Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation

PubMed Central

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-01-01

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0–6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation. PMID:27775052

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation.

PubMed

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-10-24

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0-6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation.

Conditions Optimizing and Application of Laccase-mediator System (LMS) for the Laccase-catalyzed Pesticide Degradation

NASA Astrophysics Data System (ADS)

Jin, Xiaoting; Yu, Xiangyang; Zhu, Guangyan; Zheng, Zuntao; Feng, Fayun; Zhang, Zhiyong

2016-10-01

A high capacity of laccase from Trametes versicolor capable of degrading pesticides has been revealed. The conditions for degrading of five selected pesticides including chlorpyrifos, chlorothalonil, pyrimethanil, atrazine and isoproturon with the purified laccases from Trametes versicolor were optimized. The results showed that the optimum conditions for the highest activity were pH at 5.0 and temperature at 25 °C. The best mediators were violuric acid for pyrimethanil and isoproturon, vanillin for chlorpyrifos, and acetosyringone and HBT for chlorothalonil and atrazine, respectively. The laccase was found to be stable at a pH range from 5.0 to 7.0 and temperature from 25 to 30 °C. It was observed that each pesticide required a different laccase mediator concentration typically between 4.0-6.0 mmol/L. In the experiment, the degradation rates of pyrimethanil and isoproturon were significantly faster than those of chlorpyrifos, chlorothalonil and atrazine. For example, it was observed that pyrimethanil and isoproturon degraded up to nearly 100% after 24 hours while the other three pesticides just reached up 90% of degradation after 8 days of incubation.

Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination

PubMed Central

Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

2009-01-01

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

Degradation of anthracene by laccase of Trametes versicolor in the presence of different mediator compounds.

PubMed

Johannes, C; Majcherczyk, A; Hüttermann, A

1996-10-01

Laccase of Trametes versicolor was generally able to oxidize anthracene in vitro. After 72 h incubation about 35% of the anthracene was transformed stoichiometrically to 9,10-anthraquinone. Transformation of anthracene increased rapidly in the presence of different mediators that readily generate stable radicals: 2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and 1-hydroxybenzotriazole. For the reaction, the presence of both the laccase and the mediator was necessary. In the presence of 0.005 mM 1-hydroxybenzotriazole this conversion had removed 47% of the anthracene after 72 h; 75% of the substrate was oxidized during this period when ABTS (1 mM) was used as mediator. In contrast to reactions without or with only low concentrations of a mediator, there was a discrepancy between the disappearance of anthracene and the formation of 9,10-anthraquinone in mediator-forced reactions. Coupling-products of mediators with anthracene degradation products were found. Anthracene disappeared nearly completely after incubation for 72 h with laccase in a 0.1 mM solution of 1-hydroxybenzotriazole and was transformed to 9,10-anthraquinone in about 80% yield; 90% of the substrate was transformed in the presence of ABTS (2.0 mM) resulting again in 80% quinone. Phenothiazine was not effective in this system.

Laccase-initiated cross-linking of lignocellulose fibres using a ultra-filtered lignin isolated from kraft black liquor.

PubMed

Elegir, G; Bussini, D; Antonsson, S; Lindström, M E; Zoia, L

2007-12-01

In this work, the effect of Trametes pubescens laccase (TpL) used in combination with a low-molecular-weight ultra-filtered lignin (UFL) to improve mechanical properties of kraft liner pulp and chemi-thermo-mechanical pulp was studied. UFL was isolated by ultra-filtration from the kraft cooking black liquor obtained from softwood pulping. This by-product from the pulp industry contains an oligomeric lignin with almost twice the amount of free phenolic moieties than residual kraft pulp lignin. The reactivity of TpL on UFL and kraft pulp was studied by nuclear magnetic resonance spectroscopy and size exclusion chromatography. Laccase was shown to polymerise UFL and residual kraft pulp lignin in the fibres, seen by the increase in their average molecular weight and in the case of UFL as a decrease in the amount of phenolic hydroxyls. The laccase initiated cross-linking of lignin, mediated by UFL, which gives rise to more than a twofold increase in wet strength of kraft liner pulp handsheets without loosing other critical mechanical properties. Hence, this could be an interesting path to decrease mechano-sorptive creep that has been reported to lessen in extent as wet strength is given to papers. The laccase/2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) mediator system showed a greater increase in wet tensile strength of the resulting pulp sheets than the laccase/UFL system. However, other mechanical properties such as dry tensile strength, compression strength and Scott Bond internal strength were negatively affected by the laccase/ABTS system.

Laccase from Pycnoporus cinnabarinus and phenolic compounds: can the efficiency of an enzyme mediator for delignifying kenaf pulp be predicted?

PubMed

Andreu, Glòria; Vidal, Teresa

2013-03-01

In this work, kenaf pulp was delignified by using laccase in combination with various redox mediators and the efficiency of the different laccase–mediator systems assessed in terms of the changes in pulp properties after bleaching. The oxidative ability of the individual mediators used (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and actovanillone) and the laccase–mediator systems was determined by monitoring the oxidation–reduction potential (ORP) during process. The results confirmed the production of phenoxy radicals of variable reactivity and stressed the significant role of lignin structure in the enzymatic process. Although changes in ORP were correlated with the oxidative ability of the mediators, pulp properties as determined after the bleaching stage were also influenced by condensation and grafting reactions. As shown here, ORP measurements provide a first estimation of the delignification efficiency of a laccase–mediator system. Copyright © 2013 Elsevier Ltd. All rights reserved.

Bioprospecting and biotechnological applications of fungal laccase.

PubMed

Upadhyay, Pooja; Shrivastava, Rahul; Agrawal, Pavan Kumar

2016-06-01

Laccase belongs to a small group of enzymes called the blue multicopper oxidases, having the potential ability of oxidation. It belongs to enzymes, which have innate properties of reactive radical production, but its utilization in many fields has been ignored because of its unavailability in the commercial field. There are diverse sources of laccase producing organisms like bacteria, fungi and plants. In fungi, laccase is present in Ascomycetes, Deuteromycetes, Basidiomycetes and is particularly abundant in many white-rot fungi that degrade lignin. Laccases can degrade both phenolic and non-phenolic compounds. They also have the ability to detoxify a range of environmental pollutants. Due to their property to detoxify a range of pollutants, they have been used for several purposes in many industries including paper, pulp, textile and petrochemical industries. Some other application of laccase includes in food processing industry, medical and health care. Recently, laccase has found applications in other fields such as in the design of biosensors and nanotechnology. The present review provides an overview of biological functions of laccase, its mechanism of action, laccase mediator system, and various biotechnological applications of laccase obtained from endophytic fungi.

A high effective NADH-ferricyanide dehydrogenase coupled with laccase for NAD(+) regeneration.

PubMed

Wang, Jizhong; Yang, Chengli; Chen, Xing; Bao, Bingxin; Zhang, Xuan; Li, Dali; Du, Xingfan; Shi, Ruofu; Yang, Junfang; Zhu, Ronghui

2016-08-01

To find an efficient and cheap system for NAD(+) regeneration A NADH-ferricyanide dehydrogenase was obtained from an isolate of Escherichia coli. Optimal activity of the NADH dehydrogenase was at 45 °C and pH 7.5, with a K m value for NADH of 10 μM. By combining the NADH dehydrogenase, potassium ferricyanide and laccase, a bi-enzyme system for NAD(+) regeneration was established. The system is attractive in that the O2 consumed by laccase is from air and the sole byproduct of the reaction is water. During the reaction process, 10 mM NAD(+) was transformed from NADH in less than 2 h under the condition of 0.5 U NADH dehydrogenase, 0.5 U laccase, 0.1 mM potassium ferricyanide at pH 5.6, 30 °C CONCLUSION: The bi-enzyme system employed the NADH-ferricyanide dehydrogenase and laccase as catalysts, and potassium ferricyanide as redox mediator, is a promising alternative for NAD(+) regeneration.

Laccase pretreatment for agrofood wastes valorization.

PubMed

Giacobbe, Simona; Pezzella, Cinzia; Lettera, Vincenzo; Sannia, Giovanni; Piscitelli, Alessandra

2018-06-01

Apple pomace, potato peels, and coffee silverskin are attractive agrofood wastes for the production of biofuels and chemicals, due to their abundance and carbohydrate content. As lignocellulosic biomasses, their conversion is challenged by the presence of lignin that prevents hydrolysis of polysaccharides, hence demanding a pretreatment step. In this work, the effectiveness of Pleurotus ostreatus laccases (with and without mediator) to remove lignin, improving the subsequent saccharification, was assessed. Optimized conditions for sequential protocol were set up for all agrofood wastes reaching delignification and detoxification yields correlated with high saccharification. Especially noteworthy were results for apple pomace and coffee silverskin for which 83% of and 73% saccharification yields were observed, by using laccase and laccase mediator system, respectively. The herein developed sequential protocol, saving soluble sugars and reducing the amount of wastewater, can improve the overall process for obtaining chemicals or fuels from agrofood wastes. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Electron beam-induced immobilization of laccase on porous supports for waste water treatment applications.

PubMed

Jahangiri, Elham; Reichelt, Senta; Thomas, Isabell; Hausmann, Kristin; Schlosser, Dietmar; Schulze, Agnes

2014-08-08

The versatile oxidase enzyme laccase was immobilized on porous supports such as polymer membranes and cryogels with a view of using such biocatalysts in bioreactors aiming at the degradation of environmental pollutants in wastewater. Besides a large surface area for supporting the biocatalyst, the aforementioned porous systems also offer the possibility for simultaneous filtration applications in wastewater treatment. Herein a "green" water-based, initiator-free, and straightforward route to highly reactive membrane and cryogel-based bioreactors is presented, where laccase was immobilized onto the porous polymer supports using a water-based electron beam-initiated grafting reaction. In a second approach, the laccase redox mediators 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and syringaldehyde were cross-linked instead of the enzyme via electron irradiation in a frozen aqueous poly(acrylate) mixture in a one pot set-up, yielding a mechanical stable macroporous cryogel with interconnected pores ranging from 10 to 50 µm in size. The membranes as well as the cryogels were characterized regarding their morphology, chemical composition, and catalytic activity. The reactivity towards waste- water pollutants was demonstrated by the degradation of the model compound bisphenol A (BPA). Both membrane- and cryogel-immobilized laccase remained highly active after electron beam irradiation. Apparent specific BPA removal rates were higher for cryogel- than for membrane-immobilized and free laccase, whereas membrane-immobilized laccase was more stable with respect to maintenance of enzymatic activity and prevention of enzyme leakage from the carrier than cryogel-immobilized laccase. Cryogel-immobilized redox mediators remained functional in accelerating the laccase-catalyzed BPA degradation, and especially ABTS was found to act more efficiently in immobilized than in freely dissolved state.

Simultaneous production of laccase and degradation of bisphenol A with Trametes versicolor cultivated on agricultural wastes.

PubMed

Zeng, Shengquan; Zhao, Jie; Xia, Liming

2017-08-01

Solid state fermentation with Trametes versicolor was carried out on agricultural wastes containing bisphenol A (BPA). It was found that BPA degradation was along with the occurrence of laccase production, and wheat bran and corn straw were identified as suitable mixed substrates for laccase production. In the process of BPA degradation with T. versicolor, laccase activity increased rapidly at the 6th-10th day after inoculation. Moreover, BPA can enhance the production of laccase. After 10 days of fermentation, degradation rate of BPA exceeded 90% without the usage of mediators ABTS and acetosyringone at pH 4.0-8.0. In addition, metal ions did not affect the BPA degradation with T. versicolor. In vitro, the optimum pH range of BPA degradation with laccase was in the acidic region with the optimal performance of pH 5.0. Metal ions Cu 2+ , Zn 2+ , and Co 2+ showed little effect on BPA degradation. However, Fe 3+ and Fe 2+ substantially inhibited the BPA degradation. Natural mediator acetosyringone showed optimum enhancement on BPA degradation. Greater than 90% of the estrogenic activity of BPA was removed by T. versicolor and its laccase. Compared to in vitro degradation with laccase, this study shows that the process of simultaneous laccase production and BPA degradation with T. versicolor was more advantageous since BPA can enhance the laccase production, mediators were unnecessary, degradation rate was not affected by metal ions, and the applicable pH range was broader. This study concludes that T. versicolor and laccase have great potential to treat industrial wastewater containing BPA.

Studying the effects of laccase treatment in a softwood dissolving pulp: cellulose reactivity and crystallinity.

PubMed

Quintana, Elisabet; Valls, Cristina; Barneto, Agustín G; Vidal, Teresa; Ariza, José; Roncero, M Blanca

2015-03-30

An enzymatic biobleaching sequence (LVAQPO) using a laccase from Trametes villosa in combination with violuric acid (VA) and then followed by a pressurized hydrogen peroxide treatment (PO) was developed and found to give high bleaching properties and meet dissolving pulp requirements: high brightness, low content of hemicellulose, satisfactory pulp reactivity, no significant cellulose degradation manifested by α-cellulose and HPLC, and brightness stability against moist heat ageing. The incorporation of a laccase-mediator system (LMS) to bleach sulphite pulps can be a good alternative to traditional bleaching processes since thermogravimetric analysis (TGA) showed that the laccase treatment prevented the adverse effect of hydrogen peroxide on fibre surface as observed during a conventional hydrogen peroxide bleaching treatment (PO). Although VA exhibited the best results in terms of bleaching properties, the performance of natural mediators, such as p-coumaric acid and syringaldehyde, was discussed in relation to changes in cellulose surface detected by TGA. Copyright © 2014 Elsevier Ltd. All rights reserved.

Reactivity of bacterial and fungal laccases with lignin under alkaline conditions.

PubMed

Moya, Raquel; Saastamoinen, Päivi; Hernández, Manuel; Suurnäkki, Anna; Arias, Enriqueta; Mattinen, Maija-Liisa

2011-11-01

The ability of Streptomyces ipomoea laccase to polymerize secoisolariciresinol lignan and technical lignins was assessed. The reactivity of S. ipomoea laccase was also compared to that of low redox fungal laccase from Melanocarpus albomyces using low molecular mass p-coumaric, ferulic and sinapic acid as well as natural (acetosyringone) and synthetic 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO) mediators as substrates. Oxygen consumption measurement, MALDI-TOF MS and SEC were used to follow the enzymatic reactions at pH 7, 8, 9 and 10 at 30°C and 50°C. Polymerization of lignins and lignan by S. ipomoea laccase under alkaline reaction conditions was observed, and was enhanced in the presence of acetosyringone almost to the level obtained with M. albomyces laccase without mediator. Reactivities of the enzymes towards acetosyringone and TEMPO were similar, suggesting exploitation of the compounds and low redox laccase in lignin valorization under alkaline conditions. The results have scientific impact on basic research of laccases. Copyright © 2011 Elsevier Ltd. All rights reserved.

Reactivities of various mediators and laccases with kraft pulp and lignin model compounds.

PubMed

Bourbonnais, R; Paice, M G; Freiermuth, B; Bodie, E; Borneman, S

1997-12-01

Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification.

Reactivities of Various Mediators and Laccases with Kraft Pulp and Lignin Model Compounds

PubMed Central

Bourbonnais, R.; Paice, M. G.; Freiermuth, B.; Bodie, E.; Borneman, S.

1997-01-01

Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification. PMID:16535747

Visible-Light-Driven Oxidation of Organic Substrates with Dioxygen Mediated by a [Ru(bpy)3 ](2+) /Laccase System.

PubMed

Schneider, Ludovic; Mekmouche, Yasmina; Rousselot-Pailley, Pierre; Simaan, A Jalila; Robert, Viviane; Réglier, Marius; Aukauloo, Ally; Tron, Thierry

2015-09-21

Oxidation reactions are highly important chemical transformations that still require harsh reaction conditions and stoichiometric amounts of chemical oxidants that are often toxic. To circumvent these issues, olefins oxidation is achieved in mild conditions upon irradiation of an aqueous solution of the complex [Ru(bpy)3 ](2+) and the enzyme laccase. Epoxide formation is coupled to the light-driven reduction of O2 by [Ru(bpy)3 ](2+) /laccase system. The reactivity can be explained by dioxygen acting both as an oxidative agent and as renewable electron acceptor, avoiding the use of a sacrificial electron acceptor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Expression and characterization of novel laccase gene from Pandoraea sp. ISTKB and its application.

PubMed

Kumar, Madan; Mishra, Arti; Singh, Shashi Shekhar; Srivastava, Shaili; Thakur, Indu Shekhar

2018-04-14

In the present study, a non-blue laccase gene from previously reported lignin degrading bacterium, Pandoraea sp. ISTKB, was isolated, cloned and expressed in E. coli. Bioinformatics analysis of sequence discovered twin-arginine translocation signal sequence, copper binding motifs and presence of more random coil compare to helices and sheets in structure. The enzyme was found to be active on wide pH range and the pH optima was observed at pH 4 and 8 on substrate 2,2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) and 2,6-Dimethoxyphenol respectively. This is a thermophilic enzyme with maximum activity around 50-70 °C. The enzyme was further characterized by spectroscopy, reaction kinetics and effect of metal ions and inhibitors were studied. Compared to laccase alone; the treatment of dyes with laccase plus mediator resulted in enhanced decolorization of crystal violet, methylene blue, azure B, carmine and Congo red but the effect of mediator was not observed on trypan blue. Laccase treatment triggered polymerization on vanillic acid (VA) and kraft lignin (KL). Laccase plus mediator treatment reversed the polymerization and resulted in transformation or degradation of VA and KL. This thermophilic and alkalophilic non-blue laccase from Pandoraea sp. ISTKB is promising with prospective biotechnological application. Copyright © 2018. Published by Elsevier B.V.

Prediction and optimization of the laccase-mediated synthesis of the antimicrobial compound iodine (I2).

PubMed

Schubert, M; Fey, A; Ihssen, J; Civardi, C; Schwarze, F W M R; Mourad, S

2015-01-10

An artificial neural network (ANN) and genetic algorithm (GA) were applied to improve the laccase-mediated oxidation of iodide (I(-)) to elemental iodine (I2). Biosynthesis of iodine (I2) was studied with a 5-level-4-factor central composite design (CCD). The generated ANN network was mathematically evaluated by several statistical indices and revealed better results than a classical quadratic response surface (RS) model. Determination of the relative significance of model input parameters, ranking the process parameters in order of importance (pH>laccase>mediator>iodide), was performed by sensitivity analysis. ANN-GA methodology was used to optimize the input space of the neural network model to find optimal settings for the laccase-mediated synthesis of iodine. ANN-GA optimized parameters resulted in a 9.9% increase in the conversion rate. Copyright © 2014 Elsevier B.V. All rights reserved.

Laccase-mediator catalyzed conversion of model lignin compounds

USDA-ARS?s Scientific Manuscript database

Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

Laccase-mediator catalyzed conversion of model lignin compounds

USDA-ARS?s Scientific Manuscript database

Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...

Immobilized laccase mediated dye decolorization and transformation pathway of azo dye acid red 27.

PubMed

Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

2015-01-01

Laccases have good potential as bioremediating agents and can be used continuously in the immobilized form like many other enzymes. In the present study, laccase from Cyathus bulleri was immobilized by entrapment in Poly Vinyl Alcohol (PVA) beads cross-linked with either nitrate or boric acid. Immobilized laccase was used for dye decolorization in both batch and continuous mode employing a packed bed column. The products of degradation of dye Acid Red 27 were identified by LC MS/MS analysis. The method led to very effective (90%) laccase immobilization and also imparted significant stability to the enzyme (more than 70% after 5 months of storage at 4°C). In batch decolorization, 90-95% decolorization was achieved of the simulated dye effluent for up to 10-20 cycles. Continuous decolorization in a packed bed bioreactor led to nearly 90% decolorization for up to 5 days. The immobilized laccase was also effective in decolorization and degradation of Acid Red 27 in the presence of a mediator. Four products of degradation were identified by LC-MS/MS analysis. The immobilized laccase in PVA-nitrate was concluded to be an effective agent in treatment of textile dye effluents.

Comparison of different fungal enzymes for bleaching high-quality paper pulps.

PubMed

Sigoillot, Cécile; Camarero, Susana; Vidal, Teresa; Record, Eric; Asther, Michèle; Pérez-Boada, Marta; Martínez, María Jesús; Sigoillot, Jean-Claude; Asther, Marcel; Colom, José F; Martínez, Angel T

2005-02-23

Wild and recombinant hydrolases and oxidoreductases with a potential interest for environmentally sound bleaching of high-quality paper pulp (from flax) were incorporated into a totally chlorine free (TCF) sequence that also included a peroxide stage. The ability of feruloyl esterase (from Aspergillus niger) and Mn2+-oxidizing peroxidases (from Phanerochaete chrysosporium and Pleurotus eryngii) to decrease the final lignin content of flax pulp was shown. Laccase from Pycnoporus cinnabarinus (without mediator) also caused a slight improvement of pulp brightness that was increased in the presence of aryl-alcohol oxidase. However, the best results were obtained when the laccase treatment was performed in the presence of a mediator, 1-hydroxybenzotriazol (HBT), enabling strong delignification of pulps. The enzymatic removal of lignin resulted in high-final brightness values that are difficult to attain by chemical bleaching of this type of pulp. A partial inactivation of laccase by HBT was observed but this negative effect was strongly reduced in the presence of pulp. The good results obtained with the same laccase expressed in A. niger at bioreactor scale, revealed the feasibility of using recombinant laccase for bleaching high-quality non-wood pulps in the presence of a mediator.

Laccases: Production, Expression Regulation, and Applications in Pharmaceutical Biodegradation

PubMed Central

Yang, Jie; Li, Wenjuan; Ng, Tzi Bun; Deng, Xiangzhen; Lin, Juan; Ye, Xiuyun

2017-01-01

Laccases are a family of copper-containing oxidases with important applications in bioremediation and other various industrial and biotechnological areas. There have been over two dozen reviews on laccases since 2010 covering various aspects of this group of versatile enzymes, from their occurrence, biochemical properties, and expression to immobilization and applications. This review is not intended to be all-encompassing; instead, we highlighted some of the latest developments in basic and applied laccase research with an emphasis on laccase-mediated bioremediation of pharmaceuticals, especially antibiotics. Pharmaceuticals are a broad class of emerging organic contaminants that are recalcitrant and prevalent. The recent surge in the relevant literature justifies a short review on the topic. Since low laccase yields in natural and genetically modified hosts constitute a bottleneck to industrial-scale applications, we also accentuated a genus of laccase-producing white-rot fungi, Cerrena, and included a discussion with regards to regulation of laccase expression. PMID:28559880

Decolorization and detoxification of two textile industry effluents by the laccase/1-hydroxybenzotriazole system.

PubMed

Benzina, Ouafa; Daâssi, Dalel; Zouari-Mechichi, Héla; Frikha, Fakher; Woodward, Steve; Belbahri, Lassaad; Rodriguez-Couto, Susana; Mechichi, Tahar

2013-08-01

The aim of this work was to determine the optimal conditions for the decolorization and the detoxification of two effluents from a textile industry-effluent A (the reactive dye bath Bezactive) and effluent B (the direct dye bath Tubantin)-using a laccase mediator system. Response surface methodology (RSM) was applied to optimize textile effluents decolorization. A Box-Behnken design using RSM with the four variables pH, effluent concentration, 1-hydroxybenzotriazole (HBT) concentration, and enzyme (laccase) concentration was used to determine correlations between the effects of these variables on the decolorization of the two effluents. The optimum conditions for pH and concentrations of HBT, effluent and laccase were 5, 1 mM, 50 % and 0.6 U/ml, respectively, for maximum decolorization of effluent A (68 %). For effluent B, optima were 4, 1 mM, 75 %, and 0.6 U/ml, respectively, for maximum decolorization of approximately 88 %. Both effluents were treated at 30 °C for 20 h. A quadratic model was obtained for each decolorization through this design. The experimental and predicted values were in good agreement and both models were highly significant. In addition, the toxicity of the two effluents was determined before and after laccase treatment using Saccharomyces cerevisiae, Bacillus cereus, and germination of tomato seeds.

Azo Dye Biodecolorization Enhanced by Echinodontium taxodii Cultured with Lignin

PubMed Central

Meng, Jing; Yu, Hongbo; Zhang, Xiaoyu

2014-01-01

Lignocellulose facilitates the fungal oxidization of recalcitrant organic pollutants through the extracellular ligninolytic enzymes induced by lignin in wood or other plant tissues. However, available information on this phenomenon is insufficient. Free radical chain reactions during lignin metabolism are important in xenobiotic removal. Thus, the effect of lignin on azo dye decolorization in vivo by Echinodontium taxodii was evaluated. In the presence of lignin, optimum decolorization percentages for Remazol Brilliant Violet 5R, Direct Red 5B, Direct Black 38, and Direct Black 22 were 91.75% (control, 65.96%), 76.89% (control, 43.78%), 43.44% (control, 17.02%), and 44.75% (control, 12.16%), respectively, in the submerged cultures. Laccase was the most important enzyme during biodecolorization. Aside from the stimulating of laccase activity, lignin might be degraded by E. taxodii, and then these degraded low-molecular-weight metabolites could act as redox mediators promoting decolorization of azo dyes. The relationship between laccase and lignin degradation was investigated through decolorization tests in vitro with purified enzyme and dozens of aromatics, which can be derivatives of lignin and can function as laccase mediators or inducers. Dyes were decolorized at triple or even higher rates in certain laccase–aromatic systems at chemical concentrations as low as 10 µM. PMID:25285777

Production of cellobionate from cellulose using an engineered Neurospora crassa strain with laccase and redox mediator addition

USDA-ARS?s Scientific Manuscript database

We report a novel production process for cellobionic acid from cellulose using an engineered fungal strain with the exogenous addition of laccase and a redox mediator. A previously engineered strain of Neurospora crassa (F5'ace-1'cre-1'ndvB) was shown to produce cellobionate directly from cellulose ...

Treatment of tetracycline antibiotics by laccase in the presence of 1-hydroxybenzotriazole.

PubMed

Suda, Tomoyo; Hata, Takayuki; Kawai, Shingo; Okamura, Hideo; Nishida, Tomoaki

2012-01-01

Tetracycline antibiotics are widely used in human and veterinary medicine; however, residual amounts of these antibiotics in the environment are of concern since they could contribute to selection of resistant bacteria. In this study, tetracycline (TC), chlortetracycline (CTC), doxycycline (DC) and oxytetracycline (OTC) were treated with laccase from the white rot fungus Trametes versicolor in the presence of the redox mediator 1-hydroxybenzotriazole (HBT). High performance liquid chromatography demonstrated that DC and CTC were completely eliminated after 15 min, while TC and CTC were eliminated after 1 h. This system also resulted in a complete loss of inhibition of growth of Escherichia coli and Bacillus subtilis and the green alga Pseudokirchneriella subcapitata with decreasing tetracycline antibiotic concentration. These results suggest that the laccase-HBT system is effective in eliminating tetracycline antibiotics and removing their ecotoxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.

Multicomponent kinetic analysis and theoretical studies on the phenolic intermediates in the oxidation of eugenol and isoeugenol catalyzed by laccase.

PubMed

Qi, Yan-Bing; Wang, Xiao-Lei; Shi, Ting; Liu, Shuchang; Xu, Zhen-Hao; Li, Xiqing; Shi, Xuling; Xu, Ping; Zhao, Yi-Lei

2015-11-28

Laccase catalyzes the oxidation of natural phenols and thereby is believed to initialize reactions in lignification and delignification. Numerous phenolic mediators have also been applied in laccase-mediator systems. However, reaction details after the primary O-H rupture of phenols remain obscure. In this work two types of isomeric phenols, EUG (eugenol) and ISO (trans-/cis-isoeugenol), were used as chemical probes to explore the enzymatic reaction pathways, with the combined methods of time-resolved UV-Vis absorption spectra, MCR-ALS, HPLC-MS, and quantum mechanical (QM) calculations. It has been found that the EUG-consuming rate is linear to its concentration, while the ISO not. Besides, an o-methoxy quinone methide intermediate, (E/Z)-4-allylidene-2-methoxycyclohexa-2,5-dienone, was evidenced in the case of EUG with the UV-Vis measurement, mass spectra and TD-DFT calculations; in contrast, an ISO-generating phenoxyl radical, a (E/Z)-2-methoxy-4-(prop-1-en-1-yl) phenoxyl radical, was identified in the case of ISO. Furthermore, QM calculations indicated that the EUG-generating phenoxyl radical (an O-centered radical) can easily transform into an allylic radical (a C-centered radical) by hydrogen atom transfer (HAT) with a calculated activation enthalpy of 5.3 kcal mol(-1) and then be fast oxidized to the observed eugenol quinone methide, rather than an O-radical alkene addition with barriers above 12.8 kcal mol(-1). In contrast, the ISO-generating phenoxyl radical directly undergoes a radical coupling (RC) process, with a barrier of 4.8 kcal mol(-1), while the HAT isomerization between O- and C-centered radicals has a higher reaction barrier of 8.0 kcal mol(-1). The electronic conjugation of the benzyl-type radical and the aromatic allylic radical leads to differentiation of the two pathways. These results imply that competitive reaction pathways exist for the nascent reactive intermediates generated in the laccase-catalyzed oxidation of natural phenols, which is important for understanding the lignin polymerization and may shed some light on the development of efficient laccase-mediator systems.

Advanced Chemical Design for Efficient Lignin Bioconversion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Shangxian; Sun, Qining; Pu, Yunqiao

Here, lignin depolymerization mainly involves redox reactions relying on the effective electron transfer. Even though electron mediators were previously used for delignification of paper pulp, no study has established a bioprocess to fragment and solubilize the lignin with an effective laccase–mediator system, in particular, for subsequent microbial bioconversion. Efficient lignin depolymerization was achieved by screening proper electron mediators with laccase to attain a nearly 6-fold increase of kraft lignin solubility compared to the control kraft lignin without laccase treatment. Chemical analysis suggested the release of a low molecular weight fraction of kraft lignin into the solution phase. Moreover, NMR analysismore » revealed that an efficient enzyme–mediator system can promote the lignin degradation. More importantly, the fundamental mechanisms guided the development of an efficient lignin bioconversion process, where solubilized lignin from laccase–HBT treatment served as a superior substrate for bioconversion by Rhodococcus opacus PD630. The cell growth was increased by 10 6 fold, and the lipid titer reached 1.02 g/L. Overall, the study has manifested that an efficient enzyme–mediator–microbial system can be exploited to establish a bioprocess to solubilize lignin, cleave lignin linkages, modify the structure, and produce substrates amenable to bioconversion.« less

Advanced Chemical Design for Efficient Lignin Bioconversion

DOE PAGES

Xie, Shangxian; Sun, Qining; Pu, Yunqiao; ...

2017-01-30

Here, lignin depolymerization mainly involves redox reactions relying on the effective electron transfer. Even though electron mediators were previously used for delignification of paper pulp, no study has established a bioprocess to fragment and solubilize the lignin with an effective laccase–mediator system, in particular, for subsequent microbial bioconversion. Efficient lignin depolymerization was achieved by screening proper electron mediators with laccase to attain a nearly 6-fold increase of kraft lignin solubility compared to the control kraft lignin without laccase treatment. Chemical analysis suggested the release of a low molecular weight fraction of kraft lignin into the solution phase. Moreover, NMR analysismore » revealed that an efficient enzyme–mediator system can promote the lignin degradation. More importantly, the fundamental mechanisms guided the development of an efficient lignin bioconversion process, where solubilized lignin from laccase–HBT treatment served as a superior substrate for bioconversion by Rhodococcus opacus PD630. The cell growth was increased by 10 6 fold, and the lipid titer reached 1.02 g/L. Overall, the study has manifested that an efficient enzyme–mediator–microbial system can be exploited to establish a bioprocess to solubilize lignin, cleave lignin linkages, modify the structure, and produce substrates amenable to bioconversion.« less

Redox polymer mediation for enzymatic biofuel cells

NASA Astrophysics Data System (ADS)

Gallaway, Joshua

Mediated biocatalytic cathodes prepared from the oxygen-reducing enzyme laccase and redox-conducting osmium hydrogels were characterized for use as cathodes in enzymatic biofuel cells. A series of osmium-based redox polymers was synthesized with redox potentials spanning the range from 0.11 V to 0.85 V (SHE), and the resulting biocatalytic electrodes were modeled to determine reaction kinetic constants using the current response, measured osmium concentration, and measured apparent electron diffusion. As in solution-phase systems, the bimolecular rate constant for mediation was found to vary greatly with mediator potential---from 250 s-1M-1 when mediator and enzyme were close in potential to 9.4 x 10 4 s-1M-1 when this overpotential was large. Optimum mediator potential for a cell operating with a non-limiting platinum anode and having no mass transport limitation from bulk solution was found to be 0.66 V (SHE). Redox polymers were synthesized under different concentrations, producing osmium variation. An increase from 6.6% to 7.2% osmium increased current response from 1.2 to 2.1 mA/cm2 for a planar film in 40°C oxygen-saturated pH 4 buffer, rotating at 900 rpm. These results translated to high surface area electrodes, nearly doubling current density to 13 mA/cm2, the highest to date for such an electrode. The typical fungal laccase from Trametes versicolor was replaced by a bacterially-expressed small laccase from Streptomyces coelicolor, resulting in biocatalytic films that reduced oxygen at increased pH, with full functionality at pH 7, producing 1.5 mA/cm 2 in planar configuration. Current response was biphasic with pH, matching the activity profile of the free enzyme in solution. The mediated enzyme electrode system was modeled with respect to apparent electron diffusion, mediator concentration, and transport of oxygen from bulk solution, all of which are to some extent controlled by design. Each factor was found to limit performance in certain circumstances. In systems relying on stagnant solution, oxygen transport was found to dominate. However, if mass transport was efficient, differences in mediator design greatly affected performance.

Expression of a thermotolerant laccase from Pycnoporus sanguineus in Trichoderma reesei and its application in the degradation of bisphenol A.

PubMed

Zhao, Jie; Zeng, Shengquan; Xia, Ying; Xia, Liming

2018-04-01

The laccase gene from Pycnoporus sanguineus was cloned and inserted between the strong Pcbh1 promoter and the Tcbh1 terminator from Trichoderma reesei to form the recombinant plasmid pCH-lac. Using Agrobacterium-mediated technique, the pCH-lac was integrated into the chromosomes of T. reesei. Twenty positive transformants were obtained by employing hygromycin B as a selective agent. PCR was used to confirm that the laccase gene was integrated into the chromosomal DNA of T. reesei. Laccase production by recombinant transformants was performed in shaking flasks, and the activity of laccase reached 8.8 IU/mL after 96-h fermentation under a batch process, and 17.7 IU/mL after 144-h fermentation using a fed-batch process. SDS-PAGE analysis of the fermentation broth showed that the molecular mass of the protein was about 68 kDa, almost the same as that of the laccase produced by P. sanguineus, which indicated that laccase was successfully expressed in T. reesei and secreted out of the cells. The laccase produced by the recombinant T. reesei showed good thermal stability, and could degrade the toxic phenolic material bisphenol A efficiently, after 1-h reaction with 0.06 IU/mL laccase and 0.5 mmol/L ABTS as the mediator at 60 °C and pH 4.5, the degradation rate reached 95%, which demonstrated that it had great potential value in treating the household garbage and wastewater containing the bisphenol A. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Graphene Facilitated Removal of Labetalol in Laccase-ABTS System: Reaction Efficiency, Pathways and Mechanism

PubMed Central

Dong, Shipeng; Xiao, Huifang; Huang, Qingguo; Zhang, Jian; Mao, Liang; Gao, Shixiang

2016-01-01

The widespread occurrence of the beta-blocker labetalol causes environmental health concern. Enzymatic reactions are highly efficient and specific offering biochemical transformation of trace contaminants with short reaction time and little to none energy consumption. Our experiments indicate that labetalol can be effectively transformed by laccase-catalyzed reaction using 2, 2-Azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a mediator, while no significant removal of labetalol can be achieved in the absence of ABTS. A total of three products were identified. It is interesting that the presence of graphene greatly increased the reaction rate while not changed the products. In the presence of 100 μg/L graphene, the pseudo-first-order reaction rate constant was increased ~50 times. We found that the enhancement of graphene is probably attributed to the formation and releasing of ABTS2+ which has a much greater reactivity towards labetalol when graphene is present. This study provides fundamental information for laccase-ABTS mediated labetalol reactions and the effect of graphene, which could eventually lead to development of novel methods to control beta-blocker contamination. PMID:26891761

Production of Laccase by a New Myrothecium verrucaria MD-R-16 Isolated from Pigeon Pea [Cajanus cajan (L.) Millsp.] and its Application on Dye Decolorization.

PubMed

Sun, Jiao; Guo, Na; Niu, Li-Li; Wang, Qing-Fang; Zang, Yu-Ping; Zu, Yuan-Gang; Fu, Yu-Jie

2017-04-23

The present study was conducted to screen a laccase-producing fungal endophyte, optimize fermentation conditions, and evaluate the decolorization ability of the laccase. A new fungal endophyte capable of laccase-producing was firstly isolated from pigeon pea and identified as Myrothecium verrucaria based on a ITS-rRNA sequences analysis. Meanwhile, various fermentation parameters on the laccase production were optimized via response surface methodology (RSM). The optimal fermentation conditions were a fermentation time of five days, temperature 30 °C and pH 6.22. Laccase activity reached 16.52 ± 0.18 U/mL under the above conditions. Furthermore, the laccase showed effective decolorization capability toward synthetic dyes (Congo red, Methyl orange, Methyl red, and Crystal violet) in the presence of the redox mediator ABTS, with more than 70% of dyes decolorizing after 24 h of incubation. Additionally, the activity of laccase was relatively stable with pH (4.5-6.5) and a temperature range of 35-55 °C. Therefore, the high laccase production of the strain and the new fungal laccase could provide a promising alterative approach for industrial and environmental applications.

Elimination of Bisphenol A and Triclosan Using the Enzymatic System of Autochthonous Colombian Forest Fungi

PubMed Central

Arboleda, Carolina; Cabana, H.; De Pril, E.; Jones, J. Peter; Jiménez, G. A.; Mejía, A. I.; Agathos, S. N.; Penninckx, M. J.

2013-01-01

Bisphenol A (BPA) and triclosan (TCS) are known or suspected potential endocrine disrupting chemicals (EDCs) which may pose a risk to human health and have an environmental impact. Enzyme preparations containing mainly laccases, obtained from Ganoderma stipitatum and Lentinus swartzii, two autochthonous Colombian forest white rot fungi (WRF), previously identified as high enzyme producers, were used to remove BPA and TCS from aqueous solutions. A Box-Behnken factorial design showed that pH, temperature, and duration of treatment were significant model terms for the elimination of BPA and TCS. Our results demonstrated that these EDCs were extensively removed from 5 mg L−1 solutions after a contact time of 6 hours. Ninety-four percent of TCS and 97.8% of BPA were removed with the enzyme solution from G. stipitatum; 83.2% of TCS and 88.2% of BPA were removed with the L. swartzii enzyme solution. After a 6-hour treatment with enzymes from G. stipitatum and L. swartzii, up to 90% of the estrogenic activity of BPA was lost, as shown by the yeast estrogen screen assay. 2,2-Azino-bis-(3-ethylthiazoline-6-sulfonate) (ABTS) was used as a mediator (laccase/mediator system) and significantly improved the laccase catalyzed elimination of BPA and TCS. The elimination of BPA in the absence of a mediator resulted in production of oligomers of molecular weights of 454, 680, and 906 amu as determined by mass spectra analysis. The elimination of TCS in the same conditions produced dimers, trimers, and tetramers of molecular weights of 574, 859, and 1146 amu. Ecotoxicological studies using Daphnia pulex to determine lethal concentration (LC50) showed an important reduction of the toxicity of BPA and TCS solutions after enzymatic treatments. Use of laccases emerges thus as a key alternative in the development of innovative wastewater treatment technologies. Moreover, the exploitation of local biodiversity appears as a potentially promising approach for identifying new efficient strains for biotechnological applications. PMID:25969787

Redox Chemistry in Laccase-Catalyzed Oxidation of N-Hydroxy Compounds

PubMed Central

Xu, Feng; Kulys, Juozas J.; Duke, Kyle; Li, Kaichang; Krikstopaitis, Kastis; Deussen, Heinz-Josef W.; Abbate, Eric; Galinyte, Vilija; Schneider, Palle

2000-01-01

1-Hydroxybenzotriazole, violuric acid, and N-hydroxyacetanilide are three N-OH compounds capable of mediating a range of laccase-catalyzed biotransformations, such as paper pulp delignification and degradation of polycyclic hydrocarbons. The mechanism of their enzymatic oxidation was studied with seven fungal laccases. The oxidation had a bell-shaped pH-activity profile with an optimal pH ranging from 4 to 7. The oxidation rate was found to be dependent on the redox potential difference between the N-OH substrate and laccase. A laccase with a higher redox potential or an N-OH compound with a lower redox potential tended to have a higher oxidation rate. Similar to the enzymatic oxidation of phenols, phenoxazines, phenothiazines, and other redox-active compounds, an “outer-sphere” type of single-electron transfer from the substrate to laccase and proton release are speculated to be involved in the rate-limiting step for N-OH oxidation. PMID:10788380

Hydrophobic modification of jute fiber used for composite reinforcement via laccase-mediated grafting

NASA Astrophysics Data System (ADS)

Dong, Aixue; Yu, Yuanyuan; Yuan, Jiugang; Wang, Qiang; Fan, Xuerong

2014-05-01

Jute fiber is a lignocellulosic material which could be utilized for reinforcement of composites. To improve the compatibility of hydrophilic jute fiber with hydrophobic resin, surface hydrophobization of the fiber is often needed. In this study, the feasibility of laccase-mediated grafting dodecyl gallate (DG) on the jute fiber was investigated. First, the grafting products were characterized by FT-IR, XPS, SEM and AFM. And then the grafting percentage (Gp) and the DG content of the modified jute were determined in terms of weighting and saponification, respectively. The parameters of the enzymatic grafting process were optimized to the target application. Lastly, the hydrophobicity of the jute fabrics was estimated by means of contact angle and wetting time. The mechanical properties and the fracture section of the jute fabric/polypropylene (PP) composites were studied. The results revealed covalently coupling of DG to the jute substrates mediated by laccase. The enzymatic process reached the maximum grafting rate of 4.16% when the jute fabric was incubated in the 80/20 (v/v, %) pH 3 0.2 M acetate buffer/ethanol medium with 1.0 U/mL laccase and 5 mM DG at 50 °C for 4 h. The jute fabric modified with laccase and DG showed increased contact angle of 111.49° and wetting time of at least 30 min, indicating that the surface hydrophobicity of the jute fabric was increased after the enzymatic graft modification with hydrophobic DG. The breaking strength of the modified jute fiber/PP composite was also increased and the fracture section became neat and regular due to the laccase-assisted grafting with DG.

Removal of antibiotics in wastewater by enzymatic treatment with fungal laccase - Degradation of compounds does not always eliminate toxicity.

PubMed

Becker, Dennis; Varela Della Giustina, Saulo; Rodriguez-Mozaz, Sara; Schoevaart, Rob; Barceló, Damià; de Cazes, Matthias; Belleville, Marie-Pierre; Sanchez-Marcano, José; de Gunzburg, Jean; Couillerot, Olivier; Völker, Johannes; Oehlmann, Jörg; Wagner, Martin

2016-11-01

In this study, the performance of immobilised laccase (Trametes versicolor) was investigated in combination with the mediator syringaldehyde (SYR) in removing a mixture of 38 antibiotics in an enzymatic membrane reactor (EMR). Antibiotics were spiked in osmosed water at concentrations of 10μg·L(-1) each. Laccase without mediator did not reduce the load of antibiotics significantly. The addition of SYR enhanced the removal: out of the 38 antibiotics, 32 were degraded by >50% after 24h. In addition to chemical analysis, the samples' toxicity was evaluated in two bioassays (a growth inhibition assay and the Microtox assay). Here, the addition of SYR resulted in a time-dependent increase of toxicity in both bioassays. In cooperation with SYR, laccase effectively removes a broad range of antibiotics. However, this enhanced degradation induces unspecific toxicity. If this issue is resolved, enzymatic treatment may be a valuable addition to existing water treatment technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification and evaluation of bioremediation potential of laccase isoforms produced by Cyathus bulleri on wheat bran.

PubMed

Vats, Arpita; Mishra, Saroj

2018-02-15

Multiplicity in laccases among lignin degrading fungal species is of interest as it confers the ability to degrade several types of lignocellulosics. The combination of laccases produced on such substrates could be beneficial for treatment of complex aromatics, including dyes. In this study, we report on production of high units (679.6Ug -1 substrate) of laccase on solid wheat bran (WB) by Cyathus bulleri. Laccase, purified from the culture filtrates of WB grown fungus, was effective for oxidation of veratryl alcohol, Reactive blue 21 and textile effluent without assistance of externally added mediators. De novo sequencing of the 'purified' laccase lead to identification of several peptides that originated from different laccase genes. Transcriptome analysis of the fungus, cultivated on WB, confirmed presence of 8 isozymes, that were re-amplified and sequenced from the cDNA prepared from WB grown fungus. The 8 isozymes were grouped into 3 classes, based on their sequence relationship with other basidiomycete laccases. The isoforms produced on WB decolorized (by ∼57%) and degraded textile effluent far more effectively, compared to laccase obtained from Basal salt cultivated fungus. The decolorization and degradation was also accompanied by more than 95% reduction in phytotoxicity. Copyright © 2017 Elsevier B.V. All rights reserved.

Fungal Laccases: Production, Function, and Applications in Food Processing

PubMed Central

Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.

2010-01-01

Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed. PMID:21048859

Inactivation of Laccase by the Attack of As (III) Reaction in Water.

PubMed

Hu, Jinyuan; Lu, Kun; Dong, Shipeng; Huang, Qingguo; Mao, Liang

2018-03-06

Laccase is a multicopper oxidase containing four coppers as reaction sites, including one type 1, one type 2, and two type 3. We here provide the first experimental data showing that As (III) can be effectively removed from water and transformed to As (V) through reactions mediated by laccase with the presence of oxygen. To this end, the As (III) removal, As (V) yields, total protein, active laccase, and copper concentrations in the aqueous phase were determined, respectively. Additionally, electron paramagnetic resonance spectra and UV-vis spectra were applied to probe possible structural changes of the laccase during the reaction. The data offer the first evidence that laccase can be inactivated by As (III) attack thus leading to the release of type 2 copper. The released copper has no reactivity with the As (III). These findings provide new ideas into a significant pathway likely to master the environmental transformation of arsenite, and advance the understanding of laccase inactivation mechanisms, thus providing a foundation for optimization of enzyme-based processes and potential development for removal and remediation of arsenite contamination in the environment.

Metal release and sequestration from black slate mediated by a laccase of Schizophyllum commune.

PubMed

Kirtzel, Julia; Scherwietes, Eric Leon; Merten, Dirk; Krause, Katrin; Kothe, Erika

2018-06-25

Schizophyllum commune is a filamentous basidiomycete which can degrade complex organic macromolecules like lignin by the secretion of a large repertoire of enzymes. One of these white rot enzymes, laccase, exhibits a broad substrate specificity and is able to oxidize a variety of substances including carbonaceous rocks. To investigate the role of laccase in bioweathering, laccase gene lcc2 was overexpressed, and the influence on weathering of black slate, originating from a former alum mine in Schmiedefeld, Germany, was examined. The metal release from the rock material was enhanced, associated with a partial metal accumulation into the mycelium. A sequestration of metals could be shown with fluorescent staining methods, and an accumulation of Zn, Cd, and Pb was visualized in different cell organelles. Additionally, we could show an increased metal resistance of the laccase overexpressing strain.

In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

PubMed

Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

2012-05-01

Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

Laccase-syringaldehyde-mediated degradation of trace organic contaminants in an enzymatic membrane reactor: Removal efficiency and effluent toxicity.

PubMed

Nguyen, Luong N; van de Merwe, Jason P; Hai, Faisal I; Leusch, Frederic D L; Kang, Jinguo; Price, William E; Roddick, Felicity; Magram, Saleh F; Nghiem, Long D

2016-01-01

Redox-mediators such as syringaldehyde (SA) can improve laccase-catalyzed degradation of trace organic contaminants (TrOCs) but may increase effluent toxicity. The degradation performance of 14 phenolic and 17 non-phenolic TrOCs by a continuous flow enzymatic membrane reactor (EMR) at different TrOC and SA loadings was assessed. A specific emphasis was placed on the investigation of the toxicity of the enzyme (laccase), SA, TrOCs and the treated effluent. Batch tests demonstrated significant individual and interactive toxicity of the laccase and SA preparations. Reduced removal of resistant TrOCs by the EMR was observed for dosages over 50μg/L. SA addition at a concentration of 10μM significantly improved TrOC removal, but no removal improvement was observed at the elevated SA concentrations of 50 and 100μM. The treated effluent showed significant toxicity at SA concentrations beyond 10μM, providing further evidence that higher dosage of SA must be avoided. Copyright © 2015 Elsevier Ltd. All rights reserved.

Kinetic modeling of a bi-enzymatic system for efficient conversion of lactose to lactobionic acid.

PubMed

Van Hecke, Wouter; Bhagwat, Aditya; Ludwig, Roland; Dewulf, Jo; Haltrich, Dietmar; Van Langenhove, Herman

2009-04-01

A model has been developed to describe the interaction between two enzymes and an intermediary redox mediator. In this bi-enzymatic process, the enzyme cellobiose dehydrogenase oxidizes lactose at the C-1 position of the reducing sugar moiety to lactobionolactone, which spontaneously hydrolyzes to lactobionic acid. 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt is used as electron acceptor and is continuously regenerated by laccase. Oxygen is the terminal electron acceptor and is fully reduced to water by laccase, a copper-containing oxidase. Oxygen is added to the system by means of bubble-free oxygenation. Using the model, the productivity of the process is investigated by simultaneous solution of the rate equations for varying enzyme quantities and redox mediator concentrations, solved with the aid of a numerical solution. The isocharts developed in this work provide an easy-to-use graphical tool to determine optimal process conditions. The model allows the optimization of the employed activities of the two enzymes and the redox mediator concentration for a given overall oxygen mass transfer coefficient by using the isocharts. Model predictions are well in agreement with the experimental data.

Mill Designed Bio bleaching Technologies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Institute of Paper Science Technology

2004-01-30

A key finding of this research program was that Laccase Mediator Systems (LMS) treatments on high-kappa kraft could be successfully accomplished providing substantial delignification (i.e., > 50%) without detrimental impact on viscosity and significantly improved yield properties. The efficiency of the LMS was evident since most of the lignin from the pulp was removed in less than one hour at 45 degrees C. Of the mediators investigated, violuric acid was the most effective vis-a-vis delignification. A comparative study between oxygen delignification and violuric acid revealed that under relatively mild conditions, a single or a double LMS{sub VA} treatment is comparablemore » to a single or a double O stage. Of great notability was the retention of end viscosity of LMS{sub VA} treated pulps with respect to the end viscosity of oxygen treated pulps. These pulps could then be bleached to full brightness values employing conventional ECF bleaching technologies and the final pulp physical properties were equal and/or better than those bleached in a conventional ECF manner employing an aggressively O or OO stage initially. Spectral analyses of residual lignins isolated after LMS treated high-kappa kraft pulps revealed that similar to HBT, VA and NHA preferentially attack phenolic lignin moieties. In addition, a substantial decrease in aliphatic hydroxyl groups was also noted, suggesting side chain oxidation. In all cases, an increase in carboxylic acid was observed. Of notable importance was the different selectivity of NHA, VA and HBT towards lignin functional groups, despite the common N-OH moiety. C-5 condensed phenolic lignin groups were overall resistant to an LMS{sub NHA, HBT} treatments but to a lesser extent to an LMS{sub VA}. The inactiveness of these condensed lignin moieties was not observed when low-kappa kraft pulps were biobleached, suggesting that the LMS chemistry is influenced by the extent of delignification. We have also demonstrated that the current generation of laccase has a broad spectrum of operating parameters. Nonetheless, the development of future genetically engineered laccases with enhanced temperature, pH and redox potentials will dramatically improve the overall process. A second challenge for LMS bleaching technologies is the need to develop effective, catalytic mediators. From the literature we already know this is feasible since ABTS and some inorganic mediators are catalytic. Unfortunately, the mediators that exhibit catalytic properties do not exhibit significant delignification properties and this is a challenge for future research studies. Potential short-term mill application of laccase has been recently reported by Felby132 and Chandra133 as they have demonstrated that the physical properties of linerboard can be improved when exposed to laccase without a chemical mediator. In addition, xxx has shown that the addition of laccase to the whitewater of the paper machine has several benefits for the removal of colloidal materials. Finally, this research program has presented important features on the delignification chemistry of LMS{sub NHA} and LMS{sub VA} that, in the opinion of the author, are momentous contributions to the overall LMS chemistry/biochemistry knowledge base which will continue to have future benefits.« less

Roles of small laccases from Streptomyces in lignin degradation.

PubMed

Majumdar, Sudipta; Lukk, Tiit; Solbiati, Jose O; Bauer, Stefan; Nair, Satish K; Cronan, John E; Gerlt, John A

2014-06-24

Laccases (EC 1.10.3.2) are multicopper oxidases that can oxidize a range of substrates, including phenols, aromatic amines, and nonphenolic substrates. To investigate the involvement of the small Streptomyces laccases in lignin degradation, we generated acid-precipitable polymeric lignin obtained in the presence of wild-type Streptomyces coelicolor A3(2) (SCWT) and its laccase-less mutant (SCΔLAC) in the presence of Miscanthus x giganteus lignocellulose. The results showed that strain SCΔLAC was inefficient in degrading lignin compared to strain SCWT, thereby supporting the importance of laccase for lignin degradation by S. coelicolor A3(2). We also studied the lignin degradation activity of laccases from S. coelicolor A3(2), Streptomyces lividans TK24, Streptomyces viridosporus T7A, and Amycolatopsis sp. 75iv2 using both lignin model compounds and ethanosolv lignin. All four laccases degraded a phenolic model compound (LM-OH) but were able to oxidize a nonphenolic model compound only in the presence of redox mediators. Their activities are highest at pH 8.0 with a low krel/Kapp for LM-OH, suggesting that the enzymes’ natural substrates must be different in shape or chemical nature. Crystal structures of the laccases from S. viridosporus T7A (SVLAC) and Amycolatopsis sp. 75iv2 were determined both with and without bound substrate. This is the first report of a crystal structure for any laccase bound to a nonphenolic β-O-4 lignin model compound. An additional zinc metal binding site in SVLAC was also identified. The ability to oxidize and/or rearrange ethanosolv lignin provides further evidence of the utility of laccase activity for lignin degradation and/or modification.

Kraft Pulp Biobleaching and Mediated Oxidation of a Nonphenolic Substrate by Laccase from Streptomyces cyaneus CECT 3335

PubMed Central

Arias, M. Enriqueta; Arenas, María; Rodríguez, Juana; Soliveri, Juan; Ball, Andrew S.; Hernández, Manuel

2003-01-01

A new laccase (EC 1.10.3.2) produced by Streptomyces cyaneus CECT 3335 in liquid media containing soya flour (20 g per liter) was purified to homogeneity. The physicochemical, catalytic, and spectral characteristics of this enzyme, as well as its suitability for biobleaching of eucalyptus kraft pulps, were assessed. The purified laccase had a molecular mass of 75 kDa and an isoelectric point of 5.6, and its optimal pH and temperature were 4.5 and 70°C, respectively. The activity was strongly enhanced in the presence of Cu2+, Mn2+, and Mg2+ and was completely inhibited by EDTA and sodium azide. The purified laccase exhibited high levels of activity against 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and 2,6-dimethoxyphenol and no activity against tyrosine. The UV-visible spectrum of the purified laccase was the typical spectrum of the blue laccases, with an absorption peak at 600 nm and a shoulder around 330 to 340 nm. The ability of the purified laccase to oxidize a nonphenolic compound, such as veratryl alcohol, in the presence of ABTS opens up new possibilities for the use of bacterial laccases in the pulp and paper industry. We demonstrated that application of the laccase from S. cyaneus in the presence of ABTS to biobleaching of eucalyptus kraft pulps resulted in a significant decrease in the kappa number (2.3 U) and an important increase in the brightness (2.2%, as determined by the International Standard Organization test) of pulps, showing the suitability of laccases produced by streptomycetes for industrial purposes. PMID:12676669

Combined enzymatic and physical deinking methodology for efficient eco-friendly recycling of old newsprint.

PubMed

Virk, Antar Puneet; Puri, Minakshi; Gupta, Vijaya; Capalash, Neena; Sharma, Prince

2013-01-01

The development in the deinking process has made recycled fiber a major part of the raw material for pulp and paper industry. Enzymes have revolutionized the deinking process obtaining brightness levels surpassing conventional deinking processes. This study explores the deinking efficiencies of bacterial alkalophilic laccase (L) and xylanase (X) enzymes along with physical deinking methods of microwaving (MW) and sonication (S) for recycling of old newsprint (ONP). The operational parameters viz. enzyme dose, pH and treatment time for X and L deinking were optimized statistically using Response Surface Methodology. Laccase did not require any mediator supplementation for deinking. Deinking of ONP pulp with a combination of xylanase and laccase enzymes was investigated, and fiber surface composition and morphological changes were studied using X-ray diffraction, fourier transform infrared spectroscopy and scanning electron microscopy. Compared to the pulp deinked with xylanase (47.9%) or laccase (62.2%) individually, the percentage reduction of effective residual ink concentration (ERIC) was higher for the combined xylanase/laccase-deinked pulp (65.8%). An increase in brightness (21.6%), breaking length (16.5%), burst factor (4.2%) tear factor (6.9%), viscosity (13%) and cellulose crystallinity (10.3%) along with decrease in kappa number (22%) and chemical consumption (50%) were also observed. Surface appeared more fibrillar along with changes in surface functional groups. A combination of physical and enzymatic processes (S-MW-XL) for deinking further improved brightness (28.8%) and decreased ERIC (73.9%) substantially. This is the first report on deinking of ONP with laccase without any mediator supplementation. XL pretreatment resulted in marked improvement in paper quality and a new sequence being reported for deinking (S-MW-XL) will contribute further in decreasing chemical consumption and making the process commercially feasible.

