal sequence, copper binding motifs and presence of more random coil compare to helices and sheets in structure. The enzyme was found to be active on wide pH range and the pH optima was observed at pH 4 and 8 on substrate 2,2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) and 2,6-Dimethoxyphenol respectively. This is a thermophilic enzyme with maximum activity around 50-70 °C. The enzyme was further characterized by spectroscopy, reaction kinetics and effect of metal ions and inhibitors were studied. Compared to laccase alone; the treatment of dyes with laccase plus mediator resulted in enhanced decolorization of crystal violet, methylene blue, azure B, carmine and Congo red but the effect of mediator was not observed on trypan blue. Laccase treatment triggered polymerization on vanillic acid (VA) and kraft lignin (KL). Laccase plus mediator treatment reversed the polymerization and resulted in transformation or degradation of VA and KL. This thermophilic and alkalophilic non-blue laccase from Pandoraea sp. ISTKB is promising with prospective biotechnological application. Copyright © 2018. Published by Elsevier B.V.
Johansson, T; Nyman, P O
1993-01-01
The basidiomycete Trametes versicolor is a white-rot fungus and a potent degrader of lignin. The development of extracellular enzyme activities in the fungal culture under physiological conditions of secondary metabolism was investigated. Using the culture medium as starting material a large number of peroxidase forms were purified by the use of chromatographic techniques. Sixteen forms of lignin peroxidase and five forms of manganese(II) peroxidase were separated and the majority of these enzymes was characterized with respect to isoelectric point, molecular mass, and specific enzyme activity. The manganese(II) peroxidases showed a lower isoelectric point (pI 3.2-2.9) and a slightly higher molecular mass (44-45 kDa) than the lignin peroxidases (pI 3.7-3.1, and 41-43 kDa). Specific enzyme activities for the forms of lignin peroxidase, using veratryl alcohol as the substrate, were found to differ considerably. Certain differences in the specific enzyme activity were also observed among the forms of manganese(II) peroxidase. A multitude of peroxidase forms has previously been encountered in another white-rot fungus, Phanerochaete chrysosporium. The discovery that it also occurs in T. versicolor would suggest that this multiplicity could be a common feature among white-rot fungi and may be essential for the biodegradation of lignin.
Laccase: microbial sources, production, purification, and potential biotechnological applications.
Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay
2011-01-01
Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.
Potential uses of spent mushroom substrate and its associated lignocellulosic enzymes.
Phan, Chia-Wei; Sabaratnam, Vikineswary
2012-11-01
Mushroom industries generate a virtually in-exhaustible supply of a co-product called spent mushroom substrate (SMS). This is the unutilised substrate and the mushroom mycelium left after harvesting of mushrooms. As the mushroom industry is steadily growing, the volume of SMS generated annually is increasing. In recent years, the mushroom industry has faced challenges in storing and disposing the SMS. The obvious solution is to explore new applications of SMS. There has been considerable discussion recently about the potentials of using SMS for production of value-added products. One of them is production of lignocellulosic enzymes such as laccase, xylanase, lignin peroxidase, cellulase and hemicellulase. This paper reviews scientific research and practical applications of SMS as a readily available and cheap source of enzymes for bioremediation, animal feed and energy feedstock.
Characterization of lignin and Mn peroxidases from Phanerochaete chrysosporium. Progress report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
Long-term objectives are to elucidate the role and mechanism of the various isozymes in lignin biodegradation. Work is described on electrochemical studies on lignin and Mn peroxidases. This study was performed to investigate the structural aspects which confer the lignin and Mn peroxidases with their high reactivity. The experimentally determined redox potential of the Fe{sup 3+}/Fe{sup 2+} couple for the lignin peroxidase isozymes H1, H2, H8 and H10 are very similar, near-130 mV. The redox potential for the Mn peroxidase isozymes H3 and H4 are similar to each other ({minus}88 mV and {minus}95 mV, respectively) and are more positive thanmore » the lignin peroxidases. The higher redox potential for the Fe{sup 3+}/Fe{sup 2+} couple is consistent with the heme active site of these fungal peroxidases being more electron deficient. To investigate the accessibility of the heme active site to the substrate which is oxidized [veratryl alcohol and Mn (II)], we investigated whether these substrates had any affect on the redox potential of the heme. The E{sub m7} value for lignin and Mn peroxidases are not affected by their respective substrates, veratryl alcohol and Mn (II). These results suggest that substrates do not directly interact with the ferric heme-iron as axial ligands. This is consistent with the present model for peroxidase catalysis. Suicide inhibitor (1) and nmr studies (2) indicate that the heme-iron of horseradish peroxidase (HRP) is not fully accessible to bulky substrates occur at the periphery of the heme.« less
Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping
2018-04-11
Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .
Qiu, Weihua; Chen, Hongzhang
2012-08-01
Laccase, capable of selectively degrading lignin while keeping cellulose intact, has been widely applied for the modification and bio-bleaching of pulp. In this study Sclerotium sp. laccase (MSLac) was employed in combination with steam explosion to evaluate the effect of this treatment on cellulose hydrolysis. Combined steam explosion with laccase pretreatment enhanced the cellulose conversion rate of wheat straw no matter in the case of successive (MSLac-Cel) and simultaneous (MSLac+Cel) MSLac and cellulase hydrolysis. The highest cellulose conversion rate of 84.23% was obtained when steam-exploded wheat straw (SEWS) (1.3 MPa, 5 min) was treated by MSLac+Cel at a laccase loading of 0.55 U g(-1) substrate. FT-IR and SEM analyses indicated that MSLac oxidized the phenol and changed electron configuration of the ring, which contributed to loosening the compact wrap of lignin-carbohydrate complex and consequently enhancing the enzymatic hydrolysis efficiency of cellulose. This article provided a promising method for lignocellulose bio-pretreatment. Copyright © 2012 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cannatelli, Mark D.
Part one of this dissertation research has focused on harnessing the ability of laccases to generate reactive para-quinones in situ from the corresponding hydroquinones, followed by reaction with a variety of nucleophiles to perform novel carbon-carbon, carbon-nitrogen, and carbon-sulfur bond forming reactions for the synthesis of new and existing compounds. In part two of this dissertation, the fundamental laccase-catalyzed coupling chemistry developed in part one was applied to functionalize the surface of kraft lignin.
Chen, Ben; Tian, Xiaofei; Yu, Lian; Wu, Zhenqiang
2016-12-01
Pigments in molasses wastewater (MWW) effluent, such as melanoidins, were considered as kinds of the most recalcitrant and hazardous colorant contaminants to the environment. In this study, de-coloring the MWW by a synergistic combination of micro-electrolysis with bio-treatment was performed. Aiming to a high de-colorization yield, levels of nutrition source supplies, MWW dilution ratio, and micro-electrolysis reaction time were optimized accordingly. For a diluted (50 %, v/v) MWW, an maximum overall de-colorization yield (97.1 ± 0.5 %, for absorbance at 475 nm) was achieved through the bio-electrolysis treatment. In electrolysis bio-treatment, the positive effect of micro-electrolysis was also revealed by a promoted growth of fungal biomass as well as activities of ligninolytic enzymes. Activities of lignin peroxidase, manganese peroxidase, and laccase were promoted by 111.2, 103.9, and 7.7 %, respectively. This study also implied that the bio-treatment and the micro-electrolysis had different efficiencies on removal of pigments with distinct polarities.
Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.
Akpinar, Merve; Urek, Raziye Ozturk
2012-01-01
Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.
Mathematical model for Trametes versicolor growth in submerged cultivation.
Tisma, Marina; Sudar, Martina; Vasić-Racki, Durda; Zelić, Bruno
2010-08-01
Trametes versicolor is a white-rot fungus known as a producer of extracellular enzymes such as laccase, manganese-peroxidase, and lignin-peroxidase. The production of these enzymes requires detailed knowledge of the growth characteristics and physiology of the fungus. Submerged cultivations of T. versicolor on glucose, fructose, and sucrose as sole carbon sources were performed in shake flasks. Sucrose hydrolysis catalyzed by the whole cells of T. versicolor was considered as one-step enzymatic reaction described with Michaelis-Menten kinetics. Kinetic parameters of invertase-catalyzed sucrose hydrolysis were estimated (K (m) = 7.99 g dm(-3) and V (m) = 0.304 h(-1)). Monod model was used for description of kinetics of T. versicolor growth on glucose and fructose as sole carbon sources. Growth associated model parameters were estimated from the experimental results obtained by independent experiments (mu(G)(max) = 0.14 h(-1), K(G)(S) = 8.06 g dm(-3), mu(F)(max) = 0.37 h(-1) and K(F)(S) = 54.8 g dm(-3)). Developed mathematical model is in good agreement with the experimental results.
Fernández-Fueyo, Elena; Ruiz-Dueñas, Francisco J.; Miki, Yuta; Martínez, María Jesús; Hammel, Kenneth E.; Martínez, Angel T.
2012-01-01
The white-rot fungus Ceriporiopsis subvermispora delignifies lignocellulose with high selectivity, but until now it has appeared to lack the specialized peroxidases, termed lignin peroxidases (LiPs) and versatile peroxidases (VPs), that are generally thought important for ligninolysis. We screened the recently sequenced C. subvermispora genome for genes that encode peroxidases with a potential ligninolytic role. A total of 26 peroxidase genes was apparent after a structural-functional classification based on homology modeling and a search for diagnostic catalytic amino acid residues. In addition to revealing the presence of nine heme-thiolate peroxidase superfamily members and the unexpected absence of the dye-decolorizing peroxidase superfamily, the search showed that the C. subvermispora genome encodes 16 class II enzymes in the plant-fungal-bacterial peroxidase superfamily, where LiPs and VPs are classified. The 16 encoded enzymes include 13 putative manganese peroxidases and one generic peroxidase but most notably two peroxidases containing the catalytic tryptophan characteristic of LiPs and VPs. We expressed these two enzymes in Escherichia coli and determined their substrate specificities on typical LiP/VP substrates, including nonphenolic lignin model monomers and dimers, as well as synthetic lignin. The results show that the two newly discovered C. subvermispora peroxidases are functionally competent LiPs and also suggest that they are phylogenetically and catalytically intermediate between classical LiPs and VPs. These results offer new insight into selective lignin degradation by C. subvermispora. PMID:22437835
Gasser, Christoph A; Čvančarová, Monika; Ammann, Erik M; Schäffer, Andreas; Shahgaldian, Patrick; Corvini, Philippe F-X
2017-03-01
Lignin, a complex three-dimensional amorphous polymer, is considered to be a potential natural renewable resource for the production of low-molecular-weight aromatic compounds. In the present study, a novel sequential lignin treatment method consisting of a biocatalytic oxidation step followed by a formic acid-induced lignin depolymerization step was developed and optimized using response surface methodology. The biocatalytic step employed a laccase mediator system using the redox mediator 1-hydroxybenzotriazole. Laccases were immobilized on superparamagnetic nanoparticles using a sorption-assisted surface conjugation method allowing easy separation and reuse of the biocatalysts after treatment. Under optimized conditions, as much as 45 wt% of lignin could be solubilized either in aqueous solution after the first treatment or in ethyl acetate after the second (chemical) treatment. The solubilized products were found to be mainly low-molecular-weight aromatic monomers and oligomers. The process might be used for the production of low-molecular-weight soluble aromatic products that can be purified and/or upgraded applying further downstream processes.
Diverse Bacteria with Lignin Degrading Potentials Isolated from Two Ranks of Coal
Wang, Lu; Nie, Yong; Tang, Yue-Qin; Song, Xin-Min; Cao, Kun; Sun, Li-Zhu; Wang, Zhi-Jian; Wu, Xiao-Lei
2016-01-01
Taking natural coal as a “seed bank” of bacterial strains able to degrade lignin that is with molecular structure similar to coal components, we isolated 393 and 483 bacterial strains from a meager lean coal sample from Hancheng coalbed and a brown coal sample from Bayannaoer coalbed, respectively, by using different media. Statistical analysis showed that isolates were significantly more site-specific than medium-specific. Of the 876 strains belonging to 27 genera in Actinobacteria, Firmicutes, and Proteobacteria, 612 were positive for lignin degradation function, including 218 strains belonging to 35 species in Hancheng and 394 strains belonging to 19 species in Zhongqi. Among them, the dominant lignin-degrading strains were Thauera (Hancheng), Arthrobacter (Zhongqi) and Rhizobium (both). The genes encoding the laccases- or laccase-like multicopper oxidases, key enzymes in lignin production and degradation, were detected in three genera including Massila for the first time, which was in high expression by real time PCR (qRT-PCR) detection, confirming coal as a good seed bank. PMID:27667989
Shrestha, Prabin; Joshi, Bishnu; Joshi, Jarina; Malla, Rajani; Sreerama, Lakshmaiah
2016-01-01
At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum -CDBT1 , Ganoderma japonicum, and Lentinula edodes , isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum -CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum -CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μ M) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum -CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m , V max , and K cat , determined using 2,2'-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μ M, 36 μ mol/min/mg, and 246 min -1 , respectively. The isolated thermostable laccase will be used in future experiments for delignification process.
Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor
USDA-ARS?s Scientific Manuscript database
Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...
Bucić-Kojić, Ana; Šelo, Gordana; Zelić, Bruno; Planinić, Mirela; Tišma, Marina
2017-03-01
Corn silage is used as high-energy forage for dairy cows and more recently for biogas production in a process of anaerobic co-digestion with cow manure. In this work, fresh corn silage after the harvest was used as a substrate in solid-state fermentations with T. versicolor with the aim of phenolic acid recovery and enzyme (laccase and manganese peroxidase) production. During 20 days of fermentation, 10.4-, 3.4-, 3.0-, and 1.8-fold increments in extraction yield of syringic acid, vanillic acid, p-hydroxybenzoic acid, and caffeic acid, respectively, were reached when compared to biologically untreated corn silage. Maximal laccase activity was gained on the 4th day of fermentation (V.A. = 180.2 U/dm 3 ), and manganese peroxidase activity was obtained after the 3rd day of fermentation (V.A. = 30.1 U/dm 3 ). The addition of copper(II) sulfate as inducer during solid state fermentation resulted in 8.5- and 7-fold enhancement of laccase and manganese peroxidase activities, respectively. Furthermore, the influence of pH and temperature on enzyme activities was investigated. Maximal activity of laccase was obtained at T = 50 °C and pH = 3.0, while manganese peroxidase is active at temperature range T = 45-70 °C with the maximal activity at pH = 4.5.
Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications
Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay
2011-01-01
Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038
Automated chromatographic laccase-mediator-system activity assay.
Anders, Nico; Schelden, Maximilian; Roth, Simon; Spiess, Antje C
2017-08-01
To study the interaction of laccases, mediators, and substrates in laccase-mediator systems (LMS), an on-line measurement was developed using high performance anion exchange chromatography equipped with a CarboPac™ PA 100 column coupled to pulsed amperometric detection (HPAEC-PAD). The developed method was optimized for overall chromatographic run time (45 to 120 min) and automated sample drawing. As an example, the Trametes versicolor laccase induced oxidation of 1-(3,4-dimethoxyphenyl)-2-(2-methoxyphenoxy)-1,3-dihydroxypropane (adlerol) using 1-hydroxybenzotriazole (HBT) as mediator was measured and analyzed on-line. Since the Au electrode of the PAD detects only hydroxyl group containing substances with a limit of detection being in the milligram/liter range, not all products are measureable. Therefore, this method was applied for the quantification of adlerol, and-based on adlerol conversion-for the quantification of the LMS activity at a specific T. versicolor laccase/HBT ratio. The automated chromatographic activity assay allowed for a defined reaction start of all laccase-mediator-system reactions mixtures, and the LMS reaction progress was automatically monitored for 48 h. The automatization enabled an integrated monitoring overnight and over-weekend and minimized all manual errors such as pipetting of solutions accordingly. The activity of the LMS based on adlerol consumption was determined to 0.47 U/mg protein for a laccase/mediator ratio of 1.75 U laccase/g HBT. In the future, the automated method will allow for a fast screening of combinations of laccases, mediators, and substrates which are efficient for lignin modification. In particular, it allows for a fast and easy quantification of the oxidizing activity of an LMS on a lignin-related substrate which is not covered by typical colorimetric laccase assays. ᅟ.
Su, Yulong; Xian, He; Shi, Sujuan; Zhang, Chengsheng; Manik, S M Nuruzzaman; Mao, Jingjing; Zhang, Ge; Liao, Weihong; Wang, Qian; Liu, Haobao
2016-11-21
Tobacco stalk is one kind of abundant crop residues in China. The high lignification of tobacco stalk increases its reusing cost and the existing of nicotine will cause serious pollution. The biodegradation of lignocellulosic biomass has been demonstrated to be an environmental and economical approach for the utilization of plant stalk. Meanwhile, many nicotine-degrading microorganisms were found in nature. However, microorganisms which could degraded both nicotine and lignin haven't been reported. Therefore, it's imperative to find some suitable microorganisms to break down lignin and simultaneously remove nicotine in tobacco stalk. The nicotine in tobacco stalk could be degraded effectively by Trametes versicolor, Trametes hirsute and Phanerochaete chrysosporium. The nicotine content in tobacco stalk was lowered to below 500 mg/kg (a safe concentration to environment) after 10 days of fermentation with Phanerochaete chrysosporium and Trametes versicolor, and 15 days with Trametes hirsute. The degradation rate of lignin in the fermented tobacco stalk was 37.70, 51.56 and 53.75% with Trametes versicolor, Trametes hirsute and Phanerochaete chrysosporium, respectively. Meanwhile, 24.28% hemicellulose was degraded by Phanerochaete chrysosporium and 28.19% cellulose was removed by Trametes hirsute. Through the enzyme activity analysis, the main and highest ligninolytic enzymes produced by Phanerochaete chrysosporium, Trametes hirsute and Trametes versicolor were lignin peroxidase (88.62 U · L -1 ), manganese peroxidase (100.95 U · L -1 ) and laccase (745.65 U · L -1 ). Meanwhile, relatively high and stable cellulase activity was also detected during the fermentation with Phanerochaete chrysosporium, and the highest endoglucanase, exoglucanase and filter paper enzyme activities were 0.38 U · mL -1 , 0.45 U · mL -1 and 0.35U · mL -1 , respectively. Moreover, the products in the fermentation of tobacco stalk with P. chrysosporium were identified with GC-MS, besides the chemicals produced in the degradation of lignin and nicotine, some small molecular valuable chemicals and fatty acid were also detected. Our study developed a new method for the degradation and detoxification of tobacco stalk by fermentation with white rot fungi Phanerochaete chrysosporium and Trametes hirsute. The different oxidative enzymes and chemical products detected during the degradation indicated a possible pathway for the utilization of tobacco stalk.
Vetchinkina, Elena P; Pozdnyakova, Natalia N; Nikitina, Valentina E
2008-10-01
The white-rot fungus Lentinus edodes produced D-melibiose-specific lectins and two laccase forms in a lignin-containing medium. The maxima of laccase and lectin activities coincided, falling within the period of active mycelial growth. The enzymes and lectins were isolated and purified by gel filtration followed by anion-exchange chromatography. The L. edodes lectins were found to be able to stabilize the activity of the fungus's own laccases. Lectin activity during the formation of lectin-enzyme complexes remained unchanged.
Uses of Laccases in the Food Industry
Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana
2010-01-01
Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873
Shi, Xiaowei; Liu, Qian; Ma, Jiangshan; Liao, Hongdong; Xiong, Xianqiu; Zhang, Keke; Wang, Tengfei; Liu, Xuanmin; Xu, Ting; Yuan, Shanshan; Zhang, Xin; Zhu, Yonghua
2015-11-01
Isolation and identification of a novel laccase (namely Lac4) with various industrial applications potentials from an endophytical bacterium. Endophyte Sd-1 cultured in rice straw showed intra- and extra-cellular laccase activities. Genomic analysis of Sd-1 identified four putative laccases, Lac1 to Lac4. However, only Lac4 contains the complete signature sequence of laccase and shares at most 64 % sequence identity with other characterized bacterial multi-copper oxidases. Recombinant Lac4 can oxidize non-phenolic and phenolic compounds under acidic conditions and at 30-50 °C; Km values of Lac4 for ABTS at pH 2.5 and for guaiacol at pH 4.5 were 1 ± 0.15 and 6.1 ± 1.7 mM, respectively. The activity of Lac4 was stimulated by 0.8 mM Cu(2+) and 5 mM Fe(2+). In addition, Lac4 could decolorize various synthetic dyes and exhibit the degradation rate of 38 % for lignin. The data suggest that Lac4 possesses promising biotechnological potentials.
[Advance of heterologous expression study of eukaryote-origin laccases].
Ning, Na; Tan, Huijun; Sun, Xinxin; Ni, Jinfeng
2017-04-25
Laccases are enzymes belonging to the group of multi-copper oxidases. These enzymes are widely distributed in insects, plants, fungi and bacteria. In general, laccases can oxidize an exceptionally high number of substrates, so they have broad applications in textile, pulp, food and the degradation of lignin. However, low yield, low activity and thermo-instability of laccase in nature limit the application of laccase. High efficient heterologous expression of the protein is an effective way for solving this problem. Here, we summarize the research advances of heterologous expression of eukaryote-origin laccases. We focus on the overexpression of eukaryote-origin laccases using different expression system and the method for improving the production yield and enzyme activity in yeast cells. Information provided in this review would be helpful for researchers in the field.
Pham, Le Thanh Mai; Kim, Yong Hwan
2014-11-01
Free-hydroxyl phenolic units can decrease or even abort the catalytic activity of lignin peroxidase H8 during oxidation of veratryl alcohol and model lignin dimers, resulting in slow and inefficient lignin degradation. In this study we applied engineered 4-O-methyltransferase from Clarkia breweri to detoxify the inhibiting free-hydroxyl phenolic groups by converting them to methylated phenolic groups. The multistep, enzyme-catalyzed process that combines 4-O-methyltransferase and lignin peroxidase H8 suggested in this work can increase the efficiency of lignin-degradation. This study also suggests approaching the field of multi-enzyme in vitro systems to improve the understanding and development of plant biomass in biorefinery operations. Copyright © 2014 Elsevier Inc. All rights reserved.
Joshi, Jarina; Malla, Rajani
2016-01-01
At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μM) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m, V max, and K cat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process. PMID:27822471
Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo
2015-01-01
Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 μM, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784
Naranjo-Briceño, Leopoldo; Pernía, Beatriz; Guerra, Mayamaru; Demey, Jhonny R; De Sisto, Ángela; Inojosa, Ysvic; González, Meralys; Fusella, Emidio; Freites, Miguel; Yegres, Francisco
2013-01-01
Large amount of drilling waste associated with the expansion of the Orinoco Oil Belt (OOB), the biggest proven reserve of extra-heavy crude oil (EHCO) worldwide, is usually impregnated with EHCO and highly salinized water-based drilling fluids. Oxidative exoenzymes (OE) of the lignin-degrading enzyme system (LDS) of fungi catalyse the oxidation of a wide range of toxic pollutants. However, very little evidences on fungal degradation or biotransformation of EHCO have been reported, which contain high amounts of asphaltenes and its biodegradation rate is very limited. The aims of this work were to study the ability of Pestalotiopsis palmarum BM-04 to synthesize OE, its potential to biotransform EHCO and to survive in extreme environmental conditions. Enzymatic studies of the LDS showed the ability of this fungus to overproduce high amounts of laccase (LACp) in presence of wheat bran or lignin peroxidase (LIPp) with EHCO as sole carbon and energy source (1300 U mgP−1 in both cases). FT-IR spectroscopy with Attenuated Total Reflectance (ATR) analysis showed the enzymatic oxidation of carbon and sulfur atoms in both maltenes and asphaltenes fractions of biotreated EHCO catalysed by cell-free laccase-enriched OE using wheat bran as inducer. UV-visible spectrophotometry analysis revealed the oxidation of the petroporphyrins in the asphaltenes fraction of biotreated EHCO. Tolerance assays showed the ability of this fungus to grow up to 50 000 p.p.m. of EHCO and 2000 mM of NaCl. These results suggest that P. palmarum BM-04 is a hopeful alternative to be used in remediation processes in extreme environmental conditions of salinity and EHCO contamination, such as the drilling waste from the OOB. PMID:23815379
NASA Astrophysics Data System (ADS)
Wakabayashi, Kazuyuki; Nakano, Saho; Soga, Kouichi; Hoson, Takayuki
Lignin is a component of cell walls of terrestrial plants, which provides cell walls with the mechanical rigidity. Lignin is a phenolic polymer with high molecular mass and formed by the polymerization of phenolic substances on a cellulosic matrix. The polymerization is catalyzed by cell wall-bound peroxidase, and thus the activity of this enzyme regulates the rate of formation of lignin. In the present study, the changes in the lignin content and the activity of cell wall peroxidase were investigated along epicotyls of azuki bean seedlings grown under hypergravity conditions. The endogenous growth occurred primarily in the upper regions of the epicotyl and no growth was detected in the middle or basal regions. The amounts of acetyl bromide-soluble lignin increased from the upper to the basal regions of epicotyls. The lignin content per unit length in the basal region was three times higher than that in the upper region. Hypergravity treatment at 300 g for 6 h stimulated the increase in the lignin content in all regions of epicotyls, particularly in the basal regions. The peroxidase activity in the protein fraction extracted from the cell wall preparation with a high ionic strength buffer also increased gradually toward the basal region, and hypergravity treatment clearly increased the activity in all regions. There was a close correlation between the lignin content and the enzyme activity. These results suggest that gravity stimuli modulate the activity of cell wall-bound peroxidase, which, in turn, causes the stimulation of the lignin formation in stem organs.
2014-01-01
Background The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. Results Heterologous expression of the class II peroxidase genes, followed by kinetic studies, enabled their functional classification. The resulting inventory revealed the absence of lignin peroxidases (LiPs) and the presence of three versatile peroxidases (VPs) and six manganese peroxidases (MnPs), the crystal structures of two of them (VP1 and MnP4) were solved at 1.0 to 1.1 Å showing significant structural differences. Gene expansion supports the importance of both peroxidase types in the white-rot lifestyle of this fungus. Using a lignin model dimer and synthetic lignin, we showed that VP is able to degrade lignin. Moreover, the dual Mn-mediated and Mn-independent activity of P. ostreatus MnPs justifies their inclusion in a new peroxidase subfamily. The availability of the whole POD repertoire enabled investigation, at a biochemical level, of the existence of duplicated genes. Differences between isoenzymes are not limited to their kinetic constants. Surprising differences in their activity T50 and residual activity at both acidic and alkaline pH were observed. Directed mutagenesis and spectroscopic/structural information were combined to explain the catalytic and stability properties of the most interesting isoenzymes, and their evolutionary history was analyzed in the context of over 200 basidiomycete peroxidase sequences. Conclusions The analysis of the P. ostreatus genome shows a lignin-degrading system where the role generally played by LiP has been assumed by VP. Moreover, it enabled the first characterization of the complete set of peroxidase isoenzymes in a basidiomycete, revealing strong differences in stability properties and providing enzymes of biotechnological interest. PMID:24387130
Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G
1995-01-01
The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961
Freitag, M; Morrell, J J
1992-04-01
Two filamentous fungi, the white-rot fungus Trametes versicolor and the soil fungus and potential biocontrol organism Trichoderma harzianum, have been grown in pure and mixed cultures on low-N (0.4 mM) and high-N (4 mM) defined synthetic media to determine the activities of selected wood-degrading enzymes such as cellobiase, cellulase, laccase, and peroxidases. Growth characteristics and enzyme activities were examined for potential correlations. Such correlations would allow the use of simple enzyme assays for measuring biomass development and would facilitate predictions about competitiveness of species in mixed fungal cultures. Our results show that while laccase and Poly Red-478 peroxidase activities indicate survival of the decay fungus, none of the monitored extracellular enzymes can serve as a quantitative indicator for biomass accumulation. As expected, the level of available nitrogen affected the production of the enzymes monitored: in low-N media, specific cellobiase, specific cellulase, and peroxidase activities were enhanced, while laccase activities were reduced. Most importantly, laccase activities of Trametes versicolor, and to a smaller extent, cellobiase activities of both fungi, were significantly induced in mixed cultures of Trametes versicolor and Trichoderma harzianum.
The Effect of Different Pollination on the Expression of Dangshan Su Pear MicroRNA
Cheng, Xi; Yan, Chongchong; Zhang, Jinyun; Ma, Chenhui; Li, Shumei; Jin, Qing; Zhang, Nan; Cao, Yunpeng; Lin, Yi
2017-01-01
The high-throughput sequencing of pear “Dangshan Su” × “Yali” (whose fruits lignin and stone cell content are high and quality is poor) and pear “Dangshan Su” × “Wonhwang” (whose fruits with low content of lignin and stone cell and the quality are better ) found that the expressions of these two miRNAs (pyr-1809 and pyr-novel-miR-144-3p) were significantly different; their corresponding target genes encode two kinds of laccase (Pbr018935.1 and Pbr003857.1). qRT-PCR results showed that these two enzymes are involved in the formation of lignin and stone cells and the existence of these two miRNAs has a negative effect on them. It was concluded that the effect of pollination on the development of stone cells may affect the synthesis of lignin, through the regulation of laccase controlled by miRNAs, and ultimately affect the formation of stone cell and fruit quality. PMID:28497043
Patil, Swapnil M; Chandanshive, Vishal V; Rane, Niraj R; Khandare, Rahul V; Watharkar, Anuprita D; Govindwar, Sanjay P
2016-04-01
In vitro grown untransformed adventitious roots (AR) culture of Ipomoea hederifolia and its endophytic fungus (EF) Cladosporium cladosporioides decolorized Navy Blue HE2R (NB-HE2R) at a concentration of 20 ppm up to 83.3 and 65%, respectively within 96h. Whereas the AR-EF consortium decolorized the dye more efficiently and gave 97% removal within 36h. Significant inductions in the enzyme activities of lignin peroxidase, tyrosinase and laccase were observed in roots, while enzymes like tyrosinase, laccase and riboflavin reductase activities were induced in EF. Metabolites of dye were analyzed using UV-vis spectroscopy, FTIR and gas chromatography-mass spectrometry. Possible metabolic pathways of NB-HE2R were proposed with AR, EF and AR-EF systems independently. Looking at the superior efficacy of AR-EF system, a rhizoreactor was developed for the treatment of NB-HE2R at a concentration of 1000 ppm. Control reactor systems with independently grown AR and EF gave 94 and 85% NB-HE2R removal, respectively within 36h. The AR-EF rhizoreactor, however, gave 97% decolorization. The endophyte colonization additionally increased root and shoot lengths of candidate plants through mutualism. Combined bioreactor strategies can be effectively used for future eco-friendly remediation purposes. Copyright © 2016 Elsevier Inc. All rights reserved.
[Degradation of fluorene and fluoranthene by the basidiomycete Pleurotus ostreatus].
Pozdnyakova, N N; Chernyshova, M P; Grinev, V S; Landesman, E O; Koroleva, O V; Turkovskaya, O V
2016-01-01
The dependence of the degree of fluorene and fluoranthene degradation by the fungus Pleurotus ostreatus D1 on the culture medium composition has been studied. Polycyclic aromatic hydrocarbons (PAHs) have been transformed in Kirk’s medium (under conditions of laccase production) with the formation of a quinone metabolite and 9-fluorenone upon the use of fluoranthene and fluorene as substrates, respectively. More complete degradation with the formation of an intermediate metabolite, phthalic acid that has undergone subsequent utilization, has occurred in basidiomycete-rich medium (under the production of both laccase and versatile peroxidase). The formation of phthalic acid as a metabolite of fluoranthene degradation by lignolytic fungi has been revealed for the first time. The data allow the supposition that both extracellular laccase and laccase on the mycelium surface can participate in the initial stages of PAH metabolism, while versatile peroxidase is necessary for the oxidation of the formed metabolites. A scheme of fluorene metabolism by Pleurotus ostreatus D1 is suggested.
Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes
da Luz, José Maria Rodrigues; Nunes, Mateus Dias; Paes, Sirlaine Albino; Torres, Denise Pereira; de Cássia Soares da Silva, Marliane; Kasuya, Maria Catarina Megumi
2012-01-01
The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse). The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase) and hydrolytic enzymes (cellulases, xylanases and tanases). Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6). These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes. PMID:24031982
Li, Yanchun; Wang, Zhi; Xu, Xudong; Jin, Liqiang
2015-12-01
For improving stability of immobilized white-rot fungus to treat various effluents, Phanerochaete chrysosporium cells and the combined cross-link enzyme aggregates (combi-CLEAs) prepared from Trametes versicolor were co-immobilized into the Ca-alginate gel particles in this paper. The activity yields of obtained combi-CLEAs were 42.7% for lignin peroxidases (LiPs), 31.4% for manganese peroxidases (MnPs) and 40.4% for laccase (Lac), respectively. And their specific activities were 30.2U/g as combi-CLEAs-LiPs, 9.5 U/g as combi-CLEAs-MnPs and 28.4 U/g as combi-CLEAs-Lac. Further, the present of the combi-CLEAs in the particles extremely improved their ability to degrade the dyes. Compared to the immobilized Ph. chrysosporium without the combi-CLEAs, the co-immobilized particles enhanced the decolorized rate of Acid Violet 7 (from 45.2% to 93.4%) and Basic Fuchsin (from 12.1% to 67.9%). In addition, the addition of the combi-CLEAs improved the adaptability of the white-rot fungal particles to adverse environmental conditions. Copyright © 2015 Elsevier Ltd. All rights reserved.
Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination
Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.
2012-01-01
In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075
Mishra, Vartika; Jana, Asim K; Jana, Mithu Maiti; Gupta, Antriksh
2017-05-15
Sweet sorghum bagasse (SSB) generated in large quantities could be hydrolyzed to sugar and then fermented to green fuels. The hydrolysis of SSB polysaccharides interlocked in recalcitrant lignin network is the major problem. Pretreatment of SSB in SSF by using Coriolus versicolor with CuSO 4 -syringic acid supplements for effects on production of ligninocellulolytic enzymes, lignin degradation and selectivity values (SV) were studied. C. versicolor was selected based on high ligninolytic and low cellulolytic abilily. Individually, CuSO 4 increased the activities of laccase (4.9 folds) and PPO (1.9 folds); syringic acid increased LiP (13 folds), AAO (2.8 folds) and laccase (5.6 folds) resulting in increased lignin degradation and SVs. Combined syringic acid (4.4 μmol g -1 SSB) and CuSO 4 (4.4 μmol g -1 SSB) increased the activities of laccase, LiP, MnP, PPO and AAO by 11.2, 17.6, 2.8, 2.4 and 2.3 folds respectively due to synergistic effect, resulting in maximum lignin degradation 35.9 ± 1.3% (w w -1 ) (1.86 fold) and highest SV 3.07 (4.7 fold). Enzymatic hydrolysis of pretreated SSB yielded higher (∼2.2 times) fermentable sugar. Pretreated SSB was characterized by XRD, SEM, FTIR and TGA/DTG analysis to confirm results. It is possible to improve fungal pretreatment of agricultural waste by combination of supplements. Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagrimini, L.M.
Tobacco (Nicotiana tabacum) plants transformed with a chimeric tobacco anionic peroxidase gene have previously been shown to synthesize high levels of peroxidase in all tissues throughout the plant. One of several distinguishable phenotypes of transformed plants is the rapid browning of pith tissue upon wounding. Pith tissue from plants expressing high levels of peroxidase browned within 24 hours of wounding, while tissue from control plants did not brown as late as 7 days after wounding. A correlation between peroxidase activity and wound-induced browning was observed, whereas no relationship between polyphenol oxidase activity and browning was found. The purified tobacco anionicmore » peroxidase was subjected to kinetic analysis with substrates which resemble the precursors of lignin or polyphenolic acid. The purified enzyme was found to readily polymerize phenolic acids in the presence of H{sub 2}O{sub 2} via a modified ping-pong mechanism. The percentage of lignin and lignin-related polymers in cell walls was nearly twofold greater in pith tissue isolated from peroxidase-overproducer plants compared to control plants. Lignin deposition in wounded pith tissue from control plants closely followed the induction of peroxidase activity. However, wound-induced lignification occurred 24 to 48 hours sooner in plants overexpressing the anionic peroxidase. This suggests that the availability of peroxidase rather than substrate may delay polyphenol deposition in wounded tissue.« less
Role of fungal peroxidases in biological ligninolysis
Kenneth E. Hammel; Dan Cullen
2008-01-01
The degradation of lignin by filamentous fungi is a major route for the recycling of photosynthetically fixed carbon, and the oxidative mechanisms employed have potential biotechnological applications. The lignin peroxidases (LiPs), manganese peroxidases (MnPs), and closely related enzymes of white rot basidiomycetes are likely contributors to fungal ligninolysis. Many...
Wound-Induced Deposition of Polyphenols in Transgenic Plants Overexpressing Peroxidase 1
Lagrimini, L. Mark
1991-01-01
Tobacco (Nicotiana tabacum) plants transformed with a chimeric tobacco anionic peroxidase gene have previously been shown to synthesize high levels of peroxidase in all tissues throughout the plant. One of several distinguishable phenotypes of transformed plants is the rapid browning of pith tissue upon wounding. Pith tissue from plants expressing high levels of peroxidase browned within 24 hours of wounding, while tissue from control plants did not brown as late as 7 days after wounding. A correlation between peroxidase activity and wound-induced browning was observed, whereas no relationship between polyphenol oxidase activity and browning was found. The purified tobacco anionic peroxidase was subjected to kinetic analysis with substrates which resemble the precursors of lignin or polyphenolic acid. The purified enzyme was found to readily polymerize phenolic acids in the presence of H2O2 via a modified ping-pong mechanism. The percentage of lignin and lignin-related polymers in cell walls was nearly twofold greater in pith tissue isolated from peroxidase-overproducer plants compared to control plants. Lignin deposition in wounded pith tissue from control plants closely followed the induction of peroxidase activity. However, wound-induced lignification occurred 24 to 48 hours sooner in plants overexpressing the anionic peroxidase. This suggests that the availability of peroxidase rather than substrate may delay polyphenol deposition in wounded tissue. ImagesFigure 1Figure 2Figure 3 PMID:16668224
Lignolytic enzymes produced by Trametes villosa ccb176 under different culture conditions
Yamanaka, Renata; Soares, Clarissa F.; Matheus, Dácio R.; Machado, Kátia M.G.
2008-01-01
The expression of the enzymatic system produced by basidiomycetous fungi, which is involved in the degradation of xenobiotics, mainly depends on culture conditions, especially of the culture medium composition. Trametes villosa is a strain with a proven biotechnological potential for the degradation of organochlorine compounds and for the decolorization of textile dyes. The influence of glucose concentration, addition of a vegetable oil-surfactant emulsion, nature of the surfactant and the presence of manganese and copper on the growth, pH and production of laccase, total peroxidase and manganese-dependent peroxidase activities were evaluated. In general, acidification of the medium was observed, with the pH reaching a value close to 3.5 within the first days of growth. Laccase was the main activity detected under the different conditions and was produced throughout the culture period of the fungus, irrespective of the growth phase. Supplementation of the medium with vegetable oil emulsified with a surfactant induced manganese-dependent peroxidase activity in T. villosa. Higher specific yields of laccase activity were obtained with the addition of copper. PMID:24031184
Bioprospecting and biotechnological applications of fungal laccase.
Upadhyay, Pooja; Shrivastava, Rahul; Agrawal, Pavan Kumar
2016-06-01
Laccase belongs to a small group of enzymes called the blue multicopper oxidases, having the potential ability of oxidation. It belongs to enzymes, which have innate properties of reactive radical production, but its utilization in many fields has been ignored because of its unavailability in the commercial field. There are diverse sources of laccase producing organisms like bacteria, fungi and plants. In fungi, laccase is present in Ascomycetes, Deuteromycetes, Basidiomycetes and is particularly abundant in many white-rot fungi that degrade lignin. Laccases can degrade both phenolic and non-phenolic compounds. They also have the ability to detoxify a range of environmental pollutants. Due to their property to detoxify a range of pollutants, they have been used for several purposes in many industries including paper, pulp, textile and petrochemical industries. Some other application of laccase includes in food processing industry, medical and health care. Recently, laccase has found applications in other fields such as in the design of biosensors and nanotechnology. The present review provides an overview of biological functions of laccase, its mechanism of action, laccase mediator system, and various biotechnological applications of laccase obtained from endophytic fungi.
Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu
2013-01-01
Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+) and Fe(2+) could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930.
Plotnikov, Evgeny V; Glukhova, Lubov B; Sokolyanskaya, Ludmila O; Karnachuk, Olga V; Solioz, Marc
2016-01-01
We compared cold and hot wood extracts of 3 endemic Siberian trees-namely, Prunus padus (bird cherry), Populus tremula (aspen), and Betula sp. (birch)-on biomass production and laccase and peroxidase secretion in submerged cultures by the medicinal mushroom Lentinus edodes. Of the conditions tested, only hot Prunus extracts stimulated biomass production, whereas all extracts stimulated laccase and peroxidase secretion, albeit to different extents. A large, differential stimulation of manganese peroxidase was observed by hot Prunus extracts. The results highlight important differences between tree species in the stimulation of biomass and enzyme production by L. edodes and point to potentially interesting stimulatory factors present in hot Prunus extracts. These findings are of relevance in the use of L. edodes for medicinal or biotechnological applications.
Electroenzymatic oxidation of veratryl alcohol by lignin peroxidase.
Lee, KiBeom; Moon, Seung-Hyeon
2003-05-08
This paper reports the formation of veratraldehyde by electroenzymatic oxidation of veratryl alcohol (3,4-dimethoxybenzyl alcohol) hybridizing both electrochemical and enzymatic reactions and using lignin peroxidase. The novel electroenzymatic method was found to be effective for replacement of hydrogen peroxide by an electrochemical reactor, which is essential for enzyme activity of lignin peroxidase. The effects of operating parameters such as enzyme dosage, pH, and electric potential were investigated. Further, the kinetics of veratryl alcohol oxidation in an electrochemical reactor were compared to oxidation when hydrogen peroxide was supplied externally.
Collins, P J; O'Brien, M M; Dobson, A D
1999-03-01
The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression.
Collins, Patrick J.; O’Brien, Margaret M.; Dobson, Alan D. W.
1999-01-01
The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression. PMID:10049906
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Avallone, Sylvie; Guiraud, Joseph-Pierre; Brillouet, Jean-Marc; Teisson, Claude
2003-08-01
Penicillium funiculosum Thom. was consistently isolated from pineapple-infected fruitlet (black spots). Polyphenol oxidase, peroxidase, and laccase activities were determined in extracts from contiguous and infected fruitlets. Healthy fruitlets showed a rather high level of polyphenol oxidase (optimum pH 7.0), and this activity was tremendously increased (X 10) in contiguous infected fruitlets. Furthermore, infected fruitlets also exhibited laccase activity (optimum pH 4.0), while peroxidase was rather constant in both fruitlets. Browning reactions were attributed to qualitative and quantitative modifications of the enzymatic equipment (polyphenol oxidase and laccase) (p < 0.0001). In infected fruiltets, sucrose and L-malic acid were present at significantly lower amounts than in healthy ones, likely owing to fungal metabolism (p < 0.0001), whereas cell wall material was three times higher, which could be viewed as a defense mechanism to limit expansion of the mycelium.
Damián-Robles, Rosa María; Castro-Montoya, Agustín Jaime; Saucedo-Luna, Jaime; Vázquez-Garcidueñas, Ma Soledad; Arredondo-Santoyo, Marina; Vázquez-Marrufo, Gerardo
2017-10-01
Fungal strains identified by phylogenetic analysis of the ITS rDNA region as Trametes versicolor (CMU-TA01), Irpex lacteus (CMU-84/13), and Phlebiopsis sp. (CMU-47/13) are able to grow on and bleach kraft pulp (KP) in a simple solid-state fermentation (SSF) assay conducted in Petri dishes. Kappa number reductions obtained with Phlebiopsis sp. (48.3%), T. versicolor (43%), and I . lacteus (39.3%), evidence their capability for lignin breakdown. Scanning electron microscopy images of KP fibers from SSF assays demonstrated increased roughness and striation, evidencing significant cell wall modification. T. versicolor produces laccase (Lac), manganese peroxidase (MnP), and lignin peroxidase (LiP) in potato dextrose broth (PDB), PDB + CuSO 4 , and PDB + KP, whereas Phlebiopsis sp. and I. lacteus showed no Lac and low LiP activities in all media. Compared to PDB, the highest increase in Lac (7.25-fold) and MnP (2.37-fold) activities in PDB + CuSO 4 occur in T. versicolor ; for LiP, the greatest changes (6.95-fold) were observed in I. lacteus . Incubation in PDB + KP shows significant increases in Lac and MnP for T. versicolor , MnP and LiP for Phlebiopsis sp., and none for I. lacteus . SSF assays in Petri plates are a valuable tool to select fungi that are able to delignify KP. Here, delignification by Phlebiopsis sp. of this substrate is reported for the first time, and MnP activity was strongly associated with the delignification ability of the studied strains. The obtained results suggest that the studied fungal strains have biotechnological potential for use in the paper industry.
Mill Designed Bio bleaching Technologies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Institute of Paper Science Technology
2004-01-30
A key finding of this research program was that Laccase Mediator Systems (LMS) treatments on high-kappa kraft could be successfully accomplished providing substantial delignification (i.e., > 50%) without detrimental impact on viscosity and significantly improved yield properties. The efficiency of the LMS was evident since most of the lignin from the pulp was removed in less than one hour at 45 degrees C. Of the mediators investigated, violuric acid was the most effective vis-a-vis delignification. A comparative study between oxygen delignification and violuric acid revealed that under relatively mild conditions, a single or a double LMS{sub VA} treatment is comparablemore » to a single or a double O stage. Of great notability was the retention of end viscosity of LMS{sub VA} treated pulps with respect to the end viscosity of oxygen treated pulps. These pulps could then be bleached to full brightness values employing conventional ECF bleaching technologies and the final pulp physical properties were equal and/or better than those bleached in a conventional ECF manner employing an aggressively O or OO stage initially. Spectral analyses of residual lignins isolated after LMS treated high-kappa kraft pulps revealed that similar to HBT, VA and NHA preferentially attack phenolic lignin moieties. In addition, a substantial decrease in aliphatic hydroxyl groups was also noted, suggesting side chain oxidation. In all cases, an increase in carboxylic acid was observed. Of notable importance was the different selectivity of NHA, VA and HBT towards lignin functional groups, despite the common N-OH moiety. C-5 condensed phenolic lignin groups were overall resistant to an LMS{sub NHA, HBT} treatments but to a lesser extent to an LMS{sub VA}. The inactiveness of these condensed lignin moieties was not observed when low-kappa kraft pulps were biobleached, suggesting that the LMS chemistry is influenced by the extent of delignification. We have also demonstrated that the current generation of laccase has a broad spectrum of operating parameters. Nonetheless, the development of future genetically engineered laccases with enhanced temperature, pH and redox potentials will dramatically improve the overall process. A second challenge for LMS bleaching technologies is the need to develop effective, catalytic mediators. From the literature we already know this is feasible since ABTS and some inorganic mediators are catalytic. Unfortunately, the mediators that exhibit catalytic properties do not exhibit significant delignification properties and this is a challenge for future research studies. Potential short-term mill application of laccase has been recently reported by Felby132 and Chandra133 as they have demonstrated that the physical properties of linerboard can be improved when exposed to laccase without a chemical mediator. In addition, xxx has shown that the addition of laccase to the whitewater of the paper machine has several benefits for the removal of colloidal materials. Finally, this research program has presented important features on the delignification chemistry of LMS{sub NHA} and LMS{sub VA} that, in the opinion of the author, are momentous contributions to the overall LMS chemistry/biochemistry knowledge base which will continue to have future benefits.« less
De La Torre, María; Martín-Sampedro, Raquel; Fillat, Úrsula; Eugenio, María E; Blánquez, Alba; Hernández, Manuel; Arias, María E; Ibarra, David
2017-11-01
This study evaluates the potential of a bacterial laccase from Streptomyces ipomoeae (SilA) for delignification and detoxification of steam-exploded wheat straw, in comparison with a commercial fungal laccase from Trametes villosa. When alkali extraction followed by SilA laccase treatment was applied to the water insoluble solids fraction, a slight reduction in lignin content was detected, and after a saccharification step, an increase in both glucose and xylose production (16 and 6%, respectively) was observed. These effects were not produced with T. villosa laccase. Concerning to the fermentation process, the treatment of the steam-exploded whole slurry with both laccases produced a decrease in the phenol content by up to 35 and 71% with bacterial and fungal laccases, respectively. The phenols reduction resulted in an improved performance of Saccharomyces cerevisiae during a simultaneous saccharification and fermentation (SSF) process, improving ethanol production rate. This enhancement was more marked with a presaccharification step prior to the SSF process.
Liu, Zhi-Hua; Xie, Shangxian; Lin, Furong; Jin, Mingjie; Yuan, Joshua S
2018-01-01
Lignin valorization has recently been considered to be an essential process for sustainable and cost-effective biorefineries. Lignin represents a potential new feedstock for value-added products. Oleaginous bacteria such as Rhodococcus opacus can produce intracellular lipids from biodegradation of aromatic substrates. These lipids can be used for biofuel production, which can potentially replace petroleum-derived chemicals. However, the low reactivity of lignin produced from pretreatment and the underdeveloped fermentation technology hindered lignin bioconversion to lipids. In this study, combinatorial pretreatment with an optimized fermentation strategy was evaluated to improve lignin valorization into lipids using R. opacus PD630. As opposed to single pretreatment, combinatorial pretreatment produced a 12.8-75.6% higher lipid concentration in fermentation using lignin as the carbon source. Gas chromatography-mass spectrometry analysis showed that combinatorial pretreatment released more aromatic monomers, which could be more readily utilized by lignin-degrading strains. Three detoxification strategies were used to remove potential inhibitors produced from pretreatment. After heating detoxification of the lignin stream, the lipid concentration further increased by 2.9-9.7%. Different fermentation strategies were evaluated in scale-up lipid fermentation using a 2.0-l fermenter. With laccase treatment of the lignin stream produced from combinatorial pretreatment, the highest cell dry weight and lipid concentration were 10.1 and 1.83 g/l, respectively, in fed-batch fermentation, with a total soluble substrate concentration of 40 g/l. The improvement of the lipid fermentation performance may have resulted from lignin depolymerization by the combinatorial pretreatment and laccase treatment, reduced inhibition effects by fed-batch fermentation, adequate oxygen supply, and an accurate pH control in the fermenter. Overall, these results demonstrate that combinatorial pretreatment, together with fermentation optimization, favorably improves lipid production using lignin as the carbon source. Combinatorial pretreatment integrated with fed-batch fermentation was an effective strategy to improve the bioconversion of lignin into lipids, thus facilitating lignin valorization in biorefineries.
Production and Characterization of Trametes versicolor Mutants Unable To Bleach Hardwood Kraft Pulp
Addleman, K.; Dumonceaux, T.; Paice, M. G.; Bourbonnais, R.; Archibald, F. S.
1995-01-01
Protoplasts of the monokaryotic strain 52J of Trametes versicolor were treated with UV light and screened for the inability to produce a colored precipitate on guaiacol-containing agar plates. Mutants unable to oxidize guaiacol had absent or very low secretion of laccase and manganese peroxidase (MnP) proteins. All isolates unable to secrete MnP were also unable to bleach or delignify kraft pulp. One mutant strain, M49, which grew normally but did not oxidize guaiacol, was tested further with a number of other substrates whose degradation has been associated with delignification by white rot fungi. Compared with the parent, 52J, mutant M49, secreting no MnP and low laccase, could not brighten or delignify kraft pulp, produced less ethylene from 2-keto methiolbutyric acid, released much less (sup14)CO(inf2) from [(sup14)C]DHP (a synthetic lignin-like polymerizate), and produced much less methanol from pulp. This mutant also displayed decreased abilities to oxidize the dyes poly B-411, poly R-478, and phenol red compared with the wild-type strain and was also unable to decolorize kraft bleachery effluent or mineralize its organochlorine. Addition of purified MnP in conjunction with H(inf2)O(inf2), MnSO(inf4), and an Mn(III) chelator to M49 cultures partially restored methanol production, pulp delignification, and biobleaching in some cases. PMID:16535150
Purification and characterization of a melanin biodegradation enzyme from Geotrichum sp.
