VERITAS Discovery of >200 GeV Gamma-Ray Emission from the Intermediate-Frequency-Peaked BL Lacertae Object W Comae

NASA Astrophysics Data System (ADS)

Acciari, V. A.; Aliu, E.; Beilicke, M.; Benbow, W.; Böttcher, M.; Bradbury, S. M.; Buckley, J. H.; Bugaev, V.; Butt, Y.; Celik, O.; Cesarini, A.; Ciupik, L.; Chow, Y. C. K.; Cogan, P.; Colin, P.; Cui, W.; Daniel, M. K.; Ergin, T.; Falcone, A. D.; Fegan, S. J.; Finley, J. P.; Finnegan, G.; Fortin, P.; Fortson, L. F.; Furniss, A.; Gall, D.; Gillanders, G. H.; Grube, J.; Guenette, R.; Gyuk, G.; Hanna, D.; Hays, E.; Holder, J.; Horan, D.; Hui, C. M.; Humensky, T. B.; Imran, A.; Kaaret, P.; Karlsson, N.; Kertzman, M.; Kieda, D. B.; Konopelko, A.; Krawczynski, H.; Krennrich, F.; Lang, M. J.; LeBohec, S.; Lee, K.; Maier, G.; McCann, A.; McCutcheon, M.; Moriarty, P.; Mukherjee, R.; Nagai, T.; Niemiec, J.; Ong, R. A.; Pandel, D.; Perkins, J. S.; Petry, D.; Pohl, M.; Quinn, J.; Ragan, K.; Reyes, L. C.; Reynolds, P. T.; Roache, E.; Rose, H. J.; Schroedter, M.; Sembroski, G. H.; Smith, A. W.; Steele, D.; Swordy, S. P.; Toner, J. A.; Vassiliev, V. V.; Wagner, R.; Wakely, S. P.; Ward, J. E.; Weekes, T. C.; Weinstein, A.; White, R. J.; Williams, D. A.; Wissel, S. A.; Wood, M.; Zitzer, B.

2008-09-01

We report the detection of very high energy γ-ray emission from the intermediate-frequency-peaked BL Lacertae object W Comae (z = 0.102) by VERITAS. The source was observed between 2008 January and April. A strong outburst of γ-ray emission was measured in the middle of March, lasting for only 4 days. The energy spectrum measured during the two highest flare nights is fit by a power law and is found to be very steep, with a differential photon spectral index of Γ = 3.81 +/- 0.35stat+/- 0.34syst. The integral photon flux above 200 GeV during those two nights corresponds to roughly 9% of the flux from the Crab Nebula. Quasi-simultaneous Swift observations at X-ray energies were triggered by the VERITAS observations. The spectral energy distribution of the flare data can be described by synchrotron self-Compton (SSC) or external Compton (EC) leptonic jet models.

BL Lacertae Objects Beyond Redshift 1.3 - UV-to-NIR Photometry and Photometric Redshift for Fermi/LAT Blazars

NASA Technical Reports Server (NTRS)

Rau, A.; Schady, P.; Greiner, J.; Salvato, M.; Ajello, M.; Bottacini, E.; Gehrels, N.; Afonso, P. M. J.; Elliott, J.; Filgas, R.;

Testing the Pairs-Reflection Model with X-Ray Spectral Variability and X-Ray Properties of Complete Samples of Radio-Selected BL Lacertae Objects

NASA Astrophysics Data System (ADS)

Urry, C. Megan

1997-01-01

This grant was awarded to Dr. C. Megan Urry of the Space Telescope Science Institute in response to two successful ADP proposals to use archival Ginga and Rosat X-ray data for 'Testing the Pairs-Reflection model with X-Ray Spectral Variability' (in collaboration with Paola Grandi, now at the University of Rome) and 'X-Ray Properties of Complete Samples of Radio-Selected BL Lacertae Objects' (in collaboration with then-graduate student Rita Sambruna, now a post-doc at Goddard Space Flight Center). In addition, post-docs Joseph Pesce and Elena Pian, and graduate student Matthew O'Dowd, have worked on several aspects of these projects. The grant was originally awarded on 3/01/94; this report covers the full period, through May 1997. We have completed our project on the X-ray properties of radio-selected BL Lacs.

Photometric monitoring of three BL Lacertae objects in 1993-1998

NASA Astrophysics Data System (ADS)

Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.

1999-05-01

The results of optical photometric (BVRI) monitoring of three BL Lac objects over a time interval of about four years are presented. The sources are three classical radio-selected BL Lac objects, BL Lac, OJ 287 and PKS 0735+178. During our observation OJ 287 was in the stage of a large periodic outburst which consisted of at least two peaks. Almost all the observations obtained over consecutive nights detected intranight variations. In 1995 and 1996 BL Lac kept in faint states, with fewer and smaller rapid flares and fluctuations. On the contrary, in late 1997 BL Lac was at the stage of a large outburst, accompanied with much more large amplitude rapid flares and fluctuations. PKS 0735+178 was almost at its faint end from 1994 to early 1998. Over this time interval, the intraday variations and microvariations in PKS 0735+178 were rare and the amplitude was very small, except a rapid darkening of ~ 0.4 mag on 24 January 1995. Previous work by \\cite[Webb et al. (1988);]{web88} \\cite[Wagner et al. (1996);]{wag96} \\cite[Pian et al. (1997)]{pia97} also showed the same behaviour of variability as BL Lac and PKS 0735+178 in BL Lac, S5 0716+714, PKS 2155-304, respectively. We propose that the motion of orientation of the relativistic jet in a BL Lac object be responsible for these variability behaviours. Table~1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html

Optical polarization of high-energy BL Lacertae objects

NASA Astrophysics Data System (ADS)

Hovatta, T.; Lindfors, E.; Blinov, D.; Pavlidou, V.; Nilsson, K.; Kiehlmann, S.; Angelakis, E.; Fallah Ramazani, V.; Liodakis, I.; Myserlis, I.; Panopoulou, G. V.; Pursimo, T.

2016-12-01

Context. We investigate the optical polarization properties of high-energy BL Lac objects using data from the RoboPol blazar monitoring program and the Nordic Optical Telescope. Aims: We wish to understand if there are differences between the BL Lac objects that have been detected with the current-generation TeV instruments and those objects that have not yet been detected. Methods: We used a maximum-likelihood method to investigate the optical polarization fraction and its variability in these sources. In order to study the polarization position angle variability, we calculated the time derivative of the electric vector position angle (EVPA) change. We also studied the spread in the Stokes Q/I-U/I plane and rotations in the polarization plane. Results: The mean polarization fraction of the TeV-detected BL Lacs is 5%, while the non-TeV sources show a higher mean polarization fraction of 7%. This difference in polarization fraction disappears when the dilution by the unpolarized light of the host galaxy is accounted for. The TeV sources show somewhat lower fractional polarization variability amplitudes than the non-TeV sources. Also the fraction of sources with a smaller spread in the Q/I-U/I plane and a clumped distribution of points away from the origin, possibly indicating a preferred polarization angle, is larger in the TeV than in the non-TeV sources. These differences between TeV and non-TeV samples seem to arise from differences between intermediate and high spectral peaking sources instead of the TeV detection. When the EVPA variations are studied, the rate of EVPA change is similar in both samples. We detect significant EVPA rotations in both TeV and non-TeV sources, showing that rotations can occur in high spectral peaking BL Lac objects when the monitoring cadence is dense enough. Our simulations show that we cannot exclude a random walk origin for these rotations. Conclusions: These results indicate that there are no intrinsic differences in the

Besnoitia in a palaearctic lizard (Lacerta dugesii) from Madeira.

PubMed

Frank, W; Frenkel, J K

1981-01-01

Besnoitia cysts in the heart of a lizard (Lacerta dugesii) from the islands of Madeira are the first record of besnoitiosis in a poikilothermic animal in the Old World. The size of the cysts corresponds to those found in lizard genera (Basiliscus and Ameiva) from Panama which belong to B. darlingi. Up to now nothing is known concerning the life cycle of this species from Madeira but it seems possible that cats function as definitive hosts as well as in the other species.

On the surface density of X-ray selected BL Lacertae objects

NASA Technical Reports Server (NTRS)

Maccacaro, T.; Gioia, I. M.; Maccagni, D.; Stocke, J. T.

1984-01-01

Only a handful of BL Lac objects have been found as a result of systematic optical identification of serendipitous Einstein X-ray sources. By combining the data from two flux-limited complete X-ray surveys (the HEAO 1 A-2 and the Einstein Observatory Medium Sensitivity Survey) the surface density of X-ray emitting BL Lac objects is evaluated as a function of their X-ray flux. It is found that a single power law is not an acceptable representation of the BL Lac objects' X-ray log N-log S. The number-flux relationship is consistent with the Euclidean slope at 'high' flux levels but shows a drastic flattnring below fluxes of the order of 10 to the -12th ergs per sq cm/s. The implications of this result are briefly discussed with respect to the luminosity function, the cosmological evolution, and the X-ray to optical flux ratio in BL Lac objects.

IUE observations of extragalactic objects

NASA Technical Reports Server (NTRS)

Boksenberg, A.; Snijders, M. A. J.; Wilson, R.; Benvenuti, P.; Clavell, J.; Macchetto, F.; Penston, M.; Boggess, A.; Gull, T. R.; Gondhalekar, P.

1978-01-01

During the commissioning phase of IUE several extragalactic objects were observed spectrally at low dispersion in the UV range lambda lambda 1150-3200: the Seyfert galaxies NGC4151 and NGC1068, the QSO 3C273, the BL Lacertae object B2 1101+38, the giant elliptical galaxy M87 and the spiral galaxy M81. The results obtained are presented and a preliminary analysis given for all six objects, discussing the continuous spectrum, extinction, emission line spectrum and absorption line spectrum, where possible for each case. Several new or confirmatory astrophysical results are obtained.

EGRET observations of the BL Lacertae objects 0716+714 and 0521-365

NASA Technical Reports Server (NTRS)

Lin, Y. C.; Bertsch, D. L.; Dingus, B. L.; Esposito, J. A.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Mayer-Hasselwander, H. A.

1995-01-01

During the Compton Observatory's viewing programs Phase 1 (1991 April to 1992 November, also known as the All-Sky Survey) and Phase 2 (1992 November to 1993 September), the BL Lac object 0716+714 was in the field of view of the EGRET telescope a total of six times, three times in Phase 1 and three more times in Phase 2, while the BL Lac object 0521-365 was in the field of view of EGRET only once in Phase 1. The source 0716+714 was detected in high-energy gamma rays by EGRET at a flux level of (2.0 +/- 0.4) x 10(exp -7) photons/sq cm/s for E greater than 100 MeV with a 6 sigma significance when it was first observed by EGRET in 1992 January 10 to 23. The corresponding spectral slope of the photon number distribution is determined to be -2.04 +/- 0.33. The gamma-ray flux of 0716+714 showed considerable time variability in subsequent EGRET observations. But the spectral slope stayed about the same within the statistical uncertainties of the EGRET data. The average spectral slope of the four viewing periods during which the photon flux of 0716+714 stayed above the EGRET detection threshold is found to be -1.85 +/- 0.20 from the combined data. The source 0521+365 was detected by EGRET in 1992 May 14 to June 4 at a flux level of (1.8 +/- 0.5) x 10(exp -7) photons/sq cm/s for E greater than 100 MeV with a 4 sigma significance. The corresponding spectral slope of the photon number distribution is found to be 2.16 +/- 0.36. Details of the observations of these two BL Lac objects with the EGRET telescope are presented.

Multiwavelength variability properties of Fermi blazar S5 0716+714

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, N. H.; Bai, J. M.; Liu, H. T.

S5 0716+714 is a typical BL Lacertae object. In this paper we present the analysis and results of long-term simultaneous observations in the radio, near-infrared, optical, X-ray, and γ-ray bands, together with our own photometric observations for this source. The light curves show that the variability amplitudes in γ-ray and optical bands are larger than those in the hard X-ray and radio bands and that the spectral energy distribution (SED) peaks move to shorter wavelengths when the source becomes brighter, which is similar to other blazars, i.e., more variable at wavelengths shorter than the SED peak frequencies. Analysis shows thatmore » the characteristic variability timescales in the 14.5 GHz, the optical, the X-ray, and the γ-ray bands are comparable to each other. The variations of the hard X-ray and 14.5 GHz emissions are correlated with zero lag, and so are the V band and γ-ray variations, which are consistent with the leptonic models. Coincidences of γ-ray and optical flares with a dramatic change of the optical polarization are detected. Hadronic models do not have the same natural explanation for these observations as the leptonic models. A strong optical flare correlating a γ-ray flare whose peak flux is lower than the average flux is detected. The leptonic model can explain this variability phenomenon through simultaneous SED modeling. Different leptonic models are distinguished by average SED modeling. The synchrotron plus synchrotron self-Compton (SSC) model is ruled out because of the extreme input parameters. Scattering of external seed photons, such as the hot-dust or broad-line region emission, and the SSC process are probably both needed to explain the γ-ray emission of S5 0716+714.« less

Probing the Innermost Regions of AGN Jets and Their Magnetic Fields with RadioAstron. I. Imaging BL Lacertae at 21 Microarcsecond Resolution

NASA Astrophysics Data System (ADS)

Gómez, José L.; Lobanov, Andrei P.; Bruni, Gabriele; Kovalev, Yuri Y.; Marscher, Alan P.; Jorstad, Svetlana G.; Mizuno, Yosuke; Bach, Uwe; Sokolovsky, Kirill V.; Anderson, James M.; Galindo, Pablo; Kardashev, Nikolay S.; Lisakov, Mikhail M.