Combined Enzymatic and Physical Deinking Methodology for Efficient Eco-Friendly Recycling of Old Newsprint

PubMed Central

Virk, Antar Puneet; Puri, Minakshi; Gupta, Vijaya; Capalash, Neena; Sharma, Prince

2013-01-01

Background The development in the deinking process has made recycled fiber a major part of the raw material for pulp and paper industry. Enzymes have revolutionized the deinking process obtaining brightness levels surpassing conventional deinking processes. This study explores the deinking efficiencies of bacterial alkalophilic laccase (L) and xylanase (X) enzymes along with physical deinking methods of microwaving (MW) and sonication (S) for recycling of old newsprint (ONP). Methods and Results The operational parameters viz. enzyme dose, pH and treatment time for X and L deinking were optimized statistically using Response Surface Methodology. Laccase did not require any mediator supplementation for deinking. Deinking of ONP pulp with a combination of xylanase and laccase enzymes was investigated, and fiber surface composition and morphological changes were studied using X-ray diffraction, fourier transform infrared spectroscopy and scanning electron microscopy. Compared to the pulp deinked with xylanase (47.9%) or laccase (62.2%) individually, the percentage reduction of effective residual ink concentration (ERIC) was higher for the combined xylanase/laccase-deinked pulp (65.8%). An increase in brightness (21.6%), breaking length (16.5%), burst factor (4.2%) tear factor (6.9%), viscosity (13%) and cellulose crystallinity (10.3%) along with decrease in kappa number (22%) and chemical consumption (50%) were also observed. Surface appeared more fibrillar along with changes in surface functional groups. A combination of physical and enzymatic processes (S-MW-XL) for deinking further improved brightness (28.8%) and decreased ERIC (73.9%) substantially. Conclusion This is the first report on deinking of ONP with laccase without any mediator supplementation. XL pretreatment resulted in marked improvement in paper quality and a new sequence being reported for deinking (S-MW-XL) will contribute further in decreasing chemical consumption and making the process commercially feasible. PMID:23977287

Overproduction of recombinant laccase using a homologous expression system in Coriolus versicolor.

PubMed

Kajita, Shinya; Sugawara, Shinsuke; Miyazaki, Yasumasa; Nakamura, Masaya; Katayama, Yoshihiro; Shishido, Kazuo; Iimura, Yosuke

2004-12-01

One of the major extracellular enzymes of the white-rot fungus Coriolus versicolor is laccase, which is involved in the degradation of lignin. We constructed a homologous system for the expression of a gene for laccase III (cvl3) in C. versicolor, using a chimeric laccase gene driven by the promoter of a gene for glyceraldehyde-3-phosphate dehydrogenase (gpd) from this fungus. We transformed C. versicolor successfully by introducing both a gene for hygromycin B phosphotransferase (hph) and the chimeric laccase gene. In three independent experiments, we recovered 47 hygromycin-resistant transformants at a transformation frequency of 13 transformants microg(-1) of plasmid DNA. We confirmed the introduction of the chimeric laccase gene into the mycelia of transformants by a polymerase chain reaction in nine randomly selected transformants. Overproduction of extracellular laccase by the transformants was revealed by a colorimetric assay for laccase activity. We examined the transformant (T2) that had the highest laccase activity and found that its activity was significantly higher than that of the wild type, particularly in the presence of copper (II). Our transformation system should contribute to the efficient production of the extracellular proteins of C. versicolor for the accelerated degradation of lignin and aromatic pollutants.

Sequential lignin depolymerization by combination of biocatalytic and formic acid/formate treatment steps.

PubMed

Gasser, Christoph A; Čvančarová, Monika; Ammann, Erik M; Schäffer, Andreas; Shahgaldian, Patrick; Corvini, Philippe F-X

2017-03-01

Lignin, a complex three-dimensional amorphous polymer, is considered to be a potential natural renewable resource for the production of low-molecular-weight aromatic compounds. In the present study, a novel sequential lignin treatment method consisting of a biocatalytic oxidation step followed by a formic acid-induced lignin depolymerization step was developed and optimized using response surface methodology. The biocatalytic step employed a laccase mediator system using the redox mediator 1-hydroxybenzotriazole. Laccases were immobilized on superparamagnetic nanoparticles using a sorption-assisted surface conjugation method allowing easy separation and reuse of the biocatalysts after treatment. Under optimized conditions, as much as 45 wt% of lignin could be solubilized either in aqueous solution after the first treatment or in ethyl acetate after the second (chemical) treatment. The solubilized products were found to be mainly low-molecular-weight aromatic monomers and oligomers. The process might be used for the production of low-molecular-weight soluble aromatic products that can be purified and/or upgraded applying further downstream processes.

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus) Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

PubMed Central

Teixeira, Ricardo Sposina S.; Pereira, Patrícia Maia; Ferreira-Leitão, Viridiana S.

2010-01-01

Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR), Drimaren Blue X-BLN (DMBBLN), Drimaren Rubinol X-3LR (DMR), and Drimaren Blue C-R (RBBR). The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h) and RBBR (80–90%, 24 h) with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h) and DMBBLN (63–84%, 24 h). The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h. PMID:21052547

Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water

PubMed Central

Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

2015-01-01

Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

Biodegradation of sulfamethazine by Trametes versicolor: Removal from sewage sludge and identification of intermediate products by UPLC-QqTOF-MS.

PubMed

García-Galán, Ma Jesús; Rodríguez-Rodríguez, Carlos E; Vicent, Teresa; Caminal, Gloria; Díaz-Cruz, M Silvia; Barceló, Damià

2011-11-15

Degradation of the sulfonamide sulfamethazine (SMZ) by the white-rot fungus Trametes versicolor was assessed. Elimination was achieved to nearly undetectable levels after 20 h in liquid medium when SMZ was added at 9 mg L(-1). Experiments with purified laccase and laccase-mediators resulted in almost complete removal. On the other hand, inhibition of SMZ degradation was observed when piperonilbutoxide, a cytochrome P450-inhibitor, was added to the fungal cultures. UPLC-QqTOF-MS analysis allowed the identification and confirmation of 4 different SMZ degradation intermediates produced by fungal cultures or purified laccase: desulfo-SMZ, N4-formyl-SMZ, N4-hydroxy-SMZ and desamino-SMZ; nonetheless SMZ mineralization was not demonstrated with the isotopically labeled sulfamethazine-phenyl-13C6 after 7 days. Inoculation of T. versicolor to sterilized sewage sludge in solid-phase systems showed complete elimination of SMZ and also of other sulfonamides (sulfapyridine, sulfathiazole) at real environmental concentrations, making this fungus an interesting candidate for further remediation research. Copyright © 2011 Elsevier B.V. All rights reserved.

Hybrid microfluidic fuel cell based on Laccase/C and AuAg/C electrodes.

PubMed

López-González, B; Dector, A; Cuevas-Muñiz, F M; Arjona, N; Cruz-Madrid, C; Arana-Cuenca, A; Guerra-Balcázar, M; Arriaga, L G; Ledesma-García, J

2014-12-15

A hybrid glucose microfluidic fuel cell composed of an enzymatic cathode (Laccase/ABTS/C) and an inorganic anode (AuAg/C) was developed and tested. The enzymatic cathode was prepared by adsorption of 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and Laccase on Vulcan XC-72, which act as a redox mediator, enzymatic catalyst and support, respectively. The Laccase/ABTS/C composite was characterised by Fourier Transform Infrared (FTIR) Spectroscopy, streaming current measurements (Zeta potential) and cyclic voltammetry. The AuAg/C anode catalyst was characterised by Transmission electron microscopy (TEM) and cyclic voltammetry. The hybrid microfluidic fuel cell exhibited excellent performance with a maximum power density value (i.e., 0.45 mW cm(-2)) that is the highest reported to date. The cell also exhibited acceptable stability over the course of several days. In addition, a Mexican endemic Laccase was used as the biocathode electrode and evaluated in the hybrid microfluidic fuel cell generating 0.5 mW cm(-2) of maximum power density. Copyright © 2014 Elsevier B.V. All rights reserved.

Thermokinetic comparison of trypan blue decolorization by free laccase and fungal biomass.

PubMed

Razak, N N A; Annuar, M S M

2014-03-01

Free laccase and fungal biomass from white-rot fungi were compared in the thermokinetics study of the laccase-catalyzed decolorization of an azo dye, i.e., Trypan Blue. The decolorization in both systems followed a first-order kinetics. The apparent first-order rate constant, k1', value increases with temperature. Apparent activation energy of decolorization was similar for both systems at ∼ 22 kJ mol(-1), while energy for laccase inactivation was 18 kJ mol(-1). Although both systems were endothermic, fungal biomass showed higher enthalpy, entropy, and Gibbs free energy changes for the decolorization compared to free laccase. On the other hand, free laccase showed reaction spontaneity over a wider range of temperature (ΔT = 40 K) as opposed to fungal biomass (ΔT = 15 K). Comparison of entropy change (ΔS) values indicated metabolism of the dye by the biomass.

Decolorization of industrial synthetic dyes using engineered Pseudomonas putida cells with surface-immobilized bacterial laccase

PubMed Central

2012-01-01

Background Microbial laccases are highly useful in textile effluent dye biodegradation. However, the bioavailability of cellularly expressed or purified laccases in continuous operations is usually limited by mass transfer impediment or enzyme regeneration difficulty. Therefore, this study develops a regenerable bacterial surface-displaying system for industrial synthetic dye decolorization, and evaluates its effects on independent and continuous operations. Results A bacterial laccase (WlacD) was engineered onto the cell surface of the solvent-tolerant bacterium Pseudomonas putida to construct a whole-cell biocatalyst. Ice nucleation protein (InaQ) anchor was employed, and the ability of 1 to 3 tandemly aligned N-terminal repeats to direct WlacD display were compared. Immobilized WlacD was determined to be surface-displayed in functional form using Western blot analysis, immunofluorescence microscopy, flow cytometry, and whole-cell enzymatic activity assay. Engineered P. putida cells were then applied to decolorize the anthraquinone dye Acid Green (AG) 25 and diazo-dye Acid Red (AR) 18. The results showed that decolorization of both dyes is Cu2+- and mediator-independent, with an optimum temperature of 35°C and pH of 3.0, and can be stably performed across a temperature range of 15°C to 45°C. A high activity toward AG25 (1 g/l) with relative decolorization values of 91.2% (3 h) and 97.1% (18 h), as well as high activity to AR18 (1 g/l) by 80.5% (3 h) and 89.0% (18 h), was recorded. The engineered system exhibited a comparably high activity compared with those of separate dyes in a continuous three-round shake-flask decolorization of AG25/AR18 mixed dye (each 1 g/l). No significant decline in decolorization efficacy was noted during first two-rounds but reaction equilibriums were elongated, and the residual laccase activity eventually decreased to low levels. However, the decolorizing capacity of the system was easily retrieved via a subsequent 4-h cell culturing. Conclusions This study demonstrates, for the first time, the methodology by which the engineered P. putida with surface-immobilized laccase was successfully used as regenerable biocatalyst for biodegrading synthetic dyes, thereby opening new perspectives in the use of biocatalysis in industrial dye biotreatment. PMID:22686507

LacSubPred: predicting subtypes of Laccases, an important lignin metabolism-related enzyme class, using in silico approaches

PubMed Central

2014-01-01

Background Laccases (E.C. 1.10.3.2) are multi-copper oxidases that have gained importance in many industries such as biofuels, pulp production, textile dye bleaching, bioremediation, and food production. Their usefulness stems from the ability to act on a diverse range of phenolic compounds such as o-/p-quinols, aminophenols, polyphenols, polyamines, aryl diamines, and aromatic thiols. Despite acting on a wide range of compounds as a family, individual Laccases often exhibit distinctive and varied substrate ranges. This is likely due to Laccases involvement in many metabolic roles across diverse taxa. Classification systems for multi-copper oxidases have been developed using multiple sequence alignments, however, these systems seem to largely follow species taxonomy rather than substrate ranges, enzyme properties, or specific function. It has been suggested that the roles and substrates of various Laccases are related to their optimal pH. This is consistent with the observation that fungal Laccases usually prefer acidic conditions, whereas plant and bacterial Laccases prefer basic conditions. Based on these observations, we hypothesize that a descriptor-based unsupervised learning system could generate homology independent classification system for better describing the functional properties of Laccases. Results In this study, we first utilized unsupervised learning approach to develop a novel homology independent Laccase classification system. From the descriptors considered, physicochemical properties showed the best performance. Physicochemical properties divided the Laccases into twelve subtypes. Analysis of the clusters using a t-test revealed that the majority of the physicochemical descriptors had statistically significant differences between the classes. Feature selection identified the most important features as negatively charges residues, the peptide isoelectric point, and acidic or amidic residues. Secondly, to allow for classification of new Laccases, a supervised learning system was developed from the clusters. The models showed high performance with an overall accuracy of 99.03%, error of 0.49%, MCC of 0.9367, precision of 94.20%, sensitivity of 94.20%, and specificity of 99.47% in a 5-fold cross-validation test. In an independent test, our models still provide a high accuracy of 97.98%, error rate of 1.02%, MCC of 0.8678, precision of 87.88%, sensitivity of 87.88% and specificity of 98.90%. Conclusion This study provides a useful classification system for better understanding of Laccases from their physicochemical properties perspective. We also developed a publically available web tool for the characterization of Laccase protein sequences (http://lacsubpred.bioinfo.ucr.edu/). Finally, the programs used in the study are made available for researchers interested in applying the system to other enzyme classes (https://github.com/tweirick/SubClPred). PMID:25350584

Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi

PubMed Central

Mander, Gerd J.; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C.; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G.; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard

2006-01-01

Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2′-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain. PMID:16820501

Use of laccase as a novel, versatile reporter system in filamentous fungi.

PubMed

Mander, Gerd J; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard

2006-07-01

Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2'-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain.

Degradation of phenanthrene by Trametes versicolor and its laccase.

PubMed

Han, Mun-Jung; Choi, Hyoung-Tae; Song, Hong-Gyu

2004-06-01

Phenanthrene is a three-ring polycyclic aromatic hydrocarbon and commonly found as a pollutant in various environments. Degradation of phenanthrene by white rot fungus Trametes versicolor 951022 and its laccase, isolated in Korea, was investigated. After 36 h of incubation, about 46% and 65% of 100 mg/l of phenanthrene added in shaken and static fungal cultures were removed, respectively. Phenanthrene degradation was maximal at pH 6 and the optimal temperature for phenanthrene removal was 30 degrees C. Although the removal percentage of phenanthrene was highest (76.7%) at 10 mg/l of phenanthrene concentration, the transformation rate was maximal (0.82 mg/h) at 100 mg/L of phenanthrene concentration in the fungal culture. When the purified laccase of T versicolor 951022 reacted with phenanthrene, phenanthrene was not transformed. The addition of redox mediator, 2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) or 1-hydroxybenzotriazole (HBT) to the reaction mixture increased oxidation of phenanthrene by laccase about 40% and 30%, respectively.

The effects of mediator and granular activated carbon addition on degradation of trace organic contaminants by an enzymatic membrane reactor.

PubMed

Nguyen, Luong N; Hai, Faisal I; Price, William E; Leusch, Frederic D L; Roddick, Felicity; Ngo, Hao H; Guo, Wenshan; Magram, Saleh F; Nghiem, Long D

2014-09-01

The removal of four recalcitrant trace organic contaminants (TrOCs), namely carbamazepine, diclofenac, sulfamethoxazole and atrazine by laccase in an enzymatic membrane reactor (EMR) was studied. Laccases are not effective for degrading non-phenolic compounds; nevertheless, 22-55% removal of these four TrOCs was achieved by the laccase EMR. Addition of the redox-mediator syringaldehyde (SA) to the EMR resulted in a notable dose-dependent improvement (15-45%) of TrOC removal affected by inherent TrOC properties and loading rates. However, SA addition resulted in a concomitant increase in the toxicity of the treated effluent. A further 14-25% improvement in aqueous phase removal of the TrOCs was consistently observed following a one-off dosing of 3g/L granular activated carbon (GAC). Mass balance analysis reveals that this improvement was not due solely to adsorption but also enhanced biodegradation. GAC addition also reduced membrane fouling and the SA-induced toxicity of the effluent. Copyright © 2014 Elsevier Ltd. All rights reserved.

Laccase/HBT and laccase-CBM/HBT treatment of softwood kraft pulp: impact on pulp bleachability and physical properties.

PubMed

Ravalason, Holy; Bertaud, Frédérique; Herpoël-Gimbert, Isabelle; Meyer, Valérie; Ruel, Katia; Joseleau, Jean-Paul; Grisel, Sacha; Olivé, Caroline; Sigoillot, Jean-Claude; Petit-Conil, Michel

2012-10-01

Pycnoporus cinnabarinus laccase and a chimeric laccase-CBM were applied in softwood kraft pulp biobleaching in the presence of 1-hydroxybenzotriazole (HBT). The presence of CBM could enhance the laccase biobleaching potential as a decrease in the enzymatic charge and chlorine dioxide consumption, as well as an increase in pulp brightness were observed. Laccase/HBT treatment could be improved by increasing oxygen pressure from 1 to 3bar and pulp consistency from 5% to 10%. Conversely, under the same conditions, no improvement of laccase-CBM/HBT treatment was observed, indicating a different behavior of both systems. However, laccase-CBM/HBT treatment led to a better preservation of pulp properties. This effect was probably due to fiber surface modifications involving the action of the CBM. Transmission electron microscopy examination of pulp fibers indicated a retention of laccase-CBM inside the pulp fibers due to CBM binding and an increased external microfibrillation of the fibers due to enzymatic treatments. Copyright © 2012 Elsevier Ltd. All rights reserved.

[Advance of heterologous expression study of eukaryote-origin laccases].

PubMed

Ning, Na; Tan, Huijun; Sun, Xinxin; Ni, Jinfeng

2017-04-25

Laccases are enzymes belonging to the group of multi-copper oxidases. These enzymes are widely distributed in insects, plants, fungi and bacteria. In general, laccases can oxidize an exceptionally high number of substrates, so they have broad applications in textile, pulp, food and the degradation of lignin. However, low yield, low activity and thermo-instability of laccase in nature limit the application of laccase. High efficient heterologous expression of the protein is an effective way for solving this problem. Here, we summarize the research advances of heterologous expression of eukaryote-origin laccases. We focus on the overexpression of eukaryote-origin laccases using different expression system and the method for improving the production yield and enzyme activity in yeast cells. Information provided in this review would be helpful for researchers in the field.

Immobilization of fungal laccase onto a nonionic surfactant-modified clay material: application to PAH degradation.

PubMed

Chang, Yi-Tang; Lee, Jiunn-Fwu; Liu, Keng-Hua; Liao, Yi-Fen; Yang, Vivian

2016-03-01

Nonionic surfactant-modified clay is a useful absorbent material that effectively removes hydrophobic organic compounds from soil/groundwater. We developed a novel material by applying an immobilized fungal laccase onto nonionic surfactant-modified clay. Low-water-solubility polycyclic aromatic hydrocarbons (PAHs) (naphthalene/phenanthrene) were degraded in the presence of this bioactive material. PAH degradation by free laccase was higher than degradation by immobilized laccase when the surfactant concentration was allowed to form micelles. PAH degradation by immobilized laccase on TX-100-modified clay was higher than on Brij35-modified clay. Strong laccase degradation of PAH can be maintained by adding surfactant monomers or micelles. The physical adsorption of nonionic surfactants onto clay plays an important role in PAH degradation by laccase, which can be explained by the structure and molecular interactions of the surfactant with the clay and enzyme. A system where laccase is immobilized onto TX-100-monomer-modified clay is a good candidate bioactive material for in situ PAHs bioremediation.

Reduced toxicity of malachite green decolorized by laccase produced from Ganoderma sp. rckk-02 under solid-state fermentation.

PubMed

Sharma, Abha; Shrivastava, Bhuvnesh; Kuhad, Ramesh Chander

2015-10-01

Statistical designs were applied for optimizing laccase production from a white-rot fungus, Ganoderma sp. rckk-02 under solid-state fermentation (SSF). Compared to unoptimized conditions [2,154 U/gds (Unit per gram of dry substrate)], the optimization process resulted in a 17.3-fold increase in laccase production (37,423 U/gds). The laccase produced was evaluated for its potential to decolorize a recalcitrant synthetic dye, malachite green. Laccase at dosage of 30 U/ml in presence of 1 mM of 1-hydroxybenzotriazole (HBT) almost completely decolorized 100 and 200 mg/l of malachite green in 16 and 20 h, respectively, at 30 °C, pH 5.5 and 150 rpm. While, higher dyes concentrations of 300, 400 and 500 mg/l were decolorized to 72, 62 and 55 % in 24, 28 and 32 h, respectively, under similar conditions. Furthermore, it was observed that the decolorized malachite green was less toxic towards the growth of five white-rot fungi tested viz. Crinipellis sp. RCK-1, Ganoderma sp. rckk-02, Coriolopsis Caperata RCK 2011, Phanerochaete chrysosporium K3 and Pycnoporous cinnabarinus PB. The present study demonstrates the potential of Ganoderma sp. rckk-02 to produce high titres of laccase under SSF, which can be exploited in conjunction with redox mediator for the decolorization of high concentrations of malachite green from water bodies.

[Induce of laccase from Trametes gallica and its degradation on neutral dyes and organophosphorus pesticides].

PubMed

Jing, De-Jun; Huang, Jian-Bo; Yang, Zhou-Ping; Hu, Rong; Cheng, Zi-Zhang; Huang, Qian-Ming

2011-12-01

The characteristics of the induction of laccase in Trametes gallica under different initial cultural pH, incubation time by different inducers were discussed, as well as the effects of temperature, pH and time on laccase degradation of six dyes and four organophosphors. The results showed that RB-bright blue, ABTS and o-toluidine affected the production of laccase at different levels, and ABTS was the best inductive agent in our test conditions, whose optimal initial pH and incubation time were 4.0 and 13 days, respectively. The appropriate reaction temperature of the laccase produced was 38 degrees C, and it got a good stability, for it could retain 78.6% of the enzyme activity after 20 min holding at 40 degrees C. Mediated by ABTS, the optimal temperature for laccase to degrade the six types of neutral dyes could be divided into two cases, that was 30 degrees C (neutral black, neutral bordeaux, neutral pink, methyl orange) and 60 degrees C (neutral dark yellow, cresol red), the optimal pH were 6.0 (neutral black), 2.0 (neutral bordeaux, neutral pink) and 4.0 (methyl orange, neutral dark yellow, cresol red), respectively, while the optimal times separately were 6 h (methyl orange, neutral dark yellow, cresol red), 12 h (neutral pink) and 24 h (neutral bordeaux). And using the same inductive agent, the best temperature for laccase to degrade dimethoate, chlorpyrifos, trichlorfon and parathion-pyridazine was 25 degrees C, the suitable time was 9 h, and the optimal pH was 10.0 for dimethoate, chlorpyrifos and parathion-pyridazine, and 8.0 for trichlorfon.

Heterologous laccase production and its role in industrial applications

PubMed Central

Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

2010-01-01

Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

Heterologous expression of Trametes versicolor laccase in Saccharomyces cerevisiae.

PubMed

Iimura, Yosuke; Sonoki, Tomonori; Habe, Hiroshi

2018-01-01

Laccase is used in various industrial fields, and it has been the subject of numerous studies. Trametes versicolor laccase has one of the highest redox potentials among the various forms of this enzyme. In this study, we optimized the expression of laccase in Saccharomyces cerevisiae. Optimizing the culture conditions resulted in an improvement in the expression level, and approximately 45 U/L of laccase was functionally secreted in the culture. The recombinant laccase was found to be a heavily hypermannosylated glycoprotein, and the molecular weight of the carbohydrate chain was approximately 60 kDa. These hypermannosylated glycans lowered the substrate affinity, but the optimum pH and thermo-stability were not changed by these hypermannosylated glycans. This functional expression system described here will aid in molecular evolutionary studies conducted to generate new variants of laccase. Copyright © 2017 Elsevier Inc. All rights reserved.

Impact of reaction conditions on the laccase-catalyzed conversion of bisphenol A.

PubMed

Kim, Young-Jin; Nicell, James A

2006-08-01

The oxidative conversion of aqueous BPA catalyzed by laccase from Trametes versicolor was conducted in a closed, temperature-controlled system containing buffer for pH control. The effects of medium pH, buffer concentration, temperature and mediators and the impacts of dissolved wastewater constituents on BPA conversion were investigated. The optimal pH for BPA conversion was approximately 5, with greater than half maximal conversion and good enzyme stability in the range of 4-7. The stability of the enzyme was not impacted by buffer concentration, nor was BPA conversion. Despite the observation that the enzyme tended to be inactivated at elevated temperatures, enhanced conversion of BPA was observed up until a reaction temperature of 45 degrees C. Of the mediators studied, ABTS was most successful at enhancing the conversion of BPA. Dissolved wastewater constituents that were studied included various inorganic salts, organic compounds and heavy metal ions. BPA conversion was inhibited in the presence of anions such as sulfite, thiosulfate, sulfide, nitrite and cyanide. The metal ions Fe(III) and Cu(II) and the halogens chloride and fluoride substantially suppressed BPA conversion, but the presence of selected organic compounds did not significantly reduce the conversion of BPA.

Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate.

PubMed

Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji

2016-01-01

Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.

Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts

PubMed Central

De Fine Licht, Henrik H.; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J.

2013-01-01

Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non–leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya. PMID:23267060

Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts.

PubMed

De Fine Licht, Henrik H; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J

2013-01-08

Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non-leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya.

Structural Insights into 2,2′-Azino-Bis(3-Ethylbenzothiazoline-6-Sulfonic Acid) (ABTS)-Mediated Degradation of Reactive Blue 21 by Engineered Cyathus bulleri Laccase and Characterization of Degradation Products

PubMed Central

Kenzom, T.; Srivastava, P.

2014-01-01

Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. PMID:25261507

Structural insights into 2,2'-azino-Bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS)-mediated degradation of reactive blue 21 by engineered Cyathus bulleri Laccase and characterization of degradation products.

PubMed

Kenzom, T; Srivastava, P; Mishra, S

2014-12-01

Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Production and characterization of laccase from Cyathus bulleri and its use in decolourization of recalcitrant textile dyes.

PubMed

Salony; Mishra, S; Bisaria, V S

2006-08-01

Many fungi (particularly the white rot) are well suited for treatment of a broad range of textile dye effluents due to the versatility of the lignin-degrading enzymes produced by them. We have investigated decolourization of a number of recalcitrant reactive azo and acid dyes using the culture filtrate and purified laccase from the fungus Cyathus bulleri. For this, the enzyme was purified from the culture filtrate to a high specific activity of 4,022 IU mg(-1) protein, produced under optimized carbon, nitrogen and C/N ratio with induction by 2,6-dimethylaniline. The protein was characterized as a monomer of 58+/-5.0 kDa with carbohydrate content of 16% and was found to contain all three Cu(II) centres. The three internal peptide sequences showed sequence identity (80-92%) with laccases of a number of white rot fungi. Substrate specificity indicated highest catalytic efficiency (k(cat)/K(M)) on guaiacol followed by 2,2'-azino-bis(3-ethylthiazoline-6-sulfonic acid) (ABTS). Decolourization of a number of reactive azo and acid dyes was seen with the culture filtrate of the fungus containing predominantly laccase. In spite of no observable effect of purified laccase on other dyes, the ability to decolourize these was achieved in the presence of the redox mediator ABTS, with 50% decolourization in 0.5-5.4 days.

Derivatization of single-walled carbon nanotubes with redox mediator for biocatalytic oxygen electrodes.

PubMed

Sadowska, K; Stolarczyk, K; Biernat, J F; Roberts, K P; Rogalski, J; Bilewicz, R

2010-11-01

Single-walled carbon nanotubes (SWCNTs) were covalently modified with a redox mediator derived from 2,2'-azino-bis-(3-ethylbenzothiazoline)-6-sulfonic acid (ABTS), and implemented in the construction of electrodes for biocatalytic oxygen reduction. The procedure is based on: covalent bonding of mediator to nanotubes, placing the nanotubes directly on the carbon electrode surface and covering the nanostructured electrode with a Nafion film containing laccase as the biocatalyst. The modified electrode is stable and the problem of mediator (ABTS) leaking from the film is eliminated by binding it covalently to the nanotubes. Three different synthetic approaches were used to obtain ABTS-modified carbon nanotubes. Nanotubes were modified at ends/defect sites or on the nanotube sidewalls and characterized by Raman spectroscopy, TGA and electrochemistry. The accessibility of differently located ABTS units by the laccase active center and mediation of electron transfer were studied by cyclic voltammetry. The surface concentrations of ABTS groups electrically connected with the electrode were compared for each of the electrodes based on the charges of the voltammetric peaks recorded in the deaerated solution. The nanotube modification procedure giving the best parameters of the catalytic process was selected. Copyright © 2010 Elsevier B.V. All rights reserved.

Immobilization of laccase of Pycnoporus sanguineus CS43.

PubMed

Gonzalez-Coronel, Luis A; Cobas, Marta; Rostro-Alanis, Magdalena de J; Parra-Saldívar, Roberto; Hernandez-Luna, Carlos; Pazos, Marta; Sanromán, M Ángeles

2017-10-25

Laccase from Pycnoporus sanguineus CS43 was successfully immobilized onto Immobead-150 and Eupergit-C by covalent binding and by entrapment in LentiKats. The highest immobilization was onto Immobead-150 (97.1±1.2%) compared to the other supports, LentiKats (89±1.1%) and Eupergit-C (83.2±1.4%). All three immobilized enzyme systems showed increased thermostability and better mechanical properties than free laccase. Moreover, after 5 cycles of reuse of these systems, 90% of initial laccase activity was retained. Immobead-150 and LentiKats systems exhibited the highest efficiencies in removal of m-cresol under the combined actions of biodegradation and adsorption, while laccase entrapped in LentiKats showed a high ability for degradation of m-cresol within 24h. In addition, the typical Michaelis-Menten enzymatic model effectively described the kinetic profile of m-cresol degradation by the enzyme entrapped in LentiKats. Based on the results obtained in the present study, it can be established that the immobilized biocatalysts developed here possess significant potential for wastewater treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Evolved α-factor prepro-leaders for directed laccase evolution in Saccharomyces cerevisiae.

PubMed

Mateljak, Ivan; Tron, Thierry; Alcalde, Miguel

2017-11-01

Although the functional expression of fungal laccases in Saccharomyces cerevisiae has proven to be complicated, the replacement of signal peptides appears to be a suitable approach to enhance secretion in directed evolution experiments. In this study, twelve constructs were prepared by fusing native and evolved α-factor prepro-leaders from S. cerevisiae to four different laccases with low-, medium- and high-redox potential (PM1L from basidiomycete PM1; PcL from Pycnoporus cinnabarinus; TspC30L from Trametes sp. strain C30; and MtL from Myceliophthora thermophila). Microcultures of the prepro-leader:laccase fusions were grown in selective expression medium that used galactose as both the sole carbon source and as the inducer of expression so that the secretion and activity were assessed with low- and high-redox potential mediators in a high-throughput screening context. With total activity improvements as high as sevenfold over those obtained with the native α-factor prepro-leader, the evolved prepro-leader from PcL (α PcL ) most strongly enhanced secretion of the high- and medium-redox potential laccases PcL, PM1L and TspC30L in the microtiter format with an expression pattern driven by prepro-leaders in the order α PcL  > α PM 1L  ~ α native . By contrast, the pattern of the low-redox potential MtL was α native  > α PcL  > α PM 1L . When produced in flask with rich medium, the evolved prepro-leaders outperformed the α native signal peptide irrespective of the laccase attached, enhancing secretion over 50-fold. Together, these results highlight the importance of using evolved α-factor prepro-leaders for functional expression of fungal laccases in directed evolution campaigns. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity

PubMed Central

Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

2014-01-01

Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

Suppression of Laccase 2 severely impairs cuticle tanning and pathogen resistance during the pupal metamorphosis of Anopheles sinensis (Diptera: Culicidae).

PubMed

Du, Ming-Hui; Yan, Zheng-Wen; Hao, You-Jin; Yan, Zhen-Tian; Si, Feng-Ling; Chen, Bin; Qiao, Liang

2017-04-04

Phenol oxidases (POs) catalyze the oxidation of dopa and dopamine to melanin, which is crucial for cuticle formation and innate immune maintenance in insects. Although, Laccase 2, a member of the PO family, has been reported to be a requirement for melanin-mediated cuticle tanning in the development stages of some insects, whether it participates in cuticle construction and other physiological processes during the metamorphosis of mosquito pupae is unclear. The association between the phenotype and the expression profile of Anopheles sinensis Laccase 2 (AsLac2) was assessed from pupation to adult eclosion. Individuals showing an expression deficiency of AsLac2 that was produced by RNAi and their phenotypic defects and physiological characterizations were compared in detail with the controls. During the dominant expression period, knockdown of AsLac2 in pupae caused the cuticle to be unpigmented, and produced thin and very soft cuticles, which further impeded the eclosion rate of adults as well as their fitness. Moreover, melanization immune responses in the pupae were sharply decreased, leading to poor resistance to microorganism infection. Both the high conservation among Laccase 2 homologs and a very similar genomic synteny of the neighborhood in Anopheles genus implies a conservative function in the pupal stage. To our knowledge, this is the first study to report the serious phenotypic defects in mosquito pupae caused by the dysfunction of Laccase 2. Our findings strongly suggest that Laccase 2 is crucial for Anopheles cuticle construction and melanization immune responses to pathogen infections during pupal metamorphosis. This irreplaceability provides valuable information on the application of Lacccase 2 and/or other key genes in the melanin metabolism pathway for developing mosquito control strategies.

A chloride tolerant laccase from the plant pathogen ascomycete Botrytis aclada expressed at high levels in Pichia pastoris.

PubMed

Kittl, Roman; Mueangtoom, Kitti; Gonaus, Christoph; Khazaneh, Shima Tahvilda; Sygmund, Christoph; Haltrich, Dietmar; Ludwig, Roland

2012-01-20

Fungal laccases from basidiomycetous fungi are thoroughly investigated in respect of catalytic mechanism and industrial applications, but the number of reported and well characterized ascomycetous laccases is much smaller although they exhibit interesting catalytic properties. We report on a highly chloride tolerant laccase produced by the plant pathogen ascomycete Botrytis aclada, which was recombinantly expressed in Pichia pastoris with an extremely high yield and purified to homogeneity. In a fed-batch fermentation, 495 mg L(-1) of laccase was measured in the medium, which is the highest concentration obtained for a laccase by a yeast expression system. The recombinant B. aclada laccase has a typical molecular mass of 61,565 Da for the amino acid chain. The pI is approximately 2.4, a very low value for a laccase. Glycosyl residues attached to the recombinant protein make up for approximately 27% of the total protein mass. B. aclada laccase exhibits very low K(M) values and high substrate turnover numbers for phenolic and non-phenolic substrates at acidic and near neutral pH. The enzyme's stability increases in the presence of chloride ions and, even more important, its substrate turnover is only weakly inhibited by chloride ions (I(50)=1.4M), which is in sharp contrast to most other described laccases. This high chloride tolerance is mandatory for some applications such as implantable biofuel cells and laccase catalyzed reactions, which suffer from the presence of chloride ions. The high expression yield permits fast and easy production for further basic and applied research. Copyright © 2011 Elsevier B.V. All rights reserved.

A step forward in laccase exploitation: Recombinant production and evaluation of techno-economic feasibility of the process.

PubMed

Pezzella, Cinzia; Giacobelli, Valerio Guido; Lettera, Vincenzo; Olivieri, Giuseppe; Cicatiello, Paola; Sannia, Giovanni; Piscitelli, Alessandra

2017-10-10

Protein heterologous production offers viable opportunities to tailor laccase properties to specific industrial needs. The high redox potential laccase POXA1b from Pleurotus ostreatus was chosen as case study of marketable enzyme, due to its desirable properties in terms of activity/stability profile, and already assessed applicability. POXA1b was heterologously produced in Pichia pastoris by investigating the effect of inducible and constitutive expression systems on both the yield and the cost of its production. System performances were first assessed in shaken-flasks and then scaled-up in bioreactor. The production level obtained in the inducible system is 42U/mL, while the activity value achieved with the constitutive one is 60U/mL, the highest obtained in constitutive systems so far. The economic feasibility of recombinant laccase production was simulated, describing the case of an Italian small-medium enterprise. Two scenarios were evaluated: Scenario (I) production based on methanol inducible system; Scenario (II) production based on the constitutive system, fed with glycerol. At all the scales the glycerol-based fermentation is more economic than the methanol-based one. The price forecast for rPOXA1b production is 0.34€kU -1 for glycerol-based process, and is very competitive with the current price of commercial laccase. Copyright © 2017 Elsevier B.V. All rights reserved.

Supermagnetically Tuned Halloysite Nanotubes Functionalized with Aminosilane for Covalent Laccase Immobilization.

PubMed

Kadam, Avinash A; Jang, Jiseon; Lee, Dae Sung

2017-05-10

Halloysite nanotubes (HNTs) were tuned with supermagnetic Fe 3 O 4 (M-HNTs) and functionalized with γ-aminopropyltriethoxysilane (APTES) (A-M-HNTs). Gluteraldehyde (GTA) was linked to A-M-HNTs (A-M-HNTs-GTA) and explored for covalent laccase immobilization. The structural characterization of M-HNTs, A-M-HNTs, and A-M-HNTs-GTA-immobilized laccase (A-M-HNTs-GTA-Lac) was determined by X-ray photoelectron spectroscopy, field-emission high-resolution transmission electron microscopy, a magnetic property measurement system, and thermogavimetric analyses. A-M-HNTs-GTA-Lac gave 90.20% activity recovery and a loading capability of 84.26 mg/g, with highly improved temperature and storage stabilities. Repeated usage of A-M-HNTs-GTA-Lac revealed a remarkably consistent relative activity of 80.49% until the ninth cycle. The A-M-HNTs-GTA-Lac gave consistent redox-mediated sulfamethoxazole (SMX) degradation up to the eighth cycle. In the presence of guaiacol, A-M-HNTs-GTA-Lac gave elevated SMX degradation compared with 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic acid) and syrinialdehyde. Therefore, the A-M-HNTs can serve as supermagnetic amino-functionalized nanoreactors for biomacromolecule immobilization. The obtained A-M-HNTs-GTA-Lac is an environmentally friendly biocatalyst for effective degradation of micropollutants, such as SMX, and can be easily retrieved from an aqueous solution by a magnet after decontamination of pollutants in water and wastewater.

Laccase from Aspergillus niger: A novel tool to graft multifunctional materials of interests and their characterization.

PubMed

Iqbal, Hafiz M N; Kyazze, Godfrey; Tron, Thierry; Keshavarz, Tajalli

2018-03-01

In the present study, we propose a green route to prepare poly(3-hydroxybutyrate) [(P(3HB)] grafted ethyl cellulose (EC) based green composites with novel characteristics through laccase-assisted grafting. P(3HB) was used as a side chain whereas, EC as a backbone material under ambient processing conditions. A novel laccase obtained from Aspergillus niger through its heterologous expression in Saccharomyces cerevisiae was used as a green catalyst for grafting purposes without the use of additional initiator and/or cross-linking agents. Subsequently, the resulting P(3HB)- g -EC composites were characterized using a range of analytical and imagining techniques. Fourier transform infrared spectroscopy (FT-IR) spectra showed an increase in the hydrogen-bonding type interactions between the side chains of P(3HB) and backbone material of EC. Evidently, X-ray diffraction (XRD) analysis revealed a decrease in the crystallinity of the P(3HB)- g -EC composites as compared to the pristine individual polymers. A homogeneous P(3HB) distribution was also achieved in case of the graft composite prepared in the presence of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) as a mediator along with laccase as compared to the composite prepared using pure laccase alone. A substantial improvement in the thermal and mechanical characteristics was observed for grafted composites up to the different extent as compared to the pristine counterparts. The hydrophobic/hydrophilic properties of the grafted composites were better than those of the pristine counterparts.

Molecular modeling and simulation studies of recombinant laccase from Yersinia enterocolitica suggests significant role in the biotransformation of non-steroidal anti-inflammatory drugs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Deepti; Rawat, Surender; Waseem, Mohd

The YacK gene from Yersinia enterocolitica strain 7, cloned in pET28a vector and expressed in Escherichia coli BL21 (DE3), showed laccase activity when oxidized with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and guaiacol. The recombinant laccase protein was purified and characterized biochemically with a molecular mass of ≈58 KDa on SDS-PAGE and showed positive zymogram with ABTS. The protein was highly robust with optimum pH 9.0 and stable at 70 °C upto 12 h with residual activity of 70%. Kinetic constants, K{sub m} values, for ABTS and guaiacol were 675 μM and 2070 μM, respectively, with corresponding Vmax values of 0.125 μmol/ml/min and 6500 μmol/ml/min. It also possess antioxidative propertymore » against BSA and Cu{sup 2+}/H{sub 2}O{sub 2} model system. Constant pH MD simulation studies at different protonation states of the system showed ABTS to be most stable at acidic pH, whereas, diclofenac at neutral pH. Interestingly, aspirin drifted out of the binding pocket at acidic and neutral pH, but showed stable binding at alkaline pH. The biotransformation of diclofenac and aspirin by laccase also corroborated the in silico results. This is the first report on biotransformation of non-steroidal anti-inflammatory drugs (NSAIDs) using recombinant laccase from gut bacteria, supported by in silico simulation studies. - Highlights: • Laccase from Yersinia enterocolitica strain 7 was expressed in Escherichia coli BL21 (DE3). • Recombinant laccase was found to be thermostable and alkali tolerant. • The in silico and experimental studied proves the biotransformation of NSAIDs. • Laccase binds to ligands differentially under different protonation state. • Laccase also possesses free radical scavenging property.« less

Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

PubMed

Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

2014-01-01

We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Reactivity of long chain alkylamines to lignin moieties: implications on hydrophobicity of lignocellulose materials.

PubMed

Kudanga, Tukayi; Prasetyo, Endry Nugroho; Sipilä, Jussi; Guebitz, Georg M; Nyanhongo, Gibson S

2010-08-20

Enzymatic processes provide new perspectives for modification of lignocellulose materials. In the current study, laccase catalyzed coupling of long chain alkylamines to lignin model molecules and lignocellulose was investigated. Up to two molecules of dodecylamine (DA) and dihexylamine (DHA) were successfully coupled with lignin monomers (guaiacol, catechol and ferulic acid) while coupling onto complex lignin model compounds (syringylglycerol beta-guaiacyl ether, guaiacylglycerol beta-guaiacyl ether and dibenzodioxocin) yielded 1:1 coupling products. Surface analysis of beech veneers enzymatically grafted with DA showed an increase in nitrogen content of 3.18% compared to 0.71% in laccase only treated controls while the O/C ratio decreased from 0.52 to 0.46. Concomitantly the grafting of DHA or DA onto beech veneers resulted in a 53.8% and 84.2% increase in hydrophobicity, respectively when compared to simple adsorption. Therefore, laccase-mediated grafting of long chain alkylamines onto lignocellulose materials can be potentially exploited for improving their hydrophobicity. Copyright 2010 Elsevier B.V. All rights reserved.

Cross-linking proteins by laccase: Effects on the droplet size and rheology of emulsions stabilized by sodium caseinate.

PubMed

Sato, A C K; Perrechil, F A; Costa, A A S; Santana, R C; Cunha, R L

2015-09-01

The aim of this work was to evaluate the influence of laccase and ferulic acid on the characteristics of oil-in-water emulsions stabilized by sodium caseinate at different pH (3, 5 and 7). Emulsions were prepared by high pressure homogenization of soybean oil with sodium caseinate solution containing varied concentrations of laccase (0, 1 and 5mg/mL) and ferulic acid (5 and 10mM). Laccase treatment and pH exerted a strong influence on the properties with a consequent effect on stability, structure and rheology of emulsions stabilized by Na-caseinate. At pH7, O/W emulsions were kinetically stable due to the negative protein charge which enabled electrostatic repulsion between oil droplets resulting in an emulsion with small droplet size, low viscosity, pseudoplasticity and viscoelastic properties. The laccase treatment led to emulsions showing shear-thinning behavior as a result of a more structured system. O/W emulsions at pH5 and 3 showed phase separation due to the proximity to protein pI, but the laccase treatment improved their stability of emulsions especially at pH3. At pH3, the addition of ferulic acid and laccase produced emulsions with larger droplet size but with narrower droplet size distribution, increased viscosity, pseudoplasticity and viscoelastic properties (gel-like behavior). Comparing laccase treatments, the combined addition of laccase and ferulic acid generally produced emulsions with lower stability (pH5), larger droplet size (pH3, 5 and 7) and higher pseudoplasticity (pH5 and 7) than emulsion with only ferulic acid. The results suggested that the cross-linking of proteins by laccase and ferulic acid improved protein emulsifying properties by changing functional mechanisms of the protein on emulsion structure and rheology, showing that sodium caseinate can be successfully used in acid products when treated with laccase. Copyright © 2015 Elsevier Ltd. All rights reserved.

Investigation of chitosan-phenolics systems as wood adhesives.

PubMed

Peshkova, Svetlana; Li, Kaichang

2003-04-24

Chitosan-phenolics systems were investigated as wood adhesives. Adhesion between two pieces of wood veneer developed only when all three components-chitosan, a phenolic compound, and laccase-were present. For the adhesive systems containing a phenolic compound with only one phenolic hydroxyl group, adhesive strengths were highly dependent upon the chemical structures of phenolic compounds used in the system and the relative oxidation rates of the phenolic compounds by laccase. The adhesive strengths were also directly related to the viscosity of the adhesive systems. However, for the adhesive systems containing a phenolic compound with two or three phenolic hydroxyl groups adjacent to each other, no correlations among adhesive strengths, relative oxidation rates of the phenolic compounds by laccase, and viscosities were observed. The adhesion mechanisms of these chitosan-phenolics systems were proposed to be similar to those of mussel adhesive proteins.

Ecofriendly syntheses of phenothiazones and related structures facilitated by laccase – A comparative study

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2016-07-06

The biocatalytic synthesis of phenothiazones and related compounds has been achieved in an aqueous system under mild conditions facilitated by laccase oxidation. It was found that by coupling 2-aminothiophenol directly with 1,4-quinones, the product yields could be significantly increased compared to generating the 1,4-quinones in situ from the corresponding hydroquinones via laccase oxidation. However, laccase still proved to be pivotal for achieving highest product yields by catalyzing the final oxidation step. Furthermore, a difference in reactivity of aromatic and aliphatic amines toward 1,4-naphthoquinone is observed. Furthermore, this study provides a sustainable approach to the synthesis of a biologically important classmore » of compounds.« less

Production of laccase by Coriolus versicolor and its application in decolorization of dyestuffs: (II). Decolorization of dyes by laccase containing fermentation broth with or without self-immobilized mycelia.

PubMed

Lin, Jian-Ping; Lian, Wei; Xia, Li-Ming; Cen, Pei-Lin

2003-01-01

The capability of decolorization for commercial dyes by Coriolus versicolor fermentation broth containing laccase with or without immobilized mycelium was evaluated. With cell-free fermentation broth containing laccase, high decolorization ratio was achieved foracid orange 7, but not for the other dyes concerned. The immobilized mycelium was proved to be more efficient than the cell-free system. All the four dyestuffs studied were found being decolourized with certain extent by immobilized mycelium. The repeated-batch decolorization was carried out with satisfactory results. The experimental data showed that the continuous decolorization of wastewater from a printing and dyeing industry was possible by using the self-immobilized C. versicolor.

Enhancing the laccase production and laccase gene expression in the white-rot fungus Trametes velutina 5930 with great potential for biotechnological applications by different metal ions and aromatic compounds.

PubMed

Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu

2013-01-01

Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+) and Fe(2+) could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930.

A High Redox Potential Laccase from Pycnoporus sanguineus RP15: Potential Application for Dye Decolorization

PubMed Central

Zimbardi, Ana L. R. L.; Camargo, Priscila F.; Carli, Sibeli; Aquino Neto, Sidney; Meleiro, Luana P.; Rosa, Jose C.; De Andrade, Adalgisa R.; Jorge, João A.; Furriel, Rosa P. M.

2016-01-01

Laccase production by Pycnoporus sanguineus RP15 grown in wheat bran and corncob under solid-state fermentation was optimized by response surface methodology using a Central Composite Rotational Design. A laccase (Lacps1) was purified and characterized and the potential of the pure Lacps1 and the crude culture extract for synthetic dye decolorization was evaluated. At optimal conditions (eight days, 26 °C, 18% (w/w) milled corncob, 0.8% (w/w) NH4Cl and 50 mmol·L−1 CuSO4, initial moisture 4.1 mL·g−1), the laccase activity reached 138.6 ± 13.2 U·g−1. Lacps1 was a monomeric glycoprotein (67 kDa, 24% carbohydrate). Optimum pH and temperature for the oxidation of 2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) were 4.4 and 74.4 °C, respectively. Lacps1 was stable at pH 3.0–8.0, and after two hours at 55–60 °C, presenting high redox potential (0.747 V vs. NHE). ABTS was oxidized with an apparent affinity constant of 147.0 ± 6.4 μmol·L−1, maximum velocity of 413.4 ± 21.2 U·mg−1 and catalytic efficiency of 3140.1 ± 149.6 L·mmol−1·s−1. The maximum decolorization percentages of bromophenol blue (BPB), remazol brilliant blue R and reactive blue 4 (RB4), at 25 or 40 °C without redox mediators, reached 90%, 80% and 60%, respectively, using either pure Lacps1 or the crude extract. This is the first study of the decolorization of BPB and RB4 by a P. sanguineus laccase. The data suggested good potential for treatment of industrial dye-containing effluents. PMID:27164083

Scale-up laccase production from Trametes versicolor stimulated by vanillic acid.

PubMed

Wang, Ke-Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2016-07-01

An efficient strategy for laccase production in Trametes versicolor cultures was developed using vanillic acid as the inducer. The optimized vanillic acid treatment strategy consisted of exposing 2-day-old mycelia cultures to 80 mg/L vanillic acid. After 4 days, laccase activity of 588.84 U/L was achieved in flasks which represented a 1.79-fold increase compared to the control. In 200-L airlift bioreactor, the maximal laccase activity reached up to 785.12 U/L using the optimized vanillic acid treatment strategy. The zymograms of culture supernatants revealed three bands with laccase activity, among which Lac1 and Lac2 were abundant laccase isoforms constitutively expressed, and Lac3 was an inducible isozyme by vanillic acid. The results of real-time quantitative PCR showed that the transcription level of lcc in T. versicolor cultures grown with vanillic acid for 7 days was about 5.64-fold greater than that without vanillic acid in flasks. In 200-L airlift bioreactor cultures of T. versicolor with addition of vanillic acid, the transcript level of lcc at day 7 was 2.62-fold higher than that in flasks with vanillic acid due to the good mass transfer and oxygen supply in the bioreactor system. This study provides a basis for understanding the induction mechanism of vanillic acid for laccase production and has good potential for industrial applications.

Synergistic enzymatic and microbial lignin conversion

DOE PAGES

Zhao, Cheng; Xie, Shangxian; Pu, Yunqiao; ...

2015-10-02

We represent the utilization of lignin for fungible fuels and chemicals and it's one of the most imminent challenges in modern biorefineries. However, bioconversion of lignin is highly challenging due to its recalcitrant nature as a phenolic heteropolymer. This study addressed the challenges by revealing the chemical and biological mechanisms for synergistic lignin degradation by a bacterial and enzymatic system, which significantly improved lignin consumption, cell growth and lipid yield. The Rhodococcus opacus cell growth increased exponentially in response to the level of laccase treatment, indicating the synergy between laccase and bacterial cells in lignin degradation. Other treatments like ironmore » and hydrogen peroxide showed limited impact on cell growth. Chemical analysis of lignin under various treatments further confirmed the synergy between laccase and cells at the chemical level. 31P nuclear magnetic resonance (NMR) suggested that laccase, R. opacus cell and Fenton reaction reagents promoted the degradation of different types of lignin functional groups, elucidating the chemical basis for the synergistic effects. 31P NMR further revealed that laccase treatment had the most significant impact for degrading the abundant chemical groups. The results were further confirmed by the molecular weight analysis and lignin quantification by the Prussian blue assay. The cell–laccase fermentation led to a 17-fold increase of lipid production. Overall, the study indicated that laccase and R. opacus can synergize to degrade lignin efficiently, likely through rapid utilization of monomers generated by laccase to promote the reaction toward depolymerization. The study provided a potential path for more efficient lignin conversion and development of consolidated lignin conversion.« less

Synergistic enzymatic and microbial lignin conversion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Cheng; Xie, Shangxian; Pu, Yunqiao

We represent the utilization of lignin for fungible fuels and chemicals and it's one of the most imminent challenges in modern biorefineries. However, bioconversion of lignin is highly challenging due to its recalcitrant nature as a phenolic heteropolymer. This study addressed the challenges by revealing the chemical and biological mechanisms for synergistic lignin degradation by a bacterial and enzymatic system, which significantly improved lignin consumption, cell growth and lipid yield. The Rhodococcus opacus cell growth increased exponentially in response to the level of laccase treatment, indicating the synergy between laccase and bacterial cells in lignin degradation. Other treatments like ironmore » and hydrogen peroxide showed limited impact on cell growth. Chemical analysis of lignin under various treatments further confirmed the synergy between laccase and cells at the chemical level. 31P nuclear magnetic resonance (NMR) suggested that laccase, R. opacus cell and Fenton reaction reagents promoted the degradation of different types of lignin functional groups, elucidating the chemical basis for the synergistic effects. 31P NMR further revealed that laccase treatment had the most significant impact for degrading the abundant chemical groups. The results were further confirmed by the molecular weight analysis and lignin quantification by the Prussian blue assay. The cell–laccase fermentation led to a 17-fold increase of lipid production. Overall, the study indicated that laccase and R. opacus can synergize to degrade lignin efficiently, likely through rapid utilization of monomers generated by laccase to promote the reaction toward depolymerization. The study provided a potential path for more efficient lignin conversion and development of consolidated lignin conversion.« less

Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

PubMed Central

Feng, Bao Zhen; Li, Peiqian

2014-01-01

Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2′-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

Correlation between mesopore volume of carbon supports and the immobilization of laccase from Trametes versicolor for the decolorization of Acid Orange 7.

PubMed

Ramírez-Montoya, Luis A; Hernández-Montoya, Virginia; Montes-Morán, Miguel A; Cervantes, Francisco J

2015-10-01

Immobilization of laccase from Trametes versicolor was carried out using carbon supports prepared from different lignocellulosic wastes. Enzymes were immobilized by physical adsorption. Taguchi methodology was selected for the design of experiments regarding the preparation of the carbon materials, which included the use of activating agents for the promotion of mesoporosity. A good correlation between the mesopore volumes of the carbon supports and the corresponding laccase loadings attained was observed. Specifically, the chemical activation of pecan nut shell with FeCl3 led to a highly mesoporous material that also behaved as the most efficient support for the immobilization of laccase. This particular laccase/carbon support system was used as biocatalyst for the decolorization of aqueous solutions containing Acid Orange 7. Mass spectrometry coupled to a liquid chromatograph allowed us to identify the products of the dye degradation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Direct electrochemistry of dopamine on gold-Agaricus bisporus laccase enzyme electrode: characterization and quantitative detection.

PubMed

Shervedani, Reza Karimi; Amini, Akbar

2012-04-01

Direct electrochemistry of a new laccase enzyme immobilized on gold and its application as a biosensor for dopamine (DA) are investigated by voltammetry and electrochemical impedance spectroscopy. The sensor demonstrated a redox adsorption behavior with E(0') = + 180 mV vs. Ag/AgCl for immobilized Agaricus bisporus laccase (LacAB) enzyme. The MPA platform was assembled on Au with and without utilization of ultrasounds. Excellent results were obtained by using the enzyme electrode fabricated based on MPA assembled with sonication. The LacAB immobilized in this condition showed a large electrocatalytic activity for oxidation of DA. Accordingly, a third-generation (mediator free) biosensor was constructed for DA. The DA concentration could be measured in the linear range of 0.5 to 13.0 and 47.0 to 430.0 μmol L(-1) with correlation coefficients of 0.999 and 0.989, respectively, and a detection limit of 29.0 nmol L(-1). The biosensor was successfully tested for determination of DA in human blood plasma and pharmaceutical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

PubMed

Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

2012-10-23

Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L(-1) in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation.

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

PubMed Central

2012-01-01

Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L-1 in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation. PMID:23092193

Catechol Removal from Aqueous Media Using Laccase Immobilized in Different Macro- and Microreactor Systems.

PubMed

Tušek, Ana Jurinjak; Šalić, Anita; Zelić, Bruno

2017-08-01

Laccase belongs to the group of enzymes that are capable to catalyze the oxidation of phenols. Since the water is only by-product in laccase-catalyzed phenol oxidations, it is ideally "green" enzyme with many possible applications in different industrial processes. To make the oxidation process more sustainable in terms of biocatalyst consumption, immobilization of the enzyme is implemented in to the processes. Additionally, when developing a process, choice of a reactor type plays a significant role in the total outcome.In this study, the use of immobilized laccase from Trametes versicolor for biocatalytic catechol oxidation was explored. Two different methods of immobilization were performed and compared using five different reactor types. In order to compare different systems used for catechol oxidation, biocatalyst turnover number and turnover frequency were calculated. With low consumption of the enzyme and good efficiency, obtained results go in favor of microreactors with enzyme covalently immobilized on the microchannel surface.

Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.

PubMed

Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

2014-02-01

Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

Enzymatic biofuel cell based on electrodes modified with lipid liquid-crystalline cubic phases

NASA Astrophysics Data System (ADS)

Nazaruk, Ewa; Smoliński, Sławomir; Swatko-Ossor, Marta; Ginalska, Grażyna; Fiedurek, Jan; Rogalski, Jerzy; Bilewicz, Renata

Two glassy carbon electrodes modified with enzymes embedded in lyotropic liquid-crystalline cubic phase were used for the biofuel cell construction. The monoolein liquid-crystalline film allowed to avoid separators in the biofuel cell. Glucose and oxygen as fuels, and glucose oxidase and laccase as anode and cathode biocatalysts, respectively were used. The biofuel cell parameters were examined in McIlvaine buffer, pH 7 solution containing 15 mM of glucose and saturated with dioxygen. A series of mediators were tested taking into account their formal potentials, stability in the cubic phase and efficiency of mediation. Most stable was the biofuel cell based on tetrathiafulvalene (TTF) and 2,2‧-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as anode and cathode mediators, respectively. The open-circuit voltage was equal to 450 ± 40 mV. The power densities and current densities were measured for all the systems studied.

Improved recovery of active recombinant laccase from maize seed.

PubMed

Bailey, M R; Woodard, S L; Callaway, E; Beifuss, K; Magallanes-Lundback, M; Lane, J R; Horn, M E; Mallubhotla, H; Delaney, D D; Ward, M; Van Gastel, F; Howard, J A; Hood, E E

2004-01-01

Lignolytic enzymes such as laccase have been difficult to over-express in an active form. This paper describes the expression, characterization, and application of a fungal laccase in maize seed. The transgenic seed contains immobilized and extractable laccase. Fifty ppm dry weight of aqueously extractable laccase was obtained, and the remaining solids contained a significant amount of immobilized laccase that was active. Although a portion of the extractable laccase was produced as inactive apoenzyme, laccase activity was recovered by treatment with copper and chloride. In addition to allowing the apoenzyme to regain activity, treatment with copper also provided a partial purification step by precipitating other endogenous corn proteins while leaving >90% of the laccase in solution. The data also demonstrate the application of maize-produced laccase as a polymerization agent. The apparent concentration of laccase in ground, defatted corn germ is approximately 0.20% of dry weight.