Kim, B S; Blaghen, M; Hong, H-S; Lee, K-M
2016-12-01
Melanin is a black or brown phenolic polymer present mainly in skin and hair. Although melanin can be degraded by some microbial species, the melanin degradation capacity of Geotrichum sp. is unknown. The aim of this study was to characterize a melanin biodegradation enzyme from Geotrichum sp. In this study, we assessed the melanin degradation activity of Geotrichum sp. in comparison with the major melanin-degrading enzymes, manganese-dependent peroxidase (MnP), manganese-independent peroxidase, lignin peroxidase and laccase. Furthermore, the effect of several carbohydrates on melanin degradation by Geotrichum sp. was determined. The MnP enzyme was purified using ammonium sulphate precipitation and Sephadex G-200 column chromatography, and then the conditions for optimal enzymatic activity were determined by adjusting the pH, temperature and Tween-80 concentration. Compared with extracellular ligninolytic enzymes of Geotrichum sp., MnP had the highest ligninolytic enzyme activity; and the highest enzymatic activity was observed in the presence of glucose. The final purified MnP enzyme exhibited 6 U mL -1 activity and had a molecular weight of 54.2 kDa. The enzymatic activity was highest at pH 4.5 and 25-35°C in the absence of Tween-80. These results indicate the potential of MnP purified from Geotrichum sp. as a skin-lightening agent in the cosmetic industry. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Unravelling lignin formation and structure. Final report, April 1, 1988--March 31, 1991
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, N.G.
1991-12-31
During this study, we established that the Fagaceae exclusively accumulate Z-monolignois/glucosides, and not the E-isomers. Evidence for the presence of a novel E{yields}Z isomerse has been obtained. Our pioneering work in lignin biosynthesis and structure in situ has also progressed smoothly. We established the bonding environments of a woody angiosperm, Leucanea leucocephala, as well as wheat (T. aestivum) and tobacco (N. tabacum). A cell culture system from Pinus taeda was developed which seems ideal for investigating the early stages of lignification. These cultures excrete peroxidase isozymes, considered to be specifically involved in lignin deposition. We also studied the effect ofmore » the putative lignin-degrading enzyme, lignin peroxidase, on monolignols and dehydropolymerisates therefrom. In all cases, polymerization was observed, and not degradation; these polymers are identical to that obtained with horseradish peroxidases/H{sub 2}O{sub 2}. It seems inconceivable that these enzymes can be considered as being primarily responsible for lignin biodegradation.« less
Vasina, Daria V.; Moiseenko, Konstantin V.; Fedorova, Tatiana V.; Tyazhelova, Tatiana V.
2017-01-01
Ligninolytic heme peroxidases comprise an extensive family of enzymes, which production is characteristic for white-rot Basidiomycota. The majority of fungal heme peroxidases are encoded by multigene families that differentially express closely related proteins. Currently, there were very few attempts to characterize the complete multigene family of heme peroxidases in a single fungus. Here we are focusing on identification and characterization of peroxidase genes, which are transcribed and secreted by basidiomycete Trametes hirsuta 072, an efficient lignin degrader. The T. hirsuta genome contains 18 ligninolytic peroxidase genes encoding 9 putative lignin peroxidases (LiP), 7 putative short manganese peroxidases (MnP) and 2 putative versatile peroxidases (VP). Using ddPCR method we have quantified the absolute expression of the 18 peroxidase genes under different culture conditions and on different growth stages of basidiomycete. It was shown that only two genes (one MnP and one VP) were prevalently expressed as well as secreted into cultural broth under all conditions investigated. However their transcriptome and protein profiles differed in time depending on the effector used. The expression of other peroxidase genes revealed a significant variability, so one can propose the specific roles of these enzymes in fungal development and lifestyle. PMID:28301519
Sharma, Krishna Kant; Shrivastava, Bhuvnesh; Sastry, V. R. B.; Sehgal, Neeta; Kuhad, Ramesh Chander
2013-01-01
The variables influencing laccase production by white-rot fungus Ganoderma sp. rckk-02 were optimized employing response surface methodology. Malt extract (6.0% w/v), lignin (0.5% w/v) and pH (5.5) were found to be the most significant factors for enhanced laccase production by 7 fold (226.0 U/ml) as compared to unoptimized growth conditions (32.0 U/ml). The N-terminal sequence of laccase revealed its distinct amino acid profile (S- I- R- N- S- G), which suggested it as a novel enzyme. The Far-UV CD spectrum of the laccase showed single broad negative trough at around 213 nm, a typical signature of all β proteins. The laccase was found to fall in the range of middle redox potential laccases. Purified laccase at dosage of 2.5 Ug−1 body weight when supplemented with pelleted diet of rats, a significant improvement (p < 0.05) in nutrients digestibility without causing any elevation of blood stress enzymes was observed. PMID:23416696
Metal release and sequestration from black slate mediated by a laccase of Schizophyllum commune.
Kirtzel, Julia; Scherwietes, Eric Leon; Merten, Dirk; Krause, Katrin; Kothe, Erika
2018-06-25
Schizophyllum commune is a filamentous basidiomycete which can degrade complex organic macromolecules like lignin by the secretion of a large repertoire of enzymes. One of these white rot enzymes, laccase, exhibits a broad substrate specificity and is able to oxidize a variety of substances including carbonaceous rocks. To investigate the role of laccase in bioweathering, laccase gene lcc2 was overexpressed, and the influence on weathering of black slate, originating from a former alum mine in Schmiedefeld, Germany, was examined. The metal release from the rock material was enhanced, associated with a partial metal accumulation into the mycelium. A sequestration of metals could be shown with fluorescent staining methods, and an accumulation of Zn, Cd, and Pb was visualized in different cell organelles. Additionally, we could show an increased metal resistance of the laccase overexpressing strain.
A Review on The Bioconversion of Lignin to Microbial Lipid with Oleaginous Rhodococcus opacus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mahan, Kristina M.; Le, Rosemary K.; Yuan, Joshua
Rhodococcus opacus produces intracellular lipids from the biodegradation of lignocellulosic biomass. These lipids can be used to produce biofuels that could potentially replace petroleum-derived chemicals. Some current studies are focusing on deconstructing lignin through efficient and cost-effective pretreatment methods and improving microbial lipid titers. Furthermore, R. opacus can reach high levels of oleaginicity (>80%) when grown on glucose and other aromatic model compounds but intracellular lipid production is much lower on complex recalcitrant lignin substrates. Our review will discuss recent advances in studying R. opacus lignin degradation by exploring different pretreatment methods, increasing lignin solubility, enriching for low molecular weightmore » lignin compounds and laccase supplementation.« less
A Review on The Bioconversion of Lignin to Microbial Lipid with Oleaginous Rhodococcus opacus
Mahan, Kristina M.; Le, Rosemary K.; Yuan, Joshua; ...
2017-06-29
Rhodococcus opacus produces intracellular lipids from the biodegradation of lignocellulosic biomass. These lipids can be used to produce biofuels that could potentially replace petroleum-derived chemicals. Some current studies are focusing on deconstructing lignin through efficient and cost-effective pretreatment methods and improving microbial lipid titers. Furthermore, R. opacus can reach high levels of oleaginicity (>80%) when grown on glucose and other aromatic model compounds but intracellular lipid production is much lower on complex recalcitrant lignin substrates. Our review will discuss recent advances in studying R. opacus lignin degradation by exploring different pretreatment methods, increasing lignin solubility, enriching for low molecular weightmore » lignin compounds and laccase supplementation.« less
Evidence for Lignin Oxidation by the Giant Panda Fecal Microbiome
Zhou, Peng; Chang, Fei; Hong, Yuzhi; Zhang, Xuecheng; Peng, Hui; Xiao, Yazhong
2012-01-01
The digestion of lignin and lignin-related phenolic compounds from bamboo by giant pandas has puzzled scientists because of the lack of lignin-degrading genes in the genome of the bamboo-feeding animals. We constructed a 16S rRNA gene library from the microorganisms derived from the giant panda feces to identify the possibility for the presence of potential lignin-degrading bacteria. Phylogenetic analysis showed that the phylotypes of the intestinal bacteria were affiliated with the phyla Proteobacteria (53%) and Firmicutes (47%). Two phylotypes were affiliated with the known lignin-degrading bacterium Pseudomonas putida and the mangrove forest bacteria. To test the hypothesis that microbes in the giant panda gut help degrade lignin, a metagenomic library of the intestinal bacteria was constructed and screened for clones that contained genes encoding laccase, a lignin-degrading related enzyme. A multicopper oxidase gene, designated as lac51, was identified from a metagenomic clone. Sequence analysis and copper content determination indicated that Lac51 is a laccase rather than a metallo-oxidase and may work outside its original host cell because it has a TAT-type signal peptide and a transmembrane segment at its N-terminus. Lac51 oxidizes a variety of lignin-related phenolic compounds, including syringaldazine, 2,6-dimethoxyphenol, ferulic acid, veratryl alcohol, guaiacol, and sinapinic acid at conditions that simulate the physiologic environment in giant panda intestines. Furthermore, in the presence of 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), syringic acid, or ferulic acid as mediators, the oxidative ability of Lac51 on lignin was promoted. The absorbance of lignin at 445 nm decreased to 36% for ABTS, 51% for syringic acid, and 51% for ferulic acid after incubation for 10 h. Our findings demonstrate that the intestinal bacteria of giant pandas may facilitate the oxidation of lignin moieties, thereby clarifying the digestion of bamboo lignin by the animal. PMID:23209704
Pham, Le Thanh Mai; Kim, Su Jin; Kim, Yong Hwan
2016-01-01
Although lignin peroxidase is claimed as a key enzyme in enzyme-catalyzed lignin degradation, in vitro enzymatic degradation of lignin was not easily observed in lab-scale experiments. It implies that other factors may hinder the enzymatic degradation of lignin. Irreversible interaction between phenolic compound and lignin peroxidase was hypothesized when active enzyme could not be recovered after the reaction with degradation product (guaiacol) of lignin phenolic dimer. In the study of lignin peroxidase isozyme H8 from white-rot fungi Phanerochaete chrysosporium (LiPH8), W251 site was revealed to make the covalent coupling with one moiety of monolignolic radical (guaiacol radical) by LC-MS/MS analysis. Hypothetical electron-relay containing W251 residue was newly suggested based on the observation of repressed radical coupling and remarkably lower electron transfer rate for W215A mutant. Furthermore, the retardation of the suicidal radical coupling between the W251 residue and the monolignolic radical was attempted by supplementing the acidic microenvironment around the W251 residue to engineer radical-robust LiPH8. Among many mutants, mutant A242D showed exceptional catalytic performances by yielding 21.1- and 4.9-fold higher increases of k cat and k cat /K M values, respectively, in the oxidation of non-phenolic model lignin dimer. A mechanism-based suicide inhibition of LiPH8 by phenolic compounds was firstly revealed and investigated in this work. Radical-robust LiPH8 was also successfully engineered by manipulating the transient radical state of radical-susceptible electron-relay. Radical-robust LiPH8 will play an essential role in degradation of lignin, which will be consequently linked with improved production of sugars from lignocellulose biomass.
Naranjo-Briceño, Leopoldo; Pernía, Beatriz; Guerra, Mayamaru; Demey, Jhonny R; De Sisto, Angela; Inojosa, Ysvic; González, Meralys; Fusella, Emidio; Freites, Miguel; Yegres, Francisco
2013-11-01
Large amount of drilling waste associated with the expansion of the Orinoco Oil Belt (OOB), the biggest proven reserve of extra-heavy crude oil (EHCO) worldwide, is usually impregnated with EHCO and highly salinized water-based drilling fluids. Oxidative exoenzymes (OE) of the lignin-degrading enzyme system (LDS) of fungi catalyse the oxidation of a wide range of toxic pollutants. However, very little evidences on fungal degradation or biotransformation of EHCO have been reported, which contain high amounts of asphaltenes and its biodegradation rate is very limited. The aims of this work were to study the ability of Pestalotiopsis palmarum BM-04 to synthesize OE, its potential to biotransform EHCO and to survive in extreme environmental conditions. Enzymatic studies of the LDS showed the ability of this fungus to overproduce high amounts of laccase (LACp) in presence of wheat bran or lignin peroxidase (LIPp) with EHCO as sole carbon and energy source (1300 U mgP(-1) in both cases). FT-IR spectroscopy with Attenuated Total Reflectance (ATR) analysis showed the enzymatic oxidation of carbon and sulfur atoms in both maltenes and asphaltenes fractions of biotreated EHCO catalysed by cell-free laccase-enriched OE using wheat bran as inducer. UV-visible spectrophotometry analysis revealed the oxidation of the petroporphyrins in the asphaltenes fraction of biotreated EHCO. Tolerance assays showed the ability of this fungus to grow up to 50,000 p.p.m. of EHCO and 2000 mM of NaCl. These results suggest that P. palmarum BM-04 is a hopeful alternative to be used in remediation processes in extreme environmental conditions of salinity and EHCO contamination, such as the drilling waste from the OOB. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Qin, Xing; Sun, Xianhua; Huang, Huoqing; Bai, Yingguo; Wang, Yuan; Luo, Huiying; Yao, Bin; Zhang, Xiaoyu; Su, Xiaoyun
2017-01-01
Manganese peroxidase is one of the Class II fungal peroxidases that are able to oxidize the low redox potential phenolic lignin compounds. For high redox potential non-phenolic lignin degradation, mediators such as GSH and unsaturated fatty acids are required in the reaction. However, it is not known whether carboxylic acids are a mediator for non-phenolic lignin degradation. The white rot fungus Irpex lacteus is one of the most potent fungi in degradation of lignocellulose and xenobiotics. Two manganese peroxidases ( Il MnP1 and Il MnP2) from I. lacteus CD2 were over-expressed in Escherichia coli and successfully refolded from inclusion bodies. Both Il MnP1 and Il MnP2 oxidized the phenolic compounds efficiently. Surprisingly, they could degrade veratryl alcohol, a non-phenolic lignin compound, in a Mn 2+ -dependent fashion. Malonate or oxalate was found to be also essential in this degradation. The oxidation of non-phenolic lignin was further confirmed by analysis of the reaction products using LC-MS/MS. We proved that Mn 2+ and a certain carboxylate are indispensable in oxidation and that the radicals generated under this condition, specifically superoxide radical, are at least partially involved in lignin oxidative degradation. Il MnP1 and Il MnP2 can also efficiently decolorize dyes with different structures. We provide evidence that a carboxylic acid may mediate oxidation of non-phenolic lignin through the action of radicals. MnPs, but not LiP, VP, or DyP, are predominant peroxidases secreted by some white rot fungi such as I. lacteus and the selective lignocellulose degrader Ceriporiopsis subvermispora . Our finding will help understand how these fungi can utilize MnPs and an excreted organic acid, which is usually a normal metabolite, to efficiently degrade the non-phenolic lignin. The unique properties of Il MnP1 and Il MnP2 make them good candidates for exploring molecular mechanisms underlying non-phenolic lignin compounds oxidation by MnPs and for applications in lignocellulose degradation and environmental remediation.
Unraveling the effects of laccase treatment on enzymatic hydrolysis of steam-exploded wheat straw.
Oliva-Taravilla, Alfredo; Moreno, Antonio D; Demuez, Marie; Ibarra, David; Tomás-Pejó, Elia; González-Fernández, Cristina; Ballesteros, Mercedes
2015-01-01
Laccase enzymes are promising detoxifying agents during lignocellulosic bioethanol production from wheat straw. However, they affect the enzymatic hydrolysis of this material by lowering the glucose recovery yields. This work aimed at explaining the negative effects of laccase on enzymatic hydrolysis. Relative glucose recovery in presence of laccase (10IU/g substrate) with model cellulosic substrate (Sigmacell) at 10% (w/v) was almost 10% points lower (P<0.01) than in the absence of laccase. This fact could be due to an increase in the competition of cellulose binding sites between the enzymes and a slight inhibition of β-glucosidase activity. However, enzymatic hydrolysis and infrared spectra of laccase-treated and untreated wheat straw filtered pretreated residue (WS-FPR), revealed that a grafting process of phenoxy radicals onto the lignin fiber could be the cause of diminished accessibility of cellulases to cellulose in pretreated wheat straw. Copyright © 2014 Elsevier Ltd. All rights reserved.
Lignocellulose Degradation Mechanisms Across the Tree of Life
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cragg, Simon M.; Beckham, Gregg T.; Bruce, Neil C.
Organisms use diverse mechanisms involving multiple complementary enzymes, particularly glycoside hydrolases (GHs), to deconstruct lignocellulose. Lytic polysaccharide monooxygenases (LPMOs) produced by bacteria and fungi facilitate deconstruction as does the Fenton chemistry of brown-rot fungi. Lignin depolymerisation is achieved by white-rot fungi and certain bacteria, using peroxidases and laccases. Meta-omics is now revealing the complexity of prokaryotic degradative activity in lignocellulose-rich environments. Protists from termite guts and some oomycetes produce multiple lignocellulolytic enzymes. We found that the Lignocellulose-consuming animals secrete some GHs, but most harbour a diverse enzyme-secreting gut microflora in a mutualism that is particularly complex in termites. Shipworms however,more » house GH-secreting and LPMO-secreting bacteria separate from the site of digestion and the isopod Limnoria relies on endogenous enzymes alone. Moreover, the omics revolution is identifying many novel enzymes and paradigms for biomass deconstruction, but more emphasis on function is required, particularly for enzyme cocktails, in which LPMOs may play an important role.« less
Lignocellulose Degradation Mechanisms Across the Tree of Life
Cragg, Simon M.; Beckham, Gregg T.; Bruce, Neil C.; ...
2015-11-14
Organisms use diverse mechanisms involving multiple complementary enzymes, particularly glycoside hydrolases (GHs), to deconstruct lignocellulose. Lytic polysaccharide monooxygenases (LPMOs) produced by bacteria and fungi facilitate deconstruction as does the Fenton chemistry of brown-rot fungi. Lignin depolymerisation is achieved by white-rot fungi and certain bacteria, using peroxidases and laccases. Meta-omics is now revealing the complexity of prokaryotic degradative activity in lignocellulose-rich environments. Protists from termite guts and some oomycetes produce multiple lignocellulolytic enzymes. We found that the Lignocellulose-consuming animals secrete some GHs, but most harbour a diverse enzyme-secreting gut microflora in a mutualism that is particularly complex in termites. Shipworms however,more » house GH-secreting and LPMO-secreting bacteria separate from the site of digestion and the isopod Limnoria relies on endogenous enzymes alone. Moreover, the omics revolution is identifying many novel enzymes and paradigms for biomass deconstruction, but more emphasis on function is required, particularly for enzyme cocktails, in which LPMOs may play an important role.« less
Decolorization of textile dyes in an air-lift bioreactor inoculated with Bjerkandera adusta OBR105.
Sodaneath, Hong; Lee, Jung-In; Yang, Seung-Ok; Jung, Hyekyeng; Ryu, Hee Wook; Cho, Kyung-Suk
2017-09-19
A new decolorizing white-rot fungus, OBR105, was isolated from Mount Odae in South Korea and identified by the morphological characterization of its fruit body and spores and partial 18s rDNA sequences. The ligninolytic enzyme activity of OBR105 was studied to characterize their decolorizing mechanism using a spectrophotometric enzyme assay. For the evaluation of the decolorization capacity of OBR105, the isolate was incubated in an erlenmeyer flask and in an airlifte bioreator with potato dextrose broth (PDB) medium supplemented with each dye. In addition, the decolorization efficiency of real textile wastewater was evaluated in an airlift bioreactor inoculated with the isolate. The isolate was identified as Bjerkandera adusta and had ligninolytic enzymes such as laccase, lignin peroxidase (LiP), and Mn-dependent peroxidase (MnP). Its LiP activity was higher than its MnP and laccase activities. B. adusta OBR105 successfully decolorized reactive dyes (red 120, blue 4, orange 16, and black 5) and acid dyes (red 114, blue 62, orange 7, and black 172). B. adusta OBR105 decolorized 91-99% of 200 mg L -1 of each dye (except acid orange 7) within 3 days in a PDB medium at 28°C, pH 5, and 150 rpm. This fungus decolorized only 45% of 200 mg L -1 acid orange 7 (single azo-type dye) within 3 days, and the decolorization efficiency did not increase by prolonging the cultivation time. In the air-lift bioreactor, B. adusta OBR105 displayed a high decolorization capacity, greater than 90%, for 3 acid dyes (red 114, blue 62, and black 172) and 1 reactive dye (blue 4) within 10-15 h of treatment. B. adusta OBR105 could decolorize real textile wastewater in the air-lift bioreactor. This result suggests that an air-lift reactor employing B. adusta OBR105 is a promising bioreactor for the treatment of dye wastewater.
NASA Technical Reports Server (NTRS)
Prasad, T. K.; Cline, M. G.
1987-01-01
Inversion of the upper shoot of Pharbitis nil results in the inhibition of elongation in the inverted stem. The objective of the present study was to determine how shoot inversion-induced gravity stress inhibited elongation and to elucidate the possible role of ethylene-induced glycoprotein and lignin in this process. Determinations of hydroxyproline, peroxidase, phenylalanine ammonia-lyase (PAL), phenol, and lignin content/activity were carried out by appropriate spectrophotometric methods. It was found that inversion and Ethrel treatments of upright shoots caused significant increases in hydroxyproline content, peroxidase, and PAL activity in 12 hours and in phenol and lignin contents in 24 hours. All of these increases except for that of cytoplasmic peroxidase activity were partially reversed by AgNO3, the ethylene action inhibitor. It is concluded that possible cross-linking associated with the accumulation of the ethylene-induced hydroxyproline-rich glycoprotein and lignin may be responsible for the later stages of cessation of elongation in the inverted Pharbitis shoot.
Sun, Qing; Liu, Xiaogang; Yang, Juan; Liu, Wenwen; Du, Qingguo; Wang, Hongqiu; Fu, Chunxiang; Li, Wen-Xue
2018-06-04
Lodging under nitrogen (N)-luxury conditions substantially reduces crop yield and seed quality. However, the molecular mechanisms of plant lodging resistance remain largely unclear, especially in maize. We report here that the expression of ZmmiR528, a monocot-specific microRNA, is induced by N luxury but reduced by N deficiency. We show by the thioacidolysis and acetyl bromide analysis that N luxury significantly reduces the generation of H, G, and S monomers of the lignin as well as its total content in maize shoots. We further demonstrate that ZmLACCASE3 (ZmLAC3) and ZmLACCASE5 (ZmLAC5), which encode the copper-containing laccases, are the targets of ZmmiR528. In situ hybridization showed that ZmmiR528 is mainly expressed in maize vascular tissues. Knockdown of ZmmiR528 or overexpression of ZmLAC3 significantly increased the lignin content and rind penetrometer resistance of maize stems. In contrast, transgenic maize plants overexpressing ZmmiR528 had reduced lignin content and rind penetrometer resistance and were prone to lodging under N-luxury conditions. RNA-sequencing analysis revealed that ZmPAL7 and ZmPAL8 are upregulated in transgenic maize lines downregulating ZmmiR528. Under N-luxury conditions, the expression levels of ZmPALs were much higher in ZmmiR528-knockdown lines than in the wild type and transgenic maize lines overexpressing ZmmiR528. Taken together, these results indicate that, by regulating the expression of ZmLAC3 and ZmLAC5, ZmmiR528 affects maize lodging resistance under N-luxury conditions. Copyright © 2018 The Author. Published by Elsevier Inc. All rights reserved.
Progress and obstacles in the production and application of recombinant lignin-degrading peroxidases
Lambertz, Camilla; Ece, Selin; Fischer, Rainer; Commandeur, Ulrich
2016-01-01
ABSTRACT Lignin is 1 of the 3 major components of lignocellulose. Its polymeric structure includes aromatic subunits that can be converted into high-value-added products, but this potential cannot yet been fully exploited because lignin is highly recalcitrant to degradation. Different approaches for the depolymerization of lignin have been tested, including pyrolysis, chemical oxidation, and hydrolysis under supercritical conditions. An additional strategy is the use of lignin-degrading enzymes, which imitates the natural degradation process. A versatile set of enzymes for lignin degradation has been identified, and research has focused on the production of recombinant enzymes in sufficient amounts to characterize their structure and reaction mechanisms. Enzymes have been analyzed individually and in combinations using artificial substrates, lignin model compounds, lignin and lignocellulose. Here we consider progress in the production of recombinant lignin-degrading peroxidases, the advantages and disadvantages of different expression hosts, and obstacles that must be overcome before such enzymes can be characterized and used for the industrial processing of lignin. PMID:27295524
Perazzini, Raffaella; Saladino, Raffaele; Guazzaroni, Melissa; Crestini, Claudia
2011-01-01
Horseradish peroxidase (HRP) was chemically immobilised onto alumina particles and coated by polyelectrolytes layers, using the layer-by-layer technique. The reactivity of the immobilised enzyme was studied in the oxidative functionalisation of softwood milled wood and residual kraft lignins and found higher than the free enzyme. In order to investigate the chemical modifications in the lignin structure, quantitative (31)P NMR was used. The immobilised HRP showed a higher reactivity with respect to the native enzyme yielding extensive depolymerisation of lignin. Copyright © 2010 Elsevier Ltd. All rights reserved.
Methylene blue as a lignin surrogate in manganese peroxidase reaction systems.
Goby, Jeffrey D; Penner, Michael H; Lajoie, Curtis A; Kelly, Christine J
2017-11-15
Manganese peroxidase (MnP) is associated with lignin degradation and is thus relevant to lignocellulosic-utilization technologies. Technological applications require reaction mixture optimization. A surrogate substrate can facilitate this if its susceptibility to degradation is easily monitored and mirrors that of lignin. The dye methylene blue (MB) was evaluated in these respects as a surrogate substrate by testing its reactivity in reaction mixtures containing relevant redox mediators (dicarboxylic acids, fatty acids). Relative rates of MB degradation were compared to available literature reports of lignin degradation under similar conditions, and suggest that MB can be a useful lignin surrogate in MnP systems. Copyright © 2017 Elsevier Inc. All rights reserved.
Vats, Arpita; Mishra, Saroj
2018-02-15
Multiplicity in laccases among lignin degrading fungal species is of interest as it confers the ability to degrade several types of lignocellulosics. The combination of laccases produced on such substrates could be beneficial for treatment of complex aromatics, including dyes. In this study, we report on production of high units (679.6Ug -1 substrate) of laccase on solid wheat bran (WB) by Cyathus bulleri. Laccase, purified from the culture filtrates of WB grown fungus, was effective for oxidation of veratryl alcohol, Reactive blue 21 and textile effluent without assistance of externally added mediators. De novo sequencing of the 'purified' laccase lead to identification of several peptides that originated from different laccase genes. Transcriptome analysis of the fungus, cultivated on WB, confirmed presence of 8 isozymes, that were re-amplified and sequenced from the cDNA prepared from WB grown fungus. The 8 isozymes were grouped into 3 classes, based on their sequence relationship with other basidiomycete laccases. The isoforms produced on WB decolorized (by ∼57%) and degraded textile effluent far more effectively, compared to laccase obtained from Basal salt cultivated fungus. The decolorization and degradation was also accompanied by more than 95% reduction in phytotoxicity. Copyright © 2017 Elsevier B.V. All rights reserved.
Min, Kyoungseon; Gong, Gyeongtaek; Woo, Han Min; Kim, Yunje; Um, Youngsoon
2015-01-01
In the biorefinery using lignocellulosic biomass as feedstock, pretreatment to breakdown or loosen lignin is important step and various approaches have been conducted. For biological pretreatment, we screened Bacillus subtilis KCTC2023 as a potential lignin-degrading bacterium based on veratryl alcohol (VA) oxidation test and the putative heme-containing dye-decolorizing peroxidase was found in the genome of B. subtilis KCTC2023. The peroxidase from B. subtilis KCTC2023 (BsDyP) was capable of oxidizing various substrates and atypically exhibits substrate-dependent optimum temperature: 30°C for dyes (Reactive Blue19 and Reactive Black5) and 50°C for high redox potential substrates (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid [ABTS], VA, and veratryl glycerol-β-guaiacyl ether [VGE]) over +1.0 V vs. normal hydrogen electrode. At 50°C, optimum temperature for high redox potential substrates, BsDyP not only showed the highest VA oxidation activity (0.13 Umg−1) among the previously reported bacterial peroxidases but also successfully achieved VGE decomposition by cleaving Cα-Cβ bond in the absence of any oxidative mediator with a specific activity of 0.086 Umg−1 and a conversion rate of 53.5%. Based on our results, BsDyP was identified as the first bacterial peroxidase capable of oxidizing high redox potential lignin-related model compounds, especially VGE, revealing a previously unknown versatility of lignin degrading biocatalyst in nature. PMID:25650125
Maqbool, Zahid; Hussain, Sabir; Imran, Muhammad; Mahmood, Faisal; Shahzad, Tanvir; Ahmed, Zulfiqar; Azeem, Farrukh; Muzammil, Saima
2016-09-01
Pesticides are used for controlling the development of various pests in agricultural crops worldwide. Despite their agricultural benefits, pesticides are often considered a serious threat to the environment because of their persistent nature and the anomalies they create. Hence removal of such pesticides from the environment is a topic of interest for the researchers nowadays. During the recent years, use of biological resources to degrade or remove pesticides has emerged as a powerful tool for their in situ degradation and remediation. Fungi are among such bioresources that have been widely characterized and applied for biodegradation and bioremediation of pesticides. This review article presents the perspectives of using fungi for biodegradation and bioremediation of pesticides in liquid and soil media. This review clearly indicates that fungal isolates are an effective bioresource to degrade different pesticides including lindane, methamidophos, endosulfan, chlorpyrifos, atrazine, cypermethrin, dieldrin, methyl parathion, heptachlor, etc. However, rate of fungal degradation of pesticides depends on soil moisture content, nutrient availability, pH, temperature, oxygen level, etc. Fungal strains were found to harbor different processes including hydroxylation, demethylation, dechlorination, dioxygenation, esterification, dehydrochlorination, oxidation, etc during the biodegradation of different pesticides having varying functional groups. Moreover, the biodegradation of different pesticides was found to be mediated by involvement of different enzymes including laccase, hydrolase, peroxidase, esterase, dehydrogenase, manganese peroxidase, lignin peroxidase, etc. The recent advances in understanding the fungal biodegradation of pesticides focusing on the processes, pathways, genes/enzymes and factors affecting the biodegradation have also been presented in this review article.
Enzymatic synthesis of lignin-siloxane hybrid functional polymers.
Prasetyo, Endry Nugroho; Kudanga, Tukayi; Fischer, Roman; Eichinger, Reinhard; Nyanhongo, Gibson S; Guebitz, Georg M
2012-02-01
This study combines the properties of siloxanes and lignin polymers to produce hybrid functional polymers that can be used as adhesives, coating materials, and/or multifunctionalized thin-coating films. Lignin-silica hybrid copolymers were synthesized by using a sol-gel process. Laccases from Trametes hirsuta were used to oxidize lignosulphonates to enhance their reactivity towards siloxanes and then were incorporated into siloxane precursors undergoing a sol-gel process. In vitro copolymerization studies using pure lignin monomers with aminosilanes or ethoxytrimethylsilane and analysis by ²⁹Si NMR spectroscopy revealed hybrid products. Except for kraft lignin, an increase in lignin concentration positively affected the tensile strength in all samples. Similarly, the viscosity generally increased in all samples with increasing lignin concentration and also affected the curing time. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Winery biomass waste degradation by sequential sonication and mixed fungal enzyme treatments.
Karpe, Avinash V; Dhamale, Vijay V; Morrison, Paul D; Beale, David J; Harding, Ian H; Palombo, Enzo A
2017-05-01
To increase the efficiency of winery-derived biomass biodegradation, grape pomace was ultrasonicated for 20min in the presence of 0.25M, 0.5Mand1.0MKOH and 1.0MNaOH. This was followed by treatment with a 1:1 (v/v) mix of crude enzyme preparation derived from Phanerochaete chrysosporium and Trametes versicolor for 18h and a further 18h treatment with a 60:14:4:2 percent ratio combination of enzymes derived from Aspergillus niger: Penicillium chrysogenum: Trichoderma harzianum: P. citrinum, repsectively. Process efficiency was evaluated by its comparison to biological only mixed fungal degradation over 16days. Ultrasonication treatment with 0.5MKOH followed by mixed enzyme treatment yielded the highest lignin degradation of about 13%. Cellulase, β-glucosidase, xylanase, laccase and lignin peroxidase activities of 77.9, 476, 5,390.5, 66.7 and 29,230.7U/mL, respectively, were observed during biomass degradation. Gas chromatography-mass spectrometry (GC-MS) analysis of the degraded material identified commercially important compounds such as gallic acid, lithocholic acid, glycolic acid and lactic acid which were generated in considerable quantities. Thus, the combination of sonication pre-treatment and enzymatic degradation has the potential to considerably improve the breakdown of agricultural biomass and produce commercially useful compounds in markedly less time (<40h) with respect to biological only degradation (16days). Copyright © 2016 Elsevier Inc. All rights reserved.
Decolorization of palm oil mill effluent using growing cultures of Curvularia clavata.
Neoh, Chin Hong; Lam, Chi Yong; Lim, Chi Kim; Yahya, Adibah; Ibrahim, Zaharah
2014-03-01
Agricultural wastewater that produces color are of environmental and health concern as colored effluent can produce toxic and carcinogenic by-products. From this study, batch culture optimization using response surface methods indicated that the fungus isolated from the pineapple solid waste, Curvularia clavata was able to decolorize sterile palm oil mill effluent (POME) which is mainly associated with polyphenol and lignin. Results showed successful decolorization of POME up to 80 % (initial ADMI [American Dye Manufacturing Index] of 3,793) with 54 % contributed by biosorption and 46 % by biodegradation after 5 days of treatment. Analysis using HPLC and GC-MS showed the degradation of color causing compound such as 3-methoxyphenyl isothiocynate and the production of new metabolites. Ecotoxicity test indicated that the decolorized effluent is safe for discharge. To determine the longevity of the fungus for a prolonged decolorization period, sequential batch decolorization studies were carried out. The results showed that lignin peroxidase and laccase were the main ligninolytic enzymes involved in the degradation of color. Carboxymethyl cellulase (CMCase) and xylanase activities were also detected suggesting possible roles of the enzymes in promoting growth of the fungus which consequently contributed to improved decolorization of POME. In conclusion, the ability of C. clavata in treating color of POME indicated that C. clavata is of potential use for decolorization and degradation of agricultural wastewater containing polyphenolic compounds.
Watharkar, Anuprita D; Kadam, Suhas K; Khandare, Rahul V; Kolekar, Parag D; Jeon, Byong-Hun; Jadhav, Jyoti P; Govindwar, Sanjay P
2018-05-30
This study explores the potential of Asparagus densiflorus to treat disperse Rubin GFL (RGFL) dye and a real textile effluent in constructed vertical subsurface flow (VSbF) phytoreactor; its field cultivation for soil remediation offers a real green and economic way of environmental management. A. densiflorus decolorized RGFL (40 gm L -1 ) up to 91% within 48 h. VSbF phytoreactor successfully reduced American dye manufacture institute (ADMI), BOD, COD, Total Dissolved Solids (TDS) and Total Suspended Solids (TSS) of real textile effluent by 65%, 61%, 66%, 48% and 66%, respectively within 6 d. Oxidoreductive enzymes such as laccase (138%), lignin peroxidase (129%), riboflavin reductase (111%) were significantly expressed during RGFL degradation in A. densiflorus roots, while effluent transformation caused noteworthy induction of enzymes like, tyrosinase (205%), laccase (178%), veratryl oxidase (52%). Based on enzyme activities, UV-vis spectroscopy, FTIR and GC-MS results; RGFL was proposed to be transformed to 4-amino-3- methylphenyl (hydroxy) oxoammonium and N, N-diethyl aniline. Anatomical study of the advanced root tissue of A. densiflorus exhibited the progressive dye accumulation and removal during phytoremediation. HepG2 cell line and phytotoxicity study demonstrated reduced toxicity of biotransformed RGFL and treated effluent by A. densiflorus, respectively. On field remediation study revealed a noteworthy removal (67%) from polluted soil within 30 d. Copyright © 2018 Elsevier Inc. All rights reserved.
Effects of experimental hypogravity on peroxidase and cell wall constituents in the dwarf marigold
NASA Technical Reports Server (NTRS)
Siegel, S.; Speitel, T.; Shiraki, D.; Fukumoto, J.
1977-01-01
Dwarf marigolds grown from seed under experimental hypogravity are modified in lignin content, hemicellulose composition and peroxidase activity. The two conditions used, clinostats and flotation, induced changes differing in magnitude but qualitatively similar. Most responses on clinostats required correction for vertical axis rotational effects, thus limiting the value of these instruments in free-fall simulation. These findings extend earlier observations suggesting that increased peroxidase and decreased lignin are characteristic of growth under experimental hypogravity.
Effects of experimental hypogravity on peroxidase and cell wall constituents in the dwarf marigold
NASA Technical Reports Server (NTRS)
Siegel, S.; Speitel, T.; Shiraki, D.; Fukumoto, J.
1978-01-01
Dwarf Marigolds grown from seed under experimental hypogravity are modified in lignin content, hemicellulose composition, and peroxidase activity. The two conditions used, clinostats and flotation, induced changes differing in magnitude but qualitatively similar. Most responses on clinostats required corrections for vertical axis rotational effects, thus limiting the value of these instruments in free-fall simulation. These findings extend earlier observations suggesting that increased peroxidase and decreased lignin are characteristic of growth under experimental hypogravity.
Interference of peptone and tyrosine with the lignin peroxidase assay.
ten Have, R; Hartmans, S; Field, J A
1997-01-01
The N-unregulated white rot fungus Bjerkandera sp. strain BOS55 was cultured in 1 liter of peptone-yeast extract medium to produce lignin peroxidase (LiP). During the LiP assay, the oxidation of veratryl alcohol to veratraldehyde was inhibited due to tyrosine present in the peptone and the yeast extract. PMID:9251220
Regulation of Coal Polymer Degradation by Fungi
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1998-09-01
During this reporting period we have further studied the oxidation of soluble coal macromolecules by lignin peroxidase from Phanerochaete chrysosporium . Previous studies by others have suggested that a soluble fraction (coal macromolecule B-111) from a nitric acid solubilized North Dakota Lignite is depolymerized by this enzyme. Our investigations indicate that fraction B-111 is a substrate for lignin peroxidase as this material is decolorized in the presence of lignin peroxidase H8 and hydrogen peroxide. Of interest, however, is the observation that little, if any, depolymerization of this material occurs. Instead, it appears that lignin peroxidase and coal macromolecule B-111 formmore » a precipitate. These results are similar to those observed in our investigations of lignin peroxidase mediated oxidation of oxalate solubilize coal macromolecule. Previous studies in our laboratory using a spectrophotometric assay suggested that, in addition to oxalate, several other fungal metabolites are able to solubilize leonardite. We have reinvestigated this phenomenon using a more reliable gravimetric procedure for assessing solubilization. Our results confirm our earlier findings that malate, oxaloacetate and citrate are effective solubilizing agents whereas succinate, fumarate and x-ketoglutarate solubilize relatively small amounts of leonardite. Finally, we have studied the composition of the insoluble material remaining following extensive solubilization by sodium oxalate. The ratio of hydrogen to carbon is increased in the insoluble material relative to the parent leonardite. However, the ratio of oxygen to carbon is also increased in the insoluble material. Thus, the insoluble material does not appear to be more highly reduced that the parent leonardite and is not likely to be a better fuel that the parent material.« less
Demonstration of Lignin-to-Peroxidase Direct Electron Transfer
Sáez-Jiménez, Verónica; Baratto, Maria Camilla; Pogni, Rebecca; Rencoret, Jorge; Gutiérrez, Ana; Santos, José Ignacio; Martínez, Angel T.; Ruiz-Dueñas, Francisco Javier
2015-01-01
Versatile peroxidase (VP) is a high redox-potential peroxidase of biotechnological interest that is able to oxidize phenolic and non-phenolic aromatics, Mn2+, and different dyes. The ability of VP from Pleurotus eryngii to oxidize water-soluble lignins (softwood and hardwood lignosulfonates) is demonstrated here by a combination of directed mutagenesis and spectroscopic techniques, among others. In addition, direct electron transfer between the peroxidase and the lignin macromolecule was kinetically characterized using stopped-flow spectrophotometry. VP variants were used to show that this reaction strongly depends on the presence of a solvent-exposed tryptophan residue (Trp-164). Moreover, the tryptophanyl radical detected by EPR spectroscopy of H2O2-activated VP (being absent from the W164S variant) was identified as catalytically active because it was reduced during lignosulfonate oxidation, resulting in the appearance of a lignin radical. The decrease of lignin fluorescence (excitation at 355 nm/emission at 400 nm) during VP treatment under steady-state conditions was accompanied by a decrease of the lignin (aromatic nuclei and side chains) signals in one-dimensional and two-dimensional NMR spectra, confirming the ligninolytic capabilities of the enzyme. Simultaneously, size-exclusion chromatography showed an increase of the molecular mass of the modified residual lignin, especially for the (low molecular mass) hardwood lignosulfonate, revealing that the oxidation products tend to recondense during the VP treatment. Finally, mutagenesis of selected residues neighboring Trp-164 resulted in improved apparent second-order rate constants for lignosulfonate reactions, revealing that changes in its protein environment (modifying the net negative charge and/or substrate accessibility/binding) can modulate the reactivity of the catalytic tryptophan. PMID:26240145
Sáez-Jiménez, Verónica; Baratto, Maria Camilla; Pogni, Rebecca; Rencoret, Jorge; Gutiérrez, Ana; Santos, José Ignacio; Martínez, Angel T; Ruiz-Dueñas, Francisco Javier
2015-09-18
Versatile peroxidase (VP) is a high redox-potential peroxidase of biotechnological interest that is able to oxidize phenolic and non-phenolic aromatics, Mn(2+), and different dyes. The ability of VP from Pleurotus eryngii to oxidize water-soluble lignins (softwood and hardwood lignosulfonates) is demonstrated here by a combination of directed mutagenesis and spectroscopic techniques, among others. In addition, direct electron transfer between the peroxidase and the lignin macromolecule was kinetically characterized using stopped-flow spectrophotometry. VP variants were used to show that this reaction strongly depends on the presence of a solvent-exposed tryptophan residue (Trp-164). Moreover, the tryptophanyl radical detected by EPR spectroscopy of H2O2-activated VP (being absent from the W164S variant) was identified as catalytically active because it was reduced during lignosulfonate oxidation, resulting in the appearance of a lignin radical. The decrease of lignin fluorescence (excitation at 355 nm/emission at 400 nm) during VP treatment under steady-state conditions was accompanied by a decrease of the lignin (aromatic nuclei and side chains) signals in one-dimensional and two-dimensional NMR spectra, confirming the ligninolytic capabilities of the enzyme. Simultaneously, size-exclusion chromatography showed an increase of the molecular mass of the modified residual lignin, especially for the (low molecular mass) hardwood lignosulfonate, revealing that the oxidation products tend to recondense during the VP treatment. Finally, mutagenesis of selected residues neighboring Trp-164 resulted in improved apparent second-order rate constants for lignosulfonate reactions, revealing that changes in its protein environment (modifying the net negative charge and/or substrate accessibility/binding) can modulate the reactivity of the catalytic tryptophan. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
A recombinant actinomycete, Streptomyces lividans TK23.1, expressing a pIJ702-encoded extracellular lignin peroxidase gene cloned from the chromosome of Streptomyces virodosporus T7A, was released into soil in flask- and microcosm-scale studies to determine its effects on humific...
Alexander N. Kapich; Tatyana V. Korneichik; Annele Hatakka; Kenneth E. Hammel
2010-01-01
Unsaturated fatty acids have been proposed to mediate the oxidation of recalcitrant, non-phenolic lignin structures by fungal manganese peroxidases (MnP), but their precise role remains unknown. We investigated the oxidizability of three fatty acids with varying degrees of polyunsaturation (linoleic, linolenic, and arachidonic acids) by measuring conjugated dienes...
Schulz, Elke; Schloter, Michael; Buscot, François; Hofrichter, Martin; Krüger, Dirk
2014-01-01
Leaf litter decomposition is the key ecological process that determines the sustainability of managed forest ecosystems, however very few studies hitherto have investigated this process with respect to silvicultural management practices. The aims of the present study were to investigate the effects of forest management practices on leaf litter decomposition rates, nutrient dynamics (C, N, Mg, K, Ca, P) and the activity of ligninolytic enzymes. We approached these questions using a 473 day long litterbag experiment. We found that age-class beech and spruce forests (high forest management intensity) had significantly higher decomposition rates and nutrient release (most nutrients) than unmanaged deciduous forest reserves (P<0.05). The site with near-to-nature forest management (low forest management intensity) exhibited no significant differences in litter decomposition rate, C release, lignin decomposition, and C/N, lignin/N and ligninolytic enzyme patterns compared to the unmanaged deciduous forest reserves, but most nutrient dynamics examined in this study were significantly faster under such near-to-nature forest management practices. Analyzing the activities of ligninolytic enzymes provided evidence that different forest system management practices affect litter decomposition by changing microbial enzyme activities, at least over the investigated time frame of 473 days (laccase, P<0.0001; manganese peroxidase (MnP), P = 0.0260). Our results also indicate that lignin decomposition is the rate limiting step in leaf litter decomposition and that MnP is one of the key oxidative enzymes of litter degradation. We demonstrate here that forest system management practices can significantly affect important ecological processes and services such as decomposition and nutrient cycling. PMID:24699676
Purahong, Witoon; Kapturska, Danuta; Pecyna, Marek J; Schulz, Elke; Schloter, Michael; Buscot, François; Hofrichter, Martin; Krüger, Dirk
2014-01-01
Leaf litter decomposition is the key ecological process that determines the sustainability of managed forest ecosystems, however very few studies hitherto have investigated this process with respect to silvicultural management practices. The aims of the present study were to investigate the effects of forest management practices on leaf litter decomposition rates, nutrient dynamics (C, N, Mg, K, Ca, P) and the activity of ligninolytic enzymes. We approached these questions using a 473 day long litterbag experiment. We found that age-class beech and spruce forests (high forest management intensity) had significantly higher decomposition rates and nutrient release (most nutrients) than unmanaged deciduous forest reserves (P<0.05). The site with near-to-nature forest management (low forest management intensity) exhibited no significant differences in litter decomposition rate, C release, lignin decomposition, and C/N, lignin/N and ligninolytic enzyme patterns compared to the unmanaged deciduous forest reserves, but most nutrient dynamics examined in this study were significantly faster under such near-to-nature forest management practices. Analyzing the activities of ligninolytic enzymes provided evidence that different forest system management practices affect litter decomposition by changing microbial enzyme activities, at least over the investigated time frame of 473 days (laccase, P<0.0001; manganese peroxidase (MnP), P = 0.0260). Our results also indicate that lignin decomposition is the rate limiting step in leaf litter decomposition and that MnP is one of the key oxidative enzymes of litter degradation. We demonstrate here that forest system management practices can significantly affect important ecological processes and services such as decomposition and nutrient cycling.
Enzymatic Synthesis of Lignin-Based Concrete Dispersing Agents.
Jankowska, Dagmara; Heck, Tobias; Schubert, Mark; Yerlikaya, Alpaslan; Weymuth, Christophe; Rentsch, Daniel; Schober, Irene; Richter, Michael
2018-03-15
Lignin is the most abundant aromatic biopolymer, functioning as an integral component of woody materials. In its unmodified form it shows limited water solubility and is relatively unreactive, so biotechnological lignin valorisation for high-performance applications is greatly underexploited. Lignin can be obtained from the pulp and paper industry as a by-product. To expand its application, a new synthesis route to new dispersing agents for use as concrete additives was developed. The route is based on lignin functionalisation by enzymatic transformation. Screening of lignin-modifying systems resulted in functionalised lignin polymers with improved solubility in aqueous systems. Through grafting of sulfanilic acid or p-aminobenzoic acid by fungal laccases, lignin became soluble in water at pH≤4 or pH≤7, respectively. Products were analysed and evaluated in miniaturised application tests in cement paste and mortar. Their dispersing properties match the performance criteria of commercially available lignosulfonates. The study provides examples of new perspectives for the use of lignin. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Milstein, O.A.; Vared, Y.; Sharma, A.
1983-08-01
Aspergillus japonicus is an efficient degrader of phenolics and carbohydrates present in a mixture of soluble lignocarbohydrate complexes extracted from wheat straw. Trichoderma species attacked part of the carbohydrate but hardly affected the aromatic portion of this solution. Polyporus versicolor had a complex effect; polymerization of low-molecular-size phenolics accompanied the degradation of aromatic and carbohydrate polymers. The addition of xylose to the medium facilitated depolymerization of lignin by the fungi tested and prevented the polymerization of low-molecular-size fractions of lignocarbohydrate complexes by P. versicolor. P. versicolor, in contrast to A. japonicus and Trichoderma species, also excreted into the medium considerablemore » amounts of laccase, but only in the absence of endogenous or exogenous carbohydrates. Apparently, laccase is involved in polymerization rather than degradation of lignin in this organism. A number of extracellular glycanases were also secreted by these fungi. 19 references« less
Secretome-based Manganese(II) Oxidation by Filamentous Ascomycete Fungi
NASA Astrophysics Data System (ADS)
Zeiner, C. A.; Purvine, S.; Zink, E.; Paša-Tolić, L.; Chaput, D.; Wu, S.; Santelli, C. M.; Hansel, C. M.
2017-12-01
Manganese (Mn) oxides are among the strongest oxidants in the environment, and Mn(II) oxidation to Mn(III/IV) (hydr)oxides includes both abiotic and microbially-mediated processes. While white-rot Basidiomycete fungi oxidize Mn(II) using laccases and Mn peroxidases in association with lignocellulose degradation, the mechanisms by which filamentous Ascomycete fungi oxidize Mn(II) and a physiological role for Mn(II) oxidation in these organisms remain poorly understood. Through a combination of chemical and in-gel assays, bulk mass spectrometry, and iTRAQ proteomics, we demonstrate enzymatic Mn(II) oxidation in the secretomes of three phylogenetically diverse Ascomycetes that were isolated from Mn-laden sediments. Candidate Mn(II)-oxidizing enzymes were species-specific and included bilirubin oxidase and tyrosinase in Stagonospora sp. SRC1lsM3a, GMC oxidoreductase in Paraconiothyrium sporulosum AP3s5-JAC2a, and FAD-binding oxidoreductases in Pyrenochaeta sp. DS3sAY3a. These findings were supported by full proteomic characterization of the secretomes, which revealed a lack of Mn, lignin, and versatile peroxidases in these Ascomycetes but a substantially higher proportion of LMCOs and GMC oxidoreductases compared to wood-rot Basidiomycetes. We also identified the potential for indirect enzymatic Mn(II) oxidation by hydroxyl radical, as the secretomes were rich in diverse lignocellulose-degrading enzymes that could participate in Fenton chemistry. A link between Mn(II) oxidation and carbon oxidation analogous to white-rot Basidiomycetes remains unknown in these Ascomycetes. Interestingly, growth rates on rich medium were unaffected by the presence of Mn(II), and the production of Mn(II)-oxidizing proteins in the secretome was constitutive and not inducible by Mn(II). Thus, no physiological benefit of Mn(II) oxidation in these Ascomycetes has yet been identified, and Mn(II) oxidation appears to be a side reaction. Future work will explore the lignin-degrading capacity of these fungi and any associated role of Mn(II) oxidation.