2016-02-01

We present the first polarimetric space very long baseline interferometry (VLBI) imaging observations at 22 GHz. BL Lacertae was observed in 2013 November 10 with the RadioAstron space VLBI mission, including a ground array of 15 radio telescopes. The instrumental polarization of the space radio telescope is found to be less than 9%, demonstrating the polarimetric imaging capabilities of RadioAstron at 22 GHz. Ground-space fringes were obtained up to a projected baseline distance of 7.9 Earth diameters in length, allowing us to image the jet in BL Lacertae with a maximum angular resolution of 21 μas, the highest achieved to date. We find evidence for emission upstream of the radio core, which may correspond to a recollimation shock at about 40 μas from the jet apex, in a pattern that includes other recollimation shocks at approximately 100 and 250 μas from the jet apex. Polarized emission is detected in two components within the innermost 0.5 mas from the core, as well as in some knots 3 mas downstream. Faraday rotation analysis, obtained from combining RadioAstron 22 GHz and ground-based 15 and 43 GHz images, shows a gradient in rotation measure and Faraday-corrected polarization vector as a function of position angle with respect to the core, suggesting that the jet in BL Lacertae is threaded by a helical magnetic field. The intrinsic de-boosted brightness temperature in the unresolved core exceeds 3× {10}12 K, suggesting, at the very least, departure from equipartition of energy between the magnetic field and radiating particles.

Clustering environments of BL Lac objects

NASA Technical Reports Server (NTRS)

Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.

1993-01-01

We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.

One-milliarsecond precision parallax studies in the regions of Delta Cephei and EV Lacertae

NASA Technical Reports Server (NTRS)

Gatewood, George; De Jonge, Kiewiet Joost; Stephenson, Bruce

1993-01-01

Trigonometric parallaxes for stars in the regions of the variable stars delta Cephei and EV Lacertae are derived from data collected with the Multichannel Astrometric Photometer (MAP) and the Thaw Refractor of the University of Pittsburgh's Allegheny Observatory. The weighted mean parallax of all trigonometric studies of delta Cephei is now + 0.0030 sec + or - 0.00093 sec, corresponding to a distance modulus of 7.61 + or - 0.67 mag. This indicates that this luminosity standard star is approximately one standard deviation more distance than has been generally accepted. The weighted mean trigonometric parallax of all studies of the variable star EV Lacertae (BD + 43 deg 4305) is + 0.1993 sec + or - 0.00093 sec, implying a distance modulus of - 1.498 + or - 0.0010 mag. The calculated absolute magnitude of this star is almost exactly that predicted by its (R-I)(sub Kron) magnitude and by the Gliese (R-I) main-sequence value for stars in the solar neighborhood. We also find a parallax of 0.0189 sec + or - 0.0008 sec for the FO IVn star, HR 8666 (BD + 43 sec 4300). The derived luminosity of this star is midway between that expected for luminosity class IV and V stars at the indicated temperature.

On the Location of the gamma-Ray Outburst Emission in the BL Lacertae Object AO 0235 + 164 Through Observations Across the Electromagnetic Spectrum

NASA Technical Reports Server (NTRS)

Agudo, Ivan; Marscher, Alan P.; Jorstad, Svetlana G.; Larionov, Valeri M.; Gomez, Jose L.; Laehteenmaeki, Anne; Smith, Paul S.; Nilsson, Kari; Readhead, Anthony C. S.; Aller, Margo F.;

Radio constraints on the nature of BL Lacertae objects and their parent population

NASA Technical Reports Server (NTRS)

Kollgaard, R. I.; Wardle, J. F. C.; Roberts, D. H.; Gabuzda, D. C.

1992-01-01

5 GHz VLA observations of 17 BL Lac objects with bright radio cores at both high and low resolution are reported. Extended emission is detected around most objects. None of the sources observed at low resolution show evidence of giant halos on the scale of tens of arcmin. In general, the sources with the most luminous extended emission exhibit FR II characteristics in both morphology and polarization, and less luminous sources exhibit FR I characteristics. Thus, the parent population of the BL Lac objects contains both FR I and FR II radio sources. No BL Lac objects are found that clearly exhibit quasarlike polarization at milliarcsec resolution. This argues against the view that the more luminous BL Lac objects are simply an extension of the quasar/OVV population, or that most BL Lac objects are gravitationally microlensed images of distant quasars. Other properties are generally consistent with the view the BL Lac objects are normal radio galaxies whose jets make a small angle to the line of sight.

Discovery of high and very high-energy emission from the BL Lacertae object SHBL J001355.9-185406

NASA Astrophysics Data System (ADS)

H.E.S.S. Collaboration; Abramowski, A.; Acero, F.; Aharonian, F.; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Gast, H.; Giebels, B.; Glicenstein, J. F.; Göring, D.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hague, J. D.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Medina, M. C.; Méhault, J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Nedbal, D.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; de Oña Wilhelmi, E.; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Paz Arribas, M.; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; de los Reyes, R.; Rieger, F.; Rob, L.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spieß, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

2013-06-01

The detection of the high-frequency peaked BL Lac object (HBL) SHBL J001355.9-185406 (z = 0.095) at high (HE; 100 MeV < E < 300 GeV) and very high-energy (VHE; E > 100 GeV) with the Fermi Large Area Telescope (LAT) and the High Energy Stereoscopic System (H.E.S.S.) is reported. Dedicated observations were performed with the H.E.S.S. telescopes, leading to a detection at the 5.5σ significance level. The measured flux above 310 GeV is (8.3 ± 1.7stat ± 1.7sys) × 10-13 photons cm-2 s-1 (about 0.6% of that of the Crab Nebula), and the power-law spectrum has a photon index of Γ = 3.4 ± 0.5stat ± 0.2sys. Using 3.5 years of publicly available Fermi-LAT data, a faint counterpart has been detected in the LAT data at the 5.5σ significance level, with an integrated flux above 300 MeV of (9.3 ± 3.4stat ± 0.8sys) × 10-10 photons cm-2 s-1 and a photon index of Γ = 1.96 ± 0.20stat ± 0.08sys. X-ray observations with Swift-XRT allow the synchrotron peak energy in νFν representation to be located at ~1.0 keV. The broadband spectral energy distribution is modelled with a one-zone synchrotronself-Compton (SSC) model and the optical data by a black-body emission describing the thermal emission of the host galaxy. The derived parameters are typical of HBLs detected at VHE, with a particle-dominated jet.

A Search for Low-Luminosity BL Lacertae Objects

NASA Astrophysics Data System (ADS)

Rector, Travis A.; Stocke, John T.; Perlman, Eric S.

1999-05-01

Many properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis, whereby BL Lacs are FR 1 radio galaxies viewed nearly along the jet axis. However, a possible problem with this model is that a transition population between beamed BL Lacs and unbeamed FR 1 galaxies has not been detected. A transition population of ``low-luminosity BL Lacs'' was predicted to exist in abundance in X-ray-selected samples such as the Einstein Extended Medium Sensitivity Survey (EMSS) by Browne & Marcha. However, these BL Lacs may have been misidentified as clusters of galaxies. We have conducted a search for such objects in the EMSS with the ROSAT High-Resolution Imager (HRI) here we present ROSAT HRI images, optical spectra, and VLA radio maps for a small number of BL Lacs that were previously misidentified in the EMSS catalog as clusters of galaxies. While these objects are slightly lower in luminosity than other EMSS BL Lacs, their properties are too similar to the other BL Lacs in the EMSS sample to ``bridge the gap'' between BL Lacs and FR 1 radio galaxies. Also, the number of new BL Lacs found is too low to alter significantly the X-ray luminosity function or value for the X-ray-selected EMSS BL Lac sample. Thus, these observations do not explain fully the discrepancy between the X-ray- and radio-selected BL Lac samples.

Finding the rarest objects in the universe: A new, efficient method for discovering BL Lacertae objects

NASA Technical Reports Server (NTRS)

Stocke, John; Perlman, Eric; Granados, Arno; Schachter, Jonathan; Elvis, Martin; Urry, Meg; Impey, Chris; Smith, Paul

1993-01-01

We present a new, efficient method for discovering new BL Lac Objects based upon the results of the Einstein Extended Medium Sensitivity Survey (EMSS). We have found that all x-ray selected BL Lacs are radio emitters, and further, that in a 'color-color' diagram (radio/optical and optical/x-ray) the BL Lac Objects occupy an area distinct from both radio loud quasars and the radio quiet QSOs and Seyferts which dominate x-ray selected samples. After obtaining radio counterparts via VLA 'snapshot' observations of a large sample of unidentified x-ray sources, the list of candidates is reduced. These candidates then can be confirmed with optical spectroscopy and/or polarimetry. Since greater than 70 percent of these sources are expected to be BL Lacs, the optical observations are very efficient. We have tested this method using unidentified sources found in the Einstein Slew Survey. The 162 Slew Survey x-ray source positions were observed with the VLA in a mixed B/C configuration at 6 cm resulting in 60 detections within 1.5 position error circle radii. These x-ray/optical/radio sources were then plotted, and 40 BL Lac candidates were identified. To date, 10 candidates have been spectroscopically observed resulting in 10 new BL Lac objects! Radio flux, optical magnitude, and polarization statistics (obtained in white light with the Steward Observatory 2.3 m CCD polarimeter) for each are given.

Optical and radio properties of X-ray selected BL Lacertae objects

NASA Technical Reports Server (NTRS)

Stocke, J. T.; Liebert, J.; Schmidt, G.; Gioia, I. M.; Maccacaro, T.

1985-01-01

The eight BL Lac objects from the HEAO 1 A-2 all-sky survey and from the Einstein medium-sensitivity survey (MSS) form a flux-limited complete X-ray selected sample. The optical and radio properties of the MSS BL Lac objects are presented and compared with those of the HEAO 1 A-2 sample and with those of radio-selected BL Lac objects. The X-ray selected BL Lac objects possess smaller polarized fractions and less violent optical variability than radio-selected BL Lac objects. These properties are consistent with the substantial starlight fraction seen in the optical spectra of a majority of these objects. This starlight allows a determination of definite redshifts for two of four MSS BL Lac objects and a probable redshift for a third. These redshifts are 0.2, 0.3, and 0.6. Despite the differences in characteristics between the X-ray selected and radio-selected samples, it is concluded that these eight objects possess most of the basic qualities of BL Lac objects and should be considered members of that class. Moreover, as a class, these X-ray selected objects have the largest ratio of X-ray to optical flux of any active galactic nuclei yet discovered.

Extraordinary Activity in the BL Lacertae Object OJ 287

NASA Astrophysics Data System (ADS)

Hughes, Philip A.; Aller, Hugh D.; Aller, Margo F.

1998-08-01

We use a continuous wavelet transform to analyze more than two decades of data for the BL Lac object OJ 287 acquired as part of the University of Michigan Radio Astronomy Observatory (UMRAO) variability program. We find clear evidence for a persistent modulation of the total flux and polarization with period ~1.66 yr and for another signal that dominates activity in the 1980s with period ~1.12 yr. The relationship between these two variations can be understood in terms of a ``shock-in-jet'' model, in which the longer timescale periodicity is associated with an otherwise quiescent jet and the shorter timescale activity is associated with the passage of a shock. The different periodicities of these two components may reflect different internal conditions of the two flow domains leading to different wave speeds or different contractions of a single underlying periodicity due to the different Doppler factors of the two flow components. We suggest that the modulation arises from a wave driven by some asymmetric disturbance close to the central engine. The periodic behavior in polarization exhibits excursions in U that correspond to a direction ~45° from the VLBI jet axis. This behavior is not explained by the random walk in the Q-U plane that is expected from models in which a pattern of randomly aligned magnetic field elements propagate across the visible portion of the flow and suggests a small amplitude, cyclic variation in the flow direction in that part of the flow that dominates centimeter wavelength emission.

A FAST FLARE AND DIRECT REDSHIFT CONSTRAINT IN FAR-ULTRAVIOLET SPECTRA OF THE BLAZAR S5 0716+714

DOE Office of Scientific and Technical Information (OSTI.GOV)

Danforth, Charles W.; Nalewajko, Krzysztof; France, Kevin

The BL Lacertae object S5 0716+714 is one of the most studied blazars on the sky due to its active variability and brightness in many bands, including very-high-energy gamma rays. We present here two serendipitous results from recent far-ultraviolet spectroscopic observations by the Cosmic Origins Spectrograph onboard the Hubble Space Telescope (HST). First, during the course of our 7.3 hr HST observations, the blazar increased in flux rapidly by {approx}40% (-0.45 mag hr{sup -1}) followed by a slower decline (+0.36 mag hr{sup -1}) to previous FUV flux levels. We model this flare using asymmetric flare templates and constrain the physicalmore » size and energetics of the emitting region. Furthermore, the spectral index of the object softens considerably during the course of the flare from {alpha}{sub {nu}} Almost-Equal-To -1.0 to {alpha}{sub {nu}} Almost-Equal-To -1.4. Second, we constrain the source redshift directly using the {approx}30 intervening absorption systems. A system at z = 0.2315 is detected in Ly{alpha}, Ly{beta}, O VI, and N V and defines the lower bound on the source redshift. No absorbers are seen in the remaining spectral coverage (0.2315 < z {sub Ly{alpha}} {approx}< 0.47) and we set a statistical upper bound of z < 0.322 (95% confidence) on the blazar. This is the first direct redshift limit for this object and is consistent with literature estimates of z = 0.31 {+-} 0.08 based on the detection of a host galaxy.« less

The intraday variability in the radio-selected and X-ray-selected BL Lacertae objects

NASA Astrophysics Data System (ADS)

Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.