Construction and direct electrochemistry of orientation controlled laccase electrode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Ying; Zhang, Jiwei; Huang, Xirong, E-mail: xrhuang@sdu.edu.cn

2014-03-28

Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, usingmore » genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.« less

Recovery of laccase from processed Hericium erinaceus (Bull.:Fr) Pers. fruiting bodies in aqueous two-phase system.

PubMed

Rajagopalu, Devamalini; Show, Pau Loke; Tan, Yee Shin; Muniandy, Sekaran; Sabaratnam, Vikineswary; Ling, Tau Chuan

2016-09-01

The feasible use of aqueous two-phase systems (ATPSs) to establish a viable protocol for the recovery of laccase from processed Hericium erinaceus (Bull.:Fr.) Pers. fruiting bodies was evaluated. Cold-stored (4.00±1.00°C) H. erinaceus recorded the highest laccase activities of 2.02±0.04 U/mL among all the processed techniques. The evaluation was carried out in twenty-five ATPSs, which composed of polyethylene glycol (PEG) with various molecular weights and potassium phosphate salt solution to purify the protein from H. erinaceus. Optimum recovery condition was observed in the ATPS which contained 17% (w/w) PEG with a molecular weight of 8000 and 12.2% (w/w) potassium phosphate solution, at a volume ratio (VR) of 1.0. The use of ATPS resulted in one-single primary recovery stage process that produced an overall yield of 99% with a purification factor of 8.03±0.46. The molecular mass of laccases purified from the bottom phase was in the range of 55-66 kDa. The purity of the partitioned laccase was confirmed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Use of bacteria for improving the lignocellulose biorefinery process: importance of pre-erosion.

PubMed

Zhuo, Shengnan; Yan, Xu; Liu, Dan; Si, Mengying; Zhang, Kejing; Liu, Mingren; Peng, Bing; Shi, Yan

2018-01-01

Biological pretreatment is an important alternative strategy for biorefining lignocellulose and has attracted increasing attention in recent years. However, current designs for this pretreatment mainly focus on using various white rot fungi, overlooking the bacteria. To the best of our knowledge, for the first time, we evaluated the potential contribution of bacteria to lignocellulose pretreatment, with and without a physicochemical process, based on the bacterial strain Pandoraea sp. B-6 (hereafter B-6) that was isolated from erosive bamboo slips. Moreover, the mechanism of the improvement of reducing sugar yield by bacteria was elucidated via analyses of the physicochemical changes of corn stover (CS) before and after pretreatment. The digestibility of CS pretreated with B-6 was equivalent to that of untreated CS. The recalcitrant CS surface provided fewer mediators for contact with the extracellular enzymes of B-6. A pre-erosion strategy using a tetrahydrofuran-water co-solvent system was shown to destroy the recalcitrant CS surface. The optimal condition for pre-erosion showed a 6.5-fold increase in enzymatic digestibility compared with untreated CS. The pre-erosion of CS can expose more phenolic compounds that were chelated to oxidized Mn 3+ and also provided mediators for combination with laccase, which was attributable to B-6 pretreatment. B-6 pretreatment following pre-erosion exhibited a sugar yield that was 91.2 mg/g greater than that of pre-erosion alone and 7.5-fold higher than that of untreated CS. This pre-erosion application was able to destroy the recalcitrant CS surface, thus leading to a rough and porous architecture that better facilitated the diffusion and transport of lignin derivatives. This enhanced the ability of laccase and manganese peroxidase secreted by B-6 to improve the efficiency of this biological pretreatment. Bacteria were not found useful alone as a biological pretreatment, but they significantly improved enzymatic digestion after lignocellulose breakdown via other physicochemical methods. Nonetheless, phenyl or phenoxy radicals were used by laccase and manganese peroxidase in B-6 for lignin attack or lignin depolymerization. These particular mediators released from the recalcitrance network of lignocellulose openings are important for the efficacy of this bacterial pretreatment. Our findings thus offer a novel perspective on the effective design of biological pretreatment methods for lignocellulose.

Construction and direct electrochemistry of orientation controlled laccase electrode.

PubMed

Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

2014-03-28

A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. Copyright © 2014 Elsevier Inc. All rights reserved.

Cloning and Expression of Laccase from Trametes versicolor in Saccharomyces cerevisiae using a Novel Vector System

USDA-ARS?s Scientific Manuscript database

The long-term goal of this research is to increase efficiency and decrease cost of ethanol fermentation of lignocellulosic feedstocks by combining pre-treatment using laccase enzyme and subsequent fermentation to ethanol through simultaneous saccharification and fermentation paradigms. The first st...

Influence of a soil enzyme on iron-cyanide complex speciation and mineral adsorption.

PubMed

Zimmerman, Andrew R; Kang, Dong-Hee; Ahn, Mi-Youn; Hyun, Seunghun; Banks, M Katherine

2008-01-01

Cyanide is commonly found as ferrocyanide [Fe(II)(CN)(6)](-4) and in the more mobile form, ferricyanide [Fe(III)(CN)(6)](-3) in contaminated soils and sediments. Although soil minerals may influence ferrocyanide speciation, and thus mobility, the possible influence of soil enzymes has not been examined. In a series of experiments conducted under a range of soil-like conditions, laccase, a phenoloxidase enzyme derived from the fungi Trametes versicolor, was found to exert a large influence on iron-cyanide speciation and mobility. In the presence of laccase, up to 93% of ferrocyanide (36-362ppm) was oxidized to ferricyanide within 4h. No significant effect of pH (3.6 and 6.2) or initial ferrocyanide concentration on the extent or rate of oxidation was found and ferrocyanide oxidation did not occur in the absence of laccase. Relative to iron-cyanide-mineral systems without laccase, ferrocyanide adsorption to aluminum hydroxide and montmorillonite decreased in the presence of laccase and was similar to or somewhat greater than that of ferricyanide without laccase. Laccase-catalyzed conversion of ferrocyanide to ferricyanide was extensive though up to 33% of the enzyme was mineral-bound. These results demonstrate that soil enzymes can play a major role in ferrocyanide speciation and mobility. Biotic soil components must be considered as highly effective oxidation catalysts that may alter the mobility of metals and metal complexes in soil. Immobilized enzymes should also be considered for use in soil metal remediation efforts.

Three-dimensional graphene networks as a new substrate for immobilization of laccase and dopamine and its application in glucose/O2 biofuel cell.

PubMed

Zhang, Yijia; Chu, Mi; Yang, Lu; Tan, Yueming; Deng, Wenfang; Ma, Ming; Su, Xiaoli; Xie, Qingji

2014-08-13

We report here three-dimensional graphene networks (3D-GNs) as a novel substrate for the immobilization of laccase (Lac) and dopamine (DA) and its application in glucose/O2 biofuel cell. 3D-GNs were synthesized with an Ni(2+)-exchange/KOH activation combination method using a 732-type sulfonic acid ion-exchange resin as the carbon precursor. The 3D-GNs exhibited an interconnected network structure and a high specific surface area. DA was noncovalently functionalized on the surface of 3D-GNs with 3,4,9,10-perylene tetracarboxylic acid (PTCA) as a bridge and used as a novel immobilized mediating system for Lac-based bioelectrocatalytic reduction of oxygen. The 3D-GNs-PTCA-DA nanocomposite modified glassy carbon electrode (GCE) showed stable and well-defined redox current peaks for the catechol/o-quinone redox couple. Due to the mediated electron transfer by the 3D-GNs-PTCA-DA nanocomposite, the Nafion/Lac/3D-GNs-PTCA-DA/GCE exhibited high catalytic activity for oxygen reduction. The 3D-GNs are proven to be a better substrate for Lac and its mediator immobilization than 2D graphene nanosheets (2D-GNs) due to the interconnected network structure and high specific surface area of 3D-GNs. A glucose/O2 fuel cell using Nafion/Lac/3D-GNs-PTCA-DA/GCE as the cathode and Nafion/glucose oxidase/ferrocence/3D-GNs/GCE as the anode can output a maximum power density of 112 μW cm(-2) and a short-circuit current density of 0.96 mA cm(-2). This work may be helpful for exploiting the popular 3D-GNs as an efficient electrode material for many other biotechnology applications.

Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.

PubMed

Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

2015-09-01

Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase.

Systematic Analysis of the Pleurotus ostreatus Laccase Gene (PoLac) Family and Functional Characterization of PoLac2 Involved in the Degradation of Cotton-Straw Lignin.

PubMed

Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping

2018-04-11

Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .

Degradation of synthetic pollutants in real wastewater using laccase encapsulated in core-shell magnetic copper alginate beads.

PubMed

Le, Thao Thanh; Murugesan, Kumarasamy; Lee, Chung-Seop; Vu, Chi Huong; Chang, Yoon-Seok; Jeon, Jong-Rok

2016-09-01

Immobilization of laccase has been highlighted to enhance their stability and reusability in bioremediation. In this study, we provide a novel immobilization technique that is very suitable to real wastewater treatment. A perfect core-shell system composing copper alginate for the immobilization of laccase (Lac-beads) was produced. Additionally, nFe2O3 was incorporated for the bead recycling through magnetic force. The beads were proven to immobilize 85.5% of total laccase treated and also to be structurally stable in water, acetate buffer, and real wastewater. To test the Lac-beads reactivity, triclosan (TCS) and Remazol Brilliant Blue R (RBBR) were employed. The Lac-beads showed a high percentage of TCS removal (89.6%) after 8h and RBBR decolonization at a range from 54.2% to 75.8% after 4h. Remarkably, the pollutants removal efficacy of the Lac-beads was significantly maintained in real wastewater with the bead recyclability, whereas that of the corresponding free laccase was severely deteriorated. Copyright © 2016 Elsevier Ltd. All rights reserved.

Highly-efficient liposome-mediated transformation system for the basidiomycetous fungus Flammulina velutipes.

PubMed

Shi, Liang; Chen, Dongdong; Xu, Chao; Ren, Ang; Yu, Hanshou; Zhao, Mingwen

2017-07-11

Flammulina velutipes is a well-known edible mushroom cultivated all over the world. However, because of the low transformation frequency, the expensive instruments required, and the complicated, time-consuming procedures necessary, there is insufficient genetic research on F. velutipes. In this study, we report a liposome-mediated transformation (LMT) system for the genetic transformation of F. velutipes. Using the LMT system, we obtained 82 ± 4 stable F. velutipes transformants per 10 5 protoplasts, which is a clear increase in transformation frequency compared to the other methods used. We were able to detect the expression of an EGFP reporter gene in the F. velutipes transformants using fluorescence imaging assays. Furthermore, we used this method to transfer the laccase gene into F. velutipes and found that the transcriptional level and enzymatic activity increased in these transformants. Mitotic stability analysis showed that all of the selected transformants remained mitotically stable, even after five successive rounds of sub-culturing. These results demonstrate a new transgenic approach that will facilitate F. velutipes research.

Constitutive expression of Botrytis aclada laccase in Pichia pastoris

PubMed Central

Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland

2012-01-01

The heterologous expression of laccases is important for their large-scale production and genetic engineering—a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL-1) and the AOX1 system (495 mgL-1) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg-1 GAP, 14.2 Umg-1 AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842

Biocatalytic degradation of pharmaceuticals, personal care products, industrial chemicals, steroid hormones and pesticides in a membrane distillation-enzymatic bioreactor.

PubMed

Asif, Muhammad B; Hai, Faisal I; Kang, Jinguo; van de Merwe, Jason P; Leusch, Frederic D L; Price, William E; Nghiem, Long D

2018-01-01

Laccase-catalyzed degradation of a broad spectrum of trace organic contaminants (TrOCs) by a membrane distillation (MD)-enzymatic membrane bioreactor (EMBR) was investigated. The MD component effectively retained TrOCs (94-99%) in the EMBR, facilitating their continuous biocatalytic degradation. Notably, the extent of TrOC degradation was strongly influenced by their molecular properties. A significant degradation (above 90%) of TrOCs containing strong electron donating functional groups (e.g., hydroxyl and amine groups) was achieved, while a moderate removal was observed for TrOCs containing electron withdrawing functional groups (e.g., amide and halogen groups). Separate addition of two redox-mediators, namely syringaldehyde and violuric acid, further improved TrOC degradation by laccase. However, a mixture of both showed a reduced performance for a few pharmaceuticals such as primidone, carbamazepine and ibuprofen. Mediator addition increased the toxicity of the media in the enzymatic bioreactor, but the membrane permeate (i.e., final effluent) was non-toxic, suggesting an added advantage of coupling MD with EMBR. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of natural cellulase inhibitor mediated intensified biological pretreatment technology using Pleurotus florida for maximum recovery of cellulose from paddy straw under solid state condition.

PubMed

Naresh Kumar, Manickam; Ravikumar, Rajarathinam; Thenmozhi, Senniyappan; Kirupa Sankar, Muthuvelu

2017-11-01

Inhibitor mediated intensified bio-pretreatment (IMBP) technology using natural cellulase inhibitor (NCI) for maximum cellulose recovery from paddy straw was studied. Pretreatment was carried out under solid state condition. Supplementation of 8% NCI in pretreatment medium improves cellulose recovery and delignification by 1.2 and 1.5-fold respectively, compared to conventional bio-pretreatment due to inhibition of 61% of cellulase activity in IMBP. Further increase in NCI concentration showed negative effect on Pleurotus florida growth and suppress the laccase productivity by 1.1-fold. Laccase activity in IMBP was found to be 2.0U/mL on 19 th day, which is higher than (1.5U/mL) conventional bio-pretreatment. Physico-chemical modifications in paddy straw before and after pretreatment were analysed by SEM, ATR-FTIR, XRD and TGA. According to these findings, the IMBP technology can be a viable eco-friendly technology for sustainable production of bioethanol with maximum cellulose recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

An improved TCF sequence for biobleaching kenaf pulp: influence of the hexenuronic acid content and the use of xylanase.

PubMed

Andreu, Glòria; Vidal, Teresa

2014-01-01

Enzymatic delignification with laccase from Trametes villosa used in combination with chemical mediators (acetosyringone, acetovanillone and 1-hydroxybenzotriazole) to improve the totally chlorine-free (TCF) bleaching of kenaf pulp was studied. The best final pulp properties were obtained by using an LHBTQPo sequence developed by incorporating a laccase-mediator stage into an industrial bleaching sequence involving chelation and peroxide stages. The new sequence resulted in increased kenaf pulp delignification (90.4%) and brightness (77.2%ISO) relative to a conventional TCF chemical sequence (74.5% delignification and 74.5% brightness). Also, the sequence provided bleached kenaf fibers with high cellulose content (pulp viscosity of 890 g·mL(-1) vs 660 g·mL(-1)). Scanning electron micrographs revealed that xylanase altered fiber surfaces and facilitated reagent access as a result. However, the LHBTX (xylanase) stage removed 21% of hexenuronic acids in kenaf pulp. These recalcitrant compounds spent additional bleaching reagents and affected pulp properties after peroxide stage. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Decolorization of dyestuff and dying waste water by laccase solution with self-flocculent mycelial pellets of Coriolus versicolor].

PubMed

Wu, Mianbin; Xia, Liming

2002-06-01

Both laccase production by the white-rot fungus Coriolus versicolor and decolorization of dyestuff and dying waste water with crude solution of laccase were studied in this work. Laccase production meets the definition of secondary metabolism. For laccase production the optimum initial pH is 4.5. Addition of veratryl alcohol or elevated trace metals could both enhance the laccase activity, while Tween80 showed some inhibition. The immobilized mycelia of C. versicolor in polyurethane foam had less laccase production ability than mycelial pellets. A repeated batch cultivation process was found to be a very economical way for laccase harvest. The same pellets could be used for at least 14 times and average laccase activity of each batch could maintain 6.72 IU/mL. This method reduces the enzyme production course, medium consumption and the possibility of contamination, showing high efficient and great economic benefit. Good results were also obtained in decolorization experiments with the crude solution of laccase. With 3.3 IU/mL initial laccase activity, color removal of Acid Orange reached 98.5% after 24 h reaction. Also with 2.6 IU/mL initial laccase activity, color removal of dying waste water reached 93% after 24 h reaction.

Refolding of laccase from Trametes versicolor using aqueous two phase systems: Effect of different additives.

PubMed

Sánchez-Trasviña, Calef; Mayolo-Deloisa, Karla; González-Valdez, José; Rito-Palomares, Marco

2017-07-21

Protein refolding is a strategy used to obtain active forms of proteins from inclusion bodies. On its part, laccase is an enzyme with potential for different biotechnological applications but there are few reports regarding its refolding which in many cases is considered inefficient due to the poor obtained refolding yields. Aqueous Two-Phase Systems (ATPS) have been used for the refolding of proteins getting acceptable recovery percentages since PEG presents capacity to avoid protein aggregation. In this work, 48 PEG-phosphate ATPS were analyzed to study the impact of different parameters (i.e. tie line length (TLL), volume ratio (V R ) and PEG molecular weight) upon the recovery and refolding of laccase. Additionally, since laccase is a metalloprotein, the use of additives (individually and in mixture) was studied with the aim of favoring refolding. Results showed that laccase presents a high affinity for the PEG-rich phase obtaining recovery values of up to 90%. Such affinity increases with increasing TLL and decreases when PEG molecular weight and V R increase. In denatured state, this PEG-rich phase affinity decreases drastically. However, the use of additives such as l-cysteine, glutathione oxidized, cysteamine and Cu +2 was critical in improving refolding yield values up to 100%. The best conditions for the refolding of laccase were obtained using the PEG 400gmol -1 , TLL 45% w/w, V R 3 ATPS and a mixture of 2.5mM cysteamine with 1mM Cu +2 . To our knowledge, this is the first time that the use of additives and the behavior of the mixture of such additives to enhance refolding performance in ATPS is reported. Copyright © 2017 Elsevier B.V. All rights reserved.

Laccase catalyzed elimination of morphine from aqueous systems.

PubMed

Huber, Daniela; Bleymaier, Klaus; Pellis, Alessandro; Vielnascher, Robert; Daxbacher, Andreas; Greimel, Katrin J; Guebitz, Georg M

2018-05-25

Pharmaceuticals contaminate the environment for several reasons, including metabolic excretion after intake, industrial waste and improper disposal. The narcotic drug morphine is commonly utilized for chronic pain management, and the distribution of morphine in aqueous systems and in waste waters is of high concern. Here, the removal of morphine by a laccase from Myceliophthora thermophila both in its free form as well as immobilized on Accurel MP1000 beads was investigated. Complete morphine elimination was achieved within 30 min for the free and the immobilized enzyme (70% bound protein) for concentrations between 1 and 1,000 mg L -1 according to LC-TOF mass spectrometry analysis. Higher morphine concentrations up to 60 g L -1 were also tested and total elimination was achieved within 6 h. Therefore, laccases are ideal candidates for removing morphine from aqueous systems. Copyright © 2018 Elsevier B.V. All rights reserved.

Antioxidant capacity of phenolic compounds on human cell lines as affected by grape-tyrosinase and Botrytis-laccase oxidation.

PubMed

Riebel, Matthias; Sabel, Andrea; Claus, Harald; Xia, Ning; Li, Huige; König, Helmut; Decker, Heinz; Fronk, Petra

2017-08-15

Phenolic components (PCs) are well-known for their positive impact on human health. In addition to their action as radical scavengers, they act as activators for the intrinsic cellular antioxidant system. Polyphenol oxidases (PPOs) such as tyrosinase and laccase catalyze the enzymatic oxidation of PCs and thus, can alter their scavenging and antioxidative capacity. In this study, oxidation by tryosinase was shown to increase the antioxidant capacity of many PCs, especially those that lack adjacent aromatic hydroxyl groups. In contrast, oxidation by laccase tended to decrease the antioxidant capacity of red wine and distinct PCs. This was clearly demonstrated for p-coumaric acid and resveratrol, which is associated with many health benefits. While oxidation by tyrosinase increased their antioxidant activity laccase treatment resulted in a decreased activity and also of that for red wines. Copyright © 2017 Elsevier Ltd. All rights reserved.

Oxidative polymerization of lignins by laccase in water-acetone mixture.

PubMed

Fiţigău, Ionița Firuța; Peter, Francisc; Boeriu, Carmen Gabriela

2013-01-01

The enzymatic oxidative polymerization of five technical lignins with different molecular properties, i.e. Soda Grass/Wheat straw Lignin, Organosolv Hardwood Lignin, Soda Wheat straw Lignin, Alkali pretreated Wheat straw Lignin, and Kraft Softwood was studied. All lignins were previously fractionated by acetone/water 50:50 (v/v) and the laccase-catalyzed polymerization of the low molecular weight fractions (Mw < 4000 g/mol) was carried out in the same solvent system. Reactivity of lignin substrates in laccase-catalyzed reactions was determined by monitoring the oxygen consumption. The oxidation reactions in 50% acetone in water mixture proceed with high rate for all tested lignins. Polymerization products were analyzed by size exclusion chromatography, FT-IR, and (31)P-NMR and evidence of important lignin modifications after incubation with laccase. Lignin polymers with higher molecular weight (Mw up to 17500 g/mol) were obtained. The obtained polymers have potential for applications in bioplastics, adhesives and as polymeric dispersants.

Gel-Based Purification and Biochemical Study of Laccase Isozymes from Ganoderma sp. and Its Role in Enhanced Cotton Callogenesis

PubMed Central

Kumar, Amit; Singh, Deepti; Sharma, Krishna K.; Arora, Sakshi; Singh, Amarjeet K.; Gill, Sarvajeet S.; Singhal, Barkha

2017-01-01

Basidiomycetous fungi, Ganoderma lucidum MDU-7 and Ganoderma sp. kk-02 secreted multiple laccase isozymes under diverse growth condition. Aromatic compounds and metal salts were also found to regulate the differential expression of laccase isozymes from both the Ganoderma sp. Laccase isozymes induced in the presence of copper from G. lucidum MDU-7 were purified by gel-based (native-PAGE) purification method. The purity of laccase isozymes was checked by zymogram and SDS-PAGE. The SDS-PAGE of purified proteins confirmed the multimeric nature of laccase isozymes. The molecular mass of isozymes was found to be in the range of 40–66 kDa. Further, the purified laccase isozymes and their peptides were confirmed with the help of MALDI-TOF peptide fingerprinting. The biochemical characterization of laccase isozymes viz. Glac L2, Glac L3, Glac L4, and Glac L5 have shown the optimum temperature in the range of 30°–45°C and pH 3.0. The Km values of all the laccase isozymes determined for guaiacol were (96–281 μM), ABTS (15–83 μM) and O-tolidine (78–724 μM). Further, laccase isozymes from G. lucidum whole genome were studied using bioinformatics tools. The molecular modeling and docking of laccase isozymes with different substrates showed a significant binding affinity, which further validates our experimental results. Interestingly, copper induced laccase of 40 U/ml in culture medium was found to significantly induce cotton callogenesis. Interestingly, all the laccase isozymes were found to have an antioxidative role and therefore capable in free radicals scavenging during callogenesis. This is the first detailed study on the biochemical characterization of all the laccase isozymes purified by a gel-based novel method. PMID:28473815

Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

PubMed Central

Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo

2013-01-01

The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

Laccase of Cyathus bulleri: structural, catalytic characterization and expression in Escherichia coli.

PubMed

Salony; Garg, N; Baranwal, R; Chhabra, M; Mishra, S; Chaudhuri, T K; Bisaria, V S

2008-02-01

Cyathus bulleri, a ligninolytic fungus, produces a single laccase the internal peptides (3) of which bear similarity to laccases of several white rot fungi. Comparison of the total amino acid composition of this laccase with several fungal laccases indicated dissimilarity in the proportion of some basic and hydrophobic amino acids. Analysis of the circular dichroism spectrum of the protein indicated 37% alpha-helical, 26% beta-sheet and 38% random coil content which differed significantly from that in the solved structures of other laccases, which contain higher beta-sheet structures. The critical role of the carboxylic group containing amino acids was demonstrated by determining the kinetic parameters at different pH and this was confirmed by the observation that a critical Asp is strongly conserved in both Ascomycete and Basidiomycete laccases. The enzyme was denatured in the presence of a number of denaturing agents and refolded back to functional state with copper. In the folding experiments under alkaline conditions, zinc could replace copper in restoring 100% of laccase activity indicating the non-essential role of copper in this laccase. The laccase was expressed in Escherichia coli by a modification of the ligation-anchored PCR approach making it the first fungal laccase to be expressed in a bacterial host. The laccase sequence was confirmed by way of analysis of a 435 bp sequence of the insert.

Production of laccase by Coriolus versicolor and its application in decolorization of dyestuffs: (I). Production of laccase by batch and repeated-batch processes.

PubMed

Lin, Jian-Ping; Wei, Lian; Xia, Li-Ming; Cen, Pei-Lin

2003-01-01

The production of laccase by Coriolus versicolor was studied. The effect of cultivation conditions on laccase production by Coriolus versicolor was examined to obtain optimal medium and cultivation conditions. Both batch and repeated-batch processes were performed for laccase production. In repeated-batch fermentation with self-immobilized mycelia, total of 14 cycles were performed with laccase activity in the range between 3.4 and 14.8 U/ml.

Enhanced laccase production by Trametes versicolor using corn steep liquor as both nitrogen source and inducer.

PubMed

Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2014-08-01

A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. Copyright © 2014 Elsevier Ltd. All rights reserved.

Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

PubMed

Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

2015-12-01

The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

Characterization and immobilization of Trametes versicolor laccase on magnetic chitosan-clay composite beads for phenol removal.

PubMed

Aydemir, Tülin; Güler, Semra

2015-01-01

Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h.

Effect of different compounds on the induction of laccase production by Agaricus blazei.

PubMed

Valle, J S; Vandenberghe, L P S; Oliveira, A C C; Tavares, M F; Linde, G A; Colauto, N B; Soccol, C R

2015-12-03

Laccases are polyphenol oxidases produced by many fungi and have many applications in textile, food and beverage, and pulp and paper industries. Laccase production can be induced using aromatic or phenolic compounds that mostly affect the transcription of laccase-encoding genes. In this study, we analyzed laccase and biomass production by Agaricus blazei in the presence of different concentrations of nitrogen, copper, and inducers such as pyrogallol, veratryl alcohol, xylidine, vanillin, guaiacol, and ethanol. Laccase production by A. blazei U2-4 reached 43.8 U/mL in the presence of 2.8 g/L nitrogen and 150 μM copper. However, addition of copper to the cultivation medium decreased biomass production. Different compounds differentially induced laccase production by A. blazei. Moreover, different concentrations of these inducers exerted different effects on laccase activity. Ethanol (1.0 mM), guaiacol (0.5 mM), and vanillin (0.5 mM) were the best inducers and increased laccase activity by 120% (A. blazei U2-2), 30% (A. blazei U2-3), and 9% (A. blazei U2-4), respectively. In contrast, pyrogallol and xylidine decreased laccase activity but increased biomass production.

Synthesis of novel laccase-biotitania biocatalysts for malachite green decolorization.

PubMed

Zhang, Xinying; Wang, Meiyin; Lin, Linlin; Xiao, Gao; Tang, Zhenping; Zhu, Xuefeng

2018-07-01

Biomimetic mineralization has emerged as a novel tool for generating excellent supports for enzyme stabilization. In this work, protamine was used to induce titanium (IV) bis(ammonium lactato) dihydroxide (Ti-BALDH) into titania nanoparticles. This biomimetic titanification process was adopted for laccase immobilization. Laccase-biotitania biocatalyst was prepared and the effect of different parameters (buffer solution, titania precursor concentration, protamine concentration, and enzyme loading) on the encapsulation efficiency and recovery of laccase were evaluated. Compared with free laccase, the thermal and pH stability of immobilized laccase were improved significantly. In addition, laccase loaded on titania was effective at enhancing its storage stability. After seven consecutive cycles, the immobilized laccase still retained 51% of its original activity. Finally, laccase-biotitania biocatalysts showed good performance on decolorization of malachite green (MG), which can be attributed to an adsorption and degradation effect. The intermediates of the MG degradation were identified by gas chromatography-mass spectrometry (GC-MS) analysis, and the most probable degradation pathway was proposed. This study provides deeper understanding of the laccase-biotitania particles as a fast biocatalyst for MG decolorization. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Using Biotechnology in the Laboratory: Using an Immobilized-Laccase Reactor-System to Learn about Wastewater Treatment

ERIC Educational Resources Information Center

Genc, Rukan; Rodriguez-Couto, Susana

2009-01-01

This article includes a practical guide, which was used to teach the phenomenon of immobilization of enzymes and their subsequent use for discoloration of dyes to under-graduate students of Biotechnology at the Rovira i Virgili University (Tarragona, Spain). Alginate was selected as a support for the immobilization of laccase. Remazol Brilliant…

Laccase isoenzymes of Pleurotus eryngii: characterization, catalytic properties, and participation in activation of molecular oxygen and Mn2+ oxidation.

PubMed Central

Muñoz, C; Guillén, F; Martínez, A T; Martínez, M J

1997-01-01

Two laccase isoenzymes produced by Pleurotus eryngii were purified to electrophoretic homogeneity (42- and 43-fold) with an overall yield of 56.3%. Laccases I and II from this fungus are monomeric glycoproteins with 7 and 1% carbohydrate content, molecular masses (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 65 and 61 kDa, and pIs of 4.1 and 4.2, respectively. The highest rate of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) oxidation for laccase I was reached at 65 degrees C and pH 4, and that for laccase II was reached at 55 degrees C and pH 3.5. Both isoenzymes are stable at high pH, retaining 60 to 70% activity after 24 h from pH 8 to 12. Their amino acid compositions and N-terminal sequences were determined, the latter strongly differing from those of laccases of other basidiomycetes. Antibodies against laccase I reacted with laccase II, as well as with laccases from Pleurotus ostreatus, Pleurotus pulmonarius, and Pleurotus floridanus. Different hydroxy- and methoxy-substituted phenols and aromatic amines were oxidized by the two laccase isoenzymes from P. eryngii, and the influence of the nature, number, and disposition of aromatic-ring substituents on kinetic constants is discussed. Although both isoenzymes presented similar substrate affinities, the maximum rates of reactions catalyzed by laccase I were higher than those of laccase II. In reactions with hydroquinones, semiquinones produced by laccase isoenzymes were in part converted into quinones via autoxidation. The superoxide anion radical produced in the latter reaction dismutated, producing hydrogen peroxide. In the presence of manganous ion, the superoxide union was reduced to hydrogen peroxide with the concomitant production of manganic ion. These results confirmed that laccase in the presence of hydroquinones can participate in the production of both reduced oxygen species and manganic ions. PMID:9172335

Dibenzyl sulfide metabolism by white rot fungi.

PubMed

Van Hamme, Jonathan D; Wong, Eddie T; Dettman, Heather; Gray, Murray R; Pickard, Michael A

2003-02-01

Microbial metabolism of organosulfur compounds is of interest in the petroleum industry for in-field viscosity reduction and desulfurization. Here, dibenzyl sulfide (DBS) metabolism in white rot fungi was studied. Trametes trogii UAMH 8156, Trametes hirsuta UAMH 8165, Phanerochaete chrysosporium ATCC 24725, Trametes versicolor IFO 30340 (formerly Coriolus sp.), and Tyromyces palustris IFO 30339 all oxidized DBS to dibenzyl sulfoxide prior to oxidation to dibenzyl sulfone. The cytochrome P-450 inhibitor 1-aminobenzotriazole eliminated dibenzyl sulfoxide oxidation. Laccase activity (0.15 U/ml) was detected in the Trametes cultures, and concentrated culture supernatant and pure laccase catalyzed DBS oxidation to dibenzyl sulfoxide more efficiently in the presence of 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) than in its absence. These data suggest that the first oxidation step is catalyzed by extracellular enzymes but that subsequent metabolism is cytochrome P-450 mediated.

Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology.

PubMed

D'Souza-Ticlo, Donna; Garg, Sandeep; Raghukumar, Chandralata

2009-11-25

The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159. Inducible laccases were produced in the idiophase only after addition of an inducer such as CuSO(4). Concentration of carbon and nitrogen acted antagonistically with respect to laccase production. A combination of low nitrogen and high carbon concentration favored both biomass and laccase production. The most favorable combination resulted in 917 U L(-1) of laccase. After sufficient growth had occurred, addition of a surfactant such as Tween 80 positively impacted biomass and increased the laccase activity to around 1,300 U L(-1). Increasing the surface to volume ratio of the culture vessel further increased its activity to almost 2,000 U L(-1).

Role of laccase from Coriolus versicolor MTCC-138 in selective oxidation of aromatic methyl group.

PubMed

Chaurasia, Pankaj Kumar; Singh, Sunil Kumar; Bharati, Shashi Lata

2014-01-01

Now a day, laccases are the most promising enzymes in the area of biotechnology and synthesis. One of the best applications of laccases is the selective oxidation of aromatic methyl group to aldehyde group. Such transformations are valuable because it is difficult to stop the reaction at aldehyde stage. Chemical methods used for such biotransformations areexpensive and give poor yields. But, the laccase-catalyzed biotransformations of such type are non-expensive and yield is excellent. Authors have used crude laccase obtained from the liquid culture growth medium of fungal strain Coriolus versicolor MTCC-138 for the biotransformations of toluene, 3-nitrotoluene, and 4-chlorotoluene to benzaldehyde, 3-nitrobenzaldehyde, and 4-chlorobenzaldehyde, respectively, instead of purified laccase because purification process requires much time and cost. This communication reports that crude laccase can also be used in the place of purified laccase as effective biocatalyst.

A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation

PubMed Central

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

2013-01-01

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

Continuous adsorption and biotransformation of micropollutants by granular activated carbon-bound laccase in a packed-bed enzyme reactor.

PubMed

Nguyen, Luong N; Hai, Faisal I; Dosseto, Anthony; Richardson, Christopher; Price, William E; Nghiem, Long D

2016-06-01

Laccase was immobilized on granular activated carbon (GAC) and the resulting GAC-bound laccase was used to degrade four micropollutants in a packed-bed column. Compared to the free enzyme, the immobilized laccase showed high residual activities over a broad range of pH and temperature. The GAC-bound laccase efficiently removed four micropollutants, namely, sulfamethoxazole, carbamazepine, diclofenac and bisphenol A, commonly detected in raw wastewater and wastewater-impacted water sources. Mass balance analysis showed that these micropollutants were enzymatically degraded following adsorption onto GAC. Higher degradation efficiency of micropollutants by the immobilized compared to free laccase was possibly due to better electron transfer between laccase and substrate molecules once they have adsorbed onto the GAC surface. Results here highlight the complementary effects of adsorption and enzymatic degradation on micropollutant removal by GAC-bound laccase. Indeed laccase-immobilized GAC outperformed regular GAC during continuous operation of packed-bed columns over two months (a throughput of 12,000 bed volumes). Copyright © 2016 Elsevier Ltd. All rights reserved.

Development of a Saccharomyces cerevisiae Strain with Enhanced Resistance to Phenolic Fermentation Inhibitors in Lignocellulose Hydrolysates by Heterologous Expression of Laccase

PubMed Central

Larsson, Simona; Cassland, Pierre; Jönsson, Leif J.

2001-01-01

To improve production of fuel ethanol from renewable raw materials, laccase from the white rot fungus Trametes versicolor was expressed under control of the PGK1 promoter in Saccharomyces cerevisiae to increase its resistance to phenolic inhibitors in lignocellulose hydrolysates. It was found that the laccase activity could be enhanced twofold by simultaneous overexpression of the homologous t-SNARE Sso2p. The factors affecting the level of active laccase obtained, besides the cultivation temperature, included pH and aeration. Laccase-expressing and Sso2p-overexpressing S. cerevisiae was cultivated in the presence of coniferyl aldehyde to examine resistance to lignocellulose-derived phenolic fermentation inhibitors. The laccase-producing transformant had the ability to convert coniferyl aldehyde at a faster rate than a control transformant not expressing laccase, which enabled faster growth and ethanol formation. The laccase-producing transformant was also able to ferment a dilute acid spruce hydrolysate at a faster rate than the control transformant. A decrease in the content of low-molecular-mass aromatic compounds, accompanied by an increase in the content of high-molecular-mass compounds, was observed during fermentation with the laccase-expressing strain, illustrating that laccase was active even at the very low levels of oxygen supplied. Our results demonstrate the importance of phenolic compounds as fermentation inhibitors and the advantage of using laccase-expressing yeast strains for producing ethanol from lignocellulose. PMID:11229906

Development of a Saccharomyces cerevisiae strain with enhanced resistance to phenolic fermentation inhibitors in lignocellulose hydrolysates by heterologous expression of laccase.

PubMed

Larsson, S; Cassland, P; Jönsson, L J

2001-03-01

To improve production of fuel ethanol from renewable raw materials, laccase from the white rot fungus Trametes versicolor was expressed under control of the PGK1 promoter in Saccharomyces cerevisiae to increase its resistance to phenolic inhibitors in lignocellulose hydrolysates. It was found that the laccase activity could be enhanced twofold by simultaneous overexpression of the homologous t-SNARE Sso2p. The factors affecting the level of active laccase obtained, besides the cultivation temperature, included pH and aeration. Laccase-expressing and Sso2p-overexpressing S. cerevisiae was cultivated in the presence of coniferyl aldehyde to examine resistance to lignocellulose-derived phenolic fermentation inhibitors. The laccase-producing transformant had the ability to convert coniferyl aldehyde at a faster rate than a control transformant not expressing laccase, which enabled faster growth and ethanol formation. The laccase-producing transformant was also able to ferment a dilute acid spruce hydrolysate at a faster rate than the control transformant. A decrease in the content of low-molecular-mass aromatic compounds, accompanied by an increase in the content of high-molecular-mass compounds, was observed during fermentation with the laccase-expressing strain, illustrating that laccase was active even at the very low levels of oxygen supplied. Our results demonstrate the importance of phenolic compounds as fermentation inhibitors and the advantage of using laccase-expressing yeast strains for producing ethanol from lignocellulose.

Removal of acetaminophen in water by laccase immobilized in barium alginate.

PubMed

Ratanapongleka, Karnika; Punbut, Supot

2018-02-01

This research has focused on the optimization of immobilized laccase condition and utilization in degradation of acetaminophen contaminated in aqueous solution. Laccase from Lentinus polychrous was immobilized in barium alginate. The effects of laccase immobilization such as sodium alginate concentration, barium chloride concentration and gelation time were studied. The optimal conditions for immobilization were sodium alginate 5% (w/v), barium chloride 5% (w/v) and gelation time of 60 min. Immobilized laccase was then used for acetaminophen removal. Acetaminophen was removed quickly in the first 50 min. The degradation rate and percentage of removal increased when the enzyme concentration increased. Immobilized laccase at 0.57 U/g-alginate showed the maximum removal at 94% in 240 min. The removal efficiency decreased with increasing initial acetaminophen concentration. The K m value for immobilized laccase (98.86 µM) was lower than that of free laccase (203.56 µM), indicating that substrate affinity was probably enhanced by immobilization. The immobilized enzyme exhibited high activity and good acetaminophen removal at pH 7 and temperature of 35°C. The activation energies of free and immobilized laccase for degradation of acetaminophen were 8.08 and 17.70 kJ/mol, respectively. It was also found that laccase stability to pH and temperature increased after immobilization. Furthermore, immobilized laccase could be reused for five cycles. The capability of removal and enzyme activity were retained above 70%.

Enhanced delignification of lignocellulosic substrates by Pichia GS115 expressed recombinant laccase.

PubMed

Kumar, Vidya Pradeep; Kolte, Atul P; Dhali, Arindam; Naik, Chandrashekar; Sridhar, Manpal

2018-04-25

Utilization of energy-rich crop residues by ruminants is restricted by the presence of lignin, which is recalcitrant to digestion. Application of lignin degrading enzymes on the lignocellulosic biomass exposes the cellulose for easy digestion by ruminants. Laccases have been found to be considerably effective in improving the digestibility by way of delignification. However, laccase yields from natural hosts are not sufficient for industrial scale applications, which restricts their use. A viable option would be to express the laccase gene in compatible hosts to achieve higher production yields. A codon-optimized synthetic variant of Schizophyllum commune laccase gene was cloned into a pPIC9K vector and expressed in P. pastoris GS115 (his4) under the control of an alcohol oxidase promoter. Colonies were screened for G418 resistance and the methanol utilization phenotype was established. The transformant yielded a laccase activity of 344 U·mL -1 after 5 days of growth at 30°C (0.019 g·mL -1 wet cell weight). The laccase protein produced by the recombinant Pichia clone was detected as two bands with apparent molecular weights of 55 kDa and 70 kDa on SDS-PAGE. Activity staining on native PAGE confirmed the presence of bioactive laccase. Treatment of five common crop residues with recombinant laccase recorded a lignin loss ranging between 1.64% in sorghum stover, to 4.83% in finger millet, with an enhancement in digestibility ranging between 8.71% in maize straw to 24.61% in finger millet straw. Treatment with recombinant laccase was effective in enhancing the digestibility of lignocellulosic biomass for ruminant feeding through delignification. To date, a number of hosts have been adventured to produce laccase in large quantities, but, to our knowledge, there are no reports of the expression of laccase protein from Schizophyllum commune in Pichia pastoris, and also on the treatment of crop residues using recombinant laccase for ruminant feeding.

Secretion profiles of fungi as potential tools for metal ecotoxicity assessment: a study of enzymatic system in Trametes versicolor.

PubMed

Lebrun, Jérémie D; Demont-Caulet, Nathalie; Cheviron, Nathalie; Laval, Karine; Trinsoutrot-Gattin, Isabelle; Mougin, Christian

2011-01-01

The relationship between the expression of extracellular enzymatic system and a metal stress is scarce in fungi, hence limiting the possible use of secretion profiles as tools for metal ecotoxicity assessment. In the present study, we investigated the effect of Zn, Cu, Pb and Cd, tested alone or in equimolar cocktail, on the secretion profiles at enzymatic and protein levels in Trametesversicolor. For that purpose, extracellular hydrolases (acid phosphatase, β-glucosidase, β-galactosidase and N-acetyl-β-glucosaminidase) and ligninolytic oxidases (laccase, Mn-peroxidase) were monitored in liquid cultures. Fungal secretome was analyzed by electrophoresis and laccase secretion was characterized by western-blot and mass spectrometry analyses. Our results showed that all hydrolase activities were inhibited by the metals tested alone or in cocktail, whereas oxidase activities were specifically stimulated by Cu, Cd and metal cocktail. At protein level, metal exposure modified the electrophoretic profiles of fungal secretome and affected the diversity of secreted proteins. Two laccase isoenzymes, LacA and LacB, identified by mass spectrometry were differentially glycosylated according to the metal exposure. The amount of secreted LacA and LacB was strongly correlated with the stimulation of laccase activity by Cu, Cd and metal cocktail. These modifications of extracellular enzymatic system suggest that fungal oxidases could be used as biomarkers of metal exposure. Copyright © 2010 Elsevier Ltd. All rights reserved.

A synthetic redox biofilm made from metalloprotein-prion domain chimera nanowires

NASA Astrophysics Data System (ADS)

Altamura, Lucie; Horvath, Christophe; Rengaraj, Saravanan; Rongier, Anaëlle; Elouarzaki, Kamal; Gondran, Chantal; Maçon, Anthony L. B.; Vendrely, Charlotte; Bouchiat, Vincent; Fontecave, Marc; Mariolle, Denis; Rannou, Patrice; Le Goff, Alan; Duraffourg, Nicolas; Holzinger, Michael; Forge, Vincent

2017-02-01

Engineering bioelectronic components and set-ups that mimic natural systems is extremely challenging. Here we report the design of a protein-only redox film inspired by the architecture of bacterial electroactive biofilms. The nanowire scaffold is formed using a chimeric protein that results from the attachment of a prion domain to a rubredoxin (Rd) that acts as an electron carrier. The prion domain self-assembles into stable fibres and provides a suitable arrangement of redox metal centres in Rd to permit electron transport. This results in highly organized films, able to transport electrons over several micrometres through a network of bionanowires. We demonstrate that our bionanowires can be used as electron-transfer mediators to build a bioelectrode for the electrocatalytic oxygen reduction by laccase. This approach opens opportunities for the engineering of protein-only electron mediators (with tunable redox potentials and optimized interactions with enzymes) and applications in the field of protein-only bioelectrodes.

Construction of a laccase chimerical gene: recombinant protein characterization and gene expression via yeast surface display.

PubMed

Bleve, G; Lezzi, C; Spagnolo, S; Rampino, P; Perrotta, C; Mita, G; Grieco, Francesco

2014-03-01

The ERY4 laccase gene from Pleurotus eryngii was expressed in Saccharomyces cerevisiae and the recombinant laccase resulted to be not biologically active. This gene was thus modified to obtain chimerical enzymes derived from the substitution of N-, C- and both N- and C-terminal regions with the corresponding regions of Ery3 laccase, another laccase isoform of P. eryngii. The chimerical isoform named 4NC3, derived from the substitution of both N- and C-terminal regions, showed the best performances in terms of enzymatic activities, affinities for different substrates and stability at a broad range of temperatures and pHs. The chimerical 4NC3 laccase isoform was displayed on the cell surface of S. cerevisiae using the N-terminal fusion with either the Pir2 or the Flo1 S. cerevisiae proteins as anchor attachment sequence. Immunofluorescence microscopy and Western blot analyses confirmed the localization of 4NC3 on the yeast cell surface. The enzyme activity on specific laccase substrates revealed that 4NC3 laccase was immobilized in active form on the cell surface. To our knowledge, this is the first example of expression of a chimerical fungal laccase by yeast cell display.

[Enhancement of laccase activity by combining white rot fungal strains].

PubMed

He, Rong-yu; Liu, Xiao-feng; Yan, Zhi-ying; Yuan, Yue-xiang; Liao, Yin-zhang; Li, Xu-dong

2010-02-01

The method of combining white rot fungal strains was used to enhance laccase activity, and the interaction mechanism between strains was also studied. The laccase activity of combined fungi of strain 55 (Trametes trogii) and strain m-6 (Trametes versicolor) were 24.13 and 4.07-fold higher than that of strain 55 and strain m-6, respectively. No inhibitory effect was observed when the two strains were co-cultivated. On plate cultivation, there was hyphal interference in the contact area, where laccase activity was the highest followed by brown pigmentation. In liquid cultivation, strain m-6 played much more important role on enhancement of laccase activity, and the laccase activity of strain 55 by adding strain m-6 was 7.03-fold higher than that of strain m-6 by adding strain 55, furthermore, filter sterilized- and high temperature autoclaved-extracellular substances of strain m-6 could also stimulate strain 55 to excrete more laccase, which led to 6.79-fold and 4. 60-fold increase in laccase activity by adding 20 mL, respectively. The native staining results of Native-PAGE showed that the types of laccase isozymes were not changed when strains were co-cultured, but the concentration of three types increased.

Controlling the simultaneous production of laccase and lignin peroxidase from Streptomyces cinnamomensis by medium formulation

PubMed Central

2012-01-01

Background Use of crude ligninase of bacterial origin is one of the most promising ways to improve the practical biodegradation of lignocellulosic biomass. However, lignin is composed of diverse monolignols with different abundance levels in different plant biomass and requires different proportions of ligninase to realize efficient degradation. To improve activity and reduce cost, the simultaneous submerged fermentation of laccase and lignin peroxidase (LiP) from a new bacterial strain, Streptomyces cinnamomensis, was studied by adopting formulation design, principal component analysis, regression analysis and unconstrained mathematical programming. Results The activities of laccase and LiP from S. cinnamomensis cultured with the optimal medium formulations were improved to be five to eight folders of their initial activities, and the measured laccase:LiP activity ratios reached 0.1, 0.4 and 1.7 when cultured on medium with formulations designed to produce laccase:LiP complexes with theoretical laccase:LiP activity ratios of 0.05 to 0.1, 0.5 to 1 and 1.1 to 2. Conclusion Both the laccase and LiP activities and also the activity ratio of laccase to LiP could be controlled by the medium formulation as designed. Using a crude laccase-LiP complex with a specially designed laccase:LiP activity ratio has the potential to improve the degradation of various plant lignins composed of diverse monolignols with different abundance levels. PMID:22429569

Degradation of cytokinins by maize cytokinin dehydrogenase is mediated by free radicals generated by enzymatic oxidation of natural benzoxazinones.

PubMed

Frébortová, Jitka; Novák, Ondrej; Frébort, Ivo; Jorda, Radek

2010-02-01

Hydroxamic acid 2,4-dihydroxy-7-methoxy-1,4-benzoxazin-one (DIMBOA) was isolated from maize phloem sap as a compound enhancing the degradation of isopentenyl adenine by maize cytokinin dehydrogenase (CKX), after oxidative conversion by either laccase or peroxidase. Laccase and peroxidase catalyze oxidative cleavage of DIMBOA to 4-nitrosoresorcinol-1-monomethyl ether (coniferron), which serves as a weak electron acceptor of CKX. The oxidation of DIMBOA and coniferron generates transitional free radicals that are used by CKX as effective electron acceptors. The function of free radicals in the CKX-catalyzed reaction was also verified with a stable free radical of 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid. Application of exogenous cytokinin to maize seedlings resulted in an enhanced benzoxazinoid content in maize phloem sap. The results indicate a new function for DIMBOA in the metabolism of the cytokinin group of plant hormones.

Dibenzyl Sulfide Metabolism by White Rot Fungi

PubMed Central

Van Hamme, Jonathan D.; Wong, Eddie T.; Dettman, Heather; Gray, Murray R.; Pickard, Michael A.

2003-01-01

Microbial metabolism of organosulfur compounds is of interest in the petroleum industry for in-field viscosity reduction and desulfurization. Here, dibenzyl sulfide (DBS) metabolism in white rot fungi was studied. Trametes trogii UAMH 8156, Trametes hirsuta UAMH 8165, Phanerochaete chrysosporium ATCC 24725, Trametes versicolor IFO 30340 (formerly Coriolus sp.), and Tyromyces palustris IFO 30339 all oxidized DBS to dibenzyl sulfoxide prior to oxidation to dibenzyl sulfone. The cytochrome P-450 inhibitor 1-aminobenzotriazole eliminated dibenzyl sulfoxide oxidation. Laccase activity (0.15 U/ml) was detected in the Trametes cultures, and concentrated culture supernatant and pure laccase catalyzed DBS oxidation to dibenzyl sulfoxide more efficiently in the presence of 2,2′-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) than in its absence. These data suggest that the first oxidation step is catalyzed by extracellular enzymes but that subsequent metabolism is cytochrome P-450 mediated. PMID:12571066

Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.

PubMed

Wang, J W; Wu, J H; Huang, W Y; Tan, R X

2006-03-01

The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Blood tolerant laccase by directed evolution.

PubMed

Mate, Diana M; Gonzalez-Perez, David; Falk, Magnus; Kittl, Roman; Pita, Marcos; De Lacey, Antonio L; Ludwig, Roland; Shleev, Sergey; Alcalde, Miguel

2013-02-21

High-redox potential laccases are powerful biocatalysts with a wide range of applications in biotechnology. We have converted a thermostable laccase from a white-rot fungus into a blood tolerant laccase. Adapting the fitness of this laccase to the specific composition of human blood (above neutral pH, high chloride concentration) required several generations of directed evolution in a surrogate complex blood medium. Our evolved laccase was tested in both human plasma and blood, displaying catalytic activity while retaining a high redox potential at the T1 copper site. Mutations introduced in the second coordination sphere of the T1 site shifted the pH activity profile and drastically reduced the inhibitory effect of chloride. This proof of concept that laccases can be adapted to function in extreme conditions opens an array of opportunities for implantable nanobiodevices, chemical syntheses, and detoxification. Copyright © 2013 Elsevier Ltd. All rights reserved.

Middle-redox potential laccase from Ganoderma sp.: its application in improvement of feed for monogastric animals

PubMed Central

Sharma, Krishna Kant; Shrivastava, Bhuvnesh; Sastry, V. R. B.; Sehgal, Neeta; Kuhad, Ramesh Chander

2013-01-01

The variables influencing laccase production by white-rot fungus Ganoderma sp. rckk-02 were optimized employing response surface methodology. Malt extract (6.0% w/v), lignin (0.5% w/v) and pH (5.5) were found to be the most significant factors for enhanced laccase production by 7 fold (226.0 U/ml) as compared to unoptimized growth conditions (32.0 U/ml). The N-terminal sequence of laccase revealed its distinct amino acid profile (S- I- R- N- S- G), which suggested it as a novel enzyme. The Far-UV CD spectrum of the laccase showed single broad negative trough at around 213 nm, a typical signature of all β proteins. The laccase was found to fall in the range of middle redox potential laccases. Purified laccase at dosage of 2.5 Ug−1 body weight when supplemented with pelleted diet of rats, a significant improvement (p < 0.05) in nutrients digestibility without causing any elevation of blood stress enzymes was observed. PMID:23416696

A Laccase with HIV-1 Reverse Transcriptase Inhibitory Activity from the Broth of Mycelial Culture of the Mushroom Lentinus tigrinus

PubMed Central

Xu, LiJing; Wang, HeXiang; Ng, TziBun

2012-01-01

A 59 kDa laccase with inhibitory activity against HIV-1 reverse transcriptase (IC50 = 2.4 μM) was isolated from the broth of mycelial culture of the mushroom Lentinus tigrinus. The isolation procedure involved ion exchange chromatography on DEAE-cellulose and CM-cellulose, and gel filtration by fast protein liquid chromatography on Superdex 75. The laccase was adsorbed on both types of ion exchangers. About 95-fold purification was achieved with a 25.9% yield of the enzyme. The procedure resulted in a specific enzyme activity of 76.6 U/mg. Its N-terminal amino acid sequence was GIPDLHDLTV, which showed little similarity to other mushroom laccase and other Lentinus tigrinus strain laccase. Its characteristics were different from previously reported laccase of other Lentinus tigrinus strain. Maximal laccase activity was observed at a pH of 4 and at a temperature of 60°C, respectively. This study yielded the information about the potentially exploitable activities of Lentinus tigrinus laccase. PMID:22536022

Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.

PubMed

Ausec, Luka; Črnigoj, Miha; Šnajder, Marko; Ulrih, Nataša Poklar; Mandic-Mulec, Ines

2015-12-01

Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6× His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20 °C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH 5.0 and pH 9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50 °C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general.

Production of Laccase by Recombinant Yarrowia lipolytica from Molasses: Bioprocess Development Using Statistical Modeling and Increase Productivity in Shake-Flask and Bioreactor Cultures.

PubMed

Darvishi, Farshad; Moradi, Marzieh; Madzak, Catherine; Jolivalt, Claude

2017-03-01

Laccases are used in numerous applications, from green degradation of various xenobiotic compounds, waste detoxification, textile dye bleaching, and delignification of lignocellulose materials to biofuel production. In this study, the recombinant Yarrowia lipolytica YL4 strain carrying the white-rot fungus Trametes versicolor laccase IIIb gene was used for laccase production from beet molasses as an agro-industrial residue. Response surface methodology was used to statistical optimization of the production of laccase by Y. lipolytica using an industrial medium containing molasses which allows a six times increase in laccase activity compared to primary medium contains glucose after 144 h. In bioreactor cultivation after 48 h, laccase production reached to 3.7- and 22.5-fold more than optimized and primary media in shake-flask cultures, respectively. Laccase productivity in bioreactor (0.0937 U/h) was higher than shake-flask culture (0.0084 U/h). The present study provides valuable information about statistical optimization of bioprocess development for cost-effective production of laccase and other heterologous proteins in Y. lipolytica from beet molasses as sole carbon source, thus allowing the valorization and decreasing environmental pollution of this agro-industrial waste.

Media optimization for laccase production by Trichoderma harzianum ZF-2 using response surface methodology.

PubMed

Gao, Huiju; Chu, Xiang; Wang, Yanwen; Zhou, Fei; Zhao, Kai; Mu, Zhimei; Liu, Qingxin

2013-12-01

Trichoderma harzianum ZF-2 producing laccase was isolated from decaying samples from Shandong, China, and showed dye decolorization activities. The objective of this study was to optimize its culture conditions using a statistical analysis of its laccase production. The interactions between different fermentation parameters for laccase production were characterized using a Plackett-Burman design and the response surface methodology. The different media components were initially optimized using the conventional one-factor-at-a-time method and an orthogonal test design, and a Plackett-Burman experiment was then performed to evaluate the effects on laccase production. Wheat straw powder, soybean meal, and CuSO4 were all found to have a significant influence on laccase production, and the optimal concentrations of these three factors were then sequentially investigated using the response surface methodology with a central composite design. The resulting optimal medium components for laccase production were determined as follows: wheat straw powder 7.63 g/l, soybean meal 23.07 g/l, (NH4)2SO4 1 g/l, CuSO4 0.51 g/l, Tween-20 1 g/l, MgSO4 1 g/l, and KH2PO4 0.6 g/l. Using this optimized fermentation method, the yield of laccase was increased 59.68 times to 67.258 U/ml compared with the laccase production with an unoptimized medium. This is the first report on the statistical optimization of laccase production by Trichoderma harzianum ZF-2.

Flocculation and haze removal from crude beer using in-house produced laccase from Trametes versicolor cultured on brewer's spent grain.

PubMed

Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur; Verma, Mausam

2012-08-15

The potential of brewer's spent grain (BSG), a common waste from the brewing industry, as a support-substrate for laccase production by the well-known laccase producer Trametes versicolor ATCC 20869 under solid-state fermentation conditions was assessed. An attempt was made to improve the laccase production by T. versicolor through supplementing the cultures with inducers, such as 2,2-azino bis(3-ethylbenzthiazoline-6-sulfonic acid), copper sulfate, ethanol, gallic acid, veratryl alcohol, and phenol. A higher laccase activity of 13506.2 ± 138.2 IU/gds (gram dry substrate) was obtained with a phenol concentration of 10 mg/kg substrate in a tray bioreactor after 12 days of incubation time. The flocculation properties of the laccase treated crude beer samples have been studied by using various parameters, such as viscosity, turbidity, ζ potential, total polyphenols, and total protein content. The present results indicated that laccase (25 IU/L) showed promising results as a good flocculating agent. The laccase treatment showed better flocculation capacity compared to the industrial flocculation process using stabifix as a flocculant. The laccase treatments (25 IU/L) at 4 ± 1 °C and room temperature have shown almost similar flocculation properties without much variability. The study demonstrated the potential of in-house produced laccase using brewer's spent grain for the clarification and flocculation of crude beer as a sustainable alternative to traditional flocculants, such as stabifix and bentonite.

Spore cells from BPA degrading bacteria Bacillus sp. GZB displaying high laccase activity and stability for BPA degradation.