Hammel, K E; Mozuch, M D; Jensen, K A; Kersten, P J
1994-11-15
Oxidative C alpha-C beta cleavage of the arylglycerol beta-aryl ether lignin model 1-(3,4-dimethoxy-phenyl)-2-phenoxypropane-1,3-diol (I) by Phanerochaete chrysosporium lignin peroxidase in the presence of limiting H2O2 was enhanced 4-5-fold by glyoxal oxidase from the same fungus. Further investigation showed that each C alpha-C beta cleavage reaction released 0.8-0.9 equiv of glycolaldehyde, a glyoxal oxidase substrate. The identification of glycolaldehyde was based on 13C NMR spectrometry of reaction product obtained from beta-, gamma-, and beta,gamma-13C-substituted I, and quantitation was based on an enzymatic NADH-linked assay. The oxidation of glycolaldehyde by glyoxal oxidase yielded 0.9 oxalate and 2.8 H2O2 per reaction, as shown by quantitation of oxalate as 2,3-dihydroxyquinoxaline after derivatization with 1,2-diaminobenzene and by quantitation of H2O2 in coupled spectrophotometric assays with veratryl alcohol and lignin peroxidase. These results suggest that the C alpha-C beta cleavage of I by lignin peroxidase in the presence of glyoxal oxidase should regenerate as many as 3 H2O2. Calculations based on the observed enhancement of LiP-catalyzed C alpha-C beta cleavage by glyoxal oxidase showed that approximately 2 H2O2 were actually regenerated per cleavage of I when both enzymes were present. The cleavage of arylglycerol beta-aryl ether structures by ligninolytic enzymes thus recycles H2O2 to support subsequent cleavage reactions.
A model system to study the lignification process in Eucalyptus globulus.
Araújo, Pedro; Cesarino, Igor; Mayer, Juliana Lischka Sampaio; Ferrari, Ilse Fernanda; Kiyota, Eduardo; Sawaya, Alexandra Christine Helena Frankland; Paes Leme, Adriana Franco; Mazzafera, Paulo
2014-09-01
Recalcitrance of plant biomass is closely related to the presence of the phenolic heteropolymer lignin in secondary cell walls, which has a negative effect on forage digestibility, biomass-to-biofuels conversion and chemical pulping. The genus Eucalyptus is the main source of wood for pulp and paper industry. However, when compared to model plants such as Arabidopsis thaliana and poplar, relatively little is known about lignin biosynthesis in Eucalyptus and only a few genes were functionally characterized. An efficient, fast and inexpensive in vitro system was developed to study lignification in Eucalyptus globulus and to evaluate the potential role of candidate genes in this biological process. Seedlings were grown in four different conditions, in the presence or absence of light and with or without sucrose in the growth medium, and several aspects of lignin metabolism were evaluated. Our results showed that light and, to a lesser extent, sucrose induced lignin biosynthesis, which was followed by changes in S/G ratio, lignin oligomers accumulation and gene expression. In addition, higher total peroxidase activity and differential isoperoxidase profile were observed when seedlings were grown in the presence of light and sucrose. Peptide sequencing allowed the identification of differentially expressed peroxidases, which can be considered potential candidate class III peroxidases involved in lignin polymerization in E. globulus. © 2014 Scandinavian Plant Physiology Society.
Tartar, Aurélien; Wheeler, Marsha M; Zhou, Xuguo; Coy, Monique R; Boucias, Drion G; Scharf, Michael E
2009-01-01
Background Termite lignocellulose digestion is achieved through a collaboration of host plus prokaryotic and eukaryotic symbionts. In the present work, we took a combined host and symbiont metatranscriptomic approach for investigating the digestive contributions of host and symbiont in the lower termite Reticulitermes flavipes. Our approach consisted of parallel high-throughput sequencing from (i) a host gut cDNA library and (ii) a hindgut symbiont cDNA library. Subsequently, we undertook functional analyses of newly identified phenoloxidases with potential importance as pretreatment enzymes in industrial lignocellulose processing. Results Over 10,000 expressed sequence tags (ESTs) were sequenced from the 2 libraries that aligned into 6,555 putative transcripts, including 171 putative lignocellulase genes. Sequence analyses provided insights in two areas. First, a non-overlapping complement of host and symbiont (prokaryotic plus protist) glycohydrolase gene families known to participate in cellulose, hemicellulose, alpha carbohydrate, and chitin degradation were identified. Of these, cellulases are contributed by host plus symbiont genomes, whereas hemicellulases are contributed exclusively by symbiont genomes. Second, a diverse complement of previously unknown genes that encode proteins with homology to lignase, antioxidant, and detoxification enzymes were identified exclusively from the host library (laccase, catalase, peroxidase, superoxide dismutase, carboxylesterase, cytochrome P450). Subsequently, functional analyses of phenoloxidase activity provided results that were strongly consistent with patterns of laccase gene expression. In particular, phenoloxidase activity and laccase gene expression are mostly restricted to symbiont-free foregut plus salivary gland tissues, and phenoloxidase activity is inducible by lignin feeding. Conclusion To our knowledge, this is the first time that a dual host-symbiont transcriptome sequencing effort has been conducted in a single termite species. This sequence database represents an important new genomic resource for use in further studies of collaborative host-symbiont termite digestion, as well as development of coevolved host and symbiont-derived biocatalysts for use in industrial biomass-to-bioethanol applications. Additionally, this study demonstrates that: (i) phenoloxidase activities are prominent in the R. flavipes gut and are not symbiont derived, (ii) expands the known number of host and symbiont glycosyl hydrolase families in Reticulitermes, and (iii) supports previous models of lignin degradation and host-symbiont collaboration in cellulose/hemicellulose digestion in the termite gut. All sequences in this paper are available publicly with the accession numbers FL634956-FL640828 (Termite Gut library) and FL641015-FL645753 (Symbiont library). PMID:19832970
Cho, Dae Won; Latham, John A; Park, Hea Jung; Yoon, Ung Chan; Langan, Paul; Dunaway-Mariano, Debra; Mariano, Patrick S
2011-04-15
New types of tetrameric lignin model compounds, which contain the common β-O-4 and β-1 structural subunits found in natural lignins, have been prepared and carbon-carbon bond fragmentation reactions of their cation radicals, formed by photochemical (9,10-dicyanoanthracene) and enzymatic (lignin peroxidase) SET-promoted methods, have been explored. The results show that cation radical intermediates generated from the tetrameric model compounds undergo highly regioselective C-C bond cleavage in their β-1 subunits. The outcomes of these processes suggest that, independent of positive charge and odd-electron distributions, cation radicals of lignins formed by SET to excited states of sensitizers or heme-iron centers in enzymes degrade selectively through bond cleavage reactions in β-1 vs β-O-4 moieties. In addition, the findings made in the enzymatic studies demonstrate that the sterically large tetrameric lignin model compounds undergo lignin peroxidase-catalyzed cleavage via a mechanism involving preliminary formation of an enzyme-substrate complex.
Philip Stewart; Daniel Cullen
1999-06-01
The lignin peroxidases of Phanerochaete chrysosporium are encoded by a minimum of 10 closely related genes. Physical and genetic mapping of a cluster of eight lip genes revealed six genes occurring in pairs and transcriptionally convergent, suggesting that portions of the lip family arose by gene duplication events. The completed sequence of 1ipG and lipJ, together...
Pozdnyakova, Natalia; Dubrovskaya, Ekaterina; Chernyshova, Marina; Makarov, Oleg; Golubev, Sergey; Balandina, Svetlana; Turkovskaya, Olga
2018-05-01
The degradation of two isomeric three-ringed polycyclic aromatic hydrocarbons by the white rot fungus Pleurotus ostreatus D1 and the litter-decomposing fungus Agaricus bisporus F-8 was studied. Despite some differences, the degradation of phenanthrene and anthracene followed the same scheme, forming quinone metabolites at the first stage. The further fate of these metabolites was determined by the composition of the ligninolytic enzyme complexes of the fungi. The quinone metabolites of phenanthrene and anthracene produced in the presence of only laccase were observed to accumulate, whereas those formed in presence of laccase and versatile peroxidase were metabolized further to form products that were further included in basal metabolism (e.g. phthalic acid). Laccase can catalyze the initial attack on the PAH molecule, which leads to the formation of quinones, and that peroxidase ensures their further oxidation, which eventually leads to PAH mineralization. A. bisporus, which produced only laccase, metabolized phenanthrene and anthracene to give the corresponding quinones as the dominant metabolites. No products of further utilization of these compounds were detected. Thus, the fungi's affiliation with different ecophysiological groups and their cultivation conditions affect the composition and dynamics of production of the ligninolytic enzyme complex and the completeness of PAH utilization. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Miki, Yuta; Pogni, Rebecca; Acebes, Sandra; Lucas, Fátima; Fernández-Fueyo, Elena; Baratto, Maria Camilla; Fernández, María I; de los Ríos, Vivian; Ruiz-Dueñas, Francisco J; Sinicropi, Adalgisa; Basosi, Riccardo; Hammel, Kenneth E; Guallar, Victor; Martínez, Angel T
2013-06-15
LiP (lignin peroxidase) from Trametopsis cervina has an exposed catalytic tyrosine residue (Tyr181) instead of the tryptophan conserved in other lignin-degrading peroxidases. Pristine LiP showed a lag period in VA (veratryl alcohol) oxidation. However, VA-LiP (LiP after treatment with H2O2 and VA) lacked this lag, and H2O2-LiP (H2O2-treated LiP) was inactive. MS analyses revealed that VA-LiP includes one VA molecule covalently bound to the side chain of Tyr181, whereas H2O2-LiP contains a hydroxylated Tyr181. No adduct is formed in the Y171N variant. Molecular docking showed that VA binding is favoured by sandwich π stacking with Tyr181 and Phe89. EPR spectroscopy after peroxide activation of the pre-treated LiPs showed protein radicals other than the tyrosine radical found in pristine LiP, which were assigned to a tyrosine-VA adduct radical in VA-LiP and a dihydroxyphenyalanine radical in H2O2-LiP. Both radicals are able to oxidize large low-redox-potential substrates, but H2O2-LiP is unable to oxidize high-redox-potential substrates. Transient-state kinetics showed that the tyrosine-VA adduct strongly promotes (>100-fold) substrate oxidation by compound II, the rate-limiting step in catalysis. The novel activation mechanism is involved in ligninolysis, as demonstrated using lignin model substrates. The present paper is the first report on autocatalytic modification, resulting in functional alteration, among class II peroxidases.
UTSI/CFFF MHD Program Completion and Related Activities.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Irvin, R.L.; Bumpus, J.A.
1997-10-31
During this reporting period we have further studied the oxidation of soluble coal macromolecules by lignin peroxidase from Phanerochaete chrysosporium. Previous studies by others have suggested that a soluble fraction (coal macromolecule B-111) from a nitric acid solubilized North Dakota Lignite is depolymerized by this enzyme. Our investigations indicate that fraction B-111 is a substrate for lignin peroxidase as this material is decolorized in the presence of lignin peroxidase H{sub 8} and hydrogen peroxide. Of interest, however, is the observation that little, if any, depolymerization of this material occurs. Instead, it appears that lignin peroxidase and coal macromolecule B-111 formmore » a precipitate. These results are similar to those observed in our investigations of lignin peroxidase mediated oxidation of oxalate solubilize coal macromolecule. Previous studies in our laboratory using a spectrophotometric assay suggested that, in addition to oxalate, several other fungal metabolites are able to solubilize leonardite. We have reinvestigated this phenomenon using a more reliable gravimetric procedure for assessing solubilization. Our results confirm our earlier findings that malate, oxaloacetate and citrate are effective solubilizing agents whereas succinate, fumarate and {alpha}-ketoglutarate solubilize relatively small amounts of leonardite. Finally, we have studied the composition of the insoluble material remaining following extensive solubilization by sodium oxalate. The ratio of hydrogen to carbon is increased in the insoluble material relative to the parent leonardite. However, the ratio of oxygen to carbon is also increased in the insoluble material. Thus, the insoluble material does not appear to be more highly reduced that the parent leonardite and is not likely to be a better fuel that the parent material.« less
Robinson, Tim; Nigam, Poonam Singh
2008-12-01
A strict screening strategy for microorganism selection was followed employing a number of white-rot fungi for the bioremediation of textile effluent, which was generated from one Ireland-based American textile industry. Finally, one fungus Bjerkandera adusta has been investigated in depth for its ability to simultaneously degrade and enrich the nutritional quality of highly coloured textile effluent-adsorbed barley husks through solid-state fermentation (SSF). Certain important parameters such as media requirements, moisture content, protein/biomass production and enzyme activities were examined in detail. A previously optimised method of dye desorption was employed to measure the extent of dye remediation through effluent decolorisation achieved as a result of fungal activity in SSF. B. adusta was capable of decolourising a considerable concentration of the synthetic dye effluent (up to 53%) with a moisture content of 80-85%. Protein enrichment of the fermented mass was achieved to the extent of 229 g/kg dry weight initial substrate used. Lignin peroxidase and laccase were found to be the two main enzymes produced during SSF of the dye-adsorbed lignocellulosic waste residue.
Isikhuemhen, Omoanghe S; Mikiashvili, Nona A; Kelkar, Vinaya
2009-06-01
The degradation and utilization of solid waste (SW) from anaerobic digestion of poultry litter by Agrocybe aegerita was evaluated through mushroom production, loss of organic matter (LOM), lignocellulolytic enzymes activity, lignocellulose degradation and mushroom nutrients content. Among the substrate combinations (SCs) tested, substrates composed of 10-20% SW, 70-80% wheat straw and 10% millet was found to produce the highest mushroom yield (770.5 and 642.9 g per 1.5 kg of substrate). LOM in all SCs tested varied between 8.8 and 48.2%. A. aegerita appears to degrade macromolecule components (0.6-21.8% lignin, 33.1-55.2% cellulose and 14-53.9% hemicellulose) during cultivation on the different SCs. Among the seven extracellular enzymes monitored, laccase, peroxidase and CMCase activities were higher before fruiting; while xylanase showed higher activities after fruiting. A source of carbohydrates (e.g., millet) in the substrate is needed in order to obtain yield and biological efficiency comparable to other commercially cultivated exotic mushrooms.
Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1
Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah
2002-01-01
Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patil, Swapnil M.; Chandanshive, Vishal V.; Rane, Niraj R.
In vitro grown untransformed adventitious roots (AR) culture of Ipomoea hederifolia and its endophytic fungus (EF) Cladosporium cladosporioides decolorized Navy Blue HE2R (NB-HE2R) at a concentration of 20 ppm up to 83.3 and 65%, respectively within 96 h. Whereas the AR-EF consortium decolorized the dye more efficiently and gave 97% removal within 36 h. Significant inductions in the enzyme activities of lignin peroxidase, tyrosinase and laccase were observed in roots, while enzymes like tyrosinase, laccase and riboflavin reductase activities were induced in EF. Metabolites of dye were analyzed using UV—vis spectroscopy, FTIR and gas chromatography-mass spectrometry. Possible metabolic pathways ofmore » NB-HE2R were proposed with AR, EF and AR-EF systems independently. Looking at the superior efficacy of AR-EF system, a rhizoreactor was developed for the treatment of NB-HE2R at a concentration of 1000 ppm. Control reactor systems with independently grown AR and EF gave 94 and 85% NB-HE2R removal, respectively within 36 h. The AR-EF rhizoreactor, however, gave 97% decolorization. The endophyte colonization additionally increased root and shoot lengths of candidate plants through mutualism. Combined bioreactor strategies can be effectively used for future eco-friendly remediation purposes. - Highlights: • Endophytic fungus on Ipomoea hederifolia promotes root growth and shoot development • Endophytic Cladosporium cladosporioides synergistically degrade Navy Blue-HE2R dye • Endophyte colonized I. hederifolia roots proved superior in dye decolorization • Dye stress and toxicity was efficiently dealt by root-endophyte consortium • Root-endophyte consortium can be used as a sustainable remediation strategy.« less
Secretome analysis of Pleurotus eryngii reveals enzymatic composition for ramie stalk degradation.
Xie, Chunliang; Luo, Wei; Li, Zhimin; Yan, Li; Zhu, Zuohua; Wang, Jing; Hu, Zhenxiu; Peng, Yuande
2016-01-01
Pleurotus eryngii (P. eryngii) can secrete large amount of hydrolytic and oxidative enzymes to degrade lignocellulosic biomass. In spite of several researches on the individual lignolytic enzymes, a direct deconstruction of lignocellulose by enzyme mixture is not yet possible. Identifying more high-performance enzymes or enzyme complexes will lead to efficient in vitro lignocelluloses degradation. In this report, secretomic analysis was used to search for the new or interesting enzymes for lignocellulose degradation. Besides, the utilization ability of P. eryngii to ramie stalk substrate was evaluated from the degradation of cellulose, hemicellulose, and lignin in medium and six extracellular enzymes activities during different growth stages were discussed. The results showed that a high biological efficiency of 71% was obtained; cellulose, hemicelluloses, and lignin decomposition rates of P. eryngii were 29.2, 26.0, and 51.2%, respectively. Enzyme activity showed that carboxymethyl cellulase, xylanase, laccase, and peroxidase activity peaks appeared at the primordial initiation stage. In addition, we profiled a global view of the secretome of P. eryngii cultivated in ramie stalk media to understand the mechanism behind lignocellulosic biomass hydrolysis. Eighty-seven nonredundant proteins were identified and a diverse group of enzymes, including cellulases, hemicellulases, pectinase, ligninase, protease, peptidases, and phosphatase implicated in lignocellulose degradation were found. In conclusion, the information in this report will be helpful to better understand the lignocelluloses degradation mechanisms of P. eryngii. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sato, Toshitsugu; Irie, Toshikazu; Yoshino, Fumihiko
2017-08-01
Lentinula edodes (shiitake), which have a powerful ligninolytic system, is one of the most important edible mushrooms in Asia. In this study, we introduced the manganese peroxidase (MnP, EC 1.11.1.13) gene from Pleurotus ostreatus driven by L. edodes laccase 1 gene promoter into L. edodes for expression. The resulting transformant expressed the recombinant gene and showed a higher level of MnP activity than that of the wild-type strain.
Arun, A; Eyini, M
2011-09-01
A total of 130 wild basidiomycetes fungi were collected and identified. The polycyclic aromatic hydrocarbons (PAHs) degradation by the potential Phellinus sp., Polyporus sulphureus (in liquid state fermentation (LSF), solid state fermentation (SSF), in soil) and lignin biodegradation were compared with those of a bacterial isolate and their corresponding cocultures. The PAHs degradation was higher in LSF and the efficiency of the organisms declined in SSF and in soil treatment. Phellinus sp. showed better degradation in SSF and in soil. Bacillus pumilus showed higher degradation in LSF. B. pumilus was seen to have lower lignin degradation than the fungal cultures and the cocultures could not enhance the degradation. Phellinus sp. which had higher PAHs and lignin degradation showed higher biosurfactant production than other organism. Manganese peroxidase (MnP) was the predominant enzyme in Phellinus sp. while lignin peroxidase (Lip) was predominant in P. sulphureus. Copyright © 2011 Elsevier Ltd. All rights reserved.
[Decolorization of skin and hair-derived melanin by three ligninolytic enzymes].
Miao, F; Lei, T C; Su, M Y; Yi, W J; Jiang, S; Xu, S Z
2017-11-21
Objective: To compare the decolorization efficiency of lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase on eumelanin and pheomelanin, and to investigate the effect of topical administration of LiP solution on hyperpigmented guinea pigs skin induced by 308 nm excimer light. Methods: Pheomelanin-enriched specimens were prepared from human hair and cutaneous melanoma tissue using alkaline lysis method.Synthetic eumelanin was purchased from a commercial supplier.The same amount (0.02%) of melanin was incubated with the equal enzyme activity (0.2 U/ml) of ligninolytic enzymes for 3 h respectively.The absorbance at 475 nm ( A (475)) in the enzyme-catalyzed solution was measured using ELISA microplate reader.The experimental hyperpigmentation model was established in the dorsal skin of brownish guinea pigs using 308 nm excimer light radiation.LiP and heat-inactivated LiP solution were topically applied at each site.Meanwhile, 3% hydroquinone and vehicle cream were used as control.The skin color (L value) was recorded using a CR-10 Minolta chromameter.Corneocytes were collected using adhesive taping method.The amount and distribution of melanin in the corneocytes and skin tissues was visualized by Fontana-Masson staining. Results: All three ligninolytic enzymes showed various degree of eumelanin and pheomelanin decolorization activity.The decolorization activity of LiP, MnP and laccase was 40%-70%, 22%-42% and 9%-21%, respectively.The similar lightening was shown in the skin treated with LiP solution and 3% hydroquinone.The amount of melanin granules in the corneocytes was 199±11 by LiP, which was less than that in untreated control (923±12) and heat-inactive control (989±13). The amount of melanin was decreased in the whole epidermis treated with hydroquinone, the epidermis thickness was increased as well. In contrast, melanin of LiP group was decreased only in the superficial epidermis, the epidermis thickness seemed to be normal. Conclusion: LiP exerts a potent decolorization activity for hair- or skin-derived pheomelanin as well as eumelanin.It remains to be further investigated whether LiP serves as a substitute for hydroquinone in skin lightening products.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yuki, Tobimatsu; Sasikumar, Elumalai; Grabber, John H.
2012-04-01
The plasticity of lignin biosynthesis should permit the inclusion of new compatible phenolic monomers, such as rosmarinic acid (RA) and analogous catechol derivatives, into cell-wall lignins that are consequently less recalcitrant to biomass processing. In vitro lignin polymerization experiments revealed that RA readily underwent peroxidase-catalyzed copolymerization with monolignols and lignin oligomers to form polymers with new benzodioxane inter-unit linkages. Incorporation of RA permitted extensive depolymerization of synthetic lignins by mild alkaline hydrolysis, presumably by cleavage of ester intra-unit linkages within RA. Copolymerization of RA with monolignols into maize cell walls by in situ peroxidases significantly enhanced alkaline lignin extractability andmore » promoted subsequent cell wall saccharification by fungal enzymes. Incorporating RA also improved cell wall saccharification by fungal enzymes and by rumen microflora even without alkaline pretreatments, possibly by modulating lignin hydrophobicity and/or limiting cell wall cross-linking. Consequently, we anticipate that bioengineering approaches for partial monolignol substitution with RA and analogous plant hydroxycinnamates would permit more efficient utilization of plant fiber for biofuels or livestock production.« less
Philip Stewart; Philip Kersten; Amber J. Vanden Wymelenberg; Jill A. Gaskell; Daniel Cullen
1992-01-01
Lignin peroxidases (LiP) of Phanerochaete chrysosporium are encoded by a family of six closely related genes. Five LiP genes have been localized to the same dimorphic chromosome. In this investigation, relative transcript levels of the LiP genes were determined. Transcripts of the LiPA, LiPB, and 0282 genes were at similar levels in both carbon-and nitrogen-limited...
Mechanism of triphenylmethane Cresol Red degradation by Trichoderma harzianum M06.
Nor, Nurafifah Mohd; Hadibarata, Tony; Zubir, Meor Mohd Fikri Ahmad; Lazim, Zainab Mat; Adnan, Liyana Amalina; Fulazzaky, Mohamad Ali
2015-11-01
Cresol Red belongs to the triphenylmethane (TPM) class of dyes which are potentially carcinogenic or mutagenic. However, very few studies on biodegradation of Cresol Red were investigated as compared to other type dyes such as azo and anthraquinone dye. The aim of this work is to evaluate triphenylmethane dye Cresol Red degradation by fungal strain isolated from the decayed wood in Johor Bahru, Malaysia. Detailed taxonomic studies identified the organisms as Trichoderma species and designated as strain Trichoderma harzianum M06. In this study, Cresol Red was decolorized up to 88% within 30 days under agitation condition by Trichoderma harzianum M06. Data analysis revealed that a pH value of 3 yielded a highest degradation rate among pH concentrations (73%), salinity concentrations of 100 g/L (73%), and a volume of 0.1 mL of Tween 80 (79%). Induction in the enzyme activities of manganese peroxidase, lignin peroxidase, laccase, 1,2- and 2,3-dioxygenase indicates their involvement in Cresol Red removal. Various analytical studies such as Thin-Layer Chromatography (TLC), UV-Vis spectrophotometer, and Gas chromatography mass spectrometry (GC-MS) confirmed the biotransformation of Cresol Red by the fungus. Two metabolites were identified in the treated medium: 2,4-dihydroxybenzoic acid (t R 7.3 min and m/z 355) and 2-hydroxybenzoic acid (t R 8.6 min and m/z 267). Based on these products, a probable pathway has been proposed for the degradation of Cresol Red by Trichoderma harzianum M06.
Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert
2015-01-01
Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652
Reactivities of various mediators and laccases with kraft pulp and lignin model compounds.
Bourbonnais, R; Paice, M G; Freiermuth, B; Bodie, E; Borneman, S
1997-12-01
Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification.
Reactivities of Various Mediators and Laccases with Kraft Pulp and Lignin Model Compounds
Bourbonnais, R.; Paice, M. G.; Freiermuth, B.; Bodie, E.; Borneman, S.
1997-01-01
Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification. PMID:16535747
Growth and laccase production kinetics of Trametes versicolor in a stirred tank reactor.
Thiruchelvam, A T; Ramsay, Juliana A
2007-03-01
White rot fungi are a promising option to treat recalcitrant organic molecules, such as lignin, polycyclic aromatic hydrocarbons, and textile dyes, because of the lignin-modifying enzymes (LMEs) they secrete. Because knowledge of the kinetic parameters is important to better design and operate bioreactors to cultivate these fungi for degradation and/or to produce LME(s), these parameters were determined using Trametes versicolor ATCC 20869 (ATCC, American Type Culture Collection) in a magnetic stir bar reactor. A complete set of kinetic data has not been previously published for this culture. Higher than previously reported growth rates with high laccase production of up to 1,385 U l(-1) occurred during growth without [Formula: see text] or glucose limitation. The maximum specific growth rate averaged 0.94 +/- 0.23 day(-1), whereas the maximum specific substrate consumption rates for glucose and ammonium were 3.37 +/- 1.16 and 0.15 +/- 0.04 day(-1), respectively. The maximum specific oxygen consumption rate was 1.63 +/- 0.36 day(-1).
Frébortová, Jitka; Novák, Ondrej; Frébort, Ivo; Jorda, Radek
2010-02-01
Hydroxamic acid 2,4-dihydroxy-7-methoxy-1,4-benzoxazin-one (DIMBOA) was isolated from maize phloem sap as a compound enhancing the degradation of isopentenyl adenine by maize cytokinin dehydrogenase (CKX), after oxidative conversion by either laccase or peroxidase. Laccase and peroxidase catalyze oxidative cleavage of DIMBOA to 4-nitrosoresorcinol-1-monomethyl ether (coniferron), which serves as a weak electron acceptor of CKX. The oxidation of DIMBOA and coniferron generates transitional free radicals that are used by CKX as effective electron acceptors. The function of free radicals in the CKX-catalyzed reaction was also verified with a stable free radical of 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid. Application of exogenous cytokinin to maize seedlings resulted in an enhanced benzoxazinoid content in maize phloem sap. The results indicate a new function for DIMBOA in the metabolism of the cytokinin group of plant hormones.
Biodegradation of Direct Blue 15 by free and immobilized Trametes versicolor.
Pazarlioglu, Nurdan Kasikara; Akkaya, Alper; Akdogan, Hatice Ardag; Gungor, Burcin
2010-07-01
To investigate biodegradability by Trametes versicolor, five structurally different direct azo-dyes--Direct Black 38, Direct Blue 15 (DB 15), Direct Orange 26, Direct Green 6, and Direct Yellow 12--were studied. The DB 15 was determined as the best biodegradable dye by this white-rot fungus. Laccase and manganese peroxidase activities were monitored with the biodegradation process; it was observed that laccase played an important role in the dye degradation, while manganese peroxidase activity could not be detected. Possible degradation products also were examined by gas chromatography-mass spectrometry, but no metabolite was detected after the degradation and/or decolorization process. To enhance performance of the fungi during the degradation, Trametes versicolor cells were immobilized in alginate beads. Then, DB 15 decolorization by immobilized Trametes versicolor was studied in a small-scale packed-bed reactor. The color removal efficiency in repeated batches was found to be 98 and 93% for 50 mg/L DB 15.
Lim, Jieyan; Sana, Barindra; Krishnan, Ranganathan; Seayad, Jayasree; Ghadessy, Farid J; Jana, Satyasankar; Ramalingam, Balamurugan
2018-02-02
The laccase-catalyzed oxidative polymerization of monomeric and dimeric lignin model compounds was carried out with oxygen as the oxidant in aqueous medium. The oligomers were characterized by using gel permeation chromatography (GPC) and matrix-assisted laser desorption ionization time-of-flight mass spectroscopy (MALDI-TOF MS) analysis. Oxidative polymerization led to the formation of oligomeric species with a number-average molecular weight (M n ) that ranged from 700 to 2300 Da with a low polydispersity index. Spectroscopic analysis provided insight into the possible modes of linkages present in the oligomers, and the oligomerization is likely to proceed through the formation of C-C linkages between phenolic aromatic rings. The oligomers were found to show good UV light absorption characteristics with high molar extinction coefficient (5000-38 000 m -1 cm -1 ) in the UV spectral region. The oligomers were blended independently with polyvinyl chloride (PVC) by using solution blending to evaluate the compatibility and UV protection ability of the oligomers. The UV/Vis transmittance spectra of the oligomer-embedded PVC films indicated that these lignin-like oligomers possessed a notable ability to block UV light. In particular, oligomers obtained from vanillyl alcohol and the dimeric lignin model were found to show good photostability in accelerated UV weathering experiments. The UV-blocking characteristics and photostability were finally compared with the commercial low-molecular-weight UV stabilizer 2,4-dihydroxybenzophenone. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Salame, Tomer M; Knop, Doriv; Levinson, Dana; Mabjeesh, Sameer J; Yarden, Oded; Hadar, Yitzhak
2014-01-01
Lignin biodegradation by white-rot fungi is pivotal to the earth's carbon cycle. Manganese peroxidases (MnPs), the most common extracellular ligninolytic peroxidases produced by white-rot fungi, are considered key in ligninolysis. Pleurotus ostreatus, the oyster mushroom, is a preferential lignin degrader occupying niches rich in lignocellulose such as decaying trees. Here, we provide direct, genetically based proof for the functional significance of MnP to P. ostreatus ligninolytic capacity under conditions mimicking its natural habitat. When grown on a natural lignocellulosic substrate of cotton stalks under solid-state culture conditions, gene and isoenzyme expression profiles of its short MnP and versatile peroxidase (VP)-encoding gene family revealed that mnp2 was predominately expressed. mnp2, encoding the versatile short MnP isoenzyme 2 was disrupted. Inactivation of mnp2 resulted in three interrelated phenotypes, relative to the wild-type strain: (i) reduction of 14% and 36% in lignin mineralization of stalks non-amended and amended with Mn(2+), respectively; (ii) marked reduction of the bioconverted lignocellulose sensitivity to subsequent bacterial hydrolyses; and (iii) decrease in fungal respiration rate. These results may serve as the basis to clarify the roles of the various types of fungal MnPs and VPs in their contribution to white-rot decay of wood and lignocellulose in various ecosystems. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Enhanced delignification of steam-pretreated poplar by a bacterial laccase
Singh, Rahul; Hu, Jinguang; Regner, Matthew R.; ...
2017-02-07
The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less
Enhanced delignification of steam-pretreated poplar by a bacterial laccase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Rahul; Hu, Jinguang; Regner, Matthew R.
The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less
Characterization of Antisense Transformed Plants Deficient in the Tobacco Anionic Peroxidase.
Lagrimini, L. M.; Gingas, V.; Finger, F.; Rothstein, S.; Liu, TTY.
1997-01-01
On the basis of the biological compounds that they metabolize, plant peroxidases have long been implicated in plant growth, cell wall biogenesis, lignification, and host defenses. Transgenic tobacco (Nicotiana tabacum L.) plants that underexpress anionic peroxidase were generated using antisense RNA. The antisense RNA was found to be specific for the anionic isoenzyme and highly effective, reducing endogenous transcript levels and total peroxidase activity by as much as 1600-fold. Antisense-transformed plants appeared normal at initial observation; however, growth studies showed that plants with reduced peroxidase activity grow taller and flower sooner than control plants. In contrast, previously transformed plants overproducing anionic peroxidase were shorter and flowered later than controls. Axillary buds were more developed in antisense-transformed plants and less developed in plants overproducing this enzyme. It was found that the lignin content in leaf, stem, and root was unchanged in antisense-transformed plants, which does not support a role for anionic peroxidase in the lignification of secondary xylem vessels. However, studies of wounded tissue show some reduction in wound-induced deposition of lignin-like polymers. The data support a possible role for tobacco anionic peroxidase in host defenses but not without a reduction in growth potential. PMID:12223765
Characterization of Antisense Transformed Plants Deficient in the Tobacco Anionic Peroxidase.
Lagrimini, L. M.; Gingas, V.; Finger, F.; Rothstein, S.; Liu, TTY.
1997-08-01
On the basis of the biological compounds that they metabolize, plant peroxidases have long been implicated in plant growth, cell wall biogenesis, lignification, and host defenses. Transgenic tobacco (Nicotiana tabacum L.) plants that underexpress anionic peroxidase were generated using antisense RNA. The antisense RNA was found to be specific for the anionic isoenzyme and highly effective, reducing endogenous transcript levels and total peroxidase activity by as much as 1600-fold. Antisense-transformed plants appeared normal at initial observation; however, growth studies showed that plants with reduced peroxidase activity grow taller and flower sooner than control plants. In contrast, previously transformed plants overproducing anionic peroxidase were shorter and flowered later than controls. Axillary buds were more developed in antisense-transformed plants and less developed in plants overproducing this enzyme. It was found that the lignin content in leaf, stem, and root was unchanged in antisense-transformed plants, which does not support a role for anionic peroxidase in the lignification of secondary xylem vessels. However, studies of wounded tissue show some reduction in wound-induced deposition of lignin-like polymers. The data support a possible role for tobacco anionic peroxidase in host defenses but not without a reduction in growth potential.
NASA Technical Reports Server (NTRS)
Blee, Kristopher A.; Choi, Joon W.; O'Connell, Ann P.; Schuch, Wolfgang; Lewis, Norman G.; Bolwell, G. Paul
2003-01-01
A tobacco peroxidase isoenzyme (TP60) was down-regulated in tobacco using an antisense strategy, this affording transformants with lignin reductions of up to 40-50% of wild type (control) plants. Significantly, both guaiacyl and syringyl levels decreased in essentially a linear manner with the reductions in lignin amounts, as determined by both thioacidolysis and nitrobenzene oxidative analyses. These data provisionally suggest that a feedback mechanism is operative in lignifying cells, which prevents build-up of monolignols should oxidative capacity for their subsequent metabolism be reduced. Prior to this study, the only known rate-limiting processes in the monolignol/lignin pathways involved that of Phe supply and the relative activities of cinnamate-4-hydroxylase/p-coumarate-3-hydroxylase, respectively. These transformants thus provide an additional experimental means in which to further dissect and delineate the factors involved in monolignol targeting to precise regions in the cell wall, and of subsequent lignin assembly. Interestingly, the lignin down-regulated tobacco phenotypes displayed no readily observable differences in overall growth and development profiles, although the vascular apparatus was modified.
Mohamad Ikubar, Mohamed Roslan; Abdul Manan, Musaalbakri; Md Salleh, Madihah; Yahya, Adibah
2018-05-01
In current practice, oil palm frond leaflets and stems are re-used for soil nutrient recycling, while the petioles are typically burned. Frond petioles have high commercialization value, attributed to high lignocellulose fiber content and abundant of juice containing free reducing sugars. Pressed petiole fiber is the subject of interest in this study for the production of lignocellulolytic enzyme. The initial characterization showed the combination of 0.125 mm frond particle size and 60% moisture content provided a surface area of 42.3 m 2 /g, porosity of 12.8%, and density of 1.2 g/cm 3 , which facilitated fungal solid-state fermentation. Among the several species of Aspergillus and Trichoderma tested, Aspergillus awamori MMS4 yielded the highest xylanase (109 IU/g) and cellulase (12 IU/g), while Trichoderma virens UKM1 yielded the highest lignin peroxidase (222 IU/g). Crude enzyme cocktail also contained various sugar residues, mainly glucose and xylose (0.1-0.4 g/L), from the hydrolysis of cellulose and hemicellulose. FT-IR analysis of the fermented petioles observed reduction in cellulose crystallinity ( I 900/1098 ), cellulose-lignin ( I 900/1511 ), and lignin-hemicellulose ( I 1511/1738 ) linkages. The study demonstrated successful bioconversion of chemically untreated frond petioles into lignin peroxidase and xylanase-rich enzyme cocktail under SSF condition.
Systems biology-guided biodesign of consolidated lignin conversion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Lu; Cheng, Yanbing; Pu, Yunqiao
Lignin is the second most abundant biopolymer on the earth, yet its utilization for fungible products is complicated by its recalcitrant nature and remains a major challenge for sustainable lignocellulosic biorefineries. In this study, we used a systems biology approach to reveal the carbon utilization pattern and lignin degradation mechanisms in a unique lignin-utilizing Pseudomonas putida strain (A514). The mechanistic study further guided the design of three functional modules to enable a consolidated lignin bioconversion route. First, P. putida A514 mobilized a dye peroxidase-based enzymatic system for lignin depolymerization. This system could be enhanced by overexpressing a secreted multifunctional dyemore » peroxidase to promote a two-fold enhancement of cell growth on insoluble kraft lignin. Second, A514 employed a variety of peripheral and central catabolism pathways to metabolize aromatic compounds, which can be optimized by overexpressing key enzymes. Third, the β-oxidation of fatty acid was up-regulated, whereas fatty acid synthesis was down-regulated when A514 was grown on lignin and vanillic acid. Therefore, the functional module for polyhydroxyalkanoate (PHA) production was designed to rechannel β-oxidation products. As a result, PHA content reached 73% per cell dry weight (CDW). Further integrating the three functional modules enhanced the production of PHA from kraft lignin and biorefinery waste. Furthermore, this study elucidated lignin conversion mechanisms in bacteria with potential industrial implications and laid out the concept for engineering a consolidated lignin conversion route.« less
Systems biology-guided biodesign of consolidated lignin conversion
Lin, Lu; Cheng, Yanbing; Pu, Yunqiao; ...
2016-07-12
Lignin is the second most abundant biopolymer on the earth, yet its utilization for fungible products is complicated by its recalcitrant nature and remains a major challenge for sustainable lignocellulosic biorefineries. In this study, we used a systems biology approach to reveal the carbon utilization pattern and lignin degradation mechanisms in a unique lignin-utilizing Pseudomonas putida strain (A514). The mechanistic study further guided the design of three functional modules to enable a consolidated lignin bioconversion route. First, P. putida A514 mobilized a dye peroxidase-based enzymatic system for lignin depolymerization. This system could be enhanced by overexpressing a secreted multifunctional dyemore » peroxidase to promote a two-fold enhancement of cell growth on insoluble kraft lignin. Second, A514 employed a variety of peripheral and central catabolism pathways to metabolize aromatic compounds, which can be optimized by overexpressing key enzymes. Third, the β-oxidation of fatty acid was up-regulated, whereas fatty acid synthesis was down-regulated when A514 was grown on lignin and vanillic acid. Therefore, the functional module for polyhydroxyalkanoate (PHA) production was designed to rechannel β-oxidation products. As a result, PHA content reached 73% per cell dry weight (CDW). Further integrating the three functional modules enhanced the production of PHA from kraft lignin and biorefinery waste. Furthermore, this study elucidated lignin conversion mechanisms in bacteria with potential industrial implications and laid out the concept for engineering a consolidated lignin conversion route.« less
Light-induced inhibition of laccase in Pycnoporus sanguineus.
Hernández, Christian A; Perroni, Yareni; Pérez, José Antonio García; Rivera, Beatriz Gutiérrez; Alarcón, Enrique
2016-03-01
The aim was to determine which specific regions of the visible light spectrum were responsible for the induction or inhibition of laccase in Pycnoporus sanguineus. Cultures were exposed to various bandwidth lights: blue (460 nm), green (525 nm), white (a combination of 460 and 560 nm), red (660 nm), and darkness. The results indicate that short wavelengths strongly inhibit the production of laccase: green (3.76 ± 1.12 U/L), blue (1.94 ± 0.36 U/L), and white (1.05 ± 0.21 U/L) in proportions of 85.8, 92.6, and 96.0%, respectively; whereas long wavelengths inhibit laccase production only partially i.e., red light (14.05 ± 4.79 U/L) in a proportion of 46.8%. Maximum activity was induced in absence of visible light (30 °C, darkness), i.e., 30.76 ± 4.0 U/L. It is concluded that the production of laccase in P. sanguineus responds to light stimuli [measured as wavelengths and lx] and that it does so inversely. This can be explained as an ecological mechanism of environmental recognition, given that P. sanguineus develops inside lignocellulose structures in conditions of darkness. The presence of short wavelength light (460-510 nm) would indicate that the organism finds itself in an external environment, unprovided of lignin, and that it is therefore unnecessary to secrete laccase. This possible new regulation in the laccase production in P. sanguineus has important biotechnological implications, for it would be possible to control the production of laccase using light stimuli.
Mechanisms of humic substances degradation by fungi
NASA Astrophysics Data System (ADS)
Chen, Y.; Hadar, Y.; Grinhut, T.
2012-04-01
Humic substances (HS) are formed by secondary synthesis reactions (humification) during the decay process and transformation of biomolecules originating from plants and other dead organisms. In nature, HS are extremely resistant to biological degradation. Thus, these substances are major components in the C cycle and in the biosphere and therefore, the understanding of the process leading to their formation and transformation and degradation is vital. Fungi active in the decomposition process of HS include mainly ascomycetes and basidiomycetes that are common in the upper layer of forest and grassland soils. Many basidiomycetes belong to the white-rot fungi (WRF) and litter-decomposing fungi (LDF). These fungi are considered to be the most efficient lignin degraders due to their nonspecific oxidizing enzymes: manganese peroxidase (MnP), lignin peroxidase (LiP) and laccase. Although bacteria dominate compost and participate in the turnover of HS, their ability to degrade stable macromolecules such as lignin and HS is limited. The overall objectives of this research were to corroborate biodegradation processes of HS by WRF. The specific objectives were: (i) To isolate, identify and characterize HS degrading WRF from biosolids (BS) compost; (ii) To study the biodegradation process of three types of HS, which differ in their structure, by WRF isolated from BS compost; and (iii) To investigate the mechanisms of HA degradation by WRF using two main approaches: (a) Study the physical and chemical analyses of the organic compounds obtained from direct fungal degradation of HA as well as elucidation of the relevant enzymatic reactions; and (b) Study the enzymatic and biochemical mechanisms involved during HA degradation. In order to study the capability of fungi to degrade HS, seventy fungal strains were isolated from biosolids (BS) compost. Two of the most active fungal species were identified based on rDNA sequences and designated Trametes sp. M23 and Phanerochaetesp., Y6. These strains were used throughout this study. This research shows that WRF are able to degrade different HA and under different culture conditions. We found that significant degradation occurred in high C/N media - conditions which are commonly present in the natural habitats of WRF. We suggest that in addition to lignin, these fungi play a crucial role during HS degradation in the environment. This work raises additional questions that are worth investigating in the future: what is the role of these fungi in dissolved organic matter degradation and its relationship to HA degradation? What is the detailed mechanism of iron reduction in Trametes sp. M23 as well as in other WRF? What is the exact involvement of hydroxyl radicals during degradation and what are the mechanisms of H2O2 production in Trametes sp. M23?
NASA Astrophysics Data System (ADS)
Yang, Dongjie; Huang, Wenjing; Qiu, Xueqing; Lou, Hongming; Qian, Yong
2017-12-01
Pine and wheat straw alkali lignin (PAL and WAL) were sulfomethylated to improve water solubility, polymerized with horseradish peroxidase (HRP) to improve the molecular weight (Mw) and applied to dope and disperse polyaniline (PANI). The structural effect of lignin from different origins on the reactivities of sulfomethylation and HRP polymerization was investigated. The results show that WAL with less methoxyl groups and lower Mw have higher reactivity in sulfomethylation (SWAL). More phenolic hydroxyl groups and lower Mw benefit the HRP polymerization of sulfomethylated PAL (SPAL). Due to the natural three-dimensional aromatic structure and introduced sulfonic groups, SPAL and SWAL could effectively dope and disperse PANI in water by π-π stacking and electrostatic interaction. HRP modified SPAL (HRP-SPAL) with much higher sulfonation degree and larger Mw significantly increased the conductivity and dispersibility of lignin/PANI composites.
Kenzom, T.; Srivastava, P.
2014-01-01
Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. PMID:25261507
Kenzom, T; Srivastava, P; Mishra, S
2014-12-01
Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes
Yitzhak Hadar; Daniel Cullen
2013-01-01
Wood decay fungi are obligate aerobes, deriving nutrients from the biological âcombustionâ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...
Polymerization reactivity of sulfomethylated alkali lignin modified with horseradish peroxidase.
Yang, Dongjie; Wu, Xiaolei; Qiu, Xueqing; Chang, Yaqi; Lou, Hongming
2014-03-01
Alkali lignin (AL) was employed as raw materials in the present study. Sulfomethylation was conducted to improve the solubility of AL, while sulfomethylated alkali lignin (SAL) was further polymerized by horseradish peroxidase (HRP). HRP modification caused a significant increase in molecular weight of SAL which was over 20 times. It was also found to increase the amount of sulfonic and carboxyl groups while decrease the amount of phenolic and methoxyl groups in SAL. The adsorption quantity of self-assembled SAL film was improved after HRP modification. Sulfonation and HRP modification were mutually promoted. The polymerization reactivity of SAL in HRP modification was increased with its sulfonation degree. Meanwhile, HRP modification facilitated SAL's radical-sulfonation reaction. Copyright © 2014. Published by Elsevier Ltd.
Cui, Songkui; Wada, Syogo; Tobimatsu, Yuki; Takeda, Yuri; Saucet, Simon B; Takano, Toshiyuki; Umezawa, Toshiaki; Shirasu, Ken; Yoshida, Satoko
2018-04-01
Parasitic plants in the family Orobanchaceae are destructive weeds of agriculture worldwide. The haustorium, an essential parasitic organ used by these plants to penetrate host tissues, is induced by host-derived phenolic compounds called haustorium-inducing factors (HIFs). The origin of HIFs remains unknown, although the structures of lignin monomers resemble that of HIFs. Lignin is a natural phenylpropanoid polymer, commonly found in secondary cell walls of vascular plants. We therefore investigated the possibility that HIFs are derived from host lignin. Various lignin-related phenolics, quinones and lignin polymers, together with nonhost and host plants that have different lignin compositions, were tested for their haustorium-inducing activity in two Orobanchaceae species, a facultative parasite, Phtheirospermum japonicum, and an obligate parasite, Striga hermonthica. Lignin-related compounds induced haustoria in P. japonicum and S. hermonthica with different specificities. High concentrations of lignin polymers induced haustorium formation. Treatment with laccase, a lignin degradation enzyme, promoted haustorium formation at low concentrations. The distinct lignin compositions of the host and nonhost plants affected haustorium induction, correlating with the response of the different parasitic plants to specific types of lignin-related compounds. Our study provides valuable insights into the important roles of lignin biosynthesis and degradation in the production of HIFs. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.
Lebrun, Jérémie D; Demont-Caulet, Nathalie; Cheviron, Nathalie; Laval, Karine; Trinsoutrot-Gattin, Isabelle; Mougin, Christian
2016-02-01
The present study investigates the effect of metals on the secretion of enzymes from 12 fungal strains maintained in liquid cultures. Hydrolases (acid phosphatase, β-glucosidase, β-galactosidase, and N-acetyl-β-glucosaminidase) and ligninolytic oxidoreductases (laccase, Mn, and lignin peroxidases) activities, as well as biomass production, were measured in culture fluids from fungi exposed to Cu or Cd. Our results showed that all fungi secreted most of the selected hydrolases and that about 50% of them produced a partial oxidative system in the absence of metals. Then, exposure of fungi to metals led to the decrease in biomass production. At the enzymatic level, Cu and Cd modified the secretion profiles of soil fungi. The response of hydrolases to metals was contrasted and complex and depended on metal, enzyme, and fungal strain considered. By contrast, the metals always stimulated the activity of ligninolytic oxidoreductases in fungal strains. In some of them, oxidoreductases were specifically produced following metal exposure. Fungal oxidoreductases provide a more generic response than hydrolases, constituting thus a physiological basis for their use as biomarkers of metal exposure in soils.
Crestini, C; D'Annibale, A; Sermanni, G G; Saladino, R
2000-02-01
Three phenolic model compounds representing bonding patterns of residual kraft lignin were incubated with manganese peroxidase from Lentinula edodes. Extensive degradation of all the phenolic models, mainly occurring via side-chain benzylic oxidation, was observed. Among the tested model compounds the diphenylmethane alpha-5 phenolic model was found to be the most reactive, yielding several products showing oxidation and fragmentation at the bridging position. The non-phenolic 5-5' biphenyl and 5-5' diphenylmethane models were found unreactive.
Report sent to NASA concerning the USU grant
NASA Technical Reports Server (NTRS)
1997-01-01
The goals of the study were to explore the effects of microgravity upon peroxidases in super dwarf wheat. The study was to explore peroxidase activities and isozyme patterns associated with different plant organs and to determine whether any changes in peroxidases in microgravity were related to altered lignin deposition or to hydrogen peroxide formation in the plant tissues.
Bacterial dye-decolorizing peroxidases: biochemical properties and biotechnological opportunities
In biorefineries, processing biomass begins with separating lignin from cellulose and hemicellulose. The latter two are depolymerized to give monosaccharides (e.g. glucose and xylose), which can be converted to fuels or chemicals. In contrast, lignin presents a challenging target...
Occurrence of lignin degradation genotypes and phenotypes among prokaryotes.
Tian, Jiang-Hao; Pourcher, Anne-Marie; Bouchez, Théodore; Gelhaye, Eric; Peu, Pascal
2014-12-01
A number of prokaryotes actively contribute to lignin degradation in nature and their activity could be of interest for many applications including the production of biogas/biofuel from lignocellulosic biomass and biopulping. This review compares the reliability and efficiency of the culture-dependent screening methods currently used for the isolation of ligninolytic prokaryotes. Isolated prokaryotes exhibiting lignin-degrading potential are presented according to their phylogenetic groups. With the development of bioinformatics, culture-independent techniques are emerging that allow larger-scale data mining for ligninolytic prokaryotic functions but today, these techniques still have some limits. In this work, two phylogenetic affiliations of isolated prokaryotes exhibiting ligninolytic potential and laccase-encoding prokaryotes were determined on the basis of 16S rDNA sequences, providing a comparative view of results obtained by the two types of screening techniques. The combination of laboratory culture and bioinformatics approaches is a promising way to explore lignin-degrading prokaryotes.
Scharf, Michael; Sethi, Amit
2016-09-13
Termites have specialized digestive systems that overcome the lignin barrier in wood to release fermentable simple sugars. Using the termite Reticulitermes flavipes and its gut symbionts, high-throughput titanium pyrosequencing and proteomics approaches experimentally compared the effects of lignin-containing diets on host-symbiont digestome composition. Proteomic investigations and functional digestive studies with recombinant lignocellulases conducted in parallel provided strong evidence of congruence at the transcription and translational levels and provide enzymatic strategies for overcoming recalcitrant lignin barriers in biofuel feedstocks. Briefly described, therefore, the disclosure provides a system for generating a fermentable product from a lignified plant material, the system comprising a cooperating series of at least two catalytically active polypeptides, where said catalytically active polypeptides are selected from the group consisting of: cellulase Cell-1, .beta.-glu cellulase, an aldo-keto-reductase, a catalase, a laccase, and an endo-xylanase.
Vivekanand, V; Dwivedi, Pallavi; Pareek, Nidhi; Singh, Rajesh P
2011-09-01
In solid-state fermentation, among various solid supports evaluated, banana peel was found to be an ideal support and resulted into higher levels of laccase (6281.4 ± 63.60 U l(-1)) along with notable levels of manganese peroxidase production (1339.0 ± 131.23 U l(-1)) by Aspergillus fumigatus VkJ2.4.5. Maximum levels of laccase was achieved under derived conditions consisting of 80% of moisture level, 6 days of incubation period, 6% inoculum level, and an aeration level of 2.5 l min(-1). A column-tray bioreactor was designed to scale up and economize the enzyme production in three successive cycles of fermentation using the same fungal biomass. Thermal and pH stability profiles revealed that enzyme was stable up to 50°C and at varying pH range from 5-9 for up to 2 h. The apparent molecular weight of laccase was found to be 34 ± 1 kDa. MALDI-TOF/TOF analysis of the protein showed significant homology with maximum identity of 67% to other laccases reported in database.