1998-10-01

Seven BL Lac objects have been photometrically observed in an effort to study the difference of optical intraday variability between the radio-selected BL Lac objects (RBLs) and X-ray-selected BL Lac objects (XBLs). The objects we observed are selected arbitrarily. They are four RBLs, PKS 0735+178, PKS 0754+101, OJ 287 and BL Lac, and three XBLs, H 0323+022, H 0548-322 and H 2154-304. During the observation all of them exhibited microvariation, and H 0323+022 and H 0548-322 sometimes showed brightness oscillation. PKS 0735+178 and BL Lac were in their faint states and not very active. It seems that RBLs do not show microvariability more frequently than XBLs. Table 2 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5)

The Cosmic Evolution of Fermi BL Lacertae Objects

NASA Astrophysics Data System (ADS)

Ajello, Marco; Gasparrini, Dario; Romani, Roger W.; Shaw, Michael S.

2014-06-01

It has been notoriously difficult in the past to measure the cosmological evolution of BL Lacs because of the challenges related to measure their redshift. Extensive optical follow-up observations of a sample of ~200 Fermi-detected BL Lac objects have provided much-needed redshift information for many of them. This stands as the largest and most complete sample of BL Lacs available in the literature and was used to determine the cosmological properties of this elusive source class. This talk will review the cosmic evolution of BL Lacs and discuss the link to their siblings flat-spectrum radio quasars (FSRQs). Evidence suggests that BL Lacs of the high-synchrotron peaked class might be an accretion-starved end-state of an earlier merger-driven gas-rich phase.

Discovery of high and very high-energy emission from the BL Lacertae object SHBL J001355.9–185406

DOE PAGES

Abramowski, A.; Acero, F.; Aharonian, F.; ...

2013-06-05

In this paper, the detection of the high-frequency peaked BL Lac object (HBL) SHBL J001355.9–185406 (z = 0.095) at high (HE; 100 MeV < E < 300 GeV) and very high-energy (VHE; E > 100 GeV) with the Fermi Large Area Telescope (LAT) and the High Energy Stereoscopic System (H.E.S.S.) is reported. Dedicated observations were performed with the H.E.S.S. telescopes, leading to a detection at the 5.5σ significance level. The measured flux above 310 GeV is (8.3 ± 1.7 stat ± 1.7 sys) × 10 -13 photons cm -2 s -1 (about 0.6% of that of the Crab Nebula), andmore » the power-law spectrum has a photon index of Γ = 3.4 ± 0.5 stat ± 0.2 sys. Using 3.5 years of publicly available Fermi-LAT data, a faint counterpart has been detected in the LAT data at the 5.5σ significance level, with an integrated flux above 300 MeV of (9.3 ± 3.4 stat ± 0.8 sys) × 10 -10 photons cm -2 s -1 and a photon index of Γ = 1.96 ± 0.20 stat ± 0.08 sys. X-ray observations with Swift-XRT allow the synchrotron peak energy in νF ν representation to be located at ~1.0 keV. The broadband spectral energy distribution is modelled with a one-zone synchrotronself-Compton (SSC) model and the optical data by a black-body emission describing the thermal emission of the host galaxy. Lastly, the derived parameters are typical of HBLs detected at VHE, with a particle-dominated jet.« less

Borrelia lusitaniae and Green Lizards (Lacerta viridis), Karst Region, Slovakia

PubMed Central

Majláth, Igor; Derdáková, Marketa; Víchová, Bronislava; Peťko, Branislav

2006-01-01

In Europe, spirochetes within the Borrelia burgdorferi sensu lato complex are transmitted by Ixodes ricinus ticks. Specific associations are described between reservoir hosts and individual genospecies. We focused on green lizard (Lacerta viridis) as a host for ticks and potential host for borreliae. In 2004 and 2005, a total of 146 green lizards infested by ticks were captured, and 469 I. ricinus ticks were removed. Borrelial infection was detected in 16.6% of ticks from lizards. Of 102 skin biopsy specimens collected from lizards, 18.6% tested positive. The most frequently detected genospecies was B. lusitaniae (77.9%–94.7%). More than 19% of questing I. ricinus collected in areas where lizards were sampled tested positive for borreliae. B. garinii was the dominant species, and B. lusitaniae represented 11.1%. The presence of B. lusitaniae in skin biopsy specimens and in ticks that had fed on green lizards implicates this species in the transmission cycle of B. lusitaniae. PMID:17326941

An Analysis of Periodic Components in BL Lac Object S5 0716 +714 with MUSIC Method

NASA Astrophysics Data System (ADS)

Tang, J.

2012-01-01

Multiple signal classification (MUSIC) algorithms are introduced to the estimation of the period of variation of BL Lac objects.The principle of MUSIC spectral analysis method and theoretical analysis of the resolution of frequency spectrum using analog signals are included. From a lot of literatures, we have collected a lot of effective observation data of BL Lac object S5 0716 + 714 in V, R, I bands from 1994 to 2008. The light variation periods of S5 0716 +714 are obtained by means of the MUSIC spectral analysis method and periodogram spectral analysis method. There exist two major periods: (3.33±0.08) years and (1.24±0.01) years for all bands. The estimation of the period of variation of the algorithm based on the MUSIC spectral analysis method is compared with that of the algorithm based on the periodogram spectral analysis method. It is a super-resolution algorithm with small data length, and could be used to detect the period of variation of weak signals.

Ondas de choque em jatos de quasares e objetos BL Lacertae

NASA Astrophysics Data System (ADS)

Melo, F. E.; Botti, L. C. L.

2003-08-01

Este trabalho é parte de um projeto que vem sendo realizado há dois anos no CRAAM, cujos objetivos principais são analisar e aplicar um modelo generalizado de ondas de choque em jatos relativísticos de plasma, presentes em quasares e objetos BL Lacertae, para explicar a variabilidade observada nestes objetos. O método consiste em uma decomposição de curvas de luz em séries de explosões similares, em várias freqüências, baseando-se em uma evolução espectro-temporal média das explosões. A partir da evolução média, um ajuste de cada explosão é feito com base em equações empíricas, modificando-se apenas parâmetros específicos de cada explosão. Inicialmente o modelo foi aplicado ajustando-se as curvas de luz a explosões delineadas por uma evolução do choque em três estágios, segundo a predominância do processo de emissão: síncrotron, Compton e adiabático. Entretanto, nesta nova fase de projeto, visando uma parametrização mais concisa, uma otimização do algoritmo de ajuste e uma convergência mais rápida, a formulação para cada evento foi assumida com uma evolução em apenas dois estágios: subida e descida. Isto possibilitou uma ótima delineação das curvas de luz das fontes OV236, OJ287, 3C273 e BL Lac, entre 1980 e 2000, nas freqüências 4.8, 8.0, 14.5 e 22 GHz, utilizando-se dados do Observatório da Universidade de Michigan, do Observatório do Itapetinga (Atibaia SP) e do Observatório Metsähovi. Como conclusões importantes, verificou-se que: os parâmetros ajustados descrevem o comportamento do jato; os valores do índice que descreve a expansão do jato sugerem que o mesmo se expande de uma forma não-cônica; o campo magnético é turbulento atrás da frente de choque; e as peculiaridades das explosões são devidas à influência de grandezas tais como o coeficiente da distribuição espectral de energia dos elétrons, a intensidade de campo magnético e o fator de feixe Doppler, no início do choque.

23 CFR 669.5 - Objective.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 23 Highways 1 2010-04-01 2010-04-01 false Objective. 669.5 Section 669.5 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS ENFORCEMENT OF HEAVY VEHICLE USE TAX § 669.5 Objective. The objective of this regulation is to establish realistic and workable...

Metabolic adaptations of overwintering European common lizards (Lacerta vivipara).

PubMed

Voituron, Y; Hérold, J P; Grenot, C

2000-01-01

The European common lizard Lacerta vivipara, a reptile of cold-temperate climates, provides us an interesting model of low-temperature adaptation. Indeed its unique cold-hardiness strategy, which employs both freeze tolerance and freeze avoidance, may be seen as the primary reason for its large distribution, which extends from Spain to beyond the Arctic circle. To study the metabolism supporting this capacity, we used three techniques: two techniques of calorimetry (oxygen consumption and thermogenesis) and nuclear magnetic resonance spectroscopy. These techniques were used to examine the metabolic balance and the different molecular pathways used between three different periods through the year (September, January, and May). The results show a significant 20% augmentation of winter anaerobic metabolism compared to other periods of the year. This is mainly because of an activation of the lactic fermentation pathway leading to an increase of lactate concentration (>34% in winter). Furthermore, glucose, which increases some 245% in winter, is used as antifreeze and metabolic substrate. Furthermore, this study provides evidence that the physiological adaptations of the common lizard differ from those of other ectotherms such as Rana sylvatica. Concentrations of alanine and glycerol, commonly used as antifreeze by many overwintering ectotherms, do not increase during winter.

An Analysis of Light Periods of BL Lac Object S5 0716+714 with the MUSIC Algorithm

NASA Astrophysics Data System (ADS)

Tang, Jie

2012-07-01

The multiple signal classification (MUSIC) algorithm is introduced to the estimation of light periods of BL Lac objects. The principle of the MUSIC algorithm is given, together with a testing on its spectral resolution by using a simulative signal. From a lot of literature, we have collected a large number of effective observational data of the BL Lac object S5 0716+714 in the three optical wavebands V, R, and I from 1994 to 2008. The light periods of S5 0716+714 are obtained by means of the MUSIC algorithm and average periodogram algorithm, respectively. It is found that there exist two major periodic components, one is the period of (3.33±0.08) yr, another is the period of (1.24±0.01) yr. The comparison of the performances of periodicity analysis of two algorithms indicates that the MUSIC algorithm has a smaller requirement on the sample length, as well as a good spectral resolution and anti-noise ability, to improve the accuracy of periodicity analysis in the case of short sample length.

HESS J1943+213: A candidate extreme BL Lacertae object

DOE PAGES

Abramowski, A.; Acero, F.; Aharonian, F.; ...

2011-03-30

In this paper, we report on a newly detected point-like source, HESS J1943+213. This source coincides with an unidentified hard X-ray source IGR J19443+2117, which was proposed to have radio and infrared counterparts. Here, we combine new H.E.S.S., Fermi/LAT and Nançay Radio Telescope observations with pre-existing non-simultaneous multi-wavelength observations of IGR J19443+2117 and discuss the likely source associations as well as the interpretation as an active galactic nucleus, a gamma-ray binary or a pulsar wind nebula.

Hα spectroscopy and BV photometry of RT Lacertae

NASA Astrophysics Data System (ADS)

Frasca, A.; Çakırlı, Ö.; Catalano, S.; Ibanoǧlu, C.; Marilli, E.; Evren, S.; Taş, G.

2002-06-01

Contemporaneous spectroscopic and photometric B V observations of the RS CVn type eclipsing binary RT Lacertae were performed in summer 2000. The photometric observations were obtained at the Ege University Observatory, while the spectroscopic ones were carried out at Catania Astrophysical Observatory in the spectral range 5860-6700 Å. We obtained a high quality radial velocity curve of the system that allowed us to give more accurate values of the orbital parameters. A steady decrease of the barycentric velocity from 1920 to 2000 has been pointed out and has been discussed in the context of a third body hypothesis. Through the subtraction of a ``synthetic'' spectrum, built up with spectra of inactive standard stars, we detected Hα excess emission which fills in the photospheric absorption profiles of both components. With the exception of a few spectra, taken close to the eclipses, in which some extra absorption or a faint double-peaked broad emission appears, there is no further evidence of circumstellar matter in this system, as suggested in previous works. The hotter and more massive star appears also as the more active at a chromospheric level, since it has a Hα flux about ten times greater than the companion, on average. Rotational modulation of the Hα emission has been detected in both stars. The hemisphere of the more massive star facing the observer at phase 0fp75 appears brighter (in Hα ) than that seen at phase 0fp25 , while for the less massive G9 IV star the maximum Hα emission is seen around phase 0fp0-0fp1 . From the analysis of the contemporaneous light curve (Lanza et al. \\cite{Lanza2001}), the more massive G5 IV star results to be more active than the companion at a photospheric level, in agreement with the chromospheric behaviour observed in Hα . In addition, the starspots of the G5 IV star are mainly located in the Hα brighter hemisphere, suggesting a close spatial association of spots and plages in this star. The G9 IV star displays

The complete mitochondrial genome of the green lizard Lacerta viridis viridis (Reptilia: Lacertidae) and its phylogenetic position within squamate reptiles.