PubMed

Das, Ranjit; Li, Guiying; Mai, Bixian; An, Taicheng

2018-06-04

Laccase has been applied extensively as a biocatalyst to remove different organic pollutants. This study characterized a spore-laccase from the bisphenol A (BPA)-degrading strain Bacillus sp. GZB. The spore-laccase was encoded with 513 amino acids, containing spore coat protein A (CotA). It showed optimal activity at 70 °C and pH = 7.2 in presence of 2, 6-dimethoxyphenol. At 60 °C, optimal activity was also seen at pH = 3.0 and pH = 6.8 with 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) and syringaldazine, respectively. The spore-laccase was stable at high temperature, at acidic to alkaline pH values, and in the presence of different organic solvents. Spore-laccase activity was increased by introducing Cu 2+ , Mg 2+ , and Na + , but was strongly inhibited by Fe 2+ , Ag + , l-cysteine, dithiothreitol, and NaN 3 . The cotA gene was cloned and expressed in E. coli BL21 (DE3); the purified protein was estimated as having a molecular weight of ~63 kDa. Different synthetic dyes and BPA were effectively decolorized or degraded both by the spore laccase and recombinant laccase. When BPA oxidation was catalyzed using laccase, there was an initial formation of phenoxy radicals and further oxidation or CC bond cleavage of the radicals produced different organic acids. Detailed reaction pathways were developed based on nine identified intermediates. The acute toxicity decreased gradually during BPA degradation by laccase. This study is the first report about a genus of Bacillus that can produce a highly active and stable laccase to degrade BPA. Copyright © 2018 Elsevier B.V. All rights reserved.

Secretory expression of Lentinula edodes intracellular laccase by yeast high-cell-density system: sub-milligram production of difficult-to-express secretory protein.

PubMed

Kurose, Takeshi; Saito, Yuta; Kimata, Koichi; Nakagawa, Yuko; Yano, Akira; Ito, Keisuke; Kawarasaki, Yasuaki

2014-06-01

While a number of heterologous expression systems have been reported for extracellular laccases, there are few for the intracellular counterparts. The Lentinula edodes intracellular laccase Lcc4 is an industrially potential enzyme with its unique substrate specificity. The heterologous production of the intracellular laccase, however, had been difficult because of its expression-dependent toxicity. We previously demonstrated that recombinant yeast cells synthesized and, interestingly, secreted Lcc4 only when they were suspended to an inducing medium in a high cell-density (J. Biosci. Bioeng., 113, 154-159, 2012). The high cell-density system was versatile and applicable to other difficult-to-express secretory proteins. Nevertheless, the system's great dependence on aeration, which was a practical obstacle to scale-up production of the enzyme and some other proteins, left the secretion pathway and enzymatic properties of the Lcc4 uncharacterized. In this report, we demonstrate a successful production of Lcc4 by applying a jar-fermentor to the high cell-density system. The elevated yield (0.6 mg L(-1)) due to the sufficient aeration allowed us to prepare and purify the enzyme to homogeneity. The enzyme had been secreted as a hyper-glycosylated protein, resulting in smear band-formations in SDS-PAGE. The amino acid sequencing analysis suggested that the N-terminal 17 residues had been recognized as a secretion signal. The recombinant enzyme showed similar enzymatic properties to the naturally occurring Lcc4. The characteristics of the scale-upped expression system, which includes helpful information for the potential users, have also been described. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effect of antibiotics on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus.

PubMed

Dhawan, Shikha; Lal, Rup; Hanspal, Manjit; Kuhad, Ramesh Chander

2005-08-01

The effect of nine different antibiotics (chloramphenicol, ampicillin trihydrate, kanamycin A monosulfate, neomycin sulfate, erythromycin, thiostrepton, tetracycline, apramycin sulfate and streptomycin sulfate) on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus has been investigated. All the antibiotics tested at a concentration of 200 mg/l affected the fungal growth, release of protein and laccase production to different extent. Inhibition in fungal growth was found to be positively correlated with increase in laccase production. Interestingly, apramycin sulfate inhibited biomass production (14.9-26.2%), nevertheless, it stimulated maximum laccase production (18.2 U/ml) in both the fungi. Increasing concentrations of apramycin sulfate enhanced laccase production from P. cinnabarinus but not from C. bulleri.

Immobilization of laccase on a novel ZnO/SiO2 nano-composited support for dye decolorization

NASA Astrophysics Data System (ADS)

Li, Wei-Xun; Sun, Huai-Yan; Zhang, Rui-Feng

2015-07-01

ZnO nanowires were introduced into macroporous SiO2 by means of in situ hydrothermal growth. The obtained nano-composite was then used to immobilize laccase (secured from Trametes versicolor) through the process of static adsorption. The average loading amount was as high as 193.4 μmol-g-1. The immobilized laccase was proven to be an effective biocatalyst in the decolorization of two dyes: Remazol Brilliant Blue B, and Acid Blue 25. The decolorization percentage of Remazol Brilliant Blue B and Acid Blue 25 reached 93% and 82% respectively. The immobilized laccase exhibited enhanced thermal stability and pH adaptability compared to free laccase. After ten recycles, the immobilized laccase retained 42% decolorization catalytic activity.

Modeling of growth and laccase production by Pycnoporus sanguineus.

PubMed

Saat, Muhammad Naziz; Annuar, Mohamad Suffian Mohamad; Alias, Zazali; Chuan, Ling Tau; Chisti, Yusuf

2014-05-01

Production of extracellular laccase by the white-rot fungus Pycnoporus sanguineus was examined in batch submerged cultures in shake flasks, baffled shake flasks and a stirred tank bioreactor. The biomass growth in the various culture systems closely followed a logistic growth model. The production of laccase followed a Luedeking-Piret model. A modified Luedeking-Piret model incorporating logistic growth effectively described the consumption of glucose. Biomass productivity, enzyme productivity and substrate consumption were enhanced in baffled shake flasks relative to the cases for the conventional shake flasks. This was associated with improved oxygen transfer in the presence of the baffles. The best results were obtained in the stirred tank bioreactor. At 28 °C, pH 4.5, an agitation speed of 600 rpm and a dissolved oxygen concentration of ~25 % of air saturation, the laccase productivity in the bioreactor exceeded 19 U L(-1 )days(-1), or 1.5-fold better than the best case for the baffled shake flask. The final concentration of the enzyme was about 325 U L(-1).

Systemic RNAi in the small hive beetle Aethina tumida Murray (Coleoptera: Nitidulidae), a serious pest of the European honey bee Apis mellifera.

PubMed

Powell, Michelle E; Bradish, Hannah M; Gatehouse, John A; Fitches, Elaine C

2017-01-01

Aethina tumida is a serious pest of the European honey bee (Apis mellifera) in North America and Australia. Here we investigate whether Laccase 2, the phenoloxidase gene essential for cuticle sclerotisation and pigmentation in many insects, and vacuolar-ATPase V-type subunit A, vital for the generation of proton gradients used to drive a range of transport processes, could be potential targets for RNAi-mediated control of A. tumida. Injection of V-ATPase subunit A (5 ng) and Laccase 2 (12.5 ng) dsRNAs resulted in 100% larval mortality, and qPCR confirmed significant decreases and enhanced suppression of transcript levels over time. Oral delivery of V-ATPase subunit A dsRNA in solutions resulted in 50% mortality; however, gene suppression could not be verified. We suggest that the inconsistent RNAi effect was a consequence of dsRNA degradation within the gut owing to the presence of extracellular nucleases. Target specificity was confirmed by a lack of effect on survival or gene expression in honey bees injected with A. tumida dsRNAs. This is the first study to show evidence for systemic RNAi in A. tumida in response to injected dsRNA, but further research is required to develop methods to induce RNAi effects via ingestion. © 2016 Crown copyright. Pest Management Science © 2016 Society of Chemical Industry. © 2016 Crown copyright. Pest Management Science © 2016 Society of Chemical Industry.

Ultrarapid sonochemical synthesis of enzyme-incorporated copper nanoflowers and their application to mediatorless glucose biofuel cell

NASA Astrophysics Data System (ADS)

Chung, Minsoo; Nguyen, Tuan Loi; Tran, Thao Quynh Ngan; Yoon, Hyon Hee; Kim, Il Tae; Kim, Moon Il

2018-01-01

We have developed a mediatorless glucose biofuel cell based on hybrid nanoflowers incorporating enzymes including glucose oxidase (GOx), laccase, or catalase with copper phosphate, which were further mixed and compressed with conductive multi-walled carbon nanotube (CNT). The nanoflowers were simply synthesized within 5 min at room temperature using sonication method but yielded greatly improved stability as well as highly retained activity by the proper incorporation of enzyme molecules inside the flower-like structure. With glucose as biofuel, GOx and laccase nanoflowers were applied to form enzyme anode and cathode, respectively, and catalase nanoflowers were additionally employed to catalyze the decomposition of hydrogen peroxide, which may be deleterious for GOx, into oxygen and water. Using the enzyme nanoflowers-based biofuel cell system without any involved mediator, a high power density up to 200 μW cm-2 were obtained, which was approximately 80% to that from the biofuel cell system prepared with the corresponding free enzymes. Importantly, the enzyme nanoflowers-based biofuel cell maintained their initial power density over 90% during storage for two months at 4 °C, while most of the glucose biofuel cells in the literature present meaningful stability only in the range of one or two weeks. Based on this result, we expect that this simple but efficient strategy to prepare highly stable glucose biofuel cell using the rapidly-synthesized enzyme-inorganic hybrid nanoflowers can be readily extended to diverse applications in medical and environmental chemistry.

Rice (Oryza sativa) Laccases Involved in Modification and Detoxification of Herbicides Atrazine and Isoproturon Residues in Plants.

PubMed

Huang, Meng Tian; Lu, Yi Chen; Zhang, Shuang; Luo, Fang; Yang, Hong

2016-08-24

Atrazine (ATR) and isoproturon (IPU) as herbicides have become serious environmental contaminants due to their overuse in crop production. Although ATR and IPU in soils are easily absorbed by many crops, the mechanisms for their degradation or detoxification in plants are poorly understood. This study identified a group of novel genes encoding laccases (EC 1.10.3.2) that are possibly involved in catabolism or detoxification of ATR and IPU residues in rice. Transcriptome profiling shows at least 22 differentially expressed laccase genes in ATR/IPU-exposed rice. Some of the laccase genes were validated by RT-PCR analysis. The biochemical properties of the laccases were analyzed, and their activities in rice were induced under ATR/IPU exposure. To investigate the roles of laccases in degrading or detoxifying ATR/IPU in rice, transgenic yeast cells (Pichia pastoris X-33) expressing two rice laccase genes (LOC_Os01g63180 and LOC_Os12g15680) were generated. Both transformants were found to accumulate less ATR/IPU compared to the control. The ATR/IPU-degraded products in the transformed yeast cells using UPLC-TOF-MS/MS were further characterized. Two metabolites, hydroxy-dehydrogenated atrazine (HDHA) and 2-OH-isopropyl-IPU, catalyzed by laccases were detected in the eukaryotic cells. These results indicate that the laccase-coding genes identified here could confer degradation or detoxification of the herbicides and suggest that the laccases could be one of the important enzymatic pathways responsible for ATR/IPU degradation/detoxification in rice.

Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397).

PubMed

Dhakar, Kusum; Pandey, Anita

2013-01-01

Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03) isolated from a glacial site in Indian Himalayan Region (IHR) has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C ± 2 (25°C opt.) and pH 3-13 (5-7 opt.). Molecular weight of laccase was determined approximately 45 kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain) contained 200 bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0 mM) induced laccase production up to 2-fold, in case of 0.4 mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold) induction. The study has implications in bioprospecting of ecologically resilient microbial strains.

Differential Regulation by Organic Compounds and Heavy Metals of Multiple Laccase Genes in the Aquatic Hyphomycete Clavariopsis aquatica

PubMed Central

Solé, Magali; Müller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke

2012-01-01

To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 μM, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri.

PubMed

Dhawan, Shikha; Kuhad, Ramesh Chander

2002-08-01

Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production.

Laccase modification of the physical properties of bark and pulp of loblolly pine and spruce pulp

Treesearch

William Kenealy; John Klungness; Mandla Tshabalala; Eric Horn; Masood Akhtar; Roland Gleisner; Gisela Buschle-Diller

2004-01-01

Pine bark, pine pulp, and spruce pulp were reacted with laccase in the presence of phenolic laccase substrates to modify the fiber surface properties. The acid-base and dispersive characteristics of these modified steam-treated thermomechanical loblolly pine pulps were determined by inverse gas chromatography. Different combinations of substrates with laccase modified...

Laccases as palladium oxidases.

PubMed

Mekmouche, Yasmina; Schneider, Ludovic; Rousselot-Pailley, Pierre; Faure, Bruno; Simaan, A Jalila; Bochot, Constance; Réglier, Marius; Tron, Thierry

2015-02-01

The first example of a coupled catalytic system involving an enzyme and a palladium(ii) catalyst competent for the aerobic oxidation of alcohol in mild conditions is described. In the absence of dioxygen, the fungal laccase LAC3 is reduced by a palladium(0) species as evidenced by the UV/VIS and ESR spectra of the enzyme. During the oxidation of veratryl alcohol performed in water, at room temperature and atmospheric pressure, LAC3 regenerates the palladium catalyst, is reduced and catalyzes the four-electron reduction of dioxygen into water with no loss of enzyme activity. The association of a laccase with a water-soluble palladium complex results in a 7-fold increase in the catalytic efficiency of the complex. This is the first step in the design of a family of renewable palladium catalysts for aerobic oxidation.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.

2007-09-15

Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. Inmore » the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.« less

Enhanced phenol degradation in coking wastewater by immobilized laccase on magnetic mesoporous silica nanoparticles in a magnetically stabilized fluidized bed.

PubMed

Wang, Feng; Hu, Yiru; Guo, Chen; Huang, Wei; Liu, Chun-Zhao

2012-04-01

The immobilized laccase on magnetic mesoporous silica nanoparticles has been developed for efficient phenol degradation. The degradation rate of phenol by the immobilized laccase was 2-fold higher than that of the free laccase, and the immobilized laccase retained 71.3% of its initial degradation ability after 10 successive batch treatments of coking wastewater. The phenol degradation in the coking wastewater was enhanced in a continuous treatment process by the immobilized laccase in a magnetically stabilized fluidized bed (MSFB) because of good mixing and mass transfer. The degradation rate of phenol maintained more than 99% at a flow rate of less than 450mLh(-1) and decreased slowly to 91.5% after 40h of the continuous operation in the MSFB. The present work indicated that the immobilized laccase on magnetic mesoporous supports together with the MSFB provided a promising avenue for the continuous enzymatic degradation of phenolic compounds in industrial wastewater. Copyright © 2012 Elsevier Ltd. All rights reserved.

Comparison of the efficiency of bacterial and fungal laccases in delignification and detoxification of steam-pretreated lignocellulosic biomass for bioethanol production.

PubMed

De La Torre, María; Martín-Sampedro, Raquel; Fillat, Úrsula; Eugenio, María E; Blánquez, Alba; Hernández, Manuel; Arias, María E; Ibarra, David

2017-11-01

This study evaluates the potential of a bacterial laccase from Streptomyces ipomoeae (SilA) for delignification and detoxification of steam-exploded wheat straw, in comparison with a commercial fungal laccase from Trametes villosa. When alkali extraction followed by SilA laccase treatment was applied to the water insoluble solids fraction, a slight reduction in lignin content was detected, and after a saccharification step, an increase in both glucose and xylose production (16 and 6%, respectively) was observed. These effects were not produced with T. villosa laccase. Concerning to the fermentation process, the treatment of the steam-exploded whole slurry with both laccases produced a decrease in the phenol content by up to 35 and 71% with bacterial and fungal laccases, respectively. The phenols reduction resulted in an improved performance of Saccharomyces cerevisiae during a simultaneous saccharification and fermentation (SSF) process, improving ethanol production rate. This enhancement was more marked with a presaccharification step prior to the SSF process.

Insights into lignin degradation and its potential industrial applications.

PubMed

Abdel-Hamid, Ahmed M; Solbiati, Jose O; Cann, Isaac K O

2013-01-01

Lignocellulose is an abundant biomass that provides an alternative source for the production of renewable fuels and chemicals. The depolymerization of the carbohydrate polymers in lignocellulosic biomass is hindered by lignin, which is recalcitrant to chemical and biological degradation due to its complex chemical structure and linkage heterogeneity. The role of fungi in delignification due to the production of extracellular oxidative enzymes has been studied more extensively than that of bacteria. The two major groups of enzymes that are involved in lignin degradation are heme peroxidases and laccases. Lignin-degrading peroxidases include lignin peroxidase (LiP), manganese peroxidase (MnP), versatile peroxidase (VP), and dye-decolorizing peroxidase (DyP). LiP, MnP, and VP are class II extracellular fungal peroxidases that belong to the plant and microbial peroxidases superfamily. LiPs are strong oxidants with high-redox potential that oxidize the major non-phenolic structures of lignin. MnP is an Mn-dependent enzyme that catalyzes the oxidation of various phenolic substrates but is not capable of oxidizing the more recalcitrant non-phenolic lignin. VP enzymes combine the catalytic activities of both MnP and LiP and are able to oxidize Mn(2+) like MnP, and non-phenolic compounds like LiP. DyPs occur in both fungi and bacteria and are members of a new superfamily of heme peroxidases called DyPs. DyP enzymes oxidize high-redox potential anthraquinone dyes and were recently reported to oxidize lignin model compounds. The second major group of lignin-degrading enzymes, laccases, are found in plants, fungi, and bacteria and belong to the multicopper oxidase superfamily. They catalyze a one-electron oxidation with the concomitant four-electron reduction of molecular oxygen to water. Fungal laccases can oxidize phenolic lignin model compounds and have higher redox potential than bacterial laccases. In the presence of redox mediators, fungal laccases can oxidize non-phenolic lignin model compounds. In addition to the peroxidases and laccases, fungi produce other accessory oxidases such as aryl-alcohol oxidase and the glyoxal oxidase that generate the hydrogen peroxide required by the peroxidases. Lignin-degrading enzymes have attracted the attention for their valuable biotechnological applications especially in the pretreatment of recalcitrant lignocellulosic biomass for biofuel production. The use of lignin-degrading enzymes has been studied in various applications such as paper industry, textile industry, wastewater treatment and the degradation of herbicides. Copyright © 2013 Elsevier Inc. All rights reserved.

Continuous degradation of a mixture of sulfonamides by Trametes versicolor and identification of metabolites from sulfapyridine and sulfathiazole.

PubMed

Rodríguez-Rodríguez, Carlos E; García-Galán, M A Jesús; Blánquez, Paqui; Díaz-Cruz, M Silvia; Barceló, Damià; Caminal, Glòria; Vicent, Teresa

2012-04-30

In this study, we assessed the degradation of the sulfonamides sulfapyridine (SPY) and sulfathiazole (STZ) by the white-rot fungus Trametes versicolor. Complete degradation was accomplished in fungal cultures at initial pollutant concentrations of approximately 10 mg L(-1), although a longer period of time was needed to completely remove STZ in comparison to SPY. When cytochrome P450 inhibitors were added to the fungal cultures, STZ degradation was partially suppressed, while no additional effect was observed for SPY. Experiments with purified laccase and laccase mediators caused the removal of greater than 75% of each antibiotic. Ultra-performance liquid chromatography-quadupole time of flight mass spectrometry (UPLC-QqTOF-MS) analyses allowed the identification of a total of eight degradation intermediates of SPY in both the in vivo and the laccase experiments, being its desulfonated moiety the commonly detected product. For STZ, a total of five products were identified. A fluidized bed reactor with T. versicolor pellets degraded a mixture of sulfonamides (SPY, STZ and sulfamethazine, SMZ) by greater than 94% each at a hydraulic residence time of 72 h. Because wastewater contains many diverse pollutants, these results highlight the potential of T. versicolor as a bioremediation agent not only for the removal of antibiotics but also for the elimination of a wide range of contaminants. Copyright © 2012 Elsevier B.V. All rights reserved.

One-pot synthesis of active copper-containing carbon dots with laccase-like activities

NASA Astrophysics Data System (ADS)

Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

2015-11-01

Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04685h

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

PubMed Central

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

PubMed

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications.

Molecular dynamics simulation studies suggests unconventional roles of non-secretary laccases from enteropathogenic gut bacteria and Cryptococcus neoformans serotype D.

PubMed

Sharma, Krishna Kant; Singh, Deepti; Rawat, Surender

2018-04-01

Laccase in Cryptococcus neoformans is covalently linked to the carbohydrate moiety of the cell wall, which allows it to get access to the different substrates for catalyzing their oxidation and therefore plays a vital role in the virulence. The laccase gene (3.0 kb) from C. neoformans serotype D was amplified, cloned and sequenced for protein modeling, docking and simulation studies. The three dimensional homology models of laccase protein from C. neoformans and other pathogenic gut bacteria were docked with selected biomolecules like prostaglandins (PG), membrane phospholipids, neurotransmitters (serotonin) using GOLD software. The GOLDscore values of laccase from C. neoformans docked with prostaglandinH 2 (59.76), prostaglandinG 2 (59.45), prostaglandinE 2 (60.99), phosphatidylinositol (54.95), phosphatidylcholine (46.26), phosphatidylserine (55.26), arachidonic acid (53.08) and serotonin (46.22) were similar to the laccase from enteropathogenic bacteria but showed a better binding affinity as compared to that of the non-pathogenic bacteria (e.g. Bacillus safensis, Bacillus pumilus and Bacillus subtilis). The RMSD of MD simulation study done for 25 ns using laccase protein from C. neoformans complexed with phosphatidylcholine was found to be highly stable, followed by the laccase-PGE 2 and laccase-serotonin complexes. Furthermore, the binding free energy results were found to support the docking and MD simulation results. The present study implies that few candidate ligands can be intermediate substrate in the catalysis of microbial laccases, which can further play some crucial role in the cell signaling and pathogenesis of enteropathogenic gut micro flora and C. neoformans. Copyright © 2018 Elsevier Ltd. All rights reserved.

A novel Laccase Biosensor based on Laccase immobilized Graphene-Cellulose Microfiber Composite modified Screen-Printed Carbon Electrode for Sensitive Determination of Catechol

PubMed Central

Palanisamy, Selvakumar; Ramaraj, Sayee Kannan; Chen, Shen-Ming; Yang, Thomas C. K.; Yi-Fan, Pan; Chen, Tse-Wei; Velusamy, Vijayalakshmi; Selvam, Sonadevi

2017-01-01

In the present work, we demonstrate the fabrication of laccase biosensor to detect the catechol (CC) using laccase immobilized on graphene-cellulose microfibers (GR-CMF) composite modified screen printed carbon electrode (SPCE). The direct electrochemical behavior of laccase was investigated using laccase immobilized different modified SPCEs, such as GR/SPCE, CMF/SPCE and GR-CMF/SPCE. Compared with laccase immobilized GR and CMF modified SPCEs, a well-defined redox couple of CuI/CuII for laccase was observed at laccase immobilized GR-CMF composite modified SPCE. Cyclic voltammetry results show that the as-prepared biosensor has 7 folds higher catalytic activity with lower oxidation potential towards CC than SPCE modified with GR-CMF composite. Under optimized conditions, amperometric i-t method was used for the quantification of CC, and the amperometric response of the biosensor was linear over the concertation of CC ranging from 0.2 to 209.7 μM. The sensitivity, response time and the detection limit of the biosensor for CC is 0.932 μMμA−1 cm−2, 2 s and 0.085 μM, respectively. The biosensor has high selectivity towards CC in the presence of potentially active biomolecules and phenolic compounds. The biosensor also accessed for the detection of CC in different water samples and shows good practicality with an appropriate repea. PMID:28117357

Ethidium bromide stimulated hyper laccase production from bird's nest fungus Cyathus bulleri.

PubMed

Dhawan, S; Lal, R; Kuhad, R C

2003-01-01

Effect of ethidium bromide, a DNA intercalating agent, on laccase production from Cyathus bulleri was studied. The bird's nest fungus, Cyathus bulleri was grown on 2% (w/v) malt extract agar (MEA) supplemented with 1.5 microg ml(-1) of the phenanthridine dye ethidium bromide (EtBr) for 7 d and when grown subsequently in malt extract broth (MEB), produced a 4.2-fold increase in laccase production as compared to the untreated fungus. The fungal cultures following a single EtBr treatment, when regrown on MEA devoid of EtBr, produced a sixfold increase in laccase in MEB. However, on subsequent culturing on MEA in the absence of EtBr, only a 2.5-fold increase in laccase production could be maintained. In another attempt, the initial EtBr-treated cultures, when subjected to a second EtBr treatment (1.5 microg ml(-1)) on MEA for 7 d, produced a 1.4-fold increase in laccase production in MEB. The white-rot fungus Cyathus bulleri, when treated with EtBr at a concentration of 1.5 microg ml(-1) and regrown on MEA devoid of EtBr, produced a sixfold increase in laccase production in MEB. The variable form of C. bulleri capable of hyper laccase production can improve the economic feasibility of environmentally benign processes involving use of fungal laccases in cosmetics (including hair dyes), food and beverages, clinical diagnostics, pulp and paper industry, industrial effluent treatment, animal biotechnology and biotransformations.

Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1

PubMed Central

Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah

2002-01-01

Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346

Laccase production by the aquatic ascomycete Phoma sp. UHH 5-1-03 and the white rot basidiomycete Pleurotus ostreatus DSM 1833 during submerged cultivation on banana peels and enzyme applicability for the removal of endocrine-disrupting chemicals.

PubMed

Libardi, Nelson; Gern, Regina Maria Miranda; Furlan, Sandra Aparecida; Schlosser, Dietmar

2012-07-01

This work aimed to study the production of laccase from Pleurotus ostreatus DSM 1833 and Phoma sp. UHH 5-1-03 using banana peels as alternative carbon source, the subsequent partial purification and characterization of the enzyme, as well the applicability to degrade endocrine disruptors. The laccase stability with pH and temperature, the optimum pH, the K (m) and V(max) parameters, and the molar mass were determined. Tests were conducted for assessing the ability of degradation of the endocrine disruptors t-nonylphenol, bisphenol A, and 17α-ethinylestradiol. Laccase production of 752 and 1,117 U L⁻¹ was obtained for Phoma sp. and P. ostreatus, respectively. Phoma sp. laccase showed higher stability with temperature and pH. The laccase from both species showed higher affinity by syringaldazine. The culture broth with banana peels induced the production of two isoforms of P. ostreatus (58.7 and 21 kDa) and one of Phoma sp. laccase (72 kDa). In the first day of incubation, the concentrations of bisphenol A and 17α-ethinylestradiol were reduced to values close to zero and after 3 days the concentration of t-nonylphenol was reduced in 90% by the P. ostreatus laccase, but there was no reduction in its concentration by the Phoma sp. laccase.

Functional expression, production, and biochemical characterization of a laccase using yeast surface display technology.

PubMed

Bertrand, Brandt; Trejo-Hernández, María R; Morales-Guzmán, Daniel; Caspeta, Luis; Suárez Rodríguez, Ramón; Martínez-Morales, Fernando

2016-12-01

A Trametes versicolor laccase was functionally expressed on the membrane surface of Saccharomyces cerevisiae EBY100. Laccase expression was increased 6.57-fold by medium optimization and surpassed production by the native strain. Maximal laccase and biomass production reached 19 735 ± 1719 Ug -1 and 6.22 ± 0.53 gL -1 respectively, after 2 d of culture. Optimum oxidization of all substrates by laccase was observed at pH 3. Laccase showed high affinity towards substrates used with Km (mM) and Vmax (μmol min -1 ) values of 0.57 ± 0.0047 and 24.55 ± 0.64, 1.52 ± 0.52 and 9.25 ± 1.78, and 2.67 ± 0.12 and 11.26 ± 0.75, were reported for ABTS, 2, 6-DMP and GUA, respectively. EDTA and NaN 3 displayed none competitive inhibition towards laccase activity. The optimum temperature for activity was 50 °C; however, the enzyme was stable over a wide range of temperatures (25-70 °C). The biologically immobilized laccase showed high reusability towards phenolic substrates and low reusability with non-phenolic substrates. High affinity for a diversity phenolic compounds and great ethanol tolerance substantiates this laccase/yeast biocatalyst potential for application in the production of bioethanol. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes

PubMed Central

Zhao, J.; Kwan, H. S.

1999-01-01

The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

Biobleaching of wheat straw-rich soda pulp with alkalophilic laccase from gamma-proteobacterium JB: optimization of process parameters using response surface methodology.

PubMed

Singh, Gursharan; Ahuja, Naveen; Batish, Mona; Capalash, Neena; Sharma, Prince

2008-11-01

An alkalophilic laccase from gamma-proteobacterium JB was applied to wheat straw-rich soda pulp to check its bleaching potential by using response surface methodology based on central composite design. The design was employed by selecting laccase units, ABTS (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) concentration and pH as model factors. The results of second order factorial design experiments showed that all three independent variables had significant effect on brightness and kappa number of laccase-treated pulp. Optimum conditions for biobleaching of pulp with laccase preparation (specific activity, 65 nkat mg(-1) protein) were 20 nkat g(-1) of pulp, 2mM ABTS and pH 8.0 which enhanced brightness by 5.89% and reduced kappa number by 21.1% within 4h of incubation at 55 degrees C, without further alkaline extraction of pulp. Tear index (8%) and burst index (18%) also improved for laccase-treated pulp as compared to control raw pulp. Treatment of chemically (CEH1H2) bleached pulp with laccase showed significant effect on release of chromophores, hydrophobic and reducing compounds. Laccase-prebleaching of raw pulp reduced the use of hypochlorite by 10% to achieve brightness of resultant hand sheets similar to the fully chemically bleached pulp.

Laccase-catalyzed oxidation of iodide and formation of organically bound iodine in soils.

PubMed

Seki, Miharu; Oikawa, Jun-ichi; Taguchi, Taro; Ohnuki, Toshihiko; Muramatsu, Yasuyuki; Sakamoto, Kazunori; Amachi, Seigo

2013-01-02

Laccase oxidizes iodide to molecular iodine or hypoiodous acid, both of which are easily incorporated into natural soil organic matter. In this study, iodide sorption and laccase activity in 2 types of Japanese soil were determined under various experimental conditions to evaluate possible involvement of this enzyme in the sorption of iodide. Batch sorption experiment using radioactive iodide tracer ((125)I(-)) revealed that the sorption was significantly inhibited by autoclaving (121 °C, 40 min), heat treatment (80 and 100 °C, 10 min), γ-irradiation (30 kGy), N(2) gas flushing, and addition of reducing agents and general laccase inhibitors (KCN and NaN(3)). Interestingly, very similar tendency of inhibition was observed in soil laccase activity, which was determined using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a substrate. The partition coefficient (K(d): mL g(-1)) for iodide and specific activity of laccase in soils (Unit g(-1)) showed significant positive correlation in both soil samples. Addition of a bacterial laccase with an iodide-oxidizing activity to the soils strongly enhanced the sorption of iodide. Furthermore, the enzyme addition partially restored iodide sorption capacity of the autoclaved soil samples. These results suggest that microbial laccase is involved in iodide sorption on soils through the oxidation of iodide.

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composite for laccase immobilization

PubMed Central

Huang, Jun; Liu, Cheng; Xiao, Haiyan; Wang, Juntao; Jiang, Desheng; GU, Erdan

2007-01-01

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composites were prepared by organic-inorganic complex technology and characterized. It has been proved that the ZnTAPc dispersed randomly onto the surface of Fe3O4 nanoparticles to form molecular dispersion layer and there was a relatively strong bond between central zinc cation and oxygen. The nanoparticle composite took the shape of roundish spheres with the mean diameter of about 15 nm. Active amino groups of magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH for the activity of the immobilized laccases and free laccase were the same at pH 3.0 and the optimal temperature for laccase immobilization on ZnTAPc-Fe3O4 nanoparticle composite was 45°. The immobilization yields and Km value of the laccase immobilized on ZnTAPc-Fe3O4 nanoparticle composite were 25% and 20.1 μM, respectively. This kind of immobilized laccase has good thermal, storage and operation stability, and could be used as the sensing biocomponent for the fiber optic biosensor based on enzyme catalysis. PMID:18203444

Influence of nutrients on enhancing laccase production by Botryosphaeria rhodina MAMB-05.

PubMed

Dekker, Robert F H; Barbosa, Aneli M; Giese, Ellen C; Godoy, Saulo D S; Covizzi, Luiz G

2007-09-01

The physiological requirements needed to enhance the production of laccases by the ascomycete Botryosphaeria rhodina MAMB-05 in submerged cultivation were examined under non-induced and induced (veratryl alcohol, VA) conditions. Under non-induced conditions (-VA), the initial pH, C:N ratio, and inorganic N source did not influence laccase production, in contrast to Tween 80, soybean oil, and copper, which significantly increased laccase production, and proline and urea, which suppressed laccase formation. In addition, Tween 60 could serve as the sole carbon source for the production of these enzymes. Under VA-induced conditions of fungal growth, factors such as inoculum type, time-point of addition of inducer, initial pH, C:N ratio, and type of N source, influenced the production of laccases; however, unlike the non-induced conditions, proline and urea did not act as suppressors. Each of these physiological conditions exerted different effects on biomass production. The nutritional conditions examined for B. rhodina MAMB-05 are discussed in relation to their influence on fungal growth and laccase production.

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

Laccase-conjugated amino-functionalized nanosilica for efficient degradation of Reactive Violet 1 dye

NASA Astrophysics Data System (ADS)

Gahlout, Mayur; Rudakiya, Darshan M.; Gupte, Shilpa; Gupte, Akshaya

2017-08-01

Immobilization of enzyme with nanostructures enhances its ideal characteristics, which may allow the enzyme to become more stable and resistant. The present investigation deals with the formulation of laccase nanosilica conjugates to overcome the problems associated with its stability and reusability. Synthesized nanosilica and laccase nanoparticles were spherical shaped, with the mean size of 220 and 615 nm, respectively. Laccase nanoparticles had an optimum temperature of 55 °C and pH 4.0 for the oxidation of ABTS. Laccase nanoparticle retained 79% of residual activity till 20th cycle. It also showed 91% of its initial activity at lower temperatures even after 60 days. Laccase nanoparticles were applied for Reactive Violet 1 degradation wherein 96.76% of decolourization was obtained at pH 5.0 and 30 °C within 12 h. Toxicity studies on microbes and plants suggested that the degraded metabolites were less toxic than control dye. Thus, the method applied for immobilization increased storage stability and reusability of laccase, and therefore, it can be utilized for efficient degradation of azo dyes.

Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta

PubMed Central

Abadulla, Elias; Tzanov, Tzanko; Costa, Silgia; Robra, Karl-Heinz; Cavaco-Paulo, Artur; Gübitz, Georg M.

2000-01-01

Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC50) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (ΔE*) below 1.1 were measured for most dyes. PMID:10919791

A novel multicopper oxidase (laccase) from cyanobacteria: Purification, characterization with potential in the decolorization of anthraquinonic dye.

PubMed

Afreen, Sumbul; Shamsi, Tooba Naz; Baig, Mohd Affan; Ahmad, Nadeem; Fatima, Sadaf; Qureshi, M Irfan; Hassan, Md Imtaiyaz; Fatma, Tasneem

2017-01-01

A novel extracellular laccase enzyme produced from Spirulina platensis CFTRI was purified by ultrafiltration, cold acetone precipitation, anion exchange and size exclusion chromatography with 51.5% recovery and 5.8 purification fold. The purified laccase was a monomeric protein with molecular mass of ~66 kDa that was confirmed by zymogram analysis and peptide mass fingerprinting. The optimum pH and temperature of the enzyme activity was found at 3.0 and 30°C using ABTS as substrate but the enzyme was quite stable at high temperature and alkaline pH. The laccase activity was enhanced by Cu+2, Zn+2 and Mn+2. In addition, the dye decolorization potential of purified laccase was much higher in terms of extent as well as time. The purified laccase decolorized (96%) of anthraquinonic dye Reactive blue- 4 within 4 h and its biodegradation studies was monitored by UV visible spectra, FTIR and HPLC which concluded that cyanobacterial laccase can be efficiently used to decolorize synthetic dye and help in waste water treatment.

A novel multicopper oxidase (laccase) from cyanobacteria: Purification, characterization with potential in the decolorization of anthraquinonic dye

PubMed Central

Afreen, Sumbul; Shamsi, Tooba Naz; Baig, Mohd Affan; Ahmad, Nadeem; Fatima, Sadaf; Qureshi, M. Irfan; Hassan, Md. Imtaiyaz

2017-01-01

A novel extracellular laccase enzyme produced from Spirulina platensis CFTRI was purified by ultrafiltration, cold acetone precipitation, anion exchange and size exclusion chromatography with 51.5% recovery and 5.8 purification fold. The purified laccase was a monomeric protein with molecular mass of ~66 kDa that was confirmed by zymogram analysis and peptide mass fingerprinting. The optimum pH and temperature of the enzyme activity was found at 3.0 and 30°C using ABTS as substrate but the enzyme was quite stable at high temperature and alkaline pH. The laccase activity was enhanced by Cu+2, Zn+2 and Mn+2. In addition, the dye decolorization potential of purified laccase was much higher in terms of extent as well as time. The purified laccase decolorized (96%) of anthraquinonic dye Reactive blue- 4 within 4 h and its biodegradation studies was monitored by UV visible spectra, FTIR and HPLC which concluded that cyanobacterial laccase can be efficiently used to decolorize synthetic dye and help in waste water treatment. PMID:28384218

Optimization of laccase production by Trametes versicolor cultivated on industrial waste.

PubMed

Tišma, Marina; Znidaršič-Plazl, Polona; Vasić-Rački, Durđa; Zelić, Bruno

2012-01-01

Laccases are very interesting biocatalysts for several industrial applications. Its production by different white-rot fungi can be stimulated by a variety of inducing substrates, and the use of lignocellulosic wastes or industrial by-products is one of the possible approaches to reduce production costs. In this work, various industrial wastes were tested for laccase production by Trametes versicolor MZKI G-99. Solid waste from chemomechanical treatment facility of a paper manufacturing plant showed the highest potential for laccase production. Enzyme production during submerged cultivation of T. versicolor on the chosen industrial waste has been further improved by medium optimization using genetic algorithm. Concentrations of five components in the medium were optimized within 60 shake-flasks experiments, where the highest laccase activity of 2,378 U dm(-3) was achieved. Waste from the paper industry containing microparticles of CaCO(3) was found to stimulate the formation of freely dispersed mycelium and laccase production during submerged cultivation of T. versicolor. It was proven to be a safe and inexpensive substrate for commercial production of laccase and might be more widely applicable for metabolite production by filamentous fungi.

Synergic effect studies of the bi-enzymatic system laccase-peroxidase in a voltammetric biosensor for catecholamines.

PubMed

Leite, Oldair D; Lupetti, Karina O; Fatibello-Filho, Orlando; Vieira, Iolanda C; Barbosa, Aneli de M

2003-04-10

Several bi-enzymatic carbon paste biosensors modified with enzymes laccase from Pleurotus ostreatus fungi and peroxidase from zucchini (Cucurbita pepo) were constructed for evaluating the synergic effect of the two enzymes on the voltammetric biosensor response for various catecholamines. Initially was investigated the effect of pH from 5.0 to 7.5, temperature from 25 to 50 degrees C, initial stirring time from 30 to 150 s, scan rate from 10 to 60 mVs(-1) and potential pulse amplitude from 10 to 60 mV on the biosensor response for several catecholamines such as dopamine, adrenaline, isoprenaline and l-dopa. It was observed a biosensor signal increase employing both enzymes, indicating thus there is a synergic effect between laccase and peroxidase, verified also in spectrophotometric studies, in the determination of these catecholamines.

One-pot synthesis of active copper-containing carbon dots with laccase-like activities.

PubMed

Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

2015-12-14

Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.

Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing

2006-08-01

A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.

Immobilization of Trametes versicolor cultures for improving laccase production in bubble column reactor intensified by sonication.

PubMed

Wang, Feng; Guo, Chen; Liu, Chun-Zhao

2013-01-01

The mycelia of Trametes versicolor immobilized in alginate beads provided higher laccase production than that in pelleted form. An efficient ultrasonic treatment enhanced laccase production from the immobilized T. versicolor cultures. The optimized treatment process consisted of exposing 36-h-old bead cultures to 7-min ultrasonic treatments twice with a 12-h interval using a fixed ultrasonic power and frequency (120 W, 40 kHz). Using the intensification strategy with sonication, laccase production increased by more than 2.1-fold greater than the untreated control in both flasks and bubble column reactors. The enhancement of laccase production by ultrasonic treatment is related to the improved mass transfer of nutrients and product between the liquid medium and the gel matrix. These results provide a basis for the large-scale and highly-efficient production of laccase using sonobioreactors.

Laccase-catalyzed synthesis of 2,3-ethylenedithio-1,4-quinones

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2015-06-05

Laccases (benzenediol:oxygen oxidoreductase EC 1.10.3.2) are part of a family of multicopper oxidases. These environmentally friendly enzymes require O 2 as their only co-substrate and produce H 2O as their sole by-product. As a result, they have acquired increasing use in biotechnological applications, particularly in the field of organic synthesis. In the current study, laccases have been employed to successfully couple 1,2-ethanedithiol to various substituted hydroquinones to produce novel 2,3-ethylenedithio-1,4-quinones in good yields via an oxidation–addition–oxidation–addition–oxidation mechanism. The reactions proceeded in one-pot under mild conditions (room temperature, pH 5.0). This study further supports the use of laccases as green toolsmore » in organic chemistry. Furthermore, it provides evidence that laccase-catalyzed cross-coupling reactions involving small thiols are possible, in spite of research that suggests small thiols are potent inhibitors of laccases.« less

Decolorization of textile dye RB19 using volcanic rock matrix immobilized Bacillus thuringiensis cells with surface displayed laccase.

PubMed

Wan, Juan; Sun, Xiaowen; Liu, Cheng; Tang, Mengjun; Li, Lin; Ni, Hong

2017-06-01

A triplicate volcanic rock matrix-Bacillus thuringiensis-laccase WlacD (VRMs-Bt-WlacD) dye decolorization system was developed. WlacD was displayed on the B. thuringiensis MB174 cell surface to prepare a whole-cell laccase biocatalyst by using two repeat N-terminal domains of autolysin Mbg (Mbgn) 2 as the anchoring motif. Immunofluorescence microscopic assays confirmed that the fusion protein (Mbgn) 2 -WlacD was anchored on the surface of the recombinant B. thuringiensis MB174. After optimization by a single factor test, L 9 (3 4 )-orthogonal test, Plackett-Burman test, steepest ascent method, and Box-Behnken response surface methodology, the whole-cell specific laccase activity of B. thuringiensis MB174 was improved to 555.2 U L -1 , which was 2.25 times than that of the primary culture condition. Optimized B. thuringiensis MB174 cells were further adsorbed by VRMs to prepare VRMs-Bt-WlacD, an immobilized whole-cell laccase biocatalyst. Decolorization capacity of as-prepared VRMs-Bt-WlacD toward an initial concentration of 500 mg L -1 of an textile dye reactive blue 19 (RB19) aqueous solution reached 72.36% at a solid-to-liquid ratio of 10 g-100 mL. Repeated decolorization-activation operations showed the high decolorization capacity of VRMs-Bt-WlacD and have the potential for large-scale or continuous operations.

Heterologous expression of the Pleurotus ostreatus MnP3 gene by the laccase gene promoter in Lentinula edodes.

PubMed

Sato, Toshitsugu; Irie, Toshikazu; Yoshino, Fumihiko

2017-08-01

Lentinula edodes (shiitake), which have a powerful ligninolytic system, is one of the most important edible mushrooms in Asia. In this study, we introduced the manganese peroxidase (MnP, EC 1.11.1.13) gene from Pleurotus ostreatus driven by L. edodes laccase 1 gene promoter into L. edodes for expression. The resulting transformant expressed the recombinant gene and showed a higher level of MnP activity than that of the wild-type strain.

Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal.

PubMed

Shrestha, Prabin; Joshi, Bishnu; Joshi, Jarina; Malla, Rajani; Sreerama, Lakshmaiah

2016-01-01

At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum -CDBT1 , Ganoderma japonicum, and Lentinula edodes , isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum -CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum -CDBT1. Presence of lignin (5 g/L) and copper sulfate (30  μ M) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum -CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m , V max , and K cat , determined using 2,2'-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110  μ M, 36  μ mol/min/mg, and 246 min -1 , respectively. The isolated thermostable laccase will be used in future experiments for delignification process.

Aldehyde PEGylation of laccase from Trametes versicolor in route to increase its stability: effect on enzymatic activity.

PubMed

Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco

2015-03-01

Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12 mg/ml), reaction time (4 and 17 h), molecular weight, and type of mPEG (20, 30, 40 kDa and 40 kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12 mg/ml of laccase, molar ratio 1:4, and 4 h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. Copyright © 2015 John Wiley & Sons, Ltd.

Overproduction of laccase and pectinase by microbial associations in solid substrate fermentation.

PubMed

Stoilova, Ivanka; Krastanov, Albert

2008-04-01

The growth and the enzymatic production of two microbial fungal associations were studied: Aspergillus niger and Fusarium moniliforme and Trametes versicolor and Aspergillus niger. The synergistic interrelations between the species of the first mixed culture increased the biosynthesis of alpha-amylase and pectinase. T. versicolor and A. niger proved to be compatible partners in the overproduction of the enzyme laccase, whose synthesis surpassed 8.4 times the enzymatic level in the monoculture, with both of the mixed microbial populations cocultivation facilitating the amplified synthesis of enzymes rather than their growth acceleration. A further proof of the presence of synergism established by the cultures was the enzyme volumetric productivities in both of the mixed microbial cultures, which increased parallel to the rise in the combined biomass synthesis. The competent selection of compatible partners can adjust the desired enzymatic levels and compositions in mixed fungal systems aimed at a number of specified designations. Thus, a very high level of laccase production (97,600 IU/g dry weight) was achieved. The chosen fungal strains produce a variety of different enzymes, but first microbial association produces mainly amylase and pectinase, necessary for their growth, and second association produces mainly laccase and pectinase.

Inactivation of virginiamycin by Aureobasidium pullulans

USDA-ARS?s Scientific Manuscript database

Objective: To test the inactivation of the antibiotic, virginiamycin, by laccase-induced culture supernatants of Aureobasidium pullulans. Results: Fourteen strains of A. pullulans from phylogenetic clade 7 were tested for laccase production. Three laccase-producing strains from this group and three...

Heat shock treatment improves Trametes versicolor laccase production.

PubMed

Wang, Feng; Guo, Chen; Wei, Tao; Zhang, Tian; Liu, Chun-Zhao

2012-09-01

An efficient heat shock strategy has been developed to improve laccase production in submerged Trametes versicolor cultures. The optimized heat shock strategy consists of subjecting T. versicolor mycelial pellets to three heat shock treatments at 45 °C for 45 min, starting at culture day 0, with a 24-h interval between treatments. Laccase production increased by more than 1.6-fold relative to the control in both flasks and a 5-L bioreactor because the expression of the laccase gene was enhanced by heat shock induction. The present work demonstrates that heat shock induction is a promising method because it both improves fungal laccase production and has a good potential in industrial application.

Combined sequence and structure analysis of the fungal laccase family.

PubMed

Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P

2003-08-20

Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal laccases. The identified motifs, L1-L4, can be useful in searching the newly sequenced genomes for putative laccase enzymes. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 83: 386-394, 2003.

Online UV-visible spectroscopy and multivariate curve resolution as powerful tool for model-free investigation of laccase-catalysed oxidation.

PubMed

Kandelbauer, A; Kessler, W; Kessler, R W

2008-03-01

The laccase-catalysed transformation of indigo carmine (IC) with and without a redox active mediator was studied using online UV-visible spectroscopy. Deconvolution of the mixture spectra obtained during the reaction was performed on a model-free basis using multivariate curve resolution (MCR). Thereby, the time courses of educts, products, and reaction intermediates involved in the transformation were reconstructed without prior mechanistic assumptions. Furthermore, the spectral signature of a reactive intermediate which could not have been detected by a classical hard-modelling approach was extracted from the chemometric analysis. The findings suggest that the combined use of UV-visible spectroscopy and MCR may lead to unexpectedly deep mechanistic evidence otherwise buried in the experimental data. Thus, although rather an unspecific method, UV-visible spectroscopy can prove useful in the monitoring of chemical reactions when combined with MCR. This offers a wide range of chemists a cheap and readily available, highly sensitive tool for chemical reaction online monitoring.

Fungal colonization and enzyme-mediated metabolism of waste coal by Neosartorya fischeri strain ECCN 84.

PubMed

Sekhohola, Lerato Mary; Isaacs, Michelle Louise; Cowan, Ashton Keith

2014-01-01

Colonization and oxidative metabolism of South African low-rank discard coal by the fungal strain ECCN 84 previously isolated from a coal environment and identified as Neosartorya fischeri was investigated. Results show that waste coal supported fungal growth. Colonization of waste coal particles by N. fischeri ECCN 84 was associated with the formation of compact spherical pellets or sclerotia-like structures. Dissection of the pellets from liquid cultures revealed a nucleus of "engulfed" coal which when analyzed by energy dispersive X-ray spectroscopy showed a time-dependent decline in weight percentage of elemental carbon and an increase in elemental oxygen. Proliferation of peroxisomes in hyphae attached to coal particles and increased extracellular laccase activity occurred after addition of waste coal to cultures of N. fischeri ECCN 84. These results support a role for oxidative enzyme action in the biodegradation of coal and suggest that extracellular laccase is a key component in this process.

Induction of laccases in Trametes versicolor by aqueous wood extracts.

PubMed

Bertrand, Brandt; Martínez-Morales, Fernando; Tinoco, Raunel; Rojas-Trejo, Sonia; Serrano-Carreón, Leobardo; Trejo-Hernández, María R

2014-01-01

The induction of laccase isoforms in Trametes versicolor HEMIM-9 by aqueous extracts (AE) from softwood and hardwood was studied. Samples of sawdust of Pinus sp., Cedrela sp., and Quercus sp. were boiled in water to obtain AE. Different volumes of each AE were added to fungal cultures to determine the amount of AE needed for the induction experiments. Laccase activity was assayed every 24 h for 15 days. The addition of each AE (50 to 150 μl) to the fungal cultures increased laccase production compared to the control (0.42 ± 0.01 U ml(-1)). The highest laccase activities detected were 1.92 ± 0.15 U ml(-1) (pine), 1.87 ± 0.26 U ml(-1) (cedar), and 1.56 ± 0.34 U ml(-1) (oak); laccase productivities were also significantly increased. Larger volumes of any AE inhibited mycelial growth. Electrophoretic analysis revealed two laccase bands (lcc1 and lcc2) for all the treatments. However, when lcc2 was analyzed by isoelectric focusing, inducer-dependent isoform patterns composed of three (pine AE), four (oak AE), and six laccase bands (cedar AE) were observed. Thus, AE from softwood and hardwood had induction effects in T. versicolor HEMIM-9, as indicated by the increase in laccase activity and different isoform patterns. All of the enzymatic extracts were able to decolorize the dye Orange II. Dye decolorization was mainly influenced by pH. The optimum pH for decolorization was pH 5 (85%), followed by pH 7 (50%) and pH 3 (15%). No significant differences in the dye decolorizing capacity were detected between the control and the differentially induced laccase extracts (oak, pine and cedar). This could be due to the catalytic activities of isoforms with pI 5.4 and 5.8, which were detected under all induction conditions.

Fabrication, characterization and application of laccase-nylon 6,6/Fe3+ composite nanofibrous membrane for 3,3'-dimethoxybenzidine detoxification.

PubMed

Jasni, M Jasmin Fathi; Sathishkumar, Palanivel; Sornambikai, Sundaram; Yusoff, Abdull Rahim Mohd; Ameen, Fuad; Buang, Nor Aziah; Kadir, Mohammed Rafiq Abdul; Yusop, Zulkifli

2017-02-01

In this study, laccase was immobilized on nylon 6,6/Fe 3+ composite (NFC) nanofibrous membrane and used for the detoxification of 3,3'-dimethoxybenzidine (DMOB). The average size and tensile strength of the NFC membrane were found to be 60-80 nm (diameter) and 2.70 MPa, respectively. The FTIR results confirm that the amine (N-H) group of laccase was attached with Fe 3+ particles and the carbonyl (C=O) group of NFC membrane via hydrogen bonding. The half-life of the laccase-NFC membrane storage stability was increased from 6 to 11 weeks and the reusability was significantly extended up to 43 cycles against ABTS oxidation. Enhanced electro-oxidation of DMOB by laccase was observed at 0.33 V and the catalytic current was found to be 30 µA. The DMOB-treated mouse fibroblast 3T3-L1 preadipocytes showed maximum (97 %) cell inhibition at 75 µM L -1 within 24 h. The cytotoxicity of DMOB was significantly decreased to 78 % after laccase treatment. This study suggests that laccase-NFC membrane might be a good candidate for emerging pollutant detoxification.

Optimization of media components for laccase production by litter dwelling fungal isolate Fusarium incarnatum LD-3.

PubMed

Chhaya, Urvish; Gupte, Akshaya

2010-02-01

Laccase production by solid state fermentation (SSF) using an indigenously isolated litter dwelling fungus Fusarium incarnatum LD-3 was optimized. Fourteen medium components were screened by the initial screening method of Plackett-Burman. Each of the components was screened on the basis of 'p' (probability value) which was above 95% confidence level. Ortho-dianisidine, thiamine HCl and CuSO(4) . 5 H(2)O were identified as significant components for laccase production. The Central Composite Design response surface methodology was then applied to further optimize the laccase production. The optimal concentration of these three medium components for higher laccase production were (g/l): CuSO(4) . 5 H(2)O, 0.01; thiamine HCl, 0.0136 and ortho-dianisidine, 0.388 mM served as an inducer. Wheat straw, 5.0 g was used as a solid substrate. Using this statistical optimization method the laccase production was found to increase from 40 U/g to 650 U/g of wheat straw, which was sixteen times higher than non optimized medium. This is the first report on statistical optimization of laccase production from Fusarium incarnatum LD-3.

Laccases from Aureobasidium pullulans

USDA-ARS?s Scientific Manuscript database

Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...

Exploiting the oxidizing capabilities of laccases exploiting the oxidizing capabilities of laccases for sustainable chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cannatelli, Mark D.

Part one of this dissertation research has focused on harnessing the ability of laccases to generate reactive para-quinones in situ from the corresponding hydroquinones, followed by reaction with a variety of nucleophiles to perform novel carbon-carbon, carbon-nitrogen, and carbon-sulfur bond forming reactions for the synthesis of new and existing compounds. In part two of this dissertation, the fundamental laccase-catalyzed coupling chemistry developed in part one was applied to functionalize the surface of kraft lignin.

Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.

PubMed

Touahar, Imad E; Haroune, Lounès; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert

2014-05-15

In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60°C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. Copyright © 2014 Elsevier B.V. All rights reserved.

Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal

PubMed Central

Joshi, Jarina; Malla, Rajani

2016-01-01

At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μM) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m, V max, and K cat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process. PMID:27822471

Bacterial exopolysaccharides as a modern biotechnological tool for modification of fungal laccase properties and metal ion binding.

PubMed

Osińska-Jaroszuk, Monika; Jaszek, Magdalena; Starosielec, Magdalena; Sulej, Justyna; Matuszewska, Anna; Janczarek, Monika; Bancerz, Renata; Wydrych, Jerzy; Wiater, Adrian; Jarosz-Wilkołazka, Anna

2018-03-26

Four bacterial EPSs extracted from Rhizobium leguminosarum bv. trifolii Rt24.2, Sinorhizobium meliloti Rm1021, Bradyrhizobium japonicum USDA110, and Bradyrhizobium elkanii USDA76 were determined towards their metal ion adsorption properties and possible modification of Cerrena unicolor laccase properties. The highest magnesium and iron ion-sorption capacity (~ 42 and ~ 14.5%, respectively) was observed for EPS isolated from B. japonicum USDA110. An evident influence of EPSs on the stability of laccase compared to the control values (without EPSs) was shown after 30-day incubation at 25 °C. The residual activity of laccases was obtained in the presence of Rh76EPS and Rh1021EPS, i.e., 49.5 and 41.5% of the initial catalytic activity, respectively. This result was confirmed by native PAGE electrophoresis. The EPS effect on laccase stability at different pH (from 3.8 to 7.0) was also estimated. The most significant changes at the optimum pH value (pH 5.8) was observed in samples of laccase stabilized by Rh76EPS and Rh1021EPS. Cyclic voltamperometry was used for analysis of electrochemical parameters of laccase stabilized by bacterial EPS and immobilized on single-walled carbon nanotubes (SWCNTs) with aryl residues. Laccases with Rh76EPS and Rh1021EPS had an evident shift of the value of the redox potential compared to the control without EPS addition. In conclusion, the results obtained in this work present a new potential use of bacterial EPSs as a metal-binding component and a modulator of laccase properties especially stability of enzyme activity, which can be a very effective tool in biotechnology and industrial applications.

Engineering laccases: in search for novel catalysts.

PubMed

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-04-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases.

Engineering Laccases: In Search for Novel Catalysts

PubMed Central

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-01-01

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases. PMID:21966250

Unraveling the effects of laccase treatment on enzymatic hydrolysis of steam-exploded wheat straw.

PubMed

Oliva-Taravilla, Alfredo; Moreno, Antonio D; Demuez, Marie; Ibarra, David; Tomás-Pejó, Elia; González-Fernández, Cristina; Ballesteros, Mercedes

2015-01-01

Laccase enzymes are promising detoxifying agents during lignocellulosic bioethanol production from wheat straw. However, they affect the enzymatic hydrolysis of this material by lowering the glucose recovery yields. This work aimed at explaining the negative effects of laccase on enzymatic hydrolysis. Relative glucose recovery in presence of laccase (10IU/g substrate) with model cellulosic substrate (Sigmacell) at 10% (w/v) was almost 10% points lower (P<0.01) than in the absence of laccase. This fact could be due to an increase in the competition of cellulose binding sites between the enzymes and a slight inhibition of β-glucosidase activity. However, enzymatic hydrolysis and infrared spectra of laccase-treated and untreated wheat straw filtered pretreated residue (WS-FPR), revealed that a grafting process of phenoxy radicals onto the lignin fiber could be the cause of diminished accessibility of cellulases to cellulose in pretreated wheat straw. Copyright © 2014 Elsevier Ltd. All rights reserved.

Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipov, E. M., E-mail: e.m.osipov@gmail.com; Polyakov, K. M.; Engelhardt Institute of Molecular Biology, Vavilova str. 32, Moscow 119991

2015-11-18

The restoration of the native form of laccase from B. aclada from the type 2 copper-depleted form of the enzyme was investigated. Copper ions were found to be incorporated into the active site after soaking the depleted enzyme in a Cu{sup +}-containing solution. Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. Withmore » the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu{sup +}- and Cu{sup 2+}-containing solutions. Copper ions were found to be incorporated into the active site only when Cu{sup +} was used. A comparative analysis of the native and depleted forms of the enzymes was performed.« less

Enhanced production of laccase from Coriolus versicolor NCIM 996 by nutrient optimization using response surface methodology.