Rahmanpour, Rahman; Rea, Dean; Jamshidi, Shirin; Fülöp, Vilmos; Bugg, Timothy D H
2016-03-15
A Dyp-type peroxidase enzyme from thermophilic cellulose degrader Thermobifida fusca (TfuDyP) was investigated for catalytic ability towards lignin oxidation. TfuDyP was characterised kinetically against a range of phenolic substrates, and a compound I reaction intermediate was observed via pre-steady state kinetic analysis at λmax 404 nm. TfuDyP showed reactivity towards Kraft lignin, and was found to oxidise a β-aryl ether lignin model compound, forming an oxidised dimer. A crystal structure of TfuDyP was determined, to 1.8 Å resolution, which was found to contain a diatomic oxygen ligand bound to the heme centre, positioned close to active site residues Asp-203 and Arg-315. The structure contains two channels providing access to the heme cofactor for organic substrates and hydrogen peroxide. Site-directed mutant D203A showed no activity towards phenolic substrates, but reduced activity towards ABTS, while mutant R315Q showed no activity towards phenolic substrates, nor ABTS. Copyright © 2016 Elsevier Inc. All rights reserved.
Sitarz, Anna K; Mikkelsen, Jørn D; Højrup, Peter; Meyer, Anne S
2013-12-10
Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ∼3U/mL toward syringaldazine. This activity was 13-17 fold higher than the corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ∼62.5kDa, and a Km value of 0.107mM (determined on ABTS). A partial amino acid sequence analysis of four short de novo sequenced peptides, defined after trypsin digest analysis using MALDI-TOF MS/MS analysis, revealed 64-100% homology to sequences in related laccases in the UniProt database, but also indicated that certain sequence stretches had low homology. Addition of the laccase-rich G. lucidum broth to lignocellulosic biomass (pretreated sugar cane bagasse) together with a state-of-the-art cellulase enzyme preparation (Cellic™CTec1) produced significantly increased cellulolytic yields, which were also better than those obtained with a T. versicolor laccase addition, indicating that the laccase from G. lucidum has unique properties that may be momentous in lignocellulosic biomass conversion. Copyright © 2013 Elsevier Inc. All rights reserved.
Chenthamarakshan, Aiswarya; Parambayil, Nayana; Miziriya, Nafeesathul; Soumya, P S; Lakshmi, M S Kiran; Ramgopal, Anala; Dileep, Anuja; Nambisan, Padma
2017-02-13
Fungal laccase has profound applications in different fields of biotechnology due to its broad specificity and high redox potential. Any successful application of the enzyme requires large scale production. As laccase production is highly dependent on medium components and cultural conditions, optimization of the same is essential for efficient product production. Production of laccase by fungal strain Marasmiellus palmivorus LA1 under solid state fermentation was optimized by the Taguchi design of experiments (DOE) methodology. An orthogonal array (L8) was designed using Qualitek-4 software to study the interactions and relative influence of the seven selected factors by one factor at a time approach. The optimum condition formulated was temperature (28 °C), pH (5), galactose (0.8%w/v), cupric sulphate (3 mM), inoculum concentration (number of mycelial agar pieces) (6Nos.) and substrate length (0.05 m). Overall yield increase of 17.6 fold was obtained after optimization. Statistical optimization leads to the elimination of an insignificant medium component ammonium dihydrogen phosphate from the process and contributes to a 1.06 fold increase in enzyme production. A final production of 667.4 ± 13 IU/mL laccase activity paves way for the application of this strain for industrial applications. Study optimized lignin degrading laccases from Marasmiellus palmivorus LA1. This laccases can thus be used for further applications in different scales of production after analyzing the properties of the enzyme. Study also confirmed the use of taguchi method for optimizations of product production.
Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan
2012-01-01
Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and γ-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paice, M.G.; Reid, I.D.; Bourbonnais, R.
1993-01-01
The white rot fungus Trametes (Coriolus) versicolor delignifies and bleaches kraft pulp. However, the process is slow compared with chemical bleaching and the cellulose is also attacked. This study attempts to determine the enzymology of fungal delignification and then applies the relevant enzymes directly to the pulp. Lignin peroxidase and manganese peroxidase (MnP) have both been implicated in lignin biodegradations. However, the researchers show that MnP is the critical enzyme. It is produced by bleaching cultures of T. versicolor; its peak production occurs at the same time as the maximum rate of fungal culture bleaching, and the manganese-and peroxide-dependent demethylationmore » and delignification of kraft pulp occurs in vitro. 50 refs., 4 figs., 7 tabs.« less
Ntougias, Spyridon; Baldrian, Petr; Ehaliotis, Constantinos; Nerud, Frantisek; Antoniou, Theodoros; Merhautová, Věra; Zervakis, Georgios I
2012-07-01
Thirty-nine white-rot fungi belonging to nine species of Agaricomycotina (Basidiomycota) were initially screened for their ability to decrease olive-mill wastewater (OMW) phenolics. Four strains of Ganoderma australe, Ganoderma carnosum, Pleurotus eryngii and Pleurotus ostreatus, were selected and further examined for key-aspects of the OMW biodegradation process. Fungal growth in OMW-containing batch cultures resulted in significant decolorization (by 40-46% and 60-65% for Ganoderma and Pleurotus spp. respectively) and reduction of phenolics (by 64-67% and 74-81% for Ganoderma and Pleurotus spp. respectively). COD decrease was less pronounced (12-29%). Cress-seeds germination increased by 30-40% when OMW was treated by Pleurotus strains. Toxicity expressed as inhibition of Aliivibrio fischeri luminescence was reduced in fungal-treated OMW samples by approximately 5-15 times compared to the control. As regards the pertinent enzyme activities, laccase and Mn-independent peroxidase were detected for Ganoderma spp. during the entire incubation period. In contrast, Pleurotus spp. did not exhibit any enzyme activities at early growth stages; instead, high laccase (five times greater than those of Ganoderma spp.) and Mn peroxidases activities were determined at the end of treatment. OMW decolorization by Ganoderma strains was strongly correlated to the reduction of phenolics, whereas P. eryngii laccase activity was correlated with the effluent's decolorization. Copyright © 2012 Elsevier Ltd. All rights reserved.
Xu, Xiangqun; Xu, Zhiqi; Shi, Song; Lin, Mengmeng
2017-10-01
This study examined the white rot fungus I. obliquus on the degradation of three types of straw biomass and the production of extracellular lignocellulolytic enzymes under submerged fermentation. The fungus process resulted in a highest lignin loss of 72%, 39%, and 47% in wheat straw, rice straw, and corn stover within 12days, respectively. In merely two days, the fungus selectively degraded wheat straw lignin by 37%, with only limited cellulose degradation (13%). Fourier transform infrared spectroscopy revealed that the fungus most effectively degraded the wheat straw lignin and rice straw crystalline cellulose. Scanning electronic microscopy showed the most pronounced structural changes in wheat straw. High activities of manganese peroxidase (159.0U/mL) and lignin peroxidase (123.4U/mL) were observed in wheat straw culture on Day 2 and 4, respectively. Rice straw was the best substrate to induce the production of cellulase and xylanase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhao, Meihua; Zhang, Chaosheng; Zeng, Guangming; Huang, Danlian; Xu, Piao; Cheng, Min
2015-11-01
This study examines the growth, metabolism of Phanerochaete chrysosporium (P. chrysosporium) and route of lignin degradation in response to cadmium (Cd) stress in solid-state fermentation of rice straw. Less living fungi biomass was found under Cd exposure, suggesting that Cd had strong toxicity to P. chrysosporium. The maximum values of lignin peroxidase and manganese peroxidase were 0.34 and 5.21 U g(-1) at the Cd concentration of 32 mg kg(-1), respectively, lower than that in control, which indicated Cd stress would inhibit ligninolytic enzymes. The production of reactive oxygen species (ROS) including hydroxyl radicals (OH), superoxide anion radical (O2(-)) and hydrogen peroxide (H2O2) increased after Cd exposure. Higher concentration of oxalate was detected at high Cd concentrations. Cd stress also had influence on the rates of lignocelluloses degradation and the route of lignin degradation. Partial Cd could be removed by P. chrysosporium. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lignin biodegradation by the ascomycete Chrysonilia sitophila.
Rodríguez, J; Ferraz, A; Nogueira, R F; Ferrer, I; Esposito, E; Durán, N
1997-01-01
The lignin biodegradation process has an important role in the carbon cycle of the biosphere. The study of this natural process has developed mainly with the use of basidiomycetes in laboratory investigations. This has been a logical approach since most of the microorganisms involved in lignocellulosic degradation belong to this class of fungi. However, other microorganisms such as ascomycetes and also some bacteria, are involved in the lignin decaying process. This work focuses on lignin biodegradation by a microorganism belonging to the ascomycete class, Chrysonilia sitophila. Lignin peroxidase production and characterization, mechanisms of lignin degradation (lignin model compounds and lignin in wood matrix) and biosynthesis of veratryl alcohol are outstanding. Applications of C. sitophila for effluent treatment, wood biodegradation and single-cell protein production are also discussed.
ENHANCED ENZYMATIC REMOVAL OF CHLOROPHENOLS IN THE PRESENCE OF CO-SUBSTRATES. (R823847)
The effect of reactive co-substrates such as guaiacol and 2,6-dimethoxyphenol on the removal of chlorinated phenols by horseradish peroxidase (HRP) and a
laccase from the fungus Trametes versicolor was investigated. Addition of 50 mM guaiacol enhanced the precipitation of 4-ch...
USDA-ARS?s Scientific Manuscript database
Epigallocatechin gallate (EGCG) was evaluated as a potential lignin bioengineering target for rendering biomass more amenable to processing for biofuel production. In vitro peroxidase-catalyzed polymerization experiments revealed that both gallate and pyrogalloyl (B-ring) moieties in EGCG underwent ...
Ruiz‐Dueñas, Francisco J.; Martínez, Ángel T.
2009-01-01
Summary Lignin is the second most abundant constituent of the cell wall of vascular plants, where it protects cellulose towards hydrolytic attack by saprophytic and pathogenic microbes. Its removal represents a key step for carbon recycling in land ecosystems, as well as a central issue for industrial utilization of plant biomass. The lignin polymer is highly recalcitrant towards chemical and biological degradation due to its molecular architecture, where different non‐phenolic phenylpropanoid units form a complex three‐dimensional network linked by a variety of ether and carbon–carbon bonds. Ligninolytic microbes have developed a unique strategy to handle lignin degradation based on unspecific one‐electron oxidation of the benzenic rings in the different lignin substructures by extracellular haemperoxidases acting synergistically with peroxide‐generating oxidases. These peroxidases posses two outstanding characteristics: (i) they have unusually high redox potential due to haem pocket architecture that enables oxidation of non‐phenolic aromatic rings, and (ii) they are able to generate a protein oxidizer by electron transfer to the haem cofactor forming a catalytic tryptophanyl‐free radical at the protein surface, where it can interact with the bulky lignin polymer. The structure–function information currently available is being used to build tailor‐made peroxidases and other oxidoreductases as industrial biocatalysts. PMID:21261911
[Degradation of anthraquinone blue by Trametes trogii].
Levin, L; Jordan, A; Forchiassin, F; Viale, A
2001-01-01
The ability of the white rot fungus Trametes trogii BAFC 463 (high producer of ligninolytic enzymes, especially laccase and manganese peroxidase) to degrade the dye anthraquinone blue, refractory to bacterial attack, was evaluated. Both tropho- and idiophasic T. trogii cultures in synthetic medium (glucose/asparagine) and complex medium (malt extract/glucose) were able to transform up to 88% dye in 4 hours. The activity of laccase, an oxygen-dependent phenoloxidase which was present at high levels in all the conditions assayed, might be related to the ability of the fungus to degrade the colorant. This is supported by the fact that in bioreactor experiences carried out at pH 4.5 the addition of anthraquinone blue caused a decrease in the levels of soluble oxygen. However, although high levels of laccase were produced at pH 7.5, the enzyme was not active, and neither dye transformation nor loss in the levels of soluble oxygen were quantified.
Snajdr, J; Baldrian, P
2007-01-01
Enzyme activity was determined in cultures of Pleurotus ostreatus and Trametes versicolor with cellulose as a sole C source and high C/N ratio. The fungi were able to grow and produce laccase and Mn-peroxidase (MnP) at 5-35 degrees C, the highest production being recorded at 25-30 degrees C in P. ostreatus and at 35 degrees C in T. versicolor. Production of both enzymes at 10 degrees C accounted only for 4-20% of the maximum value. Temperature optima for enzyme activity were 50 and 55 degrees C for P. ostreatus and T. versicolor laccases, respectively, and 60 degrees C for MnP. Temperatures causing 50% loss of activity after 24 h were 32 and 47 degrees C for laccases and 36 and 30 degrees C for MnP from P. ostreatus and T. versicolor, respectively.
Chracterization of class III peroxidases from switchgrass
USDA-ARS?s Scientific Manuscript database
Class III peroxidases (CIIIPRX) catalyze the oxidation of monolignols, generate radicals, and ultimately lead to the formation of lignin. In general, CIIIPRX genes encode a large number of isozymes with ranges of in vitro substrate specificities. In order to elucidate the mode of substrate specifici...
Natural Hypolignification Is Associated with Extensive Oligolignol Accumulation in Flax Stems1[C][W
Huis, Rudy; Morreel, Kris; Fliniaux, Ophélie; Lucau-Danila, Anca; Fénart, Stéphane; Grec, Sébastien; Neutelings, Godfrey; Chabbert, Brigitte; Mesnard, François; Boerjan, Wout; Hawkins, Simon
2012-01-01
Flax (Linum usitatissimum) stems contain cells showing contrasting cell wall structure: lignified in inner stem xylem tissue and hypolignified in outer stem bast fibers. We hypothesized that stem hypolignification should be associated with extensive phenolic accumulation and used metabolomics and transcriptomics to characterize these two tissues. 1H nuclear magnetic resonance clearly distinguished inner and outer stem tissues and identified different primary and secondary metabolites, including coniferin and p-coumaryl alcohol glucoside. Ultrahigh-performance liquid chromatography-Fourier transform ion cyclotron resonance-mass spectrometry aromatic profiling (lignomics) identified 81 phenolic compounds, of which 65 were identified, to our knowledge, for the first time in flax and 11 for the first time in higher plants. Both aglycone forms and glycosides of monolignols, lignin oligomers, and (neo)lignans were identified in both inner and outer stem tissues, with a preponderance of glycosides in the hypolignified outer stem, indicating the existence of a complex monolignol metabolism. The presence of coniferin-containing secondary metabolites suggested that coniferyl alcohol, in addition to being used in lignin and (neo)lignan formation, was also utilized in a third, partially uncharacterized metabolic pathway. Hypolignification of bast fibers in outer stem tissues was correlated with the low transcript abundance of monolignol biosynthetic genes, laccase genes, and certain peroxidase genes, suggesting that flax hypolignification is transcriptionally regulated. Transcripts of the key lignan genes Pinoresinol-Lariciresinol Reductase and Phenylcoumaran Benzylic Ether Reductase were also highly abundant in flax inner stem tissues. Expression profiling allowed the identification of NAC (NAM, ATAF1/2, CUC2) and MYB transcription factors that are likely involved in regulating both monolignol production and polymerization as well as (neo)lignan production. PMID:22331411
Kutsuki, H; Higuchi, T
1981-07-01
The activities of the following five enzymes which are involved in the formation of lignin have been compared in reaction wood and in opposite wood: phenylalanine ammonia lyase (EC 4.3.1.5), caffeate 3-O-methyltransferase (EC 2.1.1.-), p-hydroxycinnamate: CoA ligase (EC 6.2.1.12), cinnamyl alcohol dehydrogenase (EC 1.1.1.-) and peroxidase (EC 1.11.1.7). The activities of the four first-named enzymes in the compression wood of Thuja orientalis L. and Metasequoia glyptostroboides Hu et Cheng were 2.8±1.4-fold and 2.6±1.5-fold higher than those in opposite wood, respectively, whereas peroxidase had the same level of activity in either type of wood. On the other hand, no differences were observed in the activities of the five enzymes between tension and opposite woods of Robinia pseudoacacia L. These findings are well in accord with the chemical structure of lignin in the compression and tension woods of the three species studied: high content of lignin rich in condensed units in compression wood, and little difference in lignin between tension and opposite woods.
Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P
2011-10-01
Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.
2016-01-01
degradation of poly- and perfluoroalkyl compounds (PFCs), and potentially other water contaminants, without the need for repeated bioaugmentation with...active cultures or stimulation with nutrients. We designed a single-step method for encapsulating lignin peroxidases (LiP), manganese peroxidases (MnP
Salony; Mishra, S; Bisaria, V S
2006-08-01
Many fungi (particularly the white rot) are well suited for treatment of a broad range of textile dye effluents due to the versatility of the lignin-degrading enzymes produced by them. We have investigated decolourization of a number of recalcitrant reactive azo and acid dyes using the culture filtrate and purified laccase from the fungus Cyathus bulleri. For this, the enzyme was purified from the culture filtrate to a high specific activity of 4,022 IU mg(-1) protein, produced under optimized carbon, nitrogen and C/N ratio with induction by 2,6-dimethylaniline. The protein was characterized as a monomer of 58+/-5.0 kDa with carbohydrate content of 16% and was found to contain all three Cu(II) centres. The three internal peptide sequences showed sequence identity (80-92%) with laccases of a number of white rot fungi. Substrate specificity indicated highest catalytic efficiency (k(cat)/K(M)) on guaiacol followed by 2,2'-azino-bis(3-ethylthiazoline-6-sulfonic acid) (ABTS). Decolourization of a number of reactive azo and acid dyes was seen with the culture filtrate of the fungus containing predominantly laccase. In spite of no observable effect of purified laccase on other dyes, the ability to decolourize these was achieved in the presence of the redox mediator ABTS, with 50% decolourization in 0.5-5.4 days.
Screening and production of ligninolytic enzyme by a marine-derived fungal Pestalotiopsis sp. J63.
Chen, Hui-Ying; Xue, Dong-Sheng; Feng, Xiao-Yu; Yao, Shan-Jing
2011-12-01
Marine-derived fungi are prone to produce structurally unique secondary metabolites, a considerable number of which display the promising biological properties and/or industrial applications. Among those, ligninolytic enzymes have attracted great interest in recent years. In this work, about 20 strains were isolated from sea mud samples collected in the East China Sea and then screened for their capacity to produce lignin-degrading enzymes. The results showed that a strain, named J63, had a great potential to secrete a considerable amount of laccase. Using molecular method, it was identified as an endophytic fungus, Pestalotiopsis sp. which was rarely reported as ligninolytic enzyme producer in the literature. The production of laccase by Pestalotiopsis sp. J63 was investigated under submerged fermentation (SF) and solid state fermentation (SSF) with various lignocellulosic by-products as substrates. The SSF of rice straw powder accumulated the highest level of laccase activity (10,700 IU/g substrate), whereas the SF of untreated sugarcane bagasse provided the maximum amount of laccase activity (2,000 IU/ml). The value was far higher than those reported by other reports. In addition, it produced 0.11 U/ml cellulase when alkaline-pretreated sugarcane bagasse was used as growth substrate under SF. Meanwhile, the growth of fungi and laccase production under different salinity conditions were also studied. It appeared to be a moderately halo-tolerant organism.
Ardao, Inés; Magnin, Delphine; Agathos, Spiros N
2015-10-01
Microbial laccases are powerful enzymes capable of degrading lignin and other recalcitrant compounds including endocrine disrupting chemicals (EDCs). Efficient EDC removal on an industrial scale requires robust, stable, easy to handle and cost-effective immobilized biocatalysts. In this direction, magnetic biocatalysts are attractive due to their easy separation through an external magnetic field. Recently, a bioinspired immobilization technique that mimics the natural biomineralization reactions in diatoms has emerged as a fast and versatile tool for generating robust, cheap, and highly stable (nano) biocatalysts. In this work, bioinspired formation of a biotitania matrix is triggered on the surface of magnetic particles in the presence of laccase in order to produce laccase-biotitania (lac-bioTiO2 ) biocatalysts suitable for environmental applications using a novel, fast and versatile enzyme entrapment technique. Highly active lac-bioTiO2 particles have been produced and the effect of different parameters (enzyme loading, titania precursor concentration, pH, duration of the biotitania formation, and laccase adsorption steps) on the apparent activity yield of these biocatalysts were evaluated, the concentration of the titania precursor being the most influential. The lac-bioTiO2 particles were able to catalyze the removal of bisphenol A, 17α-ethinylestradiol and diclofenac in a mixture of six model EDCs and retained 90% of activity after five reaction cycles and 60% after 10 cycles. © 2015 Wiley Periodicals, Inc.
Degradation of polyethylene by Trichoderma harzianum--SEM, FTIR, and NMR analyses.
Sowmya, H V; Ramalingappa; Krishnappa, M; Thippeswamy, B
2014-10-01
Trichoderma harzianum was isolated from local dumpsites of Shivamogga District for use in the biodegradation of polyethylene. Soil sample of that dumpsite was used for isolation of T. harzianum. Degradation was carried out using autoclaved, UV-treated, and surface-sterilized polyethylene. Degradation was monitored by observing weight loss and changes in physical structure by scanning electron microscopy, Fourier transform infrared spectroscopy, and nuclear magnetic resonance spectroscopy. T. harzianum was able to degrade treated polyethylene (40%) more efficiently than autoclaved (23%) and surface-sterilized polyethylene (13%). Enzymes responsible for polyethylene degradation were screened from T. harzianum and were identified as laccase and manganese peroxidase. These enzymes were produced in large amount, and their activity was calculated using spectrophotometric method and crude extraction of enzymes was carried out. Molecular weight of laccase was determined as 88 kDa and that of manganese peroxidase was 55 kDa. The capacity of crude enzymes to degrade polyethylene was also determined. By observing these results, we can conclude that this organism may act as solution for the problem caused by polyethylene in nature.
2013-01-01
Armillaria mellea is a major plant pathogen. Yet, no large-scale “-omics” data are available to enable new studies, and limited experimental models are available to investigate basidiomycete pathogenicity. Here we reveal that the A. mellea genome comprises 58.35 Mb, contains 14473 gene models, of average length 1575 bp (4.72 introns/gene). Tandem mass spectrometry identified 921 mycelial (n = 629 unique) and secreted (n = 183 unique) proteins. Almost 100 mycelial proteins were either species-specific or previously unidentified at the protein level. A number of proteins (n = 111) was detected in both mycelia and culture supernatant extracts. Signal sequence occurrence was 4-fold greater for secreted (50.2%) compared to mycelial (12%) proteins. Analyses revealed a rich reservoir of carbohydrate degrading enzymes, laccases, and lignin peroxidases in the A. mellea proteome, reminiscent of both basidiomycete and ascomycete glycodegradative arsenals. We discovered that A. mellea exhibits a specific killing effect against Candida albicans during coculture. Proteomic investigation of this interaction revealed the unique expression of defensive and potentially offensive A. mellea proteins (n = 30). Overall, our data reveal new insights into the origin of basidiomycete virulence and we present a new model system for further studies aimed at deciphering fungal pathogenic mechanisms. PMID:23656496
Endophytic fungi: expanding the arsenal of industrial enzyme producers.
Corrêa, Rúbia Carvalho Gomes; Rhoden, Sandro Augusto; Mota, Thatiane Rodrigues; Azevedo, João Lúcio; Pamphile, João Alencar; de Souza, Cristina Giatti Marques; Polizeli, Maria de Lourdes Teixeira de Moraes; Bracht, Adelar; Peralta, Rosane Marina
2014-10-01
Endophytic fungi, mostly belonging to the Ascomycota, are found in the intercellular spaces of the aerial plant parts, particularly in leaf sheaths, sometimes even within the bark and root system without inducing any visual symptoms of their presence. These fungi appear to have a capacity to produce a wide range of enzymes and secondary metabolites exhibiting a variety of biological activities. However, they have been only barely exploited as sources of enzymes of industrial interest. This review emphasizes the suitability and possible advantages of including the endophytic fungi in the screening of new enzyme producing organisms as well as in studies aiming to optimize the production of enzymes through well-known culture processes. Apparently endophytic fungi possess the two types of extracellular enzymatic systems necessary to degrade the vegetal biomass: (1) the hydrolytic system responsible for polysaccharide degradation consisting mainly in xylanases and cellulases; and (2) the unique oxidative ligninolytic system, which degrades lignin and opens phenyl rings, comprises mainly laccases, ligninases and peroxidases. The obvious ability of endophytic fungi to degrade the complex structure of lignocellulose makes them useful in the exploration of the lignocellulosic biomass for the production of fuel ethanol and other value-added commodity chemicals. In addition to this, endophytic fungi may become new sources of industrially useful enzymes such as lipases, amylases and proteases.
Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez
2014-01-01
Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...
Xu, Jianzhong; Zhang, Junlan; Zhang, Weiguo; Hu, Kaihui
2012-08-01
Laccase has been proved important in decolorization of Remazol Brilliant Blue R (RBBR), oxidation of 2, 2'-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, lignin degradation and fruiting-body formation. The decolorization of RBBR by laccase was firstly used to screen protoplast fusants. Fusants were obtained by protoplast fusion between the strains of Hypsizigus marmoreus and Clitocybe maxima, and two fusants (IM1 and IIIM5) were screened on PDA medium containing RBBR. These fusants were significant higher in laccase activity than H. marmoreus, nearly 413 and 395 times, respectively. Their hyphal growth rates were also remarkable higher than H. marmoreus, nearly 1.5 and 1.4 times, respectively. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis showed these fusants contained the laccase, and the molecular mass of the laccase was consistent with the laccase of C. maxima, nearly 62 kDa. The pileus color of the IM1 and IIIM5 also showed partial recombined characteristics comparing to the parental strains, while biological efficiency ratios were prominent higher than that of H. marmoreus, up to 14.58 and 10.87 %, respectively. Randomly amplified polymorphic DNA bands of fusants not only were similar to parental bands, but presented new non-parental bands. Using the Unweighted pair-group method together with mathematic averages method to gain a dendrogram, in which the fusants showed intra-cluster variations. Significantly, H. marmoreus was the dominant parent, while C. maxima were distant from the fusants. The differences among IM1, IIIM5 and H. marmoreus, and the similarities among IM1, IIIM5 and C. maxima indicated IM1 and IIIM5 were somatic hybrids of H. marmoreus and C. maxima. Accordingly, it is feasible to use laccase to screen fusants of H. marmoreus and C. maxima.
Ruiz-Dueñas, Francisco J; Martínez, Angel T
2009-03-01
Lignin is the second most abundant constituent of the cell wall of vascular plants, where it protects cellulose towards hydrolytic attack by saprophytic and pathogenic microbes. Its removal represents a key step for carbon recycling in land ecosystems, as well as a central issue for industrial utilization of plant biomass. The lignin polymer is highly recalcitrant towards chemical and biological degradation due to its molecular architecture, where different non-phenolic phenylpropanoid units form a complex three-dimensional network linked by a variety of ether and carbon-carbon bonds. Ligninolytic microbes have developed a unique strategy to handle lignin degradation based on unspecific one-electron oxidation of the benzenic rings in the different lignin substructures by extracellular haemperoxidases acting synergistically with peroxide-generating oxidases. These peroxidases poses two outstanding characteristics: (i) they have unusually high redox potential due to haem pocket architecture that enables oxidation of non-phenolic aromatic rings, and (ii) they are able to generate a protein oxidizer by electron transfer to the haem cofactor forming a catalytic tryptophanyl-free radical at the protein surface, where it can interact with the bulky lignin polymer. The structure-function information currently available is being used to build tailor-made peroxidases and other oxidoreductases as industrial biocatalysts. © 2009 The Authors. Journal compilation © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.
Novo-Uzal, Esther; Gutiérrez, Jorge; Martínez-Cortés, Teresa; Pomar, Federico
2014-10-01
Peroxidase isoenzymes play diverse roles in plant physiology, such as lignification and defence against pathogens. The actions and regulation of many peroxidases are not known with much accuracy. A number of studies have reported direct involvement of peroxidase isoenzymes in the oxidation of monolignols, which constitutes the last step in the lignin biosynthesis pathway. However, most of the available data concern only peroxidases and lignins from angiosperms. This study describes the molecular cloning of two novel peroxidases from the 'living fossil' Ginkgo biloba and their regulation by salt stress and salicylic acid. Suspension cell cultures were used to purify peroxidases and to obtain the cDNAs. Treatments with salicylic acid and sodium chloride were performed and peroxidase activity and gene expression were monitored. A novel peroxidase was purified, which preferentially used p-hydroxycinnamyl alcohols as substrates and was able to form dehydrogenation polymers in vitro from coniferyl and sinapyl alcohols. Two peroxidase full-length cDNAs, GbPrx09 and GbPrx10, were cloned. Both peroxidases showed high similarity to other basic peroxidases with a putative role in cell wall lignification. Both GbPrx09 and GbPrx10 were expressed in leaves and stems of the plant. Sodium chloride enhanced the gene expression of GbPrx09 but repressed GbPrx10, whereas salicylic acid strongly repressed both GbPrx09 and GbPrx10. Taken together, the data suggest the participation of GbPrx09 and GbPrx10 in the developmental lignification programme of the cell wall. Both peroxidases possess the structural characteristics necessary for sinapyl alcohol oxidation. Moreover, GbPrx09 is also involved in lignification induced by salt stress, while salicylic acid-mediated lignification is not a result of GbPrx09 and GbPrx10 enzymatic activity. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Peroxyl radicals are potential agents of lignin biodegradation
Alexander N. Kapich; Kenneth A. Jensen; Kenneth E. Hammel
1999-01-01
Past work has shown that the extracellular manganese- dependent peroxidases (MnPs) of ligninolytic fungi degrade the principal non-phenolic structures of lignin when they peroxidize unsaturated fatty acids. This reaction is likely to be relevant to ligninolysis in sound wood, where enzymes cannot penetrate, only if it employs a small, diffusible lipid radical as the...
Engineering Ligninolytic Consortium for Bioconversion of Lignocelluloses to Ethanol and Chemicals.
Bilal, Muhammad; Nawaz, Muhammad Zohaib; Iqbal, Hafiz M N; Hou, Jialin; Mahboob, Shahid; Al-Ghanim, Khalid A; Cheng, Hairong
2018-01-01
Rising environmental concerns and recent global scenario of cleaner production and consumption are leading to the design of green industrial processes to produce alternative fuels and chemicals. Although bioethanol is one of the most promising and eco-friendly alternatives to fossil fuels yet its production from food and feed has received much negative criticism. The main objective of this study was to present the noteworthy potentialities of lignocellulosic biomass as an enormous and renewable biological resource. The particular focus was also given on engineering ligninolytic consortium for bioconversion of lignocelluloses to ethanol and chemicals on sustainable and environmentally basis. Herein, an effort has been made to extensively review, analyze and compile salient information related to the topic of interest. Several authentic bibliographic databases including PubMed, Scopus, Elsevier, Springer, Bentham Science and other scientific databases were searched with utmost care, and inclusion/ exclusion criterion was adopted to appraise the quality of retrieved peer-reviewed research literature. Bioethanol production from lignocellulosic biomass can largely satisfy the possible inconsistency of first-generation ethanol since it utilizes inedible lignocellulosic feedstocks, primarily sourced from agriculture and forestry wastes. Two major polysaccharides in lignocellulosic biomass namely, cellulose and hemicellulose constitute a complex lignocellulosic network by connecting with lignin, which is highly recalcitrant to depolymerization. Several attempts have been made to reduce the cost involved in the process through improving the pretreatment process. While, the ligninolytic enzymes of white rot fungi (WRF) including laccase, lignin peroxidase (LiP), and manganese peroxidase (MnP) have appeared as versatile biocatalysts for delignification of several lignocellulosic residues. The first part of the review is mainly focused on engineering ligninolytic consortium. In the second part, WRF and its unique ligninolytic enzyme-based bio-delignification of lignocellulosic biomass, enzymatic hydrolysis, and fermentation of hydrolyzed feedstock are discussed. The metabolic engineering, enzymatic engineering, synthetic biology aspects for ethanol production and platform chemicals production are comprehensively reviewed in the third part. Towards the end information is also given on futuristic viewpoints. In conclusion, given the present unpredicted scenario of energy and fuel crisis accompanied by global warming, lignocellulosic bioethanol holds great promise as an alternative to petroleum. Apart from bioethanol, the simultaneous production of other value-added products may improve the economics of lignocellulosic bioethanol bioconversion process. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Touahar, Imad E; Haroune, Lounès; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert
2014-05-15
In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60°C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. Copyright © 2014 Elsevier B.V. All rights reserved.
Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.
Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher
2008-07-01
Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.
Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.
Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C
2008-07-01
The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.
Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity
Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael
2014-01-01
Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755
Elisashvili, Vladimir; Kachlishvili, Eva; Penninckx, Michel
2008-11-01
The exploration of seven physiologically different white rot fungi potential to produce cellulase, xylanase, laccase, and manganese peroxidase (MnP) showed that the enzyme yield and their ratio in enzyme preparations significantly depends on the fungus species, lignocellulosic growth substrate, and cultivation method. The fruit residues were appropriate growth substrates for the production of hydrolytic enzymes and laccase. The highest endoglucanase (111 U ml(-1)) and xylanase (135 U ml(-1)) activities were revealed in submerged fermentation (SF) of banana peels by Pycnoporus coccineus. In the same cultivation conditions Cerrena maxima accumulated the highest level of laccase activity (7,620 U l(-1)). The lignified materials (wheat straw and tree leaves) appeared to be appropriate for the MnP secretion by majority basidiomycetes. With few exceptions, SF favored to hydrolases and laccase production by fungi tested whereas SSF was appropriate for the MnP accumulation. Thus, the Coriolopsis polyzona hydrolases activity increased more than threefold, while laccase yield increased 15-fold when tree leaves were undergone to SF instead SSF. The supplementation of nitrogen to the control medium seemed to have a negative effect on all enzyme production in SSF of wheat straw and tree leaves by Pleurotus ostreatus. In SF peptone and ammonium containing salts significantly increased C. polyzona and Trametes versicolor hydrolases and laccase yields. However, in most cases the supplementation of media with additional nitrogen lowered the fungi specific enzyme activities. Especially strong repression of T. versicolor MnP production was revealed.
Bacterial dye-decolorizing peroxidases: biochemical ...
In biorefineries, processing biomass begins with separating lignin from cellulose and hemicellulose. The latter two are depolymerized to give monosaccharides (e.g. glucose and xylose), which can be converted to fuels or chemicals. In contrast, lignin presents a challenging target for further processing due to its inherent heterogeneity and recalcitrance. Therefore, it has only been used in low-value applications. For example, lignin is burnt to recover energy in cellulosic ethanol production. Valorization of lignin is critical for biorefineries as it may generate high revenue. Lignin is the obvious candidate to provide renewable aromatic chemicals. As long as it can be depolymerized, the phenylpropane units can be converted into useful phenolic chemicals, which are currently derived from fossil fuels. This is a survey of an emerging group of enzymes that may have applications in lignin valorization.
The Paleozoic origin of enzymatic lignin decomposition reconstructed from 31 fungal genomes.
Floudas, Dimitrios; Binder, Manfred; Riley, Robert; Barry, Kerrie; Blanchette, Robert A; Henrissat, Bernard; Martínez, Angel T; Otillar, Robert; Spatafora, Joseph W; Yadav, Jagjit S; Aerts, Andrea; Benoit, Isabelle; Boyd, Alex; Carlson, Alexis; Copeland, Alex; Coutinho, Pedro M; de Vries, Ronald P; Ferreira, Patricia; Findley, Keisha; Foster, Brian; Gaskell, Jill; Glotzer, Dylan; Górecki, Paweł; Heitman, Joseph; Hesse, Cedar; Hori, Chiaki; Igarashi, Kiyohiko; Jurgens, Joel A; Kallen, Nathan; Kersten, Phil; Kohler, Annegret; Kües, Ursula; Kumar, T K Arun; Kuo, Alan; LaButti, Kurt; Larrondo, Luis F; Lindquist, Erika; Ling, Albee; Lombard, Vincent; Lucas, Susan; Lundell, Taina; Martin, Rachael; McLaughlin, David J; Morgenstern, Ingo; Morin, Emanuelle; Murat, Claude; Nagy, Laszlo G; Nolan, Matt; Ohm, Robin A; Patyshakuliyeva, Aleksandrina; Rokas, Antonis; Ruiz-Dueñas, Francisco J; Sabat, Grzegorz; Salamov, Asaf; Samejima, Masahiro; Schmutz, Jeremy; Slot, Jason C; St John, Franz; Stenlid, Jan; Sun, Hui; Sun, Sheng; Syed, Khajamohiddin; Tsang, Adrian; Wiebenga, Ad; Young, Darcy; Pisabarro, Antonio; Eastwood, Daniel C; Martin, Francis; Cullen, Dan; Grigoriev, Igor V; Hibbett, David S
2012-06-29
Wood is a major pool of organic carbon that is highly resistant to decay, owing largely to the presence of lignin. The only organisms capable of substantial lignin decay are white rot fungi in the Agaricomycetes, which also contains non-lignin-degrading brown rot and ectomycorrhizal species. Comparative analyses of 31 fungal genomes (12 generated for this study) suggest that lignin-degrading peroxidases expanded in the lineage leading to the ancestor of the Agaricomycetes, which is reconstructed as a white rot species, and then contracted in parallel lineages leading to brown rot and mycorrhizal species. Molecular clock analyses suggest that the origin of lignin degradation might have coincided with the sharp decrease in the rate of organic carbon burial around the end of the Carboniferous period.
Compounds inhibiting the bioconversion of hydrothermally pretreated lignocellulose.
Ko, Ja Kyong; Um, Youngsoon; Park, Yong-Cheol; Seo, Jin-Ho; Kim, Kyoung Heon
2015-05-01
Hydrothermal pretreatment using liquid hot water, steam explosion, or dilute acids enhances the enzymatic digestibility of cellulose by altering the chemical and/or physical structures of lignocellulosic biomass. However, compounds that inhibit both enzymes and microbial activity, including lignin-derived phenolics, soluble sugars, furan aldehydes, and weak acids, are also generated during pretreatment. Insoluble lignin, which predominantly remains within the pretreated solids, also acts as a significant inhibitor of cellulases during hydrolysis of cellulose. Exposed lignin, which is modified to be more recalcitrant to enzymes during pretreatment, adsorbs cellulase nonproductively and reduces the availability of active cellulase for hydrolysis of cellulose. Similarly, lignin-derived phenolics inhibit or deactivate cellulase and β-glucosidase via irreversible binding or precipitation. Meanwhile, the performance of fermenting microorganisms is negatively affected by phenolics, sugar degradation products, and weak acids. This review describes the current knowledge regarding the contributions of inhibitors present in whole pretreatment slurries to the enzymatic hydrolysis of cellulose and fermentation. Furthermore, we discuss various biological strategies to mitigate the effects of these inhibitors on enzymatic and microbial activity to improve the lignocellulose-to-biofuel process robustness. While the inhibitory effect of lignin on enzymes can be relieved through the use of lignin blockers and by genetically engineering the structure of lignin or of cellulase itself, soluble inhibitors, including phenolics, furan aldehydes, and weak acids, can be detoxified by microorganisms or laccase.
NASA Astrophysics Data System (ADS)
Patel, Sanjay K. S.; Choi, Seung Ho; Kang, Yun Chan; Lee, Jung-Kul
2016-03-01
Multiple-shelled Fe2O3 yolk-shell particles were synthesized using the spray drying method and intended as a suitable support for the immobilization of commercial enzymes such as glucose oxidase (GOx), horseradish peroxidase (HRP), and laccase as model enzymes. Yolk-shell particles have an average diameter of 1-3 μm with pore diameters in the range of 16 to 28 nm. The maximum immobilization of GOx, HRP, and laccase resulted in the enzyme loading of 292, 307 and 398 mg per g of support, respectively. After cross-linking of immobilized laccase by glutaraldehyde, immobilization efficiency was improved from 83.5% to 90.2%. Km and Vmax values were 41.5 μM and 1722 μmol min-1 per mg protein for cross-linked laccase and those for free laccase were 29.3 μM and 1890 μmol min-1 per mg protein, respectively. The thermal stability of the enzyme was enhanced up to 18-fold upon cross-linking, and the enzyme retained 93.1% of residual activity after ten cycles of reuse. The immobilized enzyme has shown up to 32-fold higher stability than the free enzyme towards different solvents and it showed higher efficiency than free laccase in the decolorization of dyes and degradation of bisphenol A. The synthesized yolk-shell particles have 3-fold higher enzyme loading efficiency and lower acute toxicity than the commercial Fe2O3 spherical particles. Therefore, the use of unique yolk-shell structure Fe2O3 particles with multiple-shells will be promising for the immobilization of various enzymes in biotechnological applications with improved electrochemical properties. To the best of our knowledge, this is the first report on the use of one pot synthesized Fe2O3 yolk-shell structure particles for the immobilization of enzymes.Multiple-shelled Fe2O3 yolk-shell particles were synthesized using the spray drying method and intended as a suitable support for the immobilization of commercial enzymes such as glucose oxidase (GOx), horseradish peroxidase (HRP), and laccase as model enzymes. Yolk-shell particles have an average diameter of 1-3 μm with pore diameters in the range of 16 to 28 nm. The maximum immobilization of GOx, HRP, and laccase resulted in the enzyme loading of 292, 307 and 398 mg per g of support, respectively. After cross-linking of immobilized laccase by glutaraldehyde, immobilization efficiency was improved from 83.5% to 90.2%. Km and Vmax values were 41.5 μM and 1722 μmol min-1 per mg protein for cross-linked laccase and those for free laccase were 29.3 μM and 1890 μmol min-1 per mg protein, respectively. The thermal stability of the enzyme was enhanced up to 18-fold upon cross-linking, and the enzyme retained 93.1% of residual activity after ten cycles of reuse. The immobilized enzyme has shown up to 32-fold higher stability than the free enzyme towards different solvents and it showed higher efficiency than free laccase in the decolorization of dyes and degradation of bisphenol A. The synthesized yolk-shell particles have 3-fold higher enzyme loading efficiency and lower acute toxicity than the commercial Fe2O3 spherical particles. Therefore, the use of unique yolk-shell structure Fe2O3 particles with multiple-shells will be promising for the immobilization of various enzymes in biotechnological applications with improved electrochemical properties. To the best of our knowledge, this is the first report on the use of one pot synthesized Fe2O3 yolk-shell structure particles for the immobilization of enzymes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00346j
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu Qinghua; Fu Yingjuan; Gao Yang
2009-05-15
Performance and efficiency of old newspaper (ONP) deinking by combining cellulase/hemicellulase with laccase-violuric acid system (LVS) were investigated in this study. Brightness, effective residual ink concentration (ERIC) and physical properties were evaluated for the deinked pulp. Fiber length, coarseness, specific surface area and specific volume were also tested. The changes of dissolved lignin during the deinking processes were measured with UV spectroscopy. The fiber morphology was observed with environmental scanning electronic microscopy (ESEM). Experimental results showed that, compared to the pulp deinked with each individual enzyme, ERIC was lower for the cellulase/hemicellulase-LVS-deinked pulp. This indicated that a synergy existed inmore » ONP deinking using a combination of enzymes. After being bleached by H{sub 2}O{sub 2}, enzyme-combining deinked pulp gave higher brightness and better strength properties. Compared with individual enzyme deinked pulp, average fiber length and coarseness decreased a little for the enzyme-combining deinked pulps. A higher specific surface area and specific volume of the pulp fibers were achieved. UV analysis proved that more lignin was released during the enzyme-combining deinking process. ESEM images showed that more fibrillation was observed on the fiber surface due to synergistic treatment.« less
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less
Incorporation of hydroxy-cinnamaldehydes into lignins
John Ralph; Hoon Kim; Fachuang Lu; Sally A. Ralph; Larry L. Landucci; Takashi Ito; Shingo Kawai
1999-01-01
Peroxidase/H2O2-mediated radical coupling of hydroxycinnamaldehydes produced 81O14-, 8-5-, 818-, and 5-5dimers as had been documented earlier (although we found that the 815-dimer is produced in its cyclic phenylcoumaran form at neutral pH). Spectral data from dimers and oligomers has allowed a more substantive assignment of aldehyde components in lignins isolated from...
Sugiura, Mutsumi; Hirai, Hirofumi; Nishida, Tomoaki
2003-07-29
We characterized kinetics and substrate oxidation of a novel lignin peroxidase (YK-LiP) isolated from white-rot fungus Phanerochaete sordida YK-624. YK-LiP enzyme was identified and purified to homogeneity by anion-exchange chromatography and gel permeation chromatography. The molecular mass of YK-LiP was approximately 50 kDa, and the absorption spectrum of YK-LiP was almost the same as that of the LiP (Pc-LiP) from Phanerochaete chrysosporium. Steady-state kinetics of veratryl alcohol oxidation by YK-LiP (unlike that by Pc-LiP) revealed a bi-reactant sequential mechanism, although reactivity of YK-LiP to various monomeric substituted aromatic compounds was similar to that of Pc-LiP. Degradation of dimeric lignin model compounds was more effective by YK-LiP than by Pc-LiP, and the oxidation rate of sinapyl alcohol oligomer by YK-LiP was much faster than that by Pc-LiP.
2014-01-01
Background Laccases (E.C. 1.10.3.2) are multi-copper oxidases that have gained importance in many industries such as biofuels, pulp production, textile dye bleaching, bioremediation, and food production. Their usefulness stems from the ability to act on a diverse range of phenolic compounds such as o-/p-quinols, aminophenols, polyphenols, polyamines, aryl diamines, and aromatic thiols. Despite acting on a wide range of compounds as a family, individual Laccases often exhibit distinctive and varied substrate ranges. This is likely due to Laccases involvement in many metabolic roles across diverse taxa. Classification systems for multi-copper oxidases have been developed using multiple sequence alignments, however, these systems seem to largely follow species taxonomy rather than substrate ranges, enzyme properties, or specific function. It has been suggested that the roles and substrates of various Laccases are related to their optimal pH. This is consistent with the observation that fungal Laccases usually prefer acidic conditions, whereas plant and bacterial Laccases prefer basic conditions. Based on these observations, we hypothesize that a descriptor-based unsupervised learning system could generate homology independent classification system for better describing the functional properties of Laccases. Results In this study, we first utilized unsupervised learning approach to develop a novel homology independent Laccase classification system. From the descriptors considered, physicochemical properties showed the best performance. Physicochemical properties divided the Laccases into twelve subtypes. Analysis of the clusters using a t-test revealed that the majority of the physicochemical descriptors had statistically significant differences between the classes. Feature selection identified the most important features as negatively charges residues, the peptide isoelectric point, and acidic or amidic residues. Secondly, to allow for classification of new Laccases, a supervised learning system was developed from the clusters. The models showed high performance with an overall accuracy of 99.03%, error of 0.49%, MCC of 0.9367, precision of 94.20%, sensitivity of 94.20%, and specificity of 99.47% in a 5-fold cross-validation test. In an independent test, our models still provide a high accuracy of 97.98%, error rate of 1.02%, MCC of 0.8678, precision of 87.88%, sensitivity of 87.88% and specificity of 98.90%. Conclusion This study provides a useful classification system for better understanding of Laccases from their physicochemical properties perspective. We also developed a publically available web tool for the characterization of Laccase protein sequences (http://lacsubpred.bioinfo.ucr.edu/). Finally, the programs used in the study are made available for researchers interested in applying the system to other enzyme classes (https://github.com/tweirick/SubClPred). PMID:25350584
DOE Office of Scientific and Technical Information (OSTI.GOV)
Floudas, Dimitrios; Binder, Manfred; Riley, Robert
Wood is a major pool of organic carbon that is highly resistant to decay, owing largely to the presence of lignin. The only organisms capable of substantial lignin decay are white rot fungi in the Agaricomycetes, which also contains non?lignin-degrading brown rot and ectomycorrhizal species. Comparative analyses of 31 fungal genomes (12 generated for this study) suggest that lignin-degrading peroxidases expanded in the lineage leading to the ancestor of the Agaricomycetes, which is reconstructed as a white rot species, and then contracted in parallel lineages leading to brown rot and mycorrhizal species. Molecular clock analyses suggest that the origin ofmore » lignin degradation might have coincided with the sharp decrease in the rate of organic carbon burial around the end of the Carboniferous period.« less
Ozer, Aysegul; Uzuner, Ugur; Guler, Halil Ibrahim; Ay Sal, Fulya; Belduz, Ali Osman; Deniz, Ilhan; Canakci, Sabriye
2017-12-29
A chemical bleaching process of paper pulps gives off excessive amount of chlorinated organic wastes mostly released to environment without exposing complete bioremediaton. Recent alternative and eco-friendly approaches toward pulp bleaching appear more responsive to environmental awareness. Here we report, direct use of a recombinant Bacillus subtilis bacterium for pulp bleaching, endowed with three ligninolytic enzymes from various bacteria. In addition, efficient bleaching performance from glutathione-S-transferase (GST) biocatalyst tested for the first time in pulp bleaching applications was also achieved. Simultaneous and extracellular overproduction of highly active GST, laccase, and lignin peroxidase catalysts were also performed by Bacillus cells. Both enhanced bleaching success and improved delignification rates were identified when enzyme combinations tested on both pine kraft and waste paper pulps, ranging from 69.75% to 79.18% and 60.89% to 74.65%, respectively. Furthermore, when triple enzyme combination applied onto the papers from pine kraft and waste pulps, the best ISO brightness values were identified as 66.45% and 64.67%, respectively. The delignification rates of pulp fibers exposed to various enzymatic bleaching sequences were comparatively examined under SEM. In conclusion, the current study points out that in near future, a more fined-tuned engineering of pulp-colonizing bacteria may become a cost-effective and environmentally friendly alternative to chemical bleaching. © 2017 International Union of Biochemistry and Molecular Biology, Inc.
Biodegradation of Basic Violet 3 by Candida krusei isolated from textile wastewater.
Deivasigamani, Charumathi; Das, Nilanjana
2011-11-01
Basic Violet 3 (BV) belongs to the most important group of synthetic colorants and is used extensively in textile industries. It is considered as xenobiotic compound which is recalcitrant to biodegradation. As Candida krusei could not use BV as sole carbon source, experiments were conducted to study the effect of cosubstrates on decolorization of BV in semi synthetic medium using glucose, sucrose, lactose, maltose, yeast extract, peptone, urea and ammonium sulphate. Maximum decolorization (74%) was observed in media supplemented with sucrose. Use of sugarcane bagasse extract as sole nutrient source showed 100% decolorization of BV within 24 h under optimized condition. UV-visible, FTIR spectral analysis and HPLC analysis confirmed the biodegradation of BV. Six degradation products were isolated and identified. We propose the biodegradation pathway for BV which occurs via stepwise reduction and demethylation process to yield mono-, di-, tri-, tetra-, penta- and hexa-demethylated BV species which was degraded completely. The study of the enzymes responsible for decolorization showed the activities of lignin peroxidase, lacasse, tyrosinase, NADH-DCIP reductase, MG reductase and azoreductase in cells before and after decolorization. A significant increase in activities of NADH-DCIP reductase and laccase was observed in the cells after decolorization. The yeast C. krusei could show the ability to decolorize the textile dye BV using inexpensive source like sugarcane bagasse extract for decolorization.
[Ligninolytic enzyme production by white rot fungi during paraquat (herbicide) degradation].