PubMed

Böhme, M U; Fritzsch, G; Tippmann, A; Schlegel, M; Berendonk, T U

2007-06-01

For the first time the complete mitochondrial genome was sequenced for a member of Lacertidae. Lacerta viridis viridis was sequenced in order to compare the phylogenetic relationships of this family to other reptilian lineages. Using the long-polymerase chain reaction (long PCR) we characterized a mitochondrial genome, 17,156 bp long showing a typical vertebrate pattern with 13 protein coding genes, 22 transfer RNAs (tRNA), two ribosomal RNAs (rRNA) and one major noncoding region. The noncoding region of L. v. viridis was characterized by a conspicuous 35 bp tandem repeat at its 5' terminus. A phylogenetic study including all currently available squamate mitochondrial sequences demonstrates the position of Lacertidae within a monophyletic squamate group. We obtained a narrow relationship of Lacertidae to Scincidae, Iguanidae, Varanidae, Anguidae, and Cordylidae. Although, the internal relationships within this group yielded only a weak resolution and low bootstrap support, the revealed relationships were more congruent with morphological studies than with recent molecular analyses.

Optical and UV spectroscopy of the peculiar RS CVn system RT Lacertae

NASA Technical Reports Server (NTRS)

Huenemoerder, D. P.; Barden, S. C.

1986-01-01

H-alpha and H-beta spectra of the peculiar double-lined RS CVn binary RT Lacertae have been obtained using the IUE, together with a ground-based coude-feed telescope at KPNO. The ground-based spectra show an asymmetry related to the orbital phase in the H-alpha profile. H-beta profiles showed excess emission in one hemisphere and excess absorption in the other, with a broad Gaussian emission component superposed on the excess H-alpha line. A radial velocity curve was derived to estimate the mass ratio and geometry of the system. It is shown that the component of RT Lac fills 80-90 percent of the equilibrium Roche surface. Low-resolution ultraviolet data show that the supposed cooler component is bluer than its companion, suggesting evidence of a scattering shell or a cloud produced by the splash of a gas stream. The phase behavior of the low resolution ultraviolet data support the conclusion that RT Lac is a mass transfer system and that mass transfer is the primary cause of its activity.

CATALOG AND STATISTICAL STUDY OF X-RAY SELECTED BL LACERTAE OBJECTS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapanadze, Bidzina Z., E-mail: bidzina_kapandaze@iliauni.edu.ge

2013-02-01

This paper presents a catalog of 312 X-ray selected BL Lacerate objects (XBLs), optically identified through the end of 2011. It contains the names from different surveys, equatorial coordinates, redshifts, multifrequency flux values, and luminosities for each source. In addition, the different characteristics of XBLs are statistically investigated (redshift, radio/optical/X-ray luminosities, central black hole (BH) mass, synchrotron peak frequency, broadband spectral indices, optical flux variability). Their values are collected through an extensive bibliographic and database search or calculated by us. The redshifts range from 0.031 to 0.702 with a maximum of the distribution at z = 0.223. The 1.4 GHzmore » luminosities of XBLs log {nu}L{sub {nu}} {approx} 39-42 erg s{sup -1} while optical V and X-ray 0.1-2.4 keV bands show log {nu}L{sub {nu}} {approx} 43-46 erg s{sup -1}. The XBL hosts are elliptical galaxies with effective radii r{sub eff} = 3.2625.40 kpc and ellipticities, in = 0.040.52. Their R-band absolute magnitudes M{sub R} range from -21.11 mag to -24.86 mag with a mean value of -22.83 mag. The V - R indices of the hosts span from 0.61 to 1.52 and reveal a fourth-degree polynomial relationship with z that enables us to evaluate the redshifts of five sources whose V - R indices were determined from the observations but whose irredshifts values are either not found or not confirmed. The XBL nuclei show a wider range of 7.31 mag for M{sub R} with the highest luminosity corresponding to M{sub R} = -27.24 mag. The masses of central BHs are found in the interval log M{sub BH} = 7.39-9.30 solar masses (with distribution maximum at log M{sub BH}/M{sub Sun} = 8.30). The synchrotron peak frequencies are spread over the range log {nu}{sub peak} = 14.56-19.18 Hz with a peak of the distribution at log {nu}{sub peak} = 16.60 Hz. The broadband radio-to-optical ({alpha}{sub ro}), optical-to-X-ray ({alpha}{sub ox}), and radio-to-X-ray ({alpha}{sub rx}) spectral indices

Multiwavelength Observations of the Blazar BL Lacertae: A New Fast TeV Gamma-Ray Flare

NASA Astrophysics Data System (ADS)

Abeysekara, A. U.; Benbow, W.; Bird, R.; Brantseg, T.; Brose, R.; Buchovecky, M.; Buckley, J. H.; Bugaev, V.; Connolly, M. P.; Cui, W.; Daniel, M. K.; Falcone, A.; Feng, Q.; Finley, J. P.; Fortson, L.; Furniss, A.; Gillanders, G. H.; Gunawardhana, I.; Hütten, M.; Hanna, D.; Hervet, O.; Holder, J.; Hughes, G.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Krennrich, F.; Lang, M. J.; Lin, T. T. Y.; McArthur, S.; Moriarty, P.; Mukherjee, R.; O’Brien, S.; Ong, R. A.; Otte, A. N.; Park, N.; Petrashyk, A.; Pohl, M.; Pueschel, E.; Quinn, J.; Ragan, K.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Rulten, C.; Sadeh, I.; Santander, M.; Sembroski, G. H.; Shahinyan, K.; Wakely, S. P.; Weinstein, A.; Wells, R. M.; Wilcox, P.; Williams, D. A.; Zitzer, B.; The VERITAS Collaboration; Jorstad, S. G.; Marscher, A. P.; Lister, M. L.; Kovalev, Y. Y.; Pushkarev, A. B.; Savolainen, T.; Agudo, I.; Molina, S. N.; Gómez, J. L.; Larionov, V. M.; Borman, G. A.; Mokrushina, A. A.; Tornikoski, M.; Lähteenmäki, A.; Chamani, W.; Enestam, S.; Kiehlmann, S.; Hovatta, T.; Smith, P. S.; Pontrelli, P.

2018-04-01

Combined with measurements made by very-long-baseline interferometry, the observations of fast TeV gamma-ray flares probe the structure and emission mechanism of blazar jets. However, only a handful of such flares have been detected to date, and only within the last few years have these flares been observed from lower-frequency-peaked BL Lac objects and flat-spectrum radio quasars. We report on a fast TeV gamma-ray flare from the blazar BL Lacertae observed by the Very Energetic Radiation Imaging Telescope Array System (VERITAS). with a rise time of ∼2.3 hr and a decay time of ∼36 min. The peak flux above 200 GeV is (4.2 ± 0.6) × 10‑6 photon m‑2 s‑1 measured with a 4-minute-binned light curve, corresponding to ∼180% of the flux that is observed from the Crab Nebula above the same energy threshold. Variability contemporaneous with the TeV gamma-ray flare was observed in GeV gamma-ray, X-ray, and optical flux, as well as in optical and radio polarization. Additionally, a possible moving emission feature with superluminal apparent velocity was identified in Very Long Baseline Array observations at 43 GHz, potentially passing the radio core of the jet around the time of the gamma-ray flare. We discuss the constraints on the size, Lorentz factor, and location of the emitting region of the flare, and the interpretations with several theoretical models that invoke relativistic plasma passing stationary shocks.

PKS 2155-304 relativistically beamed synchrotron radiation from BL LAC object

NASA Technical Reports Server (NTRS)

Urry, C. M.; Mushotzky, R. F.

1981-01-01

The newly discovered BL Lacertae object, PKS 2155-304, was observed with the medium and high intensity energy detectors of the HEAO-1 A2 experiment. The variability by a factor of two in less than a day reported by Snyder, et al (1979) is confirmed. Two spectra, obtained a year apart, while the satellite was in scanning mode, are well fit by simple power laws with energy spectral index alpha sub 1 equals approximately 1.4. A third spectrum, of higher statistical quality, obtained while the satellite was pointed at its source, has has two components. An acceptable fit was obtained using a two power law model, with indices alpha sub 1 equals 2.0 (+1.2, -0.6) and alpha sub 2 equals -1.5 (+1.5, -2.3). An interpretation of the overall spectrum from radio through X-rays in terms of a synchrotron self-Compton model gives a good description of the data if allowance is made for relativistic beaming. Thus, from a consideration of the spectrum, combined with an estimate of the size of the source, the presence of jets is inferred without their observation.

41 CFR 101-5.302 - Objective.

Code of Federal Regulations, 2012 CFR

2012-07-01

... FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 5-CENTRALIZED SERVICES IN FEDERAL BUILDINGS AND COMPLEXES 5.3-Federal Employee Health Services § 101-5.302 Objective. It is the objective of GSA to provide or arrange for appropriate health service programs in all Government-owned and leased buildings, or groups of...

41 CFR 101-5.302 - Objective.

Code of Federal Regulations, 2014 CFR

2014-07-01

... FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 5-CENTRALIZED SERVICES IN FEDERAL BUILDINGS AND COMPLEXES 5.3-Federal Employee Health Services § 101-5.302 Objective. It is the objective of GSA to provide or arrange for appropriate health service programs in all Government-owned and leased buildings, or groups of...

41 CFR 101-5.302 - Objective.

Code of Federal Regulations, 2010 CFR

2010-07-01

... FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 5-CENTRALIZED SERVICES IN FEDERAL BUILDINGS AND COMPLEXES 5.3-Federal Employee Health Services § 101-5.302 Objective. It is the objective of GSA to provide or arrange for appropriate health service programs in all Government-owned and leased buildings, or groups of...

41 CFR 101-5.302 - Objective.

Code of Federal Regulations, 2011 CFR

2011-07-01

... FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 5-CENTRALIZED SERVICES IN FEDERAL BUILDINGS AND COMPLEXES 5.3-Federal Employee Health Services § 101-5.302 Objective. It is the objective of GSA to provide or arrange for appropriate health service programs in all Government-owned and leased buildings, or groups of...

Location of γ-ray Flare Emission in the Jet of the BL Lacertae Object OJ287 More than 14 pc from the Central Engine

NASA Astrophysics Data System (ADS)

Agudo, Iván; Jorstad, Svetlana G.; Marscher, Alan P.; Larionov, Valeri M.; Gómez, José L.; Lähteenmäki, Anne; Gurwell, Mark; Smith, Paul S.; Wiesemeyer, Helmut; Thum, Clemens; Heidt, Jochen; Blinov, Dmitriy A.; D'Arcangelo, Francesca D.; Hagen-Thorn, Vladimir A.; Morozova, Daria A.; Nieppola, Elina; Roca-Sogorb, Mar; Schmidt, Gary D.; Taylor, Brian; Tornikoski, Merja; Troitsky, Ivan S.

2011-01-01

We combine time-dependent multi-waveband flux and linear polarization observations with submilliarcsecond-scale polarimetric images at λ = 7 mm of the BL Lacertae type blazar OJ287 to locate the γ-ray emission in prominent flares in the jet of the source >14 pc from the central engine. We demonstrate a highly significant correlation between the strongest γ-ray and millimeter-wave flares through Monte Carlo simulations. The two reported γ-ray peaks occurred near the beginning of two major millimeter-wave outbursts, each of which is associated with a linear polarization maximum at millimeter wavelengths. Our very long baseline array observations indicate that the two millimeter-wave flares originated in the second of two features in the jet that are separated by >14 pc. The simultaneity of the peak of the higher-amplitude γ-ray flare and the maximum in polarization of the second jet feature implies that the γ-ray and millimeter-wave flares are cospatial and occur >14 pc from the central engine. We also associate two optical flares, accompanied by sharp polarization peaks, with the two γ-ray events. The multi-waveband behavior is most easily explained if the γ-rays arise from synchrotron self-Compton scattering of optical photons from the flares. We propose that flares are triggered by interaction of moving plasma blobs with a standing shock. The γ-ray and optical emission is quenched by inverse Compton losses as synchrotron photons from the newly shocked plasma cross the emission region. The millimeter-wave polarization is high at the onset of a flare, but decreases as the electrons emitting at these wavelengths penetrate less polarized regions.

LOCATION OF {gamma}-RAY FLARE EMISSION IN THE JET OF THE BL LACERTAE OBJECT OJ287 MORE THAN 14 pc FROM THE CENTRAL ENGINE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agudo, Ivan; Jorstad, Svetlana G.; Marscher, Alan P.

We combine time-dependent multi-waveband flux and linear polarization observations with submilliarcsecond-scale polarimetric images at {lambda} = 7 mm of the BL Lacertae type blazar OJ287 to locate the {gamma}-ray emission in prominent flares in the jet of the source >14 pc from the central engine. We demonstrate a highly significant correlation between the strongest {gamma}-ray and millimeter-wave flares through Monte Carlo simulations. The two reported {gamma}-ray peaks occurred near the beginning of two major millimeter-wave outbursts, each of which is associated with a linear polarization maximum at millimeter wavelengths. Our very long baseline array observations indicate that the two millimeter-wavemore » flares originated in the second of two features in the jet that are separated by >14 pc. The simultaneity of the peak of the higher-amplitude {gamma}-ray flare and the maximum in polarization of the second jet feature implies that the {gamma}-ray and millimeter-wave flares are cospatial and occur >14 pc from the central engine. We also associate two optical flares, accompanied by sharp polarization peaks, with the two {gamma}-ray events. The multi-waveband behavior is most easily explained if the {gamma}-rays arise from synchrotron self-Compton scattering of optical photons from the flares. We propose that flares are triggered by interaction of moving plasma blobs with a standing shock. The {gamma}-ray and optical emission is quenched by inverse Compton losses as synchrotron photons from the newly shocked plasma cross the emission region. The millimeter-wave polarization is high at the onset of a flare, but decreases as the electrons emitting at these wavelengths penetrate less polarized regions.« less

Discovery of hard-spectrum γ -ray emission from the BL Lacertae object 1ES 0414+009

DOE PAGES

Abramowski, A.