PubMed

Arockiasamy, Santhiagu; Krishnan, Indira Packialakshmi Gurusamy; Anandakrishnan, Nimalanandan; Seenivasan, Sabitha; Sambath, Agalya; Venkatasubramani, Janani Priya

2008-12-01

Plackett and Burman design criterion and central composite design were applied successfully for enhanced production of laccase by Coriolus versicolor NCIM 996 for the first time. Plackett and Burman design criterion was applied to screen the significance of ten nutrients on laccase production by C. versicolor NCIM 996. Out of the ten nutrients tested, starch, yeast extract, MnSO(4), MgSO(4) x 7H(2)O, and phenol were found to have significant effect on laccase production. A central composite design was applied to determine the optimum concentrations of the significant variables obtained from Plackett-Burman design. The optimized medium composition for production of laccase was (g/l): starch, 30.0; yeast extract, 4.53; MnSO(4), 0.002; MgSO(4) x 7H(2)O, 0.755; and phenol, 0.026, and the optimum laccase production was 6,590.26 (U/l), which was 7.6 times greater than the control.

On the diversity of the laccase gene: a phylogenetic perspective from Botryosphaeria rhodina (Ascomycota: Fungi) and other related taxa.

PubMed

Castilho, Flávio J D; Torres, Rodrigo A; Barbosa, Aneli M; Dekker, Robert F H; Garcia, José E

2009-02-01

The present study is the first describing the sequencing of a fragment of the copper-oxidase domain of a laccase gene in the family Botryosphaeriaceae. The aim of this work was to assess the degree of genetic and evolutionary relationships of a laccase gene from Botryosphaeria rhodina MAMB-05 with other ascomycete and basidiomycete laccase genes. The 193-amino acid sequences of the copper-oxidase domain from several different fungi, insects, a plant, and a bacterial species were retrieved from GenBank and aligned. Phylogenetic analyses were performed using neighbor-joining, maximum parsimony, and Bayesian inference methods. The organisms studied clustered into five gene clades: fungi (ascomycetes and basidiomycetes), insects, plants, and bacteria. Also, the topologies showed that fungal laccases of the ascomycetes and basidiomycetes are clearly separated into two distinct clusters. This evidence indicated that B. rhodina MAMB-05 and other closely related ascomycetes are a new biological resource given the biotechnological potential of their laccase genes.

Potentiality of a ceramic membrane reactor for the laccase-catalyzed removal of bisphenol A from secondary effluents.

PubMed

Arca-Ramos, A; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T

2015-11-01

In this study, the removal of bisphenol A (BPA) by laccase in a continuous enzymatic membrane reactor (EMR) was investigated. The effects of key parameters, namely, type of laccase, pH, and enzyme activity, were initially evaluated. Once optimal conditions were determined, the continuous removal of the pollutant in an EMR was assessed in synthetic and real biologically treated wastewaters. The reactor configuration consisted of a stirred tank reactor coupled to a ceramic membrane, which prevented the sorption of the pollutant and allowed the recovery and recycling of laccase. Nearly complete removal of BPA was attained under both operation regimes with removal yields above 94.5 %. In experiments with real wastewater, the removal of BPA remained high while the presence of colloids and certain ions and the formation of precipitates on the membrane potentially affected enzyme stability and made necessary the periodic addition of laccase. Polymerization and degradation were observed as probable mechanisms of BPA transformation by laccase.

Chitosan multiple addition enhances laccase production from Trametes versicolor.

PubMed

Adekunle, Abiodun Emmanuel; Wang, Feng; Hu, Jianhua; Ma, Anzhou; Guo, Chen; Zhuang, Guoqiang; Liu, Chun-Zhao

2015-10-01

Chitosan multiple addition strategy was developed to improve laccase production from Trametes versicolor cultures. The optimized multiple addition strategy was carried out by two-time addition of 0.1 g L(-1) chitosan to a 2-day-old culture media, with 24-h interval between the treatments. Under these conditions, laccase activity of 644.9 U l(-1) was achieved on the seventh day and laccase production was improved by 93.5 % higher than the control. Chitosan treatment increased reactive oxygen species generation and extracellular protein concentration in the treated mycelia. In contrast, the inducer inhibited the mycelia growth. The result of the quantitative reverse transcription polymerase chain reaction showed that the copy number of the laccase gene transcript increased by 16.7-fold in the treated mycelia relative to the control. This study provides insight into some of the intrinsic metabolic processes involved in the upregulation of laccase production in the presence of chitosan inducer in fungal culture.

The laccase-like reactivity of manganese oxide nanomaterials for pollutant conversion: rate analysis and cyclic voltammetry.

PubMed

Wang, Xinghao; Liu, Jiaoqin; Qu, Ruijuan; Wang, Zunyao; Huang, Qingguo

2017-08-10

Nanostructured manganese oxides, e.g. MnO 2 , have shown laccase-like catalytic activities, and are thus promising for pollutant oxidation in wastewater treatment. We have systematically compared the laccase-like reactivity of manganese oxide nanomaterials of different crystallinity, including α-, β-, γ-, δ-, and ɛ-MnO 2 , and Mn 3 O 4 , with 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 17β-estradiol (E2) as the probing substrates. The reaction rate behaviors were examined with regard to substrate oxidation and oxygen reduction to evaluate the laccase-like catalysis of the materials, among which γ-MnO 2 exhibits the best performance. Cyclic voltammetry (CV) was employed to assess the six MnO x nanomaterials, and the results correlate well with their laccase-like catalytic activities. The findings help understand the mechanisms of and the factors controlling the laccase-like reactivity of different manganese oxides nanomaterials, and provide a basis for future design and application of MnO x -based catalysts.

FTIR Spectroscopy Applied in Remazol Blue Dye Oxidation by Laccases

NASA Astrophysics Data System (ADS)

Juárez-Hernández, J.; Zavala-Soto, M. E.; Bibbins-Martínez, M.; Delgado-Macuil, R.; Díaz-Godinez, G.; Rojas-López, M.

2008-04-01

We have used FTIR with attenuated total reflectance (ATR) technique to analyze the decolourization process of Remazol Blue dye (RB19) caused by the oxidative activity of laccase enzyme. It is known that laccases catalyze the oxidation of a large range of phenolic compounds and aromatic amines carrying out one-electron oxidations, although also radicals could be formed which undergo subsequent nonenzymatic reactions. The enzyme laccase is a copper-containing polyphenol oxidase (EC 1.10.3.2) which has been tested as a potential alternative in detoxification of environmental pollutants such as dyes present in wastewaters generated for the textile industry. In order to ensure degradation or avoid formation of toxic compounds it is important to establish the mechanism by which laccase oxidizes dyes. In this research individual ATR-FTIR spectra have been recorded for several reaction times between 0 to 236 hours, and the temporal dependence of the reaction was analyzed through the relative diminution of the intensity of the infrared band at 1127 cm-1 (associated to C-N vibration), with respect to the intensity of the band at 1104 cm-1 (associated to S = O) from sulphoxide group. Decolourization process of this dye by laccase could be attributed to its accessibility on the secondary amino group, which is a potential point of attack of laccases, abstracting the hydrogen atom. This decolourization process of remazol blue dye by laccase enzyme might in a future replace the traditionally high chemical, energy and water consuming textile operations.

Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

PubMed Central

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Purification of a thermostable alkaline laccase from papaya (Carica papaya) using affinity chromatography.

PubMed

Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

2015-01-01

A laccase from papaya leaves was purified to homogeneity by a two step procedure namely, heat treatment (at 70 °C) and Con-A affinity chromatography. The procedure resulted in 1386.7-fold purification of laccase with a specific activity of 41.3 units mg(-1) and an overall yield of 61.5%. The native purified laccase was found to be a hexameric protein of ∼ 260 kDa. The purified enzyme exhibited acidic and alkaline pH optima of 6.0 and 8.0 with the non-phenolic substrate (ABTS) and phenolic substrate (catechol), respectively. The purified laccase was found to be thermostable up to 70 °C such that it retained ∼ 80% activity upon 30 min incubation at 70 °C. The Arrhenius energy of activation for purified laccase was found to be 7.7 kJ mol(-1). The enzyme oxidized various phenolic and non-phenolic substrates having catalytic efficiency (K(cat)/K(m)) in the order of 7.25>0.67>0.27 mM(-1) min(-1) for ABTS, catechol and hydroquinone, respectively. The purified laccase was found to be activated by Mn(2+), Cd(2+), Ca(2+), Na(+), Fe(2+), Co(2+) and Cu(2+) while weakly inhibited by Hg(2+). The properties such as thermostability, alkaline pH optima and metal tolerance exhibited by the papaya laccase make it a promising candidate enzyme for industrial exploitation. Copyright © 2014 Elsevier B.V. All rights reserved.

Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.

PubMed

Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

2014-01-01

A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively.

CotA of Bacillus subtilis Is a Copper-Dependent Laccase

PubMed Central

Hullo, Marie-Françoise; Moszer, Ivan; Danchin, Antoine; Martin-Verstraete, Isabelle

2001-01-01

The spore coat protein CotA of Bacillus subtilis displays similarities with multicopper oxidases, including manganese oxidases and laccases. B. subtilis is able to oxidize manganese, but neither CotA nor other sporulation proteins are involved. We demonstrate that CotA is a laccase. Syringaldazine, a specific substrate of laccases, reacted with wild-type spores but not with ΔcotA spores. CotA may participate in the biosynthesis of the brown spore pigment, which appears to be a melanin-like product and to protect against UV light. PMID:11514528

Laccase and lectin activities of intracellular proteins produced in a submerged culture of the xylotrophic basidiomycete Lentinus edodes.

PubMed

Vetchinkina, Elena P; Pozdnyakova, Natalia N; Nikitina, Valentina E

2008-10-01

The white-rot fungus Lentinus edodes produced D-melibiose-specific lectins and two laccase forms in a lignin-containing medium. The maxima of laccase and lectin activities coincided, falling within the period of active mycelial growth. The enzymes and lectins were isolated and purified by gel filtration followed by anion-exchange chromatography. The L. edodes lectins were found to be able to stabilize the activity of the fungus's own laccases. Lectin activity during the formation of lectin-enzyme complexes remained unchanged.

Uses of Laccases in the Food Industry

PubMed Central

Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana

2010-01-01

Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873

Studies on Acetone Powder and Purified Rhus Laccase Immobilized on Zirconium Chloride for Oxidation of Phenols

PubMed Central

Lu, Rong; Miyakoshi, Tetsuo

2012-01-01

Rhus laccase was isolated and purified from acetone powder obtained from the exudates of Chinese lacquer trees (Rhus vernicifera) from the Jianshi region, Hubei province of China. There are two blue bands appearing on CM-sephadex C-50 chromatography column, and each band corresponding to Rhus laccase 1 and 2, the former being the major constituent, and each had an average molecular weight of approximately 110 kDa. The purified and crude Rhus laccases were immobilized on zirconium chloride in ammonium chloride solution, and the kinetic properties of free and immobilized Rhus laccase, such as activity, molecular weight, optimum pH, and thermostability, were examined. In addition, the behaviors on catalytic oxidation of phenols also were conducted. PMID:22545205

Genome-wide identification of multifunctional laccase gene family in cotton (Gossypium spp.); expression and biochemical analysis during fiber development

PubMed Central

Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal

2016-01-01

The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939

Characterization of a novel laccase produced by the wood-rotting fungus Phellinus ribis.

PubMed

Min, K L; Kim, Y H; Kim, Y W; Jung, H S; Hah, Y C

2001-08-15

The white-rot fungus Phellinus ribis produced a single form of laccase, which was purified to apparent electrophoretic homogeneity from cultures induced with 2,5-xylidine. This protein was a dimer, consisting of two subunits of 76 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Carbohydrate analysis revealed that the enzyme contained about 28% carbohydrate content. The laccase appeared to be different from other known laccases by the UV-visible absorption spectrum analysis. One enzyme molecule contained one copper, one manganese, and two zinc atoms. The laccase showed optimal activity at pH 4.0-6.0, 5.0, and 6.0 with 2,6-dimethoxyphenol, ABTS [2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)], and syringaldazine, respectively. The enzyme preferably oxidized dimethoxyphenol and aromatic amine compounds. The stability of the laccase was low at acidic pH, whereas it showed high stability at neutral pH and mild temperature. The N-terminal amino acid sequence revealed a very low homology with other microbial laccases. With some substrates, the addition of manganese and H2O2 resulted in a remarkable increase in the oxidation rate. Without an appropriate phenolic substrate, the enzyme could not oxidize Mn(II) in the presence of H2O2 or pyrophosphate. Copyright 2001 Academic Press.

Optimization and modeling of laccase production by Trametes versicolor in a bioreactor using statistical experimental design.

PubMed

Tavares, A P M; Coelho, M A Z; Agapito, M S M; Coutinho, J A P; Xavier, A M R B

2006-09-01

Experimental design and response surface methodologies were applied to optimize laccase production by Trametes versicolor in a bioreactor. The effects of three factors, initial glucose concentration (0 and 9 g/L), agitation (100 and 180 rpm), and pH (3.0 and 5.0), were evaluated to identify the significant effects and its interactions in the laccase production. The pH of the medium was found to be the most important factor, followed by initial glucose concentration and the interaction of both factors. Agitation did not seem to play an important role in laccase production, nor did the interaction agitation x medium pH and agitation x initial glucose concentration. Response surface analysis showed that an initial glucose concentration of 11 g/L and pH controlled at 5.2 were the optimal conditions for laccase production by T. versicolor. Under these conditions, the predicted value for laccase activity was >10,000 U/L, which is in good agreement with the laccase activity obtained experimentally (11,403 U/L). In addition, a mathematical model for the bioprocess was developed. It is shown that it provides a good description of the experimental profile observed, and that it is capable of predicting biomass growth based on secondary process variables.

Copper induction and differential expression of laccase in Aspergillus flavus

PubMed Central

Gomaa, Ola M.; Momtaz, Osama A.

2015-01-01

Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

Light-induced inhibition of laccase in Pycnoporus sanguineus.

PubMed

Hernández, Christian A; Perroni, Yareni; Pérez, José Antonio García; Rivera, Beatriz Gutiérrez; Alarcón, Enrique

2016-03-01

The aim was to determine which specific regions of the visible light spectrum were responsible for the induction or inhibition of laccase in Pycnoporus sanguineus. Cultures were exposed to various bandwidth lights: blue (460 nm), green (525 nm), white (a combination of 460 and 560 nm), red (660 nm), and darkness. The results indicate that short wavelengths strongly inhibit the production of laccase: green (3.76 ± 1.12 U/L), blue (1.94 ± 0.36 U/L), and white (1.05 ± 0.21 U/L) in proportions of 85.8, 92.6, and 96.0%, respectively; whereas long wavelengths inhibit laccase production only partially i.e., red light (14.05 ± 4.79 U/L) in a proportion of 46.8%. Maximum activity was induced in absence of visible light (30 °C, darkness), i.e., 30.76 ± 4.0 U/L. It is concluded that the production of laccase in P. sanguineus responds to light stimuli [measured as wavelengths and lx] and that it does so inversely. This can be explained as an ecological mechanism of environmental recognition, given that P. sanguineus develops inside lignocellulose structures in conditions of darkness. The presence of short wavelength light (460-510 nm) would indicate that the organism finds itself in an external environment, unprovided of lignin, and that it is therefore unnecessary to secrete laccase. This possible new regulation in the laccase production in P. sanguineus has important biotechnological implications, for it would be possible to control the production of laccase using light stimuli.

Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.

PubMed

Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong

2018-04-01

Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.

Bacterial versus fungal laccase: potential for micropollutant degradation

PubMed Central

2013-01-01

Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.

PubMed

Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu

2014-09-15

In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum μ(ap) was 2.7×10(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high α-helical content (68%). The MW of the purified EPS was determined to be 1.8×10(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). Copyright © 2014 Elsevier Ltd. All rights reserved.

Fungal Laccases and Their Applications in Bioremediation

PubMed Central

Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

2014-01-01

Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

Laccase production by free and immobilized mycelia of Peniophora cinerea and Trametes versicolor: a comparative study.

PubMed

Silvério, Sara C; Moreira, Sérgio; Milagres, Adriane M F; Macedo, Eugénia A; Teixeira, José A; Mussatto, Solange I

2013-03-01

The production of laccase by immobilized mycelia of Peniophora cinerea and Trametes versicolor was studied. In an initial stage, experimental assays were performed in Erlenmeyer flasks using free and immobilized mycelium, and the performance of the fungal strains to produce the enzyme was compared. Both fungi adhered into the support material (a synthetic fiber), growing not only on the surface but also in the interspaces of the fibers. Immobilization of P. cinerea provided a 35-fold increase in laccase production when compared to the production obtained by using free mycelium. On the other hand, immobilization of T. versicolor caused a decrease in laccase activity. A comparison between the strains revealed that immobilized P. cinerea (3,500 U/L) surpassed the enzyme production by free T. versicolor (800 U/L). When the conditions that gave the best laccase production to each fungus were employed in a stirred tank bioreactor, very low laccase production was observed for both the cases, suggesting that shear stress and mycelia damage caused by the agitation impellers negatively affected the enzyme production.

Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.

2006-10-01

The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccasemore » structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.« less

Biochemical characterization and molecular evidence of a laccase from the bird's nest fungus Cyathus bulleri.

PubMed

Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander

2005-08-01

Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity.

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

PubMed Central

Rodríguez-Escribano, David; de Salas, Felipe; Camarero, Susana

2017-01-01

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin–Ciocalteau reagent (FCR), to detect the decrease in phenolic content produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). The method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates. PMID:28820431

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less

High-Throughput Screening Assay for Laccase Engineering toward Lignosulfonate Valorization

DOE PAGES

Rodriguez-Escribano, David; de Salas, Felipe; Pardo, Isabel; ...

2017-08-18

Lignin valorization is a pending issue for the integrated conversion of lignocellulose in consumer goods. Lignosulfonates (LS) are the main technical lignins commercialized today. However, their molecular weight should be enlarged to meet application requirements as additives or dispersing agents. Oxidation of lignosulfonates with fungal oxidoreductases, such as laccases, can increase the molecular weight of lignosulfonates by the cross-linking of lignin phenols. To advance in this direction, we describe here the development of a high-throughput screening (HTS) assay for the directed evolution of laccases, with lignosulfonate as substrate and the Folin-Ciocalteau reagent (FCR), to detect the decrease in phenolic contentmore » produced upon polymerization of lignosulfonate by the enzyme. Once the reaction conditions were adjusted to the 96-well-plate format, the enzyme for validating the assay was selected from a battery of high-redox-potential laccase variants functionally expressed in S. cerevisiae (the preferred host for the directed evolution of fungal oxidoreductases). The colorimetric response (absorbance at 760 nm) correlated with laccase activity secreted by the yeast. The HTS assay was reproducible (coefficient of variation (CV) = 15%) and sensitive enough to detect subtle differences in activity among yeast clones expressing a laccase mutant library obtained by error-prone PCR (epPCR). As a result, the method is therefore feasible for screening thousands of clones during the precise engineering of laccases toward valorization of lignosulfonates.« less

Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride

PubMed Central

Balcázar-López, Edgar; Méndez-Lorenzo, Luz Helena; Batista-García, Ramón Alberto; Esquivel-Naranjo, Ulises; Ayala, Marcela; Kumar, Vaidyanathan Vinoth; Savary, Olivier; Cabana, Hubert; Herrera-Estrella, Alfredo; Folch-Mallol, Jorge Luis

2016-01-01

Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus) sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc). To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor) from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation. PMID:26849129

Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.

PubMed

Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F

2013-01-01

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes

PubMed Central

Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

2013-01-01

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametes pubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, P.J.; Dobson, A.D.W.; Kotterman, M.J.J.

1996-12-01

Polycyclic aromatic hydrocarbons, particularly benzene homologs, are highly toxic organic pollutants. One of the three major groups of extracellular oxidative enzymes involved in the white rot fungal lignin degradative process are laccases. This study presents evidence indicating that laccase has a role in PAH oxidation by white rot fungi. 36 refs., 5 figs., 1 tab.

Degradation of dyes using crude extract and a thermostable and pH-stable laccase isolated from Pleurotus nebrodensis.

PubMed

Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun

2016-08-01

Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC-MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. © 2016 The Author(s).

Degradation of dyes using crude extract and a thermostable and pH-stable laccase isolated from Pleurotus nebrodensis

PubMed Central

Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun

2016-01-01

Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC–MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. PMID:27354563

Elimination of estrogenic activity of thermal paper using laccase from Trichoderma sp NFCCI-2745.

PubMed

Divya, L M; Prasanth, G K; Sadasivan, C

2013-02-01

In thermal printing, bisphenol A (BPA) functions chemically as a developer and reacts with white or colorless dyes in the presence of heat, converting them to a dark color. BPA can transfer readily to skin in small amounts from these papers. Its damage to environment and organisms has caused an extensive concern. In the present study, thermal paper used at the local automated teller machine counters of India were analyzed for the presence of BPA, and the capability of the paper to produce estrogenicity were assessed using a yeast two-hybrid assay experimental system. The study also focused on eliminating the endocrine-disrupting properties with partially purified laccase from newly isolated ascomycete fungi. The results indicate that these papers can produce estrogen hormone-like effect on experimental systems. It should be noted that on a daily basis, tons of such receipts are being dumped in the environment. Estrogenic properties of thermal paper were effectively removed from the reaction mixture within 3 h of incubation with the partially purified enzyme. We propose the utilization of waste thermal paper as a cheap substrate for laccase production for a safer and cleaner environment.

Laccase induction by synthetic dyes in Pycnoporus sanguineus and their possible use for sugar cane bagasse delignification.

PubMed

Hernández, Christian; Farnet Da Silva, Anne-Marie; Ziarelli, Fabio; Perraud-Gaime, Isabelle; Gutiérrez-Rivera, Beatriz; García-Pérez, José Antonio; Alarcón, Enrique

2017-02-01

The use of synthetic dyes for laccase induction in vivo has been scarcely explored. We characterized the effect of adding different synthetic dyes to liquid cultures of Pycnoporus sanguineus on laccase production. We found that carminic acid (CA) can induce 722 % and alizarin yellow 317 % more laccase than control does, and they promoted better fungal biomass development in liquid cultures. Aniline blue and crystal violet did not show such positive effect. CA and alizarin yellow were degraded up to 95 % during P. sanguineus culturing (12 days). With this basis, CA was selected as the best inducer and used to evaluate the induction of laccase on solid-state fermentation (SSF), using sugarcane bagasse (SCB) as substrate, in an attempt to reach selective delignification. We found that laccase induction occurred in SSF, and a slight inhibition of cellulase production was observed when CA was added to the substrate; also, a transformation of SCB under SSF was followed by the 13 C cross polarization magic angle spinning (CPMAS) solid-state nuclear magnetic resonance (NMR). Results showed that P. sanguineus can selectively delignify SCB, decreasing aromatic C compounds by 32.67 % in 16 days; O-alkyl C region (polysaccharides) was degraded less than 2 %; delignification values were not correlated with laccase activities. Cellulose-crystallinity index was increased by 27.24 % in absence of CA and 15.94 % when 0.01 mM of CA was added to SCB; this dye also inhibits the production of fungal biomass in SSF (measured as alkyl C gain). We conclude that CA is a good inducer of laccase in liquid media, and that P. sanguineus is a fungus with high potential for biomass delignification.

Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation.

PubMed

Sitarz, Anna K; Mikkelsen, Jørn D; Højrup, Peter; Meyer, Anne S

2013-12-10

Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ∼3U/mL toward syringaldazine. This activity was 13-17 fold higher than the corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ∼62.5kDa, and a Km value of 0.107mM (determined on ABTS). A partial amino acid sequence analysis of four short de novo sequenced peptides, defined after trypsin digest analysis using MALDI-TOF MS/MS analysis, revealed 64-100% homology to sequences in related laccases in the UniProt database, but also indicated that certain sequence stretches had low homology. Addition of the laccase-rich G. lucidum broth to lignocellulosic biomass (pretreated sugar cane bagasse) together with a state-of-the-art cellulase enzyme preparation (Cellic™CTec1) produced significantly increased cellulolytic yields, which were also better than those obtained with a T. versicolor laccase addition, indicating that the laccase from G. lucidum has unique properties that may be momentous in lignocellulosic biomass conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Quantification of the Influence of Extracellular Laccase and Intracellular Reactions on the Isomer-Specific Biotransformation of the Xenoestrogen Technical Nonylphenol by the Aquatic Hyphomycete Clavariopsis aquatica▿

PubMed Central

Martin, Claudia; Corvini, Philippe F. X.; Vinken, Ralph; Junghanns, Charles; Krauss, Gudrun; Schlosser, Dietmar

2009-01-01

The aquatic hyphomycete Clavariopsis aquatica was used to quantify the effects of extracellular laccase and intracellular reactions on the isomer-specific biotransformation of technical nonylphenol (t-NP). In laccase-producing cultures, maximal removal rates of t-NP and the isomer 4-(1-ethyl-1,4-dimethylpentyl)phenol (NP112) were about 1.6- and 2.4-fold higher, respectively, than in laccase-lacking cultures. The selective suppression of either laccase or intracellular reactions resulted in essentially comparable maximal removal rates for both compounds. Evidence for an unspecific oxidation of t-NP isomers was consistently obtained from laccase-expressing fungal cultures when intracellular biotransformation was suppressed and from reaction mixtures containing isolated laccase. This observation contrasts with the selective degradation of t-NP isomers by bacteria and should prevent the enrichment of highly estrogenic isomers in remaining t-NP. In contrast with laccase reactions, intracellular fungal biotransformation caused a significant shift in the isomeric composition of remaining t-NP. As a result, certain t-NP constituents related to more estrogenic isomers were less efficiently degraded than others. In contrast to bacterial degradation via ipso-hydroxylation, the substitution pattern of the quaternary α-carbon of t-NP isomers does not seem to be very important for intracellular transformation in C. aquatica. As-yet-unknown intracellular enzymes are obviously induced by nonylphenols. Mass spectral data of the metabolites resulting from the intracellular oxidation of t-NP, NP112, and 4-(1-ethyl-1,3-dimethylpentyl)phenol indicate nonyl chain hydroxylation, further oxidation into keto or aldehyde compounds, and the subsequent formation of carboxylic acid derivatives. Further metabolites suggest nonyl chain desaturation and methylation of carboxylic acids. The phenolic moieties of the nonylphenols remained unchanged. PMID:19429559

Assessment of hazelnut husk as a lignocellulosic feedstock for the production of fermentable sugars and lignocellulolytic enzymes.

PubMed

Pinar, Orkun; Karaosmanoğlu, Kübra; Sayar, Nihat Alpagu; Kula, Ceyda; Kazan, Dilek; Sayar, Ahmet Alp

2017-12-01

The present work focuses firstly on the evaluation of the effect of laccase on enzymatic hydrolysis of hazelnut husk which is one of the most abundant lignocellulosic agricultural residues generated in Turkey. In this respect, the co-enzymatic treatment of hazelnut husk by cellulase and laccase, without a conventional pretreatment step is evaluated. Using 2.75 FPU/g substrate (40 g/L substrate) and a ratio of 131 laccase U/FPU achieved the highest reducing sugars concentration. Gas chromatography mass spectrometry confirmed that the hydrolysate was composed of glucose, xylose, mannose, arabinose and galactose. The inclusion of laccase in the enzyme mixture [carboxymethyl cellulase (CMCase) and β-glucosidase] increased the final glucose content of the reducing sugars from 20 to 50%. Therefore, a very significant increase in glucose content of the final reducing sugars concentration was obtained by laccase addition. Furthermore, the production of cellulases and laccase by Pycnoporus sanguineus DSM 3024 using hazelnut husk as substrate was also investigated. Among the hazelnut husk concentrations tested (1.5, 6, 12, 18 g/L), the highest CMCase concentration was obtained using 12 g/L husk concentration on the 10th day of fermentation. Besides CMCase, P. sanguineus DSM 3024 produced β-glucosidase and laccase using hazelnut husk as carbon source. In addition to CMCase and β-glucosidase, the highest laccase activity measured was 2240 ± 98 U/L (8.89 ± 0.39 U/mg). To the best of our knowledge, this is the first study to report hazelnut husk hydrolysis in the absence of pretreatment procedures.

Melanoidin-containing wastewaters induce selective laccase gene expression in the white-rot fungus Trametes sp. I-62.

PubMed

González, Tania; Terrón, María Carmen; Yagüe, Susana; Junca, Howard; Carbajo, José María; Zapico, Ernesto Javier; Silva, Ricardo; Arana-Cuenca, Ainhoa; Téllez, Alejandro; González, Aldo Enrique

2008-03-01

Wastewaters generated from the production of ethanol from sugar cane molasses may have detrimental effects on the environment due to their high chemical oxygen demand and dark brown color. The color is mainly associated with the presence of melanoidins, which are highly recalcitrant to biodegradation. We report here the induction of laccases by molasses wastewaters and molasses melanoidins in the basidiomycetous fungus Trametes sp. I-62. The time course of effluent decolorization and laccase activity in the culture supernatant of the fungus were correlated. The expression of laccase genes lcc1 and lcc2 increased as a result of the addition of complete molasses wastewater and its high molecular weight fraction to fungal cultures. This is the first time differential laccase gene expression has been reported to occur upon exposure of fungal cultures to molasses wastewaters and their melanoidins.

A membraneless biofuel cell powered by ethanol and alcoholic beverage.

PubMed

Deng, Liu; Shang, Li; Wen, Dan; Zhai, Junfeng; Dong, Shaojun

2010-09-15

In this study, we reported on the construction of a stable single-chamber ethanol/O(2) biofuel cell harvesting energy from the ethanol and alcoholic beverage. We prepared a composite film which consisted of partially sulfonated (3-mercaptopropyl)-trimethoxysilane sol-gel (PSSG) and chitosan (CHI). The combination of ion-exchange capacity sol-gel and biopolymer chitosan not only provided the attached sites for mediator MDB and AuNPs to facilitate the electron transfer along the substrate reaction, but also gave the suitable microenvironment to retain the enzyme activity in long term. The ethanol bioanode was constructed with the film coimmobilized dehydrogenase (ADH), Meldola's blue (MDB) and gold nanoparticles (AuNPs). The MDB/AuNPs/PSSG-CHI-ADH composite modified electrode showed prominent electrocatalytic activity towards the oxidation of ethanol. The oxygen biocathode consisted of laccase and AuNPs immobilized on the PSSG-CHI composite membrane. The AuNPs/PSSG-CHI-laccase modified electrode catalyzed four-electron reduction of O(2) to water, without any mediator. The assembled single-chamber biofuel cell exhibited good stability and power output towards ethanol. The open-circuit voltage of this biofuel cell was 860 mV. The maximum power density of the biofuel cell was 1.56 mWcm(-2) at 550 mV. Most interestingly, this biofuel cell showed the similar performance when the alcoholic beverage acted as the fuel. When this biofuel cell ran with wine as the fuel, the maximum power output density was 3.21 mAcm(-2) and the maximum power density was 1.78 mWcm(-2) at 680 mV of the cell voltage. Our system exhibited stable and high power output in the multi-component substrate condition. This cell has great potential for the development and practical application of bioethanol fuel cell. Copyright 2010 Elsevier B.V. All rights reserved.

Effect of the inducers veratryl alcohol, Xylidine, and ligninosulphonates on activity and thermal stability and inactivation kinetics of laccase from Trametes versicolor.

PubMed

Saraiva, Jorge A; Tavares, Ana P M; Xavier, Ana M R B

2012-06-01

Laccase production from Trametes versicolor was improved in the presence of the inducers ligninosulphonates, veratryl alcohol, and xylidine respectively two-, four-, and eightfold. The thermal inactivation of the produced laccase, after partial purification with ammonium sulfate was kinetically investigated at various temperatures (60-70 °C) and pH values (3.5, 4.5, and 5.5). The inactivation process followed first-order kinetics for all conditions tested, except for veratryl alcohol, for which a constant activity level was observed at the end of the inactivation, also after first-order decay. Enzyme thermostability was affected by the type of inducer used in the culture medium for the production of laccase and also by the pH of incubation mixture. Generally, laccase stability increased with pH increment, being more stable at pH 5.5, except with xylidine. At pHs 4.5 and 5.5, the three inducers significantly increased laccase thermal stability, with the higher effect being observed for pH 5.5 and ligninosulphonates, where increment of half-life times ranged from 3- to 20-fold, depending on the temperature.

A Laccase with Antiproliferative and HIV-I Reverse Transcriptase Inhibitory Activities from the Mycorrhizal Fungus Agaricus placomyces

PubMed Central

Sun, Jian; Chen, Qing-Jun; Cao, Qing-Qin; Wu, Ying-Ying; Xu, Li-Jing; Zhu, Meng-Juan; Ng, Tzi-Bun; Wang, He-Xiang; Zhang, Guo-Qing

2012-01-01

A novel 68 kDa laccase was purified from the mycorrhizal fungus Agaricus placomyces by utilizing a procedure that comprised three successive steps of ion exchange chromatography and gel filtration as the final step. The monomeric enzyme exhibited the N-terminal amino acid sequence of DVIGPQAQVTLANQD, which showed only a low extent of homology to sequences of other fungal laccases. The optimal temperature for A. placomyces laccase was 30°C, and optimal pH values for laccase activity towards the substrates 2,7′-azinobis[3-ethylbenzothiazolone-6-sulfonic acid] diammonium salt (ABTS) and hydroquinone were 5.2 and 6.8, respectively. The laccase displayed, at 30°C and pH 5.2, Km values of 0.392 mM towards hydroquinone and 0.775 mM towards ABTS. It potently suppressed proliferation of MCF 7 human breast cancer cells and Hep G2 hepatoma cells and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) activity with an IC50 of 1.8 μM, 1.7 μM, and 1.25 μM, respectively, signifying that it is an antipathogenic protein. PMID:23093860

Laccase engineering: from rational design to directed evolution.

PubMed

Mate, Diana M; Alcalde, Miguel

2015-01-01

Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. Copyright © 2014 Elsevier Inc. All rights reserved.

Optimisation of the expression of a Trametes versicolor laccase gene in Pichia pastoris.

PubMed

O'Callaghan, J; O'Brien, M M; McClean, K; Dobson, A D W

2002-08-01

A cDNA encoding a laccase enzyme was isolated from a Trametes versicolor cDNA library. The gene was subcloned into the Pichia pastoris expression vector pPIC3.5 and transformed into the P. pastoris strains KM71 and GS115. Laccase-secreting transformants were selected by their ability to oxidise the substrate ABTS. No difference in laccase activity was observed between culture supernatants from GS115 (proteolytic) and KM71 (nonproteolytic) strains. The presence of at least 200 microM copper was necessary for optimal laccase activity in the culture supernatants. During growth of P. pastoris on minimal medium the pH of the medium was reduced to <3.0. If alanine was added to the medium the pH reduction was not as pronounced and at alanine concentrations >0.6% w/v the pH was kept constant for >7 days. Cultures in which the pH was maintained by alanine metabolism produced higher levels of laccase activity than those grown in the absence of alanine. This study describes the development of a medium that allows convenient pH control of P. pastoris without the need for continuous neutralisation.

Performance of an alkalophilic and halotolerant laccase from gamma-proteobacterium JB in the presence of industrial pollutants.

PubMed

Singh, Gursharan; Sharma, Prince; Capalash, Neena

2009-08-01

An alkalophilic and halotolerant laccase from gamma-proteobacterium JB catalyzed in high concentrations of organic solvents and various salts. The enzyme retained 80-100% activity in 10% concentration of dimethylsulfoxide (DMSO), ethanol, acetone or methanol; 100, 85 and 50% activity in 20 mM MgCl(2), 5.0 mM MnCl(2) and 0.1 mM CuCl(2); 140, 120 and 110% activity in 5.0 mM MnSO(4), 10 mM MgSO(4) and 1mM CaSO(4), respectively. Sodium halides inhibited the enzyme in the order: F(-)> Br(-)> I(-)> Cl(-). In 0.5 M NaCl, pH 6.0, laccase was approximately 60% active. Decolorization of indigo carmine by laccase at pH 9.0 was not inhibited even in the presence of 0.5 M NaCl. Release of chromophoric, reducing and hydrophobic compounds during biobleaching of straw rich-soda pulp by laccase was not inhibited when the enzyme was applied in the presence of 1 M NaCl at pH 8.0. Laccase retained 50% residual activity even when incubated with 5% calcium hypochlorite for 30 min.

Genome-Wide Identification and Characterization of Novel Laccase Genes in the White-Rot Fungus Flammulina velutipes

PubMed Central

Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo

2014-01-01

The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003

Laccase: microbial sources, production, purification, and potential biotechnological applications.

PubMed

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.

Laccase-mediated synthesis of lignin-core hyperbranched copolymers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cannatelli, Mark D.; Ragauskas, Arthur J.

Lignin, one of the major chemical constituents of woody biomass, is the second most abundant biopolymer found in nature. The pulp and paper industry has long produced lignin on the scale of millions of tons annually as a by-product of the pulping process, and the dawn of cellulosic ethanol production has further contributed to this amount. Historically, lignin has been perceived as a waste material and burned as a fuel for the pulping process. But, recent research has been geared toward developing cost-effective technologies to convert lignin into valuable commodities. Attributing to the polyphenolic structure of lignin, enzymatic modification ofmore » its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) has demonstrated to be highly successful. The current study aims at developing lignin-core hyperbranched copolymers via the laccase-assisted copolymerization of kraft lignin with methylhydroquinone and a trithiol. Based on the physical properties of the resulting material, it is likely that crosslinking reactions have taken place during the drying process to produce a copolymeric network rather than discrete hyperbranched copolymers, with NMR data providing evidence of covalent bonding between monomers. A preliminary thermal analysis data reveals that the copolymeric material possesses a moderate glass transition temperature and exhibits good thermostability, thus may have potential application as a lignin-based thermoplastic. Scanning electron microscopy images confirm the smooth, glossy surface of the material and that it is densely packed. Our results are a sustainable, ecofriendly, economic method to create an exciting novel biomaterial from a renewable feedstock while further enhancing lignin valorization.« less

Laccase-mediated synthesis of lignin-core hyperbranched copolymers

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2017-06-06

Lignin, one of the major chemical constituents of woody biomass, is the second most abundant biopolymer found in nature. The pulp and paper industry has long produced lignin on the scale of millions of tons annually as a by-product of the pulping process, and the dawn of cellulosic ethanol production has further contributed to this amount. Historically, lignin has been perceived as a waste material and burned as a fuel for the pulping process. But, recent research has been geared toward developing cost-effective technologies to convert lignin into valuable commodities. Attributing to the polyphenolic structure of lignin, enzymatic modification ofmore » its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) has demonstrated to be highly successful. The current study aims at developing lignin-core hyperbranched copolymers via the laccase-assisted copolymerization of kraft lignin with methylhydroquinone and a trithiol. Based on the physical properties of the resulting material, it is likely that crosslinking reactions have taken place during the drying process to produce a copolymeric network rather than discrete hyperbranched copolymers, with NMR data providing evidence of covalent bonding between monomers. A preliminary thermal analysis data reveals that the copolymeric material possesses a moderate glass transition temperature and exhibits good thermostability, thus may have potential application as a lignin-based thermoplastic. Scanning electron microscopy images confirm the smooth, glossy surface of the material and that it is densely packed. Our results are a sustainable, ecofriendly, economic method to create an exciting novel biomaterial from a renewable feedstock while further enhancing lignin valorization.« less

Laccase-mediated synthesis of lignin-core hyperbranched copolymers.

PubMed

Cannatelli, Mark D; Ragauskas, Arthur J

2017-08-01

Lignin, one of the major chemical constituents of woody biomass, is the second most abundant biopolymer found in nature. The pulp and paper industry has long produced lignin on the scale of millions of tons annually as a by-product of the pulping process, and the dawn of cellulosic ethanol production has further contributed to this amount. Historically, lignin has been perceived as a waste material and burned as a fuel for the pulping process. However, recent research has been geared toward developing cost-effective technologies to convert lignin into valuable commodities. Attributing to the polyphenolic structure of lignin, enzymatic modification of its surface using laccases (benzenediol:oxygen oxidoreductases, EC 1.10.3.2) has demonstrated to be highly successful. The current study aims at developing lignin-core hyperbranched copolymers via the laccase-assisted copolymerization of kraft lignin with methylhydroquinone and a trithiol. Based on the physical properties of the resulting material, it is likely that crosslinking reactions have taken place during the drying process to produce a copolymeric network rather than discrete hyperbranched copolymers, with NMR data providing evidence of covalent bonding between monomers. Preliminary thermal analysis data reveals that the copolymeric material possesses a moderate glass transition temperature and exhibits good thermostability, thus may have potential application as a lignin-based thermoplastic. Scanning electron microscopy images confirm the smooth, glossy surface of the material and that it is densely packed. The presented results are a sustainable, ecofriendly, economic method to create an exciting novel biomaterial from a renewable feedstock while further enhancing lignin valorization.

Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

PubMed

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

2015-03-01

Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation

PubMed Central

Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

2015-01-01

Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 μM, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

The effect of operational parameters on the biodegradation of bisphenols by Trametes versicolor laccase immobilized on Hippospongia communis spongin scaffolds.

PubMed

Zdarta, Jakub; Antecka, Katarzyna; Frankowski, Robert; Zgoła-Grześkowiak, Agnieszka; Ehrlich, Hermann; Jesionowski, Teofil

2018-02-15

Due to the rapid growth in quantities of phenolic compounds in wastewater, the development of efficient and environmentally friendly methods for their removal becomes a necessity. Thus, in a presented work, for the first time, a novel material, Hippospongia communis spongin-based scaffold, was used as a biopolymeric support for the immobilization of laccase from Trametes versicolor. The resulting biocatalytic systems were used for the biodegradation of three bisphenols: bisphenol A (BPA), bisphenol F (BPF) and bioremoval-resistant bisphenol S (BPS). Optimization of the immobilization and biodegradation methodologies was performed to increase bisphenols removal. The effect of temperature, pH and initial pollutant concentration was evaluated. It was shown that under optimal conditions, almost 100% of BPA (pH5, 30°C) and BPF (pH5, 40°C), and over 40% of BPS (pH4, 30°C) was removed from the solution at a concentration of 2mg/mL. Furthermore, the immobilized laccase exhibited good reusability and storage stability, retaining over 80% of its initial activity after 50days of storage. In addition, the main biodegradation products of BPA and BPF were identified. It was shown that mainly dimers and trimers were formed following the oxidation of bisphenols by the immobilized laccase. Copyright © 2017 Elsevier B.V. All rights reserved.

Recent developments and applications of immobilized laccase.

PubMed

Fernández-Fernández, María; Sanromán, M Ángeles; Moldes, Diego

2013-12-01

Laccase is a promising biocatalyst with many possible applications, including bioremediation, chemical synthesis, biobleaching of paper pulp, biosensing, textile finishing and wine stabilization. The immobilization of enzymes offers several improvements for enzyme applications because the storage and operational stabilities are frequently enhanced. Moreover, the reusability of immobilized enzymes represents a great advantage compared with free enzymes. In this work, we discuss the different methodologies of enzyme immobilization that have been reported for laccases, such as adsorption, entrapment, encapsulation, covalent binding and self-immobilization. The applications of laccase immobilized by the aforementioned methodologies are presented, paying special attention to recent approaches regarding environmental applications and electrobiochemistry. Copyright © 2012 Elsevier Inc. All rights reserved.

Production of laccase by Pynoporus sanguineus using 2,5 - Xylidine and ethanol

PubMed Central

Valeriano, Viviane S.; Silva, Anna Maria F.; Santiago, Mariângela F.; Bara, Maria T. F.; Garcia, Telma A.

2009-01-01

Enzyme application in biotechnological and environmental processes has had increasing interest due to its efficiency, selectivity and mainly for being environmentally healthful, but these applications require a great volume of enzymes. In this work the effect of different concentrations of ethanol and 2,5-xylidine on growth and production of laccase by Pycnoporus sanguineus was investigated. In a medium containing 200 mg.L-1 of 2,5-xylidine or 50 g.L-1 of ethanol, the maximum activity of laccase was 2019 U.L-1 and 1035 U.L-1, respectively. No direct correlation between biomass and activity of laccase was observed for any of the inducers used during the tests. Ethanol concentrations, larger than or equal to 20 g.L-1, inhibited the radial growth of P. sanguineus. This study showed that ethanol, which has less toxicity and cost than the majority of the studied inducers, presents promising perspectives for laccase production by P. sanguineus. PMID:24031426

Upgrading Laccase Production and Biochemical Properties: Strategies and Challenges.

PubMed

Bertrand, Brandt; Martínez-Morales, Fernando; Trejo-Hernández, María R

2017-07-01

Improving laccases continues to be crucial in novel biotechnological developments and industrial applications, where they are concerned. This review breaks down and explores the potential of the strategies (conventional and modern) that can be used for laccase enhancement (increased production and upgraded biochemical properties such as stability and catalytic efficiency). The challenges faced with these approaches are briefly discussed. We also shed light on how these strategies merge and give rise to new options and advances in this field of work. Additionally, this article seeks to serve as a guide for students and academic researchers interested in laccases. This document not only gives basic information on laccases, but also provides updated information on the state of the art of various technologies that are used in this line of investigation. It also gives the readers an idea of the areas extensively studied and the areas where there is still much left to be done. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1015-1034, 2017. © 2017 American Institute of Chemical Engineers.

Laccase SilA from Streptomyces ipomoeae CECT 3341, a key enzyme for the degradation of lignin from agricultural residues?

PubMed Central

Blánquez, Alba; Ball, Andrew S.; González-Pérez, José Antonio; Jiménez-Morillo, Nicasio T.; González-Vila, Francisco; Arias, M. Enriqueta

2017-01-01

The role of laccase SilA produced by Streptomyces ipomoeae CECT 3341 in lignocellulose degradation was investigated. A comparison of the properties and activities of a laccase-negative mutant strain (SilA−) with that of the wild-type was studied in terms of their ability to degrade lignin from grass lignocellulose. The yields of solubilized lignin (acid precipitable polymeric lignin, APPL) obtained from wheat straw by both strains in Solid State Fermentation (SSF) conditions demonstrated the importance of SilA laccase in lignin degradation with the wild-type showing 5-fold more APPL produced compared with the mutant strain (SilA−). Analytical pyrolysis and FT-IR (Fourier Transform Infrared Spectroscopy) confirmed that the APPL obtained from the substrate fermented by wild-type strain was dominated by lignin derived methoxyphenols whereas those from SilA− and control APPLs were composed mainly of polysaccharides. This is the first report highlighting the role of this laccase in lignin degradation. PMID:29112957

Laccase SilA from Streptomyces ipomoeae CECT 3341, a key enzyme for the degradation of lignin from agricultural residues?

PubMed

Blánquez, Alba; Ball, Andrew S; González-Pérez, José Antonio; Jiménez-Morillo, Nicasio T; González-Vila, Francisco; Arias, M Enriqueta; Hernández, Manuel

2017-01-01

The role of laccase SilA produced by Streptomyces ipomoeae CECT 3341 in lignocellulose degradation was investigated. A comparison of the properties and activities of a laccase-negative mutant strain (SilA-) with that of the wild-type was studied in terms of their ability to degrade lignin from grass lignocellulose. The yields of solubilized lignin (acid precipitable polymeric lignin, APPL) obtained from wheat straw by both strains in Solid State Fermentation (SSF) conditions demonstrated the importance of SilA laccase in lignin degradation with the wild-type showing 5-fold more APPL produced compared with the mutant strain (SilA-). Analytical pyrolysis and FT-IR (Fourier Transform Infrared Spectroscopy) confirmed that the APPL obtained from the substrate fermented by wild-type strain was dominated by lignin derived methoxyphenols whereas those from SilA- and control APPLs were composed mainly of polysaccharides. This is the first report highlighting the role of this laccase in lignin degradation.

Knockdown of a laccase in Populus deltoides confers altered cell wall chemistry and increased sugar release

DOE PAGES

Bryan, Anthony C.; Jawdy, Sara; Gunter, Lee; ...

2016-04-15

Plant laccases are thought to function in the oxidation of monolignols which leads to higher order lignin formation. Only a hand-full of laccases in plants have been functionally evaluated and as such little is known about the breadth of their impact on cell wall chemistry or structure. Here we describe a previously uncharacterized laccase from Populus, encoded by locus Potri.008G06400, whose reduced expression resulted in transgenic Populus trees with changes in syringyl/guaiacyl (S/G) ratios as well as altered sugar release phenotypes. These phenotypes are consistent with plant biomass exhibiting reduced recalcitrance. Interestingly, the transgene effect on recalcitrance is dependent onmore » a mild pretreatment prior to chemical extraction of sugars. Metabolite profiling suggests the transgene modulates phenolics that are associated with the cell wall structure. Finally, we propose a model in which this particular laccase has a range of functions related to oxidation of phenolics that interact with lignin in the cell wall.« less

Knockdown of a laccase in Populus deltoides confers altered cell wall chemistry and increased sugar release

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bryan, Anthony C.; Jawdy, Sara; Gunter, Lee

Plant laccases are thought to function in the oxidation of monolignols which leads to higher order lignin formation. Only a hand-full of laccases in plants have been functionally evaluated and as such little is known about the breadth of their impact on cell wall chemistry or structure. Here we describe a previously uncharacterized laccase from Populus, encoded by locus Potri.008G06400, whose reduced expression resulted in transgenic Populus trees with changes in syringyl/guaiacyl (S/G) ratios as well as altered sugar release phenotypes. These phenotypes are consistent with plant biomass exhibiting reduced recalcitrance. Interestingly, the transgene effect on recalcitrance is dependent onmore » a mild pretreatment prior to chemical extraction of sugars. Metabolite profiling suggests the transgene modulates phenolics that are associated with the cell wall structure. Finally, we propose a model in which this particular laccase has a range of functions related to oxidation of phenolics that interact with lignin in the cell wall.« less

Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.

PubMed

Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

2010-12-01

Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. 2010 Elsevier Ltd. All rights reserved.

Stabilized Laccases as Heterogeneous Bioelectrocatalysts (Postprint)

DTIC Science & Technology

2012-10-01

nature, with examples that range from bacterial species to fungi and plants.19·101 However, certain properties of laccases, such as their protein...identified, includ- ing examples of extremophilic enzymes,l11·121 but the extracellu- lar laccases from wood-rotting fungi , such as Trametes spp...biomolecules not only affects the stability and selectivity of an enzyme towards different substrates but also the charge trans- fer at the electrode

Functional Characterization of Epitheaflagallin 3-O-Gallate Generated in Laccase-Treated Green Tea Extracts in the Presence of Gallic Acid.

PubMed

Itoh, Nobuya; Kurokawa, Junji; Isogai, Yasuhiro; Ogasawara, Masaru; Matsunaga, Takayuki; Okubo, Tsutomu; Katsube, Yuji

2017-12-06

Epitheaflagallin (ETFG) and epitheaflagallin 3-O-gallate (ETFGg) are minor polyphenols in black tea extract that are enzymatically synthesized from epigallocatechin (EGC) and epigallocatechin gallate (EGCg), respectively, in green tea extract via laccase oxidation in the presence of gallic acid. The constituents of laccase-treated green tea extract in the presence of gallic acid are thus quite different from those of nonlaccase-treated green tea extract: EGC and EGCg are present in lower concentrations, and ETFG and ETFGg are present in higher concentrations. Additionally, laccase-treated green tea extract contains further polymerized catechin derivatives, comparable with naturally fermented teas such as oolong tea and black tea. We found that ETFGg and laccase-treated green tea extracts exhibit versatile physiological functions in vivo and in vitro, including antioxidative activity, pancreatic lipase inhibition, Streptococcus sorbinus glycosyltransferase inhibition, and an inhibiting effect on the activity of matrix metalloprotease-1 and -3 and their synthesis by human gingival fibroblasts. We confirmed that these inhibitory effects of ETFGg in vitro match well with the results obtained by docking simulations of the compounds with their target enzymes or noncatalytic protein. Thus, ETFGg and laccase-treated green tea extracts containing ETFGg are promising functional food materials with potential antiobesity and antiperiodontal disease activities.

Laccase production in bioreactor scale under saline condition by the marine-derived basidiomycete Peniophora sp. CBMAI 1063.

PubMed

Mainardi, Pedro H; Feitosa, Valker A; Brenelli de Paiva, Livia B; Bonugli-Santos, Rafaella C; Squina, Fabio M; Pessoa, Adalberto; Sette, Lara D

2018-05-01

Laccase production in saline conditions is still poorly studied. The aim of the present study was to investigate the production of laccase in two different types of bioreactors by the marine-derived basidiomycete Peniophora sp. CBMAI 1063. The highest laccase activity and productivity were obtained in the Stirred Tank (ST) bioreactor, while the highest biomass concentration in Air-lift (AL) bioreactor. The main laccase produced was purified by ion exchange and size exclusion chromatography and appeared to be monomeric with molecular weight of approximately 55 kDa. The optimum oxidation activity was obtained at pH 5.0. The thermal stability of the enzyme ranged from 30 to 50 °C (120 min). The Far-UV Circular Dichroism revealed the presence of high β-sheet and low α-helical conformation in the protein structure. Additional experiments carried out in flask scale showed that the marine-derived fungus was able to produce laccase only in the presence of artificial seawater and copper sulfate. Results from the present study confirmed the fungal adaptation to marine conditions and its potential for being used in saline environments and/or processes. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications

PubMed Central

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

Induction of lcc2 expression and activity by Agaricus bisporus provides defence against Trichoderma aggressivum toxic extracts

PubMed Central

Sjaarda, Calvin P; Abubaker, Kamal S; Castle, Alan J

2015-01-01

Laccases are used by fungi for several functions including defence responses to stresses associated with attack by other fungi. Laccase activity changes and the induction of two laccase genes, lcc1 and lcc2, in Agaricus bisporus were measured in response to toxic extracts of medium in which Trichoderma aggressivum, the cause of green mould disease, was grown. A strain of A. bisporus that shows resistance to the extracts showed higher basal levels and greater enzymatic activity after extract exposure than did a sensitive strain. Furthermore, pre-incubation of T. aggressivum extract with laccases reduced toxicity. Faster induction and greater numbers of lcc2 transcripts in response to the extract were noted in the resistant strain than in the sensitive strain. The timing and increase in lcc2 transcript abundance mirrored changes in total laccase activity. No correlation between resistance and lcc1 transcription was apparent. Transcript abundance in transformants with a siRNA construct homologous to both genes varied widely. A strong negative correlation between transcript abundance and sensitivity of the transformant to toxic extract was observed in plate assays. These results indicated that laccase activity and in particular that encoded by lcc2 contributes to toxin metabolism and by extension green mould disease resistance. PMID:25824278

Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity.

PubMed

Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, Michal; Lisá, Ludmila

2015-12-01

The strain Pleurotus ostreatus Florida f6, its 45 basidiospore-derived isolates (both monokaryons and dikaryons prepared in our laboratory), Trametes versicolor strain CCBAS 614 and 22 other T. versicolor isolates obtained from the sporocarps collected in distant localities were successfully preserved for 12 y using perlite and straw cryopreservation protocols. All tested isolates survived a 12-year storage in liquid nitrogen (LN) and their laccase production and Poly B411 decolorization capacity was preserved. Also mycelium extension rate and the types of colony appearance of individual isolates remained unchanged. Different cryopreservation techniques were also tested for the short time (24 h) and the long time (6 m) storage of the culture liquid with extracellular laccase produced by T. versicolor strain CCBAS 614. The results showed that 10 % glycerol was the most suitable cryopreservant. The absence of the cryopreservant did not cause high loss of laccase activity in the samples; the presence of DMSO (5 or 10 %) in LN-stored samples caused mostly a decrease of laccase activity. For the preservation of laccase activity in the liquid culture the storage in the freezer at -80 °C is more convenient than the storage in liquid nitrogen. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Investigation on electrochemical behavior and its catalytic effect on oxygen reduction reaction of 3-Ferrocenyl dihydropyrazole derivative as electron relay

NASA Astrophysics Data System (ADS)

Zeng, Han; Huo, Wen-Shan; Zhao, Shu-Xian; Zhang, Yu-He

2017-11-01

Amino group surface tailored multi-wall carbon nano-tubes were covalently tethered to the gold disk electrode and Laccase molecules were covalently coupled to nano-tubes to prepare Lac-based electrode. Derivative of 3-ferrocenyl dihydropyrazole (FDPFFP) was proposed to be electron mediator for mediated oxygen reduction reaction. Investigation in electro-chemical behavior and catalytic performance to enzymatic reaction of FDPFFP indicated that it displayed quasi-reversible characteristics of electro-chemical reaction with rapid dynamics of electron shuttle and had apparent catalytic effect in oxygen reduction (onset potential for catalysis at 450 mV vs NHE). This enzymatic catalysis was restrained by the step in diffusion of substrate.

Use of sugarcane molasses by Pycnoporus sanguineus for the production of laccase for dye decolorization.

PubMed

Marim, R A; Oliveira, A C C; Marquezoni, R S; Servantes, J P R; Cardoso, B K; Linde, G A; Colauto, N B; Valle, J S

2016-10-17

Pycnoporus sanguineus is a white-rot basidiomycete that produces laccase as the only oxidoreductase; enzyme synthesis depends on cultivation variables, and fungal species and strain. Laccases have wide substrate specificity, oxidize a broad range of compounds, and show potential for use in dye decolorization. We evaluated laccase production in a recently isolated strain of P. sanguineus cultivated with sugarcane molasses as the only carbon source, and urea or yeast extract as the nitrogen source [at various nitrogen concentrations (0.4, 1.4, 2.4, 3.4, and 4.4 g/L)], supplemented with copper (0, 150, 200, 250, and 300 µM), with or without agitation. The enzymatic extract produced at laccase peak activity was tested for dye decolorization capability on Remazol Brilliant Blue R, Reactive Black 5, Reactive Red 195, and Reactive Yellow 145. The nitrogen source did not affect enzyme production and the higher nitrogen concentration (3.4 g/L nitrogen as urea) increased enzymatic activity. The addition of up to 300 µM of Cu did not affect laccase production, whereas cultivation with agitation increased the activity peak by 17%. The highest laccase activity was ~50,000 U/L on the ninth day of cultivation. After 24 h, decolorization was 80% for Remazol Brilliant Blue R, 9% for Reactive Yellow 145, 6% for Reactive Red 195, and 2% for Reactive Black 5. The enzymatic extract of P. sanguineus provides a potential alternative to wastewater treatment. A better understanding of the behavior of this fungus under various culture conditions would allow improvement of the enzyme production bioprocess.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

Optimization of laccase production from Marasmiellus palmivorus LA1 by Taguchi method of Design of experiments.