Camacho-Morales, Reyna L; Gerardo-Gerardo, José Luis; Guillén Navarro, Karina; Sánchez, José E
Paraquat is a widely used herbicide in agriculture. Its inappropriate use and wide distribution represents a serious pollution problem for soil and water. White rot fungi are capable of degrading pollutants having a similar structure to that of lignin, such as paraquat. This study evaluated the degradation effect of paraquat on the production of ligninolytic enzymes by white rot fungi isolated from the South of Mexico. Six fungal strains showed tolerance to the herbicide in solid culture. Three of the six evaluated strains showed levels of degradation of 32, 26 and 47% (Polyporus tricholoma, Cilindrobasidium laeve and Deconica citrispora, respectively) after twelve days of cultivation in the presence of the xenobiotic. An increase in laccase and manganese peroxidase (MnP) activities was detected in the strains showing the highest percentage of degradation. Experiments were done with enzyme extracts from the extracellular medium with the two strains showing more degradation potential and enzyme production. After 24hours of incubation, a degradation of 49% of the initial paraquat concentration was observed for D. citrispora. These results suggest that paraquat degradation can be attributed to the presence of extracellular enzymes from white rot fungi. In this work the first evidence of the biodegradation potential of D. citrispora and Cilindrobasidium leave is shown. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Cilerdzic, Jasmina; Vukojevic, Jelena; Stajic, Mirjana; Hadzic, Ibrahim
2011-01-01
Two weakly differentiated taxa, Ganoderma lucidum and G. carnosum, were compared in their sufficient morphological and physiological features. The obtained results showed that dimensions of basidiospores and pileocystidia were insignificantly different, while pore shape and dimensions have shown greater diversity with average diameter of 138.46 μm in G. carnosum and 238.34 μm in G. lucidum. Mycelial growth rate was higher in G. lucidum (8.39 mm day-1) than in G. carnosum (6.02 mm day-1). G. lucidum was also a slightly better producer of biomass and extracellular polysaccharides (28.16 g L-1 and 1.42 mg mL-1, respectively) than G. carnosum (23.68 g L-1 and 0.35 mg mL-1, respectively). However, a higher amount of synthesized intracellular polysaccharides was noted in G. carnosum than in G. lucidum (40.00 mg g-1 and 30.00 mg g-1 of dry biomass, respectively). Higher activity levels of Mn-oxidizing peroxidases were obtained in G. carnosum, while G. lucidum was a better laccase producer. In G. carnosum, corn stem/NH₄NO₃ medium with nitrogen concentration of 20 mM was the optimum for Mn-dependent peroxidase production (88.00 U L-1), while the highest versatile peroxidase activity was detected in the medium with grapevine sawdust and 10 mM of nitrogen (80.80 U L-1). Wheat straw was the best carbon source for laccase synthesis in G. lucidum (55.75 U L-1).
Laccase applications in biofuels production: current status and future prospects.
Kudanga, Tukayi; Le Roes-Hill, Marilize
2014-08-01
The desire to reduce dependence on the ever diminishing fossil fuel reserves coupled with the impetus towards green energy has seen increased research in biofuels as alternative sources of energy. Lignocellulose materials are one of the most promising feedstocks for advanced biofuels production. However, their utilisation is dependent on the efficient hydrolysis of polysaccharides, which in part is dependent on cost-effective and benign pretreatment of biomass to remove or modify lignin and release or expose sugars to hydrolytic enzymes. Laccase is one of the enzymes that are being investigated not only for potential use as pretreatment agents in biofuel production, mainly as a delignifying enzyme, but also as a biotechnological tool for removal of inhibitors (mainly phenolic) of subsequent enzymatic processes. The current review discusses the major advances in the application of laccase as a potential pretreatment strategy, the underlying principles as well as directions for future research in the search for better enzyme-based technologies for biofuel production. Future perspectives could include synergy between enzymes that may be required for optimal results and the adoption of the biorefinery concept in line with the move towards the global implementation of the bioeconomy strategy.
Xue, Hui; Cao, Shangyin; Li, Haoxian; Zhang, Jie; Niu, Juan; Chen, Lina; Zhang, Fuhong; Zhao, Diguang
2017-01-01
Pomegranate (Punica granatum L.) belongs to Punicaceae, and is valued for its social, ecological, economic, and aesthetic values, as well as more recently for its health benefits. The 'Tunisia' variety has softer seeds and big arils that are easily swallowed. It is a widely popular fruit; however, the molecular mechanisms of the formation of hard and soft seeds is not yet clear. We conducted a de novo assembly of the seed transcriptome in P. granatum L. and revealed differential gene expression between the soft-seed and hard-seed pomegranate varieties. A total of 35.1 Gb of data were acquired in this study, including 280,881,106 raw reads. Additionally, de novo transcriptome assembly generated 132,287 transcripts and 105,743 representative unigenes; approximately 13,805 unigenes (37.7%) were longer than 1,000 bp. Using bioinformatics annotation libraries, a total of 76,806 unigenes were annotated and, among the high-quality reads, 72.63% had at least one significant match to an existing gene model. Gene expression and differentially expressed genes were analyzed. The seed formation of the two pomegranate cultivars involves lignin biosynthesis and metabolism, including some genes encoding laccase and peroxidase, WRKY, MYB, and NAC transcription factors. In the hard-seed pomegranate, lignin-related genes and cellulose synthesis-related genes were highly expressed; in soft-seed pomegranates, expression of genes related to flavonoids and programmed cell death was slightly higher. We validated selection of the identified genes using qRT-PCR. This is the first transcriptome analysis of P. granatum L. This transcription sequencing greatly enriched the pomegranate molecular database, and the high-quality SSRs generated in this study will aid the gene cloning from pomegranate in the future. It provides important insights into the molecular mechanisms underlying the formation of soft seeds in pomegranate.
Xue, Hui; Cao, Shangyin; Li, Haoxian; Zhang, Jie; Niu, Juan; Chen, Lina; Zhang, Fuhong; Zhao, Diguang
2017-01-01
Pomegranate (Punica granatum L.) belongs to Punicaceae, and is valued for its social, ecological, economic, and aesthetic values, as well as more recently for its health benefits. The ‘Tunisia’ variety has softer seeds and big arils that are easily swallowed. It is a widely popular fruit; however, the molecular mechanisms of the formation of hard and soft seeds is not yet clear. We conducted a de novo assembly of the seed transcriptome in P. granatum L. and revealed differential gene expression between the soft-seed and hard-seed pomegranate varieties. A total of 35.1 Gb of data were acquired in this study, including 280,881,106 raw reads. Additionally, de novo transcriptome assembly generated 132,287 transcripts and 105,743 representative unigenes; approximately 13,805 unigenes (37.7%) were longer than 1,000 bp. Using bioinformatics annotation libraries, a total of 76,806 unigenes were annotated and, among the high-quality reads, 72.63% had at least one significant match to an existing gene model. Gene expression and differentially expressed genes were analyzed. The seed formation of the two pomegranate cultivars involves lignin biosynthesis and metabolism, including some genes encoding laccase and peroxidase, WRKY, MYB, and NAC transcription factors. In the hard-seed pomegranate, lignin-related genes and cellulose synthesis-related genes were highly expressed; in soft-seed pomegranates, expression of genes related to flavonoids and programmed cell death was slightly higher. We validated selection of the identified genes using qRT-PCR. This is the first transcriptome analysis of P. granatum L. This transcription sequencing greatly enriched the pomegranate molecular database, and the high-quality SSRs generated in this study will aid the gene cloning from pomegranate in the future. It provides important insights into the molecular mechanisms underlying the formation of soft seeds in pomegranate. PMID:28594931
IONIC EFFECTS ON LIGNIFICATION AND PEROXIDASE IN TISSUE CULTURES
Lipetz, Jacques; Garro, Anthony J.
1965-01-01
Crown-gall tumor tissue cultures release peroxidase into the medium in response to the concentration of specific ions in the medium. This release is not due to diffusion from cut surfaces or injured cells. Calcium, magnesium, and ammonium were, in that order, most effective in increasing peroxidase release. The enzyme was demonstrated cytochemically on the cell walls and in the cytoplasm. Cell wall fractions, exhaustively washed in buffer, still contained bound peroxidase. This bound peroxidase could be released by treating the wall fractions with certain divalent cations or ammonium. The order of effectiveness for removing the enzyme from the washed cell walls is: Ca++ ≈ Sr++ > Ba++ > Mg++ > NH4 +. These data support the thesis presented that specific ions can control the deposition of lignin on cell walls by affecting the peroxidase levels on these walls. PMID:19866650
Moreno, Antonio D; Ibarra, David; Ballesteros, Ignacio; González, Alberto; Ballesteros, Mercedes
2013-05-01
In this study, the thermotolerant yeast Kluyveromyces marxianus CECT 10875 was compared to the industrial strain Saccharomyces cerevisiae Ethanol Red for lignocellulosic ethanol production. For it, whole slurry from steam-exploded wheat straw was used as raw material, and two process configurations, simultaneous saccharification and fermentation (SSF) and presaccharification and simultaneous saccharification and fermentation (PSSF), were evaluated. Compared to S. cerevisiae, which was able to produce ethanol in both process configurations, K. marxianus was inhibited, and neither growth nor ethanol production occurred during the processes. However, laccase treatment of the whole slurry removed specifically lignin phenols from the overall inhibitory compounds present in the slurry and triggered the fermentation by K. marxianus, attaining final ethanol concentrations and yields comparable to those obtained by S. cerevisiae. Copyright © 2012 Elsevier Ltd. All rights reserved.
Andreu, Glòria; Vidal, Teresa
2013-03-01
In this work, kenaf pulp was delignified by using laccase in combination with various redox mediators and the efficiency of the different laccase–mediator systems assessed in terms of the changes in pulp properties after bleaching. The oxidative ability of the individual mediators used (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and actovanillone) and the laccase–mediator systems was determined by monitoring the oxidation–reduction potential (ORP) during process. The results confirmed the production of phenoxy radicals of variable reactivity and stressed the significant role of lignin structure in the enzymatic process. Although changes in ORP were correlated with the oxidative ability of the mediators, pulp properties as determined after the bleaching stage were also influenced by condensation and grafting reactions. As shown here, ORP measurements provide a first estimation of the delignification efficiency of a laccase–mediator system. Copyright © 2013 Elsevier Ltd. All rights reserved.
Demont-Caulet, Nathalie; Lapierre, Catherine; Jouanin, Lise; Baumberger, Stéphanie; Méchin, Valérie
2010-10-01
In order to determine the mechanism of the earlier copolymerization steps of two main lignin precursors, sinapyl (S) alcohol and coniferyl (G) alcohol, microscale in vitro oxidations were carried out with a PRX34 Arabidopsis thaliana peroxidase in the presence of H(2)O(2). This plant peroxidase was found to have an in vitro polymerization activity similar to the commonly used horseradish peroxidase. The selected polymerization conditions lead to a bulk polymerization mechanism when G alcohol was the only phenolic substrate available. In the same conditions, the presence of S alcohol at a 50/50 S/G molar ratio turned this bulk mechanism into an endwise one. A kinetics monitoring (size-exclusion chromatography and liquid chromatography-mass spectrometry) of the different species formed during the first 24h oxidation of the S/G mixture allowed sequencing the bondings responsible for oligomerization. Whereas G homodimers and GS heterodimers exhibit low reactivity, the SS pinoresinol structure act as a nucleating site of the polymerization through an endwise process. This study is particularly relevant to understand the impact of S units on lignin structure in plants and to identify the key step at which this structure is programmed. Copyright © 2010 Elsevier Ltd. All rights reserved.
Camassola, Marli; da Rosa, Letícia O.; Calloni, Raquel; Gaio, Tamara A.; Dillon, Aldo J.P.
2013-01-01
Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm−1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm−1, respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307
Lebrun, Jérémie D; Demont-Caulet, Nathalie; Cheviron, Nathalie; Laval, Karine; Trinsoutrot-Gattin, Isabelle; Mougin, Christian
2011-01-01
The relationship between the expression of extracellular enzymatic system and a metal stress is scarce in fungi, hence limiting the possible use of secretion profiles as tools for metal ecotoxicity assessment. In the present study, we investigated the effect of Zn, Cu, Pb and Cd, tested alone or in equimolar cocktail, on the secretion profiles at enzymatic and protein levels in Trametesversicolor. For that purpose, extracellular hydrolases (acid phosphatase, β-glucosidase, β-galactosidase and N-acetyl-β-glucosaminidase) and ligninolytic oxidases (laccase, Mn-peroxidase) were monitored in liquid cultures. Fungal secretome was analyzed by electrophoresis and laccase secretion was characterized by western-blot and mass spectrometry analyses. Our results showed that all hydrolase activities were inhibited by the metals tested alone or in cocktail, whereas oxidase activities were specifically stimulated by Cu, Cd and metal cocktail. At protein level, metal exposure modified the electrophoretic profiles of fungal secretome and affected the diversity of secreted proteins. Two laccase isoenzymes, LacA and LacB, identified by mass spectrometry were differentially glycosylated according to the metal exposure. The amount of secreted LacA and LacB was strongly correlated with the stimulation of laccase activity by Cu, Cd and metal cocktail. These modifications of extracellular enzymatic system suggest that fungal oxidases could be used as biomarkers of metal exposure. Copyright © 2010 Elsevier Ltd. All rights reserved.
Bohacz, Justyna
2017-02-15
Environmentally friendly strategies of waste management are both part of legal solutions currently in place and a focus of interest worldwide. Large-scale composting plants are set up across various regions while home composting is becoming increasingly popular. A variety of microbial groups are successively at work during composting and enzymatic activities detected in the composting mass fluctuate accordingly. Changes in the activities of oxidoreductases and hydrolases, i.e. glucose oxidase, horseradish peroxidase, lignin peroxidase, laccase, xylanase, superoxide dismutase and keratinase, low-molecular weight compounds, i.e. methoxyphenolic and hydroxyphenolic compounds, and the relative level of superoxide radicals and glucose were determined periodically in water extracts of composts to investigate the process of biochemical transformations of ligninocellulose in relation to biothermal phases and to identify a potential priming effect in two composts containing different ratios of lignocellulosic waste and chicken feathers. Composting was conducted for 30weeks. An important aim of the study was to demonstrate that a positive priming effect was induced during composting of a variety of lignocellulosic waste types using native keratin (chicken feathers) as a source of N. The effect was more evident in compost containing grass, which was related to a more rapid depletion of easily available sources of C and energy (glucose) during composting. Ligninolytic enzymes known to biodegrade recalcitrant organic matter were induced in subsequent biothermal phases of composting. Compost I enriched with grass (pine bark, grass, sawdust and chicken feathers) exhibited a higher enzymatic activity than compost II which did not contain any grass but which had a greater number of hardly-degradable components (pine bark, wheat straw, sawdust, chicken feathers). Similar observations were made for the concentrations of low-molecular weight compounds. The enzymes activities and concentration of low-molecular weight compounds listed above can be used to estimate the biodegradation of lignocellulose during composting. Copyright © 2016 Elsevier B.V. All rights reserved.
Hu, Xia; Wang, Chunyan; Wang, Le; Zhang, Ranran; Chen, Hui
2014-04-01
The bark beetle Dendroctonus armandi is able to kill living Pinus armandi and has caused serious damage to pine forest in Northern China. As the most important symbiotic fungus of D. armandi, Leptographium qinlingensis plays an important role in the invasion process of the bark beetle. The laccase secreted by it are involved in lignin degradation to provide utilizable nutrition for D. armandi, and catalyze some biochemical reactions, causing the damages of tree tissue. In present study, the extracellular laccase of L. qinlingensis was purified by using the ammonium sulfate precipitation and DEAE-cellulose (DE-52) column chromatography. Furthermore, the effects of temperature, pH value and metal ions on it were investigated and characterized. The purified enzyme exerted its optimal activity with guaiacol. The catalytic efficiencies K(m) and V(max) determined for substrate guaiacol were 15.4 μM and 372.9 IU mg⁻¹, respectively. The optimum pH and temperature for the purified enzyme was 4.4 and 45 °C, respectively, with the highest enzyme specific activity of 7,000 IU mg⁻¹. Moreover, the metal ions, Co²⁺, Mn²⁺, Ca²⁺, Mg²⁺, Fe²⁺ and Cd²⁺, especially Hg²⁺, showed significantly inhibition effects on its activity. To understand the characteristics of this laccase might provide an opportunity and theoretical basis to promote integrated pest management of D. armandi.
Impact assessment of bisphenol A on lignin-modifying enzymes by basidiomycete Trametes versicolor.
Takamiya, Minako; Magan, Naresh; Warner, Philip J
2008-06-15
The impact of different concentrations of bisphenol A (BPA) was evaluated on growth of the white-rot basidiomycete, Trametes versicolor, and on the expression of genes encoding lignin-modifying enzyme (LME) activities. Effective doses (EDs) were obtained from fungal growth rate to monitor LME activities and the expression levels of their encoding genes. The fungus showed mycelial growth at concentrations of up to 300 microg ml(-1) of BPA with an ED50 value of 185 microg ml(-1). The LME activities were stimulated by BPA concentrations up to 300 microg ml(-1). The lignin peroxidase (LIP) encoding gene may be sensitive to BPA stress.
Thanh Mai Pham, Le; Kim, Yong Hwan
2016-01-01
Using bioinformatic homology search tools, this study utilized sequence phylogeny, gene organization and conserved motifs to identify members of the family of O-methyltransferases from lignin-degrading fungus Phanerochaete chrysosporium. The heterologous expression and characterization of O-methyltransferases from P. chrysosporium were studied. The expressed protein utilized S-(5'-adenosyl)-L-methionine p-toluenesulfonate salt (SAM) and methylated various free-hydroxyl phenolic compounds at both meta and para site. In the same motif, O-methyltransferases were also identified in other white-rot fungi including Bjerkandera adusta, Ceriporiopsis (Gelatoporia) subvermispora B, and Trametes versicolor. As free-hydroxyl phenolic compounds have been known as inhibitors for lignin peroxidase, the presence of O-methyltransferases in white-rot fungi suggested their biological functions in accelerating lignin degradation in white-rot basidiomycetes by converting those inhibitory groups into non-toxic methylated phenolic ones. Copyright © 2015 Elsevier Inc. All rights reserved.
Bleaching kraft pulps with white-rot fungi
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reid, I.D.; Paice, M.G.; Bourbonnais, R.
1996-10-01
Certain white-rot fungi, notably Trametes versicolor, Phanerochaete sordida, and isolate IZU-154 can lower the residual lignin content and increase the brightness of kraft pulps without damaging the pulps` strength or yield. This biological delignification effect can be used in Elemental Chlorine Free and Totally Chlorine Free bleaching sequences. Physical contact between the fungal hyphae and the pulp fibers is not required, but the presence of the living fungus is necessary for continued delignification. In many but not a systems, delignification is correlated with manganese peroxidase activity. Experiments with pulps containing {sup 14}C-labelled lignin indicate that the residual lignin is solubilized,more » but not extensively mineralized, by T. versicolor. The solubilized lignin has the same molecular size as the residual lignin originally present in the pulp. Demethylation of the phenolic rings in the pulp is an early effect of incubation with the fungus.« less
Effect of soya lecithin on the enzymatic system of the white-rot fungi Anthracophyllum discolor.
Bustamante, M; González, M E; Cartes, A; Diez, M C
2011-01-01
The present work optimized the initial pH of the medium and the incubation temperature for ligninolytic enzymes produced by the white-rot fungus Anthracophyllum discolor. Additionally, the effect of soya lecithin on mycelial growth and the production of ligninolytic enzymes in static batch cultures were evaluated. The critical micelle concentration of soya lecithin was also studied by conductivity. The effects of the initial pH (3, 4, and 5) and incubation temperature (20, 25, and 30°C) on different enzymatic activities revealed that the optimum conditions to maximize ligninolytic activity were 26°C and pH 5.5 for laccase and manganese peroxidase (MnP) and 30°C and pH 5.5 for manganese-independent peroxidase (MiP). Under these culture conditions, the maximum enzyme production was 10.16, 484.46, and 112.50 U L(-1) for laccase, MnP, and manganese-independent peroxidase MiP, respectively. During the study of the effect of soya lecithin on A. discolor, we found that the increase in soya lecithin concentration from 0 to 10 g L(-1) caused an increase in mycelial growth. On the other hand, in the presence of soya lecithin, A. discolor produced mainly MnP, which reached a maximum concentration of 30.64 ± 4.61 U L(-1) after 25 days of incubation with 1 g L(-1) of the surfactant. The other enzymes were produced but to a lesser extent. The enzymatic activity of A. discolor was decreased when Tween 80 was used as a surfactant. The critical micelle concentration of soya lecithin calculated in our study was 0.61 g L(-1).
Billings, Andrew F.; Fortney, Julian L.; Hazen, Terry C.; ...
2015-11-19
Tolumonas lignolytica BRL6-1 T sp. nov. is the type strain of T. lignolytica sp. nov., a proposed novel species of the Tolumonas genus. This strain was isolated from tropical rainforest soils based on its ability to utilize lignin as a sole carbon source. Cells of Tolumonas lignolytica BRL6-1 T are mesophilic, non-spore forming, Gram-negative rods that are oxidase and catalase negative. The genome for this isolate was sequenced and returned in seven unique contigs totaling 3.6Mbp, enabling the characterization of several putative pathways for lignin breakdown. Particularly, we found an extracellular peroxidase involved in lignin depolymerization, as well as severalmore » enzymes involved in β-aryl ether bond cleavage, which is the most abundant linkage between lignin monomers. We also found genes for enzymes involved in ferulic acid metabolism, which is a common product of lignin breakdown. Finally, by characterizing pathways and enzymes employed in the bacterial breakdown of lignin in anaerobic environments, this work should assist in the efficient engineering of biofuel production from lignocellulosic material.« less
Hu, Zunfang; Xu, Longqian; Wen, Xianghua
2013-01-01
Immobilization of enzymes on mesoporous silicas (MS) allows for good reusability. MS with two-dimensional hexagonal pores in diameter up to 14.13 nm were synthesized using Pluronic P123 as template and 1,3,5-triisopropylbenzene as a swelling agent in acetate buffer. The surface of MS was modified by the silanization reagents 3-aminopropyltriethoxysilane. Lignin peroxidase (LiP) was successfully immobilized on the modified MS through covalent binding method by four agents: glutaraldehyde, 1,4-phenylene diisothiocyanate, cyanotic chloride and water-soluble carbodiimide. Results showed that cyanotic chloride provided the best performance for LIP immobilization. The loaded protein concentration was 12.15 mg/g and the immobilized LiP activity was 812.9 U/L. Immobilized LiP had better pH stability. Acid Orange II was used to examine the reusability of immobilized LiP, showing more than 50% of the dye was decolorized at the fifth cycle.
Hoon Kim; John Ralph; Fachuang Lu; Sally A. Ralph; Alain-M. Boudett; John J. MacKay; Ronald R. Sederoff; Takashi Ito; Shingo Kawai; Hideo Ohashi; Takayoshi Higuchi
2003-01-01
Peroxidase/H2O2-mediated radical coupling of 4-hydroxycinnamaldehydes produces 8âOâ4-, 8â5-, and 8â8-coupled dehydrodimers as has been documented earlier, as well as the 5-5-coupled dehydrodimer. The 8â5- dehydrodimer is however produced kinetically in its cyclic phenylcoumaran form at neutral pH. Synthetic polymers produced from mixtures of hydroxycinnamaldehydes and...
Chen, Chao; Shrestha, Ruben; Jia, Kaimin; Gao, Philip F.; Geisbrecht, Brian V.; Bossmann, Stefan H.; Shi, Jishu; Li, Ping
2015-01-01
Dye-decolorizing peroxidases (DyPs) comprise a new family of heme peroxidases, which has received much attention due to their potential applications in lignin degradation. A new DyP from Thermomonospora curvata (TcDyP) was identified and characterized. Unlike other A-type enzymes, TcDyP is highly active toward a wide range of substrates including model lignin compounds, in which the catalytic efficiency with ABTS (kcatapp/Kmapp = (1.7 × 107) m−1 s−1) is close to that of fungal DyPs. Stopped-flow spectroscopy was employed to elucidate the transient intermediates as well as the catalytic cycle involving wild-type (wt) and mutant TcDyPs. Although residues Asp220 and Arg327 are found necessary for compound I formation, His312 is proposed to play roles in compound II reduction. Transient kinetics of hydroquinone (HQ) oxidation by wt-TcDyP showed that conversion of the compound II to resting state is a rate-limiting step, which will explain the contradictory observation made with the aspartate mutants of A-type DyPs. Moreover, replacement of His312 and Arg327 has significant effects on the oligomerization and redox potential (E°′) of the enzyme. Both mutants were found to promote the formation of dimeric state and to shift E°′ to a more negative potential. Not only do these results reveal the unique catalytic property of the A-type DyPs, but they will also facilitate the development of these enzymes as lignin degraders. PMID:26205819
Kumari, Simpal; Naraian, Ram
2016-09-15
Aim of the present study was to evaluate the efficiency of fungal co-culture for the decolorization of synthetic brilliant green carpet industry dye. For this purpose two lignocellulolytic fungi Pleurotus florida (PF) and Rhizoctonia solani (RS) were employed. The study includes determination of enzyme profiles (laccase and peroxidase), dye decolorization efficiency of co-culture and crude enzyme extracts. Both fungi produced laccase and Mn peroxidase and successfully decolorized solutions of different concentrations (2.0, 4.0, 6.0, & 8.0(w/v) of dye. The co-culture resulted highest 98.54% dye decolorization at 2% (w/v) of dye as compared to monocultures (82.12% with PF and 68.89% with RS) during 12 days of submerged fermentation. The lower levels of dyes were rapidly decolorized, while higher levels in slow order as 87.67% decolorization of 8% dye. The promising achievement of the study was remarkable decolorizing efficiency of co-culture over monocultures. The direct treatment of the mono and co-culture enzyme extracts to dye also influenced remarkable. The highest enzymatic decolorization was through combined (PF and RS) extracts, while lesser by monoculture extracts. Based on the observations and potentiality of co-culture technology; further it can be exploited for the bioremediation of areas contaminated with hazardous environmental pollutants including textile and other industry effluents. Copyright © 2016 Elsevier Ltd. All rights reserved.
PbrmiR397a regulates lignification during stone cell development in pear fruit.
Xue, Cheng; Yao, Jia-Long; Qin, Meng-Fan; Zhang, Ming-Yue; Allan, Andrew C; Wang, De-Fu; Wu, Jun
2018-05-13
Lignified stone cells substantially reduce fruit quality. Therefore, it is desirable to inhibit stone cell development by using genetic technologies. However, the molecular mechanisms regulating lignification are poorly understood in fruit stone cells. In this study, we have shown that microRNA (miR) miR397a regulates fruit cell lignification by inhibiting laccase (LAC) genes that encode key lignin biosynthesis enzymes. Transient overexpression of PbrmiR397a, which is the miR397a of Chinese pear (Pyrus bretschneideri), and simultaneous silencing of three LAC genes reduced the lignin content and stone cell number in pear fruit. A single nucleotide polymorphism (SNP) identified in the promoter of the PbrmiR397a gene was found to associate with low levels of fruit lignin, after analysis of the genome sequences of sixty pear varieties. This SNP created a TCA-element that responded to salicylic acid (SA) to induce gene expression as confirmed using a cell-based assay system. Furthermore, stable overexpression of PbrmiR397a in transgenic tobacco plants reduced the expression of target LAC genes and decreased the content of lignin but did not change the ratio of syringyl and guaiacyl lignin monomers. Consistent with reduction of lignin content, the transgenic plants showed fewer numbers of vessel elements and thinner secondary walls in the remaining elements compared to wild-type control plants. This study has advanced our understanding of the regulation of lignin biosynthesis and provided useful molecular genetic information for improving pear fruit quality. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Linke, Diana; Leonhardt, Robin; Eisele, Nadine; Petersen, Laura M; Riemer, Stephanie; Nimtz, Manfred; Berger, Ralf G
2015-06-01
Four extracellular enzymes, a versatile peroxidase, a manganese peroxidase, a dye-decolorizing peroxidase and a lignin peroxidase were discovered in liquid cultures of the basidiomycete Bjerkandera adusta. All of them cleaved β-carotene effectively. Expression was enhanced in the presence of β-carotene or Coomassie Brilliant Blue and peaked after 7-9 days. The monomeric proteins were purified by ion exchange and size exclusion chromatography and exhibited molecular masses of 41, 43, 51 and 43 kDa, respectively. The coding sequences showed homologies from 61 to 89 % to peroxidases from other basidiomycetes. The novel enzymes retained strong activity even in the absence of hydrogen peroxide and at alkaline pH. De-staining of fabrics using detergent-tolerant enzymes may help to save the most important bio-resources, energy and water, in washing processes and led to green processes in textile cleaning.
Zhang, Kai; Lu, Kun; Qu, Cunmin; Liang, Ying; Wang, Rui; Chai, Yourong; Li, Jiana
2013-01-01
Yellow-seed (i.e., yellow seed coat) is one of the most important agronomic traits of Brassica plants, which is correlated with seed oil and meal qualities. Previous studies on the Brassicaceae, including Arabidopsis and Brassica species, proposed that the seed-color trait is correlative to flavonoid and lignin biosynthesis, at the molecular level. In Arabidopsis thaliana, the oxidative polymerization of flavonoid and biosynthesis of lignin has been demonstrated to be catalyzed by laccase 15, a functional enzyme encoded by the AtTT10 gene. In this study, eight Brassica TT10 genes (three from B. napus, three from B. rapa and two from B. oleracea) were isolated and their roles in flavonoid oxidation/polymerization and lignin biosynthesis were investigated. Based on our phylogenetic analysis, these genes could be divided into two groups with obvious structural and functional differentiation. Expression studies showed that Brassica TT10 genes are active in developing seeds, but with differential expression patterns in yellow- and black-seeded near-isogenic lines. For functional analyses, three black-seeded B. napus cultivars were chosen for transgenic studies. Transgenic B. napus plants expressing antisense TT10 constructs exhibited retarded pigmentation in the seed coat. Chemical composition analysis revealed increased levels of soluble proanthocyanidins, and decreased extractable lignin in the seed coats of these transgenic plants compared with that of the controls. These findings indicate a role for the Brassica TT10 genes in proanthocyanidin polymerization and lignin biosynthesis, as well as seed coat pigmentation in B. napus. PMID:23613820
Regulation of coal polymer degradation by fungi. Eighth quarterly report, [April--June 1996
DOE Office of Scientific and Technical Information (OSTI.GOV)
Irvine, R.L.; Bumpus, J.A.
1996-07-28
This project addresses the solubilization of low-rank coal (leonardite) by lignin degrading fungi. During this reporting period efforts were focused on determining the effect of pH on coal solubilization by oxalate ion and other biologically important compounds that might function as metal chelators, on the role of laccase in coal solubilization and metabolism, on decolorization of soluble coal macromolecule by Phanerochaete chrysosporium and T. versicolor in solid agar media, and on solubilization of coal in slurry cultures and solid phase reactors.
Tao, Zhangsheng; Huang, Yi; Zhang, Lida; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong
2017-01-01
Silique shattering resistance is one of the most important agricultural traits in oil crop breeding. Seed shedding from siliques prior to and during harvest causes devastating losses in oilseed yield. Lignin biosynthesis in the silique walls is thought to affect silique-shattering resistance in oil crops. Here, we identified and characterized B. napus LATE FLOWERING (BnLATE), which encodes a Cys2/His2-type zinc-finger protein. Heterologous expression of BnLATE under the double enhanced CaMV 35S promoter (D35S) in wild-type Arabidopsis plants resulted in a marked decrease in lignification in the replum, valve layer (carpel) and dehiscence zone. pBnLATE::GUS activity was strong in the yellowing silique walls of transgenic lines. Furthermore, the expression pattern of BnLATE and the lignin content gradient in the silique walls at 48 days after pollination (DAP) of 73290, a B. napus silique shattering-resistant line, are similar to those in transgenic Arabidopsis lines expressing BnLATE. Transcriptome sequencing of the silique walls revealed that genes encoding peroxidases, which polymerize monolignols and lignin in the phenylpropanoid pathway, were down-regulated at least two-fold change in the D35S::BnLATE transgenic lines. pBnLATE::BnLATE transgenic lines were further used to identify the function of BnLATE, and the results showed that lignification in the carpel and dehiscence zone of yellowing silique also remarkably decreased compared with the wild-type control, the silique shattering-resistance and expression pattern of peroxidase genes are very similar to results with D35S::BnLATE. These results suggest that BnLATE is a negative regulator of lignin biosynthesis in the yellowing silique walls, and promotes silique-shattering resistance in B. napus through restraining the polymerization of monolignols and lignin. PMID:28081140
Steffen, K T; Hofrichter, M; Hatakka, A
2000-12-01
Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.
Smith, Andrew T; Doyle, Wendy A; Dorlet, Pierre; Ivancich, Anabella
2009-09-22
The surface oxidation site (Trp-171) in lignin peroxidase (LiP) required for the reaction with veratryl alcohol a high-redox-potential (1.4 V) substrate, was engineered into Coprinus cinereus peroxidase (CiP) by introducing a Trp residue into a heme peroxidase that has similar protein fold but lacks this activity. To create the catalytic activity toward veratryl alcohol in CiP, it was necessary to reproduce the Trp site and its negatively charged microenvironment by means of a triple mutation. The resulting D179W+R258E+R272D variant was characterized by multifrequency EPR spectroscopy. The spectra unequivocally showed that a new Trp radical [g values of g(x) = 2.0035(5), g(y) = 2.0027(5), and g(z) = 2.0022(1)] was formed after the [Fe(IV)=O Por(*+)] intermediate, as a result of intramolecular electron transfer between Trp-179 and the porphyrin. Also, the EPR characterization crucially showed that [Fe(IV)=O Trp-179(*)] was the reactive intermediate with veratryl alcohol. Accordingly, our work shows that it is necessary to take into account the physicochemical properties of the radical, fine-tuned by the microenvironment, as well as those of the preceding [Fe(IV)=O Por(*+)] intermediate to engineer a catalytically competent Trp site for a given substrate. Manipulation of the microenvironment of the Trp-171 site in LiP allowed the detection by EPR spectroscopy of the Trp-171(*), for which direct evidence has been missing so far. Our work also highlights the role of Trp residues as tunable redox-active cofactors for enzyme catalysis in the context of peroxidases with a unique reactivity toward recalcitrant substrates that require oxidation potentials not realized at the heme site.
Chandra, Ram; Bharagava, Ram Naresh
2013-11-01
Pulp paper mill effluent has high pollution load due to presence of lignin and its derivatives as major colouring and polluting constituents. In this study, two lignin degrading bacteria IITRL1 and IITRSU7 were isolated and identified as Citrobacter freundii (FJ581026) and Citrobacter sp. (FJ581023), respectively. In degradation study by axenic and mixed culture, mixed bacterial culture was found more effective compared to axenic culture as it decolourized 85 and 62% of synthetic and kraft lignin whereas in axenic conditions, bacterium IITRL1 and IITRSU7 decolourized 61 and 64% synthetic and 49 and 54% kraft lignin, respectively. Further, the mixed bacterial culture also showed the removal of 71, 58% TOC; 78, 53% AOX; 70, 58% COD and 74, 58% lignin from synthetic and kraft lignin, respectively. The ligninolytic enzyme was characterized as manganese peroxidase by SDS-PAGE yielding a single band of 43 KDa. The HPLC analysis of degraded samples showed reduction as well as shifting of peaks compared to control indicating the degradation as well as transformation of compounds. Further, in GC-MS analysis of synthetic and kraft lignin degraded samples, hexadecanoic acid was found as recalcitrant compounds while 2,4,6-trichloro-phenol, 2,3,4,5-tetrachloro-phenol and pentachloro-phenol were detected as new metabolites.
Molecular Phylogeny of Heme Peroxidases
NASA Astrophysics Data System (ADS)
Zámocký, Marcel; Obinger, Christian
All currently available gene sequences of heme peroxidases can be phylogenetically divided in two superfamilies and three families. In this chapter, the phylogenetics and genomic distribution of each group are presented. Within the peroxidase-cyclooxygenase superfamily, the main evolutionary direction developed peroxidatic heme proteins involved in the innate immune defense system and in biosynthesis of (iodinated) hormones. The peroxidase-catalase superfamily is widely spread mainly among bacteria, fungi, and plants, and particularly in Class I led to the evolution of bifunctional catalase-peroxidases. Its numerous fungal representatives of Class II are involved in carbon recycling via lignin degradation, whereas Class III secretory peroxidases from algae and plants are included in various forms of secondary metabolism. The family of di-heme peroxidases are predominantly bacteria-inducible enzymes; however, a few corresponding genes were also detected in archaeal genomes. Four subfamilies of dyp-type peroxidases capable of degradation of various xenobiotics are abundant mainly among bacteria and fungi. Heme-haloperoxidase genes are widely spread among sac and club fungi, but corresponding genes were recently found also among oomycetes. All described families herein represent heme peroxidases of broad diversity in structure and function. Our accumulating knowledge about the evolution of various enzymatic functions and physiological roles can be exploited in future directed evolution approaches for engineering peroxidase genes de novo for various demands.
Characterization of Trapped Lignin-Degrading Microbes in Tropical Forest Soil
DeAngelis, Kristen M.; Allgaier, Martin; Chavarria, Yaucin; Fortney, Julian L.; Hugenholtz, Phillip; Simmons, Blake; Sublette, Kerry; Silver, Whendee L.; Hazen, Terry C.
2011-01-01
Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in the soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition. PMID:21559391
Class III peroxidases in cellulose deficient cultured maize cells during cell wall remodelling.
Martínez-Rubio, Romina; Acebes, José Luis; Encina, Antonio; Kärkönen, Anna
2018-02-21
Maize (Zea mays L.) suspension-cultured cells habituated to a cellulose biosynthesis inhibitor 2,6-dichlorobenzonitrile (DCB) have a modified cell wall, in which the reduction in the cellulose content is compensated by a network of highly cross-linked feruloylated arabinoxylans and the deposition of lignin-like polymers. For both arabinoxylan cross-linking and lignin polymerization, class III peroxidases (POXs) have been demonstrated to have a prominent role. For the first time, a comparative study of POX activity and isoforms in control and cellulose-impaired cells has been addressed, also taking into account their cellular distribution in different compartments. Proteins from the spent medium (SM), soluble cellular (SC), ionically (ICW) and covalently bound cell wall protein fractions were assayed for total and specific peroxidase activity by using coniferyl and sinapyl alcohol and ferulic acid as substrates. The isoPOX profile was obtained by isoelectric focusing. POX activity was higher in DCB-habituated than in non-habituated cells in all protein fractions at all cell culture stages. For all substrates assayed, SC and ICW fractions showed higher activity at the early-log growth phase than at the late-log phase. However, the highest POX activity in the spent medium was found at the late-log phase. According to the isoPOX profiles, the highest diversity of isoPOXs was detected in the ICW and SM protein fractions. The latter fraction contained isoPOXs with higher activity in DCB-habituated cells. Some of the isoPOXs detected could be involved in cross-linking of arabinoxylans and in the lignin-like polymer formation in DCB-habituated cells. This article is protected by copyright. All rights reserved.
Fragoeiro, Silvia; Magan, Naresh
2005-03-01
In this study we examined the extracellular enzymatic activity of two white rot fungi (Phanerochaete chrysosporium and Trametes versicolor) in a soil extract broth in relation to differential degradation of a mixture of different concentrations (0-30 p.p.m.) of simazine, dieldrin and trifluralin under different osmotic stress (-0.7 and -2.8 MPa) and quantified enzyme production, relevant to P and N release (phosphomonoesterase, protease), carbon cycling (beta-glucosidase, cellulase) and laccase activity, involved in lignin degradation. Our results suggest that T. versicolor and P. chrysosporium have the ability to degrade different groups of pesticides, supported by the capacity for expression of a range of extracellular enzymes at both -0.7 and -2.8 MPa water potential. Phanerochaete chrysosporium was able to degrade this mixture of pesticides independently of laccase activity. In soil extract, T. versicolor was able to produce the same range of enzymes as P. chrysoporium plus laccase, even in the presence of 30 p.p.m. of the pesticide mixture. Complete degradation of dieldrin and trifluralin was observed, while about 80% of the simazine was degraded regardless of osmotic stress treatment in a nutritionally poor soil extract broth. The capacity of tolerance and degradation of high concentrations of mixtures of pesticides and production of a range of enzymes, even under osmotic stress, suggest potential bioremediation applications.
A preliminary X-ray diffraction study of the laccase from Coriolus zonatus in the native state
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lyashenko, A. V.; Zhukhlistova, N. E.; Stepanova, E. V.
2006-03-15
The copper-containing enzyme laccase is involved, owing to its oxidase activity, in the biodegradation of lignins-one of the most important bioconversion processes. On the basis of the X-ray diffraction data for the laccase from Coriolus zonatus, the spatial structure of this enzyme is determined with a resolution of 3.2 A. R and R{sub free} are 0.2347 and 0.2976, respectively, and the rms deviations of the bond lengths and the bond angles are 0.009 and 1.547 A, respectively. The three-domain structure of the laccase from Coriolus zonatus is confirmed, where each domain is represented by a protein from the cupredoxin family.more » The spatial organization of the active center of the protein is established. The mononuclear center contains a copper ion Cu(1) with the atoms of S{sub C}ys453, ND1{sub H}is395, and ND1{sub H}is458 ligands. The trinuclear center is formed by copper ions Cu(2), Cu(3), and Cu(4), surrounded by ligands of eight nitrogen atoms of the histidines of the first and third domains of the protein His66, His109, His454, His111, His400, His452, His64, and His398. The Cu(1) ion is located at distances of 11.84 and 13.22 A from the Cu(2) and Cu(3) ions, respectively. The distance between the Cu(2) and Cu(3) ions is 5.14 A and the Cu(4)-Cu(2) and Cu(4)-Cu(3) distances are 4.75 and 4.41 A, respectively.« less
Pretreatment of lignocellulosic biomass using Fenton chemistry
USDA-ARS?s Scientific Manuscript database
Pretreatment is a necessary step in “biomass to biofuel conversion” due to the recalcitrant nature of lignocellulosic biomass. White-rot fungi utilize peroxidases and hydrogen peroxide (in vivo Fenton chemistry) to degrade lignin. In an attempt to mimic this process, solution phase Fenton chemistry ...
Oliveira, Sabrina Feliciano; da Luz, José Maria Rodrigues; Kasuya, Maria Catarina Megumi; Ladeira, Luiz Orlando; Correa Junior, Ary
2018-05-01
The majority of the textile dyes are harmful to the environment and potentially carcinogenic. Among strategies for their exclusion, the treatment of dye contaminated wastewater with fungal extract, containing lignin peroxidase (LiP), may be useful. Two fungi isolates, Pleurotus ostreatus (PLO9) and Ganoderma lucidum (GRM117), produced the enzymatic extract by fermentation in the lignocellulosic residue, Jatropha curcas seed cake. The extracts from PLO9 and GRM117 were immobilized on carbon nanotubes and showed an increase of 18 and 27-fold of LiP specific activity compared to the free enzyme. Also, LiP from both fungi extracts showed higher Vmax and lower Km values. Only the immobilized extracts could be efficiently reused in the dye decolourization, contrary, the carbon nanotubes became saturated and they should be discarded over time. This device may offer a final biocatalyst with higher catalytic efficiency and capability to be reused in the dye decolourization process.
Mali, Tuulia; Kuuskeri, Jaana; Shah, Firoz
2017-01-01
Fomitopsis pinicola is a species of Polyporales frequently encountered in Nordic temperate and boreal forests. In nature, the fungus causes destructive brown rot in wood, colonizing tree trunks often occupied by other Basidiomycota species. We mimicked these species-species interactions by introducing F. pinicola to five white rot species, all common saprotrophs of Norway spruce. Hyphal interactions and mycelial growth in various combinations were recorded, while activities of lignocellulose-acting CAZymes and oxidoreductases were followed in co-cultures on two different carbon-source media. Of the species, Phlebia radiata and Trichaptum abietinum were the strongest producers of lignin-modifying oxidoreductases (laccase, manganese peroxidase) when evaluated alone, as well as in co-cultures, on the two different growth media (low-nitrogen liquid medium containing ground coniferous wood, and malt extract broth). F. pinicola was an outstanding producer of oxalic acid (up to 61 mM), whereas presence of P. radiata prevented acidification of the growth environment in the liquid malt-extract cultures. When enzyme profiles of the species combinations were clustered, time-dependent changes were observed on wood-supplemented medium during the eight weeks of growth. End-point acidity and production of mycelium, oxalic acid and oxidoreductase activities, in turn clustered the fungal combinations into three distinct functional groups, determined by the presence of F. pinicola and P. radiata, by principal component analysis. Our findings indicate that combinations of wood-decay fungi have dramatic dynamic effects on the production of lignocellulose-active enzymes, which may lead to divergent degradative processes of dead wood and forest litter. PMID:28953947
Phenoloxidase-mediated interactions of phenols and anilines with humic materials
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dec, J.; Bollag, J.M.
Phenoloxidases present in terrestrial systems may contribute to the formation of humus through random coupling of a variety of aromatic compounds, including xenobiotic chemicals. Because of their structural similarity to natural substrates originating mainly from lignin decomposition, xenobiotic phenols and anilines can be readily incorporated into the soil organic matter, a phenomenon referred to as binding. The underlying mechanism of binding involves oxidation of the xenobiotic substrates to free radicals or quinone products that subsequently couple directly to humus or to naturally occurring phenols that also are subject to oxidation. The oxidation can be mediated by soil phenoloxidases as wellmore » as by abiotic catalysts. The ability of the enzymes to mediate the oxidation was demonstrated in a number of model studies, in which selected pollutants were incubated with humic monomers or natural humic acids in the presence of different phenoloxidases (laccase, peroxidase, tyrosinase). Analysis of the formed complexes by mass spectrometry and {sup 13}C nuclear magnetic resonance (NMR) spectroscopy left no doubt about the formation of covalent bonds between the pollutants and humic materials. Some bonds were formed at the chlorinated sites, leading to partial dehalogenation of the aromatic contaminants. Experimental data indicated that bound phenols and anilines were unlikely to adversely affect the environment; their release from humic complexes by soil microorganisms was very limited and once released, they were subjected to mineralization. For those reasons, phenoloxidases, which proved capable of mediating the underlying reaction, are currently considered as a tool for enhancing immobilization phenomena in soil.« less
Mali, Tuulia; Kuuskeri, Jaana; Shah, Firoz; Lundell, Taina Kristina
2017-01-01
Fomitopsis pinicola is a species of Polyporales frequently encountered in Nordic temperate and boreal forests. In nature, the fungus causes destructive brown rot in wood, colonizing tree trunks often occupied by other Basidiomycota species. We mimicked these species-species interactions by introducing F. pinicola to five white rot species, all common saprotrophs of Norway spruce. Hyphal interactions and mycelial growth in various combinations were recorded, while activities of lignocellulose-acting CAZymes and oxidoreductases were followed in co-cultures on two different carbon-source media. Of the species, Phlebia radiata and Trichaptum abietinum were the strongest producers of lignin-modifying oxidoreductases (laccase, manganese peroxidase) when evaluated alone, as well as in co-cultures, on the two different growth media (low-nitrogen liquid medium containing ground coniferous wood, and malt extract broth). F. pinicola was an outstanding producer of oxalic acid (up to 61 mM), whereas presence of P. radiata prevented acidification of the growth environment in the liquid malt-extract cultures. When enzyme profiles of the species combinations were clustered, time-dependent changes were observed on wood-supplemented medium during the eight weeks of growth. End-point acidity and production of mycelium, oxalic acid and oxidoreductase activities, in turn clustered the fungal combinations into three distinct functional groups, determined by the presence of F. pinicola and P. radiata, by principal component analysis. Our findings indicate that combinations of wood-decay fungi have dramatic dynamic effects on the production of lignocellulose-active enzymes, which may lead to divergent degradative processes of dead wood and forest litter.
Characterization of Trapped Lignin-Degrading Microbes in Tropical Forest Soil
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeAngelis, Kristen M.; Allgaier, Martin; Chavarria, Yaucin
2011-04-29
Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in themore » soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.« less
Characterization of trapped lignin-degrading microbes in tropical forest soil
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeAngelis, K.M.; Allgaier, M.; Chavarria, Y.
2011-03-01
Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in themore » soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.« less
Characterization of Trapped Lignin-Degrading Microbes in Tropical Forest Soil
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeAngelis, Kristen; Allgaier, Martin; Chavarria, Yaucin
2011-07-14
Lignin is often the most difficult portion of plant biomass to degrade, with fungi generally thought to dominate during late stage decomposition. Lignin in feedstock plant material represents a barrier to more efficient plant biomass conversion and can also hinder enzymatic access to cellulose, which is critical for biofuels production. Tropical rain forest soils in Puerto Rico are characterized by frequent anoxic conditions and fluctuating redox, suggesting the presence of lignin-degrading organisms and mechanisms that are different from known fungal decomposers and oxygen-dependent enzyme activities. We explored microbial lignin-degraders by burying bio-traps containing lignin-amended and unamended biosep beads in themore » soil for 1, 4, 13 and 30 weeks. At each time point, phenol oxidase and peroxidase enzyme activity was found to be elevated in the lignin-amended versus the unamended beads, while cellulolytic enzyme activities were significantly depressed in lignin-amended beads. Quantitative PCR of bacterial communities showed more bacterial colonization in the lignin-amended compared to the unamended beads after one and four weeks, suggesting that the lignin supported increased bacterial abundance. The microbial community was analyzed by small subunit 16S ribosomal RNA genes using microarray (PhyloChip) and by high-throughput amplicon pyrosequencing based on universal primers targeting bacterial, archaeal, and eukaryotic communities. Community trends were significantly affected by time and the presence of lignin on the beads. Lignin-amended beads have higher relative abundances of representatives from the phyla Actinobacteria, Firmicutes, Acidobacteria and Proteobacteria compared to unamended beads. This study suggests that in low and fluctuating redox soils, bacteria could play a role in anaerobic lignin decomposition.« less
Cho, Dae Won; Parthasarathi, Ramakrishnan; Pimentel, Adam S; Maestas, Gabriel D; Park, Hea Jung; Yoon, Ung Chan; Dunaway-Mariano, Debra; Gnanakaran, S; Langan, Paul; Mariano, Patrick S
2010-10-01
Features of the oxidative cleavage reactions of diastereomers of dimeric lignin model compounds, which are models of the major types of structural units found in the lignin backbone, were examined. Cation radicals of these substances were generated by using SET-sensitized photochemical and Ce(IV) and lignin peroxidase promoted oxidative processes, and the nature and kinetics of their C-C bond cleavage reactions were determined. The results show that significant differences exist between the rates of cation radical C1-C2 bond cleavage reactions of 1,2-diaryl-(β-1) and 1-aryl-2-aryloxy-(β-O-4) propan-1,3-diol structural units found in lignins. Specifically, under all conditions C1-C2 bond cleavage reactions of cation radicals of the β-1 models take place more rapidly than those of the β-O-4 counterparts. The results of DFT calculations on cation radicals of the model compounds show that the C1-C2 bond dissociation energies of the β-1 lignin model compounds are significantly lower than those of the β-O-4 models, providing clear evidence for the source of the rate differences.
Michel, F C; Dass, S B; Grulke, E A; Reddy, C A
1991-08-01
The role of lignin peroxidases (LIPs) and manganese peroxidases (MNPs) of Phanerochaete chrysosporium in decolorizing kraft bleach plant effluent (BPE) was investigated. Negligible BPE decolorization was exhibited by a per mutant, which lacks the ability to produce both the LIPs and the MNPs. Also, little decolorization was seen when the wild type was grown in high-nitrogen medium, in which the production of LIPs and MNPs is blocked. A lip mutant of P. chrysosporium, which produces MNPs but not LIPs, showed about 80% of the activity exhibited by the wild type, indicating that the MNPs play an important role in BPE decolorization. When P. chrysosporium was grown in a medium with 100 ppm of Mn(II), high levels of MNPs but no LIPs were produced, and this culture also exhibited high rates of BPE decolorization, lending further support to the idea that MNPs play a key role in BPE decolorization. When P. chrysosporium was grown in a medium with no Mn(II), high levels of LIPs but negligible levels of MNPs were produced and the rate and extent of BPE decolorization by such cultures were quite low, indicating that LIPs play a relatively minor role in BPE decolorization. Furthermore, high rates of BPE decolorization were seen on days 3 and 4 of incubation, when the cultures exhibit high levels of MNP activity but little or no LIP activity. These results indicate that MNPs play a relatively more important role than LIPs in BPE decolorization by P. chrysosporium.