2012-02-01

1ES 0414 + 009 (z = 0.287) is a distant high-frequency-peaked BL Lac object, and has long been considered a likely emitter of very-high-energy (VHE, E > 100 GeV) γ-rays due to its high X-ray and radio flux. Observations in the VHE γ-ray band and across the electromagnetic spectrum can provide insights into the origin of highly energetic particles present in the source and the radiation processes at work. Because of the distance of the source, the γ-ray spectrum might provide further limits on the level of the extragalactic background light (EBL). Methods. We report observations made between October 2005more » and December 2009 with H.E.S.S., an array of four imaging atmospheric Cherenkov telescopes. Observations at high energies (HE, 100 MeV–100 GeV) with the Fermi-LAT instrument in the first 20 months of its operation are also reported. To complete the multi-wavelength picture, archival UV and X-ray observations with the Swift satellite and optical observations with the ATOM telescope are also used. Based on the observations with H.E.S.S., 1ES 0414 + 009 is detected for the first time in the VHE band. An excess of 224 events is measured, corresponding to a significance of 7.8σ. The photon spectrum of the source is well described by a power law, with photon index of ΓVHE = 3.45 ± 0.25stat ± 0.20syst. The integral flux above 200 GeV is (1.88 ± 0.20stat ± 0.38syst) × 10-12 cm-2 s-1. Observations with the Fermi-LAT in the first 20 months of operation show a flux between 200 MeV and 100 GeV of (2.3 ± 0.2stat) × 10-9 erg cm-2 s-1, and a spectrum well described by a power-law function with a photon index ΓHE = 1.85 ± 0.18. Swift/XRT observations show an X-ray flux between 2 and 10 keV of (0.8-1) × 10-11 erg cm-2 s-1, and a steep spectrum ΓX = (2.2-2.3). Combining X-ray with optical-UV data, a fit with a log-parabolic function locates the synchrotron peak around 0.1 keV. Although the GeV–TeV observations do not provide better constraints on the EBL

Optical monitoring of BL Lac object S5 0716+714 and FSRQ 3C 273 from 2000 to 2014

NASA Astrophysics Data System (ADS)

Yuan, Yu-Hai; Fan, Jun-hui; Tao, Jun; Qian, Bo-Chen; Costantin, Denise; Xiao, Hu-Bing; Pei, Zhi-Yuan; Lin, Chao

2017-09-01

Context. Using the 1.56 m telescope at the Shanghai Observatory (ShAO), China, we monitored two sources, BL Lac object S5 0716+714 and flat spectrum radio quasar (FSRQ) 3C 273. For S5 0716+714, we report 4969 sets of CCD (Charge-coupled Device) photometrical optical observations (1369 for V band, 1861 for R band and 1739 for I band) in the monitoring time from Dec. 4, 2000 to Apr. 5, 2014. For 3C 273, we report 460 observations (138 for V band, 146 for R band and 176 for I band) in the monitoring time from Mar. 28, 2006 to Apr. 9, 2014. Aims: The observations provide us with a large amount of data to analyze the short-term and long-term optical variabilities. Based on the variable timescales, we can estimate the central black hole mass and the Doppler factor. An abundance of multi-band observations can help us to analyze the relations between the brightness and spectrum. Methods: We use Gaussian fitting to analyze the intra-day light curves and obtain the intra-day variability (IDV) timescales. We use the discrete correlation function (DCF) method and Jurkevich method to analyze the quasi-periodic variability. Based on the VRI observations, we use the linear fitting to analyze the relations between brightness and spectrum. Results: The two sources both show IDV properties for S5 0716+714. The timescales are in the range from 17.3 min to 4.82 h; for 3C 273, the timescale is ΔT = 35.6 min. Based on the periodic analysis methods, we find the periods PV = 24.24 ± 1.09 days, PR = 24.12 ± 0.76 days, PI = 24.82 ± 0.73 days for S5 0716+714, and P = 12.99 ± 0.72, 21.76 ± 1.45 yr for 3C 273. The two sources displayed the "bluer-when-brighter" spectral evolution properties. Conclusions: S5 0716+714 and 3C 273 are frequently studied objects. The violent optical variability and IDV may come from the jet. Gaussian fitting can be used to analyze IDVs. The relations between brightness (flux density) and spectrum are strongly influenced by the frequency. A table of the

Optical and UV spectroscopy of the peculiar RS CVn system, RT Lacertae

NASA Technical Reports Server (NTRS)

Huenemoerder, D. P.; Barden, S. C.

1985-01-01

Spectra in the H-alpha and H-beta regions of the peculiar double-lined RS CVn binary, RT Lacertae, were obtained in the fall of 1984. Limited International Ultraviolet Explorer (IUE) long wavelength low and high resolution spectra were obtained concurrently. The ground based spectra have shown an asymmetry with orbital phase in the H-alpha profile. The H-beta profiles were consistent with the same effect. One hemisphere showed excess emission and the other excess absorption, with a broad Gaussian emission component superposed upon the excess H-alpha line. An improved radial velocity curve, giving a better determined mass ratio and geometry was derived. This combined with the radii implied by the rotational broadening of the spectra, showed one component to be 80 to 90% filling the equilibrium Roche surface. The two-faced nature is, therfore, very likely due to mass transfer from the contact component impacting upon its companion. Low resolution ultraviolet data showed that the supposed cooler component is bluer than its companion. High resolution ultraviolet data taken during secondary eclipse showed Mg II emission strength which decreased more slowly than the area visible. The phase behavior of the low resolution data support the former situation, indicating traditional chromospheric activity.

Optical and UV spectroscopy of the peculiar RS CVn system, RT Lacertae

NASA Astrophysics Data System (ADS)

Huenemoerder, D. P.; Barden, S. C.

1985-11-01

Spectra in the H-alpha and H-beta regions of the peculiar double-lined RS CVn binary, RT Lacertae, were obtained in the fall of 1984. Limited International Ultraviolet Explorer (IUE) long wavelength low and high resolution spectra were obtained concurrently. The ground based spectra have shown an asymmetry with orbital phase in the H-alpha profile. The H-beta profiles were consistent with the same effect. One hemisphere showed excess emission and the other excess absorption, with a broad Gaussian emission component superposed upon the excess H-alpha line. An improved radial velocity curve, giving a better determined mass ratio and geometry was derived. This combined with the radii implied by the rotational broadening of the spectra, showed one component to be 80 to 90% filling the equilibrium Roche surface. The two-faced nature is, therfore, very likely due to mass transfer from the contact component impacting upon its companion. Low resolution ultraviolet data showed that the supposed cooler component is bluer than its companion. High resolution ultraviolet data taken during secondary eclipse showed Mg II emission strength which decreased more slowly than the area visible. The phase behavior of the low resolution data support the former situation, indicating traditional chromospheric activity.

Multifrequency observations of the BL Lacertae object PKS 0537 - 441

NASA Technical Reports Server (NTRS)

Maraschi, L.; Treves, A.; Schwartz, D. A.; Tanzi, E. G.

1985-01-01

PKS 0537 - 441 was repeatedly observed in the UV band with the International Ultraviolet Explorer and in the X-ray with the Einstein Observatory. On September 27, 1980, simultaneous observations in the two bands were obtained. Near-infrared photometry preceding and following the simultaneous observations by about one month is available from the literature, as is radio monitoring at 408 and 5000 MHz. Comparison of the observed X-ray flux with that predicted by the standard synchrotron self-Compton formalism, with a source dimension deduced from radio variability at 5 GHz, indicates that this component of the radio emission must be moving at relativistic speed with an effective projected Doppler beaming factor of about 10.

POWERFUL HIGH-ENERGY EMISSION OF THE REMARKABLE BL Lac OBJECT S5 0716+714

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vittorini, V.; Chen, A. W.; Ferrari, A.

BL Lac objects of the intermediate subclass (IBLs) are known to emit a substantial fraction of their power in the energy range 0.1-10 GeV. Detecting gamma-ray emission from such sources provides therefore a direct probe of the emission mechanisms and of the underlying powerhouse. The gamma-ray satellite, AGILE, detected the remarkable IBL S5 0716+714 (z approx = 0.3) during a high state in the period from 2007 September-October, marked by two very intense flares reaching peak fluxes of 200 x 10{sup -8} photons cm{sup -2} s{sup -1} above 100 MeV, with simultaneous optical and X-ray observations. We present here amore » theoretical model for the two major flares and discuss the overall energetics of the source. We conclude that 0716+714 is among the brightest BL Lac's ever detected at gamma-ray energies. Because of its high power and lack of signs for ongoing accretion or surrounding gas, the source is an ideal candidate to test the maximal power extractable from a rotating supermassive black hole via the pure Blandford-Znajek (BZ) mechanism. We find that during the 2007 gamma-ray flares 0716+714 approached or just exceeded the upper limit set by BZ for a black hole of mass 10{sup 9} M{sub sun}.« less

Soft X-ray spectrum of BL Lacertae object AO 0235+164 as a tracer of elemental abundances at z approximately 0.5

NASA Technical Reports Server (NTRS)

Madejski, Greg

1994-01-01

We report the soft X-ray spectrum of BL Lac object AO 0235+164, observed with the Einstein Observatory Imaging Proportional Counter (IPC). This object (z = 0.94) has an intervening galaxy (or a protogalactic disk) at z = 0.524 present in the line of sight, producing both radio and optical absorption lines in the background BL Lac continuum. The X-ray spectrum exhibits a substantial soft X-ray cutoff, corresponding to several times that expected from our own Galaxy; we interpret that excess cutoff as due to the intervening galaxy. The comparison of the hydrogen column density inferred from the 21 cm radio data and the X-ray absorption allows, in principle, the determination of the elemental abundances in the intervening galaxy. However, the uncertainties in both the H I spin temperature and X-ray spectral parameters only loosely restrict these abundances to be 2 +/- 1 solar, which even at the lower limit appears higher than that inferred from studies of samples of optical absoprtion-line systems.

Lacerta I and Cassiopeia III. Two Luminous and Distant Andromeda Satellite Dwarf Galaxies Found in the 3π Pan-STARRS1 Survey

NASA Astrophysics Data System (ADS)

Martin, Nicolas F.; Slater, Colin T.; Schlafly, Edward F.; Morganson, Eric; Rix, Hans-Walter; Bell, Eric F.; Laevens, Benjamin P. M.; Bernard, Edouard J.; Ferguson, Annette M. N.; Finkbeiner, Douglas P.; Burgett, William S.; Chambers, Kenneth C.; Hodapp, Klaus W.; Kaiser, Nicholas; Kudritzki, Rolf-Peter; Magnier, Eugene A.; Morgan, Jeffrey S.; Price, Paul A.; Tonry, John L.; Wainscoat, Richard J.

2013-07-01

We report the discovery of two new dwarf galaxies, Lacerta I/Andromeda XXXI (Lac I/And XXXI) and Cassiopeia III/Andromeda XXXII (Cas III/And XXXII), in stacked Pan-STARRS1 r P1- and i P1-band imaging data. Both are luminous systems (MV ~ -12) located at projected distances of 20.°3 and 10.°5 from M31. Lac I and Cas III are likely satellites of the Andromeda galaxy with heliocentric distances of 756^{+44}_{-28}\\,kpc and 772^{+61}_{-56}\\,kpc, respectively, and corresponding M31-centric distances of 275 ± 7 kpc and 144^{+6}_{-4}\\,kpc. The brightest of recent Local Group member discoveries, these two new dwarf galaxies owe their late discovery to their large sizes (r_h = 4.2^{+0.4}_{-0.5} arcmin or 912^{+124}_{-93}\\,pc for Lac I r_h = 6.5^{+1.2}_{-1.0} arcmin or 1456 ± 267 pc for Cas III) and consequently low surface brightness (μ0 ~ 26.0 mag arcsec-2), as well as to the lack of a systematic survey of regions at large radii from M31, close to the Galactic plane. This latter limitation is now alleviated by the 3π Pan-STARRS1 survey, which could lead to the discovery of other distant Andromeda satellite dwarf galaxies.

Radio morphology and parent population of X-ray selected BL Lacertae objects

NASA Technical Reports Server (NTRS)

Laurent-Muehleisen, S. A.; Kollgaard, R. I.; Moellenbrock, G. A.; Feigelson, E. D.

1993-01-01

High-dynamic range (typically 1700:1) radio maps of 15 X-ray BL Lac (XBL) objects from the HEAO-1 Large Area Sky Survey are presented. Morphological characteristics of these sources are compared with Fanaroff-Riley (FR) class I radio galaxies in the context of unified schemes, with reference to one-sided kiloparsec-scale emission. Evidence that cluster membership of XBLs is significantly higher than previously thought is also presented. It is shown that the extended radio powers, X-ray emission, core-to-lobe ratios, and linear sizes of the radio selected BL Lac (RBL) and XBL populations are consistent with an FR I radio galaxy parent population. A source list and VLA observing log and map parameters are provided.

Promiscuity in sand lizards (Lacerta agilis) and adder snakes (Vipera berus): causes and consequences.