PubMed

Chenthamarakshan, Aiswarya; Parambayil, Nayana; Miziriya, Nafeesathul; Soumya, P S; Lakshmi, M S Kiran; Ramgopal, Anala; Dileep, Anuja; Nambisan, Padma

2017-02-13

Fungal laccase has profound applications in different fields of biotechnology due to its broad specificity and high redox potential. Any successful application of the enzyme requires large scale production. As laccase production is highly dependent on medium components and cultural conditions, optimization of the same is essential for efficient product production. Production of laccase by fungal strain Marasmiellus palmivorus LA1 under solid state fermentation was optimized by the Taguchi design of experiments (DOE) methodology. An orthogonal array (L8) was designed using Qualitek-4 software to study the interactions and relative influence of the seven selected factors by one factor at a time approach. The optimum condition formulated was temperature (28 °C), pH (5), galactose (0.8%w/v), cupric sulphate (3 mM), inoculum concentration (number of mycelial agar pieces) (6Nos.) and substrate length (0.05 m). Overall yield increase of 17.6 fold was obtained after optimization. Statistical optimization leads to the elimination of an insignificant medium component ammonium dihydrogen phosphate from the process and contributes to a 1.06 fold increase in enzyme production. A final production of 667.4 ± 13 IU/mL laccase activity paves way for the application of this strain for industrial applications. Study optimized lignin degrading laccases from Marasmiellus palmivorus LA1. This laccases can thus be used for further applications in different scales of production after analyzing the properties of the enzyme. Study also confirmed the use of taguchi method for optimizations of product production.

Crystal structure of a four-copper laccase complexed with an arylamine: insights into substrate recognition and correlation with kinetics.

PubMed

Bertrand, Thomas; Jolivalt, Claude; Briozzo, Pierre; Caminade, Eliane; Joly, Nathalie; Madzak, Catherine; Mougin, Christian

2002-06-11

Laccases are multicopper oxidases that catalyze the oxidation of a wide range of phenols or arylamines, and their use in industrial oxidative processes is increasing. We purified from the white rot fungus Trametes versicolor a laccase that exists as five different isozymes, depending on glycosylation. The 2.4 A resolution structure of the most abundant isozyme of the glycosylated enzyme was solved. The four copper atoms are present, and it is the first crystal structure of a laccase in its active form. The crystallized enzyme binds 2,5-xylidine, which was used as a laccase inducer in the fungus culture. This arylamine is a very weak reducing substrate of the enzyme. The cavity enclosing 2,5-xylidine is rather wide, allowing the accommodation of substrates of various sizes. Several amino acid residues make hydrophobic interactions with the aromatic ring of the ligand. In addition, two charged or polar residues interact with its amino group. The first one is an histidine that also coordinates the copper that functions as the primary electron acceptor. The second is an aspartate conserved among fungal laccases. The purified enzyme can oxidize various hydroxylated compounds of the phenylurea family of herbicides that we synthesized. These phenolic substrates have better affinities at pH 5 than at pH 3, which could be related to the 2,5-xylidine binding by the aspartate. This is the first high-resolution structure of a multicopper oxidase complexed to a reducing substrate. It provides a model for engineering laccases that are either more efficient or with a wider substrate specificity.

Diversity of Ligninolytic Enzymes and Their Genes in Strains of the Genus Ganoderma: Applicable for Biodegradation of Xenobiotic Compounds?

PubMed Central

Torres-Farradá, Giselle; Manzano León, Ana M.; Rineau, François; Ledo Alonso, Lucía L.; Sánchez-López, María I.; Thijs, Sofie; Colpaert, Jan; Ramos-Leal, Miguel; Guerra, Gilda; Vangronsveld, Jaco

2017-01-01

White-rot fungi (WRF) and their ligninolytic enzymes (laccases and peroxidases) are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba). All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR)-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains. PMID:28588565

The novel role of fungal intracellular laccase: used to screen hybrids between Hypsizigus marmoreus and Clitocybe maxima by protoplasmic fusion.

PubMed

Xu, Jianzhong; Zhang, Junlan; Zhang, Weiguo; Hu, Kaihui

2012-08-01

Laccase has been proved important in decolorization of Remazol Brilliant Blue R (RBBR), oxidation of 2, 2'-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, lignin degradation and fruiting-body formation. The decolorization of RBBR by laccase was firstly used to screen protoplast fusants. Fusants were obtained by protoplast fusion between the strains of Hypsizigus marmoreus and Clitocybe maxima, and two fusants (IM1 and IIIM5) were screened on PDA medium containing RBBR. These fusants were significant higher in laccase activity than H. marmoreus, nearly 413 and 395 times, respectively. Their hyphal growth rates were also remarkable higher than H. marmoreus, nearly 1.5 and 1.4 times, respectively. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis showed these fusants contained the laccase, and the molecular mass of the laccase was consistent with the laccase of C. maxima, nearly 62 kDa. The pileus color of the IM1 and IIIM5 also showed partial recombined characteristics comparing to the parental strains, while biological efficiency ratios were prominent higher than that of H. marmoreus, up to 14.58 and 10.87 %, respectively. Randomly amplified polymorphic DNA bands of fusants not only were similar to parental bands, but presented new non-parental bands. Using the Unweighted pair-group method together with mathematic averages method to gain a dendrogram, in which the fusants showed intra-cluster variations. Significantly, H. marmoreus was the dominant parent, while C. maxima were distant from the fusants. The differences among IM1, IIIM5 and H. marmoreus, and the similarities among IM1, IIIM5 and C. maxima indicated IM1 and IIIM5 were somatic hybrids of H. marmoreus and C. maxima. Accordingly, it is feasible to use laccase to screen fusants of H. marmoreus and C. maxima.

Influence of Laccase and Tyrosinase on the Antioxidant Capacity of Selected Phenolic Compounds on Human Cell Lines.

PubMed

Riebel, Matthias; Sabel, Andrea; Claus, Harald; Fronk, Petra; Xia, Ning; Li, Huige; König, Helmut; Decker, Heinz

2015-09-18

Polyphenolic compounds affect the color, odor and taste of numerous food products of plant origin. In addition to the visual and gustatory properties, they serve as radical scavengers and have antioxidant effects. Polyphenols, especially resveratrol in red wine, have gained increasing scientific and public interest due to their presumptive beneficial impact on human health. Enzymatic oxidation of phenolic compounds takes place under the influence of polyphenol oxidases (PPO), including tyrosinase and laccase. Several studies have demonstrated the radical scavenger effect of plants, food products and individual polyphenols in vitro, but, apart from resveratrol, such impact has not been proved in physiological test systems. Furthermore, only a few data exist on the antioxidant capacities of the enzymatic oxidation products of phenolic compounds generated by PPO. We report here first results about the antioxidant effects of phenolic substances, before and after oxidation by fungal model tyrosinase and laccase. In general, the common chemical 2,2-diphenyl-1-picrylhydrazyl assay and the biological tests using two different types of cell cultures (monocytes and endothelial cells) delivered similar results. The phenols tested showed significant differences with respect to their antioxidant activity in all test systems. Their antioxidant capacities after enzymatic conversion decreased or increased depending on the individual PPO used.

Complete biodegradation of chlorpyrifos by engineered Pseudomonas putida cells expressing surface-immobilized laccases.

PubMed

Liu, Jin; Tan, Luming; Wang, Jing; Wang, Zhiyong; Ni, Hong; Li, Lin

2016-08-01

The long-term abuse use of chlorpyrifos-like pesticides in agriculture and horticulture has resulted in significant soil or water contamination and a worldwide ecosystem threat. In this study, the ability of a solvent-tolerant bacterium, Pseudomonas putida MB285, with surface-displayed bacterial laccase, to biodegrade chlorpyrifos was investigated. The results of compositional analyses of the degraded products demonstrate that the engineered MB285 was capable of completely eliminating chlorpyrifos via direct biodegradation, as determined by high-performance liquid chromatography and gas chromatography-mass spectrometry assays. Two intermediate metabolites, namely 3,5,6-trichloro-2-pyridinol (TCP) and diethyl phosphate, were temporarily detectable, verifying the joint and stepwise degradation of chlorpyrifos by surface laccases and certain cellular enzymes, whereas the purified free laccase incompletely degraded chlorpyrifos into TCP. The degradation reaction can be conducted over a wide range of pH values (2-7) and temperatures (5-55 °C) without the need for Cu(2+). Bioassays using Caenorhabditis elegans as an indicator organism demonstrated that the medium was completely detoxified of chlorpyrifos by degradation. Moreover, the engineered cells exhibited a high capacity of repeated degradation and good performance in continuous degradation cycles, as well as a high capacity to degrade real effluents containing chlorpyrifos. Therefore, the developed system exhibited a high degradation capacity and performance and constitutes an improved approach to address chlorpyrifos contamination in chlorpyrifos-remediation practice. Copyright © 2016 Elsevier Ltd. All rights reserved.

Laccases as palladium oxidases† †Electronic supplementary information (ESI) available: Experimental procedures, synthesis of catalysts molecules, enzyme activity assay, bleaching experiments, oxygraph traces, oxidation of veratryl alcohol assay, inhibition experiments, electrophoresis. See DOI: 10.1039/c4sc02564d Click here for additional data file.

PubMed Central

Schneider, Ludovic; Rousselot-Pailley, Pierre; Faure, Bruno; Simaan, A. Jalila; Bochot, Constance; Réglier, Marius

2015-01-01

The first example of a coupled catalytic system involving an enzyme and a palladium(ii) catalyst competent for the aerobic oxidation of alcohol in mild conditions is described. In the absence of dioxygen, the fungal laccase LAC3 is reduced by a palladium(0) species as evidenced by the UV/VIS and ESR spectra of the enzyme. During the oxidation of veratryl alcohol performed in water, at room temperature and atmospheric pressure, LAC3 regenerates the palladium catalyst, is reduced and catalyzes the four-electron reduction of dioxygen into water with no loss of enzyme activity. The association of a laccase with a water-soluble palladium complex results in a 7-fold increase in the catalytic efficiency of the complex. This is the first step in the design of a family of renewable palladium catalysts for aerobic oxidation. PMID:29560210

Lignolytic enzymes produced by Trametes villosa ccb176 under different culture conditions

PubMed Central

Yamanaka, Renata; Soares, Clarissa F.; Matheus, Dácio R.; Machado, Kátia M.G.

2008-01-01

The expression of the enzymatic system produced by basidiomycetous fungi, which is involved in the degradation of xenobiotics, mainly depends on culture conditions, especially of the culture medium composition. Trametes villosa is a strain with a proven biotechnological potential for the degradation of organochlorine compounds and for the decolorization of textile dyes. The influence of glucose concentration, addition of a vegetable oil-surfactant emulsion, nature of the surfactant and the presence of manganese and copper on the growth, pH and production of laccase, total peroxidase and manganese-dependent peroxidase activities were evaluated. In general, acidification of the medium was observed, with the pH reaching a value close to 3.5 within the first days of growth. Laccase was the main activity detected under the different conditions and was produced throughout the culture period of the fungus, irrespective of the growth phase. Supplementation of the medium with vegetable oil emulsified with a surfactant induced manganese-dependent peroxidase activity in T. villosa. Higher specific yields of laccase activity were obtained with the addition of copper. PMID:24031184

Enhancement of catalytic, reusability, and long-term stability features of Trametes versicolor IBL-04 laccase immobilized on different polymers.

PubMed

Asgher, Muhammad; Noreen, Sadia; Bilal, Muhammad

2017-02-01

In the current study, different bio-polymers such as agar-agar, polyacrylamide and gelatin were utilized as bolster materials for the immobilization of a fungal laccase through entrapment approach. Among the polymers, agar-agar matrix most firmly encapsulated the enzyme yielding significant laccase immobilization (79.65±2.55%). Immobilization prolonged the reaction time of laccase and agar-agar, polyacrylamide and gelatin entrapped laccases displayed maximum catalytic activities after 10.0, 15.0 and 10.0min of reaction, respectively, as compared to free counterpart (5.0min). It also increased the optimal temperature by 5.0-10°C and provided an alkaline shift of the pH optima to agar-agar and gelatin entrapped laccase, while, in case of polyacrylamide, optimum pH was displaced to acidic region. Kinetic data revealed that K m(app) values were slightly increased while V max values were decreased as compared to free counterpart. Polymers encapsulation led to significant improvement in activity against thermal denaturation. After 180min at 60°C, the enzymes preserved 28.1±0.9, 48.6±1.3 and 32.5±1.8% residual activities, respectively, whereas, the free enzyme was completely inactive. Immobilization enabled the enzymes to resist a number of different effectors including metal ions, inhibitors/denaturants and chelating agents. Moreover, the resulted modified laccases displayed good recycling capability for substrate-oxidation reactions in several successive batches. In summary, the tremendously improved attributes of polymers-encapsulated enzymes display a high potential for various applications in different industrial sectors. Copyright © 2016 Elsevier B.V. All rights reserved.

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

PubMed

Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

2011-10-01

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

D /Souza, T.M.; Merritt, C.S.; Reddy, C.A.

1999-12-01

Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units aremore » structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.« less

Preparation and Optimisation of Cross-Linked Enzyme Aggregates Using Native Isolate White Rot Fungi Trametes versicolor and Fomes fomentarius for the Decolourisation of Synthetic Dyes

PubMed Central

Vršanská, Martina; Voběrková, Stanislava; Jiménez Jiménez, Ana María; Strmiska, Vladislav; Adam, Vojtěch

2017-01-01

The key to obtaining an optimum performance of an enzyme is often a question of devising a suitable enzyme and optimisation of conditions for its immobilization. In this study, laccases from the native isolates of white rot fungi Fomes fomentarius and/or Trametes versicolor, obtained from Czech forests, were used. From these, cross-linked enzyme aggregates (CLEA) were prepared and characterised when the experimental conditions were optimized. Based on the optimization steps, saturated ammonium sulphate solution (75 wt.%) was used as the precipitating agent, and different concentrations of glutaraldehyde as a cross-linking agent were investigated. CLEA aggregates formed under the optimal conditions showed higher catalytic efficiency and stabilities (thermal, pH, and storage, against denaturation) as well as high reusability compared to free laccase for both fungal strains. The best concentration of glutaraldehyde seemed to be 50 mM and higher efficiency of cross-linking was observed at a low temperature 4 °C. An insignificant increase in optimum pH for CLEA laccases with respect to free laccases for both fungi was observed. The results show that the optimum temperature for both free laccase and CLEA laccase was 35 °C for T. versicolor and 30 °C for F. fomentarius. The CLEAs retained 80% of their initial activity for Trametes and 74% for Fomes after 70 days of cultivation. Prepared cross-linked enzyme aggregates were also investigated for their decolourisation activity on malachite green, bromothymol blue, and methyl red dyes. Immobilised CLEA laccase from Trametes versicolor showed 95% decolourisation potential and CLEA from Fomes fomentarius demonstrated 90% decolourisation efficiency within 10 h for all dyes used. These results suggest that these CLEAs have promising potential in dye decolourisation. PMID:29295505

Dehalogenation of Chlorinated Hydroxybiphenyls by Fungal Laccase

PubMed Central

Schultz, Asgard; Jonas, Ulrike; Hammer, Elke; Schauer, Frieder

2001-01-01

We have investigated the transformation of chlorinated hydroxybiphenyls by laccase produced by Pycnoporus cinnabarinus. The compounds used were transformed to sparingly water-soluble colored precipitates which were identified by gas chromatography-mass spectrometry as oligomerization products of the chlorinated hydroxybiphenyls. During oligomerization of 2-hydroxy-5-chlorobiphenyl and 3-chloro-4-hydroxybiphenyl, dechlorinated C—C-linked dimers were formed, demonstrating the dehalogenation ability of laccase. In addition to these nonhalogenated dimers, both monohalogenated and dihalogenated dimers were identified. PMID:11526052

Purification and characterization of the extracellular laccase produced by Trametes polyzona WR710-1 under solid-state fermentation.

PubMed

Chairin, Thanunchanok; Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko; Khanongnuch, Chartchai; Lumyong, Saisamorn

2014-01-01

Laccase from Trametes polyzona WR710-1 was produced under solid-state fermentation using the peel from the Tangerine orange (Citrus reticulata Blanco) as substrate, and purified to homogeneity. This laccase was found to be a monomeric protein with a molecular mass of about 71 kDa estimated by SDS-PAGE. The optimum pH was 2.0 for ABTS, 4.0 for L-DOPA, guaiacol, and catechol, and 5.0 for 2,6-DMP. The K(m) value of the enzyme for the substrate ABTS was 0.15 mM, its corresponding V(max) value was 1.84 mM min(-1), and the k(cat)/K(m) value was about 3960 s(-1)  mM(-1). The enzyme activity was stable between pH 6.0 and 8.0, at temperatures of up to 40 °C. The laccase was inhibited by more than 50% in the presence of 20 mM NaCl, by 95% at 5 mM of Fe(2+), and it was completely inhibited by 0.1 mM NaN(3). The N-terminal amino acid sequence of this laccase is AVTPVADLQISNAGISPDTF, which is highly similar to those of laccases from other white-rot basidiomycetes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Zhongchuan; Xie, Tian; Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of

2016-03-24

The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature ofmore » CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.« less

Laccase immobilization and insolubilization: from fundamentals to applications for the elimination of emerging contaminants in wastewater treatment.

PubMed

Ba, Sidy; Arsenault, Alexandre; Hassani, Thanina; Jones, J Peter; Cabana, Hubert

2013-12-01

Over the last few decades many attempts have been made to use biocatalysts for the biotransformation of emerging contaminants in environmental matrices. Laccase, a multicopper oxidoreductase enzyme, has shown great potential in oxidizing a large number of phenolic and non-phenolic emerging contaminants. However, laccases and more broadly enzymes in their free form are biocatalysts whose applications in solution have many drawbacks rendering them currently unsuitable for large scale use. To circumvent these limitations, the enzyme can be immobilized onto carriers or entrapped within capsules; these two immobilization techniques have the disadvantage of generating a large mass of non-catalytic product. Insolubilization of the free enzymes as cross-linked enzymes (CLEAs) is found to yield a greater volume ratio of biocatalyst while improving the characteristics of the biocatalyst. Ultimately, novel techniques of enzymes insolubilization and stabilization are feasible with the combination of cross-linked enzyme aggregates (combi-CLEAs) and enzyme polymer engineered structures (EPESs) for the elimination of emerging micropollutants in wastewater. In this review, fundamental features of laccases are provided in order to elucidate their catalytic mechanism, followed by different chemical aspects of the immobilization and insolubilization techniques applicable to laccases. Finally, kinetic and reactor design effects for enzymes in relation with the potential applications of laccases as combi-CLEAs and EPESs for the biotransformation of micropollutants in wastewater treatment are discussed.

Optimization of laccase production by Pleurotus ostreatus IMI 395545 using the Taguchi DOE methodology.

PubMed

Periasamy, Rathinasamy; Palvannan, Thayumanavan

2010-12-01

Production of laccase using a submerged culture of Pleurotus orstreatus IMI 395545 was optimized by the Taguchi orthogonal array (OA) design of experiments (DOE) methodology. This approach facilitates the study of the interactions of a large number of variables spanned by factors and their settings, with a small number of experiments, leading to considerable savings in time and cost for process optimization. This methodology optimizes the number of impact factors and enables to calculate their interaction in the production of industrial enzymes. Eight factors, viz. glucose, yeast extract, malt extract, inoculum, mineral solution, inducer (1 mM CuSO₄) and amino acid (l-asparagine) at three levels and pH at two levels, with an OA layout of L18 (2¹ × 3⁷) were selected for the proposed experimental design. The laccase yield obtained from the 18 sets of fermentation experiments performed with the selected factors and levels was further processed with Qualitek-4 software. The optimized conditions shared an enhanced laccase expression of 86.8% (from 485.0 to 906.3 U). The combination of factors was further validated for laccase production and reactive blue 221 decolorization. The results revealed an enhanced laccase yield of 32.6% and dye decolorization up to 84.6%. This methodology allows the complete evaluation of main and interaction factors. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Transcriptional and Enzymatic Profiling of Pleurotus ostreatus Laccase Genes in Submerged and Solid-State Fermentation Cultures

PubMed Central

Castanera, Raúl; Pérez, Gúmer; Omarini, Alejandra; Alfaro, Manuel; Pisabarro, Antonio G.; Faraco, Vincenza; Amore, Antonella

2012-01-01

The genome of the white rot basidiomycete Pleurotus ostreatus includes 12 phenol oxidase (laccase) genes. In this study, we examined their expression profiles in different fungal strains under different culture conditions (submerged and solid cultures) and in the presence of a wheat straw extract, which was used as an inducer of the laccase gene family. We used a reverse transcription-quantitative PCR (RT-qPCR)-based approach and focused on determining the reaction parameters (in particular, the reference gene set for the normalization and reaction efficiency determinations) used to achieve an accurate estimation of the relative gene expression values. The results suggested that (i) laccase gene transcription is upregulated in the induced submerged fermentation (iSmF) cultures but downregulated in the solid fermentation (SSF) cultures, (ii) the Lacc2 and Lacc10 genes are the main sources of laccase activity in the iSmF cultures upon induction with water-soluble wheat straw extracts, and (iii) an additional, as-yet-uncharacterized activity (Unk1) is specifically induced in SSF cultures that complements the activity of Lacc2 and Lacc10. Moreover, both the enzymatic laccase activities and the Lacc gene family transcription profiles greatly differ between closely related strains. These differences can be targeted for biotechnological breeding programs for enzyme production in submerged fermentation reactors. PMID:22467498

Electrochemical studies of a truncated laccase produced in Pichia pastoris

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.

1999-12-01

The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms ofmore » their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.« less

LACCASE Is Necessary and Nonredundant with PEROXIDASE for Lignin Polymerization during Vascular Development in Arabidopsis[C][W

PubMed Central

Zhao, Qiao; Nakashima, Jin; Chen, Fang; Yin, Yanbin; Fu, Chunxiang; Yun, Jianfei; Shao, Hui; Wang, Xiaoqiang; Wang, Zeng-Yu; Dixon, Richard A.

2013-01-01

The evolution of lignin biosynthesis was critical in the transition of plants from an aquatic to an upright terrestrial lifestyle. Lignin is assembled by oxidative polymerization of two major monomers, coniferyl alcohol and sinapyl alcohol. Although two recently discovered laccases, LAC4 and LAC17, have been shown to play a role in lignin polymerization in Arabidopsis thaliana, disruption of both genes only leads to a relatively small change in lignin content and only under continuous illumination. Simultaneous disruption of LAC11 along with LAC4 and LAC17 causes severe plant growth arrest, narrower root diameter, indehiscent anthers, and vascular development arrest with lack of lignification. Genome-wide transcript analysis revealed that all the putative lignin peroxidase genes are expressed at normal levels or even higher in the laccase triple mutant, suggesting that lignin laccase activity is necessary and nonredundant with peroxidase activity for monolignol polymerization during plant vascular development. Interestingly, even though lignin deposition in roots is almost completely abolished in the lac11 lac4 lac17 triple mutant, the Casparian strip, which is lignified through the activity of peroxidase, is still functional. Phylogenetic analysis revealed that lignin laccase genes have no orthologs in lower plant species, suggesting that the monolignol laccase genes diverged after the evolution of seed plants. PMID:24143805

Functional magnetic mesoporous nanoparticles for efficient purification of laccase from fermentation broth in magnetically stabilized fluidized bed.

PubMed

Wang, Feng; Guo, Chen; Liu, Chun-Zhao

2013-12-01

A magnetically stabilized fluidized bed (MSFB) with the Cu(2+)-chelated magnetic mesoporous silica nanoparticles (MMSNPs-Cu(2+)) was established to purify laccase directly from the fermentation broth of Trametes versicolor. The MMSNPs-Cu(2+) particles in the MSFB maintained a stable bed expansion of two to threefold at a flow rate of 120-180 cm/h. At the optimal magnetic field intensity of 120 Gs, both the maximal Bodenstein number and the smallest axial dispersion coefficient were achieved, which resulted in a stable fluidization stage. The dynamic binding capacity of laccase in the MSFB decreased from 192.5 to144.3 mg/g when the flow velocity through the bed increased from 44.2 to 69.8 cm/h. The MSFB with MMSNPs-Cu(2+) achieved efficient laccase purification from the fermentation broth with 62.4-fold purification of laccase and 108.9 % activity yield. These results provided an excellent platform for the application of these magnetic mesoporous nanoparticles integrated with the MSFB in developing novel protein purification process.

Enhanced the enzymatic hydrolysis efficiency of wheat straw after combined steam explosion and laccase pretreatment.

PubMed

Qiu, Weihua; Chen, Hongzhang

2012-08-01

Laccase, capable of selectively degrading lignin while keeping cellulose intact, has been widely applied for the modification and bio-bleaching of pulp. In this study Sclerotium sp. laccase (MSLac) was employed in combination with steam explosion to evaluate the effect of this treatment on cellulose hydrolysis. Combined steam explosion with laccase pretreatment enhanced the cellulose conversion rate of wheat straw no matter in the case of successive (MSLac-Cel) and simultaneous (MSLac+Cel) MSLac and cellulase hydrolysis. The highest cellulose conversion rate of 84.23% was obtained when steam-exploded wheat straw (SEWS) (1.3 MPa, 5 min) was treated by MSLac+Cel at a laccase loading of 0.55 U g(-1) substrate. FT-IR and SEM analyses indicated that MSLac oxidized the phenol and changed electron configuration of the ring, which contributed to loosening the compact wrap of lignin-carbohydrate complex and consequently enhancing the enzymatic hydrolysis efficiency of cellulose. This article provided a promising method for lignocellulose bio-pretreatment. Copyright © 2012 Elsevier Ltd. All rights reserved.

Ultrasound-intensified laccase production from Trametes versicolor.

PubMed

Wang, Feng; Ma, An-Zhou; Guo, Chen; Zhuang, Guo-Qiang; Liu, Chun-Zhao

2013-01-01

An efficient intermittent ultrasonic treatment strategy was developed to improve laccase production from Trametes versicolor mycelia cultures. The optimized strategy consisted of exposing 2-day-old mycelia cultures to 5-min ultrasonic treatments for two times with a 12-h interval at the fixed ultrasonic power and frequency (120 W, 40 kHz). After 5 days of culture, this strategy produced the highest extracellular laccase activity of 588.9 U/L among all treatments tested which was 1.8-fold greater than the control without ultrasound treatment. The ultrasonic treatment resulted in a higher pellet porosity that facilitated the mass transfer of nutrients and metabolites from the pellets to the surrounding liquid. Furthermore, the ultrasonic treatment induced the expression of the laccase gene (lcc), which correlated with a sharp increase in both extracellular and intracellular laccase activity. This is the first study to find positive effects of ultrasound on gene expression in fungal cells. These results provide a basis for understanding the stimulation of metabolite production and process intensification by ultrasonic treatment in filamentous fungal culture. Copyright © 2012 Elsevier B.V. All rights reserved.

Laccase produced by a thermotolerant strain of Trametes trogii LK13

PubMed Central

Yan, Jinping; Chen, Yuhui; Niu, Jiezhen; Chen, Daidi; Chagan, Irbis

2015-01-01

Thermophilic and thermotolerant micro-organisms strains have served as the natural source of industrially relevant and thermostable enzymes. Although some strains of the Trametes genus are thermotolerant, few Trametes strains were studied at the temperature above 30 °C until now. In this paper, the laccase activity and the mycelial growth rate for Trametes trogii LK13 are superior at 37 °C. Thermostability and organic cosolvent tolerance assays of the laccase produced at 37 °C indicated that the enzyme possessed fair thermostability with 50% of its initial activity at 80 °C for 5 min, and could remain 50% enzyme activity treated with organic cosolvent at the concentration range of 25%–50% (v/v). Furthermore, the test on production of laccase and lignocellulolytic enzymes showed the crude enzymes possessed high laccase level (1000 U g −1 ) along with low cellulose (2 U g −1 ) and xylanase (140 U g −1 ) activity. Thus, T. trogii LK13 is a potential strain to be applied in many biotechnological processes. PMID:26221089

Pilot-scale bioconversion of rice and sunflower agro-residues into medicinal mushrooms and laccase enzymes through solid-state fermentation with Ganoderma lucidum.

PubMed

Postemsky, P D; Bidegain, M A; González-Matute, R; Figlas, N D; Cubitto, M A

2017-05-01

Solid-state fermentation was evaluated at the pilot-scale for the bioconversion and valorization of rice husks and straw (RSH), or sunflower seed hulls (SSH), into medicinal mushrooms and crude extracts, with laccase activity. The average mushroom yield was 56kg dry weight per ton of agro-residues. Laccase activity in crude aqueous extracts showed its maximum value of 10,927Ukg -1 in RSH (day 10, Exudate phase) and 16,442Ukg -1 in SSH (day 5, Full colonization phase), the activity at the Residual substrate phase being 511Ukg -1 in RSH and 803Ukg -1 in SSH, respectively. Crude extracts obtained with various protocols revealed differences in the extraction yields. Lyophilization followed by storage at 4°C allowed the preservation of laccase activity for more than one month. It is proposed that standard mushroom farms could increase their profits by obtaining laccase as a byproduct during the gaps in mycelium running. Copyright © 2017 Elsevier Ltd. All rights reserved.

Laccase production by Coriolopsis caperata RCK2011: Optimization under solid state fermentation by Taguchi DOE methodology

PubMed Central

Nandal, Preeti; Ravella, Sreenivas Rao; Kuhad, Ramesh Chander

2013-01-01

Laccase production by Coriolopsis caperata RCK2011 under solid state fermentation was optimized following Taguchi design of experiment. An orthogonal array layout of L18 (21 × 37) was constructed using Qualitek-4 software with eight most influensive factors on laccase production. At individual level pH contributed higher influence, whereas, corn steep liquor (CSL) accounted for more than 50% of the severity index with biotin and KH2PO4 at the interactive level. The optimum conditions derived were; temperature 30°C, pH 5.0, wheat bran 5.0 g, inoculum size 0.5 ml (fungal cell mass = 0.015 g dry wt.), biotin 0.5% w/v, KH2PO4 0.013% w/v, CSL 0.1% v/v and 0.5 mM xylidine as an inducer. The validation experiments using optimized conditions confirmed an improvement in enzyme production by 58.01%. The laccase production to the level of 1623.55 Ugds−1 indicates that the fungus C. caperata RCK2011 has the commercial potential for laccase. PMID:23463372

Biodegradation of polycyclic aromatic hydrocarbons (PAHs) by laccase from Trametes versicolor covalently immobilized on amino-functionalized SBA-15.

PubMed

Bautista, Luis Fernando; Morales, Gabriel; Sanz, Raquel

2015-10-01

A covalent immobilization method based on glutaraldehyde and amino-functionalized SBA-15 supports has been successfully applied to covalently and stably immobilize laccase from Trametes versicolor. The resultant biocatalysts displayed high incorporation yields of enzyme and led to excellent biodegradation rates of selected HPAs models, i.e. naphthalene, phenanthrene and anthracene, in water. The nature of the hydrocarbon chain accompanying the amino group has been shown as determinant for the immobilization as well as for the activity and reusability of the materials. Thus, alkyl moieties displayed higher enzyme loadings than phenyl moieties, being more adequate the larger n-butyl tethering residue likely due to its higher mobility. Using the aminobutyl-based laccase-SBA-15, 82%, 73%, and 55% conversion of naphthalene, phenanthrene and anthracene, respectively, were achieved after 48 h, very close to the values obtained with free laccase under the same reaction conditions. On the other hand, aminopropyl-based laccase-SBA-15 biocatalysts displayed the best reusability properties, retaining higher activity after four repeated uses than the corresponding aminobutyl-based materials. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effects of laccase on lignin depolymerization and enzymatic hydrolysis of ensiled corn stover.

PubMed

Chen, Qin; Marshall, Megan N; Geib, Scott M; Tien, Ming; Richard, Tom L

2012-08-01

The aim of this study was to explore the synergies of laccase, a ligninolytic enzyme, with cellulose and hemicellulase amendments on ensiled corn stover. Molecular signals of lignin decomposition were observed by tetramethylammonium hydroxide thermochemolysis and gas chromatography-mass spectroscopy (TMAH-GC-MS) analysis. The significant findings suggest that ensilage might provide a platform for biological pretreatment. By partially hydrolyzing cellulose and hemicellulose into soluble sugars, ensilage facilitates laccase penetration into the lignocellulose complex to enhance lignin degradation. Downstream cellulose hydrolysis was improved 7% with increasing laccase loading rate. These results demonstrate the potential of enzymes, either directly amended or expressed by microbes during ensilage, to maximize utilization of corn stover for cellulosic biofuels and other downstream fermentations. Copyright © 2012. Published by Elsevier Ltd.

Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

2007-12-01

The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

Production of laccase from Trametes versicolor by solid-state fermentation using olive leaves as a phenolic substrate.

PubMed

Aydinoğlu, Tuğba; Sargin, Sayit

2013-02-01

The aim of the present study was to investigate whether olive leaves were feasible as a substrate for laccase production by the white-rot fungus Trametes versicolor FPRL 28A INI under solid-state fermentation conditions. Different experiments were conducted to select the variables that allow obtaining high levels of laccase activity. In particular, the effects of the initial moisture content, substrate particle size, supplementation with inorganic and organic nitrogen sources were evaluated. Highest laccase activity (276.62 ± 25.67 U/g dry substrate) was achieved with 80 % initial moisture content and 1.4-1.6 mm particle size of the substrate supplemented with yeast extract (1 % (w/w) nitrogen). Such a high activity was obtained without any addition of inducers.

Location of laccase in ordered mesoporous materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Location of laccase in ordered mesoporous materials

NASA Astrophysics Data System (ADS)

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

2014-11-01

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Copper and dyes enhance laccase production in gamma-proteobacterium JB.

PubMed

Malhotra, Kanam; Sharma, Prince; Capalash, Neena

2004-07-01

Laccase production in gamma-proteobacterium JB was enhanced 13-fold by adding 0.1 mM CuSO(4) 24 h after the onset of growth. Ethidium bromide (2.5 microM), Malachite Green, Phenol Red and Thymol Blue (10 microM each) enhanced laccase production 17-, 19-, 4- and 2-fold, respectively. Among the fourteen aromatic/organic compounds tried, p-aminobenzoic acid and an industrial effluent, from where the organism was isolated, showed 1.2- and 1.26-fold increases in production.

Induction of fungal laccase production under solid state bioprocessing of new agroindustrial waste and its application on dye decolorization.

PubMed

Akpinar, Merve; Ozturk Urek, Raziye

2017-06-01

Lignocellulosic wastes are generally produced in huge amounts worldwide. Peach waste of these obtained from fruit juice industry was utilized as the substrate for laccase production by Pleurotus eryngii under solid state bioprocessing (SSB). Its chemical composition was determined and this bioprocess was carried out under stationary conditions at 28 °C. The effects of different compounds; copper, iron, Tween 80, ammonium nitrate and manganese, and their variable concentrations on laccase production were investigated in detail. The optimum production of laccase (43,761.33 ± 3845 U L -1 ) was achieved on the day of 20 by employing peach waste of 5.0 g and 70 µM Cu 2+ , 18 µM Fe 2+ , 0.025% (v/v) Tween 80, 4.0 g L -1 ammonium nitrate, 750 µM Mn 2+ as the inducers. The dye decolorization also researched to determine the degrading capability of laccase produced from peach culture under the above-mentioned conditions. Within this scope of the study, methyl orange, tartrazine, reactive red 2 and reactive black dyes were treated with this enzyme. The highest decolorization was performed with methyl orange as 43 ± 2.8% after 5 min of treatment when compared to other dyes. Up to now, this is the first report on the induction of laccase production by P. eryngii under SSB using peach waste as the substrate.

Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris

PubMed Central

Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.

1999-01-01

The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI→LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10−4 cm s−1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

Hydrogen peroxide produced by glucose oxidase affects the performance of laccase cathodes in glucose/oxygen fuel cells: FAD-dependent glucose dehydrogenase as a replacement.

PubMed

Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

2013-11-28

Hydrogen peroxide production by glucose oxidase (GOx) and its negative effect on laccase performance have been studied. Simultaneously, FAD-dependent glucose dehydrogenase (FAD-GDH), an O2-insensitive enzyme, has been evaluated as a substitute. Experiments focused on determining the effect of the side reaction of GOx between its natural electron acceptor O2 (consumed) and hydrogen peroxide (produced) in the electrolyte. Firstly, oxygen consumption was investigated by both GOx and FAD-GDH in the presence of substrate. Relatively high electrocatalytic currents were obtained with both enzymes. O2 consumption was observed with immobilized GOx only, whilst O2 concentration remained stable for the FAD-GDH. Dissolved oxygen depletion effects on laccase electrode performances were investigated with both an oxidizing and a reducing electrode immersed in a single compartment. In the presence of glucose, dramatic decreases in cathodic currents were recorded when laccase electrodes were combined with a GOx-based electrode only. Furthermore, it appeared that the major loss of performance of the cathode was due to the increase of H2O2 concentration in the bulk solution induced laccase inhibition. 24 h stability experiments suggest that the use of O2-insensitive FAD-GDH as to obviate in situ peroxide production by GOx is effective. Open-circuit potentials of 0.66 ± 0.03 V and power densities of 122.2 ± 5.8 μW cm(-2) were observed for FAD-GDH/laccase biofuel cells.

A designed bifunctional laccase/β-1,3-1,4-glucanase enzyme shows synergistic sugar release from milled sugarcane bagasse.

PubMed

Furtado, G P; Ribeiro, L F; Lourenzoni, M R; Ward, R J

2013-01-01

A bifunctional enzyme has been created by fusing two Bacillus subtilis enzymes: the β-1,3-1,4-glucanase (BglS, EC 3.2.1.73) that hydrolyzes plant cell wall β-glucans and the copper-dependent oxidase laccase (CotA, EC 1.10.3.2) that catalyzes the oxidation of aromatic compounds with simultaneous reduction of oxygen to water. The chimeric laccase/β-1,3-1,4-glucanase was created by insertion fusion of the bglS and cotA genes, and expressed in Escherichia coli. The affinity-purified recombinant chimeric enzyme showed both laccase and glucanase activities, with a maximum laccase activity at pH 4.5 and 75°C that showed a V(max) 30% higher than observed for the parental laccase. The maximum glucanase activity in the chimeric enzyme was at pH 6.0 and 50°C, with a slight reduction in V(max) by ∼10% compared with the parental glucanase. A decreased K(M) resulted in an overall increase in the K(cat)/K(M) value for the glucanase activity of the chimeric enzyme. The hydrolytic activity of the chimera was 20% higher against natural milled sugarcane bagasse as compared with equimolar mixtures of the separate parental enzymes. Molecular dynamics simulations indicated the approximation of the two catalytic domains in the chimeric enzyme, and the formation of an inter-domain interface may underlie the improved catalytic function.

Kinetic evidence for the interactive inhibition of laccase from Trametes versicolor by pH and chloride.

PubMed

Raseda, Nasrin; Hong, Soonho; Kwon, O Yul; Ryu, Keungarp

2014-12-28

The interactive inhibitory effects of pH and chloride on the catalysis of laccase from Trametes versicolor were investigated by studying the alteration of inhibition characteristics of sodium chloride at different pHs for the oxidation of 2,2'-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid). At pH 3.0, the addition of sodium chloride (50 mM) brought about a 40-fold increase in Km(app) and a 4-fold decrease in Vmax(app). As the pH increased to 7.0, the inhibitory effects of sodium chloride became significantly weakened. The mixed-inhibition mechanism was successfully used to quantitatively estimate the competitive and uncompetitive inhibition strengths by chloride at two different pHs (pH 3.0 and 6.0). At pH 3.0, the competitive inhibition constant, Ki, was 0.35 mM, whereas the uncompetitive inhibition constant, Ki', was 18.1 mM, indicating that the major cause of the laccase inhibition by chloride is due to the competitive inhibition step. At a higher pH of 6.0, where the inhibition of the laccase by hydroxide ions takes effect, the inhibition of the laccase by chloride diminished to a great extent, showing increased values of both the competitive inhibition constant (Ki= 23.7 mM) and uncompetitive inhibition constant (Ki' = 324 mM). These kinetic results evidenced that the hydroxide anion and chloride share a common mechanism to inhibit the laccase activity.

Advanced Synthesis of Conductive Polyaniline Using Laccase as Biocatalyst.

PubMed

de Salas, Felipe; Pardo, Isabel; Salavagione, Horacio J; Aza, Pablo; Amougi, Eleni; Vind, Jesper; Martínez, Angel T; Camarero, Susana

2016-01-01

Polyaniline is a conductive polymer with distinctive optical and electrical properties. Its enzymatic synthesis is an environmentally friendly alternative to the use of harsh oxidants and extremely acidic conditions. 7D5L, a high-redox potential laccase developed in our lab, is the biocatalyst of choice for the synthesis of green polyaniline (emeraldine salt) due to its superior ability to oxidize aniline and kinetic stability at the required polymerization conditions (pH 3 and presence of anionic surfactants) as compared with other fungal laccases. Doses as low as 7.6 nM of 7D5L catalyze the polymerization of 15 mM aniline (in 24 h, room temperature, 7% yield) in the presence of different anionic surfactants used as doping templates to provide linear and water-soluble polymers. Aniline polymerization was monitored by the increase of the polaron absorption band at 800 nm (typical for emeraldine salt). Best polymerization results were obtained with 5 mM sodium dodecylbenzenesulfonate (SDBS) as template. At fixed conditions (15 mM aniline and 5mM SDBS), polymerization rates obtained with 7D5L were 2.5-fold the rates obtained with commercial Trametes villosa laccase. Moreover, polyaniline yield was notably boosted to 75% by rising 7D5L amount to 0.15 μM, obtaining 1g of green polyaniline in 1L-reaction volume. The green polymer obtained with the selected system (7D5L/SDBS) holds excellent electrochemical and electro-conductive properties displayed in water-dispersible nanofibers, which is advantageous for the nanomaterial to be readily cast into uniform films for different applications.

Polyphenoloxidases immobilized in organic gels: Properties and applications in the detoxification of aromatic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crecchio, C.; Ruggiero, P.; Pizzigallo, M.D.R.

1995-12-20

Gelatine gels originate from water in oil microemulsions in which the ternary system consists of isooctane/sulfosuccinic acid bis [2-ethyl hexyl] ester/water; the solubilization of gelatin in the water pool of these microemulsions transforms them into viscous gels in which it is possible to cosolubilize various reactive molecules. These gels were used to immobilize two phenoloxidases, a laccase from Trametes versicolor and a tyrosinase from mushroom. The best balance between gel retention and catalytic activity was reached at a gelatine concentration of 2.5% (w/v) in the case of tyrosinase, while laccase immobilization was independent of gelatine concentration. Both enzymes kept themore » same optimum pH as the corresponding soluble controls, while a partial loss of activity was observed when they were immobilized. Immobilized enzymes showed an increased stability when incubated for several days at 4 C with a very low release from the gels in the incubation solutions. The immobilization of tyrosinase and of laccase enhanced stability to thermal inactivation. Furthermore, gel-entrapped tyrosinase was almost completely preserved from proteolysis: more than 80% of the activity was maintained, while only 25% of the soluble control activity was detected after the same proteolytic treatments. A column packed with gel-immobilized tyrosinase was used to demonstrate that enzymes immobilized with this technique may be reused several times in the same reaction without loosing their efficiency. Finally, gel-entrapped tyrosinase and laccase were capable of removing naturally occurring and xenobiotic aromatic compounds from aqueous suspensions with different degrees of efficiency.« less

Advanced Synthesis of Conductive Polyaniline Using Laccase as Biocatalyst

PubMed Central

de Salas, Felipe; Pardo, Isabel; Salavagione, Horacio J.; Aza, Pablo; Amougi, Eleni; Vind, Jesper; Martínez, Angel T.; Camarero, Susana

2016-01-01

Polyaniline is a conductive polymer with distinctive optical and electrical properties. Its enzymatic synthesis is an environmentally friendly alternative to the use of harsh oxidants and extremely acidic conditions. 7D5L, a high-redox potential laccase developed in our lab, is the biocatalyst of choice for the synthesis of green polyaniline (emeraldine salt) due to its superior ability to oxidize aniline and kinetic stability at the required polymerization conditions (pH 3 and presence of anionic surfactants) as compared with other fungal laccases. Doses as low as 7.6 nM of 7D5L catalyze the polymerization of 15 mM aniline (in 24 h, room temperature, 7% yield) in the presence of different anionic surfactants used as doping templates to provide linear and water-soluble polymers. Aniline polymerization was monitored by the increase of the polaron absorption band at 800 nm (typical for emeraldine salt). Best polymerization results were obtained with 5 mM sodium dodecylbenzenesulfonate (SDBS) as template. At fixed conditions (15 mM aniline and 5mM SDBS), polymerization rates obtained with 7D5L were 2.5-fold the rates obtained with commercial Trametes villosa laccase. Moreover, polyaniline yield was notably boosted to 75% by rising 7D5L amount to 0.15 μM, obtaining 1g of green polyaniline in 1L-reaction volume. The green polymer obtained with the selected system (7D5L/SDBS) holds excellent electrochemical and electro-conductive properties displayed in water-dispersible nanofibers, which is advantageous for the nanomaterial to be readily cast into uniform films for different applications. PMID:27741301

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

PubMed Central

Kües, Ursula; Rühl, Martin

2011-01-01

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Enhanced performance of immobilized laccase in electrospun fibrous membranes by carbon nanotubes modification and its application for bisphenol A removal from water.

PubMed

Dai, Yunrong; Yao, Jun; Song, Yonghui; Liu, Xiaoling; Wang, Siyu; Yuan, Yu

2016-11-05

Multi-walled carbon nanotubes (MWCNTs) were used as modified materials to improve the performance of laccase-carrying electrospun fibrous membranes (LCEFMs). The MWCNTs modified LCEFMs (MWCNTs-LCEFMs) were successfully fabricated via emulsion electrospinning, with active laccase and MWCNTs encapsulated inside the fibers. After modified by an optimal amount (1.5wt%, vs. polymer) of MWCNTs, the obtained MWCNTs-LCEFMs showed not only higher activity recovery (85.3%, vs. free laccase) than LCEFMs (71.2%), but also better storage and operational stability, which were mainly attributed to the promoted electron transfer in laccase-catalytic reaction. Furthermore, the specific surface area and tensile strength of MWCNTs-LCEFMs have also been enhanced nearly 2 and 3 times than those of LCEFMs, respectively. The MWCNTs-LCEFMs were applied to remove the widespread bisphenol A from water, where their removal efficiency reached above 90%, with the degradation efficiency accounting for over 80%, and their adsorption efficiency increased about 45% than that of LCEFMs. In addition, the endurances of MWCNTs-LCEFMs to environmental factors such as pH and temperature were also improved. Copyright © 2016 Elsevier B.V. All rights reserved.

Sonochemical and hydrodynamic cavitation reactors for laccase/hydrogen peroxide cotton bleaching.

PubMed

Gonçalves, Idalina; Martins, Madalena; Loureiro, Ana; Gomes, Andreia; Cavaco-Paulo, Artur; Silva, Carla

2014-03-01

The main goal of this work is to develop a novel and environmental-friendly technology for cotton bleaching with reduced processing costs. This work exploits a combined laccase-hydrogen peroxide process assisted by ultrasound. For this purpose, specific reactors were studied, namely ultrasonic power generator type K8 (850 kHz) and ultrasonic bath equipment Ultrasonic cleaner USC600TH (45 kHz). The optimal operating conditions for bleaching were chosen considering the highest levels of hydroxyl radical production and the lowest energy input. The capacity to produce hydroxyl radicals by hydrodynamic cavitation was also assessed in two homogenizers, EmulsiFlex®-C3 and APV-2000. Laccase nanoemulsions were produced by high pressure homogenization using BSA (bovine serum albumin) as emulsifier. The bleaching efficiency of these formulations was tested and the results showed higher whiteness values when compared to free laccase. The combination of laccase-hydrogen peroxide process with ultrasound energy produced higher whiteness levels than those obtained by conventional methods. The amount of hydrogen peroxide was reduced 50% as well as the energy consumption in terms of temperature (reduction of 40 °C) and operating time (reduction of 90 min). Copyright © 2013 Elsevier Inc. All rights reserved.

An acid-stable bacterial laccase identified from the endophyte Pantoea ananatis Sd-1 genome exhibiting lignin degradation and dye decolorization abilities.

PubMed

Shi, Xiaowei; Liu, Qian; Ma, Jiangshan; Liao, Hongdong; Xiong, Xianqiu; Zhang, Keke; Wang, Tengfei; Liu, Xuanmin; Xu, Ting; Yuan, Shanshan; Zhang, Xin; Zhu, Yonghua

2015-11-01

Isolation and identification of a novel laccase (namely Lac4) with various industrial applications potentials from an endophytical bacterium. Endophyte Sd-1 cultured in rice straw showed intra- and extra-cellular laccase activities. Genomic analysis of Sd-1 identified four putative laccases, Lac1 to Lac4. However, only Lac4 contains the complete signature sequence of laccase and shares at most 64 % sequence identity with other characterized bacterial multi-copper oxidases. Recombinant Lac4 can oxidize non-phenolic and phenolic compounds under acidic conditions and at 30-50 °C; Km values of Lac4 for ABTS at pH 2.5 and for guaiacol at pH 4.5 were 1 ± 0.15 and 6.1 ± 1.7 mM, respectively. The activity of Lac4 was stimulated by 0.8 mM Cu(2+) and 5 mM Fe(2+). In addition, Lac4 could decolorize various synthetic dyes and exhibit the degradation rate of 38 % for lignin. The data suggest that Lac4 possesses promising biotechnological potentials.

Banana peel: a potential substrate for laccase production by Aspergillus fumigatus VkJ2.4.5 in solid-state fermentation.

PubMed

Vivekanand, V; Dwivedi, Pallavi; Pareek, Nidhi; Singh, Rajesh P

2011-09-01

In solid-state fermentation, among various solid supports evaluated, banana peel was found to be an ideal support and resulted into higher levels of laccase (6281.4 ± 63.60 U l(-1)) along with notable levels of manganese peroxidase production (1339.0 ± 131.23 U l(-1)) by Aspergillus fumigatus VkJ2.4.5. Maximum levels of laccase was achieved under derived conditions consisting of 80% of moisture level, 6 days of incubation period, 6% inoculum level, and an aeration level of 2.5 l min(-1). A column-tray bioreactor was designed to scale up and economize the enzyme production in three successive cycles of fermentation using the same fungal biomass. Thermal and pH stability profiles revealed that enzyme was stable up to 50°C and at varying pH range from 5-9 for up to 2 h. The apparent molecular weight of laccase was found to be 34 ± 1 kDa. MALDI-TOF/TOF analysis of the protein showed significant homology with maximum identity of 67% to other laccases reported in database.

A New Laccase Based Biosensor for Tartrazine.

PubMed

Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu

2017-12-09

Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM ( R ² = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis.

A New Laccase Based Biosensor for Tartrazine

PubMed Central

Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu

2017-01-01

Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM (R2 = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis. PMID:29232842

Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition

USGS Publications Warehouse

Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

2007-01-01

The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

Methods for Purifying Enzymes for Mycoremediation

NASA Technical Reports Server (NTRS)

Cullings, Kenneth W. (Inventor); DeSimone, Julia C. (Inventor); Paavola, Chad D. (Inventor)

2014-01-01

A process for purifying laccase from an ectomycorrhizal fruiting body is disclosed. The process includes steps of homogenization, sonication, centrifugation, filtration, affinity chromatography, ion exchange chromatography, and gel filtration. Purified laccase can also be separated into isomers.

Comparative analyses of laccase-catalyzed amination reactions for production of novel β-lactam antibiotics.

PubMed

Mikolasch, Annett; Manda, Katrin; Schlüter, Rabea; Lalk, Michael; Witt, Sabine; Seefeldt, Simone; Hammer, Elke; Schauer, Frieder; Jülich, Wolf-Dieter; Lindequist, Ulrike

2012-01-01

Seven novel β-lactam antibiotics with activities against Gram-positive bacterial strains, among them methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci, were synthesized by amination of 2,5-dihydroxyphenylacetic acid in usable yields (30-60%). These products protected mice against an infection with S. aureus lethal to the control animals. The results show the usefulness of laccase for the synthesis of potential new antibiotics, in addition to the interdependence of the laccase substrates, the amino coupling partners, and the product formation, yield, and activity. The syntheses of β-lactam antibiotics with 2,5-dihydroxyaromatic acid substructures (para-substituted) are then compared with those of 3,4-dihydroxyaromatic acid substructures (ortho-substituted). Para-substituted laccase substrates were better reaction partners in these syntheses than ortho-substituted compounds. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

Electrochemical Study and Characterization of an Amperometric Biosensor Based on the Immobilization of Laccase in a Nanostructure of TiO₂ Synthesized by the Sol-Gel Method.

PubMed

Romero-Arcos, Mariana; Garnica-Romo, Ma Guadalupe; Martínez-Flores, Héctor Eduardo

2016-07-07

Laccase amperometric biosensors were developed to detect the catechol compound. The laccase enzyme (LAC) immobilization was performed on nanostructures of (a) titania (TiO₂); (b) titania/Nafion (TiO₂/NAF) (both immobilized by the sol-gel method) and a third nanostructure, which consisted of a single biosensor composite of Nafion and laccase enzyme denoted as NAF/LAC. The Nafion was deposited on a graphite electrode and used to avoid "cracking" on the matrix. The TiO₂ particle size was an average of 66 nm. FTIR spectroscopy vibration modes of different composites were determined. The electrochemical behavior of the biosensor was studied using electrochemical spectroscopy (EIS) and cyclic voltammetry (CV). The biosensor based on TiO₂/NAF/LAC presented the best electro-chemical properties with regard to sensitivity, stability and detection limit after a period of 22 days.

Crystal structures of E. coli laccase CueO at different copper concentrations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Xu; Wei Zhiyi; National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101

2007-03-02

CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra {alpha}-helixmore » from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper.« less

Pulse-radiolysis studies on the interaction of one-electron reduced species with blue oxidases. Reduction of native and type-2-copper-depleted Vietnamese-lacquer-tree and Japanese-lacquer-tree laccases.

PubMed

O'Neill, P; Fielden, E M; Morpurgo, L; Agostinelli, E

1984-08-15

The interactions of one-electron reduced metronidazole (ArNO2.-) and O2.- with native and Type-2-copper-depleted Vietnamese- and Japanese-lacquer-tree laccases were studied in aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. On reaction with ArNO2.-, in the absence of O2, the holo- and the Type-2-copper-depleted proteins accept, with reduction of Type 1 copper, 2 and 1 reducing equivalents respectively. On reaction with O2.- of both holo- and Type-2-copper-depleted Vietnamese-lacquer-tree laccase, almost complete reduction of Type 1 copper was observed and, after completion of the reaction, some (less than 20%) reoxidation of Type 1 copper occurs. Reduction of Type 1 copper of the laccases by these one-electron donors occurs via a bimolecular step; however, the rate of reduction of Vietnamese-lacquer-tree laccase is over 10 times that of Japanese-lacquer-tree laccase. It is inferred that electrons enter the protein via Type 1 copper with, in the case of the holoprotein, subsequent rapid intramolecular transfer of 1 reducing equivalent within the protein. Furthermore it is suggested that intra-molecular electron transfer to Type 3 copper atoms is slow and, in the case of Type-2-copper-depleted protein, may not occur. This slow process may partially account for the variation of the catalytic activities of 'blue' oxidases.

Effect of growth substrate, method of fermentation, and nitrogen source on lignocellulose-degrading enzymes production by white-rot basidiomycetes.

PubMed

Elisashvili, Vladimir; Kachlishvili, Eva; Penninckx, Michel

2008-11-01

The exploration of seven physiologically different white rot fungi potential to produce cellulase, xylanase, laccase, and manganese peroxidase (MnP) showed that the enzyme yield and their ratio in enzyme preparations significantly depends on the fungus species, lignocellulosic growth substrate, and cultivation method. The fruit residues were appropriate growth substrates for the production of hydrolytic enzymes and laccase. The highest endoglucanase (111 U ml(-1)) and xylanase (135 U ml(-1)) activities were revealed in submerged fermentation (SF) of banana peels by Pycnoporus coccineus. In the same cultivation conditions Cerrena maxima accumulated the highest level of laccase activity (7,620 U l(-1)). The lignified materials (wheat straw and tree leaves) appeared to be appropriate for the MnP secretion by majority basidiomycetes. With few exceptions, SF favored to hydrolases and laccase production by fungi tested whereas SSF was appropriate for the MnP accumulation. Thus, the Coriolopsis polyzona hydrolases activity increased more than threefold, while laccase yield increased 15-fold when tree leaves were undergone to SF instead SSF. The supplementation of nitrogen to the control medium seemed to have a negative effect on all enzyme production in SSF of wheat straw and tree leaves by Pleurotus ostreatus. In SF peptone and ammonium containing salts significantly increased C. polyzona and Trametes versicolor hydrolases and laccase yields. However, in most cases the supplementation of media with additional nitrogen lowered the fungi specific enzyme activities. Especially strong repression of T. versicolor MnP production was revealed.

Distribution, diversity and abundance of bacterial laccase-like genes in different particle size fractions of sediments in a subtropical mangrove ecosystem.

PubMed

Luo, Ling; Zhou, Zhi-Chao; Gu, Ji-Dong

2015-10-01

This study investigated the diversity and abundance of bacterial lacasse-like genes in different particle size fractions, namely sand, silt, and clay of sediments in a subtropical mangrove ecosystem. Moreover, the effects of nutrient conditions on bacterial laccase-like communities as well as the correlation between nutrients and, both the abundance and diversity indices of laccase-like bacteria in particle size fractions were also studied. Compared to bulk sediments, Bacteroidetes, Caldithrix, Cyanobacteria and Chloroflexi were dominated in all 3 particle-size fractions of intertidal sediment (IZ), but Actinobacteria and Firmicutes were lost after the fractionation procedures used. The diversity index of IZ fractions decreased in the order of bulk > clay > silt > sand. In fractions of mangrove forest sediment (MG), Verrucomicrobia was found in silt, and both Actinobacteria and Bacteroidetes appeared in clay, but no new species were found in sand. The declining order of diversity index in MG fractions was clay > silt > sand > bulk. Furthermore, the abundance of lacasse-like bacteria varied with different particle-size fractions significantly (p < 0.05), and decreased in the order of sand > clay > silt in both IZ and MG fractions. Additionally, nutrient availability was found to significantly affect the diversity and community structure of laccase-like bacteria (p < 0.05), while the total organic carbon contents were positively related to the abundance of bacterial laccase-like genes in particle size fractions (p < 0.05). Therefore, this study further provides evidence that bacterial laccase plays a vital role in turnover of sediment organic matter and cycling of nutrients.

Biofunctionalization of multiwalled carbon nanotubes by irradiation of electropolymerized poly(pyrrole-diazirine) films.