A polymer of caffeyl alcohol in plant seeds
Chen, Fang; Tobimatsu, Yuki; Havkin-Frenkel, Daphna; Dixon, Richard A.; Ralph, John
2012-01-01
Lignins are complex phenylpropanoid polymers mostly associated with plant secondary cell walls. Lignins arise primarily via oxidative polymerization of the three monolignols, p-coumaryl, coniferyl, and sinapyl alcohols. Of the two hydroxycinnamyl alcohols that represent incompletely methylated biosynthetic products (and are not usually considered to be monolignols), 5-hydroxyconiferyl alcohol is now well established as incorporating into angiosperm lignins, but incorporation of caffeyl alcohol has not been shown. We report here the presence of a homopolymer of caffeyl alcohol in the seed coats of both monocot and dicot plants. This polymer (C-lignin) is deposited to high concentrations in the seed coat during the early stages of seed development in the vanilla orchid (Vanilla planifolia), and in several members of the Cactaceae. The lignin in other parts of the Vanilla plant is conventionally biosynthesized from coniferyl and sinapyl alcohols. Some species of cacti contain only C-lignin in their seeds, whereas others contain only classical guaiacyl/syringyl lignin (derived from coniferyl and sinapyl alcohols). NMR spectroscopic analysis revealed that the Vanilla seed-coat polymer was massively comprised of benzodioxane units and was structurally similar to the polymer synthesized in vitro by peroxidase-catalyzed polymerization of caffeyl alcohol. CD spectroscopy did not detect any optical activity in the seed polymer. These data support the contention that the C-lignin polymer is produced in vivo via combinatorial oxidative radical coupling that is under simple chemical control, a mechanism analogous to that theorized for classical lignin biosynthesis. PMID:22307645
Growth and lignification in seedlings exposed to eight days of microgravity
NASA Technical Reports Server (NTRS)
Cowles, J. R.; Scheld, H. W.; Lemay, R.; Peterson, C.
1984-01-01
Four-day-old pine seedlings and mung bean and oat seeds were prepared for flight on the third Space Transport System Mission (STS-3). The seedlings and seeds were planted in six mini-growth chambers (two chambers per species) which were placed in a plant growth unit (PGU). Another set of seedlings and seeds was prepared and placed in another PGU as the 1 g control. The flight PGU was positioned in the orbiter mid-deck locker area about 11 h prior to launch. The pine seedlings and germinating mung bean and oat seeds were exposed to 194 h of microgravity. The PGU was received at a temporary laboratory about 75 min post-landing. Plants were observed, photographed and the atmospheric gases analyzed at the landing site. The plants were then brought to our Houston laboratory where they were measured and analyzed for lignin and protein content and for phenylalanine ammonia-lyase (PAL) and peroxidase activities. Flight seedlings were shorter than the controls in all three species. Twenty-five to 40 per cent of the mung bean and oat roots were growing upward, and the mung beans showed signs of disorientation. Flight mung beans showed a significant reduction in lignin content in comparison to the controls, and PAL and peroxidase activities were reduced in flight pine seedlings. The results generally support the postulate that lignin synthesis is reduced in near-weightlessness and show other interesting findings.
[Degradation of lignocellulose in the corn straw by Bacillus amyloliquefaciens MN-8].
Li, Hong-ya; Li, Shu-na; Wang, Shu-xiang; Wang, Quan; Xue, Yin-yin; Zhu, Bao-cheng
2015-05-01
Microbial degradation of lignocellulose is one of the key problems that need to be solved urgently in the process of utilizing biomass resource. Bacillus amyloliquefaciens MN-8 is our previously isolated bacterium capable of degrading lignin. To determine the capability of strain MN-8 to degrade lignocellulose of corn straw, B. amyloliquefaciens MN-8 was inoculated and fermented with solid-state corn straw powder-MSM culture medium. The changes in the enzyme activity and degradation products of lignocellulose were monitored in the process of fermentation using the FTIR and GC/MS. The results showed that B. amyloliquefaciens MN-8 could produce lignin peroxidase, manganese peroxidase, cellulase and hemicellulase enzymes. The activities of all these enzymes reached the peak after being incubated for 10-16 days, and the highest enzyme activities were 55.0, 16.7, 45.4 and 60.5 U · g(-1), respectively. After 24 d of incubation, the degradation percentages of lignin, cellulose and hemicellulose were up to 42.9%, 40.6% and 27.1%, respectively. The spectroscopic data by FTIR indicated that the intensities of characteristic absorption peaks of lignin, cellulose and hemicellulose of the corn straw were decreased, indicating that the lignocellulose was degraded partly after being fermented by B. amyloliquefaciens MN-8. GC/MS analysis also demonstrated that strain MN-8 could degrade lignocellulose efficiently. It could depolymerize lignin into some monomeric compounds with retention of phenylpropane structure unit, such as amphetamine, benzene acetone and benzene propanoic acids, by the rupture of β-O-4 bond connected between lignin monomer, and it further oxidized some monomer compounds into Cα carbonyl compounds, such as 2-amino-1-benzeneacetone and 4-hydroxy-3,5-dimethoxy-acetophenone. The GC/MS analysis of the degradation products of cellulose and hemicellulose showed that there were not only monosaccharide compounds, such as glucose, mannose and galactose, but also some glycolysis products including formic acid, acetic acid, propionic acid, 1,1-ethanediol and 3-hydroxy butyric acid. Our results demonstrated that B. amyloliquefaciens MN-8 is capable of degrading lignocelluse of the corn straw effectively and the degradation capacity depends on the lignocellulase activity.
Rioja, R; García, M T; Peña, M; González, G
2008-06-01
Continuous decolourisation of wastewater from molasses fermentation using mycelium of Trametes versicolor in pellets shape was performed in an airlift bioreactor (semi-pilot scale) with the aim of operating steadily for a long period, maintaining the colour removal activity. The influences of influent flow and glucose feed rate were tested. Induction of peroxidases secretion by Mn(2+) addition was also studied. The efficiency of the decolourisation process was followed by monitoring colour and enzymatic activities. The experimental results showed that continuous decolourisation in an airlift bioreactor can be considered a suitable alternative for treating molasses fermentation wastewater. A colour removal yield around 60% remained practically constant during 23 days under continuous operation. Laccase was found to be the main enzyme secreted by the strain, being responsible for the decolourisation process. Mn(2+) addition was not likely to induct manganese-dependent peroxidase secretion.
Hermosilla, Edward; Schalchli, Heidi; Mutis, Ana; Diez, María Cristina
2017-09-01
Lignin is one of the main barriers to obtaining added-value products from cellulosic fraction of lignocellulosic biomass due to its random aromatic structure and strong association with cellulose and hemicellulose. Inorganic and organic compounds have been used as enzyme inducers to increase the ligninolytic potential of white-rot fungi, without considering their effect on the selectivity of degradation. In this study, the selective lignin degradation in wheat straw by Ganoderma lobatum was optimized using a central composite design to evaluate the combined effect of Fe 2+ and Mn 2+ as inducers of ligninolytic enzymes and NO 3 - as an additional nitrogen source. Selective lignin degradation was promoted to maximize lignin degradation and minimize weight losses. The optimal conditions were 0.18 M NO 3 - , 0.73 mM Fe 2+ , and 1 mM Mn 2+ , which resulted in 50.0% lignin degradation and 18.5% weight loss after 40 days of fungal treatment. A decrease in absorbance at 1505 and 900 cm -1 in fungal-treated samples was observed in the FTIR spectra, indicating lignin and cellulose degradation in fungal-treated wheat straw, respectively. The main ligninolytic enzymes detected during lignin degradation were manganese-dependent and manganese-independent peroxidases. Additionally, confocal laser scanning microscopy revealed that lignin degradation in wheat straw by G. lobatum resulted in higher cellulose accessibility. We concluded that the addition of enzyme inducers and NO 3 - promotes selective lignin degradation in wheat straw by G. lobatum.
Qi, Yan-Bing; Wang, Xiao-Lei; Shi, Ting; Liu, Shuchang; Xu, Zhen-Hao; Li, Xiqing; Shi, Xuling; Xu, Ping; Zhao, Yi-Lei
2015-11-28
Laccase catalyzes the oxidation of natural phenols and thereby is believed to initialize reactions in lignification and delignification. Numerous phenolic mediators have also been applied in laccase-mediator systems. However, reaction details after the primary O-H rupture of phenols remain obscure. In this work two types of isomeric phenols, EUG (eugenol) and ISO (trans-/cis-isoeugenol), were used as chemical probes to explore the enzymatic reaction pathways, with the combined methods of time-resolved UV-Vis absorption spectra, MCR-ALS, HPLC-MS, and quantum mechanical (QM) calculations. It has been found that the EUG-consuming rate is linear to its concentration, while the ISO not. Besides, an o-methoxy quinone methide intermediate, (E/Z)-4-allylidene-2-methoxycyclohexa-2,5-dienone, was evidenced in the case of EUG with the UV-Vis measurement, mass spectra and TD-DFT calculations; in contrast, an ISO-generating phenoxyl radical, a (E/Z)-2-methoxy-4-(prop-1-en-1-yl) phenoxyl radical, was identified in the case of ISO. Furthermore, QM calculations indicated that the EUG-generating phenoxyl radical (an O-centered radical) can easily transform into an allylic radical (a C-centered radical) by hydrogen atom transfer (HAT) with a calculated activation enthalpy of 5.3 kcal mol(-1) and then be fast oxidized to the observed eugenol quinone methide, rather than an O-radical alkene addition with barriers above 12.8 kcal mol(-1). In contrast, the ISO-generating phenoxyl radical directly undergoes a radical coupling (RC) process, with a barrier of 4.8 kcal mol(-1), while the HAT isomerization between O- and C-centered radicals has a higher reaction barrier of 8.0 kcal mol(-1). The electronic conjugation of the benzyl-type radical and the aromatic allylic radical leads to differentiation of the two pathways. These results imply that competitive reaction pathways exist for the nascent reactive intermediates generated in the laccase-catalyzed oxidation of natural phenols, which is important for understanding the lignin polymerization and may shed some light on the development of efficient laccase-mediator systems.
DeAngelis, Kristen M.; Sharma, Deepak; Varney, Rebecca; Simmons, Blake; Isern, Nancy G.; Markilllie, Lye Meng; Nicora, Carrie; Norbeck, Angela D.; Taylor, Ronald C.; Aldrich, Joshua T.; Robinson, Errol W.
2013-01-01
Lignocellulosic biofuels are promising as sustainable alternative fuels, but lignin inhibits access of enzymes to cellulose, and by-products of lignin degradation can be toxic to cells. The fast growth, high efficiency and specificity of enzymes employed in the anaerobic litter deconstruction carried out by tropical soil bacteria make these organisms useful templates for improving biofuel production. The facultative anaerobe Enterobacter lignolyticus SCF1 was initially cultivated from Cloud Forest soils in the Luquillo Experimental Forest in Puerto Rico, based on anaerobic growth on lignin as sole carbon source. The source of the isolate was tropical forest soils that decompose litter rapidly with low and fluctuating redox potentials, where bacteria using oxygen-independent enzymes likely play an important role in decomposition. We have used transcriptomics and proteomics to examine the observed increased growth of SCF1 grown on media amended with lignin compared to unamended growth. Proteomics suggested accelerated xylose uptake and metabolism under lignin-amended growth, with up-regulation of proteins involved in lignin degradation via the 4-hydroxyphenylacetate degradation pathway, catalase/peroxidase enzymes, and the glutathione biosynthesis and glutathione S-transferase (GST) proteins. We also observed increased production of NADH-quinone oxidoreductase, other electron transport chain proteins, and ATP synthase and ATP-binding cassette (ABC) transporters. This suggested the use of lignin as terminal electron acceptor. We detected significant lignin degradation over time by absorbance, and also used metabolomics to demonstrate moderately significant decreased xylose concentrations as well as increased metabolic products acetate and formate in stationary phase in lignin-amended compared to unamended growth conditions. Our data show the advantages of a multi-omics approach toward providing insights as to how lignin may be used in nature by microorganisms coping with poor carbon availability. PMID:24065962
Deangelis, Kristen M; Sharma, Deepak; Varney, Rebecca; Simmons, Blake; Isern, Nancy G; Markilllie, Lye Meng; Nicora, Carrie; Norbeck, Angela D; Taylor, Ronald C; Aldrich, Joshua T; Robinson, Errol W
2013-01-01
Lignocellulosic biofuels are promising as sustainable alternative fuels, but lignin inhibits access of enzymes to cellulose, and by-products of lignin degradation can be toxic to cells. The fast growth, high efficiency and specificity of enzymes employed in the anaerobic litter deconstruction carried out by tropical soil bacteria make these organisms useful templates for improving biofuel production. The facultative anaerobe Enterobacter lignolyticus SCF1 was initially cultivated from Cloud Forest soils in the Luquillo Experimental Forest in Puerto Rico, based on anaerobic growth on lignin as sole carbon source. The source of the isolate was tropical forest soils that decompose litter rapidly with low and fluctuating redox potentials, where bacteria using oxygen-independent enzymes likely play an important role in decomposition. We have used transcriptomics and proteomics to examine the observed increased growth of SCF1 grown on media amended with lignin compared to unamended growth. Proteomics suggested accelerated xylose uptake and metabolism under lignin-amended growth, with up-regulation of proteins involved in lignin degradation via the 4-hydroxyphenylacetate degradation pathway, catalase/peroxidase enzymes, and the glutathione biosynthesis and glutathione S-transferase (GST) proteins. We also observed increased production of NADH-quinone oxidoreductase, other electron transport chain proteins, and ATP synthase and ATP-binding cassette (ABC) transporters. This suggested the use of lignin as terminal electron acceptor. We detected significant lignin degradation over time by absorbance, and also used metabolomics to demonstrate moderately significant decreased xylose concentrations as well as increased metabolic products acetate and formate in stationary phase in lignin-amended compared to unamended growth conditions. Our data show the advantages of a multi-omics approach toward providing insights as to how lignin may be used in nature by microorganisms coping with poor carbon availability.
Effects of pH and Temperature on Recombinant Manganese Peroxidase Production and Stability
NASA Astrophysics Data System (ADS)
Jiang, Fei; Kongsaeree, Puapong; Schilke, Karl; Lajoie, Curtis; Kelly, Christine
The enzyme manganese peroxidase (MnP) is produced by numerous white-rot fungi to overcome biomass recalcitrance caused by lignin. MnP acts directly on lignin and increases access of the woody structure to synergistic wood-degrading enzymes such as cellulases and xylanases. Recombinant MnP (rMnP) can be produced in the yeast Pichia pastoris αMnP1-1 in fed-batch fermentations. The effects of pH and temperature on recombinant manganese peroxidase (rMnP) production by P. pastoris αMnP1-1 were investigated in shake flask and fed-batch fermentations. The optimum pH and temperature for a standardized fed-batch fermentation process for rMnP production in P. pastoris ctMnP1-1 were determined to be pH 6 and 30 °C, respectively. P. pastoris αMnP1-1 constitutively expresses the manganese peroxidase (mnp1) complementary DNA from Phanerochaete chrysosporium, and the rMnP has similar kinetic characteristics and pH activity and stability ranges as the wild-type MnP (wtMnP). Cultivation of P. chrysosporium mycelia in stationary flasks for production of heme peroxidases is commonly conducted at low pH (pH 4.2). However, shake flask and fed-batch fermentation experiments with P. pastoris αMnP1-1 demonstrated that rMnP production is highest at pH 6, with rMnP concentrations in the medium declining rapidly at pH less than 5.5, although cell growth rates were similar from pH 4-7. Investigations of the cause of low rMnP production at low pH were consistent with the hypothesis that intracellular proteases are released from dead and lysed yeast cells during the fermentation that are active against rMnP at pH less than 5.5.
P450 monooxygenases (P450ome) of the model white rot fungus Phanerochaete chrysosporium.
Syed, Khajamohiddin; Yadav, Jagjit S
2012-11-01
Phanerochaete chrysosporium, the model white rot fungus, has been the focus of research for the past about four decades for understanding the mechanisms and processes of biodegradation of the natural aromatic polymer lignin and a broad range of environmental toxic chemicals. The ability to degrade this vast array of xenobiotic compounds was originally attributed to its lignin-degrading enzyme system, mainly the extracellular peroxidases. However, subsequent physiological, biochemical, and/or genetic studies by us and others identified the involvement of a peroxidase-independent oxidoreductase system, the cytochrome P450 monooxygenase system. The whole genome sequence revealed an extraordinarily large P450 contingent (P450ome) with an estimated 149 P450s in this organism. This review focuses on the current status of understanding on the P450 monooxygenase system of P. chrysosproium in terms of pre-genomic and post-genomic identification, structural and evolutionary analysis, transcriptional regulation, redox partners, and functional characterization for its biodegradative potential. Future research on this catalytically diverse oxidoreductase enzyme system and its major role as a newly emerged player in xenobiotic metabolism/degradation is discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeAngelis, Kristen M.; Sharma, Deepak; Varney, Rebecca
2013-08-29
The anaerobic isolate Enterobacter lignolyticus SCF1 was initially cultivated based on anaerobic growth on lignin as sole carbon source. The source of the isolated bacteria was from tropical forest soils that decompose litter rapidly with low and fluctuating redox potentials, making it likely that bacteria using oxygen-independent enzymes play an important role in decomposition. We have examined differential expression of the anaerobic isolate Enterobacter lignolyticus SCF1 during growth on lignin. After 48 hours of growth, we used transcriptomics and proteomics to define the enzymes and other regulatory machinery that these organisms use to degrade lignin, as well as metabolomics tomore » measure lignin degradation and monitor the use of lignin and iron as terminal electron acceptors that facilitate more efficient use of carbon. Proteomics revealed accelerated xylose uptake and metabolism under lignin-amended growth, and lignin degradation via the 4-hydroxyphenylacetate degradation pathway, catalase/peroxidase enzymes, and the glutathione biosynthesis and glutathione S-transferase proteins. We also observed increased production of NADH-quinone oxidoreductase, other electron transport chain proteins, and ATP synthase and ATP-binding cassette (ABC) transporters. Our data shows the advantages of a multi-omics approach, where incomplete pathways identified by genomics were completed, and new observations made on coping with poor carbon availability. The fast growth, high efficiency and specificity of enzymes employed in bacterial anaerobic litter deconstruction makes these soils useful templates for improving biofuel production.« less
Wakabayashi, Kazuyuki; Soga, Kouichi; Hoson, Takayuki; Kotake, Toshihisa; Yamazaki, Takashi; Higashibata, Akira; Ishioka, Noriaki; Shimazu, Toru; Fukui, Keiji; Osada, Ikuko; Kasahara, Haruo; Kamada, Motoshi
2015-01-01
Network structures created by hydroxycinnamate cross-links within the cell wall architecture of gramineous plants make the cell wall resistant to the gravitational force of the earth. In this study, the effects of microgravity on the formation of cell wall-bound hydroxycinnamates were examined using etiolated rice shoots simultaneously grown under artificial 1 g and microgravity conditions in the Cell Biology Experiment Facility on the International Space Station. Measurement of the mechanical properties of cell walls showed that shoot cell walls became stiff during the growth period and that microgravity suppressed this stiffening. Amounts of cell wall polysaccharides, cell wall-bound phenolic acids, and lignin in rice shoots increased as the shoot grew. Microgravity did not influence changes in the amounts of cell wall polysaccharides or phenolic acid monomers such as ferulic acid (FA) and p-coumaric acid, but it suppressed increases in diferulic acid (DFA) isomers and lignin. Activities of the enzymes phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) in shoots also increased as the shoot grew. PAL activity in microgravity-grown shoots was almost comparable to that in artificial 1 g-grown shoots, while CW-PRX activity increased less in microgravity-grown shoots than in artificial 1 g-grown shoots. Furthermore, the increases in expression levels of some class III peroxidase genes were reduced under microgravity conditions. These results suggest that a microgravity environment modifies the expression levels of certain class III peroxidase genes in rice shoots, that the resultant reduction of CW-PRX activity may be involved in suppressing DFA formation and lignin polymerization, and that this suppression may cause a decrease in cross-linkages within the cell wall architecture. The reduction in intra-network structures may contribute to keeping the cell wall loose under microgravity conditions. PMID:26378793
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shrestha, Ruben; Chen, Xuejie; Ramyar, Kasra X.
Dye-decolorizing peroxidases (DyPs) are a family of heme peroxidases in which a catalytic distal aspartate is involved in H 2O 2 activation to catalyze oxidations under acidic conditions. They have received much attention due to their potential applications in lignin compound degradation and biofuel production from biomass. However, the mode of oxidation in bacterial DyPs remains unknown. We have recently reported that the bacterial TcDyP from Thermomonospora curvata is among the most active DyPs and shows activity toward phenolic lignin model compounds. On the basis of the X-ray crystal structure solved at 1.75 Å, sigmoidal steady-state kinetics with Reactive Bluemore » 19 (RB19), and formation of compound II like product in the absence of reducing substrates observed with stopped-flow spectroscopy and electron paramagnetic resonance (EPR), we hypothesized that the TcDyP catalyzes oxidation of large-size substrates via multiple surface-exposed protein radicals. Among 7 tryptophans and 3 tyrosines in TcDyP consisting of 376 residues for the matured protein, W263, W376, and Y332 were identified as surface-exposed protein radicals. Only the W263 was also characterized as one of the surface-exposed oxidation sites. SDS-PAGE and size-exclusion chromatography demonstrated that W376 represents an off-pathway destination for electron transfer, resulting in the cross-linking of proteins in the absence of substrates. Mutation of W376 improved compound I stability and overall catalytic efficiency toward RB19. While Y332 is highly conserved across all four classes of DyPs, its catalytic function in A-class TcDyP is minimal, possibly due to its extremely small solvent-accessible areas. Identification of surface-exposed protein radicals and substrate oxidation sites is important for understanding the DyP mechanism and modulating its catalytic functions for improved activity on phenolic lignin.« less
Amara, Sawsan; Perrot, Thomas; Navarro, David; Deroy, Aurélie; Benkhelfallah, Amine; Chalak, Amani; Daou, Marianne; Chevret, Didier; Faulds, Craig B; Berrin, Jean-Guy; Morel-Rouhier, Mélanie; Gelhaye, Eric; Record, Eric
2018-04-15
Trametes versicolor is a wood-inhabiting agaricomycete known for its ability to cause strong white-rot decay on hardwood and for its high tolerance of phenolic compounds. The goal of the present work was to gain insights into the molecular biology and biochemistry of the heme-including class II and dye-decolorizing peroxidases secreted by this fungus. Proteomic analysis of the secretome of T. versicolor BRFM 1218 grown on oak wood revealed a set of 200 secreted proteins, among which were the dye-decolorizing peroxidase Tv DyP1 and the versatile peroxidase Tv VP2. Both peroxidases were heterologously produced in Escherichia coli , biochemically characterized, and tested for the ability to oxidize complex substrates. Both peroxidases were found to be active against several substrates under acidic conditions, and Tv DyP1 was very stable over a relatively large pH range of 2.0 to 6.0, while Tv VP2 was more stable at pH 5.0 to 6.0 only. The thermostability of both enzymes was also tested, and Tv DyP1 was globally found to be more stable than Tv VP2. After 180 min of incubation at temperatures ranging from 30 to 50°C, the activity of Tv VP2 drastically decreased, with 10 to 30% of the initial activity retained. Under the same conditions, Tv DyP1 retained 20 to 80% of its enzyme activity. The two proteins were catalytically characterized, and Tv VP2 was shown to accept a wider range of reducing substrates than Tv DyP1. Furthermore, both enzymes were found to be active against two flavonoids, quercetin and catechin, found in oak wood, with Tv VP2 displaying more rapid oxidation of the two compounds. They were tested for the ability to decolorize five industrial dyes, and Tv VP2 presented a greater ability to oxidize and decolorize the dye substrates than Tv DyP1. IMPORTANCE Trametes versicolor is a wood-inhabiting agaricomycete known for its ability to cause strong white-rot decay on hardwood and for its high tolerance of phenolic compounds. Among white-rot fungi, the basidiomycete T. versicolor has been extensively studied for its ability to degrade wood, specifically lignin, thanks to an extracellular oxidative enzymatic system. The corresponding oxidative system was previously studied in several works for classical lignin and manganese peroxidases, and in this study, two new components of the oxidative system of T. versicolor , one dye-decolorizing peroxidase and one versatile peroxidase, were biochemically characterized in depth and compared to other fungal peroxidases. Copyright © 2018 American Society for Microbiology.
Kuuskeri, Jaana; Häkkinen, Mari; Laine, Pia; Smolander, Olli-Pekka; Tamene, Fitsum; Miettinen, Sini; Nousiainen, Paula; Kemell, Marianna; Auvinen, Petri; Lundell, Taina
2016-01-01
The white-rot Agaricomycetes species Phlebia radiata is an efficient wood-decaying fungus degrading all wood components, including cellulose, hemicellulose, and lignin. We cultivated P. radiata in solid state cultures on spruce wood, and extended the experiment to 6 weeks to gain more knowledge on the time-scale dynamics of protein expression upon growth and wood decay. Total proteome and transcriptome of P. radiata were analyzed by peptide LC-MS/MS and RNA sequencing at specific time points to study the enzymatic machinery on the fungus' natural growth substrate. According to proteomics analyses, several CAZy oxidoreductase class-II peroxidases with glyoxal and alcohol oxidases were the most abundant proteins produced on wood together with enzymes important for cellulose utilization, such as GH7 and GH6 cellobiohydrolases. Transcriptome additionally displayed expression of multiple AA9 lytic polysaccharide monooxygenases indicative of oxidative cleavage of wood carbohydrate polymers. Large differences were observed for individual protein quantities at specific time points, with a tendency of enhanced production of specific peroxidases on the first 2 weeks of growth on wood. Among the 10 class-II peroxidases, new MnP1-long, characterized MnP2-long and LiP3 were produced in high protein abundances, while LiP2 and LiP1 were upregulated at highest level as transcripts on wood together with the oxidases and one acetyl xylan esterase, implying their necessity as primary enzymes to function against coniferous wood lignin to gain carbohydrate accessibility and fungal growth. Majority of the CAZy encoding transcripts upregulated on spruce wood represented activities against plant cell wall and were identified in the proteome, comprising main activities of white-rot decay. Our data indicate significant changes in carbohydrate-active enzyme expression during the six-week surveillance of P. radiata growing on wood. Response to wood substrate is seen already during the first weeks. The immediate oxidative enzyme action on lignin and wood cell walls is supported by detected lignin substructure sidechain cleavages, release of phenolic units, and visual changes in xylem cell wall ultrastructure. This study contributes to increasing knowledge on fungal genetics and lignocellulose bioconversion pathways, allowing us to head for systems biology, development of biofuel production, and industrial applications on plant biomass utilizing wood-decay fungi.
Potential of extracellular enzymes from Trametes versicolor F21a in Microcystis spp. degradation.
Du, Jingjing; Pu, Gaozhong; Shao, Chen; Cheng, Shujun; Cai, Ji; Zhou, Liang; Jia, Yong; Tian, Xingjun
2015-03-01
Studies have shown that microorganisms may be used to eliminate cyanobacteria in aquatic environments. The present study showed that the white-rot fungus Trametes versicolor F21a could degrade Microcystis aeruginosa. After T. versicolor F21a and Microcystis spp. were co-incubated for 60h, >96% of Microcystis spp. cells were degraded by T. versicolor F21a. The activities of extracellular enzymes showed that cellulase, β-glucosidase, protease, and laccase were vital to Microcystis spp. degradation in the early stage (0h to 24h), while β-glucosidase, protease, laccase, and manganese peroxidase in the late stage (24h to 60h). The positive and significant correlation of the degradation rate with these enzyme activities indicated that these enzymes were involved in the degradation rate of Microcystis spp. cells at different phases. It suggested that the extracellular enzymes released by T. versicolor F21a might be vital to Microcystis spp. degradation. The results of this study may be used to develop alternative microbial control agents for cyanobacterial control. Copyright © 2014 Elsevier B.V. All rights reserved.
Raymond, Prosper; Mshandete, Anthony Manoni; Kajumulo Kivaisi, Amelia
2015-01-01
The activity of oxidative and hydrolytic enzymes of the edible and medicinal white rot fungi Coprinus cinereus (Schaeff.) Gray mushroom was observed during mycelia growth and fruiting body development in solid substrate fermentation using sisal waste fractions amended with cow dung manure as supplement. Laccase had the highest titre value among the five detected enzymes. Its activity was higher during mycelia growth compared to fruiting phase, with 10% supplemented substrate formulation unmixed sisal leaf decortication residues [abbreviated SL : SB (100 : 0)] displaying the highest activity of 39.45 ± 12.05 Ug−1. Lignin peroxidase (LiP) exhibited a characteristic wave-like pattern with the highest peaks found either during full mycelia colonization or soon after first flush harvest; the highest activity of 1.93 ± 0.62 Ug−1 was observed on unsupplemented SL : SB (100 : 0) substrate formulation during mycelia colonization. For hydrolytic enzymes, the highest carboxymethyl cellulase (CMCase) activity of 2.03 ± 0.70 Ug−1 was observed on 20% supplemented SL : SB (0 : 100) after first flush; that of pectinase (1.90 ± 0.32 Ug−1) was revealed after third flush on 10% supplemented SL : SB (0 : 100) substrate formulation while 10% supplemented SL : SB (25 : 75) exhibited the highest xylanase activity (1.23 ± 0.12 Ug−1) after first flush. These findings show that the activities of both oxidative and hydrolytic enzymes were regulated in line with developmental phase of growth of Coprinus cinereus. PMID:26664748
Flammulina velutipes: An option for "alperujo" use.
Rugolo, Maximiliano; Levin, Laura; Lechner, Bernardo Ernesto
Two-phase olive-mill wastes (or "alperujo") exhibit highly phytotoxic properties, mainly due to phenols. A valuable option for alperujo is its agricultural use, provided that no phytotoxic effects occur. The present investigation was aimed at evaluating the efficacy of two strains of the lignin-degrading fungus Flammulina velutipes to colonize alperujo in order to produce edible mushrooms and to achieve its detoxification. Some important cultural characters related to mushroom production (earliness, biological efficiency and quality of basidiomes) were estimated. The production of lignocellulolytic enzymes, phenol removal and detoxification of the substrate was evaluated. High biological efficiencies (70.8%) were obtained at 12°C with F. velutipes strain BAFC 670/06 in a substrate containing poplar wood shavings and 90% of alperujo. The nature of the substrate did not seem to exert an important influence on pileus and stem morphology; nevertheless shortest stems were observed at higher temperatures. Endo-β-1,4-glucanase, endo-β-1,4-xylanase, laccase and Mn-peroxidase activities were detected in the extracts recovered from the solid-state cultures. Both F. velutipes strains were effective in removing the phenolic compounds. The initial concentration in the substrate with 90% alperujo was reduced in the case of F. velutipes BAFC 1763 by 84.31%, and 40.15% by F. velutipes BAFC 670/06. Germinability experiments on Raphanus sativus, showed that alperujo phytotoxicity was significantly reduced by F. velutipes cultures. The experimented changes by the spent mushroom substrate resulting from F. velutipes cultivation with high amount of alperujo would allow its reuse for agricultural purposes. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.
Delayed fungal evolution did not cause the Paleozoic peak in coal production.
Nelsen, Matthew P; DiMichele, William A; Peters, Shanan E; Boyce, C Kevin
2016-03-01
Organic carbon burial plays a critical role in Earth systems, influencing atmospheric O2 and CO2 concentrations and, thereby, climate. The Carboniferous Period of the Paleozoic is so named for massive, widespread coal deposits. A widely accepted explanation for this peak in coal production is a temporal lag between the evolution of abundant lignin production in woody plants and the subsequent evolution of lignin-degrading Agaricomycetes fungi, resulting in a period when vast amounts of lignin-rich plant material accumulated. Here, we reject this evolutionary lag hypothesis, based on assessment of phylogenomic, geochemical, paleontological, and stratigraphic evidence. Lignin-degrading Agaricomycetes may have been present before the Carboniferous, and lignin degradation was likely never restricted to them and their class II peroxidases, because lignin modification is known to occur via other enzymatic mechanisms in other fungal and bacterial lineages. Furthermore, a large proportion of Carboniferous coal horizons are dominated by unlignified lycopsid periderm with equivalent coal accumulation rates continuing through several transitions between floral dominance by lignin-poor lycopsids and lignin-rich tree ferns and seed plants. Thus, biochemical composition had little relevance to coal accumulation. Throughout the fossil record, evidence of decay is pervasive in all organic matter exposed subaerially during deposition, and high coal accumulation rates have continued to the present wherever environmental conditions permit. Rather than a consequence of a temporal decoupling of evolutionary innovations between fungi and plants, Paleozoic coal abundance was likely the result of a unique combination of everwet tropical conditions and extensive depositional systems during the assembly of Pangea.
Delayed fungal evolution did not cause the Paleozoic peak in coal production
Nelsen, Matthew P.; DiMichele, William A.; Peters, Shanan E.; Boyce, C. Kevin
2016-01-01
Organic carbon burial plays a critical role in Earth systems, influencing atmospheric O2 and CO2 concentrations and, thereby, climate. The Carboniferous Period of the Paleozoic is so named for massive, widespread coal deposits. A widely accepted explanation for this peak in coal production is a temporal lag between the evolution of abundant lignin production in woody plants and the subsequent evolution of lignin-degrading Agaricomycetes fungi, resulting in a period when vast amounts of lignin-rich plant material accumulated. Here, we reject this evolutionary lag hypothesis, based on assessment of phylogenomic, geochemical, paleontological, and stratigraphic evidence. Lignin-degrading Agaricomycetes may have been present before the Carboniferous, and lignin degradation was likely never restricted to them and their class II peroxidases, because lignin modification is known to occur via other enzymatic mechanisms in other fungal and bacterial lineages. Furthermore, a large proportion of Carboniferous coal horizons are dominated by unlignified lycopsid periderm with equivalent coal accumulation rates continuing through several transitions between floral dominance by lignin-poor lycopsids and lignin-rich tree ferns and seed plants. Thus, biochemical composition had little relevance to coal accumulation. Throughout the fossil record, evidence of decay is pervasive in all organic matter exposed subaerially during deposition, and high coal accumulation rates have continued to the present wherever environmental conditions permit. Rather than a consequence of a temporal decoupling of evolutionary innovations between fungi and plants, Paleozoic coal abundance was likely the result of a unique combination of everwet tropical conditions and extensive depositional systems during the assembly of Pangea. PMID:26787881
Kim, Hoon; Ralph, John; Lu, Fachuang; Ralph, Sally A; Boudet, Alain M; MacKay, John J; Sederoff, Ronald R; Ito, Takashi; Kawai, Shingo; Ohashi, Hideo; Higuchi, Takayoshi
2003-01-21
Peroxidase/H2O2-mediated radical coupling of 4-hydroxycinnamaldehydes produces 8-O-4-, 8-5-, and 8-8-coupled dehydrodimers as has been documented earlier, as well as the 5-5-coupled dehydrodimer. The 8-5-dehydrodimer is however produced kinetically in its cyclic phenylcoumaran form at neutral pH. Synthetic polymers produced from mixtures of hydroxycinnamaldehydes and normal monolignols provide the next level of complexity. Spectral data from dimers, oligomers, and synthetic polymers have allowed a more substantive assignment of aldehyde components in lignins isolated from a CAD-deficient pine mutant and an antisense-CAD-downregulated transgenic tobacco. CAD-deficient pine lignin shows enhanced levels of the typical benzaldehyde and cinnamaldehyde end-groups, along with evidence for two types of 8-O-4-coupled coniferaldehyde units. The CAD-downregulated tobacco also has higher levels of hydroxycinnamaldehyde and hydroxybenzaldehyde (mainly syringaldehyde) incorporation, but the analogous two types of 8-O-4-coupled products are the dominant features. 8-8-Coupled units are also clearly evident. There is clear evidence for coupling of hydroxycinnamaldehydes to each other and then incorporation into the lignin, as well as for the incorporation of hydroxycinnamaldehyde monomers into the growing lignin polymer. Coniferaldehyde and sinapaldehyde (as well as vanillin and syringaldehyde) co-polymerize with the traditional monolignols into lignins and do so at enhanced levels when CAD-deficiency has an impact on the normal monolignol production. The implication is that, particularly in angiosperms, the aldehydes behave like the traditional monolignols and should probably be regarded as authentic lignin monomers in normal and CAD-deficient plants.
Tricin, a Flavonoid Monomer in Monocot Lignification1[OPEN
Lan, Wu; Lu, Fachuang; Regner, Matthew; Zhu, Yimin; Rencoret, Jorge; Ralph, Sally A.; Zakai, Uzma I.; Morreel, Kris; Boerjan, Wout; Ralph, John
2015-01-01
Tricin was recently discovered in lignin preparations from wheat (Triticum aestivum) straw and subsequently in all monocot samples examined. To provide proof that tricin is involved in lignification and establish the mechanism by which it incorporates into the lignin polymer, the 4′-O-β-coupling products of tricin with the monolignols (p-coumaryl, coniferyl, and sinapyl alcohols) were synthesized along with the trimer that would result from its 4′-O-β-coupling with sinapyl alcohol and then coniferyl alcohol. Tricin was also found to cross couple with monolignols to form tricin-(4′-O-β)-linked dimers in biomimetic oxidations using peroxidase/hydrogen peroxide or silver (I) oxide. Nuclear magnetic resonance characterization of gel permeation chromatography-fractionated acetylated maize (Zea mays) lignin revealed that the tricin moieties are found in even the highest molecular weight fractions, ether linked to lignin units, demonstrating that tricin is indeed incorporated into the lignin polymer. These findings suggest that tricin is fully compatible with lignification reactions, is an authentic lignin monomer, and, because it can only start a lignin chain, functions as a nucleation site for lignification in monocots. This initiation role helps resolve a long-standing dilemma that monocot lignin chains do not appear to be initiated by monolignol homodehydrodimerization as they are in dicots that have similar syringyl-guaiacyl compositions. The term flavonolignin is recommended for the racemic oligomers and polymers of monolignols that start from tricin (or incorporate other flavonoids) in the cell wall, in analogy with the existing term flavonolignan that is used for the low-molecular mass compounds composed of flavonoid and lignan moieties. PMID:25667313
Lignin-solubilizing ability of actinomycetes isolated from termite (Termitidae) gut.
Pasti, M B; Pometto, A L; Nuti, M P; Crawford, D L
1990-01-01
The lignocellulose-degrading abilities of 11 novel actinomycete strains isolated from termite gut were determined and compared with that of the well-characterized actinomycete, Streptomyces viridosporus T7A. Lignocellulose bioconversion was followed by (i) monitoring the degradation of [14C]lignin- and [14C]cellulose-labeled phloem of Abies concolor to 14CO2 and 14C-labeled water-soluble products, (ii) determining lignocellulose, lignin, and carbohydrate losses resulting from growth on a lignocellulose substrate prepared from corn stalks (Zea mays), and (iii) quantifying production of a water-soluble lignin degradation intermediate (acid-precipitable polymeric lignin). The actinomycetes were all Streptomyces strains and could be placed into three groups, including a group of five strains that appear superior to S. viridosporus T7A in lignocellulose-degrading ability, three strains of approximately equal ability, and three strains of lesser ability. Strain A2 was clearly the superior and most effective lignocellulose decomposer of those tested. Of the assays used, total lignocellulose weight loss was most useful in determining overall bioconversion ability but not in identifying the best lignin-solubilizing strains. A screening procedure based on 14CO2 evolution from [14C-lignin]lignocellulose combined with measurement of acid-precipitable polymeric lignin yield was the most effective in identifying lignin-solubilizing strains. For the termite gut strains, the pH of the medium showed no increase after 3 weeks of growth on lignocellulose. This is markedly different from the pattern observed with S. viridosporus T7A, which raises the medium pH considerably. Production of extracellular peroxidases by the 11 strains and S. viridosporus T7A was followed for 5 days in liquid cultures.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2167628
Evaluation of lignin-based black liquor decolorization by Trametes versicolor U 80
NASA Astrophysics Data System (ADS)
Amriani, Feni; Sari, Ajeng Arum; R. Irni Fitria, A.; Abimanyu, Haznan; Tachibana, Sanro
2017-01-01
Bioethanol second generation (G-2) production process generated black liquor that need to treat before the disposal to prevent environmental pollution. Usually, coagulation technology using polyaluminium chloride was employed to precipitate dissolved lignin and intended to decolorize black liquor. However, this single work is not effective to treat black liquor, so that it requires another work to treat remain brownish liquor. Isolated fungal strain from Japan Trametes versicolor U 80 and Phanerochaete chrysosporium are white rot fungi that are known in ligninolytic enzymes secretion to biodegrade soluble lignin. Decolorization of black and brownish liquor is an indicator of fungi works since lignin is known as the colour agent in liquor colouration. This work evaluated black and brownish liquor decolorization using both fungi that correspond to fungal growth. Liquor toxicity was observed based on mycelial dry weight after 30 days incubation as the presumption of the connection of fungal growth and decolorization. The biosorption from the dead cell was also evaluated for fungal adsorption capability in black and brownish decolorization. As the result, T. versicolor U 80 was able to decolorize brownish liquor 51.5% after 21 days incubation and 68.6% black liquor at 15 days incubation. MnP and Laccase enzymes activity in 15 and 21 days are correlated to those decolorized results. The dead cell was also able to decolorize 67.3% brownish liquor and 25.1% black liquor after 15 days incubation as biosorption mechanism. This research described fungal potential in decolorization as the simple black liquor treatment technology and gave valuable information related to environmental friendly decolorization process.
Copete-Pertuz, Ledys S; Plácido, Jersson; Serna-Galvis, Efraím A; Torres-Palma, Ricardo A; Mora, Amanda
2018-07-15
In this work, Leptosphaerulina sp. (a Colombian native fungus) significantly removed three Isoxazolyl-Penicillin antibiotics (IP): oxacillin (OXA, 16000 μg L -1 ), cloxacillin (CLX, 17500 μg L -1 ) and dicloxacillin (DCX, 19000 μg L -1 ) from water. The biological treatment was performed at pH 5.6, 28 °C, and 160 rpm for 15 days. The biotransformation process and lack of toxicity of the final solutions (antibacterial activity (AA) and cytotoxicity) were tested. The role of enzymes in IP removal was analysed through in vitro studies with enzymatic extracts (crude and pre-purified) from Leptosphaerulina sp., commercial enzymes and enzymatic inhibitors. Furthermore, the applicability of mycoremediation process to a complex matrix (simulated hospital wastewater) was evaluated. IP were considerably abated by the fungus, OXA was the fastest degraded (day 6), followed by CLX (day 7) and DCX (day 8). Antibiotics biodegradation was associated to laccase and versatile peroxidase action. Assays using commercial enzymes (i.e. laccase from Trametes versicolor and horseradish peroxidase) and inhibitors (EDTA, NaCl, sodium acetate, manganese (II) ions) confirmed the significant role of enzymatic transformation. Whereas, biomass sorption was not an important process in the antibiotics elimination. Evaluation of AA against Staphylococcus aureus ATCC 6538 revealed that Leptosphaerulina sp. also eliminated the AA. In addition, the cytotoxicity assay (MTT) on the HepG2 cell line demonstrated that the IP final solutions were non-toxic. Finally, Leptosphaerulina sp. eliminated OXA and its AA from synthetic hospital wastewater at 6 days. All these results evidenced the potential of Leptosphaerulina sp. mycoremediation as a novel environmentally friendly process for the removal of IP from aqueous systems. Copyright © 2018 Elsevier B.V. All rights reserved.
Diez, M C; Gallardo, F; Tortella, G; Rubilar, O; Navia, R; Bornhardt, C
2012-03-01
The white-rot fungus Anthracophyllum discolor immobilized on wheat grains was evaluated for chlorophenol (2,4-dichlorophenol, 2,4,6-trichlorophenol and pentachlorophenol) degradation in allophanic soil columns activated by acidification. Columns without inoculation were used as the control to evaluate the adsorption capacity of the soil columns. The chlorophenols were removed efficiently in soil columns by both adsorption and degradation processes. In inoculated soil columns, 2,4-dichlorophenol was highly degraded and this degradation is associated with a high production of manganese peroxidase. 2,4,6-trichlorophenol was degraded to a lesser extent compared with 2,4-dichlorophenol. Pentachlorophenol was first removed by adsorption and then through degradation by the fungus. Manganese peroxidase activity was lowest when the column was fed with pentachlorophenol and highest when the column was fed with 2,4-dichlorophenol. Laccase was also produced by the fungus but to a lesser degree. Copyright © 2010 Elsevier Ltd. All rights reserved.
Amber Vanden Wymelenberg; Bernard Janse; Jill Gaskell; Diane Dietrich; Marcelo Vallim; Dan Cullen
1998-01-01
We describe here recent methods for quantitative assessment of specific P. chrysosporium mRNAs in organopollutant contaminated soils and in Aspen wood chips. Magnetic capture techniques were used to rapidly purify poly(A)-RNA, and quantitative RT-PCR protocols were developed for all known lignin peroxidase (lip) and cellobiohydrolase (cbh1) genes. The methodology is...
Harshavardhan Doddapaneni; Venkataramanan Subramanian; Bolei Fu; Dan Cullen
2013-01-01
The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three...
Yadav, J S; Reddy, C A
1993-01-01
Degradation of the BTEX (benzene, toluene, ethylbenzene, and o-, m-, and p-xylenes) group of organopollutants by the white-rot fungus Phanerochaete chrysosporium was studied. Our results show that the organism efficiently degrades all the BTEX components when these compounds are added either individually or as a composite mixture. Degradation was favored under nonligninolytic culture conditions in malt extract medium, in which extracellular lignin peroxidases (LIPs) and manganese-dependent peroxidases (MNPs) are not produced. The noninvolvement of LIPs and MNPs in BTEX degradation was also evident from in vitro studies using concentrated extracellular fluid containing LIPs and MNPs and from a comparison of the extents of BTEX degradation by the wild type and the per mutant, which lacks LIPs and MNPs. A substantially greater extent of degradation of all the BTEX compounds was observed in static than in shaken liquid cultures. Furthermore, the level of degradation was relatively higher at 25 than at 37 degrees C, but pH variations between 4.5 and 7.0 had little effect on the extent of degradation. Studies with uniformly ring-labeled [14C]benzene and [14C]toluene showed substantial mineralization of these compounds to 14CO2. PMID:8481002
Enhancement of Environmental Hazard Degradation in the Presence of Lignin: a Proteomics Study
Sun, Su; Xie, Shangxian; Cheng, Yanbing; ...
2017-09-12
Proteomics studies of fungal systems have progressed dramatically based on the availability of more fungal genome sequences in recent years. Different proteomics strategies have been applied toward characterization of fungal proteome and revealed important gene functions and proteome dynamics. Presented here is the application of shot-gun proteomic technology to study the bio-remediation of environmental hazards by white-rot fungus. Lignin, a naturally abundant component of the plant biomass, is discovered to promote the degradation of Azo dye by white-rot fungus Irpex lacteus CD2 in the lignin/dye/fungus system. Shotgun proteomics technique was used to understand degradation mechanism at the protein level formore » the lignin/dye/fungus system. Our proteomics study can identify about two thousand proteins (one third of the predicted white-rot fungal proteome) in a single experiment, as one of the most powerful proteomics platforms to study the fungal system to date. The study shows a significant enrichment of oxidoreduction functional category under the dye/lignin combined treatment. An in vitro validation is performed and supports our hypothesis that the synergy of Fenton reaction and manganese peroxidase might play an important role in DR5B dye degradation. The results could guide the development of effective bioremediation strategies and efficient lignocellulosic biomass conversion.« less
Enhancement of Environmental Hazard Degradation in the Presence of Lignin: a Proteomics Study.
Sun, Su; Xie, Shangxian; Cheng, Yanbing; Yu, Hongbo; Zhao, Honglu; Li, Muzi; Li, Xiaotong; Zhang, Xiaoyu; Yuan, Joshua S; Dai, Susie Y
2017-09-12
Proteomics studies of fungal systems have progressed dramatically based on the availability of more fungal genome sequences in recent years. Different proteomics strategies have been applied toward characterization of fungal proteome and revealed important gene functions and proteome dynamics. Presented here is the application of shot-gun proteomic technology to study the bio-remediation of environmental hazards by white-rot fungus. Lignin, a naturally abundant component of the plant biomass, is discovered to promote the degradation of Azo dye by white-rot fungus Irpex lacteus CD2 in the lignin/dye/fungus system. Shotgun proteomics technique was used to understand degradation mechanism at the protein level for the lignin/dye/fungus system. Our proteomics study can identify about two thousand proteins (one third of the predicted white-rot fungal proteome) in a single experiment, as one of the most powerful proteomics platforms to study the fungal system to date. The study shows a significant enrichment of oxidoreduction functional category under the dye/lignin combined treatment. An in vitro validation is performed and supports our hypothesis that the synergy of Fenton reaction and manganese peroxidase might play an important role in DR5B dye degradation. The results could guide the development of effective bioremediation strategies and efficient lignocellulosic biomass conversion.
Enhancement of Environmental Hazard Degradation in the Presence of Lignin: a Proteomics Study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Su; Xie, Shangxian; Cheng, Yanbing
Proteomics studies of fungal systems have progressed dramatically based on the availability of more fungal genome sequences in recent years. Different proteomics strategies have been applied toward characterization of fungal proteome and revealed important gene functions and proteome dynamics. Presented here is the application of shot-gun proteomic technology to study the bio-remediation of environmental hazards by white-rot fungus. Lignin, a naturally abundant component of the plant biomass, is discovered to promote the degradation of Azo dye by white-rot fungus Irpex lacteus CD2 in the lignin/dye/fungus system. Shotgun proteomics technique was used to understand degradation mechanism at the protein level formore » the lignin/dye/fungus system. Our proteomics study can identify about two thousand proteins (one third of the predicted white-rot fungal proteome) in a single experiment, as one of the most powerful proteomics platforms to study the fungal system to date. The study shows a significant enrichment of oxidoreduction functional category under the dye/lignin combined treatment. An in vitro validation is performed and supports our hypothesis that the synergy of Fenton reaction and manganese peroxidase might play an important role in DR5B dye degradation. The results could guide the development of effective bioremediation strategies and efficient lignocellulosic biomass conversion.« less
NASA Astrophysics Data System (ADS)
Caicedo, Hector M.; Dempere, Luisa A.; Vermerris, Wilfred
2012-03-01
Limitations of cylindrical carbon nanotubes based on the buckminsterfullerene structure as delivery vehicles for therapeutic agents include their chemical inertness, sharp edges and toxicological concerns. As an alternative, we have developed lignin-based nanotubes synthesized in a sacrificial template of commercially available alumina membranes. Lignin is a complex phenolic plant cell wall polymer that is generated as a waste product from paper mills and biorefineries that process lignocellulosic biomass into fuels and chemicals. We covalently linked isolated lignin to the inner walls of activated alumina membranes and then added layers of dehydrogenation polymer onto this base layer via a peroxidase-catalyzed reaction. By using phenolic monomers displaying different reactivities, we were able to change the thickness of the polymer layer deposited within the pores, resulting in the synthesis of nanotubes with a wall thickness of approximately 15 nm or nanowires with a nominal diameter of 200 nm. These novel nanotubes are flexible and can be bio-functionalized easily and specifically, as shown by in vitro assays with biotin and Concanavalin A. Together with their intrinsic optical properties, which can also be varied as a function of their chemical composition, these lignin-based nanotubes are expected to enable a variety of new applications including as delivery systems that can be easily localized and imaged after uptake by living cells.