PubMed

Olsson, M; Madsen, T

2001-01-01

We review postcopulatory phenomena in the Swedish sand lizard (Lacerta agilis) and adder (Vipera berus), and in particular, links between female promiscuity, determinants of paternity, and offspring viability. In both species, females mate multiply and exhibit a positive relationship between the number of partners and offspring viability. We conclude that this relationship is most likely the result of variable genetic compatibility between mates arising from postcopulatory phenomena, predominantly assortative fertilization with respect to parental genotypes. However, males who were more successful at mate acquisition were also more successful in situations of sperm competition, suggesting a possible link between male (diploid and haploid) genetic quality per se and probability of fertilization. Neither the number of partners nor the number of matings influenced the risk of infertility in sand lizards, suggesting that selection for reduced risk of infertility is not a sufficient explanation for maintaining female promiscuity in this population. Finally, we conclude that the relatively low genetic variability exhibited by our study populations may have facilitated detection of genetic benefits compared to more outbred ones. However, recent work derived from outbred populations in other taxa suggest a greater generality of the principles we discuss than previously may have been appreciated.

Microchromosome polymorphism in the sand lizard, Lacerta agilis Linnaeus, 1758 (Reptilia, Squamata)

PubMed Central

Lisachov, Artem P.; Borodin, Pavel M.

2016-01-01

Abstract Most true lizards (Lacertidae) share a conservative karyotype, consisting of 18 pairs of macrochromosomes and one microchromosome pair. Homeologues of the microchromosome are present in other squamates and even in chickens. No structural autosomal microchromosome polymorphisms have been described previously in lizards. We found homozygous and heterozygous carriers of a microchromosome variant in a Siberian population of the sand lizard, Lacerta agilis Linnaeus, 1758. The variant microchromosome was almost twice as long as the standard one. In heterozygotes at pachytene, the microchromosomes firstly pair in proximal regions and the central part of the longer axial element undergoes foldback synapsis, then its distal region pairs with the distal region of the standard partner. At metaphase-I, the heteromorphic microchromosome bivalents have a proximal chiasma. The content of the additional segment was Ag-NOR, C-like DAPI, CMA3 negative. FISH with telomere PNA probe did not detect interstitial (TTAGGG)n sequences in the heteromorphic and any other bivalents. Both homo- and heterozygous carriers were phenotypically normal. The presence of homozygotes shows that heterozygotes are fertile. Reduction in the number of microchromosomes is a clear trend in squamate evolution, as a result of microchromosomes fusing together or with macrochromosomes. Our findings indicate that gaining additional DNA may lead to a transformation of microchromosomes into small macrochromosomes without fusion. PMID:27830048

32 CFR 634.5 - Program objectives.

Code of Federal Regulations, 2010 CFR

2010-07-01

... vehicles. (2) Reduction of traffic deaths, injuries, and property damage from traffic accidents. Most traffic accidents can be prevented. Investigation of motor vehicle accidents should examine all factors... INVESTIGATIONS MOTOR VEHICLE TRAFFIC SUPERVISION Introduction § 634.5 Program objectives. (a) The objectives of...

Examples of seismic modelling

NASA Astrophysics Data System (ADS)

Pamyatnykh, A. A.

2008-12-01

Findings of a few recent asteroseismic studies of the main sequence pulsating stars, as per- formed in Wojciech Dziembowski’s group in Warsaw and in Michel Breger’s group in Vienna, are briefly presented and discussed. The selected objects are three hybrid pulsators ν Eridani, 12 Lacertae and γ Pegasi, which show both β Cephei and SPB type modes, and the δ Scuti type star 44 Tauri.

Very high energy observations of the BL Lac objects 3C 66A and OJ 287

NASA Astrophysics Data System (ADS)

Lindner, T.; Hanna, D. S.; Kildea, J.; Ball, J.; Bramel, D. A.; Carson, J.; Covault, C. E.; Driscoll, D.; Fortin, P.; Gingrich, D. M.; Jarvis, A.; Mueller, C.; Mukherjee, R.; Ong, R. A.; Ragan, K.; Scalzo, R. A.; Williams, D. A.; Zweerink, J.

2007-11-01

Using the Solar Tower Atmospheric Cherenkov Effect Experiment (STACEE), we have observed the BL Lac objects 3C 66A and OJ 287. These are members of the class of low-frequency-peaked BL Lac objects (LBLs) and are two of the three LBLs predicted by Costamante and Ghisellini [L. Costamante, G. Ghisellini, Astron. Astrophys. 384 (2002) 56] to be potential sources of very high energy (>100 GeV) gamma-ray emission. The third candidate, BL Lacertae, has recently been detected by the MAGIC collaboration [J. Albert et al., arXiv:astro-ph/0703084v1 (2007)]. Our observations have not produced detections; we calculate a 99% CL upper limit of flux from 3C 66A of 0.15 Crab flux units and from OJ 287 our limit is 0.52 Crab. These limits assume a Crab-like energy spectrum with an effective energy threshold of 185 GeV.

European green lizard (Lacerta viridis) personalities: Linking behavioural types to ecologically relevant traits at different ontogenetic stages.

PubMed

Bajer, Katalin; Horváth, Gergely; Molnár, Orsolya; Török, János; Garamszegi, László Zsolt; Herczeg, Gábor

2015-02-01

Consistent individual differences within (animal personality) and across (behavioural syndrome) behaviours became well recognized during the past decade. Nevertheless, our knowledge about the evolutionary and developmental mechanisms behind the phenomena is still incomplete. Here, we explored if risk-taking and exploration were consistent and linked to different ecologically relevant traits in wild-caught adult male European green lizards (Lacerta viridis) and in their 2-3 weeks old laboratory-reared offspring. Both adults and juveniles displayed animal personality, consistency being higher in juveniles. We found correlation between risk-taking and exploration (suggestive of a behavioural syndrome) only in adults. Juveniles were more explorative than adults. Large or ectoparasite-free adult males were more explorative than small or parasitized males. Juvenile females tended to be more risk-taking than males. Behaviour of fathers and their offspring did not correlate. We conclude that European green lizards show high behavioural consistency and age is an important determinant of its strength and links to traits likely affecting fitness. Copyright © 2014 Elsevier B.V. All rights reserved.

Discovery of VHE γ -ray emission from the BL Lacertae object B3 2247+381 with the MAGIC telescopes

DOE PAGES

Aleksić, J.; Alvarez, E. A.; Antonelli, L. A.; ...

2012-03-02

Here, we study the non-thermal jet emission of the BL Lac object B3 2247+381 during a high optical state. The MAGIC telescopes observed the source during 13 nights between September 30th and October 30th 2010, collecting a total of 14.2 h of good quality very high energy (VHE) γ-ray data. Simultaneous multiwavelength data was obtained with X-ray observations by the Swift satellite and optical R-band observations at the KVA-telescope. We also use high energy γ-ray (HE, 0.1-100 GeV) data from the Fermi satellite. We also dedected the BL Lac object B3 2247+381 (z = 0.119) , for the first time,more » at VHE γ-rays at a statistical significance of 5.6σ. A soft VHE spectrum with a photon index of -3.2 ± 0.6 was determined. No significant short term flux variations were found. Finally, we model the spectral energy distribution using a one-zone SSC-model, which can successfully describe our data.« less

LACERTA I AND CASSIOPEIA III. TWO LUMINOUS AND DISTANT ANDROMEDA SATELLITE DWARF GALAXIES FOUND IN THE 3{pi} PAN-STARRS1 SURVEY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Nicolas F.; Laevens, Benjamin P. M.; Slater, Colin T.

We report the discovery of two new dwarf galaxies, Lacerta I/Andromeda XXXI (Lac I/And XXXI) and Cassiopeia III/Andromeda XXXII (Cas III/And XXXII), in stacked Pan-STARRS1 r{sub P1}- and i{sub P1}-band imaging data. Both are luminous systems (M{sub V} {approx} -12) located at projected distances of 20. Degree-Sign 3 and 10. Degree-Sign 5 from M31. Lac I and Cas III are likely satellites of the Andromeda galaxy with heliocentric distances of 756{sup +44}{sub -28} kpc and 772{sup +61}{sub -56} kpc, respectively, and corresponding M31-centric distances of 275 {+-} 7 kpc and 144{sup +6}{sub -4} kpc. The brightest of recent Local Groupmore » member discoveries, these two new dwarf galaxies owe their late discovery to their large sizes (r{sub h} = 4.2{sup +0.4}{sub -0.5} arcmin or 912{sup +124}{sub -93} pc for Lac I; r{sub h} = 6.5{sup +1.2}{sub -1.0} arcmin or 1456 {+-} 267 pc for Cas III) and consequently low surface brightness ({mu}{sub 0} {approx} 26.0 mag arcsec{sup -2}), as well as to the lack of a systematic survey of regions at large radii from M31, close to the Galactic plane. This latter limitation is now alleviated by the 3{pi} Pan-STARRS1 survey, which could lead to the discovery of other distant Andromeda satellite dwarf galaxies.« less

The blue light indicator in rubidium 5S-5P-5D cascade excitation

NASA Astrophysics Data System (ADS)

Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

2017-07-01

The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

Performance in Object-Choice Aesop’s Fable Tasks Are Influenced by Object Biases in New Caledonian Crows but not in Human Children

PubMed Central

Taylor, Alex H.; Cheke, Lucy G.; Gray, Russell D.; Loissel, Elsa; Clayton, Nicola S.

2016-01-01

The ability to reason about causality underlies key aspects of human cognition, but the extent to which non-humans understand causality is still largely unknown. The Aesop’s Fable paradigm, where objects are inserted into water-filled tubes to obtain out-of-reach rewards, has been used to test casual reasoning in birds and children. However, success on these tasks may be influenced by other factors, specifically, object preferences present prior to testing or arising during pre-test stone-dropping training. Here, we assessed this ‘object-bias’ hypothesis by giving New Caledonian crows and 5–10 year old children two object-choice Aesop’s Fable experiments: sinking vs. floating objects, and solid vs. hollow objects. Before each test, we assessed subjects’ object preferences and/or trained them to prefer the alternative object. Both crows and children showed pre-test object preferences, suggesting that birds in previous Aesop’s Fable studies may also have had initial preferences for objects that proved to be functional on test. After training to prefer the non-functional object, crows, but not children, performed more poorly on these two object-choice Aesop’s Fable tasks than subjects in previous studies. Crows dropped the non-functional objects into the tube on their first trials, indicating that, unlike many children, they do not appear to have an a priori understanding of water displacement. Alternatively, issues with inhibition could explain their performance. The crows did, however, learn to solve the tasks over time. We tested crows further to determine whether their eventual success was based on learning about the functional properties of the objects, or associating dropping the functional object with reward. Crows inserted significantly more rewarded, non-functional objects than non-rewarded, functional objects. These findings suggest that the ability of New Caledonian crows to produce performances rivaling those of young children on object

Sand lizard (Lacerta agilis) phenology in a warming world.

PubMed

Ljungström, Gabriella; Wapstra, Erik; Olsson, Mats

2015-10-08

Present-day climate change has altered the phenology (the timing of periodic life cycle events) of many plant and animal populations worldwide. Some of these changes have been adaptive, leading to an increase in population fitness, whereas others have been associated with fitness decline. Representing short-term responses to an altered weather regime, hitherto observed changes are largely explained by phenotypic plasticity. However, to track climatically induced shifts in optimal phenotype as climate change proceeds, evolutionary capacity in key limiting climate- and fitness-related traits is likely to be crucial. In order to produce realistic predictions about the effects of climate change on species and populations, a main target for conservation biologists is thus to assess the potential of natural populations to respond by these two mechanisms. In this study we use a large 15-year dataset on an ectotherm model, the Swedish sand lizard (Lacerta agilis), to investigate how higher spring temperature is likely to affect oviposition timing in a high latitude population, a trait strongly linked to offspring fitness and survival. With an interest in both the short- and potential long-term effect of rising temperatures, we applied a random regression model, which yields estimates of population-level plasticity and among-individual variation in the average, as well as the plastic, response to temperature. Population plasticity represents capacity for short-term adjustments whereas variation among individuals in a fitness-related trait indicates an opportunity for natural selection and hence for evolutionary adaptation. The analysis revealed both population-level plasticity and individual-level variation in average laying date. In contrast, we found no evidence for variation among females in their plastic responses to spring temperature, which could demonstrate a similarity in responses amongst females, but may also be due to a lack of statistical power to detect such an

Discourse accessibility constraints in children’s processing of object relative clauses

PubMed Central

Haendler, Yair; Kliegl, Reinhold; Adani, Flavia

2015-01-01

Children’s poor performance on object relative clauses has been explained in terms of intervention locality. This approach predicts that object relatives with a full DP head and an embedded pronominal subject are easier than object relatives in which both the head noun and the embedded subject are full DPs. This prediction is shared by other accounts formulated to explain processing mechanisms. We conducted a visual-world study designed to test the off-line comprehension and on-line processing of object relatives in German-speaking 5-year-olds. Children were tested on three types of object relatives, all having a full DP head noun and differing with respect to the type of nominal phrase that appeared in the embedded subject position: another full DP, a 1st- or a 3rd-person pronoun. Grammatical skills and memory capacity were also assessed in order to see whether and how they affect children’s performance. Most accurately processed were object relatives with 1st-person pronoun, independently of children’s language and memory skills. Performance on object relatives with two full DPs was overall more accurate than on object relatives with 3rd-person pronoun. In the former condition, children with stronger grammatical skills accurately processed the structure and their memory abilities determined how fast they were; in the latter condition, children only processed accurately the structure if they were strong both in their grammatical skills and in their memory capacity. The results are discussed in the light of accounts that predict different pronoun effects like the ones we find, which depend on the referential properties of the pronouns. We then discuss which role language and memory abilities might have in processing object relatives with various embedded nominal phrases. PMID:26157410

An optical and X-ray survey of s-type Markarian galaxies

NASA Technical Reports Server (NTRS)

Hutter, D. J.; Mufson, S. L.