PubMed

Papper, Vladislav; Gorgy, Karine; Elouarzaki, Kamal; Sukharaharja, Ayrine; Cosnier, Serge; Marks, Robert S

2013-07-15

A photoactivatable poly(pyrrole-diazirine) film was synthesized and electropolymerized as a versatile tool for covalent binding of laccase and glucose oxidase on multiwalled carbon nanotube coatings and Pt, respectively. Irradiation of the functionalized nanotubes allowed photochemical grafting of laccase and its subsequent direct electrical wiring, as illustrated by the electrocatalytic reduction of oxygen. Moreover, covalent binding of glucose oxidase as model enzyme, achieved by UV activation of electropolymerized pyrrole-diazirine, allowed a glucose biosensor to be realized. This original method to graft biomolecules combines electrochemical and photochemical techniques. The simplicity of this new method allows it to be extended easily to other biological systems. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bioelectrochemical oxidation of water.

PubMed

Pita, Marcos; Mate, Diana M; Gonzalez-Perez, David; Shleev, Sergey; Fernandez, Victor M; Alcalde, Miguel; De Lacey, Antonio L

2014-04-23

The electrolysis of water provides a link between electrical energy and hydrogen, a high energy density fuel and a versatile energy carrier, but the process is very expensive. Indeed, the main challenge is to reduce energy consumption for large-scale applications using efficient renewable catalysts that can be produced at low cost. Here we present for the first time that laccase can catalyze electrooxidation of H2O to molecular oxygen. Native and laboratory-evolved laccases immobilized onto electrodes serve as bioelectrocatalytic systems with low overpotential and a high O2 evolution ratio against H2O2 production during H2O electrolysis. Our results open new research ground on H2O splitting, as they overcome serious practical limitations associated with artificial electrocatalysts currently used for O2 evolution.

Large-scale aerosol-assisted synthesis of biofriendly Fe2O3 yolk-shell particles: a promising support for enzyme immobilization

NASA Astrophysics Data System (ADS)

Patel, Sanjay K. S.; Choi, Seung Ho; Kang, Yun Chan; Lee, Jung-Kul

2016-03-01

Multiple-shelled Fe2O3 yolk-shell particles were synthesized using the spray drying method and intended as a suitable support for the immobilization of commercial enzymes such as glucose oxidase (GOx), horseradish peroxidase (HRP), and laccase as model enzymes. Yolk-shell particles have an average diameter of 1-3 μm with pore diameters in the range of 16 to 28 nm. The maximum immobilization of GOx, HRP, and laccase resulted in the enzyme loading of 292, 307 and 398 mg per g of support, respectively. After cross-linking of immobilized laccase by glutaraldehyde, immobilization efficiency was improved from 83.5% to 90.2%. Km and Vmax values were 41.5 μM and 1722 μmol min-1 per mg protein for cross-linked laccase and those for free laccase were 29.3 μM and 1890 μmol min-1 per mg protein, respectively. The thermal stability of the enzyme was enhanced up to 18-fold upon cross-linking, and the enzyme retained 93.1% of residual activity after ten cycles of reuse. The immobilized enzyme has shown up to 32-fold higher stability than the free enzyme towards different solvents and it showed higher efficiency than free laccase in the decolorization of dyes and degradation of bisphenol A. The synthesized yolk-shell particles have 3-fold higher enzyme loading efficiency and lower acute toxicity than the commercial Fe2O3 spherical particles. Therefore, the use of unique yolk-shell structure Fe2O3 particles with multiple-shells will be promising for the immobilization of various enzymes in biotechnological applications with improved electrochemical properties. To the best of our knowledge, this is the first report on the use of one pot synthesized Fe2O3 yolk-shell structure particles for the immobilization of enzymes.Multiple-shelled Fe2O3 yolk-shell particles were synthesized using the spray drying method and intended as a suitable support for the immobilization of commercial enzymes such as glucose oxidase (GOx), horseradish peroxidase (HRP), and laccase as model enzymes. Yolk-shell particles have an average diameter of 1-3 μm with pore diameters in the range of 16 to 28 nm. The maximum immobilization of GOx, HRP, and laccase resulted in the enzyme loading of 292, 307 and 398 mg per g of support, respectively. After cross-linking of immobilized laccase by glutaraldehyde, immobilization efficiency was improved from 83.5% to 90.2%. Km and Vmax values were 41.5 μM and 1722 μmol min-1 per mg protein for cross-linked laccase and those for free laccase were 29.3 μM and 1890 μmol min-1 per mg protein, respectively. The thermal stability of the enzyme was enhanced up to 18-fold upon cross-linking, and the enzyme retained 93.1% of residual activity after ten cycles of reuse. The immobilized enzyme has shown up to 32-fold higher stability than the free enzyme towards different solvents and it showed higher efficiency than free laccase in the decolorization of dyes and degradation of bisphenol A. The synthesized yolk-shell particles have 3-fold higher enzyme loading efficiency and lower acute toxicity than the commercial Fe2O3 spherical particles. Therefore, the use of unique yolk-shell structure Fe2O3 particles with multiple-shells will be promising for the immobilization of various enzymes in biotechnological applications with improved electrochemical properties. To the best of our knowledge, this is the first report on the use of one pot synthesized Fe2O3 yolk-shell structure particles for the immobilization of enzymes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00346j

Laccase from a non-melanogenic, alkalotolerant gamma-proteobacterium JB isolated from industrial wastewater drained soil.

PubMed

Bains, Jasleen; Capalash, Neena; Sharma, Prince

2003-07-01

A gram-negative, alkalotolerant bacterium, isolated from the soil continually drained with industrial wastewater and identified as gamma-proteobacterium by partial 16S rRNA sequence analysis, produced a polyphenol oxidase, which showed laccase but not tyrosinase activity. The organism grew well from pH 6 to 10 and produced laccase maximally at pH 10. The enzyme was stable from pH 3 to 10.6 for at least 24 h and was optimally active at 55 degrees C and pH 6.5 in a 5 min assay.

Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

PubMed

Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

2014-01-01

Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability.

PubMed

Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong

2011-02-01

Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.

Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination

PubMed Central

Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

2012-01-01

In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

Characterization of C-terminally engineered laccases.

PubMed

Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry

2014-08-01

Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (CΔ) and its 6 His tagged counterpart (CΔ6H) were found active enzymes. The production of CΔ6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of CΔ6H noted CΔ6Hh. Properties of CΔ, CΔ6H and CΔ6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in CΔ for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of CΔ6H and CΔ6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. Copyright © 2014 Elsevier B.V. All rights reserved.

Growth and production of laccases by the ligninolytic fungi, Pleurotus ostreatus and Botryosphaeria rhodina , cultured on basal medium containing the herbicide, Scepter (imazaquin).

PubMed

Rezende, Maria I; Barbosa, Aneli M; Vasconcelos, Ana-Flora D; Haddad, Renata; Dekker, Robert F H

2005-01-01

The herbicide, Scepter, whose active principle is imazaquin, is commonly used in soybean farming to combat wide-leaf weeds. The basidiomycete, Pleurotus ostreatus , and the ascomycete, Botryosphaeria rhodina , were evaluated for their growth and laccase production when cultured on basal media containing Scepter. Both fungi could grow on the herbicide when cultivated in solid and submerged liquid culture in the presence of Scepter at concentrations of 0-6% (v/v) for P. ostreatus , and up to 0-50% (v/v) for B. rhodina , and in each case produced laccases when assayed against ABTS [2,2(1)-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)] and 2,6-dimethoxyphenol. P . ostreatus could tolerate up to 6% of Scepter before it became toxic to the fungus, while in the case of B. rhodina , 50% (v/v) Scepter was the highest amount that supported grow, and laccase activity was detectable up to 25% (v/v). An inverse relationship existed between the level of Scepter in the culture medium that supported fungal growth and laccase production. Analysis of the results showed that the fungi studied presented different behaviour towards Scepter in the culture environment. ((c) 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim).

Enhanced production of thermostable laccases from a native strain of Pycnoporus sanguineus using central composite design*

PubMed Central

Ramírez-Cavazos, Leticia I.; Junghanns, Charles; Nair, Rakesh; Cárdenas-Chávez, Diana L.; Hernández-Luna, Carlos; Agathos, Spiros N.; Parra, Roberto

2014-01-01

The production of thermostable laccases from a native strain of the white-rot fungus Pycnoporus sanguineus isolated in Mexico was enhanced by testing different media and a combination of inducers including copper sulfate (CuSO4). The best conditions obtained from screening experiments in shaken flasks using tomato juice, CuSO4, and soybean oil were integrated in an experimental design. Enhanced levels of tomato juice as the medium, CuSO4 and soybean oil as inducers (36.8% (v/v), 3 mmol/L, and 1% (v/v), respectively) were determined for 10 L stirred tank bioreactor runs. This combination resulted in laccase titer of 143 000 IU/L (2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), pH 3.0), which represents the highest activity so far reported for P. sanguineus in a 10-L fermentor. Other interesting media resulting from the screening included glucose-bactopeptone which increased laccase activity up to 20 000 IU/L, whereas the inducers Acid Blue 62 and Reactive Blue 19 enhanced enzyme production in this medium 10 times. Based on a partial characterization, the laccases of this strain are especially promising in terms of thermostability (half-life of 6.1 h at 60 °C) and activity titers. PMID:24711355

A Novel Laccase with Potent Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Mycelia of Mushroom Coprinus comatus

PubMed Central

Zhao, Shuang; Rong, Cheng-Bo; Kong, Chang; Liu, Yu; Xu, Feng; Miao, Qian-Jiang; Wang, Shou-Xian; Wang, He-Xiang

2014-01-01

A novel laccase was isolated and purified from fermentation mycelia of mushroom Coprinus comatus with an isolation procedure including three ion-exchange chromatography steps on DEAE-cellulose, CM-cellulose, and Q-Sepharose and one gel-filtration step by fast protein liquid chromatography on Superdex 75. The purified enzyme was a monomeric protein with a molecular weight of 64 kDa. It possessed a unique N-terminal amino acid sequence of AIGPVADLKV, which has considerably high sequence similarity with that of other fungal laccases, but is different from that of C. comatus laccases reported. The enzyme manifested an optimal pH value of 2.0 and an optimal temperature of 60°C using 2,2′-azinobis(3-ethylbenzothiazolone-6-sulfonic acid) diammonium salt (ABTS) as the substrate. The laccase displayed, at pH 2.0 and 37°C, K m values of 1.59 mM towards ABTS. It potently suppressed proliferation of tumor cell lines HepG2 and MCF7, and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) with an IC50 value of 3.46 μM, 4.95 μM, and 5.85 μM, respectively, signifying that it is an antipathogenic protein. PMID:25540778

Ligninolytic enzyme production in selected sub-tropical white rot fungi under different culture conditions.

PubMed

Tekere, M; Zvauya, R; Read, J S

2001-01-01

Lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase activities in selected sub-tropical white rot fungal species from Zimbabwe were determined. The enzyme activities were assayed at varying concentrations of C, N and Mn2+. Manganese peroxidase and laccase activities were the only expressed activities in the fungi under the culture conditions tested. Trametes species, T. cingulata, T. elegans and T. pocas produced the highest manganese peroxidase activities in a medium containing high carbon and low nitrogen conditions. High nitrogen conditions favoured high manganese peroxidase activity in DSPM95, L. velutinus and Irpex spp. High manganese peroxidase activity was notable for T. versicolor when both carbon and nitrogen in the medium were present at high levels. Laccase production by the isolates was highest under conditions of high nitrogen and those conditions with both nitrogen and carbon at high concentration. Mn2+ concentrations between 11-25 ppm gave the highest manganese peroxidase activity compared to a concentration of 40 ppm or when there was no Mn2+ added. Laccase activity was less influenced by Mn2+ levels. While some laccase activity was produced in the absence of Mn2+, the enzyme levels were higher when Mn2+ was added to the culture medium.

Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

PubMed

Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

2009-03-01

Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

Enhanced removal of aqueous acetaminophen by a laccase-catalyzed oxidative coupling reaction under a dual-pH optimization strategy.

PubMed

Wang, Kaidong; Huang, Ke; Jiang, Guoqiang

2018-03-01

Acetaminophen is one kind of pharmaceutical contaminant that has been detected in municipal water and is hard to digest. A laccase-catalyzed oxidative coupling reaction is a potential method of removing acetaminophen from water. In the present study, the kinetics of radical polymerization combined with precipitation was studied, and the dual-pH optimization strategy (the enzyme solution at pH7.4 being added to the substrate solution at pH4.2) was proposed to enhance the removal efficiency of acetaminophen. The reaction kinetics that consisted of the laccase-catalyzed oxidation, radical polymerization and precipitation were studied by UV in situ, LC-MS and DLS (dynamic light scattering) in situ. The results showed that the laccase-catalyzed oxidation is the rate-limiting step in the whole process. The higher rate of enzyme-catalyzed oxidation under a dual-pH optimization strategy led to much faster formation of the dimer, trimer and tetramer. Similarly, the formation of polymerized products that could precipitate naturally from water was faster. Under the dual-pH optimization strategy, the initial laccase activity was increased approximately 2.9-fold, and the activity remained higher for >250s, during which approximately 63.7% of the total acetaminophen was transformed into biologically inactive polymerized products, and part of these polymerized products precipitated from the water. Laccase belongs to the family of multi-copper oxidases, and the present study provides a universal method to improve the activity of multi-copper oxidases for the high-performance removal of phenol and its derivatives. Copyright © 2017 Elsevier B.V. All rights reserved.

Polypeptides having laccase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ye; Tang, Lan; Duan, Junxin

The present invention relates to isolated polypeptides having laccase activity and polynucleotides encoding the polypeptides and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential

USDA-ARS?s Scientific Manuscript database

Aspergillus flavus (Link) accumulates aflatoxins in peanuts, mainly affecting immature kernels during drought. Peanut invasion by A. flavus induces synthesis of phytoalexins, mostly stilbenoids, as a plant defense mechanism. Fungal laccases are often related to pathogenicity, and among other subst...

Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor

USDA-ARS?s Scientific Manuscript database

Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...

[Degradation of fluorene and fluoranthene by the basidiomycete Pleurotus ostreatus].

PubMed

Pozdnyakova, N N; Chernyshova, M P; Grinev, V S; Landesman, E O; Koroleva, O V; Turkovskaya, O V

2016-01-01

The dependence of the degree of fluorene and fluoranthene degradation by the fungus Pleurotus ostreatus D1 on the culture medium composition has been studied. Polycyclic aromatic hydrocarbons (PAHs) have been transformed in Kirk’s medium (under conditions of laccase production) with the formation of a quinone metabolite and 9-fluorenone upon the use of fluoranthene and fluorene as substrates, respectively. More complete degradation with the formation of an intermediate metabolite, phthalic acid that has undergone subsequent utilization, has occurred in basidiomycete-rich medium (under the production of both laccase and versatile peroxidase). The formation of phthalic acid as a metabolite of fluoranthene degradation by lignolytic fungi has been revealed for the first time. The data allow the supposition that both extracellular laccase and laccase on the mycelium surface can participate in the initial stages of PAH metabolism, while versatile peroxidase is necessary for the oxidation of the formed metabolites. A scheme of fluorene metabolism by Pleurotus ostreatus D1 is suggested.

Secretory expression of the non-secretory-type Lentinula edodes laccase by Aspergillus oryzae.

PubMed

Yano, Akira; Kikuchi, Sayaka; Nakagawa, Yuko; Sakamoto, Yuichi; Sato, Toshitsugu

2009-01-01

The shiitake mushroom, Lentinula edodes, has an extracelluar secretory-type laccase, Lcc1, and a fruiting-body-accumulation-type laccase, Lcc4. We previously reported the production of Lcc1 by plant cells, but had difficulty producing Lcc4. Here, we report the production of Lcc1 and Lcc4 by Aspergillus oryzae and the extracellular secretory production of Lcc4 using a modified secretion signal peptide (SP) from Lcc1. Sp-Lcc4 produced by A. oryzae had biochemical activities similar to Lcc4 produced by L. edodes. Lcc1 did not react with beta-(3,4-dihydroxyphenol) alanine (DOPA), but Lcc4 from L. edodes and A. oryzae could oxidize DOPA. K(M) values for the substrates 2,2'-azino-di-(3-ethylbenzthiazolinsulfonate), 2,6-dimethoxyphenol, guaiacol, pyrogallol, and catechol were similar for Lcc4 and Sp-Lcc4. In conclusion, a non-secretory-type fungal laccase is secreted into the culture media with its original enzymatic properties by exploiting modified secretory signal peptide. 2008 Elsevier GmbH.

Plasticity of laccase generated by homeologous recombination in yeast.

PubMed

Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry

2009-10-01

Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.

Kinetics of the Reduction of Metalloproteins by Chromous Ion

PubMed Central

Dawson, J. W.; Gray, H. B.; Holwerda, R. A.; Westhead, E. W.

1972-01-01

The reduction of Cu(330) in Rhus vernicifera laccase by chromous ion is 30% faster than reduction of Cu(614) at room temperature [pH 4.8, μ = 0.1 (NaCl)], and two parallel first-order paths, attributed to heterogeneity of the protein, are observed at both wavelengths. The reactions of stellacyanin, spinach and French-bean plastocyanins, and cytochrome c with chromous ion under similar conditions are faster than that with laccase by factors of 102 to 104, and are first order in protein concentration. Comparison of rates and activation parameters for the reduction of “blue” copper in laccase, stellacyanin, and the two plastocyanins indicates that reduction of the Cu(614) site in laccase may occur by intramolecular electron transfer from one of the Cu(330) sites. Our value of ΔH‡ (17.4 kcal/mol) for the chromous ion reduction of cytochrome c is consistent with a mechanism in which major conformational changes in the protein must accompany electron transfer. PMID:4500552

Laccase electrodes based on the combination of single-walled carbon nanotubes and redox layered double hydroxides: Towards the development of biocathode for biofuel cells

NASA Astrophysics Data System (ADS)

Ding, Shou-Nian; Holzinger, Michael; Mousty, Christine; Cosnier, Serge

Single-walled carbon nanotubes (SWCNT) were combined with layered double hydroxides (LDH) intercalated with 2,2‧-azino-bis(3-ethylbenzothiazoline-6-sulfonate) diammonium salt [ZnCr-ABTS] to entrap and electrically connect laccase enzyme. The resulting laccase electrodes exhibited an electro-enzymatic activity for O 2 reduction. To improve this electrocatalytic activity, varying SWCNT quantities and loading methods were tested to optimize the configuration of the laccase electrodes. Furthermore, the resulting bioelectrode was successfully used as a biocathode for the elaboration of a membrane-less glucose/air biofuel cell. In 0.1 M phosphate buffer (PBS) of pH 6.0, containing glucose (5 mM) under ambient conditions, the assembled biofuel cell yielded a maximum power density of 18 μW cm -2 at a cell voltage of 0.3 V whereas this power decreased to 8.3 μW cm -2 for a biofuel cell based on the identical biocathode setup without SWCNT.

Three-dimensional organization of three-domain copper oxidases: A review

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V.

2008-01-15

'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrenamore » maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.« less

Three-dimensional organization of three-domain copper oxidases: A review

NASA Astrophysics Data System (ADS)

Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

2008-01-01

“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

R software package based statistical optimization of process components to simultaneously enhance the bacterial growth, laccase production and textile dye decolorization with cytotoxicity study

PubMed Central

Dudhagara, Pravin; Tank, Shantilal

2018-01-01

The thermophilic bacterium, Bacillus licheniformis U1 is used for the optimization of bacterial growth (R1), laccase production (R2) and synthetic disperse blue DBR textile dye decolorization (R3) in the present study. Preliminary optimization has been performed by one variable at time (OVAT) approach using four media components viz., dye concentration, copper sulphate concentration, pH, and inoculum size. Based on OVAT result further statistical optimization of R1, R2 and R3 performed by Box–Behnken design (BBD) using response surface methodology (RSM) in R software with R Commander package. The total 29 experimental runs conducted in the experimental design study towards the construction of a quadratic model. The model indicated that dye concentration 110 ppm, copper sulphate 0.2 mM, pH 7.5 and inoculum size 6% v/v were found to be optimum to maximize the laccase production and bacterial growth. Whereas, maximum dye decolorization achieved in media containing dye concentration 110 ppm, copper sulphate 0.6 mM, pH 6 and inoculum size 6% v/v. R package predicted R2 of R1, R2 and R3 were 0.9917, 0.9831 and 0.9703 respectively; likened to Design-Expert (Stat-Ease) (DOE) predicted R2 of R1, R2, and R3 were 0.9893, 0.9822 and 0.8442 respectively. The values obtained by R software were more precise, reliable and reproducible, compared to the DOE model. The laccase production was 1.80 fold increased, and 2.24 fold enhancement in dye decolorization was achieved using optimized medium than initial experiments. Moreover, the laccase-treated sample demonstrated the less cytotoxic effect on L132 and MCF-7 cell lines compared to untreated sample using MTT assay. Higher cell viability and lower cytotoxicity observed in a laccase-treated sample suggest the impending application of bacterial laccase in the reduction of toxicity of dye to design rapid biodegradation process. PMID:29718934

Properties of the glycoprotein laccase immobilized by two methods.

PubMed

Froehner, S C; Eriksson, K

1975-01-01

Laccase (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2) from Neurospora crassa has been immobilized by two different procedures: (1) Covalent attachment to Sepharose 4B activated with cyanogen bromide, and (2) Adsorption to Concanavalin A-Sepharose via the carbohydrate moiety. Except for small changes in the Michaelis-Menten constants, no differences were noted in the enzymological properties of the immobilized enzymes when compared to free enzyme. The carbohydrate moiety of laccase involved in the interaction with Concanavalin A does not appear to be closely associated with the active center since binding to the lectin has no effect on the enzymological parameters investigated.

Prolonged Laccase Production by a Cold and pH Tolerant Strain of Penicillium pinophilum (MCC 1049) Isolated from a Low Temperature Environment

PubMed Central

Jain, Rahul; Tamta, Sushma

2014-01-01

Production of laccase by a cold and pH tolerant strain of Penicillium pinophilum has been investigated under different cultural conditions for up to 35 days of incubation. The fungus was originally isolated from a low temperature environment under mountain ecosystem of Indian Himalaya. The estimations were conducted at 3 temperatures (15, 25, and 35°C), a range of pH (3.5–11.5), and in presence of supplements including carbon and nitrogen sources, vitamins, and antibiotics. Optimum production of laccase was recorded at 25°C (optimum temperature for fungal growth) and 7.5 pH. The production of enzyme was recorded maximum on day 28 (11.6 ± 0.52 U/L) following a slow decline at day 35 of incubation (10.6 ± 0.80 U/L). Fructose and potassium nitrate (0.2%) among nutritional supplements, chloramphenicol (0.1%) among antibiotics, and folic acid (0.1%) among vitamins were found to be the best enhancers for production of laccase. Relatively lower but consistent production of laccase for a longer period is likely to be an ecologically important phenomenon under low temperature environment. Further, enhancement in production of enzyme using various supplements will be useful for its use in specific biotechnological applications. PMID:24734172

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

PubMed Central

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

PubMed

Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

2017-06-01

Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

Screening and production of ligninolytic enzyme by a marine-derived fungal Pestalotiopsis sp. J63.

PubMed

Chen, Hui-Ying; Xue, Dong-Sheng; Feng, Xiao-Yu; Yao, Shan-Jing

2011-12-01

Marine-derived fungi are prone to produce structurally unique secondary metabolites, a considerable number of which display the promising biological properties and/or industrial applications. Among those, ligninolytic enzymes have attracted great interest in recent years. In this work, about 20 strains were isolated from sea mud samples collected in the East China Sea and then screened for their capacity to produce lignin-degrading enzymes. The results showed that a strain, named J63, had a great potential to secrete a considerable amount of laccase. Using molecular method, it was identified as an endophytic fungus, Pestalotiopsis sp. which was rarely reported as ligninolytic enzyme producer in the literature. The production of laccase by Pestalotiopsis sp. J63 was investigated under submerged fermentation (SF) and solid state fermentation (SSF) with various lignocellulosic by-products as substrates. The SSF of rice straw powder accumulated the highest level of laccase activity (10,700 IU/g substrate), whereas the SF of untreated sugarcane bagasse provided the maximum amount of laccase activity (2,000 IU/ml). The value was far higher than those reported by other reports. In addition, it produced 0.11 U/ml cellulase when alkaline-pretreated sugarcane bagasse was used as growth substrate under SF. Meanwhile, the growth of fungi and laccase production under different salinity conditions were also studied. It appeared to be a moderately halo-tolerant organism.

Bioinspired production of magnetic laccase-biotitania particles for the removal of endocrine disrupting chemicals.

PubMed

Ardao, Inés; Magnin, Delphine; Agathos, Spiros N

2015-10-01

Microbial laccases are powerful enzymes capable of degrading lignin and other recalcitrant compounds including endocrine disrupting chemicals (EDCs). Efficient EDC removal on an industrial scale requires robust, stable, easy to handle and cost-effective immobilized biocatalysts. In this direction, magnetic biocatalysts are attractive due to their easy separation through an external magnetic field. Recently, a bioinspired immobilization technique that mimics the natural biomineralization reactions in diatoms has emerged as a fast and versatile tool for generating robust, cheap, and highly stable (nano) biocatalysts. In this work, bioinspired formation of a biotitania matrix is triggered on the surface of magnetic particles in the presence of laccase in order to produce laccase-biotitania (lac-bioTiO2 ) biocatalysts suitable for environmental applications using a novel, fast and versatile enzyme entrapment technique. Highly active lac-bioTiO2 particles have been produced and the effect of different parameters (enzyme loading, titania precursor concentration, pH, duration of the biotitania formation, and laccase adsorption steps) on the apparent activity yield of these biocatalysts were evaluated, the concentration of the titania precursor being the most influential. The lac-bioTiO2 particles were able to catalyze the removal of bisphenol A, 17α-ethinylestradiol and diclofenac in a mixture of six model EDCs and retained 90% of activity after five reaction cycles and 60% after 10 cycles. © 2015 Wiley Periodicals, Inc.

Phenoloxidase-mediated interactions of phenols and anilines with humic materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dec, J.; Bollag, J.M.

Phenoloxidases present in terrestrial systems may contribute to the formation of humus through random coupling of a variety of aromatic compounds, including xenobiotic chemicals. Because of their structural similarity to natural substrates originating mainly from lignin decomposition, xenobiotic phenols and anilines can be readily incorporated into the soil organic matter, a phenomenon referred to as binding. The underlying mechanism of binding involves oxidation of the xenobiotic substrates to free radicals or quinone products that subsequently couple directly to humus or to naturally occurring phenols that also are subject to oxidation. The oxidation can be mediated by soil phenoloxidases as wellmore » as by abiotic catalysts. The ability of the enzymes to mediate the oxidation was demonstrated in a number of model studies, in which selected pollutants were incubated with humic monomers or natural humic acids in the presence of different phenoloxidases (laccase, peroxidase, tyrosinase). Analysis of the formed complexes by mass spectrometry and {sup 13}C nuclear magnetic resonance (NMR) spectroscopy left no doubt about the formation of covalent bonds between the pollutants and humic materials. Some bonds were formed at the chlorinated sites, leading to partial dehalogenation of the aromatic contaminants. Experimental data indicated that bound phenols and anilines were unlikely to adversely affect the environment; their release from humic complexes by soil microorganisms was very limited and once released, they were subjected to mineralization. For those reasons, phenoloxidases, which proved capable of mediating the underlying reaction, are currently considered as a tool for enhancing immobilization phenomena in soil.« less

New potential biocatalysts by laccase immobilization in PVA Cryogel type carrier.

PubMed

Stanescu, Michaela Dina; Fogorasi, Magdalena; Shaskolskiy, Boris L; Gavrilas, Simona; Lozinsky, Vladimir I

2010-04-01

Laccases are enzymes belonging to the Oxidoreductases class. These enzymes may be good biocatalysts for different processes, at laboratory and industrial levels. A successful use at industrial scale demands a higher stability of the enzyme. As an easy way to obtain longer life biocatalysts, the immobilization process is recommended. Thus, the paper presents different ways of obtaining new biocatalysts by a laccase covalent immobilization on a macroporous carrier based on poly(vinyl alcohol) cryogel. Different procedures of covalent immobilization are described, the newly obtained biocatalysts being characterized. According to the experimental data, the stability of the immobilized enzyme increased and the pH profile changed, compared with those of the free enzyme.

A novel ethanol-tolerant laccase, Tvlac, from Trametes versicolor.

PubMed

Chen, Lei; Yi, Xiaoming; Deng, Fajun; Fang, Wei; Zhang, Xuecheng; Wang, Xiaotang; Fang, Zemin; Xiao, Yazhong

2016-03-01

To produce and characterize novel laccases with ethanol tolerance from Trametes versicolor using agriculture by-products as energy source. Trametes versicolor 1017 produces two laccase isoenzymes with a total activity of 10 U ml(-1) within 8 days when using wheat bran and peanut powder as energy sources in liquid culture medium. A novel isoenzyme, named Tvlac, was identified, purified and characterized. Its optimum pH and temperature were from 4.5 to 5 and 55 to 60 °C, respectively. Its activity was stimulated by ethanol at 10 % (v/v) which increased the V 0. The biochemical properties of Tvlac substantiate the potential of this enzyme for applications under an aqueous ethanol mixture environment.

Peptide/laccase cocatalyzed asymmetric α-oxyamination of aldehydes.

PubMed

Akagawa, Kengo; Kudo, Kazuaki

2011-07-01

An asymmetric α-oxyamination could be successfully performed by a peptide catalyst and laccase. The combination of peptide catalysis and enzymatic air oxidation promoted the reaction smoothly in water without employing a metal reagent. The oxyaminated compounds could be obtained as both aldehyde and carboxylic acid products depending on the reaction conditions.

Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity

USDA-ARS?s Scientific Manuscript database

Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by Trametes Versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS gra...

Degradation of lindane and endosulfan by fungi, fungal and bacterial laccases.

PubMed

Ulčnik, A; Kralj Cigić, I; Pohleven, F

2013-12-01

The ability of two white-rot fungi (Trametes versicolor and Pleurotus ostreatus) and one brown-rot fungus (Gloeophyllum trabeum) to degrade two organochlorine insecticides, lindane and endosulfan, in liquid cultures was studied and dead fungal biomass was examined for adsorption of both insecticides from liquid medium. Lindane and endosulfan were also treated with fungal laccase and bacterial protein CotA, which has laccase activities. The amount of degraded lindane and endosulfan increased with their exposure period in the liquid cultures of both examined white-rot fungi. Endosulfan was transformed to endosulfan sulphate by T. versicolor and P. ostreatus. A small amount of endosulfan ether was also detected and its origin was examined. Degradation of lindane and endosulfan by a brown rot G. trabeum did not occur. Mycelial biomasses of all examined fungi have been found to adsorb lindane and endosulfan and adsorption onto fungal biomass should therefore be considered as a possible mechanism of pollutant removal when fungal degradation potentials are studied. Bacterial protein CotA performed more efficient degradation of lindane and endosulfan than fungal laccase and has shown potential for bioremediation of organic pollutants.

Excretion of laccase by sycamore (Acer pseudoplatanus L.) cells. Purification and properties of the enzyme.

PubMed Central

Bligny, R; Douce, R

1983-01-01

A laccase-type polyphenol oxidase is excreted by sycamore cells (Acer pseudoplatanus L.) cells. The enzyme has been purified by classical purification techniques. It is a blue copper protein of Mr 97 000, containing 45% carbohydrate and 0.24% copper. This protein consists of one single unit and the copper content corresponds to four copper atoms per protein molecule. The specific activity of the purified extracellular sycamore-cell laccase measured at pH 6.6 (optimum pH) and in the presence of 20mM-4-methhylcatechol (optimum substrate conditions) corresponded to an oxygen uptake of 32 000 nmol of O2/min per mg of protein. Under these conditions, the catalytic-centre activity of the enzyme reached 100 s-1. The excretion of laccase by sycamore cells is significant, being about 2% of the total protein synthesized by the cells during the exponential phase of growth, and is independent of cell growth. The physiological significance and the problems raised by the passage of this protein across the cytoplasmic membrane are discussed. PMID:6847630

Refolding of laccase in dilution additive mode with copper-based ionic liquid.

PubMed

Bae, Sang-Woo; Ahn, Kihun; Koo, Yoon-Mo; Ha, Sung Ho

2013-11-01

Ionic liquids (ILs) are molten salts which do not crystallize at room temperature. Tunable physicochemical properties of ILs including hydrophobicity and polarity facilitate their applications in many biological processes. In this study, a copper-based IL was employed in order to enhance the refolding efficiency of laccase from Trametes versicolor which requires copper as a cofactor. When 1-ethyl-3-methylimidazolium trichlorocuprate ([EMIM][CuCl₃]) was added to refolding buffer instead of urea, the laccase refolding yield was improved more than 2.7 times compared to the conventional refolding buffer which contains urea. When the refolding of laccase was carried out at different temperatures (4, 25, and 37 °C), the highest refolding yield was obtained at 25 °C. At low temperature, two conflicting effects, i.e., suppression of the aggregate formation and decrease of folding rate, influence the protein refolding. In contrast, a copper-based IL did not enhance the refolding of lysozyme, a non-copper-containing protein. From these results, we can conclude that this copper-based IL, [EMIM][CuCl₃], was exclusively effective on the refolding process of a copper-containing protein.

Morphology and laccase production of white-rot fungi grown on wheat bran flakes under semi-solid-state fermentation conditions.

PubMed

Osma, Johann F; Moilanen, Ulla; Toca-Herrera, José L; Rodríguez-Couto, Susana

2011-05-01

In this paper, we studied the laccase production and the growth morphology of different white-rot fungi, i.e. Pleurotus ostreatus, Trametes pubescens, Cerrena unicolor and Trametes versicolor, cultured under semi-solid-state fermentation conditions using wheat bran flakes as a natural low-cost support substrate. Trametes versicolor exhibited the highest laccase activity per gram of total dry matter, followed by P. ostreatus (63.5 and 58.2Ug(-1) , respectively). In addition, they showed a time profile of laccase production that was quite similar. Growth morphology was studied using environmental microscopic images and analyzed by discrete Fourier transformation-based software to determine the mean diameter of the hyphae, the number of hypha layers and the global micromorphology. The four strains exhibited different micromorphologies of growth. Pleurotus ostreatus presented narrow hyphae, which formed many thick clumps, T. pubescens and T. versicolor showed clumps of different sizes and C. unicolor showed thick hyphae that formed larger clumps, but in less amounts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.

PubMed

Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min

Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.

Isolation, one-step affinity purification, and characterization of a polyextremotolerant laccase from the halophilic bacterium Aquisalibacillus elongatus and its application in the delignification of sugar beet pulp.

PubMed

Rezaei, Shahla; Shahverdi, Ahmad Reza; Faramarzi, Mohammad Ali

2017-04-01

The aim of the present work was to study the ability of a halophilic bacterial laccase to efficient delignification in extreme conditions. Here, a highly stable extracellular laccase showing ligninolytic activity from halophilic Aquisalibacillus elongatus is described. The laccase production was strongly influenced by NaCl and CuSO 4 and under optimal conditions reached 4.8UmL -1 . The monomeric enzyme of 75kDa was purified by a synthetic affinity column with 68.2% yield and 99.8-fold purification. The enzyme showed some valuable features viz. stability against a wide range of organic solvents, salts, metals, inhibitors, and surfactants and specificity to a wide spectrum of substrates diverse in structure and redox potential. It retained more than 50% of the original activity at 25-75°C and pH 5.0-10.0. Furthermore, the enzyme was found to be effective in the delignification of sugar beet pulp in an ionic liquid that makes it useful for industrial applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Polyamide 6/chitosan nanofibers as support for the immobilization of Trametes versicolor laccase for the elimination of endocrine disrupting chemicals.

PubMed

Maryšková, Milena; Ardao, Inés; García-González, Carlos A; Martinová, Lenka; Rotková, Jana; Ševců, Alena

2016-07-01

In recent years, there has been an increase in efforts to improve wastewater treatment as the concentration of dangerous pollutants, such as endocrine disrupting chemicals, in wastewater increases. These compounds, which mimic the effect of hormones, have a negative impact on human health and are not easily removed from water. One way to effectively eliminate these pollutants is to use enzymatically activated materials. In this study, we report on the use of laccase from the white rot fungus Trametes versicolor immobilized onto polyamide 6/chitosan (PA6/CHIT) nanofibers modified using two different spacers (bovine serum albumin and hexamethylenediamine). We then tested the ability of the PA6/CHIT-laccase biocatalysts to eliminate a mixture containing 50μM of two endocrine disrupting chemicals: bisphenol A and 17α-ethinylestradiol. The PA6/CHIT nanofiber matrix used in this study not only proved to be a suitable carrier for immobilized and modified laccase but was also efficient in the removal of a mixture of endocrine disrupting chemicals in three treatment cycles. Copyright © 2016 Elsevier Inc. All rights reserved.

Modeling dioxygen reduction at multicopper oxidase cathodes.

PubMed

Agbo, Peter; Heath, James R; Gray, Harry B

2014-10-01

We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate.

Decolorization of complex dyes and textile effluent by extracellular enzymes of Cyathus bulleri cultivated on agro-residues/domestic wastes and proposed pathway of degradation of Kiton blue A and reactive orange 16.

PubMed

Vats, Arpita; Mishra, Saroj

2017-04-01

In this study, the white-rot fungus Cyathus bulleri was cultivated on low-cost agro-residues, namely wheat bran (WB), wheat straw (WS), and domestic waste orange peel (OP) for production of ligninolytic enzymes. Of the three substrates, WB and OP served as good materials for the production of laccase with no requirement of additional carbon or nitrogen source. Specific laccase activity of 94.4 U mg -1 extracellular protein and 21.01 U mg -1 protein was obtained on WB and OP, respectively. Maximum decolorization rate of 13.6 μmol h -1  U -1 laccase for reactive black 5 and 22.68 μmol h -1  U -1 laccase for reactive orange 16 (RO) was obtained with the WB culture filtrate, and 11.7 μmol h -1  U -1 laccase for reactive violet 5 was observed with OP culture filtrate. Importantly, Kiton blue A (KB), reported not to be amenable to enzymatic degradation, was degraded by culture filtrate borne activities. Products of degradation of KB and RO were identified by mass spectrometry, and a pathway of degradation proposed. WB-grown culture filtrate decolorized and detoxified real and simulated textile effluents by about 40%. The study highlights the use of inexpensive materials for the production of enzymes effective on dyes and effluents.

Decolorization of the azo dye Acid Orange 51 by laccase produced in solid culture of a newly isolated Trametes trogii strain.

PubMed

Daâssi, Dalel; Zouari-Mechichi, Hela; Frikha, Fakher; Martinez, Maria Jesus; Nasri, Moncef; Mechichi, Tahar

2013-04-01

This study concerns the decolorization and detoxification of the azo dye Acid Orange 51 (AO51) by crude laccase from Trametes trogii produced in solid culture using sawdust as support media. A three-level Box-Behnken factorial design with four factors (enzyme concentration, 1-hydroxybenzotriazole (HBT) concentration, dye concentration and reaction time) combined with response surface methodology was applied to optimize AO51 decolorization. A mathematical model was developed showing the effect of each factor and their interactions on color removal. The model predicted that Acid Orange 51 decolorization above 87.87 ± 1.27 % could be obtained when enzyme concentration, HBT concentration, dye concentration and reaction time were set at 1 U/mL, 0.75 mM, 60 mg/L and 2 days, respectively. The experimental values were in good agreement with the predicted ones and the models were highly significant, the correlation coefficient (R 2 ) being 0.9. Then the desirability function was employed to determine the optimal decolorization condition for each dye and minimize the process cost simultaneously. In addition, germination index assay showed that laccase-treated dye was detoxified; however in the presence of HBT, the phytotoxicity of the treated dye was increased. By using cheap agro-industrial wastes, such as sawdust, a potential laccase was obtained. The low cost of laccase production may further broaden its application in textile wastewater treatment.

Nucleus-Selective Expression of Laccase Genes in the Dikaryotic Strain of Lentinula edodes.

PubMed

Ha, Byeongsuk; Lee, Sieun; Kim, Sinil; Kim, Minseek; Moon, Yoon Jung; Song, Yelin; Ro, Hyeon-Su

2017-12-01

In mating of Lentinula edodes , dikaryotic strains generated from certain monokaryotic strains such as the B2 used in this study tend to show better quality of fruiting bodies regardless of the mated monokaryotic strains. Unlike B2, dikaryotic strains generated from B16 generally show low yields, with deformed or underdeveloped fruiting bodies. This indicates that the two nuclei in the cytoplasm do not contribute equally to the physiology of dikaryotic L. edodes , suggesting an expression bias in the allelic genes of the two nuclei. To understand the role of each nucleus in dikaryotic strains, we investigated single nucleotide polymorphisms (SNPs) in laccase genes of monokaryotic strains to reveal nuclear origin of the expressed mRNAs in dikaryotic strain. We performed reverse transcription PCR (RT-PCR) analysis using total RNAs extracted from dikaryotic strains (A5B2, A18B2, and A2B16) as well as from compatible monokaryotic strains (A5, A18, and B2 for A5B2 and A18B2; A2 and B16 for A2B16). RT-PCR results revealed that Lcc1, Lcc2, Lcc4, Lcc7, and Lcc10 were the mainly expressed laccase genes in the L. edodes genome. To determine the nuclear origin of these laccase genes, the genomic DNA sequences in monokaryotic strains were analyzed, thereby revealing five SNPs in Lcc4 and two in Lcc7. Subsequent sequence analysis of laccase mRNAs expressed in dikaryotic strains revealed that these were almost exclusively expressed from B2-originated nuclei in A5B2 and A18B2 whereas B16 nucleus did not contribute to laccase expression in A2B16 strain. This suggests that B2 nucleus dominates the expression of allelic genes, thereby governing the physiology of dikaryons.

Nucleus-Selective Expression of Laccase Genes in the Dikaryotic Strain of Lentinula edodes

PubMed Central

Ha, Byeongsuk; Lee, Sieun; Kim, Sinil; Kim, Minseek; Moon, Yoon Jung; Song, Yelin

2017-01-01

In mating of Lentinula edodes, dikaryotic strains generated from certain monokaryotic strains such as the B2 used in this study tend to show better quality of fruiting bodies regardless of the mated monokaryotic strains. Unlike B2, dikaryotic strains generated from B16 generally show low yields, with deformed or underdeveloped fruiting bodies. This indicates that the two nuclei in the cytoplasm do not contribute equally to the physiology of dikaryotic L. edodes, suggesting an expression bias in the allelic genes of the two nuclei. To understand the role of each nucleus in dikaryotic strains, we investigated single nucleotide polymorphisms (SNPs) in laccase genes of monokaryotic strains to reveal nuclear origin of the expressed mRNAs in dikaryotic strain. We performed reverse transcription PCR (RT-PCR) analysis using total RNAs extracted from dikaryotic strains (A5B2, A18B2, and A2B16) as well as from compatible monokaryotic strains (A5, A18, and B2 for A5B2 and A18B2; A2 and B16 for A2B16). RT-PCR results revealed that Lcc1, Lcc2, Lcc4, Lcc7, and Lcc10 were the mainly expressed laccase genes in the L. edodes genome. To determine the nuclear origin of these laccase genes, the genomic DNA sequences in monokaryotic strains were analyzed, thereby revealing five SNPs in Lcc4 and two in Lcc7. Subsequent sequence analysis of laccase mRNAs expressed in dikaryotic strains revealed that these were almost exclusively expressed from B2-originated nuclei in A5B2 and A18B2 whereas B16 nucleus did not contribute to laccase expression in A2B16 strain. This suggests that B2 nucleus dominates the expression of allelic genes, thereby governing the physiology of dikaryons. PMID:29371806

Comparison of two laccases from Trametes versicolor for application in the decolorization of dyes.

PubMed

Li, Qi; Ge, Lin; Cai, Junli; Pei, Jianjun; Xie, Jingcong; Zhao, Linguo

2014-04-01

It has been previously demonstrated that laccases exhibit great potential for use in several industrial and environmental applications. In this paper, two laccase isoenzyme genes, lccB and lccC, were cloned and expressed in Pichia pastoris GS115. The sequence analysis indicated that the lccB and lccC genes consisted of 1,563 and 1,584 bp, and their open reading frames encoded 520 and 527 amino acids, respectively. They had 72.7% degree of identity in nucleotides and 86.7% in amino acids. The expression levels of LccB and LccC were up to 32,479 and 34,231 U/l, respectively. The recombinant laccases were purified by ultrafiltration and (NH4)2SO4 precipitation, showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimal pH and temperature for LccB were 2.0 and 55°C with 2,2'-azino-bis-[3-ethylbenzthiazolinesulfonic acid (ABTS) as a substrate, whereas LccC exhibited optimal pH and temperature at 3.0 and 60°C. The apparent kinetic parameters of LccB were 0.43 mM for ABTS with a Vmax value of 51.28 U/mg, and the Km and Vmax values for LccC were 0.29 mM and 62.89 U/mg. The recombinant laccases were able to decolorize five types of dyes. Acid Violet 43 (100 g/ml) was completely decolorized by LccB or LccC (2 U/ml), and the decolorization of Reactive Blue KN-R (100 g/ml) was 91.6% by LccC (2 U/ml). Thus, the study characterizes useful laccase isoenzymes from T. versicolor that have the capability of being incorporated into the treatment of similar azo and anthraquinone dyes from dyeing industries.

The trade-off of availability and growth inhibition through copper for the production of copper-dependent enzymes by Pichia pastoris.

PubMed

Balakumaran, Palanisamy Athiyaman; Förster, Jan; Zimmermann, Martin; Charumathi, Jayachandran; Schmitz, Andreas; Czarnotta, Eik; Lehnen, Mathias; Sudarsan, Suresh; Ebert, Birgitta E; Blank, Lars Mathias; Meenakshisundaram, Sankaranarayanan

2016-02-20

Copper is an essential chemical element for life as it is a part of prosthetic groups of enzymes including super oxide dismutase and cytochrome c oxidase; however, it is also toxic at high concentrations. Here, we present the trade-off of copper availability and growth inhibition of a common host used for copper-dependent protein production, Pichia pastoris. At copper concentrations ranging from 0.1 mM (6.35 mg/L) to 2 mM (127 mg/L), growth rates of 0.25 h(-1) to 0.16 h(-1) were observed with copper uptake of as high as 20 mgcopper/gCDW. The intracellular copper content was estimated by subtracting the copper adsorbed on the cell wall from the total copper concentration in the biomass. Higher copper concentrations led to stronger cell growth retardation and, at 10 mM (635 mg/L) and above, to growth inhibition. To test the determined copper concentration range for optimal recombinant protein production, a laccase gene from Aspergillus clavatus [EMBL: EAW07265.1] was cloned under the control of the constitutive glyceraldehyde-3-phosphate (GAP) dehydrogenase promoter for expression in P. pastoris. Notably, in the presence of copper, laccase expression improved the specific growth rate of P. pastoris. Although copper concentrations of 0.1 mM and 0.2 mM augmented laccase expression 4 times up to 3 U/mL compared to the control (0.75 U/mL), while higher copper concentrations resulted in reduced laccase production. An intracellular copper content between 1 and 2 mgcopper/gCDW was sufficient for increased laccase activity. The physiology of the yeast could be excluded as a reason for the stop of laccase production at moderate copper concentrations as no flux redistribution could be observed by (13)C-metabolic flux analysis. Copper and its pivotal role to sustain cellular functions is noteworthy. However, knowledge on its cellular accumulation, availability and distribution for recombinant protein production is limited. This study attempts to address one such challenge, which revealed the fact that intracellular copper accumulation influenced laccase production and should be considered for high protein expression of copper-dependent enzymes when using P. pastoris. The results are discussed in the context of P. pastoris as a general host for copper -dependent enzyme production.

Modification of lignocellulosic materials by laccase

Treesearch

William Kenealy; John Klungness; Mandla Tshabalala; Roland Gleisner; Eric Horn; Masood Akhtar; Hilda Zulaica-Villagomez; Gisela Buschle-Diller

2003-01-01

Altering the surface properties of pulp can enhance binding, increase paper strength, and decrease the cost of fiber. In this study, we modified lignocellulosic materials (bark and pulp) with laccase and selected substrates to change the nature of the pulp surface. Modified pulps were evaluated by the amount of methylene blue (a cationic dye) that would bind to the...

Bioremoval of humic acid from water by white rot fungi: exploring the removal mechanisms.

PubMed

Zahmatkesh, M; Spanjers, H; Toran, M J; Blánquez, P; van Lier, J B

2016-12-01

Twelve white rot fungi (WRF) strains were screened on agar plates for their ability to bleach humic acid (HA). Four fungal strains were selected and tested in liquid media for removal of HA. Bioremediation was investigated by HA color removal and changes in the concentration and molecular size distribution of HA by size exclusion chromatography. Trametes versicolor and Phanerochaete chrysosporium showed the highest HA removal efficiency, reaching about 80%. Laccase and manganese peroxidase were measured as extracellular enzymes and their relation to the HA removal by WRF was investigated. Results indicated that nitrogen limitation could enhance the WRF extracellular enzyme activity, but did not necessarily increase the HA removal by WRF. The mechanism of bioremediation by WRF was shown to involve biosorption of HA by fungal biomass and degradation of HA to smaller molecules. Also, contradicting previous reports, it was shown that the decolorization of HA by WRF could not necessarily be interpreted as degradation of HA. Biosorption experiments revealed that HA removal by fungal biomass is dependent not only on the amount of biomass as the sorbent, but also on the fungal species. The involvement of cytochrome P450 (CYP) enzymes was confirmed by comparing the HA removal capability of fungi with and without the presence of a CYP inhibitor. The ability of purified laccase from WRF to solely degrade HA was proven and the importance of mediators was also demonstrated.

Laccase catalysed grafting of phenolic onto xylan to improve its applicability in films

NASA Astrophysics Data System (ADS)

Pei, Jicheng; Wang, Bing; Zhang, Fangdong; Li, Zhongyang; Yin, Yunbei; Zhang, Dongxu

2015-07-01

Xylan can be tailored for various value-added applications. However, its use in aqueous systems is hampered by its complex structure, and small molecular weight. This research aimed at improving the xylan molecular weight and changing its structure. Laccase-catalysed oxidation of 4-coumaric acid (PCA), ferulic acid (FA), syringaldehyde (SD), and vanillin (VA) onto xylan was grafted to study the changes in its structure, tensile properties, and antibacterial activities. A Fourier transform infrared (FTIR) spectrum analyser was used to observe the changes in functional groups of xylan. The results showed a band at 1635 cm-1 corresponding to the stretching vibration of conjugated carbonyl carboxy hemoglobin and a benzene ring structure were strengthened; the appearance of a new band between 1200 cm-1 and 1270 cm-1 corresponding to alkyl ethers on the aryl C-O stretching vibration was due to the fact that during the grafting process, the number of benzene ring structures increased and covalent connections occurred between phenols and xylan. The reaction mechanism for the laccase-catalysed oxidation of phenol compounds onto xylan was preliminary explored by 13C-NMR. The results showed that PCA-xylan, FA-xylan graft poly onto xylan by Cγ ester bond, SD-xylan graft poly onto xylan by ether bond and an ester bond, and VD-xylan graft poly onto xylan by ether bond. The film strength of xylan derivatives has been significantly increased, especially for the PCA-xylan derivative. The increases in tensile stress at break, tensile strength, tensile yield stress, and Young's modulus were: 24.04%, 31.30%, 55.56%, and 28.21%, respectively. After laccase/phenolics were modified, xylan had a good antibacterial effect to E. coli, Corynebacterium glutamicum, and Bacillus subtilis. The SD-xylan, FA-xylan, and PCA-xylan showed a greater efficacy against E. coli, Corynebacterium glutamicum, and Bacillus subtilis, respectively.

Controlled and facile synthesis of a self-assembled enzyme-inorganic catalyst based on flexible metal-coated fiber for an excellent removal of synthetic pollutants from aqueous environment

NASA Astrophysics Data System (ADS)

Zhu, Yao; Rong, Jian; Zhang, Tao; Xu, Jicheng; Dai, Yuting; Qiu, Fengxian

2018-04-01

The development of green sustainable chemistry opens the door to the application of biocatalytic in numerous fields for the research in industry and academia. As a common biological catalyst, enzyme catalysis is ideally suited and widely applicable for various desired reaction. In this work, a hierarchical structure laccase-Cu3(PO4)2·3H2O nanoflower-coated silica fiber (La-CNSF) was successfully fabricated with hundreds of Cu3(PO4)2 nanosheets formed on the processed silica fibers as the petal and laccase as the enzyme catalyst. It included two processes: first, Cu nanoparticles were directly grown on silica fiber cloth as a precursor and three-dimensional (3D) Cu3(PO4)2·3H2O nanoflower was self-assembled on Cu-coated fibers by post-processing. Then, La-CNSF was successfully immobilized via a simple one-step immersion reaction in a laccase-phosphate buffer solution (PBS) solution. The product was characterized by FTIR, XRD, SEM and UV-visible spectroscopy. Congo red was realized using La-CNSF as a biocatalyst. Compared with pure laccase, La-CNSF sample exhibits an enhanced catalytic activity. The flower-like structure assembled on the fiber provided La-CNSF high storage stability and reusability in contrast with free laccase. The superior catalytic performance of La-CNSF supports a potential strategy for purification of water pollutants, and it favors the realization of the engineering of large scale applications of enzyme catalysis.

Formation and composition of adsorbates on hydrophobic carbon surfaces from aqueous laccase-maltodextrin mixture suspension

NASA Astrophysics Data System (ADS)

Corrales Ureña, Yendry Regina; Lisboa-Filho, Paulo Noronha; Szardenings, Michael; Gätjen, Linda; Noeske, Paul-Ludwig Michael; Rischka, Klaus

2016-11-01

A robust procedure for the surface bio-functionalization of carbon surfaces was developed. It consists on the modification of carbon materials in contact with an aqueous suspension of the enzyme laccase from Trametes versicolor and the lyophilization agent maltodextrin, with the pH value adjusted close to the isoelectric point of the enzyme. We report in-situ investigations applying Quartz Crystal Microbalance with Dissipation (QCM-D) for carbon-coated sensor surfaces and, moreover, ex-situ measurements with static contact angle measurements, X-ray Photoelectron Spectroscopy (XPS) and Scanning Force Microscopy (SFM) for smooth Highly Oriented Pyrolytic Graphite (HOPG) substrates, for contact times between the enzyme formulation and the carbon material surface ranging from 20 s to 24 h. QCM-D studies reveals the formation of rigid layer of biomaterial, a few nanometers thin, which shows a strongly improved wettability of the substrate surface upon contact angle measurements. Following spectroscopic characterization, these layers are composed of mixtures of laccase and maltodextrin. The formation of these adsorbates is attributed to attractive interactions between laccase, the maltodextrin-based lyophilization agent and the hydrophobic carbon surfaces; a short-term contact between the aqueous laccase mixture suspension and HOPG surfaces is shown to merely result in de-wetting patterns influencing the results of contact angle measurements. The new enzyme-based surface modification of carbon-based materials is suggested to be applicable for the improvement of not only the wettability of low energy substrate surfaces with fluid formulations like coatings or adhesives, but also their adhesion in contact with hardened polymers.

Diverse rheological properties, mechanical characteristics and microstructures of corn fiber gum/soy protein isolate hydrogels prepared by laccase and heat treatment

USDA-ARS?s Scientific Manuscript database

Two types of corn fiber gum (CFGs) were extracted from corn fibers (CFs) obtained from wet or dry corn milling processing. Both CFGs could form hydrogels when induced via laccase, but CFGs isolated from wet milled CFs exhibited higher storage modulus (G') and better mechanical strength as obtained f...

Laccase-catalyzed decolorization of malachite green: performance optimization and degradation mechanism.

PubMed

Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

2015-01-01

Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1) LacA, 109.9 mg L(-1) MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1), respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries.

Cotton Stalk Pretreatment Using Daedalea flavida, Phlebia radiata, and Flavodon flavus: Lignin Degradation, Cellulose Recovery, and Enzymatic Saccharification.

PubMed

Meehnian, Harmanpreet; Jana, Asim K

2017-04-01

Lignocellulolytic enzyme activities of selective fungi Daedalea flavida MTCC 145 (DF-2), Phlebia radiata MTCC 2791 (PR), and non-selective fungus Flavodon flavus MTCC 168 (FF) were studied for pretreatment of cotton stalks. Simultaneous productions of high LiP and laccase activities by DF-2 during early phase of growth were effective for lignin degradation 27.83 ± 1.25 % (w/w of lignin) in 20-day pretreatment. Production of high MnP activity without laccase in the early growth phase of PR was ineffective and delayed lignin degradation 24.93 ± 1.53 % in 25 days due to laccase production at later phase. With no LiP activity, low activities of MnP and laccase by FF yielded poor lignin degradation 15.09 ± 0.6 % in 20 days. Xylanase was predominant cellulolytic enzyme produced by DF-2, resulting hemicellulose as main carbon and energy source with 83 % of cellulose recovery after 40 days of pretreatment. The glucose yield improved more than two fold from 20-day DF-2 pretreated cotton stalks after enzymatic saccharification.

Synthesis and effect of modification on methacylate - acrylate microspheres for Trametes versicolor laccase enzyme immobilization

NASA Astrophysics Data System (ADS)

Mazlan, Siti Zulaikha; Hanifah, Sharina Abu

2014-09-01

Immobilization of laccase on the modified copolymer methacrylate-acrylate microspheres was studied. A poly (glycidyl methacrylate-co-n-butyl acrylate) microsphere consists of epoxy groups were synthesized using suspension photocuring technique. The epoxy group in poly (GMA-nBA) microspheres were converted into amino groups with aldehyde group. Laccase immobilization is based on having the amino groups on the enzyme surface and aldehyde group on the microspheres via covalent binding. Fourier transform infrared spectroscopy (FT-IR) analysis proved the successful surface modification on microspheres. The FTIR spectrum shows the characteristic peaks at 1646 cm-1 assigned to the conformation of the polymerization that took place between monomer GMA and nBA respectively. In addition, after modification, FTIR peaks that assigned to the epoxy ring (844 cm-1 and 904 cm-1) were decreased. The results obtained from FTIR method signify good agreement with the epoxy content method. Hence, the activity of the laccase-immobilized microspheres increased upon increasing the epoxy content. Furthermore, poly (GMA-nBA) exhibited uniform microspheres with below 2 μm surface. Immobilized enzyme showed a broader pH profile and higher temperature compared native enzyme.

Laccase-Catalyzed Decolorization of Malachite Green: Performance Optimization and Degradation Mechanism

PubMed Central

Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

2015-01-01

Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270

Bioprocessing of wheat bran for the production of lignocellulolytic enzyme cocktail by Cotylidia pannosa under submerged conditions.