Mäkinen, Mari A; Risulainen, Netta; Mattila, Hans; Lundell, Taina K
2018-05-04
Previously identified twelve plant cell wall degradation-associated genes of the white rot fungus Phlebia radiata were studied by RT-qPCR in semi-aerobic solid-state cultures on lignocellulose waste material, and on glucose-containing reference medium. Wood-decay-involved enzyme activities and ethanol production were followed to elucidate both the degradative and fermentative processes. On the waste lignocellulose substrate, P. radiata carbohydrate-active enzyme (CAZy) genes encoding cellulolytic and hemicellulolytic activities were significantly upregulated whereas genes involved in lignin modification displayed a more complex response. Two lignin peroxidase genes were differentially expressed on waste lignocellulose compared to glucose medium, whereas three manganese peroxidase-encoding genes were less affected. On the contrary, highly significant difference was noticed for three cellulolytic genes (cbhI_1, eg1, bgl1) with higher expression levels on the lignocellulose substrate than on glucose. This indicates expression of the wood-attacking degradative enzyme system by the fungus also on the recycled, waste core board material. During the second week of cultivation, ethanol production increased on the core board to 0.24 g/L, and extracellular activities against cellulose, xylan, and lignin were detected. Sugar release from the solid lignocellulose resulted with concomitant accumulation of ethanol as fermentation product. Our findings confirm that the fungus activates its white rot decay system also on industrially processed lignocellulose adopted as growth substrate, and under semi-aerobic cultivation conditions. Thus, P. radiata is a good candidate for lignocellulose-based renewable biotechnology to make biofuels and biocompounds from materials with less value for recycling or manufacturing.
One-Pot Enzymatic Production of Lignin-Composites.
Ion, Sabina; Opris, Cristina; Cojocaru, Bogdan; Tudorache, Madalina; Zgura, Irina; Galca, Aurelian C; Bodescu, Adina M; Enache, Madalin; Maria, Gabriel-Mihai; Parvulescu, Vasile I
2018-01-01
A novel and efficient one-pot system for green production of artificial lignin bio-composites has been developed. Monolignols such as sinapyl (SA) and coniferyl (CA) alcohols were linked together with caffeic acid (CafAc) affording a polymeric network similar with natural lignin. The interaction of the dissolved SA/CA with CafAc already bound on a solid support (S C2 /S C6 -CafAc) allowed the attachment of the polymeric product direct on the support surface (S C2 /S C6 -CafAc-L 1 and S C2 /S C6 -CafAc-L 2 , from CA and SA, respectively). Accordingly, this procedure offers the advantage of a simultaneous polymer production and deposition. Chemically, oxi-copolymerization of phenolic derivatives (SA/CA and CAfAc) was performed with H 2 O 2 as oxidation reagent using peroxidase enzyme (2-1B mutant of versatile peroxidase from Pleurotus eryngii ) as catalyst. The system performance reached a maximum of conversion for SA and CA of 71.1 and 49.8%, respectively. The conversion is affected by the system polarity as resulted from the addition of a co-solvent (e.g., MeOH, EtOH, or THF). The chemical structure, morphology, and properties of the bio-composites surface were investigated using different techniques, e.g., FTIR, TPD-NH 3 , TGA, contact angle, and SEM. Thus, it was demonstrated that the SA monolignol favored bio-composites with a dense polymeric surface, high acidity, and low hydrophobicity, while CA allowed the production of thinner polymeric layers with high hydrophobicity.
Ring, Ludwig; Yeh, Su-Ying; Hücherig, Stephanie; Hoffmann, Thomas; Blanco-Portales, Rosario; Fouche, Mathieu; Villatoro, Carmen; Denoyes, Béatrice; Monfort, Amparo; Caballero, José Luis; Muñoz-Blanco, Juan; Gershenson, Jonathan; Schwab, Wilfried
2013-01-01
Plant phenolics have drawn increasing attention due to their potential nutritional benefits. Although the basic reactions of the phenolics biosynthetic pathways in plants have been intensively analyzed, the regulation of their accumulation and flux through the pathway is not that well established. The aim of this study was to use a strawberry (Fragaria × ananassa) microarray to investigate gene expression patterns associated with the accumulation of phenylpropanoids, flavonoids, and anthocyanins in strawberry fruit. An examination of the transcriptome, coupled with metabolite profiling data from different commercial varieties, was undertaken to identify genes whose expression correlated with altered phenolics composition. Seventeen comparative microarray analyses revealed 15 genes that were differentially (more than 200-fold) expressed in phenolics-rich versus phenolics-poor varieties. The results were validated by heterologous expression of the peroxidase FaPRX27 gene, which showed the highest altered expression level (more than 900-fold). The encoded protein was functionally characterized and is assumed to be involved in lignin formation during strawberry fruit ripening. Quantitative trait locus analysis indicated that the genomic region of FaPRX27 is associated with the fruit color trait. Down-regulation of the CHALCONE SYNTHASE gene and concomitant induction of FaPRX27 expression diverted the flux from anthocyanins to lignin. The results highlight the competition of the different phenolics pathways for their common precursors. The list of the 15 candidates provides new genes that are likely to impact polyphenol accumulation in strawberry fruit and could be used to develop molecular markers to select phenolics-rich germplasm. PMID:23835409
Relative binding affinities of monolignols to horseradish peroxidase
Sangha, Amandeep K.; Petridis, Loukas; Cheng, Xiaolin; ...
2016-07-22
Monolignol binding to the peroxidase active site is the first step in lignin polymerization in plant cell walls. Using molecular dynamics, docking, and free energy perturbation calculations, we investigate the binding of monolignols to horseradish peroxidase C. Our results suggest that p-coumaryl alcohol has the strongest binding affinity followed by sinapyl and coniferyl alcohol. Stacking interactions between the monolignol aromatic rings and nearby phenylalanine residues play an important role in determining the calculated relative binding affinities. p-Coumaryl and coniferyl alcohols bind in a pose productive for reaction in which a direct H-bond is formed between the phenolic –OH group andmore » a water molecule (W2) that may facilitate proton transfer during oxidation. In contrast, in the case of sinapyl alcohol there is no such direct interaction, the phenolic –OH group instead interacting with Pro139. Furthermore, since proton and electron transfer is the rate-limiting step in monolignol oxidation by peroxidase, the binding pose (and thus the formation of near attack conformation) appears to play a more important role than the overall binding affinity in determining the oxidation rate.« less
Rekik, Hatem; Nadia, Zaraî Jaouadi; Bejar, Wacim; Kourdali, Sidali; Belhoul, Mouna; Hmidi, Maher; Benkiar, Amina; Badis, Abdelmalek; Sallem, Naim; Bejar, Samir; Jaouadi, Bassem
2015-02-01
A novel extracellular lignin peroxidase (called LiP-SN) was produced and purified from a newly isolated Streptomyces griseosporeus strain SN9. The findings revealed that the pure enzyme was a monomeric protein with an estimated molecular mass of 43 kDa and a Reinheitzahl value of 1.63. The 19 N-terminal residue sequence of LiP-SN showed high homology with those of Streptomyces peroxidases. Its optimum pH and temperature were pH 8.5 and 65 °C, respectively. The enzyme was inhibited by sodium azide and potassium cyanide, suggesting the presence of heme components in its tertiary structure. Its catalytic efficiency was higher than that of the peroxidase from Streptomyces albidoflavus strain TN644. Interestingly, LiP-SN showed marked dye-decolorization efficiency and stability toward denaturing, oxidizing, and bleaching agents, and compatibility with EcoVax and Dipex as laundry detergents for 48 h at 40 °C. These properties make LiP-SN a potential candidate for future applications in distaining synthetic dyes and detergent formulations. Copyright © 2014 Elsevier B.V. All rights reserved.
2012-01-01
Background Lignin is an integral component of the plant cell wall matrix but impedes the conversion of biomass into biofuels. The plasticity of lignin biosynthesis should permit the inclusion of new compatible phenolic monomers such as flavonoids into cell wall lignins that are consequently less recalcitrant to biomass processing. In the present study, epigallocatechin gallate (EGCG) was evaluated as a potential lignin bioengineering target for rendering biomass more amenable to processing for biofuel production. Results In vitro peroxidase-catalyzed polymerization experiments revealed that both gallate and pyrogallyl (B-ring) moieties in EGCG underwent radical cross-coupling with monolignols mainly by β–O–4-type cross-coupling, producing benzodioxane units following rearomatization reactions. Biomimetic lignification of maize cell walls with a 3:1 molar ratio of monolignols and EGCG permitted extensive alkaline delignification of cell walls (72 to 92%) that far exceeded that for lignified controls (44 to 62%). Alkali-insoluble residues from EGCG-lignified walls yielded up to 34% more glucose and total sugars following enzymatic saccharification than lignified controls. Conclusions It was found that EGCG readily copolymerized with monolignols to become integrally cross-coupled into cell wall lignins, where it greatly enhanced alkaline delignification and subsequent enzymatic saccharification. Improved delignification may be attributed to internal trapping of quinone-methide intermediates to prevent benzyl ether cross-linking of lignin to structural polysaccharides during lignification, and to the cleavage of ester intra-unit linkages within EGCG during pretreatment. Overall, our results suggest that apoplastic deposition of EGCG for incorporation into lignin would be a promising plant genetic engineering target for improving the delignification and saccharification of biomass crops. PMID:22889353
[Biosynthesis of gold nanoparticles by Azospirillum brasilense].
Kupriashina, M A; Vetchinkina, E P; Burov, A M; Ponomareva, E G; Nikitina, V E
2014-01-01
Plant-associated nitrogen-fixing soil bacteria Azospirillum brasilense were shown to reduce the gold of chloroauric acid to elemental gold, resulting in formation of gold nanoparicles. Extracellular phenoloxidizing enzymes (laccases and Mn peroxidases) were shown to participate in reduction of Au+3 (HAuCl4) to Au(0). Transmission electron microscopy revealed accumulation of colloidal gold nanoparticles of diverse shape in the culture liquid of A. brasilense strains Sp245 and Sp7. The size of the electron-dense nanospheres was 5 to 50 nm, and the size of nanoprisms varied from 5 to 300 nm. The tentative mechanism responsible for formation of gold nanoparticles is discussed.
Xu, Chunyan; Ma, Fuying; Zhang, Xiaoyu
2009-11-01
The white rot fungus Irpex lacteus CD2 was incubated on corn stover under solid-state fermentation conditions for different durations, from 5 days up to 120 days. Lignocellulose component loss, enzyme production and Fe3+-reducing activity were studied. The average weight loss ranged from 1.7% to 60.5% during the period of 5-120 days. In contrast to lignin, hemicellulose and cellulose were degraded during the initial time period. After 15 days, 63.0% of hemicellulose was degraded. Cellulose was degraded the most during the first 10 days, and 17.2% was degraded after 10 days. Lignin was significantly degraded and modified, with acid insoluble lignin loss being nearly 80% after 60 days. That weight loss, which was lower than the total component loss, indicated that not all of the lost lignocellulose was converted to carbon dioxide and water, which was indicated by the increase in soluble reducing sugars and acid soluble lignin. Filter paper activity, which corresponds to total cellulase activity, peaked at day 5 and remained at a high level from 40 to 60 days. High hemicellulase activity appeared after 30 days. No ligninases activity was detected during the incipient stage of lignin removal and only low lignin peroxidase activity was detected after 25 days. Apparently, neither of the enzymatic peaks coincided well with the highest amount of component loss. Fe3+-reducing activity could be detected during all the decay periods, which might play an important role in lignin biodegradation by I. lacteus CD2.
Shoda, M
2003-01-01
A newly isolated fungus, Geotrichum candidum Dec 1 (abbreviated as Dec 1), was found to have the ability to degrade many xenobiotic compounds such as synthetic dyes, food coloring agents, molasses, organic halogens, lignin and kraft pulp effluents. The broad spectrum of the degradation of these compounds are associated mainly with peroxidases produced by the fungus.
Kumar, Vineet; Chandra, Ram
2018-02-02
Maillard reactions products (MRPs) are a major colorant of distillery effluent. It is major source of environmental pollution due to its complex structure and recalcitrant nature. This study has revealed that sucrose glutamic acid-Maillard reaction products (SGA-MRPs) showed many absorption peaks between 200 and 450 nm. The absorption maximum peak was noted at 250 nm in spectrophotometric detection. This indicated the formation of variable molecular weight Maillard products during the SGA-MRPs formation at high temperature. The identified aerobic bacterial consortium consisting Klebsiella pneumoniae (KU726953), Salmonella enterica (KU726954), Enterobacter aerogenes (KU726955), Enterobacter cloaceae (KU726957) showed optimum production of MnP and laccase at 120 and 144 h of growth, respectively. The potential bacterial consortium showed decolourisation of Maillard product up to 70% in presence of glucose (1%), peptone (0.1%) at optimum pH (8.1), temperature (37 °C) and shaking speed (180 rpm) within 192 h of incubation. The reduction of colour of Maillard product correlated with shifting of absorption peaks in UV-Vis spectrophotometry analysis. Further, the changing of functional group in FT-IR data showed appearance of new peaks and GC-MS analysis of degraded sample revealed the depolymerisation of complex MRPs. The toxicity evaluation using seed of Phaseolus mungo L. showed reduction of toxicity of MRPs after bacterial treatment. Hence, this study concluded that developed bacterial consortium have capability for decolourisation of MRPs due to high content of MnP and laccase.
Fang, Jing; Liu, Wen; Gao, Pei-Ji
1999-01-01
The kinetic behavior of cellobiose dehydrogenase (CDH) was investigated by steady-state initial velocity studies. Variation in the concentration of one substrate led to changes in K(m) and V(max) of the other substrate. The results were consistent with a ping-pong mechanism. In the presence of cellobiose, CDH could reduce many oxidized products catalyzed by soybean hull peroxidase (SHP). The oxidation product of 1-hydroxybenzotriazole (HBT) catalyzed by SHP inactivated the enzyme itself however, CDH could prevent SHP from inactivation by reducing the oxidation product of HBT. CDH could also inhibit the polymerization of phenolic compounds catalyzed by SHP. It was found that the addition of CDH could enhance kraft pulp lignin degradation by ligninases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hammel, Kenneth E.; Ralph, John; Hunt, Christopher G.
This work focused on new methods for the detection of oxidation in natural substrates during the deconstruction of lignocellulose by microoganisms. Oxidation was the focus because all known biological systems that degrade lignin are oxidative. The detection methods involved the used of (a) micrometer-scale beads carrying a fluorescent dye that is sensitive to oxidation, (b) 13C-labeled synthetic lignins whose breakdown products can be assessed using mass spectrometry and nuclear magnetic resonance spectroscopy, and (c) a fluorometric stain that is highly sensitive to incipient oxidation during microbial attack. The results showed (a) that one white rot fungus, Phanerochaete chrysosporium, produces diffusiblemore » oxidants on wood, and that the onset of oxidation is coincident with the marked up-regulation of genes that encode ligninolytic peroxidases and auxiliary oxidative enzymes; (b) that a more selectively ligninolytic white rot fungus, Ceriporiopsis subvermispora, produces a highly diastereoselective oxidative system for attack on lignin; (c) that a brown rot fungus, Serpula lacrymans, uses extracellular hydroquinone metabolites to drive the production of lignocellulose-oxidizing free radicals; (d) that both white rot and brown rot fungi produce highly diffusible mild oxidants that modify lignocellulose at the earliest stage of substrate deconstruction; and (e) that lignin degradation in a tropical soil is not inhibited as much as expected during periods of flooding-induced hypoxia, which indicates that unknown mechanisms for attack on lignin remain to be discovered.« less
Harman-Ware, Anne E; Happs, Renee M; Davison, Brian H; Davis, Mark F
2017-01-01
Lignin dehydrogenation polymers (DHPs) are polymers generated from phenolic precursors for the purpose of studying lignin structure and polymerization processes. Here, DHPs were synthesized using a Zutropfverfahren method with horseradish peroxidase and three lignin monomers, sinapyl (S), coumaryl (H), and coniferyl (G) alcohols, in the presence of hydrogen peroxide. The H monomer was reacted with G and a 1:1 molar mixture of S:G monomers at H molar compositions of 0, 5, 10, and 20 mol% to study how the presence of the H monomer affected the structure and composition of the recovered polymers. At low H concentrations, solid-state NMR spectra suggest that the H and G monomers interact to form G:H polymers that have a lower average molecular weight than the solely G-based polymer or the G:H polymer produced at higher H concentrations. Solid-state NMR and pyrolysis-MBMS analyses suggest that at higher H concentrations, the H monomer primarily self-polymerizes to produce clusters of H-based polymer that are segregated from clusters of G- or S:G-based polymers. Thioacidolysis generally showed higher recoveries of thioethylated products from S:G or S:G:H polymers made with higher H content, indicating an increase in the linear ether linkages. Overall, the experimental results support theoretical predictions for the reactivity and structural influences of the H monomer on the formation of lignin-like polymers.
Applications and Prospective of Peroxidase Biocatalysis in the Environmental Field
NASA Astrophysics Data System (ADS)
Torres-Duarte, Cristina; Vazquez-Duhalt, Rafael
Environmental protection is, doubtless, one of the most important challenges for the human kind. The huge amount of pollutants derived from industrial activities represents a threat for the environment and ecologic equilibrium. Phenols and halogenated phenols, polycyclic aromatic hydrocarbons, endocrine disruptive chemicals, pesticides, dioxins, polychlorinated biphenyls, industrial dyes, and other xenobiotics are among the most important pollutants. A large variety of these xenobiotics are substrates for peroxidases and thus susceptible to enzymatic transformation. The literature reports mainly the use of horseradish peroxidase, manganese peroxidase, lignin peroxidase, and chloroperoxidase on the transformation of these pollutants. Peroxidases are enzymes able to transform a variety of compounds following a free radical mechanism, giving oxidized or polymerized products. The peroxidase transformation of these pollutants is accompanied by a reduction in their toxicity, due to a biological activity loss, a reduction in the bioavailability or due to the removal from aqueous phase, especially when the pollutant is found in water. In addition, when the pollutants are present in soil, peroxidases catalyze a covalent binding to soil organic matter. In most of cases, oxidized products are less toxic and easily biodegradable than the parent compounds. In spite of their versatility and potential use in environmental processes, peroxidases are not applied at large scale yet. Diverse challenges, such as stability, redox potential, and the production of large amounts, should be solved in order to apply peroxidases in the pollutant transformation. In this chapter, we critically review the transformation of different xenobiotics by peroxidases, with special attention on the identified transformation products, the probable reaction mechanisms, and the toxicity reports. Finally, the design and development of an environmental biocatalyst is discussed. The design challenges are mainly focused on the enzyme stability in the presence of hydrogen peroxide and operational conditions, an enzyme with high redox potential to be able to oxidize a wide range of xenobiotics or pollutants, and the protein overexpression at large-scale in industrial microorganisms is discussed.
Sato, Shin; Feltus, F Alex; Iyer, Prashanti; Tien, Ming
2009-06-01
As part of an effort to determine all the gene products involved in wood degradation, we have performed massively parallel pyrosequencing on an expression library from the white rot fungus Phanerochaete chrysosporium grown in shallow stationary cultures with red oak as the carbon source. Approximately 48,000 high quality sequence tags (246 bp average length) were generated. 53% of the sequence tags aligned to 4,262 P. chrysosporium gene models, and an additional 18.5% of the tags reliably aligned to the P. chrysosporium genome providing evidence for 961 putative novel fragmented gene models. Due to their role in lignocellulose degradation, the secreted proteins were focused upon. Our results show that the four enzymes required for cellulose degradation: endocellulase, exocellulase CBHI, exocellulase CBHII, and beta-glucosidase are all produced. For hemicellulose degradation, not all known enzymes were produced, but endoxylanases, acetyl xylan esterases and mannosidases were detected. For lignin degradation, the role of peroxidases has been questioned; however, our results show that lignin peroxidase is highly expressed along with the H(2)O(2) generating enzyme, alcohol oxidase. The transcriptome snapshot reveals that H(2)O(2) generation and utilization are central in wood degradation. Our results also reveal new transcripts that encode extracellular proteins with no known function.
Determination of stress responses induced by aluminum in maize (Zea mays).
Vardar, Filiz; Ismailoğlu, Işil; Inan, Deniz; Unal, Meral
2011-06-01
To assess the alternative responses to aluminum toxicity, maize (Zea mays L. cv Karadeniz yıldızı) roots were exposed to different concentrations of AlCl3 (150, 300 and 450 μM). Aluminum reduced the root elongation by 39.6% in 150 μM, 44.1% in 300 μM, 50.1% in 450 μM AlCl3 after 96 h period. To correlate the root elongation with the alternative stress responses including aluminum accumulation, lipid peroxidation, mitotic abnormalities, reduction of starch content, intracellular Ca2+ accumulation, callose formation, lignin deposition and peroxidase activity, cytochemical and biochemical tests were performed. The results indicated that aluminum accumulation and lipid peroxidation were observed more densely on the root cap and the outer cortex cells. In addition to morphological deformations, cytochemical analysis displayed cellular deformations. Furthermore, mitotic abnormalities were observed such as c-mitosis, micronuclei, bi- and trinucleated cells in aluminum treated root tips. Aluminum treatment induced starch reduction, callose formation, lignin accumulation and intracellular Ca2+ increase. Moreover, the peroxidase activity increased significantly by 3, 4.4 and 7.7 times higher than in that of control after 96 h, respectively. In conclusion, aluminum is significantly stressful in maize culminating in morphological and cellular alterations.
Clough, Richard C; Pappu, Kameshwari; Thompson, Kevin; Beifuss, Katherine; Lane, Jeff; Delaney, Donna E; Harkey, Robin; Drees, Carol; Howard, John A; Hood, Elizabeth E
2006-01-01
Manganese peroxidase (MnP) has been implicated in lignin degradation and thus has potential applications in pulp and paper bleaching, enzymatic remediation and the textile industry. Transgenic plants are an emerging protein expression platform that offer many advantages over traditional systems, in particular their potential for large-scale industrial enzyme production. Several plant expression vectors were created to evaluate the accumulation of MnP from the wood-rot fungus Phanerochaete chrysosporium in maize seed. We showed that cell wall targeting yielded full-length MnP, whereas cytoplasmic localization resulted in multiple truncated peroxidase polypeptides as detected by immunoblot analysis. In addition, the use of a seed-preferred promoter dramatically increased the expression levels and reduced the negative effects on plant health. Multiple independent transgenic lines were backcrossed with elite inbred corn lines for several generations with the maintenance of high-level expression, indicating genetic stability of the transgene.
Lignification induced by pseudomonads harboring avirulent genes on Arabidopsis.
Lee, S; Sharm, Y; Lee, T K; Chang, M; Davis, K R
2001-08-31
The responses of Arabidopsis thaliana ecotypes to the bacterial pathogen Pseudomonas syringae pv. maculicola 4326 (Psm4326) harboring cloned avirulence genes avrB and avrRpt2 from P. syringae pv. glycinea were examined. Psm4326 containing avirulent genes, avrB and avrRpt2 induced lignification and peroxidase activities in the bacteria infiltrated leaves of Col-O only and not in Mt-O, Bla-2 and Po-1. However, Arabidopsis ecotypes infiltrated with Psm4326 harboring with and without avirulent genes all showed differential induction of mRNA for peroxidase gene and lignin accumulation up to 24 h after infiltration. Only avrB gene in Col-O showed strong corelationship between peroxidase mRNA expression as well as lignification gradually up to 36 h after infiltration. These results extend previous observations that avirulence genes from pathogens of one host plant can be recognized by non-host plants and provide the genetic framework for analysis of the plant-specific response to the bacterial avirulent gene products in A. thaliana.
REVIEW ARTICLE: Environmental applications of analytical biosensors
NASA Astrophysics Data System (ADS)
Marco, María-Pilar; Barceló, Damià
1996-11-01
A review of the fundamental aspects and environmental applications of biosensors is presented. The bases of different transducer principles such as electrochemical, optical and piezoelectric are discussed. Various examples are given of the applications of such principles to develop immunosensor devices to determine common environmental contaminants. Attention is also paid to catalytic biosensors, using enzymes as sensing elements. Biosensor devices based on the use of cholinesterase and various oxidase enzymes such as tyrosinase, laccase, peroxidase and aldehyde dehydrogenase are reported. Some examples are given of the applications of other biomolecules such as whole cells, DNA or proteins, to determine pollution. Validation studies are presented comparing biosensors with chromatographic techniques to determine organophosphorus pesticides and phenolic compounds in environmental samples.
Role of Peroxidase in Lignification of Tobacco Cells 1
Mäder, Michael; Füssl, Resi
1982-01-01
Coniferyl alcohol is the primary substrate for peroxidase-mediated lignification, a process which depends on the generation of H2O2 by NADH oxidation. We measured the concentrations of various phenols (synthetic and natural) at which maximal enhancement of NADH oxidation occurs. Coniferyl alcohol was found to stimulate NADH oxidation at a much lower concentration (0.01 mm) than other natural or synthetic phenols (1-100 mm). In addition, coniferyl alcohol prevented the conversion of active peroxidase into the inactive intermediate compound III—which is usually formed in the presence of NADH—at equally low concentrations. This conversion was found to be a prerequisite for stimulation of NADH-oxidation, but it was not necessarily connected to stimulation. The oxidation of NADH and coniferyl alcohol (or guaiacol) can occur simultaneously, but there is a strong competitive interaction between these two substrates. At pH 5, the presence of NADH at concentrations 30 to 60 times lower than the phenols completely prevents their oxidation. The results are discussed in relation to the role of cell wall peroxidases in conversion of coniferyl alcohol to lignin and in formation of H2O2. PMID:16662627
Mtibaà, Rim; Olicón-Hernández, Dario Rafael; Pozo, Clementina; Nasri, Moncef; Mechichi, Tahar; González, Jesus; Aranda, Elisabet
2018-07-30
Four different laccase-producing strains were isolated from arid soils and used for bisphenol A (BPA) degradation. These strains were identified as Chaetomium strumarium G5I, Thielavia arenaria CH9, Thielavia arenaria HJ22 and Thielavia arenaria SM1(III) by internal transcribed spacer 5.8 S rDNA analysis. Residual BPA was evaluated by HPLC analysis during 48 h of incubation. A complete removal of BPA was observed by the whole cell fungal cultures within different times, depending on each strain. C. strumarium G5I was the most efficient degrader, showing 100% of removal within 8 h of incubation. The degradation of BPA was accompanied by the production of laccase and dye decolorizing peroxidase (DyP) under degradation conditions. The presence of aminobenzotriazole (ABT) as an inhibitor of cytochrome P450s monooxygenases (CYP) demonstrated a slight decrease in BPA removal rate, suggesting the effective contribution of CYP in the conversion. The great involvement of laccase in BPA transformation together with cell-associated enzymes, such as CYP, was supported by the identification of hydroxylated metabolites by ultra-high performance liquid chromatography-mass spectroscopy (UHPLC-MS). The metabolic pathway of BPA transformation was proposed based on the detected metabolites. The acute toxicity of BPA and its products was investigated and showed a significant reduction, except for T. arenaria SM1(III) that did not caused reduction of toxicity (IC 50 < 8%), possibly due to the presence of toxic metabolites. The results of the present study point out the potential application of the isolated ascomycetes in pollutant removal processes, especially C. strumarium G5I as an efficient degrader of BPA. Copyright © 2018 Elsevier Inc. All rights reserved.
A Key Role for Apoplastic H2O2 in Norway Spruce Phenolic Metabolism.
Laitinen, Teresa; Morreel, Kris; Delhomme, Nicolas; Gauthier, Adrien; Schiffthaler, Bastian; Nickolov, Kaloian; Brader, Günter; Lim, Kean-Jin; Teeri, Teemu H; Street, Nathaniel R; Boerjan, Wout; Kärkönen, Anna
2017-07-01
Apoplastic events such as monolignol oxidation and lignin polymerization are difficult to study in intact trees. To investigate the role of apoplastic hydrogen peroxide (H 2 O 2 ) in gymnosperm phenolic metabolism, an extracellular lignin-forming cell culture of Norway spruce ( Picea abies ) was used as a research model. Scavenging of apoplastic H 2 O 2 by potassium iodide repressed lignin formation, in line with peroxidases activating monolignols for lignin polymerization. Time-course analyses coupled to candidate substrate-product pair network propagation revealed differential accumulation of low-molecular-weight phenolics, including (glycosylated) oligolignols, (glycosylated) flavonoids, and proanthocyanidins, in lignin-forming and H 2 O 2 -scavenging cultures and supported that monolignols are oxidatively coupled not only in the cell wall but also in the cytoplasm, where they are coupled to other monolignols and proanthocyanidins. Dilignol glycoconjugates with reduced structures were found in the culture medium, suggesting that cells are able to transport glycosylated dilignols to the apoplast. Transcriptomic analyses revealed that scavenging of apoplastic H 2 O 2 resulted in remodulation of the transcriptome, with reduced carbon flux into the shikimate pathway propagating down to monolignol biosynthesis. Aggregated coexpression network analysis identified candidate enzymes and transcription factors for monolignol oxidation and apoplastic H 2 O 2 production in addition to potential H 2 O 2 receptors. The results presented indicate that the redox state of the apoplast has a profound influence on cellular metabolism. © 2017 American Society of Plant Biologists. All Rights Reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harman-Ware, Anne E.; Happs, Renee M.; Davison, Brian H.
Lignin dehydrogenation polymers (DHPs) are polymers generated from phenolic precursors for the purpose of studying lignin structure and polymerization processes. Here, DHPs were synthesized using a Zutropfverfahren method with horseradish peroxidase and three lignin monomers, sinapyl (S), coumaryl (H) and coniferyl (G) alcohols, in the presence of hydrogen peroxide. The H monomer was reacted with G and a 1:1 molar mixture of S:G monomers at H molar compositions of 0, 5, 10 and 20 mol% to study how the presence of the H monomer affected the structure and composition of the recovered polymers. At low H concentrations, solid state NMRmore » spectra suggest that the H and G monomers interact to form G:H polymers that have a lower average molecular weight than the solely G-based polymer or the G:H polymer produced at higher H concentrations. Solid-state NMR and pyrolysis-MBMS analyses suggest that at higher H concentrations, the H monomer primarily self-polymerizes to produce clusters of H-based polymer that are segregated from clusters of G- or S:G-based polymers. Thioacidolysis generally showed higher recoveries of thioethylated products from S:G or S:G:H polymers made with higher H content, indicating an increase in the linear ether linkages. Overall, the experimental results support theoretical predictions for the reactivity and structural influences of the H monomer on the formation of lignin-like polymers.« less
A Key Role for Apoplastic H2O2 in Norway Spruce Phenolic Metabolism1[OPEN
Laitinen, Teresa
2017-01-01
Apoplastic events such as monolignol oxidation and lignin polymerization are difficult to study in intact trees. To investigate the role of apoplastic hydrogen peroxide (H2O2) in gymnosperm phenolic metabolism, an extracellular lignin-forming cell culture of Norway spruce (Picea abies) was used as a research model. Scavenging of apoplastic H2O2 by potassium iodide repressed lignin formation, in line with peroxidases activating monolignols for lignin polymerization. Time-course analyses coupled to candidate substrate-product pair network propagation revealed differential accumulation of low-molecular-weight phenolics, including (glycosylated) oligolignols, (glycosylated) flavonoids, and proanthocyanidins, in lignin-forming and H2O2-scavenging cultures and supported that monolignols are oxidatively coupled not only in the cell wall but also in the cytoplasm, where they are coupled to other monolignols and proanthocyanidins. Dilignol glycoconjugates with reduced structures were found in the culture medium, suggesting that cells are able to transport glycosylated dilignols to the apoplast. Transcriptomic analyses revealed that scavenging of apoplastic H2O2 resulted in remodulation of the transcriptome, with reduced carbon flux into the shikimate pathway propagating down to monolignol biosynthesis. Aggregated coexpression network analysis identified candidate enzymes and transcription factors for monolignol oxidation and apoplastic H2O2 production in addition to potential H2O2 receptors. The results presented indicate that the redox state of the apoplast has a profound influence on cellular metabolism. PMID:28522458
Harman-Ware, Anne E.; Happs, Renee M.; Davison, Brian H.; ...
2017-11-30
Lignin dehydrogenation polymers (DHPs) are polymers generated from phenolic precursors for the purpose of studying lignin structure and polymerization processes. Here, DHPs were synthesized using a Zutropfverfahren method with horseradish peroxidase and three lignin monomers, sinapyl (S), coumaryl (H) and coniferyl (G) alcohols, in the presence of hydrogen peroxide. The H monomer was reacted with G and a 1:1 molar mixture of S:G monomers at H molar compositions of 0, 5, 10 and 20 mol% to study how the presence of the H monomer affected the structure and composition of the recovered polymers. At low H concentrations, solid state NMRmore » spectra suggest that the H and G monomers interact to form G:H polymers that have a lower average molecular weight than the solely G-based polymer or the G:H polymer produced at higher H concentrations. Solid-state NMR and pyrolysis-MBMS analyses suggest that at higher H concentrations, the H monomer primarily self-polymerizes to produce clusters of H-based polymer that are segregated from clusters of G- or S:G-based polymers. Thioacidolysis generally showed higher recoveries of thioethylated products from S:G or S:G:H polymers made with higher H content, indicating an increase in the linear ether linkages. Overall, the experimental results support theoretical predictions for the reactivity and structural influences of the H monomer on the formation of lignin-like polymers.« less
Effect of lignin on oxidative stress in chickens fed a diet contaminated with zearalenone.
Grešáková, L'ubomíra; Bořutová, Radka; Faix, Stefan; Plachá, Iveta; Cobanová, Klaudia; Košíková, Božena; Leng, L'ubomír
2012-03-01
The effect of lignin supplementation to a diet contaminated with zearalenone (ZEA) on antioxidant status was studied in female chickens of the ISA BROWN laying strain. From the day of hatching to 2 weeks of age, four groups of chickens were fed the same uncontaminated control diet. After 14 days, Group 1 (control) continued to receive the uncontaminated diet, while Group 2 was fed an identical diet enriched with 0.5% chemically modified lignin. Simultaneously, chickens of Group 3 were switched to a diet contaminated with 7.9 mg/kg ZEA and those of Group 4 to an identical contaminated diet supplemented with 0.5% lignin. At 6 weeks of age blood and tissue samples were collected. Feeding of a diet contaminated with a high level of ZEA resulted in elevated glutathione peroxidase (GPx) activity in the duodenal mucosa and kidney tissues, and an increased γ-glutamyltransferase (GGT) activity in the plasma, indicative of oxidative stress. In the liver tissue, no mycotoxin-induced response in GPx and thioredoxin reductase (TrxR) activities occurred, and the malondialdehyde (MDA) level was even reduced. Neither the plasma levels of retinol and α-tocopherol nor the activities of superoxide dismutase in erythrocytes and GPx in blood were affected in birds fed the contaminated diet. The only effect of lignin supplemented to the contaminated feed was that it prevented the increase of GPx activity in the duodenal mucosa as an indicator of oxidative stress.
Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin
2014-01-01
Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.
Detection of trace heavy metal ions in water by nanostructured porous Si biosensors.
Shtenberg, Giorgi; Massad-Ivanir, Naama; Segal, Ester
2015-07-07
A generic biosensing platform, based on nanostructured porous Si (PSi), Fabry-Pérot thin films, for label-free monitoring of heavy metal ions in aqueous solutions by enzymatic activity inhibition, is described. First, we show a general detection assay by immobilizing horseradish peroxidase (HRP) within the oxidized PSi nanostructure and monitor its catalytic activity in real time by reflective interferometric Fourier transform spectroscopy. Optical studies reveal the high specificity and sensitivity of the HRP-immobilized PSi towards three metal ions (Ag(+) > Pb(2+) > Cu(2+)), with a detection limit range of 60-120 ppb. Next, we demonstrate the concept of specific detection of Cu(2+) ions (as a model heavy metal) by immobilizing Laccase, a multi-copper oxidase, within the oxidized PSi. The resulting biosensor allows for specific detection and quantification of copper ions in real water samples by monitoring the Laccase relative activity. The optical biosensing results are found to be in excellent agreement with those obtained by the gold standard analytical technique (ICP-AES) for all water samples. The main advantage of the presented biosensing concept is the ability to detect heavy metal ions at environmentally relevant concentrations using a simple and portable experimental setup, while the specific biosensor design can be tailored by varying the enzyme type.
Bouacem, Khelifa; Rekik, Hatem; Jaouadi, Nadia Zaraî; Zenati, Bilal; Kourdali, Sidali; El Hattab, Mohamed; Badis, Abdelmalek; Annane, Rachid; Bejar, Samir; Hacene, Hocine; Bouanane-Darenfed, Amel; Jaouadi, Bassem
2018-01-01
Two extracellular peroxidases from Bjerkandera adusta strain CX-9, namely a lignin peroxidase (called LiP BA45) and manganese peroxidase (called MnP BA30), were purified simultaneously by applying successively, ammonium sulfate precipitation-dialysis, Mono-S Sepharose anion-exchange and Sephacryl S-200 gel filtration and biochemically characterized. The sequence of their NH 2 -terminal amino acid residues showed high homology with those of fungi peroxidases. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzymes MnP BA30 and LiP BA45 were a monomers with a molecular masses 30125.16 and 45221.10Da, respectively. While MnP BA30 was optimally active at pH 3 and 70°C, LiP BA45 showed optimum activity at pH 4 and 50°C. The two enzymes were inhibited by sodium azide and potassium cyanide, suggesting the presence of heme-components in their tertiary structures. The K m and V max for LiP BA45 toward 2,4-Dichlorolphenol (2,4-DCP) were 0.099mM and 9.12U/mg, respectively and for MnP BA30 toward 2,6-Dimethylphenol (2,6-DMP), they were 0.151mM and 18.60U/mg, respectively. Interestingly, MnP BA30 and LiP BA45 demonstrated higher catalytic efficiency than that of other tested peroxidases (MnP, LiP, HaP4, and LiP-SN) and marked organic solvent-stability and dye-decolorization efficiency. Data suggest that these peroxidases may be considered as potential candidates for future applications in distaining synthetic-dyes. Copyright © 2017 Elsevier B.V. All rights reserved.
Ecology of coarse wood decomposition by the saprotrophic fungus Fomes fomentarius.
Větrovský, Tomáš; Voříšková, Jana; Snajdr, Jaroslav; Gabriel, Jiří; Baldrian, Petr
2011-07-01
Saprotrophic wood-inhabiting basidiomycetes are the most important decomposers of lignin and cellulose in dead wood and as such they attracted considerable attention. The aims of this work were to quantify the activity and spatial distribution of extracellular enzymes in coarse wood colonised by the white-rot basidiomycete Fomes fomentarius and in adjacent fruitbodies of the fungus and to analyse the diversity of the fungal and bacterial community in a fungus-colonised wood and its potential effect on enzyme production by F. fomentarius. Fungus-colonised wood and fruitbodies were collected in low management intensity forests in the Czech Republic. There were significant differences in enzyme production by F. fomentarius between Betula pendula and Fagus sylvatica wood, the activity of cellulose and xylan-degrading enzymes was significantly higher in beech wood than in birch wood. Spatial analysis of a sample B. pendula log segment proved that F. fomentarius was the single fungal representative found in the log. There was a high level of spatial variability in the amount of fungal biomass detected, but no effects on enzyme activities were observed. Samples from the fruiting body showed high β-glucosidase and chitinase activities compared to wood samples. Significantly higher levels of xylanase and cellobiohydrolase were found in samples located near the fruitbody (proximal), and higher laccase and Mn-peroxidase activities were found in the distal ones. The microbial community in wood was dominated by the fungus (fungal to bacterial DNA ratio of 62-111). Bacterial abundance composition was lower in proximal than distal parts of wood by a factor of 24. These results show a significant level of spatial heterogeneity in coarse wood. One of the explanations may be the successive colonization of wood by the fungus: due to differential enzyme production, the rates of biodegradation of coarse wood are also spatially inhomogeneous.
Fournand, David; Cathala, Bernard; Lapierre, Catherine
2003-01-01
Capillary zone electrophoresis has been used to monitor the first steps of the dehydrogenative polymerization of coniferyl alcohol, sinapyl aldehyde, or a mixture of both, catalyzed by the horseradish peroxidase (HRP)-H(2)O(2) system. When coniferyl alcohol was the unique HRP substrate, three major dimers were observed (beta-5, beta-beta, and beta-O-4 interunit linkages) and their initial formation velocity as well as their relative abundance varied with pH. The beta-O-4 interunit linkage was thus slightly favored at lower pH values. In contrast, sinapyl aldehyde turned out to be a very poor substrate for HRP except in basic conditions (pH 8). The major dimer observed was the beta,beta'-di-sinapyl aldehyde, a red-brown exhibiting compound which might partly participate in the red coloration usually observed in cinnamyl alcohol dehydrogenase-deficient angiosperms. Finally, when a mixture of coniferyl alcohol and sinapyl aldehyde was used, it looked as if sinapyl aldehyde became a very good substrate for HRP. Indeed, coniferyl alcohol turned out to serve as a redox mediator (i.e. "shuttle oxidant") for the sinapyl aldehyde incorporation in the lignin-like polymer. This means that in particular conditions the specificity of oxidative enzymes might not hinder the incorporation of poor substrates into the growing lignin polymer.
Mauricio, Tess; Karmon, Yoram; Khaiat, Alain
2011-12-01
Historically, the most effective treatments for skin lightening have contained hydroquinone. However, there is a need for an effective alternative. The purpose of this study was to evaluate the skin-lightening efficacy and safety of lignin peroxidase (LIP) creams using a regimen of both day and night products compared with twice-daily application of 2% hydroquinone cream and placebo in Asian women. This was a randomized, double-blind, placebo-controlled, split-face, single-center study of 51 patients. Patients were randomized to receive day and night LIP cream on one randomly selected side of their face and either 2% hydroquinone cream or placebo on the other. A statistically significant change from baseline in the melanin index was observed in LIP-treated skin, with a mean reduction of 7.6% (P < 0.001) on Day 31. Conversely, hydroquinone and placebo did not provide a statistically significant lightening effect when instrumentally measured. Dermatologist scoring demonstrated a significant improvement in overall fairness as early as 8 days after treatment initiation in the LIP-treated group, which was not observed in the other groups. Overall, patients preferred the LIP creams. The application of day/night LIP cream provided a significantly more rapid and observable skin-lightening effect than hydroquinone 2% cream or placebo. © 2011 Wiley Periodicals, Inc.
MicroRNA857 Is Involved in the Regulation of Secondary Growth of Vascular Tissues in Arabidopsis1
Zhao, Yuanyuan; Lin, Sen; Qiu, Zongbo; Cao, Dechang; Wen, Jialong; Deng, Xin; Wang, Xiaohua; Lin, Jinxing; Li, Xiaojuan
2015-01-01
MicroRNAs (miRNAs) are endogenous small RNAs that repress target gene expression posttranscriptionally, and are critically involved in various developmental processes and responses to environmental stresses in eukaryotes. MiRNA857 is not widely distributed in plants and is encoded by a single gene, AtMIR857, in Arabidopsis (Arabidopsis thaliana). The functions of miR857 and its mechanisms in regulating plant growth and development are still unclear. Here, by means of genetic analysis coupled with cytological studies, we investigated the expression pattern and regulation mechanism of miR857 and its biological functions in Arabidopsis development. We found that miR857 regulates its target gene, Arabidopsis LACCASE7, at the transcriptional level, thereby reducing laccase activity. Using stimulated Raman scattering and x-ray microtomography three-dimensional analyses, we showed that miR857 was involved in the regulation of lignin content and consequently morphogenesis of the secondary xylem. In addition, miR857 was activated by SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 in response to low copper conditions. Collectively, these findings demonstrate the role of miR857 in the regulation of secondary growth of vascular tissues in Arabidopsis and reveal a unique control mechanism for secondary growth based on the miR857 expression in response to copper deficiency. PMID:26511915
Govender, Nisha T.; Mahmood, Maziah; Seman, Idris A.; Wong, Mui-Yun
2017-01-01
Basal stem rot, caused by the basidiomycete fungus, Ganoderma boninense, is an economically devastating disease in Malaysia. Our study investigated the changes in lignin content and composition along with activity and expression of the phenylpropanoid pathway enzymes and genes in oil palm root tissues during G. boninense infection. We sampled control (non-inoculated) and infected (inoculated) seedlings at seven time points [1, 2, 3, 4, 8, and 12 weeks post-inoculation (wpi)] in a randomized design. The expression profiles of phenylalanine ammonia lyase (PAL), cinnamyl alcohol dehydrogenase (CAD), and peroxidase (POD) genes were monitored at 1, 2, and 3 wpi using real-time quantitative polymerase chain reaction. Seedlings at 4, 8, and 12 wpi were screened for lignin content, lignin composition, enzyme activities (PAL, CAD, and POD), growth (weight and height), and disease severity (DS). Gene expression analysis demonstrated up-regulation of PAL, CAD, and POD genes in the infected seedlings, relative to the control seedlings at 1, 2, and 3 wpi. At 2 and 3 wpi, CAD showed highest transcript levels compared to PAL and POD. DS increased progressively throughout sampling, with 5, 34, and 69% at 4, 8, and 12 wpi, respectively. Fresh weight and height of the infected seedlings were significantly lower compared to the control seedlings at 8 and 12 wpi. Lignin content of the infected seedlings at 4 wpi was significantly higher than the control seedlings, remained elicited with no change at 8 wpi, and then collapsed with a significant reduction at 12 wpi. The nitrobenzene oxidation products of oil palm root lignin yielded both syringyl and guaiacyl monomers. Accumulation of lignin in the infected seedlings was in parallel to increased syringyl monomers, at 4 and 8 wpi. The activities of PAL and CAD enzymes in the infected seedlings at DS = 5–34% were significantly higher than the control seedlings and thereafter collapsed at DS = 69%. PMID:28861093
Govender, Nisha T; Mahmood, Maziah; Seman, Idris A; Wong, Mui-Yun
2017-01-01
Basal stem rot, caused by the basidiomycete fungus, Ganoderma boninense , is an economically devastating disease in Malaysia. Our study investigated the changes in lignin content and composition along with activity and expression of the phenylpropanoid pathway enzymes and genes in oil palm root tissues during G. boninense infection. We sampled control (non-inoculated) and infected (inoculated) seedlings at seven time points [1, 2, 3, 4, 8, and 12 weeks post-inoculation (wpi)] in a randomized design. The expression profiles of phenylalanine ammonia lyase (PAL), cinnamyl alcohol dehydrogenase (CAD), and peroxidase (POD) genes were monitored at 1, 2, and 3 wpi using real-time quantitative polymerase chain reaction. Seedlings at 4, 8, and 12 wpi were screened for lignin content, lignin composition, enzyme activities (PAL, CAD, and POD), growth (weight and height), and disease severity (DS). Gene expression analysis demonstrated up-regulation of PAL, CAD, and POD genes in the infected seedlings, relative to the control seedlings at 1, 2, and 3 wpi. At 2 and 3 wpi, CAD showed highest transcript levels compared to PAL and POD. DS increased progressively throughout sampling, with 5, 34, and 69% at 4, 8, and 12 wpi, respectively. Fresh weight and height of the infected seedlings were significantly lower compared to the control seedlings at 8 and 12 wpi. Lignin content of the infected seedlings at 4 wpi was significantly higher than the control seedlings, remained elicited with no change at 8 wpi, and then collapsed with a significant reduction at 12 wpi. The nitrobenzene oxidation products of oil palm root lignin yielded both syringyl and guaiacyl monomers. Accumulation of lignin in the infected seedlings was in parallel to increased syringyl monomers, at 4 and 8 wpi. The activities of PAL and CAD enzymes in the infected seedlings at DS = 5-34% were significantly higher than the control seedlings and thereafter collapsed at DS = 69%.
2010-01-01
Background Recent discoveries highlighting the metabolic malleability of plant lignification indicate that lignin can be engineered to dramatically alter its composition and properties. Current plant biotechnology efforts are primarily aimed at manipulating the biosynthesis of normal monolignols, but in the future apoplastic targeting of phenolics from other metabolic pathways may provide new approaches for designing lignins that are less inhibitory toward the enzymatic hydrolysis of structural polysaccharides, both with and without biomass pretreatment. To identify promising new avenues for lignin bioengineering, we artificially lignified cell walls from maize cell suspensions with various combinations of normal monolignols (coniferyl and sinapyl alcohols) plus a variety of phenolic monolignol substitutes. Cell walls were then incubated in vitro with anaerobic rumen microflora to assess the potential impact of lignin modifications on the enzymatic degradability of fibrous crops used for ruminant livestock or biofuel production. Results In the absence of anatomical constraints to digestion, lignification with normal monolignols hindered both the rate and extent of cell wall hydrolysis by rumen microflora. Inclusion of methyl caffeate, caffeoylquinic acid, or feruloylquinic acid with monolignols considerably depressed lignin formation and strikingly improved the degradability of cell walls. In contrast, dihydroconiferyl alcohol, guaiacyl glycerol, epicatechin, epigallocatechin, and epigallocatechin gallate readily formed copolymer-lignins with normal monolignols; cell wall degradability was moderately enhanced by greater hydroxylation or 1,2,3-triol functionality. Mono- or diferuloyl esters with various aliphatic or polyol groups readily copolymerized with monolignols, but in some cases they accelerated inactivation of wall-bound peroxidase and reduced lignification; cell wall degradability was influenced by lignin content and the degree of ester group hydroxylation. Conclusion Overall, monolignol substitutes improved the inherent degradability of non-pretreated cell walls by restricting lignification or possibly by reducing lignin hydrophobicity or cross-linking to structural polysaccharides. Furthermore some monolignol substitutes, chiefly readily cleaved bi-phenolic conjugates like epigallocatechin gallate or diferuloyl polyol esters, are expected to greatly boost the enzymatic degradability of cell walls following chemical pretreatment. In ongoing work, we are characterizing the enzymatic saccharification of intact and chemically pretreated cell walls lignified by these and other monolignol substitutes to identify promising genetic engineering targets for improving plant fiber utilization. PMID:20565789
Value Added Biomaterials via Laccase-Mediated Surface Functionalization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cannatelli, Mark D.; Ragauskas, J.
As we delve deeper into the 21st century, concerns regarding the current state of the environment and the future of the planet continue to rise. In response, companies and organizations from a broad spectrum of industries are increasing their involvement in joining the worldwide effort to incorporate sustainability into existing operations. The implementation of the biorefining concept, whose mission is to maximize the use of all constituents of biomass, including pulp and paper, lumber and the biofuels sectors has increased the sustainability of these industries as well as provided an avenue for the production of extensive amounts of biomaterials. Nowadays,more » biomass derived materials are incorporated into a wide array of consumer products, ranging from sophisticated biomedical devices to the plastic bottles that contain our beverages. These bio products not only provide the advantages of being renewable, sustainable, and biodegradable compared to synthetic materials, but they can be of lower cost and non-toxic. For the most part, biomaterials are mainly derived from woody and plant biomass, which comprise of three main biopolymers: cellulose, hemicellulose, and lignin. Whilst cellulose has many uses (paper products and conversion to ethanol to name a couple), the conversion of lignin into valuable products is far less established and thus has become is a growing research direction within the biorefinery committee.« less
Value Added Biomaterials via Laccase-Mediated Surface Functionalization
Cannatelli, Mark D.; Ragauskas, J.
2015-04-22
As we delve deeper into the 21st century, concerns regarding the current state of the environment and the future of the planet continue to rise. In response, companies and organizations from a broad spectrum of industries are increasing their involvement in joining the worldwide effort to incorporate sustainability into existing operations. The implementation of the biorefining concept, whose mission is to maximize the use of all constituents of biomass, including pulp and paper, lumber and the biofuels sectors has increased the sustainability of these industries as well as provided an avenue for the production of extensive amounts of biomaterials. Nowadays,more » biomass derived materials are incorporated into a wide array of consumer products, ranging from sophisticated biomedical devices to the plastic bottles that contain our beverages. These bio products not only provide the advantages of being renewable, sustainable, and biodegradable compared to synthetic materials, but they can be of lower cost and non-toxic. For the most part, biomaterials are mainly derived from woody and plant biomass, which comprise of three main biopolymers: cellulose, hemicellulose, and lignin. Whilst cellulose has many uses (paper products and conversion to ethanol to name a couple), the conversion of lignin into valuable products is far less established and thus has become is a growing research direction within the biorefinery committee.« less
A study of overproduction and enhanced secretion of enzymes. Quarterly report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dashek, W.V.