1981-01-01

The results of a study of 23 compact, lineless Markarian galaxies using broadband optical photometry and X-ray satellite observations are reported. The photometry shows that the sample can be broken into four groups. In one group (Mrk 180, 421, and 501) are composite objects in which a BL Lacertae object is embedded in an elliptical galaxy. For this group, the results of multiepoch X-ray observations using the HEAO-1 and -2 satellites are presented. In addition, photometry is used to decompose the optical emission into nonthermal and galactic components. In the second group are objects showing a small ultraviolet excess relative to normal galaxies. The X-ray survey indicates that the X-ray luminosity of objects in group 2 is much lower than those in group 1. This suggests that there is an intrinsic difference between objects in groups 1 and 2. The third and fourth groups are objects whose colors are indistinguishable from those of normal field galaxies and those of galactic stars, respectively. No X-ray emission was detected from objects in either of these groups.

[Searching for Rare Celestial Objects Automatically from Stellar Spectra of the Sloan Digital Sky Survey Data Release Eight].

PubMed

Si, Jian-min; Luo, A-li; Wu, Fu-zhao; Wu, Yi-hong

2015-03-01

There are many valuable rare and unusual objects in spectra dataset of Sloan Digital Sky Survey (SDSS) Data Release eight (DR8), such as special white dwarfs (DZ, DQ, DC), carbon stars, white dwarf main-sequence binaries (WDMS), cataclysmic variable (CV) stars and so on, so it is extremely significant to search for rare and unusual celestial objects from massive spectra dataset. A novel algorithm based on Kernel dense estimation and K-nearest neighborhoods (KNN) has been presented, and applied to search for rare and unusual celestial objects from 546 383 stellar spectra of SDSS DR8. Their densities are estimated using Gaussian kernel density estimation, the top 5 000 spectra in descend order by their densities are selected as rare objects, and the top 300 000 spectra in ascend order by their densities are selected as normal objects. Then, KNN were used to classify the rest objects, and simultaneously K nearest neighbors of the 5 000 rare spectra are also selected as rare objects. As a result, there are totally 21 193 spectra selected as initial rare spectra, which include error spectra caused by deletion, redden, bad calibration, spectra consisting of different physically irrelevant components, planetary nebulas, QSOs, special white dwarfs (DZ, DQ, DC), carbon stars, white dwarf main-sequence binaries (WDMS), cataclysmic variable (CV) stars and so on. By cross identification with SIMBAD, NED, ADS and major literature, it is found that three DZ white dwarfs, one WDMS, two CVs with company of G-type star, three CVs candidates, six DC white dwarfs, one DC white dwarf candidate and one BL Lacertae (BL lac) candidate are our new findings. We also have found one special DA white dwarf with emission lines of Ca II triple and Mg I, and one unknown object whose spectrum looks like a late M star with emission lines and its image looks like a galaxy or nebula.

Localized AdS_{5}×S^{5} Black Holes.

PubMed

Dias, Óscar J C; Santos, Jorge E; Way, Benson

2016-10-07

According to heuristic arguments, global AdS_{5}×S^{5} black holes are expected to undergo a phase transition in the microcanonical ensemble. At high energies, one expects black holes that respect the symmetries of the S^{5}; at low energies, one expects "localized" black holes that appear pointlike on the S^{5}. According to anti-de Sitter/conformal field theory correspondence, N=4 supersymmetric Yang-Mills (SYM) theory on a 3-sphere should therefore exhibit spontaneous R-symmetry breaking at strong coupling. In this Letter, we numerically construct these localized black holes. We extrapolate the location of this phase transition, and compute the expectation value of the broken scalar operator with lowest conformal dimension. Via the correspondence, these results offer quantitative predictions for N=4 SYM theory.

The Tetrahedral Zamolodchikov Algebra and the {AdS_5× S^5} S-matrix

NASA Astrophysics Data System (ADS)

Mitev, Vladimir; Staudacher, Matthias; Tsuboi, Zengo

2017-08-01

The S-matrix of the {AdS_5× S^5} string theory is a tensor product of two centrally extended su{(2|2)\\ltimes R^2 S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the {AdS_5× S^5} S-matrix.

Development of socketed foundations for S3X5.7 posts.

DOT National Transportation Integrated Search

2015-04-01

The objective of this study was to develop a socketed foundation for use with the S3x5.7 (S76x8.5) weak : post. The design focused on cylindrical, reinforced concrete foundations with a steel tube placed in the center for : use as the socket. The fou...

Coordinated observations of X-ray bright BL Lacertae objects

NASA Technical Reports Server (NTRS)

Urry, C. M.

1986-01-01

No new International Ultraviolet Explorer (IUE) observations were scheduled. The work on the spectral extraction routine was continued. The computer code was adapted from the RDAF PDP 11/44 computer to a VAX 11/750, in order that it run more quickly. A chapter on ultraviolet observations of blazars for a book celebrating the scientific accomplishment of IUE was written in colloboration. A copy of the final draft is attached.

Lifetimes and oscillator strengths for the 5s5p6s, 5s5p5d and 5p3 levels in single-ionized tin

NASA Astrophysics Data System (ADS)

Colón, C.; Alonso-Medina, A.

2004-08-01

Radiative oscillator strengths for 103 lines arising from 5s5p6s, 5s5p5d and 5p3 configurations of Sn II and lifetimes corresponding to several levels of these configurations have been calculated. These values were obtained in intermediate coupling (IC) and using ab initio relativistic Hartree-Fock (HFR) calculations. We use the standard method of least square fitting of experimental energy levels for the IC calculations by means of computer codes from Cowan. Tables 1 and 2 are only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/422/1109

The X-ray spectra of the BL Lacertae objects PKS 0548 - 322 and 3C 66A

NASA Technical Reports Server (NTRS)

Maccacaro, T.; Maccagni, D.; Tarenghi, M.

1983-01-01

Einstein Observatory simultaneous imaging proportional counter and monitor proportional counter data are combined in order to derive the energy spectra of the BL Lac objects PKS 0548-322 and 3C 66A between 0.2 and 10 keV. While the latter is found to be variable in both intensity and spectral shape, the former, although constant in the present data, is found to have experienced a spectrum variation in view of results from other experiments. Attention is given to the implications of flux and spectral variability in BL Lac objects for models of X-ray emission mechanisms. It is suggested that the wide spread of the spectral index distribution is due to the detection of the highly variable synchrotron-produced X-rays that are generally undetected in QSOs.

Lack of congruence between morphometric evolution and genetic differentiation suggests a recent dispersal and local habitat adaptation of the Madeiran lizard Lacerta dugesii

PubMed Central

Brehm, António; Khadem, Mahnaz; Jesus, José; Andrade, Paula; Vicente, Luis

2001-01-01

Genetic differentiation among nine populations of the endemic lizard Lacerta dugesii Milne-Edwards 1829 (Lacertidae) from four groups of islands constituting the Archipelago of Madeira, was investigated by protein electrophoresis at 23 enzyme loci. Among twenty polymorphic loci, the total genetic diversity was due primarily to intra-population variation. The allele and genotypic frequencies among populations showed some heterogeneity, allowing the species to present a structuring pattern compatible with their geographical clustering. Some evidence suggests that selection acting on some loci in different ecological conditions may be responsible for the clustering of the populations studied. There was no apparent isolation effect expected under an "island" model of population divergence, and no correlation was found between genetic and geographic distances among populations. Morphological variation of the proposed three L. dugesii subspecies is not congruent with the allozyme analysis. This most probably suggests a rapid colonization of the islands followed by a strong effect of selection operating over the morphological characters used to define the subspecies. PMID:11742635

Environment-dependence of behavioural consistency in adult male European green lizards (Lacerta viridis).

PubMed

Horváth, Gergely; Mészáros, Boglárka; Urszán, Tamás János; Bajer, Katalin; Molnár, Orsolya; Garamszegi, László Zsolt; Herczeg, Gábor

2017-01-01

Understanding the background mechanisms affecting the emergence and maintenance of consistent between-individual variation within population in single (animal personality) or across multiple (behavioural syndrome) behaviours has key importance. State-dependence theory suggests that behaviour is 'anchored' to individual state (e.g. body condition, gender, age) and behavioural consistency emerges through behavioural-state feedbacks. A number of relevant state variables are labile (e.g. body condition, physiological performance) and expected to be affected by short-term environmental change. Yet, whether short-term environmental shifts affect behavioural consistency during adulthood remains questionable. Here, by employing a full-factorial laboratory experiment, we explored if quantity of food (low vs. high) and time available for thermoregulation (3h vs. 10h per day) had an effect on activity and risk-taking of reproductive adult male European green lizards (Lacerta viridis). We focussed on different components of behavioural variation: (i) strength of behavioural consistency (repeatability for animal personality; between-individual correlation for behavioural syndrome), (ii) behavioural type (individual mean behaviour) and (iii) behavioural predictability (within-individual behavioural variation). Activity was repeatable in all treatments. Risk-taking was repeatable only in the low basking treatments. We found significant between-individual correlation only in the low food × long basking time group. The treatments did not affect behavioural type, but affected behavioural predictability. Activity predictability was higher in the short basking treatment, where it also decreased with size (≈ age). Risk-taking predictability in the short basking treatment increased with size under food limitation, but decreased when food supply was high. We conclude that short-term environmental change can alter various components of behavioural consistency. The effect could be

Environment-dependence of behavioural consistency in adult male European green lizards (Lacerta viridis)

PubMed Central

Urszán, Tamás János; Bajer, Katalin; Molnár, Orsolya; Garamszegi, László Zsolt; Herczeg, Gábor

2017-01-01

Understanding the background mechanisms affecting the emergence and maintenance of consistent between-individual variation within population in single (animal personality) or across multiple (behavioural syndrome) behaviours has key importance. State-dependence theory suggests that behaviour is ‘anchored’ to individual state (e.g. body condition, gender, age) and behavioural consistency emerges through behavioural-state feedbacks. A number of relevant state variables are labile (e.g. body condition, physiological performance) and expected to be affected by short-term environmental change. Yet, whether short-term environmental shifts affect behavioural consistency during adulthood remains questionable. Here, by employing a full-factorial laboratory experiment, we explored if quantity of food (low vs. high) and time available for thermoregulation (3h vs. 10h per day) had an effect on activity and risk-taking of reproductive adult male European green lizards (Lacerta viridis). We focussed on different components of behavioural variation: (i) strength of behavioural consistency (repeatability for animal personality; between-individual correlation for behavioural syndrome), (ii) behavioural type (individual mean behaviour) and (iii) behavioural predictability (within-individual behavioural variation). Activity was repeatable in all treatments. Risk-taking was repeatable only in the low basking treatments. We found significant between-individual correlation only in the low food × long basking time group. The treatments did not affect behavioural type, but affected behavioural predictability. Activity predictability was higher in the short basking treatment, where it also decreased with size (≈ age). Risk-taking predictability in the short basking treatment increased with size under food limitation, but decreased when food supply was high. We conclude that short-term environmental change can alter various components of behavioural consistency. The effect could be

How much are Harry Potter’s glasses worth? Children’s monetary evaluation of authentic objects

PubMed Central

Gelman, Susan A.; Frazier, Brandy N.; Noles, Nicholaus S.; Manczak, Erika M.; Stilwell, Sarah M.

2014-01-01

Adults attach special value to objects that link to notable people or events – authentic objects. We examined children’s monetary evaluation of authentic objects, focusing on four kinds: celebrity possessions (e.g., Harry Potter’s glasses), original creations (e.g., the very first teddy bear), personal possessions (e.g., your grandfather’s baseball glove), and merely old items (e.g., an old chair). Children ages 4–12 years and adults (N= 151) were asked how much people would pay for authentic and control objects. Young children consistently placed greater monetary value on celebrity possessions than original creations, even when adults judged the two kinds of items to be equivalent. These results suggest that contact with a special individual may be the foundation for the value placed on authentic objects. PMID:25663829

BL Lacertae: X-ray spectral evolution and a black-hole mass estimate

NASA Astrophysics Data System (ADS)

Titarchuk, Lev; Seifina, Elena

2017-06-01

We present an analysis of the spectral properties observed in X-rays from active galactic nucleus BL Lacertae using RXTE, Suzaku, ASCA, BeppoSAX, and Swift observations. The total time covered by these observations is approximately 20 yr. We show strong observational evidence that this source undergoes X-ray spectral transitions from the low hard state (LHS) through the intermediate state (IS) to the high soft state (HSS) during these observations. During the RXTE observations (1997-2001, 180 ks, for a total 145 datasets), the source was approximately 75%, 20% and only 5% of the time in the IS, LHS, and HSS, respectively. We also used Swift observations (470 datasets, for a total 800 ks), which occurred during 12 yr (2005-2016), the broadband (0.3-200 keV) data of BeppoSAX (1997-2000, 160 ks), and the low X-ray energy (0.3-10 keV) data of ASCA (1995-1999, 160 ks). Two observations of Suzaku (2006, 2013; 50 ks) in combinations with long-term RXTE and Swift data-sets fortunately allow us to describe all spectral states of BL Lac. The spectra of BL Lac are well fitted by the so-called bulk motion Comptonization (BMC) model for all spectral states. We have established the photon index saturation level, Γsat = 2.2 ± 0.1, in the Γ versus mass accretion rate (Ṁ) correlation. This Γ - Ṁ correlation allows us to estimate the black-hole (BH) mass in BL Lac to be MBH 3 × 107M⊙ for a distance of 300 Mpc. For the BH mass estimate, we use the scaling method taking stellar-mass Galactic BHs 4U 1543-47 and GX 339-4 as reference sources. The Γ - Ṁ correlation revealed in BL Lac is similar to those in a number of stellar-mass Galactic BHs and two recently studied intermediate-mass extragalactic BHs. It clearly shows the correlation along with the very extended Γ saturation at 2.2. This is robust observational evidence for the presence of a BH in BL Lac. We also reveal that the seed (disk) photon temperatures are relatively low, of order of 100 eV, which are consistent

Neuropeptide S interacts with the basolateral amygdala noradrenergic system in facilitating object recognition memory consolidation.