PubMed

Sharma, Deepika; Garlapat, Vijay Kumar; Goel, Gunjan

2016-04-02

Characterization and production of efficient lignocellulytic enzyme cocktails for biomass conversion is the need for biofuel industry. The present investigation reports the modeling and optimization studies of lignocellulolytic enzyme cocktail production by Cotylidia pannosa under submerged conditions. The predominant enzyme activities of cellulase, xylanase and laccase were produced in the cocktail through submerged conditions using wheat bran as a substrate. A central composite design approach was utilized to model the production process using temperature, pH, incubation time and agitation as input variables with the goal of optimizing the output variables namely cellulase, xylanase and laccase activities. The effect of individual, square and interaction terms on cellulase, xylanase and laccase activities were depicted through the non-linear regression equations with significant R(2) and P-values. An optimized value of 20 U/ml, 17 U/ml and 13 U/ml of cellulase, xylanase and laccase activities, respectively, were obtained with a media pH of 5.0 in 77 h at 31C, 140 rpm using wheatbran as a substrate. Overall, the present study introduces a fungal strain, capable of producing lignocellulolytic enzyme cocktail for subsequent applications in biofuel industry.

Bioprocessing of wheat bran for the production of lignocellulolytic enzyme cocktail by Cotylidia pannosa under submerged conditions

PubMed Central

Sharma, Deepika; Garlapat, Vijay Kumar; Goel, Gunjan

2016-01-01

ABSTRACT Characterization and production of efficient lignocellulytic enzyme cocktails for biomass conversion is the need for biofuel industry. The present investigation reports the modeling and optimization studies of lignocellulolytic enzyme cocktail production by Cotylidia pannosa under submerged conditions. The predominant enzyme activities of cellulase, xylanase and laccase were produced in the cocktail through submerged conditions using wheat bran as a substrate. A central composite design approach was utilized to model the production process using temperature, pH, incubation time and agitation as input variables with the goal of optimizing the output variables namely cellulase, xylanase and laccase activities. The effect of individual, square and interaction terms on cellulase, xylanase and laccase activities were depicted through the non-linear regression equations with significant R2 and P-values. An optimized value of 20 U/ml, 17 U/ml and 13 U/ml of cellulase, xylanase and laccase activities, respectively, were obtained with a media pH of 5.0 in 77 h at 31C, 140 rpm using wheatbran as a substrate. Overall, the present study introduces a fungal strain, capable of producing lignocellulolytic enzyme cocktail for subsequent applications in biofuel industry. PMID:26941214

Amperometric catechol biosensor based on laccase immobilized on nitrogen-doped ordered mesoporous carbon (N-OMC)/PVA matrix

NASA Astrophysics Data System (ADS)

Guo, Meiqing; Wang, Hefeng; Huang, Di; Han, Zhijun; Li, Qiang; Wang, Xiaojun; Chen, Jing

2014-06-01

A functionalized nitrogen-containing ordered mesoporous carbon (N-OMC), which shows good electrical properties, was synthesized by the carbonization of polyaniline inside a SBA-15 mesoporous silica template. Based on this, through entrapping laccase onto the N-OMC/polyvinyl alcohol (PVA) film a facilely fabricated amperometric biosensor was developed. Laccase from Trametes versicolor was assembled on a composite film of a N-OMC/PVA modified Au electrode and the electrochemical behavior was investigated. The results indicated that the N-OMC modified electrode exhibits electrical properties towards catechol. The optimum experimental conditions of a biosensor for the detection of catechol were studied in detail. Under the optimal conditions, the sensitivity of the biosensor was 0.29 A*M-1 with a detection limit of 0.31 μM and a linear detection range from 0.39 μM to 8.98 μM for catechol. The calibration curve followed the Michaelis-Menten kinetics and the apparent Michaelis-Menten \\left( K_{M}^{app} \\right) was 6.28 μM. This work demonstrated that the N-OMC/PVA composite provides a suitable support for laccase immobilization and the construction of a biosensor.

Laccase Gene Expression and Vinasse Biodegradation by Trametes hirsuta Strain Bm-2.

PubMed

Tapia-Tussell, Raúl; Pérez-Brito, Daisy; Torres-Calzada, Claudia; Cortés-Velázquez, Alberto; Alzate-Gaviria, Liliana; Chablé-Villacís, Rubí; Solís-Pereira, Sara

2015-08-19

Vinasse is the dark-colored wastewater that is generated by bioethanol distilleries from feedstock molasses. The vinasse that is generated from molasses contains high amounts of pollutants, including phenolic compounds and melanoindin. The goal of this work was to study the expression of laccase genes in the Trametes hirsuta strain Bm-2, isolated in Yucatan, Mexico, in the presence of phenolic compounds, as well as its effectiveness in removing colorants from vinasse. In the presence of all phenolic compounds tested (guaiacol, ferulic acid, and vanillic acid), increased levels of laccase-encoding mRNA were observed. Transcript levels in the presence of guaiacol were 40 times higher than those in the control. The lcc1 and lcc2 genes of T. hirsuta were differentially expressed; guaiacol and vanillin induced the expression of both genes, whereas ferulic acid only induced the expression of lcc2. The discoloration of vinasse was concomitant with the increase in laccase activity. The highest value of enzyme activity (2543.7 U/mL) was obtained in 10% (v/v) vinasse, which corresponded to a 69.2% increase in discoloration. This study demonstrates the potential of the Bm-2 strain of T. hirsuta for the biodegradation of vinasse.

Replacement of oxidizable residues predicted by QM-MM simulation of a fungal laccase generates variants with higher operational stability.

PubMed

Avelar, Mayra; Pastor, Nina; Ramirez-Ramirez, Joaquin; Ayala, Marcela

2018-01-01

In this work, we sought to obtain a more stable laccase with higher operational stability for the oxidation of phenols. During this reaction, phenoxy free radicals are produced that gradually inactivate the enzyme; the inactivation rate depends on the phenol chemical nature. In order to predict residues prone to oxidize within the active site, we simulated activated states of the catalytic region of a fungal laccase using QM-MM tools (Quantum Mechanics-Molecular Mechanics). After simulating the electron distribution in both the basal and activated state (plus or minus one electron) of several conformations of Coriolopsis gallica laccase, residues that could be susceptible to oxidation were identified, according to the values of spin density obtained from calculations. Three targets were selected (F357, F413, and F475) to be replaced by site-directed mutagenesis with less oxidizable residues such as leucine, alanine, and isoleucine. The resulting variants displayed a higher specific activity (from 1.5-to 4-fold) than the parental enzyme. Catalyst depletion during phenol oxidation was 2.5-fold lower for the variants, reflecting a higher operational stability. Copyright © 2017 Elsevier Inc. All rights reserved.

Laccase-catalyzed α-arylation of benzoylacetonitrile with substituted hydroquinones

DOE PAGES

Cannatelli, Mark D.; Ragauskas, Arthur J.

2014-09-03

This article investigates a green method for α-arylation of a primary nitrile. Compounds possessing a benzylic nitrile have shown to exhibit biological activity. Laccases (benzenediol:oxygen oxidoreductase EC 1.10.3.2) were used as the catalysts to perform the cross-coupling reaction between benzoylacetonitrile and substituted hydroquinones. The corresponding 2-substituted 3-oxo-3-phenylpropanenitriles where synthesized in moderate to excellent yields in pH 7.0 buffered water under mild conditions. The substituent on the hydroquinone had a significant impact on product yields and regioselectivity of reaction. The use of laccases, which require O 2 as their only co-substrate and produce H 2O as their only by-product, to performmore » this transformation is an environmentally benign method for α-arylation of primary nitriles.« less

Biocatalytic trifluoromethylation of unprotected phenols

NASA Astrophysics Data System (ADS)

Simon, Robert C.; Busto, Eduardo; Richter, Nina; Resch, Verena; Houk, Kendall N.; Kroutil, Wolfgang

2016-11-01

Organofluorine compounds have become important building blocks for a broad range of advanced materials, polymers, agrochemicals, and increasingly for pharmaceuticals. Despite tremendous progress within the area of fluorination chemistry, methods for the direct introduction of fluoroalkyl-groups into organic molecules without prefunctionalization are still highly desired. Here we present a concept for the introduction of the trifluoromethyl group into unprotected phenols by employing a biocatalyst (laccase), tBuOOH, and either the Langlois' reagent or Baran's zinc sulfinate. The method relies on the recombination of two radical species, namely, the phenol radical cation generated directly by the laccase and the CF3-radical. Various functional groups such as ketone, ester, aldehyde, ether and nitrile are tolerated. This laccase-catalysed trifluoromethylation proceeds under mild conditions and allows accessing trifluoromethyl-substituted phenols that were not available by classical methods.

Phanerochaete flavido-alba Laccase Induction and Modification of Manganese Peroxidase Isoenzyme Pattern in Decolorized Olive Oil Mill Wastewaters

PubMed Central

Pérez, J.; de la Rubia, T.; Hamman, O. Ben; Martínez, J.

1998-01-01

Lignin-degrading enzymes were partially purified from supernatant solutions obtained from Phanerochaete flavido-alba-decolorized olive oil mill wastewaters (OMW). The dominant enzymes, manganese peroxidases, exhibited different isoform patterns in decolorized OMW-containing cultures than in residue-free samples. Laccase induction was also detected in OMW-containing cultures but not in control cultures. PMID:9647858

Heterologous expression of laccase cDNA from Ceriporiopsis subvermispora yields copper-activated apoprotein and complex isoform patterns

Treesearch

Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna

2003-01-01

Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...

Characterization of an Alkali- and Halide-Resistant Laccase Expressed in E. coli: CotA from Bacillus clausii

PubMed Central

Brander, Søren; Mikkelsen, Jørn D.; Kepp, Kasper P.

2014-01-01

The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ∼0.5–2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (KM) but to pH dependence of catalytic turnover: The kcat of B. clausii cotA was 1 s−1 at pH 6 and 5 s−1 at pH 8 in contrast to 6 s−1 at pH 6 and 2 s−1 at pH 8 for of B. subtilis cotA. Overall, kcat/KM was 10-fold higher for B. subtilis cotA at pHopt. While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500–700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ∼20 minutes half-life at 80°C, less than the ∼50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH∼8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

Whole-cell fungal transformation of precursors into dyes

PubMed Central

2010-01-01

Background Chemical methods of producing dyes involve extreme temperatures and unsafe toxic compounds. Application of oxidizing enzymes obtained from fungal species, for example laccase, is an alternative to chemical synthesis of dyes. Laccase can be replaced by fungal biomass acting as a whole-cell biocatalyst with properties comparable to the isolated form of the enzyme. The application of the whole-cell system simplifies the transformation process and reduces the time required for its completion. In the present work, four fungal strains with a well-known ability to produce laccase were tested for oxidation of 17 phenolic and non-phenolic precursors into stable and non-toxic dyes. Results An agar-plate screening test of the organic precursors was carried out using four fungal strains: Trametes versicolor, Fomes fomentarius, Abortiporus biennis, and Cerrena unicolor. Out of 17 precursors, nine were transformed into coloured substances in the presence of actively growing fungal mycelium. The immobilized fungal biomass catalyzed the transformation of 1 mM benzene and naphthalene derivatives in liquid cultures yielding stable and non-toxic products with good dyeing properties. The type of fungal strain had a large influence on the absorbance of the coloured products obtained after 48-hour transformation of the selected precursors, and the most effective was Fomes fomentarius (FF25). Whole-cell transformation of AHBS (3-amino-4-hydroxybenzenesulfonic acid) into a phenoxazinone dye was carried out in four different systems: in aqueous media comprising low amounts of carbon and nitrogen source, in buffer, and in distilled water. Conclusions This study demonstrated the ability of four fungal strains belonging to the ecological type of white rot fungi to transform precursors into dyes. This paper highlights the potential of fungal biomass for replacing isolated enzymes as a cheaper industrial-grade biocatalyst for the synthesis of dyes and other commercially important products. The use of immobilized fungal biomass limits free migration of cells and facilitates their reuse in a continuous system for precursor transformation. PMID:20598166

Immobilization of Trametes hirsuta laccase into poly(3,4-ethylenedioxythiophene) and polyaniline polymer-matrices

NASA Astrophysics Data System (ADS)

Wang, Xiaoju; Sjöberg-Eerola, Pia; Immonen, Kirsi; Bobacka, Johan; Bergelin, Mikael

The immobilization of Trametes hirsuta laccase (ThL) in the poly(3,4-ethylenedioxythiophene) (PEDOT) and polyaniline (PANI) matrices was carried out in order to study the catalytic effect of ThL in different biocathode structures in a biofuel cell application. By using 2,2‧-azinobis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a mediator compound, the immobilized ThL in both polymer matrices, exhibited catalytic activity for the reduction of oxygen into water. The amount of ThL was adjustable in the PEDOT matrix by controlling the working parameters, such as the charge density used in the electropolymerization of EDOT monomer and the ThL concentration used in the electropolymerization electrolyte. In the PEDOT biocathode structure, the utilization of porous material as the PEDOT supporting template was studied in order to improve the current density generated per unit area/volume. Reticulated vitreous carbon foam (RVC foam) was chosen as the PEDOT supporting template material and the biocathodes were manufactured by in situ entrapment of ThL into PEDOT films polymerized on the RVC foam. These biocathodes possessed a high cathodic open circuit potential and produced a large current density, reaching 1 mA cm -3 at 0.45 V when 19.5 μg ml -1 of ThL was used in the electrolyte. The performance of these biocathodes was extremely sensitive to variations in pH and the optimal working pH was around 4.2. The biocathode reserved 80%, 50%, and 30% of the catalytic activity after storage in a +4 °C buffer solution for 1 day, 1 week, and 1 month, respectively. The PANI matrix was prepared in a form of printable ink where ThL was in situ entrapped in the PANI matrix during the laccase activated polymerization of aniline using a chemical batch reactor method. Different amounts of the ThL-containing printable PANI ink were then applied on carbon paper and the performance of the ink was subsequently electrochemically characterized. In this way, not only two different polymer matrices, but also two different matrix manufacturing procedures could be compared.

Overexpression of a novel thermostable and chloride-tolerant laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and its application in synthetic dye decolorization.

PubMed

Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

2015-01-01

Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.

Overexpression of a Novel Thermostable and Chloride-Tolerant Laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and Its Application in Synthetic Dye Decolorization

PubMed Central

Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying

2015-01-01

Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0–11.0 and thermostable at 40°C–90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters. PMID:25790466

Stability Mechanisms of Laccase Isoforms using a Modified FoldX Protocol Applicable to Widely Different Proteins.

PubMed

Christensen, Niels J; Kepp, Kasper P

2013-07-09

A recent computational protocol that accurately predicts and rationalizes protein multisite mutant stabilities has been extended to handle widely different isoforms of laccases. We apply the protocol to four isoenzymes of Trametes versicolor laccase (TvL) with variable lengths (498-503 residues) and thermostability (Topt ∼ 45-80 °C) and with 67-77% sequence identity. The extended protocol uses (i) statistical averaging, (ii) a molecular-dynamics-validated "compromise" homology model to minimize bias that causes proteins close in sequence to a structural template to be too stable due to having the benefits of the better sampled template (typically from a crystal structure), (iii) correction for hysteresis that favors the input template to overdestabilize, and (iv) a preparative protocol to provide robust input sequences of equal length. The computed ΔΔG values are in good agreement with the major trends in experimental stabilities; that is, the approach may be applicable for fast estimates of the relative stabilities of proteins with as little as 70% identity, something that is currently extremely challenging. The computed stability changes associated with variations are Gaussian-distributed, in good agreement with experimental distributions of stability effects from mutation. The residues causing the differential stability of the four isoforms are consistent with a range of compiled laccase wild type data, suggesting that we may have identified general drivers of laccase stability. Several sites near Cu, notably 79, 241, and 245, or near substrate, mainly 265, are identified that contribute to stability-function trade-offs, of relevance to the search for new proficient and stable variants of these important industrial enzymes.

Influence of treatment conditions on the oxidation of micropollutants by Trametes versicolor laccase.

PubMed

Margot, Jonas; Maillard, Julien; Rossi, Luca; Barry, D A; Holliger, Christof

2013-09-25

Many organic compounds present at low concentrations in municipal wastewater, such as various pharmaceuticals and biocides, are recalcitrant in conventional wastewater treatment plants (WWTPs). To improve their biodegradation, oxidoreductase enzymes such as laccases were tested. The goal was to find optimal conditions for the transformation of two anti-inflammatory pharmaceuticals (diclofenac (DFC) and mefenamic acid (MFA)), one biocide (triclosan (TCN)) and one plastic additive (bisphenol A (BPA)) by Trametes versicolor laccase. Experiments were conducted in spiked solutions at different pH values (from 3 to 9), enzyme concentrations (70-1400 Ul(-1)), reaction times (0-26 hours) and temperatures (10, 25 and 40°C) following a Doehlert experimental design. A semi-empirical model was developed to understand better the combined effects of the four factors and to determine optimal values. This model was able to fit well the experimental data (R(2)>0.97) and showed good predictive ability. All four factors had a significant effect on the micropollutant oxidation with the greatest influence shown by pH. Results for single compounds were different from those obtained for mixtures of micropollutants. For instance, DFC transformation occurred at much higher rates in mixtures under alkaline conditions. Optimal conditions were compound-dependent, but were found to be between pH 4.5 to 6.5 and between 25°C to more than 40°C. A laccase concentration of 730 Ul(-1) was sufficient to obtain a high removal rate (>90%) of the four individual compounds (range of times: 40 min to 5 hours), showing the potential of laccases to improve biodegradation of environmentally persistent compounds. Copyright © 2013 Elsevier B.V. All rights reserved.

Functionalization of a membrane sublayer using reverse filtration of enzymes and dopamine coating.

PubMed

Luo, Jianquan; Meyer, Anne S; Mateiu, R V; Kalyani, Dayanand; Pinelo, Manuel

2014-12-24

High permeability, high enzyme loading, and strong antifouling ability are the desired features for a biocatalytic membrane to be used in an enzymatic membrane reactor (EMR). To achieve these goals, the membrane sublayer was enriched with laccase by reverse filtration in this case, and the resulting enzyme-loaded sublayer was covered with a dopamine coating. After membrane reversal, the virgin membrane skin layer was facing the feed and the enzymes were entrapped by a polydopamine network in the membrane sublayer. Thus, the membrane sublayer was functionalized as a catalytically active layer. The effects of the original membrane properties (i.e., materials, pore size, and structure), enzyme type (i.e., laccase and alcohol dehydrogenase), and coating conditions (i.e., time and pH) on the resulting biocatalytic membrane permeability, enzyme loading, and activity were investigated. Using a RC10 kDa membrane with sponge-like sublayer to immobilize laccase with dopamine coating, the trade-off between permeability and enzyme loading was broken, and enzyme loading reached 44.5% without any permeability loss. After 85 days of storage and reuse 14 times, more than 80% of the immobilized laccase activity was retained for the membrane with a dopamine coating, while the relative activity was less than 40% without the coating. The resistance to high temperature and acidic/alkaline pH was also improved by the dopamine coating for the immobilized laccase. Moreover, this biocatalytic membrane could resist mild hydrodynamic cleaning (e.g., back-flushing), but the catalytic ability was reduced by chemical cleaning at extreme pH (e.g., 1.5 and 11.5). Since the immobilized enzyme is not directly facing the bulk of EMRs and the substrate can be specifically selected by the separation skin layer, this biocatalytic membrane is promising for cascade catalytic reactions.

Layered composites of PEDOT/PSS/nanoparticles and PEDOT/PSS/phthalocyanines as electron mediators for sensors and biosensors

PubMed Central

García-Hernández, Celia; García-Cabezón, Cristina; Martín-Pedrosa, Fernando; De Saja, José Antonio

2016-01-01

The sensing properties of electrodes chemically modified with PEDOT/PSS towards catechol and hydroquinone sensing have been successfully improved by combining layers of PEDOT/PSS with layers of a secondary electrocatalytic material such as gold nanoparticles (PEDOT/PSS/AuNPs), copper phthalocyanine (PEDOT/PSS/CuPc) or lutetium bisphthalocyanine (PEDOT/PSS/LuPc2). Layered composites exhibit synergistic effects that strongly enhance the electrocatalytic activity as indicated by the increase in intensity and the shift of the redox peaks to lower potentials. A remarkable improvement has been achieved using PEDOT/PSS/LuPc2, which exhibits excellent electrocatalytic activity towards the oxidation of catechol. The kinetic studies demonstrated diffusion-controlled processes at the electrode surfaces. The kinetic parameters such as Tafel slopes and charge transfer coefficient (α) confirm the improved electrocatalytic activity of the layered electron mediators. The peak currents increased linearly with concentration of catechol and hydroquinone over the range of 1.5 × 10−4 to 4.0 × 10−6 mol·L−1 with a limit of detection on the scale of μmol·L−1. The layered composite hybrid systems were also found to be excellent electron mediators in biosensors containing tyrosinase and laccase, and they combine the recognition and biocatalytic properties of biomolecules with the unique catalytic features of composite materials. The observed increase in the intensity of the responses allowed detection limits of 1 × 10−7 mol·L−1 to be attained. PMID:28144543

Biocatalytic trifluoromethylation of unprotected phenols

PubMed Central

Simon, Robert C.; Busto, Eduardo; Richter, Nina; Resch, Verena; Houk, Kendall N.; Kroutil, Wolfgang

2016-01-01

Organofluorine compounds have become important building blocks for a broad range of advanced materials, polymers, agrochemicals, and increasingly for pharmaceuticals. Despite tremendous progress within the area of fluorination chemistry, methods for the direct introduction of fluoroalkyl-groups into organic molecules without prefunctionalization are still highly desired. Here we present a concept for the introduction of the trifluoromethyl group into unprotected phenols by employing a biocatalyst (laccase), tBuOOH, and either the Langlois' reagent or Baran's zinc sulfinate. The method relies on the recombination of two radical species, namely, the phenol radical cation generated directly by the laccase and the CF3-radical. Various functional groups such as ketone, ester, aldehyde, ether and nitrile are tolerated. This laccase-catalysed trifluoromethylation proceeds under mild conditions and allows accessing trifluoromethyl-substituted phenols that were not available by classical methods. PMID:27834376

Potentialities of a membrane reactor with laccase grafted membranes for the enzymatic degradation of phenolic compounds in water.

PubMed

Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

2014-10-06

This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto α-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L-1), consumption increased with flux (up to 7.9 × 103 mg·h-1·m-2 at 128 L·h-1·m-2), whereas at the highest substrate concentration (500 mg·L-1), it was shown that the reaction was limited by the oxygen content.

Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water

PubMed Central

Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

2014-01-01

This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto α-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L−1), consumption increased with flux (up to 7.9 × 103 mg·h−1·m−2 at 128 L·h−1·m−2), whereas at the highest substrate concentration (500 mg·L−1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

PubMed Central

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with K m and k cat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

PubMed

Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

2009-04-01

The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

Protein and gene structure of a blue laccase from Pleurotus ostreatus1.

PubMed Central

Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

1999-01-01

A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

Changes in selected enzyme activities during growth of pure and mixed cultures of the white-rot decay fungus Trametes versicolor and the potential biocontrol fungus Trichoderma harzianum.

PubMed

Freitag, M; Morrell, J J

1992-04-01

Two filamentous fungi, the white-rot fungus Trametes versicolor and the soil fungus and potential biocontrol organism Trichoderma harzianum, have been grown in pure and mixed cultures on low-N (0.4 mM) and high-N (4 mM) defined synthetic media to determine the activities of selected wood-degrading enzymes such as cellobiase, cellulase, laccase, and peroxidases. Growth characteristics and enzyme activities were examined for potential correlations. Such correlations would allow the use of simple enzyme assays for measuring biomass development and would facilitate predictions about competitiveness of species in mixed fungal cultures. Our results show that while laccase and Poly Red-478 peroxidase activities indicate survival of the decay fungus, none of the monitored extracellular enzymes can serve as a quantitative indicator for biomass accumulation. As expected, the level of available nitrogen affected the production of the enzymes monitored: in low-N media, specific cellobiase, specific cellulase, and peroxidase activities were enhanced, while laccase activities were reduced. Most importantly, laccase activities of Trametes versicolor, and to a smaller extent, cellobiase activities of both fungi, were significantly induced in mixed cultures of Trametes versicolor and Trichoderma harzianum.

A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity

PubMed Central

Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

2003-01-01

Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2′-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 μM. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088

Changes is genes coding for laccases 1 and 2 may contribute to deformation and reduction of wings in apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) from the isolated population in Pieniny National Park (Poland).

PubMed

Łukasiewicz, Kinga; Węgrzyn, Grzegorz

2016-01-01

An isolated population of apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) occurs in Pieniny National Park (Poland). Deformations and reductions of wings in a relatively large number of individuals from this population is found, yet the reasons for these defects are unknown. During studies devoted to identify cause(s) of this phenomenon, we found that specific regions of genes coding of enzymes laccases 1 and 2 could not be amplified from DNA samples isolated from large fractions of malformed insects while expected PCR products were detected in almost all (with one exception) normal butterflies. Laccases (p-diphenol:dioxygen oxidoreductases) are oxidases containing several copper atoms. They catalyse single-electron oxidations of phenolic or other compounds with concomitant reduction of oxygen to water. In insects, their enzymatic activities were found previously in epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Therefore, we suggest that defects in genes coding for laccases might contribute to deformation and reduction of wings in apollo butterflies, though it seems obvious that deficiency in these enzymes could not be the sole cause of these developmental improperties in P. apollo from Pieniny National Park.

Silica nanoparticle based techniques for extraction, detection, and degradation of pesticides.

PubMed

Bapat, Gandhali; Labade, Chaitali; Chaudhari, Amol; Zinjarde, Smita

2016-11-01

Silica nanoparticles (SiNPs) find applications in the fields of drug delivery, catalysis, immobilization and sensing. Their synthesis can be mediated in a facile manner and they display broad range compatibility and stability. Their existence in the form of spheres, wires and sheets renders them suitable for varied purposes. This review summarizes the use of silica nanostructures in developing techniques for extraction, detection and degradation of pesticides. Silica nanostructures on account of their sorbent properties, porous nature and increased surface area allow effective extraction of pesticides. They can be modified (with ionic liquids, silanes or amines), coated with molecularly imprinted polymers or magnetized to improve the extraction of pesticides. Moreover, they can be altered to increase their sensitivity and stability. In addition to the analysis of pesticides by sophisticated techniques such as High Performance Liquid Chromatography or Gas chromatography, silica nanoparticles related simple detection methods are also proving to be effective. Electrochemical and optical detection based on enzymes (acetylcholinesterase and organophosphate hydrolase) or antibodies have been developed. Pesticide sensors dependent on fluorescence, chemiluminescence or Surface Enhanced Raman Spectroscopic responses are also SiNP based. Moreover, degradative enzymes (organophosphate hydrolases, carboxyesterases and laccases) and bacterial cells that produce recombinant enzymes have been immobilized on SiNPs for mediating pesticide degradation. After immobilization, these systems show increased stability and improved degradation. SiNP are significant in developing systems for effective extraction, detection and degradation of pesticides. SiNPs on account of their chemically inert nature and amenability to surface modifications makes them popular tools for fabricating devices for 'on-site' applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Immobilization of a Pleurotus ostreatus Laccase Mixture on Perlite and Its Application to Dye Decolourisation

PubMed Central

Salatino, Piero; Sannia, Giovanni

2014-01-01

In the present study, a crude laccase preparation from Pleurotus ostreatus was successfully immobilized on perlite, a cheap porous silica material, and tested for Remazol Brilliant Blue R (RBBR) decolourisation in a fluidized bed recycle reactor. Results showed that RBBR decolourisation is mainly due to enzyme action despite the occurrence of dye adsorption-related enzyme inhibition. Fine tuning of immobilization conditions allowed balancing the immobilization yield and the resulting rate of decolourisation, with the adsorption capacity of the solid biocatalyst. In the continuous lab scale reactor, a maximum conversion degree of 56.1% was achieved at reactor space-time of 4.2 h. Stability and catalytic parameters of the immobilized laccases were also assessed in comparison with the soluble counterparts, revealing an increase in stability, despite a reduction of the catalytic performances. Both effects are most likely ascribable to the occurrence of multipoint attachment phenomena. PMID:24895564

[Degradation of anthraquinone blue by Trametes trogii].

PubMed

Levin, L; Jordan, A; Forchiassin, F; Viale, A

2001-01-01

The ability of the white rot fungus Trametes trogii BAFC 463 (high producer of ligninolytic enzymes, especially laccase and manganese peroxidase) to degrade the dye anthraquinone blue, refractory to bacterial attack, was evaluated. Both tropho- and idiophasic T. trogii cultures in synthetic medium (glucose/asparagine) and complex medium (malt extract/glucose) were able to transform up to 88% dye in 4 hours. The activity of laccase, an oxygen-dependent phenoloxidase which was present at high levels in all the conditions assayed, might be related to the ability of the fungus to degrade the colorant. This is supported by the fact that in bioreactor experiences carried out at pH 4.5 the addition of anthraquinone blue caused a decrease in the levels of soluble oxygen. However, although high levels of laccase were produced at pH 7.5, the enzyme was not active, and neither dye transformation nor loss in the levels of soluble oxygen were quantified.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Interaction among multiple microorganisms and effects of nitrogen and carbon supplementations on lignin degradation.

PubMed

Lv, Yuancai; Chen, Yuancai; Sun, Shiying; Hu, Yongyou

2014-03-01

The mutual interactions among the consortium constructed by four indigenous bacteria and five inter-kingdom fusants and the effects of nitrogen and carbon supplementations on lignin degradation and laccase activity were investigated. Analyzed by Plackett-Burman and central composite design, the microbial consortium were optimized, Bacillus sp. (B) and PE-9 and Pseudomonas putida (Pp) and PE-9 had significant interactions on lignin degradation based on a 5% level of significance. The nitrogen and carbon supplementations played an important role in lignin degradation and laccase production. The ultimate lignin degradation efficiency of 96.0% and laccase activity of 268U/L were obtained with 0.5g/L of ammonium chloride and 2g/L of sucrose. Results suggested that a stable and effective microbial consortium in alkalescent conditions was successfully achieved through the introduction of fusants, which was significant for its industrial application. Copyright © 2013 Elsevier Ltd. All rights reserved.

Role of Laccase and Low Molecular Weight Metabolites from Trametes versicolor in Dye Decolorization

PubMed Central

Moldes, Diego; Fernández-Fernández, María; Sanromán, M. Ángeles

2012-01-01

The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

Printing of polymer microcapsules for enzyme immobilization on paper substrate.

PubMed

Savolainen, Anne; Zhang, Yufen; Rochefort, Dominic; Holopainen, Ulla; Erho, Tomi; Virtanen, Jouko; Smolander, Maria

2011-06-13

Poly(ethyleneimine) (PEI) microcapsules containing laccase from Trametes hirsuta (ThL) and Trametes versicolor (TvL) were printed onto paper substrate by three different methods: screen printing, rod coating, and flexo printing. Microcapsules were fabricated via interfacial polycondensation of PEI with the cross-linker sebacoyl chloride, incorporated into an ink, and printed or coated on the paper substrate. The same ink components were used for three printing methods, and it was found that laccase microcapsules were compatible with the ink. Enzymatic activity of microencapsulated TvL was maintained constant in polymer-based ink for at least eight weeks. Thick layers with high enzymatic activity were obtained when laccase-containing microcapsules were screen printed on paper substrate. Flexo printed bioactive paper showed very low activity, since by using this printing method the paper surface was not fully covered by enzyme microcapsules. Finally, screen printing provided a bioactive paper with high water-resistance and the highest enzyme lifetime.

Temperature affects the production, activity and stability of ligninolytic enzymes in Pleurotus ostreatus and Trametes versicolor.

PubMed

Snajdr, J; Baldrian, P

2007-01-01

Enzyme activity was determined in cultures of Pleurotus ostreatus and Trametes versicolor with cellulose as a sole C source and high C/N ratio. The fungi were able to grow and produce laccase and Mn-peroxidase (MnP) at 5-35 degrees C, the highest production being recorded at 25-30 degrees C in P. ostreatus and at 35 degrees C in T. versicolor. Production of both enzymes at 10 degrees C accounted only for 4-20% of the maximum value. Temperature optima for enzyme activity were 50 and 55 degrees C for P. ostreatus and T. versicolor laccases, respectively, and 60 degrees C for MnP. Temperatures causing 50% loss of activity after 24 h were 32 and 47 degrees C for laccases and 36 and 30 degrees C for MnP from P. ostreatus and T. versicolor, respectively.

Enzymatic browning and biochemical alterations in black spots of pineapple [Ananas comosus (L.) Merr.].

PubMed

Avallone, Sylvie; Guiraud, Joseph-Pierre; Brillouet, Jean-Marc; Teisson, Claude

2003-08-01

Penicillium funiculosum Thom. was consistently isolated from pineapple-infected fruitlet (black spots). Polyphenol oxidase, peroxidase, and laccase activities were determined in extracts from contiguous and infected fruitlets. Healthy fruitlets showed a rather high level of polyphenol oxidase (optimum pH 7.0), and this activity was tremendously increased (X 10) in contiguous infected fruitlets. Furthermore, infected fruitlets also exhibited laccase activity (optimum pH 4.0), while peroxidase was rather constant in both fruitlets. Browning reactions were attributed to qualitative and quantitative modifications of the enzymatic equipment (polyphenol oxidase and laccase) (p < 0.0001). In infected fruiltets, sucrose and L-malic acid were present at significantly lower amounts than in healthy ones, likely owing to fungal metabolism (p < 0.0001), whereas cell wall material was three times higher, which could be viewed as a defense mechanism to limit expansion of the mycelium.

Hybrid biobattery based on arylated carbon nanotubes and laccase.

PubMed

Stolarczyk, Krzysztof; Sepelowska, Małgorzata; Lyp, Dominika; Zelechowska, Kamila; Biernat, Jan F; Rogalski, Jerzy; Farmer, Kevin D; Roberts, Ken N; Bilewicz, Renata

2012-10-01

Single-walled carbon nanotubes (SWCNT) were covalently modified with anthracene and anthraquinone and used for the construction of cathodes for biocatalytic reduction of dioxygen. The nanotubes with aromatic groups casted onto the electrode increased the working surface of the electrode and enabled efficient direct electron transfer (DET) between the enzyme and the electrode. The aryl groups enter the hydrophobic pocket of the T1 center of laccase responsible for exchanging electrons with the substrate. Glassy carbon electrode covered with arylated SWCNT and coated with a layer of neutralized Nafion containing laccase was found to be a very efficient cathode in the hybrid battery. Zn wire covered with a Nafion film served as the anode. The cell parameters were determined: power density was 2 mW/cm(2) and the open circuit potential was 1.5 V. Copyright © 2011 Elsevier B.V. All rights reserved.

Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.

PubMed

Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

2012-01-01

The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds.

Production, purification and biochemical characterization of two laccase isoforms produced by Trametes versicolor grown on oak sawdust.

PubMed

Martínez-Morales, Fernando; Bertrand, Brandt; Pasión Nava, Angélica A; Tinoco, Raunel; Acosta-Urdapilleta, Lourdes; Trejo-Hernández, María R

2015-02-01

Two laccase isoforms (lcc1 and lcc2) produced by Trametes versicolor, grown on oak sawdust under solid-state fermentation conditions, were purified and characterized. The two isoforms showed significant biochemical differences. Lcc1 and lcc2 had MWs of 60 and 100 kDa, respectively. Both isoforms had maximal activity at pH 3 with ABTS and 2,6-dimethyloxyphenol (DMP). Lcc1 was the most attractive isoform due to its greater affinity towards all the laccase substrates used. Lcc1 had Km values of 12, 10, 15 and 17 mM towards ABTS, DMP, guaiacol and syringaldazine, respectively. Lcc2 had equivalent values of 45, 47, 15 and 39 mM. The biochemical properties of lcc1 substantiate the potential of this enzyme for application in the treatment of contaminated water with low pH values and high phenolic content.

Lignin degradation by selected fungal species.

PubMed

Knežević, Aleksandar; Milovanović, Ivan; Stajić, Mirjana; Lončar, Nikola; Brčeski, Ilija; Vukojević, Jelena; Cilerdžić, Jasmina

2013-06-01

As biological decomposition of plant biomass represents a popular alternative environmental-friendly and economically justified process, screening of ligninolytic enzyme systems of various fungal species is a topical study area. The goal of the study was to obtain clear insight into the dynamics of laccase, Mn-dependent peroxidase, and Mn-independent peroxidase activity and levels of wheat straw lignin degradation in seven wood-rotting fungi. The best laccase producers were Pleurotus ostreatus and Pleurotus eryngii. Lenzites betulinus and Fomitopsis pinicola were the best Mn-dependent peroxidase producers, and P. ostreatus the weakest one. The peak of Mn-independent peroxidase was noted in Dichomytus squalens, and the minimum value in P. ostreatus. The profiles of the three enzymes, obtained by isoelectric focusing, were variable depending on the species and cultivation period. D. squalens was the best lignin degrader (34.1% of total lignin amount), and P. ostreatus and P. eryngii the weakest ones (7.1% and 14.5%, respectively). Copyright © 2013 Elsevier Ltd. All rights reserved.

A novel quantum dot-laccase hybrid nanobiosensor for low level determination of dopamine.

PubMed

Shamsipur, Mojtaba; Shanehasz, Maryam; Khajeh, Khosro; Mollania, Nasrin; Kazemi, Sayyed Habib

2012-12-07

This work reports a novel nanobiosensor based on a thioglycolic acid (TGA)-capped CdTe quantum dot-laccase (Lac) enzyme system for sensitive detection of dopamine (DA). The enzyme used catalyzes the oxidation of DA to dopamine-o-quinone (DOQ), which can selectively quench the strong luminescence of CdTe nanocrystals at neutral pH. The relationship between luminescence intensity of CdTe nanocrystals and DA concentration is nicely described by the Stern-Volmer equation. At an optimum pH of 7.4, the proposed sensor gives a linear calibration over a DA concentration range of 0.3 to 100 μM, with a limit of detection of 0.16 μM and a response time of 2 min. The relative standard deviation for seven replicate determinations of 6.0 μM of DA was found to be 3.7%. The sensor was successfully applied to the determination of DA in a blood plasma sample and in a DA injection formulation.

Naproxen degradation test to monitor Trametes versicolor activity in solid-state bioremediation processes.

PubMed

Rodríguez-Rodríguez, Carlos E; Marco-Urrea, Ernest; Caminal, Gloria

2010-07-15

The white-rot fungus Trametes versicolor has been studied as a potential agent for the removal of environmental pollutants. For long-time solid-phase bioremediation systems a test is required to monitor the metabolic status of T. versicolor and its degradation capability at different stages. A biodegradation test based on the percentage of degradation of a spiked model pharmaceutical (anti-inflammatory naproxen) in 24 h (ND24) is proposed to monitor the removal of pharmaceuticals and personal care products in sewage sludge. ND24 is intended to act as a test complementary to ergosterol quantification as specific fungal biomarker, and laccase activity as extracellular oxidative capacity of T. versicolor. For samples collected over 45 d, ND24 values did not necessarily correlate with ergosterol or laccase amounts but in most cases, they were over 30% degradation, indicating that T. versicolor may be suitable for bioremediation of sewage sludge in the studied period. 2010 Elsevier B.V. All rights reserved.

Bioreactor with Ipomoea hederifolia adventitious roots and its endophyte Cladosporium cladosporioides for textile dye degradation.

PubMed

Patil, Swapnil M; Chandanshive, Vishal V; Rane, Niraj R; Khandare, Rahul V; Watharkar, Anuprita D; Govindwar, Sanjay P

2016-04-01

In vitro grown untransformed adventitious roots (AR) culture of Ipomoea hederifolia and its endophytic fungus (EF) Cladosporium cladosporioides decolorized Navy Blue HE2R (NB-HE2R) at a concentration of 20 ppm up to 83.3 and 65%, respectively within 96h. Whereas the AR-EF consortium decolorized the dye more efficiently and gave 97% removal within 36h. Significant inductions in the enzyme activities of lignin peroxidase, tyrosinase and laccase were observed in roots, while enzymes like tyrosinase, laccase and riboflavin reductase activities were induced in EF. Metabolites of dye were analyzed using UV-vis spectroscopy, FTIR and gas chromatography-mass spectrometry. Possible metabolic pathways of NB-HE2R were proposed with AR, EF and AR-EF systems independently. Looking at the superior efficacy of AR-EF system, a rhizoreactor was developed for the treatment of NB-HE2R at a concentration of 1000 ppm. Control reactor systems with independently grown AR and EF gave 94 and 85% NB-HE2R removal, respectively within 36h. The AR-EF rhizoreactor, however, gave 97% decolorization. The endophyte colonization additionally increased root and shoot lengths of candidate plants through mutualism. Combined bioreactor strategies can be effectively used for future eco-friendly remediation purposes. Copyright © 2016 Elsevier Inc. All rights reserved.

Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.

PubMed

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina

2016-08-23

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.

Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins

PubMed Central

Kramer, Marianne C.; Liang, Dongming; Tatomer, Deirdre C.; Gold, Beth; March, Zachary M.; Cherry, Sara; Wilusz, Jeremy E.

2015-01-01

Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3′ end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine–arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. PMID:26450910

The degradation of three-ringed polycyclic aromatic hydrocarbons by wood-inhabiting fungus Pleurotus ostreatus and soil-inhabiting fungus Agaricus bisporus.

PubMed

Pozdnyakova, Natalia; Dubrovskaya, Ekaterina; Chernyshova, Marina; Makarov, Oleg; Golubev, Sergey; Balandina, Svetlana; Turkovskaya, Olga

2018-05-01

The degradation of two isomeric three-ringed polycyclic aromatic hydrocarbons by the white rot fungus Pleurotus ostreatus D1 and the litter-decomposing fungus Agaricus bisporus F-8 was studied. Despite some differences, the degradation of phenanthrene and anthracene followed the same scheme, forming quinone metabolites at the first stage. The further fate of these metabolites was determined by the composition of the ligninolytic enzyme complexes of the fungi. The quinone metabolites of phenanthrene and anthracene produced in the presence of only laccase were observed to accumulate, whereas those formed in presence of laccase and versatile peroxidase were metabolized further to form products that were further included in basal metabolism (e.g. phthalic acid). Laccase can catalyze the initial attack on the PAH molecule, which leads to the formation of quinones, and that peroxidase ensures their further oxidation, which eventually leads to PAH mineralization. A. bisporus, which produced only laccase, metabolized phenanthrene and anthracene to give the corresponding quinones as the dominant metabolites. No products of further utilization of these compounds were detected. Thus, the fungi's affiliation with different ecophysiological groups and their cultivation conditions affect the composition and dynamics of production of the ligninolytic enzyme complex and the completeness of PAH utilization. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.

2012-06-08

Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediatemore » in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.« less

Transcriptional response of lignin-degrading enzymes to 17α-ethinyloestradiol in two white rots

PubMed Central

Přenosilová, L; Křesinová, Z; Amemori, A Slavíková; Cajthaml, T; Svobodová, K

2013-01-01

Fungal, ligninolytic enzymes have attracted a great attention for their bioremediation capabilities. A deficient knowledge of regulation of enzyme production, however, hinders the use of ligninolytic fungi in bioremediation applications. In this work, a transcriptional analyses of laccase and manganese peroxidase (MnP) production by two white rots was combined with determination of pI of the enzymes and the evaluation of 17α-ethinyloestradiol (EE2) degradation to study regulation mechanisms used by fungi during EE2 degradation. In the cultures of Trametes versicolor the addition of EE2 caused an increase in laccase activity with a maximum of 34.2 ± 6.7 U g−1 of dry mycelia that was observed after 2 days of cultivation. It corresponded to a 4.9 times higher transcription levels of a laccase-encoding gene (lacB) that were detected in the cultures at the same time. Simultaneously, pI values of the fungal laccases were altered in response to the EE2 treatment. Like T. versicolor, Irpex lacteus was also able to remove 10 mg l−1 EE2 within 3 days of cultivation. While an increase to I. lacteus MnP activity and MnP gene transcription levels was observed at the later phase of the cultivation. It suggests another metabolic role of MnP but EE2 degradation. PMID:23170978

Recovery of Phenolic Acid and Enzyme Production from Corn Silage Biologically Treated by Trametes versicolor.

PubMed

Bucić-Kojić, Ana; Šelo, Gordana; Zelić, Bruno; Planinić, Mirela; Tišma, Marina

2017-03-01

Corn silage is used as high-energy forage for dairy cows and more recently for biogas production in a process of anaerobic co-digestion with cow manure. In this work, fresh corn silage after the harvest was used as a substrate in solid-state fermentations with T. versicolor with the aim of phenolic acid recovery and enzyme (laccase and manganese peroxidase) production. During 20 days of fermentation, 10.4-, 3.4-, 3.0-, and 1.8-fold increments in extraction yield of syringic acid, vanillic acid, p-hydroxybenzoic acid, and caffeic acid, respectively, were reached when compared to biologically untreated corn silage. Maximal laccase activity was gained on the 4th day of fermentation (V.A. = 180.2 U/dm 3 ), and manganese peroxidase activity was obtained after the 3rd day of fermentation (V.A. = 30.1 U/dm 3 ). The addition of copper(II) sulfate as inducer during solid state fermentation resulted in 8.5- and 7-fold enhancement of laccase and manganese peroxidase activities, respectively. Furthermore, the influence of pH and temperature on enzyme activities was investigated. Maximal activity of laccase was obtained at T = 50 °C and pH = 3.0, while manganese peroxidase is active at temperature range T = 45-70 °C with the maximal activity at pH = 4.5.

Fast reduction of a copper center in laccase by nitric oxide and formation of a peroxide intermediate.

PubMed

Torres, Jaume; Svistunenko, Dimitri; Karlsson, Bo; Cooper, Chris E; Wilson, Michael T

2002-02-13

The rapid reduction of one of the copper atoms (type 2) of tree laccase by nitric oxide (NO) has been detected. Addition of NO to native laccase in the presence of oxygen leads to EPR changes consistent with fast reduction and slow reoxidation of this metal center. These events are paralleled by optical changes that are reminiscent of formation and decay of the peroxide intermediate in a fraction of the enzyme population. Formation of this species is only possible if the trinuclear copper cluster (type 2 plus type 3) is fully reduced. This condition can only be met if, as suggested previously, a fraction of the enzyme contains both type 3 coppers already reduced before addition of NO. Our data are consistent with this assumption. We have suggested recently that fast reduction of copper is the mechanism by which NO interacts with the oxidized dinuclear center in cytochrome c oxidase. The present experiments using laccase strongly support this view and suggest this reaction as a general mechanism by which copper proteins interact with NO. In addition, this provides an unexploited way to produce a stable peroxide intermediate in copper oxidases in which the full complement of copper atoms is present. This enables the O-O scission step in the catalytic cycle to be studied by electron addition to the peroxide derivative through the native electron entry site, type 1 copper.

Potential of Wood-Rotting Fungi to Attack Polystyrene Sulfonate and Its Depolymerisation by Gloeophyllum trabeum via Hydroquinone-Driven Fenton Chemistry

PubMed Central

Krueger, Martin C.; Hofmann, Ulrike; Moeder, Monika; Schlosser, Dietmar

2015-01-01

Synthetic polymers often pose environmental hazards due to low biodegradation rates and resulting accumulation. In this study, a selection of wood-rotting fungi representing different lignocellulose decay types was screened for oxidative biodegradation of the polymer polystyrene sulfonate (PSS). Brown-rot basidiomycetes showed PSS depolymerisation of up to 50 % reduction in number-average molecular mass (Mn) within 20 days. In-depth investigations with the most efficient depolymeriser, a Gloeophyllum trabeum strain, pointed at extracellular hydroquinone-driven Fenton chemistry responsible for depolymerisation. Detection of hydroxyl radicals present in the culture supernatants showed good compliance with depolymerisation over the time course of PSS degradation. 2,5-Dimethoxy-1,4-hydroquinone (2,5-DMHQ), which was detected in supernatants of active cultures via liquid chromatography and mass spectrometry, was demonstrated to drive the Fenton processes in G. trabeum cultures. Up to 80% reduction in Mn of PSS where observed when fungal cultures were additionally supplemented with 2,5-dimethoxy benzoquinone, the oxidized from of 2,5-DMHQ. Furthermore, 2,5-DMHQ could initiate the Fenton's reagent-mediated PSS depolymerisation in cell-free systems. In contrast, white-rot fungi were unable to cause substantial depolymerising effects despite the expression of lignin-modifying exo-enzymes. Detailed investigations with laccase from Trametes versicolor revealed that only in presence of certain redox mediators limited PSS depolymerisation occurred. Our results indicate that brown-rot fungi might be suitable organisms for the biodegradation of recalcitrant synthetic polymeric pollutants. PMID:26147966

Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

PubMed

Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

2008-07-01

Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

Oxidation of Wine Polyphenols by Secretomes of Wild Botrytis cinerea Strains from White and Red Grape Varieties and Determination of Their Specific Laccase Activity.

PubMed

Zimdars, Sabrina; Hitschler, Julia; Schieber, Andreas; Weber, Fabian

2017-12-06

Processing of Botrytis cinerea-infected grapes leads to enhanced enzymatic browning reactions mainly caused by the enzyme laccase which is able to oxidize a wide range of phenolic compounds. The extent of color deterioration depends on the activity of the enzymes secreted by the fungus. The present study revealed significant differences in the oxidative properties of secretomes of several B. cinerea strains isolated from five grape varieties. The presumed laccase-containing secretomes varied in their catalytic activity toward six phenolic compounds present in grapes. All strains led to identical product profiles for five of six substrates, but two strains showed deviating product profiles during gallic acid oxidation. Fast oxidation of caffeic acid, ferulic acid, and malvidin 3-O-glucoside was observed. Product formation rates and relative product concentrations were determined. The results reflect the wide range of enzyme activity and the corresponding different impact on color deterioration by B. cinerea.

Cost analysis in laccase production.

PubMed

Osma, Johann F; Toca-Herrera, José L; Rodríguez-Couto, Susana

2011-11-01

In this paper the cost of producing the enzyme laccase by the white-rot fungus Trametes pubescens under both submerged (SmF) and solid-state fermentation (SSF) conditions was studied. The fungus was cultured using more than 45 culture medium compositions. The cost of production was estimated by analyzing the cost of the culture medium, the cost of equipment and the operating costs. The cost of the culture medium represented, in all cases, the highest contribution to the total cost, while, the cost of equipment was significantly low, representing less than 2% of the total costs. The cultivation under SSF conditions presented a final cost 50-fold lower than the one obtained when culturing under SmF conditions at flask scale. In addition, the laccase production under SSF conditions in tray bioreactors reduced the final cost 4-fold compared to the one obtained under SSF conditions at flask scale, obtaining a final price of 0.04 cent €/U. Copyright © 2011 Elsevier Ltd. All rights reserved.

Laccase-assisted formation of bioactive chitosan/gelatin hydrogel stabilized with plant polyphenols.

PubMed

Rocasalbas, Guillem; Francesko, Antonio; Touriño, Sonia; Fernández-Francos, Xavier; Guebitz, Georg M; Tzanov, Tzanko

2013-02-15

Laccase-assisted simultaneous cross-linking and functionalization of chitosan/gelatin blends with phenolic compounds from Hamamelis virginiana was investigated for the development of bioactive hydrogel dressings. The potential of these hydrogels for chronic wound treatment was evaluated in vitro, assessing their antibacterial and inhibitory effect on myeloperoxidase and collagenase. Rheological studies revealed that the mechanical properties of the hydrogels were a function of the enzymatic reaction time. Stable hydrogels and resistant to lysozyme degradation were achieved after 2 h laccase reaction. The inhibitory capacity of the hydrogel for myeloperoxidase and collagenase was 32% and 79% respectively after 24 h incubation. Collagenase activity was additionally suppressed by adsorption (20%) of the enzyme onto the hydrogel. Therefore, the bioactive properties of the hydrogels were due to the effect of both released phenolic compounds and the permanently functionalized platform itself. The hydrogels showed antibacterial activity against Pseudomonas aeruginosa and Staphylococcus aureus. Copyright © 2012 Elsevier Ltd. All rights reserved.

Enzymatic grafting of simple phenols on flax and sisal pulp fibres using laccases.

PubMed

Aracri, Elisabetta; Fillat, Amanda; Colom, José F; Gutiérrez, Ana; Del Río, José C; Martínez, Angel T; Vidal, Teresa

2010-11-01

Flax and sisal pulps were treated with two laccases (from Pycnoporus cinnabarinus, PcL and Trametes villosa, TvL, respectively), in the presence of different phenolic compounds (syringaldehyde, acetosyringone and p-coumaric acid in the case of flax pulp, and coniferaldehyde, sinapaldehyde, ferulic acid and sinapic acid in the case of sisal pulp). In most cases the enzymatic treatments resulted in increased kappa number of pulps suggesting the incorporation of the phenols into fibres. The covalent binding of these compounds to fibres was evidenced by the analysis of the treated pulps, after acetone extraction, by pyrolysis coupled with gas chromatography/mass spectrometry in the absence and/or in the presence of tetramethylammonium hydroxide (TMAH) as methylating agent. The highest extents of phenol incorporation were observed with the p-hydroxycinnamic acids, p-coumaric and ferulic acids. The present work shows for the first time the use of analytical pyrolysis as an effective approach to study fibre functionalization by laccase-induced grafting of phenols. Copyright 2010 Elsevier Ltd. All rights reserved.

Molybdenum disulphide and graphene quantum dots as electrode modifiers for laccase biosensor.

PubMed

Vasilescu, Ioana; Eremia, Sandra A V; Kusko, Mihaela; Radoi, Antonio; Vasile, Eugeniu; Radu, Gabriel-Lucian

2016-01-15

A nanocomposite formed from molybdenum disulphide (MoS2) and graphene quantum dots (GQDs) was proposed as a novel and suitable support for enzyme immobilisation displaying interesting electrochemical properties. The conductivity of the carbon based screen-printed electrodes was highly improved after modification with MoS2 nanoflakes and GQDs, the nanocomposite also providing compatible matrix for laccase immobilisation. The influence of different modification steps on the final electroanalytical performances of the modified electrode were evaluated by UV-vis absorption and fluorescence spectroscopy, scanning electron microscopy, transmission electron microscopy, X ray diffraction, electrochemical impedance spectroscopy and cyclic voltammetry. The developed laccase biosensor has responded efficiently to caffeic acid over a concentration range of 0.38-100µM, had a detection limit of 0.32µM and a sensitivity of 17.92nAµM(-1). The proposed analytical tool was successfully applied for the determination of total polyphenolic content from red wine samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Applications of Trametes versicolor crude culture filtrates in detoxification of biomass pretreatment hydrolyzates.

PubMed

Kapoor, Rajeev Kumar; Rajan, Kalavathy; Carrier, Danielle Julie

2015-01-01

Laccases have wide range of substrate specificity and find applications from pulp industry to waste water remediation. Laccases have also been used in combined pretreatment of biomass hydrolyzates to remove enzymatic and fermentation inhibitors. In this study, laccase production by Trametes versicolor strains isolated from different regions of the United States was induced using copper salts. T. versicolor crude culture filtrates (CCF), without any purification step, were tested for removal of model inhibitor compounds as well as in poplar and rice straw pretreatment hydrolyzates. Phenolic inhibitors were removed by 76% and 94% from the dilute acid hydrolyzates of rice straw and poplar, respectively, when incubated with the CCF for 12h, at room temperature. Xylo-oligosaccharide concentrations present in rice straw hydrolyzates were reduced by 64% when incubated with T. versicolor CCF. T. versicolor CCF could be a low cost technology for decreasing enzymatic and fermentation inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

Image analysis technique as a tool to identify morphological changes in Trametes versicolor pellets according to exopolysaccharide or laccase production.

PubMed

Tavares, Ana P M; Silva, Rui P; Amaral, António L; Ferreira, Eugénio C; Xavier, Ana M R B

2014-02-01

Image analysis technique was applied to identify morphological changes of pellets from white-rot fungus Trametes versicolor on agitated submerged cultures during the production of exopolysaccharide (EPS) or ligninolytic enzymes. Batch tests with four different experimental conditions were carried out. Two different culture media were used, namely yeast medium or Trametes defined medium and the addition of lignolytic inducers as xylidine or pulp and paper industrial effluent were evaluated. Laccase activity, EPS production, and final biomass contents were determined for batch assays and the pellets morphology was assessed by image analysis techniques. The obtained data allowed establishing the choice of the metabolic pathways according to the experimental conditions, either for laccase enzymatic production in the Trametes defined medium, or for EPS production in the rich Yeast Medium experiments. Furthermore, the image processing and analysis methodology allowed for a better comprehension of the physiological phenomena with respect to the corresponding pellets morphological stages.

An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp1[OPEN

PubMed Central

Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi

2015-01-01

In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

Laccase mediated-synthesis of hydroxycinnamoyl-peptide from ferulic acid and carnosine.

PubMed

Aljawish, Abdulhadi; Chevalot, Isabelle; Madad, Nidal; Paris, Cédric; Muniglia, Lionel

2016-06-10

Carnosine (CAR) dipeptide was functionalized with ferulic acid (FA) as substrate using laccase from Myceliophtora thermophila as biocatalyst. The enzymatic reaction was performed in aqueous medium under mild conditions (pH 7.5, 30°C) as an eco-friendly procedure. Results showed that this enzymatic process led to the synthesis of two new derivatives (P1, P2), from the coupling between CAR and FA derived products. Conditions allowing a high production of P1, P2 derivatives were determined with an optimal ratio of (FA: CAR) of (1:1.6) at optimal time reaction of 8h. Under these optimal conditions, the coupling between CAR and FA-products was demonstrated, resulting in the decrease of -NH2 groups (almost 50%) as quantified via derivatization. Due to the presence of FA in the structure of these new derivatives, they exhibited higher hydrophobic property than carnosine. Structural analyses by mass spectrometry showed that P1 and P2 (FA-CAR) derivatives exhibited the same molecular mass (MM 770g/mol) containing one CAR-molecule and three FA-molecules but with different chemical structures. Furthermore, these derivatives presented improved antioxidant (almost 10 times) and anti-proliferative (almost 18 times) properties in comparison with CAR. Moreover, P1 derivative exhibited higher antioxidant and anti-proliferative activities than P2 derivative, which confirmed the different structures of P1 and P2. These results suggested that the oxidized phenols coupling with carnosine is a promising process to enhance the CAR-properties. Copyright © 2016 Elsevier B.V. All rights reserved.

Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins.

PubMed

Kramer, Marianne C; Liang, Dongming; Tatomer, Deirdre C; Gold, Beth; March, Zachary M; Cherry, Sara; Wilusz, Jeremy E

2015-10-15

Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼ 400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3' end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine-arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. © 2015 Kramer et al.; Published by Cold Spring Harbor Laboratory Press.