1993-09-01
Wood decay within forests, a significant renewable photosynthetic energy resource, is caused primarily by Basidiomycetous fungi, e.g., white rot fungi. These organisms possess the ability to degrade lignin, cellulose and hemicellulose, the main organic polymers of wood. In the case of the white rot fungi, e.g., Coriolus versicolor, the capacity results from the fungus` ability to elaborate extracellular cellulolytic and ligninolytic enzymes. With regard to the latter, at least one of the enzymes, polyphenol oxidase (PPO) appears within a defined growth medium. This proposal focuses on the over-production and enhanced secretion of PPO, cellulase and lignin peroxidase. There are twomore » major sections to the proposal: (1) overproduction of lignocellulolytic enzymes by genetic engineering methodologies and hyper-production and enhanced secretion of these enzymes by biochemical/electro microscopical techniques and (2) the biochemical/electron microscopical method involves substrate induction and the time-dependent addition of respiration and PPO enzymes.« less
Hatzilazarou, Stefanos P; Syros, Thomas D; Yupsanis, Traianos A; Bosabalidis, Artemios M; Economou, Athanasios S
2006-07-01
In vitro and ex vitro rooting of gardenia (Gardenia jasminoides Ellis) microshoots with or without indolic-3-butyric acid (IBA) was studied in order to improve acclimatization of microplants after root formation and transplantation. Peroxidase (POD) activity and isoforms, lignin content and anatomical observations were evaluated in the course of the three interdependent phases (induction, initiation and expression) of microshoot rooting. Microshoots treated or not treated with IBA achieved high rooting percentages both in vitro and ex vitro. At the end of the 2-week acclimatization period, the percentage of surviving microplants ranged from 80% to 100%, for in vitro and ex vitro rooted microshoots, respectively. Microshoots rooted in vitro and ex vitro showed a relationship between rooting and POD activity but in a different time course. It appeared that root formation occurred after the microshoots had reached and passed a peak of maximum enzyme activity. In all treatments, electrophoretic analysis (native PAGE) of PODs revealed the appearance of one anionic and three cationic POD isoforms (C(1), C(3) and C(4)). An additional cationic POD isoform (C(2)) appeared only in the ex vitro rooting. The lignin content was similar in microshoots rooted both in vitro and ex vitro. The sequential anatomical changes during the rooting process were similar in both in vitro and ex vitro rooting treatments. In the case of in vitro rooting, pith cells had vacuoles entirely filled with a dark substance, while in the case of ex vitro rooting, pith cells contained many amyloplasts. The origin of the adventitious roots, in both rooting conditions, was located in the cambial ring. Roots with organized tissue systems emerged from the microshoot stem 10-14 days after the root induction treatments; on day 10 for rooting in vitro, while a 4-day delay was noted in microshoots rooted ex vitro.
Lignin metabolism involves Botrytis cinerea BcGs1- induced defense response in tomato.
Yang, Chenyu; Liang, Yingbo; Qiu, Dewen; Zeng, Hongmei; Yuan, Jingjing; Yang, Xiufen
2018-06-04
BcGs1, a cell wall-degrading enzyme (CWDE), was originally derived from Botrytis cinerea. Our previous study revealed that BcGs1 could trigger defense responses and protect plants against various pathogens. We researched the defense response mechanism underlying this BcGs1 elicitation in tomato. We revealed that the two domains were required for BcGs1's full necrosis activity. According to analysis and quantitative real-time PCR of the up-regulated proteins and genes filtered by iTRAQ-based quantitative proteome approach, oxidative metabolism and phenylpropanoid metabolism were speculated to be involved in BcGs1-triggered defense response in tomato. Furthermore, experimental evidence showed that BcGs1 triggered reactive oxygen species (ROS) burst and increased the level of phenylalanine-ammonia lyase (PAL) and peroxidase (POD) enzyme activity, as well as lignin accumulation. Moreover, histochemical analysis revealed that infiltration of BcGs1 in tomato leaves exhibited cell wall thickening compared with untreated plants. The results suggested that BcGs1 activated the basal defense response included lignin metabolism contributed to BcGs1-induced resistance to Botrytis. cinerea infection in tomato.
Siqueira-Soares, Rita de Cássia; Parizotto, Angela Valderrama; Ferrarese, Maria de Lourdes Lucio
2013-01-01
L-3,4-Dihydroxyphenylalanine (L-DOPA) is a known allelochemical exuded from the roots of velvet bean (Mucuna pruriens L. Fabaceae). In the current work, we analyzed the effects of L-DOPA on the growth, the activities of phenylalanine ammonia-lyase (PAL), tyrosine ammonia-lyase (TAL), and peroxidase (POD), and the contents of phenylalanine, tyrosine, and lignin in maize (Zea mays) roots. Three-day-old seedlings were cultivated in nutrient solution with or without 0.1 to 2.0 mM L-DOPA in a growth chamber (25°C, light/dark photoperiod of 12/12, and photon flux density of 280 μmol m−2 s−1) for 24 h. The results revealed that the growth (length and weight) of the roots, the PAL, TAL, and soluble and cell wall-bound POD activities decreased, while phenylalanine, tyrosine, and lignin contents increased after L-DOPA exposure. Together, these findings showed the susceptibility of maize to L-DOPA. In brief, these results suggest that the inhibition of PAL and TAL can accumulate phenylalanine and tyrosine, which contribute to enhanced lignin deposition in the cell wall followed by a reduction of maize root growth. PMID:24348138
Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin
2014-02-01
Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.
Improved recovery of active recombinant laccase from maize seed.
Bailey, M R; Woodard, S L; Callaway, E; Beifuss, K; Magallanes-Lundback, M; Lane, J R; Horn, M E; Mallubhotla, H; Delaney, D D; Ward, M; Van Gastel, F; Howard, J A; Hood, E E
2004-01-01
Lignolytic enzymes such as laccase have been difficult to over-express in an active form. This paper describes the expression, characterization, and application of a fungal laccase in maize seed. The transgenic seed contains immobilized and extractable laccase. Fifty ppm dry weight of aqueously extractable laccase was obtained, and the remaining solids contained a significant amount of immobilized laccase that was active. Although a portion of the extractable laccase was produced as inactive apoenzyme, laccase activity was recovered by treatment with copper and chloride. In addition to allowing the apoenzyme to regain activity, treatment with copper also provided a partial purification step by precipitating other endogenous corn proteins while leaving >90% of the laccase in solution. The data also demonstrate the application of maize-produced laccase as a polymerization agent. The apparent concentration of laccase in ground, defatted corn germ is approximately 0.20% of dry weight.
Construction and direct electrochemistry of orientation controlled laccase electrode
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Ying; Zhang, Jiwei; Huang, Xirong, E-mail: xrhuang@sdu.edu.cn
2014-03-28
Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, usingmore » genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.« less
Baciocchi, Enrico; Fabbri, Claudia; Lanzalunga, Osvaldo
2003-11-14
The H(2)O(2)-promoted oxidations of the two nonphenolic beta-O-aryl lignin model trimers 1 and 2, catalyzed by lignin peroxidase (LiP) at pH = 3.5, have been studied. The results have been compared with those obtained in the oxidation of 1 and 2 with the genuine one-electron oxidant potassium 12-tungstocobalt(III)ate. These models present a different substitution pattern of the three aromatic rings, and by one-electron oxidation, they form radical cations with the positive charge, which is localized in the dialkoxylated ring as also evidenced by a pulse radiolysis study. Both the oxidations with the enzymatic and with the chemical systems lead to the formation of products deriving from the cleavage of C-C and C-H bonds in a beta position with respect to the radical cation with the charge residing in the dialkoxylated ring (3,4-dimethoxybenzaldehyde (5) and a trimeric ketone 6 in the oxidation of 1 and a dimeric aldehyde 8 and a trimeric ketone 9 in the oxidation of 2). These products are accompanied by a dimeric aldehyde 7 in the oxidation of 1 and 4-methoxybenzaldehyde (10) in the oxidation of 2. The unexpected formation of these two products has been explained by suggesting that 1.+ and 2.+ can also undergo an intramolecular electron transfer leading to the radical cations 1a.+ and 2a.+ with the charge residing in a monoalkoxylated ring. The fast cleavage of a C-C bond beta to this ring, leading to 7 from 1.+ and to 10 from 2.+, is the driving force of the endoergonic electron transfer. A kinetic steady-state investigation of the LiP-catalyzed oxidation of the trimer 2, the dimeric model 1-(3,4-dimethoxyphenyl)-2-phenoxy-1-ethanol (4), and 3,4-dimethoxybenzyl alcohol (3) has indicated that the turnover number (k(cat)) and the affinity for the enzyme decrease significantly by increasing the size of the model compound. In contrast, the three substrates exhibited a very similar reactivity toward a chemical oxidant [Co(III)W]. This suggests a size-dependent interaction of the enzyme with the substrate which may influence the efficiency of the electron transfer.
Decolorization of RBBR by plant cells and correlation with the transformation of PCBs.
Chroma, Ludmila; Macek, Tomas; Demnerova, Katerina; Macková, Martina
2002-11-01
An extracellular H2O2-requiring Remazol Brilliant Blue R (RBBR) decolorizing enzyme activity was detected after cultivation of cells of various plant species both in liquid medium and when growing on agar plates containing RBBR. Level of the enzyme activity was compared with the ability to metabolize polychlorinated biphenyls (PCBs). The ability to decolorize RBBR was tested in the presence and absence of PCBs. The cultures with high PCB-transforming activity proved to exhibit RBBR oxidase much more resistant towards the influence of PCBs. In addition low activities of lignin peroxidase (LiP) and manganese dependent peroxidase (MnP) were detected in medium and in plant cells. No correlation of MnP and LiP activities with PCB degradation could be found. The RBBR decolorization could be used as a rough screening method for plant cultures able to metabolize PCBs.
Proteomics reveals novel components of the Anopheles gambiae eggshell
Amenya, Dolphine A.; Chou, Wayne; Li, Jianyong; Yan, Guiyun; Gershon, Paul D.; James, Anthony A.; Marinotti, Osvaldo
2010-01-01
While genome and transcriptome sequencing has revealed a large number and diversity of Anopheles gambiae predicted proteins, identifying their functions and biosynthetic pathways remains challenging. Applied mass spectrometry based proteomics in conjunction with mosquito genome and transcriptome databases were used to identify 44 proteins as putative components of the eggshell. Among the identified molecules are two vitelline membrane proteins and a group of seven putative chorion proteins. Enzymes with peroxidase, laccase and phenoloxidase activities, likely involved in cross-linking reactions that stabilize the eggshell structure, also were identified. Seven odorant binding proteins were found in association with the mosquito eggshell, although their role has yet to be demonstrated. This analysis fills a considerable gap of knowledge about proteins that build the eggshell of anopheline mosquitoes. PMID:20433845
Bioremoval of humic acid from water by white rot fungi: exploring the removal mechanisms.
Zahmatkesh, M; Spanjers, H; Toran, M J; Blánquez, P; van Lier, J B
2016-12-01
Twelve white rot fungi (WRF) strains were screened on agar plates for their ability to bleach humic acid (HA). Four fungal strains were selected and tested in liquid media for removal of HA. Bioremediation was investigated by HA color removal and changes in the concentration and molecular size distribution of HA by size exclusion chromatography. Trametes versicolor and Phanerochaete chrysosporium showed the highest HA removal efficiency, reaching about 80%. Laccase and manganese peroxidase were measured as extracellular enzymes and their relation to the HA removal by WRF was investigated. Results indicated that nitrogen limitation could enhance the WRF extracellular enzyme activity, but did not necessarily increase the HA removal by WRF. The mechanism of bioremediation by WRF was shown to involve biosorption of HA by fungal biomass and degradation of HA to smaller molecules. Also, contradicting previous reports, it was shown that the decolorization of HA by WRF could not necessarily be interpreted as degradation of HA. Biosorption experiments revealed that HA removal by fungal biomass is dependent not only on the amount of biomass as the sorbent, but also on the fungal species. The involvement of cytochrome P450 (CYP) enzymes was confirmed by comparing the HA removal capability of fungi with and without the presence of a CYP inhibitor. The ability of purified laccase from WRF to solely degrade HA was proven and the importance of mediators was also demonstrated.
2012-01-01
The capacity of white-rot fungi to degrade wood lignin may be highly applicable to the development of novel bioreactor systems, but the mechanisms underlying this function are not yet fully understood. Lignin peroxidase (LiP) and manganese peroxidase (MnP), which are thought to be very important for the ligninolytic property, demonstrated increased activity in Phanerochaete chrysosporium RP-78 (FGSC #9002, ATCC MYA-4764™) cultures following exposure to 5 mM cyclic adenosine 3', 5'-monophosphate (cAMP) and 500 μM 3'-isobutyl-1-methylxanthine (IBMX), a phosphodiesterase inhibitor. Real-time reverse transcription polymerase chain reaction (RT-PCR) analysis revealed that transcription of most LiP and MnP isozyme genes was statistically significantly upregulated in the presence of the cAMP and IBMX compared to the untreated condition. However, 100 μM calmodulin (CaM) inhibitor N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide (W-7), which had insignificant effects on fungal growth and intracellular cAMP concentration, not only offset the increased activity and transcription induced by the drugs, but also decreased them to below basal levels. Like the isozyme genes, transcription of the CaM gene (cam) was also upregulated by cAMP and IBMX. These results suggest that cAMP signaling functions to increase the transcription of LiP and MnP through the induction of cam transcription. PMID:22273182
Are Natural Ingredients Effective in the Management of Hyperpigmentation? A Systematic Review
Angra, Kunal; Halder, Rebat M.
2018-01-01
BACKGROUND: Hyperpigmentation disorders are commonly encountered in dermatology clinics. Botanical and natural ingredients have gained popularity as alternative depigmenting products. OBJECTIVE: We sought to review clinical studies evaluating the use of different natural products in treating hyperpigmentation so clinicians are better equipped to educate their patients. Specific ingredients reviewed include azelaic acid, aloesin, mulberry, licorice extracts, lignin peroxidase, kojic acid, niacinamide, ellagic acid, arbutin, green tea, turmeric, soy, and ascorbic acid. METHODS: Systematic searches of PubMed and SCOPUS databases were performed in March 2016 using the various ingredient names, “melasma”and “hyperpigmentation.” Two reviewers independently screened titles, leading to the selection of 30 clinical studies. RESULTS: Review of the literature revealed few clinical trials that evaluated the treatment of hyperpigmentation with natural ingredients. Despite the limited evidence-based research, several natural ingredients did show efficacy as depigmenting agents, including azelaic acid, soy, lignin peroxidase, ascorbic acid iontophoresis, arbutin, ellagic acid, licorice extracts, niacinamide, and mulberry. CONCLUSION: The aforementioned ingredients show promise as natural treatments for patients with hyperpigmentation disorders. These agents might also provide clinicians and researchers with a way to further characterize the pathogenesis of dyschromia. However, the paucity of clinical studies is certainly a limitation. Additionally, many of the in-vivo studies are limited by the short length of the trials, and questions remain about the long-term efficacy and safety of the ingredients used in these studies. Lastly, we suggest a standardized objective scoring system be implemented in any further comparative studies. PMID:29552273
Fungal Laccases: Production, Function, and Applications in Food Processing
Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.
2010-01-01
Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed. PMID:21048859
Construction and direct electrochemistry of orientation controlled laccase electrode.
Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong
2014-03-28
A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. Copyright © 2014 Elsevier Inc. All rights reserved.
Sharma, Rakesh Kumar; Arora, Daljit Singh
2011-02-01
Various cereal straws are used as feed by supplementing the green forage or other feed stuffs. An experiment was designed to see the effect of different geographic locations and climatological conditions on biochemical constituents, fungal degradation and in vitro digestibility of paddy straw. Paddy straw (PS) obtained from three different geographic locations of India was subjected to solid state fermentation using four white rot fungi i.e. Phlebia brevispora, P. fascicularia, P. floridensis and P. radiata. Changes in the biochemical constituents like water soluble content, hemicellulose, cellulose, lignin, total organic matter, and in vitro digestibility of paddy straw was analyzed over a period of 60 days along with lignocellulolytic enzymes i.e. laccase, xylanase and carboxymethyl cellulase. All the fungi degraded the straw samples and enhanced the in vitro digestibility. The paddy straw, obtained from north western zone (NWZ) suffered a maximum loss (228 g/kg) of lignin by P. radiata, while a maximum enhancement of in vitro digestibility from 185 to 256 g/kg was achieved by P. brevispora, which also caused minimum loss in total organic matter (98 g/kg). In PS obtained from central eastern zone (CEZ) and north eastern zone (NEZ), a maximum amount of lignin (210 and 195 g/kg, respectively) was degraded by P. floridensis and resulted into a respective enhancement of in vitro digestibility from 172 to 246 g/kg and 188 to 264 g/kg. The study demonstrates that geographic locations not only affect the biochemical constituents of paddy straw but the fungal degradation of fibers, their in vitro digestibility and lignocellulolytic enzyme activity of the fungus may also vary.
Tang, Pei-Ling; Hassan, Osman; Maskat, Mohamad Yusof; Badri, Khairiah
2015-01-01
In this study, oil palm empty fruit bunch (OPEFBF) was pretreated with alkali, and lignin was extracted for further degradation into lower molecular weight phenolic compounds using enzymes and chemical means. Efficiency of monomeric aromatic compounds production from OPEFBF lignin via chemical (nitrobenzene versus oxygen) and enzymatic [cutinase versus manganese peroxidase (MnP)] approaches was investigated. The effects of sodium hydroxide concentration (2, 5, and 10% wt.) and reaction time (30, 90, and 180 minutes) on the yield of aromatic compounds were studied. The results obtained indicated that nitrobenzene oxidation produced the highest yield (333.17 ± 49.44 ppm hydroxybenzoic acid, 5.67 ± 0.25 ppm p-hydroxybenzaldehyde, 25.57 ± 1.64 ppm vanillic acid, 168.68 ± 23.23 ppm vanillin, 75.44 ± 6.71 ppm syringic acid, 815.26 ± 41.77 ppm syringaldehyde, 15.21 ± 2.19 ppm p-coumaric acid, and 44.75 ± 3.40 ppm ferulic acid), among the tested methods. High sodium hydroxide concentration (10% wt.) was needed to promote efficient nitrobenzene oxidation. However, less severe oxidation condition was preferred to preserve the hydroxycinnamic acids (p-coumaric acid and ferulic acid). Cutinase-catalyzed hydrolysis was found to be more efficient than MnP-catalyzed oxidation in the production of aromatic compounds. By hydrolyzed 8% wt. of lignin with 0.625 mL cutinase g(-1) lignin at pH 8 and 55°C for 24 hours, about 642.83 ± 14.45 ppm hydroxybenzoic acid, 70.19 ± 3.31 ppm syringaldehyde, 22.80 ± 1.04 ppm vanillin, 27.06 ± 1.20 ppm p-coumaric acid, and 50.19 ± 2.23 ppm ferulic acid were produced.
Chantreau, Maxime; Portelette, Antoine; Dauwe, Rebecca; Kiyoto, Shingo; Crônier, David; Morreel, Kris; Arribat, Sandrine; Neutelings, Godfrey; Chabi, Malika; Boerjan, Wout; Yoshinaga, Arata; Mesnard, François; Grec, Sebastien; Chabbert, Brigitte; Hawkins, Simon
2014-11-01
Histochemical screening of a flax ethyl methanesulfonate population led to the identification of 93 independent M2 mutant families showing ectopic lignification in the secondary cell wall of stem bast fibers. We named this core collection the Linum usitatissimum (flax) lbf mutants for lignified bast fibers and believe that this population represents a novel biological resource for investigating how bast fiber plants regulate lignin biosynthesis. As a proof of concept, we characterized the lbf1 mutant and showed that the lignin content increased by 350% in outer stem tissues containing bast fibers but was unchanged in inner stem tissues containing xylem. Chemical and NMR analyses indicated that bast fiber ectopic lignin was highly condensed and rich in G-units. Liquid chromatography-mass spectrometry profiling showed large modifications in the oligolignol pool of lbf1 inner- and outer-stem tissues that could be related to ectopic lignification. Immunological and chemical analyses revealed that lbf1 mutants also showed changes to other cell wall polymers. Whole-genome transcriptomics suggested that ectopic lignification of flax bast fibers could be caused by increased transcript accumulation of (1) the cinnamoyl-CoA reductase, cinnamyl alcohol dehydrogenase, and caffeic acid O-methyltransferase monolignol biosynthesis genes, (2) several lignin-associated peroxidase genes, and (3) genes coding for respiratory burst oxidase homolog NADPH-oxidases necessary to increase H2O2 supply. © 2014 American Society of Plant Biologists. All rights reserved.
Wang, Hang; He, Zhili; Lu, Zhenmei; Zhou, Jizhong; Van Nostrand, Joy D.; Xu, Xinhua
2012-01-01
Rising climate temperatures in the future are predicted to accelerate the microbial decomposition of soil organic matter. A field microcosm experiment was carried out to examine the impact of soil warming in freshwater wetlands on different organic carbon (C) pools and associated microbial functional responses. GeoChip 4.0, a functional gene microarray, was used to determine microbial gene diversity and functional potential for C degradation. Experimental warming significantly increased soil pore water dissolved organic C and phosphorus (P) concentrations, leading to a higher potential for C emission and P export. Such losses of total organic C stored in soil could be traced back to the decomposition of recalcitrant organic C. Warming preferentially stimulated genes for degrading recalcitrant C over labile C. This was especially true for genes encoding cellobiase and mnp for cellulose and lignin degradation, respectively. We confirmed this with warming-enhanced polyphenol oxidase and peroxidase activities for recalcitrant C acquisition and greater increases in recalcitrant C use efficiency than in labile C use efficiency (average percentage increases of 48% versus 28%, respectively). The relative abundance of lignin-degrading genes increased by 15% under warming; meanwhile, soil fungi, as the primary decomposers of lignin, were greater in abundance by 27%. This work suggests that future warming may enhance the potential for accelerated fungal decomposition of lignin-like compounds, leading to greater microbially mediated C losses than previously estimated in freshwater wetlands. PMID:22923398
Chantreau, Maxime; Portelette, Antoine; Dauwe, Rebecca; Kiyoto, Shingo; Crônier, David; Morreel, Kris; Arribat, Sandrine; Neutelings, Godfrey; Chabi, Malika; Boerjan, Wout; Yoshinaga, Arata; Mesnard, François; Grec, Sebastien; Chabbert, Brigitte; Hawkins, Simon
2014-01-01
Histochemical screening of a flax ethyl methanesulfonate population led to the identification of 93 independent M2 mutant families showing ectopic lignification in the secondary cell wall of stem bast fibers. We named this core collection the Linum usitatissimum (flax) lbf mutants for lignified bast fibers and believe that this population represents a novel biological resource for investigating how bast fiber plants regulate lignin biosynthesis. As a proof of concept, we characterized the lbf1 mutant and showed that the lignin content increased by 350% in outer stem tissues containing bast fibers but was unchanged in inner stem tissues containing xylem. Chemical and NMR analyses indicated that bast fiber ectopic lignin was highly condensed and rich in G-units. Liquid chromatography-mass spectrometry profiling showed large modifications in the oligolignol pool of lbf1 inner- and outer-stem tissues that could be related to ectopic lignification. Immunological and chemical analyses revealed that lbf1 mutants also showed changes to other cell wall polymers. Whole-genome transcriptomics suggested that ectopic lignification of flax bast fibers could be caused by increased transcript accumulation of (1) the cinnamoyl-CoA reductase, cinnamyl alcohol dehydrogenase, and caffeic acid O-methyltransferase monolignol biosynthesis genes, (2) several lignin-associated peroxidase genes, and (3) genes coding for respiratory burst oxidase homolog NADPH-oxidases necessary to increase H2O2 supply. PMID:25381351
SENGUPTA, GARGI; PALIT, P.
2004-01-01
• Background and Aims High lignin content of lignocellulose jute fibre does not favour its utilization in making finer fabrics and other value‐added products. To aid the development of low‐lignin jute fibre, this study aimed to identify a phloem fibre mutant with reduced lignin. • Methods An x‐ray‐induced mutant line (CMU) of jute (Corchorus capsularis) was morphologically evaluated and the accession (CMU 013) with the most undulated phenotype was compared with its normal parent (JRC 212) for its growth, secondary fibre development and lignification of the fibre cell wall. • Key Results The normal and mutant plants showed similar leaf photosynthetic rates. The mutant grew more slowly, had shorter internodes and yielded much less fibre after retting. The fibre of the mutant contained 50 % less lignin but comparatively more cellulose than that of the normal type. Differentiation of primary and secondary vascular tissues throughout the CMU 013 stem was regular but it did not have secondary phloem fibre bundles as in JRC 212. Instead, a few thin‐walled, less lignified fibre cells formed uni‐ or biseriate radial rows within the phloem wedges of the middle stem. The lower and earliest developed part of the mutant stem had no lignified fibre cells. This developmental deficiency in lignification of fibre cells was correlated to a similar deficiency in phenylalanine ammonia lyase activity, but not peroxidase activity, in the bark tissue along the stem axis. In spite of severe reduction in lignin synthesis in the phloem cells this mutant functioned normally and bred true. • Conclusions In view of the observations made, the mutant is designated as deficient lignified phloem fibre (dlpf). This mutant may be utilized to engineer low‐lignin jute fibre strains and may also serve as a model to study the positional information that coordinates secondary wall thickening of fibre cells. PMID:14707004
Yang, Hua; Sun, Hongfei; Zhang, Shujuan; Wu, Bingdang; Pan, Bingcai
2015-07-01
Low-cost and environmentally friendly mediators could facilitate the application of laccase (EC 1.10.3.2) in variant biotechnological processes. Acetylacetone (AA) represents an inexpensive and low toxic small molecular diketone that has been proven as an effective mediator for laccase in free radical polymerization. However, the potential of AA as a mediator for laccase in pollutant detoxification and/or degradation is still unknown. In this work, the roles of AA in laccase-induced polymerization and transformation were investigated. AA was demonstrated to be a highly efficient mediator in the laccase-induced grafting copolymerization of acrylamide and chitosan. The efficacy of AA in the laccase-induced decoloration of malachite green (MG) was compared with that of the widely used 1-hydroxybenzotriazole (HBT). The laccase-AA system had the highest turnover number (TON, 39.1 μmol/U), followed by the laccase-only system (28.5 μmol/U), while the TON of the laccase-HBT system was the lowest (14.9 μmol/U). The pseudo-first-order transformation rate constant (k 1) of MG in the laccase-AA system was up to 0.283 h(-1) under the given conditions, while the k 1 of AA caused by laccase was only 0.008 h(-1). In the five-cycle run, the concentration of AA remained stable. The larger TON of the laccase-AA system and the stability of AA in the cycling runs demonstrate that AA was more recyclable than HBT in the LMS, leading to a prolonged serving life of laccase. These results suggest that AA might be a potential redox mediator for laccase.
Wu, Mianbin; Xia, Liming
2002-06-01
Both laccase production by the white-rot fungus Coriolus versicolor and decolorization of dyestuff and dying waste water with crude solution of laccase were studied in this work. Laccase production meets the definition of secondary metabolism. For laccase production the optimum initial pH is 4.5. Addition of veratryl alcohol or elevated trace metals could both enhance the laccase activity, while Tween80 showed some inhibition. The immobilized mycelia of C. versicolor in polyurethane foam had less laccase production ability than mycelial pellets. A repeated batch cultivation process was found to be a very economical way for laccase harvest. The same pellets could be used for at least 14 times and average laccase activity of each batch could maintain 6.72 IU/mL. This method reduces the enzyme production course, medium consumption and the possibility of contamination, showing high efficient and great economic benefit. Good results were also obtained in decolorization experiments with the crude solution of laccase. With 3.3 IU/mL initial laccase activity, color removal of Acid Orange reached 98.5% after 24 h reaction. Also with 2.6 IU/mL initial laccase activity, color removal of dying waste water reached 93% after 24 h reaction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aston, John E.; Apel, William A.; Lee, Brady D.
Alicyclobacillus acidocaldarius, a thermoacidophilic bacterium, has a repertoire of thermo- and acid-stable enzymes that deconstruct lignocellulosic compounds. The work presented here describes the ability of A. acidocaldarius to reduce the concentration of the phenolic compounds: phenol, ferulic acid, ρ-coumaric acid and sinapinic acid during growth conditions. The extent and rate of the removal of these compounds were significantly increased by the presence of micro-molar copper concentrations, suggesting activity by copper oxidases that have been identified in the genome of A. acidocaldarius. Substrate removal kinetics was first order for phenol, ferulic acid, ρ-coumaric acid and sinapinic acid in the presence ofmore » 50 μM copper sulfate. In addition, laccase enzyme assays of cellular protein fractions suggested significant activity on a lignin analog between the temperatures of 45 and 90 °C. As a result, this work shows the potential for A. acidocaldarius to degrade phenolic compounds, demonstrating potential relevance to biofuel production and other industrial processes.« less
Kumar, Amit; Singh, Deepti; Sharma, Krishna K.; Arora, Sakshi; Singh, Amarjeet K.; Gill, Sarvajeet S.; Singhal, Barkha
2017-01-01
Basidiomycetous fungi, Ganoderma lucidum MDU-7 and Ganoderma sp. kk-02 secreted multiple laccase isozymes under diverse growth condition. Aromatic compounds and metal salts were also found to regulate the differential expression of laccase isozymes from both the Ganoderma sp. Laccase isozymes induced in the presence of copper from G. lucidum MDU-7 were purified by gel-based (native-PAGE) purification method. The purity of laccase isozymes was checked by zymogram and SDS-PAGE. The SDS-PAGE of purified proteins confirmed the multimeric nature of laccase isozymes. The molecular mass of isozymes was found to be in the range of 40–66 kDa. Further, the purified laccase isozymes and their peptides were confirmed with the help of MALDI-TOF peptide fingerprinting. The biochemical characterization of laccase isozymes viz. Glac L2, Glac L3, Glac L4, and Glac L5 have shown the optimum temperature in the range of 30°–45°C and pH 3.0. The Km values of all the laccase isozymes determined for guaiacol were (96–281 μM), ABTS (15–83 μM) and O-tolidine (78–724 μM). Further, laccase isozymes from G. lucidum whole genome were studied using bioinformatics tools. The molecular modeling and docking of laccase isozymes with different substrates showed a significant binding affinity, which further validates our experimental results. Interestingly, copper induced laccase of 40 U/ml in culture medium was found to significantly induce cotton callogenesis. Interestingly, all the laccase isozymes were found to have an antioxidative role and therefore capable in free radicals scavenging during callogenesis. This is the first detailed study on the biochemical characterization of all the laccase isozymes purified by a gel-based novel method. PMID:28473815
Salony; Garg, N; Baranwal, R; Chhabra, M; Mishra, S; Chaudhuri, T K; Bisaria, V S
2008-02-01
Cyathus bulleri, a ligninolytic fungus, produces a single laccase the internal peptides (3) of which bear similarity to laccases of several white rot fungi. Comparison of the total amino acid composition of this laccase with several fungal laccases indicated dissimilarity in the proportion of some basic and hydrophobic amino acids. Analysis of the circular dichroism spectrum of the protein indicated 37% alpha-helical, 26% beta-sheet and 38% random coil content which differed significantly from that in the solved structures of other laccases, which contain higher beta-sheet structures. The critical role of the carboxylic group containing amino acids was demonstrated by determining the kinetic parameters at different pH and this was confirmed by the observation that a critical Asp is strongly conserved in both Ascomycete and Basidiomycete laccases. The enzyme was denatured in the presence of a number of denaturing agents and refolded back to functional state with copper. In the folding experiments under alkaline conditions, zinc could replace copper in restoring 100% of laccase activity indicating the non-essential role of copper in this laccase. The laccase was expressed in Escherichia coli by a modification of the ligation-anchored PCR approach making it the first fungal laccase to be expressed in a bacterial host. The laccase sequence was confirmed by way of analysis of a 435 bp sequence of the insert.
NASA Astrophysics Data System (ADS)
Baker, N. R.; Allison, S. D.
2013-12-01
Traditional decomposition models developed in mesic ecosystems often consistently underestimate rates of decomposition in more arid ecosystems such as deserts and Mediterranean grasslands. Photodegradation of plant litter by ultraviolet radiation (UV) is hypothesized to be one of the mechanisms accounting for the greater-than-expected rates of decomposition observed in these ecosystems. Putatively, photodegradation preferentially degrades complex aromatic compounds in litter such as lignin, whose decomposition is considered a rate-limiting step in the microbial decomposition of plant litter. This study tested the effects of attenuated ultraviolet radiation on the decomposition of two litter types over the course of a year in a Southern California Mediterranean grassland. The two types of litter differed primarily in lignin content to test for a differential effect of UV on high-lignin versus low-lignin litter. Rates of litter mass loss, changes in litter chemistry, and changes in microbial activity and microbial biomass were observed, and assays of extracellular enzymes were conducted at 5 points through the year, beginning during the dry season and continuing until the end of the following dry season. Litter exposed to attenuated ultraviolet radiation during the dry season had lower rates of mass loss than litter exposed to ambient radiation (6.1% vs. 8.6%, respectively, p < 0.04). Extracellular enzyme activities were significantly affected by UV attenuation, as low lignin samples exposed to attenuated UV displayed elevated cellulase enzyme activity potential during the wet season, while high lignin samples displayed decreased oxidative enzyme activity potential during the wet season. For example, potential activity of the cellulase cellobiohydrolase in low-lignin, ambient UV samples was 5286 μmol/hr*g during the wet season, compared to 7969 μmol/hr*g in attenuated UV samples (p < 0.003). Conversely, potential activity of the oxidative enzyme peroxidase in high-lignin, ambient UV samples was 85.9 μmol/hr*g during the wet season, compared to 44.1 μmol/hr*g in attenuated UV samples (p < 0.028). This increased potential cellulase activity under attenuated UV may indicate that dry season photodegradation primes low-lignin litter for wet season decomposition, reducing the selective pressure for microbial decomposers to invest in costly extracellular enzyme production. Similarly, the reduced potential oxidative enzyme activity in high-lignin samples exposed to attenuated UV may indicate that photodegradation is necessary to facilitate the breakdown of more complex compounds such as lignin by microbial decomposers. We conclude that while abiotic factors such as photodegradation can have a significant effect on the mechanisms of plant matter decomposition in semiarid ecosystems, these effects are not only restricted to the dry season and may also facilitate wet season decomposition.
Baldrian, Petr; in der Wiesche, Carsten; Gabriel, Jiří; Nerud, František; Zadražil, František
2000-01-01
The white-rot fungus Pleurotus ostreatus was able to degrade the polycyclic aromatic hydrocarbons (PAHs) benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene, benzo[a]pyrene, dibenzo[a,h]anthracene, and benzo[ghi]perylene in nonsterile soil both in the presence and in the absence of cadmium and mercury. During 15 weeks of incubation, recovery of individual compounds was 16 to 69% in soil without additional metal. While soil microflora contributed mostly to degradation of pyrene (82%) and benzo[a]anthracene (41%), the fungus enhanced the disappearance of less-soluble polycyclic aromatic compounds containing five or six aromatic rings. Although the heavy metals in the soil affected the activity of ligninolytic enzymes produced by the fungus (laccase and Mn-dependent peroxidase), no decrease in PAH degradation was found in soil containing Cd or Hg at 10 to 100 ppm. In the presence of cadmium at 500 ppm in soil, degradation of PAHs by soil microflora was not affected whereas the contribution of fungus was negligible, probably due to the absence of Mn-dependent peroxidase activity. In the presence of Hg at 50 to 100 ppm or Cd at 100 to 500 ppm, the extent of soil colonization by the fungus was limited. PMID:10831426
2014-01-01
Several species of white-rot fungi were investigated for their utility in prolonged decolouration of the recalcitrant sulfonated azo dye, amaranth. Trametes pubescens, T. multicolor, T. meyenii and T. versicolor decoloured amaranth azo-dye best on low-nitrogen agar-solidified media whereas Bjerkandera adusta and Phlebia radiata were most effective in low nitrogen medium supplemented with manganese. Trametes cotonea did not decolour effectively under any condition. The decolouring Trametes species were also effective in liquid culture whereas B. adusta and P. radiata were not. Trametes meyenii, T. pubescens and T. multicolor were equal to or better than commonly employed T. versicolor at decolouring amaranth. This is the first study to show the dye decolouration potential of T. meyenii, T. pubescens, and T. multicolor. Supplementing with Mn(II) increased assayable manganese peroxidase activity, but not long-term decolouration, indicating that laccase is the main decolourizing enzyme in these Trametes species. This appears to be because of inadequate Mn3+ chelation required by manganese peroxidase because adding relatively low amounts of malonate enhanced decolouration rates. The ability of Trametes meyenii to simultaneously decolour dye over prolonged periods of time while growing in relatively nutrient-rich medium appears to be unique amongst white-rot fungi, indicating its potential in wastewater bioremediation. PMID:25401075
Lin, Jian-Ping; Wei, Lian; Xia, Li-Ming; Cen, Pei-Lin
2003-01-01
The production of laccase by Coriolus versicolor was studied. The effect of cultivation conditions on laccase production by Coriolus versicolor was examined to obtain optimal medium and cultivation conditions. Both batch and repeated-batch processes were performed for laccase production. In repeated-batch fermentation with self-immobilized mycelia, total of 14 cycles were performed with laccase activity in the range between 3.4 and 14.8 U/ml.
Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.
Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E
2014-07-20
We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.
Ravalason, Holy; Bertaud, Frédérique; Herpoël-Gimbert, Isabelle; Meyer, Valérie; Ruel, Katia; Joseleau, Jean-Paul; Grisel, Sacha; Olivé, Caroline; Sigoillot, Jean-Claude; Petit-Conil, Michel
2012-10-01
Pycnoporus cinnabarinus laccase and a chimeric laccase-CBM were applied in softwood kraft pulp biobleaching in the presence of 1-hydroxybenzotriazole (HBT). The presence of CBM could enhance the laccase biobleaching potential as a decrease in the enzymatic charge and chlorine dioxide consumption, as well as an increase in pulp brightness were observed. Laccase/HBT treatment could be improved by increasing oxygen pressure from 1 to 3bar and pulp consistency from 5% to 10%. Conversely, under the same conditions, no improvement of laccase-CBM/HBT treatment was observed, indicating a different behavior of both systems. However, laccase-CBM/HBT treatment led to a better preservation of pulp properties. This effect was probably due to fiber surface modifications involving the action of the CBM. Transmission electron microscopy examination of pulp fibers indicated a retention of laccase-CBM inside the pulp fibers due to CBM binding and an increased external microfibrillation of the fibers due to enzymatic treatments. Copyright © 2012 Elsevier Ltd. All rights reserved.
Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao
2014-08-01
A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Aydemir, Tülin; Güler, Semra
2015-01-01
Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h.
Effect of different compounds on the induction of laccase production by Agaricus blazei.
Valle, J S; Vandenberghe, L P S; Oliveira, A C C; Tavares, M F; Linde, G A; Colauto, N B; Soccol, C R
2015-12-03
Laccases are polyphenol oxidases produced by many fungi and have many applications in textile, food and beverage, and pulp and paper industries. Laccase production can be induced using aromatic or phenolic compounds that mostly affect the transcription of laccase-encoding genes. In this study, we analyzed laccase and biomass production by Agaricus blazei in the presence of different concentrations of nitrogen, copper, and inducers such as pyrogallol, veratryl alcohol, xylidine, vanillin, guaiacol, and ethanol. Laccase production by A. blazei U2-4 reached 43.8 U/mL in the presence of 2.8 g/L nitrogen and 150 μM copper. However, addition of copper to the cultivation medium decreased biomass production. Different compounds differentially induced laccase production by A. blazei. Moreover, different concentrations of these inducers exerted different effects on laccase activity. Ethanol (1.0 mM), guaiacol (0.5 mM), and vanillin (0.5 mM) were the best inducers and increased laccase activity by 120% (A. blazei U2-2), 30% (A. blazei U2-3), and 9% (A. blazei U2-4), respectively. In contrast, pyrogallol and xylidine decreased laccase activity but increased biomass production.
Synthesis of novel laccase-biotitania biocatalysts for malachite green decolorization.
Zhang, Xinying; Wang, Meiyin; Lin, Linlin; Xiao, Gao; Tang, Zhenping; Zhu, Xuefeng
2018-07-01
Biomimetic mineralization has emerged as a novel tool for generating excellent supports for enzyme stabilization. In this work, protamine was used to induce titanium (IV) bis(ammonium lactato) dihydroxide (Ti-BALDH) into titania nanoparticles. This biomimetic titanification process was adopted for laccase immobilization. Laccase-biotitania biocatalyst was prepared and the effect of different parameters (buffer solution, titania precursor concentration, protamine concentration, and enzyme loading) on the encapsulation efficiency and recovery of laccase were evaluated. Compared with free laccase, the thermal and pH stability of immobilized laccase were improved significantly. In addition, laccase loaded on titania was effective at enhancing its storage stability. After seven consecutive cycles, the immobilized laccase still retained 51% of its original activity. Finally, laccase-biotitania biocatalysts showed good performance on decolorization of malachite green (MG), which can be attributed to an adsorption and degradation effect. The intermediates of the MG degradation were identified by gas chromatography-mass spectrometry (GC-MS) analysis, and the most probable degradation pathway was proposed. This study provides deeper understanding of the laccase-biotitania particles as a fast biocatalyst for MG decolorization. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Sun, Jiao; Guo, Na; Niu, Li-Li; Wang, Qing-Fang; Zang, Yu-Ping; Zu, Yuan-Gang; Fu, Yu-Jie
2017-04-23
The present study was conducted to screen a laccase-producing fungal endophyte, optimize fermentation conditions, and evaluate the decolorization ability of the laccase. A new fungal endophyte capable of laccase-producing was firstly isolated from pigeon pea and identified as Myrothecium verrucaria based on a ITS-rRNA sequences analysis. Meanwhile, various fermentation parameters on the laccase production were optimized via response surface methodology (RSM). The optimal fermentation conditions were a fermentation time of five days, temperature 30 °C and pH 6.22. Laccase activity reached 16.52 ± 0.18 U/mL under the above conditions. Furthermore, the laccase showed effective decolorization capability toward synthetic dyes (Congo red, Methyl orange, Methyl red, and Crystal violet) in the presence of the redox mediator ABTS, with more than 70% of dyes decolorizing after 24 h of incubation. Additionally, the activity of laccase was relatively stable with pH (4.5-6.5) and a temperature range of 35-55 °C. Therefore, the high laccase production of the strain and the new fungal laccase could provide a promising alterative approach for industrial and environmental applications.
Improving the oxidative stability of a high redox potential fungal peroxidase by rational design.
Sáez-Jiménez, Verónica; Acebes, Sandra; Guallar, Victor; Martínez, Angel T; Ruiz-Dueñas, Francisco J
2015-01-01
Ligninolytic peroxidases are enzymes of biotechnological interest due to their ability to oxidize high redox potential aromatic compounds, including the recalcitrant lignin polymer. However, different obstacles prevent their use in industrial and environmental applications, including low stability towards their natural oxidizing-substrate H2O2. In this work, versatile peroxidase was taken as a model ligninolytic peroxidase, its oxidative inactivation by H2O2 was studied and different strategies were evaluated with the aim of improving H2O2 stability. Oxidation of the methionine residues was produced during enzyme inactivation by H2O2 excess. Substitution of these residues, located near the heme cofactor and the catalytic tryptophan, rendered a variant with a 7.8-fold decreased oxidative inactivation rate. A second strategy consisted in mutating two residues (Thr45 and Ile103) near the catalytic distal histidine with the aim of modifying the reactivity of the enzyme with H2O2. The T45A/I103T variant showed a 2.9-fold slower reaction rate with H2O2 and 2.8-fold enhanced oxidative stability. Finally, both strategies were combined in the T45A/I103T/M152F/M262F/M265L variant, whose stability in the presence of H2O2 was improved 11.7-fold. This variant showed an increased half-life, over 30 min compared with 3.4 min of the native enzyme, under an excess of 2000 equivalents of H2O2. Interestingly, the stability improvement achieved was related with slower formation, subsequent stabilization and slower bleaching of the enzyme Compound III, a peroxidase intermediate that is not part of the catalytic cycle and leads to the inactivation of the enzyme.
Response of ligninolytic macrofungi to the herbicide atrazine: dose-response bioassays.
Cupul, Wilberth Chan; Abarca, Gabriela Heredia; Vázquez, Refugio Rodríguez; Salmones, Dulce; Hernández, Rigoberto Gaitán; Gutiérrez, Enrique Alarcón
2014-01-01
The effect of atrazine concentrations on mycelial growth and ligninolytic enzyme activities of eight native ligninolytic macrofungi isolated in Veracruz, México, were evaluated in a semi-solid culture medium. Inhibition of mycelial growth and growth rates were significantly affected (p=0.05) by atrazine concentrations (468, 937, 1875, and 3750 mg/l). In accordance with the median effective concentration (EC50), Pleurotus sp. strain 1 proved to be the most tolerant isolate to atrazine (EC50=2281.0 mg/l), although its enzyme activity was not the highest. Pycnoporus sanguineus strain 2, Daedalea elegans and Trametes maxima showed high laccase activity (62.7, 31.9, 29.3 U mg/protein, respectively) without atrazine (control); however, this activity significantly increased (p<0.05) (to 191.1, 83.5 and 120.6 U mg/protein, respectively) owing to the effect of atrazine (937 mg/l) in the culture medium. Pleurotus sp. strain 2 and Cymatoderma elegans significantly increased (p<0.05) their manganese peroxidase (MnP) activities under atrazine stress at 468 mg/l. The isolates with high EC50 (Pleurotus sp. strain 1) and high enzymatic activity (P. sanguineus strain 2 and T. maxima) could be considered for future studies on atrazine mycodegradation. Furthermore, this study confirms that atrazine can increase laccase and MnP activities in ligninolytic macrofungi. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.
Muñoz, C; Guillén, F; Martínez, A T; Martínez, M J
1997-01-01
Two laccase isoenzymes produced by Pleurotus eryngii were purified to electrophoretic homogeneity (42- and 43-fold) with an overall yield of 56.3%. Laccases I and II from this fungus are monomeric glycoproteins with 7 and 1% carbohydrate content, molecular masses (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 65 and 61 kDa, and pIs of 4.1 and 4.2, respectively. The highest rate of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) oxidation for laccase I was reached at 65 degrees C and pH 4, and that for laccase II was reached at 55 degrees C and pH 3.5. Both isoenzymes are stable at high pH, retaining 60 to 70% activity after 24 h from pH 8 to 12. Their amino acid compositions and N-terminal sequences were determined, the latter strongly differing from those of laccases of other basidiomycetes. Antibodies against laccase I reacted with laccase II, as well as with laccases from Pleurotus ostreatus, Pleurotus pulmonarius, and Pleurotus floridanus. Different hydroxy- and methoxy-substituted phenols and aromatic amines were oxidized by the two laccase isoenzymes from P. eryngii, and the influence of the nature, number, and disposition of aromatic-ring substituents on kinetic constants is discussed. Although both isoenzymes presented similar substrate affinities, the maximum rates of reactions catalyzed by laccase I were higher than those of laccase II. In reactions with hydroquinones, semiquinones produced by laccase isoenzymes were in part converted into quinones via autoxidation. The superoxide anion radical produced in the latter reaction dismutated, producing hydrogen peroxide. In the presence of manganous ion, the superoxide union was reduced to hydrogen peroxide with the concomitant production of manganic ion. These results confirmed that laccase in the presence of hydroquinones can participate in the production of both reduced oxygen species and manganic ions. PMID:9172335
Laccases: Production, Expression Regulation, and Applications in Pharmaceutical Biodegradation
Yang, Jie; Li, Wenjuan; Ng, Tzi Bun; Deng, Xiangzhen; Lin, Juan; Ye, Xiuyun
2017-01-01
Laccases are a family of copper-containing oxidases with important applications in bioremediation and other various industrial and biotechnological areas. There have been over two dozen reviews on laccases since 2010 covering various aspects of this group of versatile enzymes, from their occurrence, biochemical properties, and expression to immobilization and applications. This review is not intended to be all-encompassing; instead, we highlighted some of the latest developments in basic and applied laccase research with an emphasis on laccase-mediated bioremediation of pharmaceuticals, especially antibiotics. Pharmaceuticals are a broad class of emerging organic contaminants that are recalcitrant and prevalent. The recent surge in the relevant literature justifies a short review on the topic. Since low laccase yields in natural and genetically modified hosts constitute a bottleneck to industrial-scale applications, we also accentuated a genus of laccase-producing white-rot fungi, Cerrena, and included a discussion with regards to regulation of laccase expression. PMID:28559880
D'Souza-Ticlo, Donna; Garg, Sandeep; Raghukumar, Chandralata
2009-11-25
The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159. Inducible laccases were produced in the idiophase only after addition of an inducer such as CuSO(4). Concentration of carbon and nitrogen acted antagonistically with respect to laccase production. A combination of low nitrogen and high carbon concentration favored both biomass and laccase production. The most favorable combination resulted in 917 U L(-1) of laccase. After sufficient growth had occurred, addition of a surfactant such as Tween 80 positively impacted biomass and increased the laccase activity to around 1,300 U L(-1). Increasing the surface to volume ratio of the culture vessel further increased its activity to almost 2,000 U L(-1).
Role of laccase from Coriolus versicolor MTCC-138 in selective oxidation of aromatic methyl group.
Chaurasia, Pankaj Kumar; Singh, Sunil Kumar; Bharati, Shashi Lata
2014-01-01
Now a day, laccases are the most promising enzymes in the area of biotechnology and synthesis. One of the best applications of laccases is the selective oxidation of aromatic methyl group to aldehyde group. Such transformations are valuable because it is difficult to stop the reaction at aldehyde stage. Chemical methods used for such biotransformations areexpensive and give poor yields. But, the laccase-catalyzed biotransformations of such type are non-expensive and yield is excellent. Authors have used crude laccase obtained from the liquid culture growth medium of fungal strain Coriolus versicolor MTCC-138 for the biotransformations of toluene, 3-nitrotoluene, and 4-chlorotoluene to benzaldehyde, 3-nitrobenzaldehyde, and 4-chlorobenzaldehyde, respectively, instead of purified laccase because purification process requires much time and cost. This communication reports that crude laccase can also be used in the place of purified laccase as effective biocatalyst.
Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan
2013-01-01
Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101
Nguyen, Luong N; Hai, Faisal I; Dosseto, Anthony; Richardson, Christopher; Price, William E; Nghiem, Long D
2016-06-01
Laccase was immobilized on granular activated carbon (GAC) and the resulting GAC-bound laccase was used to degrade four micropollutants in a packed-bed column. Compared to the free enzyme, the immobilized laccase showed high residual activities over a broad range of pH and temperature. The GAC-bound laccase efficiently removed four micropollutants, namely, sulfamethoxazole, carbamazepine, diclofenac and bisphenol A, commonly detected in raw wastewater and wastewater-impacted water sources. Mass balance analysis showed that these micropollutants were enzymatically degraded following adsorption onto GAC. Higher degradation efficiency of micropollutants by the immobilized compared to free laccase was possibly due to better electron transfer between laccase and substrate molecules once they have adsorbed onto the GAC surface. Results here highlight the complementary effects of adsorption and enzymatic degradation on micropollutant removal by GAC-bound laccase. Indeed laccase-immobilized GAC outperformed regular GAC during continuous operation of packed-bed columns over two months (a throughput of 12,000 bed volumes). Copyright © 2016 Elsevier Ltd. All rights reserved.
Zhou, Yue; Yang, Bing; Yang, Yang; Jia, Rong
2014-03-01
Manganese peroxidase (MnP), a crucial enzyme in lignin degradation, has wide potential applications in environmental protection. However, large-scale industrial application of this enzyme is limited due to several factors primarily related to cost and availability. Special attention has been paid to the production of MnP from inexpensive sources, such as lignocellulosic residues, using solid-state fermentation (SSF) systems. In the present study, a suitable SSF medium for the production of MnP by Schizophyllum sp. F17 from agro-industrial residues has been optimized. The mixed solid medium, comprising pine sawdust, rice straw, and soybean powder at a ratio of 0.52:0.15:0.33, conferred a maximum enzyme activity of 11.18 U/g on the sixth day of SSF. The results show that the use of wastes such as pine sawdust and rice straw makes the enzyme production more economical as well as helps solve environmental problems.
Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi
Mander, Gerd J.; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C.; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G.; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard
2006-01-01
Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2′-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain. PMID:16820501