PubMed

Han, Ren-Wen; Xu, Hong-Jiao; Zhang, Rui-San; Wang, Pei; Chang, Min; Peng, Ya-Li; Deng, Ke-Yu; Wang, Rui

2014-01-01

The noradrenergic activity in the basolateral amygdala (BLA) was reported to be involved in the regulation of object recognition memory. As the BLA expresses high density of receptors for Neuropeptide S (NPS), we investigated whether the BLA is involved in mediating NPS's effects on object recognition memory consolidation and whether such effects require noradrenergic activity. Intracerebroventricular infusion of NPS (1nmol) post training facilitated 24-h memory in a mouse novel object recognition task. The memory-enhancing effect of NPS could be blocked by the β-adrenoceptor antagonist propranolol. Furthermore, post-training intra-BLA infusions of NPS (0.5nmol/side) improved 24-h memory for objects, which was impaired by co-administration of propranolol (0.5μg/side). Taken together, these results indicate that NPS interacts with the BLA noradrenergic system in improving object recognition memory during consolidation. Copyright © 2013 Elsevier Inc. All rights reserved.

AdS5×S(5) mirror model as a string sigma model.

PubMed

Arutyunov, Gleb; van Tongeren, Stijn J

2014-12-31

Doing a double Wick rotation in the world sheet theory of the light cone AdS5×S(5) superstring results in an inequivalent, so-called mirror theory that plays a central role in the field of integrability in the AdS-CFT correspondence. We show that this mirror theory can be interpreted as the light cone theory of a free string on a different background. This background is related to dS5×H(5) by a double T-duality, and has hidden supersymmetry. The geometry can also be extracted from an integrable deformation of the AdS5×S(5) sigma model, and we prove the observed mirror duality of these deformed models at the bosonic level as a byproduct. While we focus on AdS5×S(5), our results apply more generally.

The Millimeter-Radio Emission of BL Lacertae During Two γ-ray Outbursts

NASA Astrophysics Data System (ADS)

Kim, Dae-Won; Trippe, Sascha; Lee, Sang-Sung; Park, Jong-Ho; Kim, Jae-Young; Algaba, Juan-Carlos; Hodgson, Jeffrey A.; Kino, Motoki; Zhao, Guang-Yao; Wajima, Kiyoaki; Kang, Sincheol; Oh, Junghwan; Lee, Taeseok; Byun, Do-Young; Kim, Soon-Wook; Kim, Jeong-Sook

2017-12-01

We present a study of the inexplicit connection between radio jet activity and γ-ray emission of BL Lacertae (BL Lac; 2200+420). We analyze the long-term millimeter activity of BL Lac via interferometric observations with the Korean VLBI Network (KVN) obtained at 22, 43, 86, and 129 GHz simultaneously over three years (from January 2013 to March 2016); during this time, two γ-ray outbursts (in November 2013 and March 2015) can be seen in γ-ray light curves obtained from Fermi observations. The KVN radio core is optically thick at least up to 86 GHz; there is indication that it might be optically thin at higher frequencies. To first order, the radio light curves decay exponentially over the time span covered by our observations, with decay timescales of 411±85 days, 352±79 days, 310±57 days, and 283±55 days at 22, 43, 86, and 129 GHz, respectively. Assuming synchrotron cooling, a cooling time of around one year is consistent with magnetic field strengths B=2 μT and electron Lorentz factors γ=10,000. Taking into account that our formal measurement errors include intrinsic variability and thus over-estimate the statistical uncertainties, we find that the decay timescale τ scales with frequency ν like τ∝ν^{-0.2}. This relation is much shallower than the one expected from opacity effects (core shift), but in agreement with the (sub-)mm radio core being a standing recollimation shock. We do not find convincing radio flux counterparts to the γ-ray outbursts. The spectral evolution is consistent with the 'generalized shock model' of Valtaoja et al. (1992). A temporary increase in the core opacity and the emergence of a knot around the time of the second γ-ray event indicate that this γ-ray outburst might be an 'orphan' flare powered by the 'ring of fire' mechanism.

Quasi-simultaneous observations of the BL Lac object MK 501 in X-ray, UV, visible, IR and radio frequencies

NASA Technical Reports Server (NTRS)

Kondo, D. M.; Worrall, D. M.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. H.; Oke, J. B.; Yee, H.; Neugebauer, G.; Matthews, K.; Feldman, P. A.

1980-01-01

Quasi-simultaneous observations of the BL Lacertae (Lac) objects MK 501 were performed for the first time at X-ray, ultraviolet, visible, infrared, and radio frequencies. The observed spectral slope from the X-ray to UV regions is positive and continuous, but that from the mid UV to visible light region becomes gradually flat and possibly turns down toward lower frequencies; the optical radio emission can not be accounted for by a single power law. Several theoretical models were considered for the emission mechanism. A quantitative comparison was performed with the synchrotron-self-Compton model; the total spectrum is found consistent with this model. The spectrum from visible light to X-ray is consistent with synchrotron radiation or with inverse-Compton scattering by a hot thermal cloud of electrons. The continuity of the spectral slope from X-ray to UV implied by the current data suggests that the previous estimates of the total luminosity of this BL Lac object is underestimated by a factor of about three or four.

Identification of the linkage group of the Z sex chromosomes of the sand lizard (Lacerta agilis, Lacertidae) and elucidation of karyotype evolution in lacertid lizards.

PubMed

Srikulnath, Kornsorn; Matsubara, Kazumi; Uno, Yoshinobu; Nishida, Chizuko; Olsson, Mats; Matsuda, Yoichi

2014-12-01

The sand lizard (Lacerta agilis, Lacertidae) has a chromosome number of 2n = 38, with 17 pairs of acrocentric chromosomes, one pair of microchromosomes, a large acrocentric Z chromosome, and a micro-W chromosome. To investigate the process of karyotype evolution in L. agilis, we performed chromosome banding and fluorescent in situ hybridization for gene mapping and constructed a cytogenetic map with 86 functional genes. Chromosome banding revealed that the Z chromosome is the fifth largest chromosome. The cytogenetic map revealed homology of the L. agilis Z chromosome with chicken chromosomes 6 and 9. Comparison of the L. agilis cytogenetic map with those of four Toxicofera species with many microchromosomes (Elaphe quadrivirgata, Varanus salvator macromaculatus, Leiolepis reevesii rubritaeniata, and Anolis carolinensis) showed highly conserved linkage homology of L. agilis chromosomes (LAG) 1, 2, 3, 4, 5(Z), 7, 8, 9, and 10 with macrochromosomes and/or macrochromosome segments of the four Toxicofera species. Most of the genes located on the microchromosomes of Toxicofera were localized to LAG6, small acrocentric chromosomes (LAG11-18), and a microchromosome (LAG19) in L. agilis. These results suggest that the L. agilis karyotype resulted from frequent fusions of microchromosomes, which occurred in the ancestral karyotype of Toxicofera and led to the disappearance of microchromosomes and the appearance of many small macrochromosomes.

Quantum spectral curve for the η-deformed AdS5 × S5 superstring

NASA Astrophysics Data System (ADS)

Klabbers, Rob; van Tongeren, Stijn J.

2017-12-01

The spectral problem for the AdS5 ×S5 superstring and its dual planar maximally supersymmetric Yang-Mills theory can be efficiently solved through a set of functional equations known as the quantum spectral curve. We discuss how the same concepts apply to the η-deformed AdS5 ×S5 superstring, an integrable deformation of the AdS5 ×S5 superstring with quantum group symmetry. This model can be viewed as a trigonometric version of the AdS5 ×S5 superstring, like the relation between the XXZ and XXX spin chains, or the sausage and the S2 sigma models for instance. We derive the quantum spectral curve for the η-deformed string by reformulating the corresponding ground-state thermodynamic Bethe ansatz equations as an analytic Y system, and map this to an analytic T system which upon suitable gauge fixing leads to a Pμ system - the quantum spectral curve. We then discuss constraints on the asymptotics of this system to single out particular excited states. At the spectral level the η-deformed string and its quantum spectral curve interpolate between the AdS5 ×S5 superstring and a superstring on "mirror" AdS5 ×S5, reflecting a more general relationship between the spectral and thermodynamic data of the η-deformed string. In particular, the spectral problem of the mirror AdS5 ×S5 string, and the thermodynamics of the undeformed AdS5 ×S5 string, are described by a second rational limit of our trigonometric quantum spectral curve, distinct from the regular undeformed limit.

Fast spinning strings on η deformed AdS 5 × S 5

NASA Astrophysics Data System (ADS)

Banerjee, Aritra; Bhattacharyya, Arpan; Roychowdhury, Dibakar

2018-02-01

In this paper, considering the correspondence between spin chains and string sigma models, we explore the rotating string solutions over η deformed AdS 5 × S 5 in the so-called fast spinning limit. In our analysis, we focus only on the bosonic part of the full superstring action and compute the relevant limits on both ( R × S 3) η and ( R × S 5) η models. The resulting system reveals that in the fast spinning limit, the sigma model on η deformed S 5 could be approximately thought of as the continuum limit of anisotropic SU(3) Heisenberg spin chain model. We compute the energy for a certain class of spinning strings in deformed S 5 and we show that this energy can be mapped to that of a similar spinning string in the purely imaginary β deformed background.

Discovery of VHE γ-ray emission and multi-wavelength observations of the BL Lacertae object 1RXS J101015.9-311909

NASA Astrophysics Data System (ADS)

H.E.S.S. Collaboration; Abramowski, A.; Acero, F.; Aharonian, F.; Akhperjanian, A. G.; Anton, G.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker, J.; Bernlöhr, K.; Birsin, E.; Biteau, J.; Bochow, A.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Büsching, I.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Charbonnier, A.; Chaves, R. C. G.; Cheesebrough, A.; Cologna, G.; Conrad, J.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; Drury, L. O'C.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Egberts, K.; Eger, P.; Espigat, P.; Fallon, L.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gallant, Y. A.; Gast, H.; Gérard, L.; Gerbig, D.; Giebels, B.; Glicenstein, J. F.; Glück, B.; Göring, D.; Häffner, S.; Hague, J. D.; Hahn, J.; Hampf, D.; Harris, J.; Hauser, M.; Heinz, S.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; de Jager, O. C.; Jahn, C.; Jamrozy, M.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Keogh, D.; Khélifi, B.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Komin, Nu.; Kosack, K.; Kossakowski, R.; Krayzel, F.; Laffon, H.; Lamanna, G.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Masbou, J.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Medina, M. C.; Méhault, J.; Moderski, R.; Mohamed, M.; Moulin, E.; Naumann, C. L.; Naumann-Godo, M.; de Naurois, M.; Nedbal, D.; Nekrassov, D.; Nguyen, N.; Nicholas, B.; Niemiec, J.; Nolan, S. J.; Ohm, S.; de Oña Wilhelmi, E.; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Paz Arribas, M.; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raue, M.; Rayner, S. M.; Reimer, A.; Reimer, O.; Renaud, M.; de los Reyes, R.; Rieger, F.; Ripken, J.; Rob, L.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sheidaei, F.; Skilton, J. L.; Sol, H.; Spengler, G.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Terrier, R.; Tluczykont, M.; Valerius, K.; van Eldik, C.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorobiov, S.; Vorster, M.; Wagner, S. J.; Ward, M.; White, R.; Wierzcholska, A.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

2012-06-01

1RXS J101015.9-311909 is a galaxy located at a redshift of z=0.14 hosting an active nucleus (called AGN) belonging to the class of bright BL Lac objects. Observations at high (HE, E > 100 MeV) and very high (VHE, E > 100 GeV) energies provide insights into the origin of very energetic particles present in such sources and the radiation processes at work. We report on results from VHE observations performed between 2006 and 2010 with the H.E.S.S. instrument, an array of four imaging atmospheric Cherenkov telescopes. H.E.S.S. data have been analysed with enhanced analysis methods, making the detection of faint sources more significant. VHE emission at a position coincident with 1RXS J101015.9-311909 is detected with H.E.S.S. for the first time. In a total good-quality livetime of about 49 h, we measure 263 excess counts, corresponding to a significance of 7.1 standard deviations. The photon spectrum above 0.2 TeV can be described by a power-law with a photon index of Γ = 3.08 ± 0.42stat ± 0.20sys. The integral flux above 0.2 TeV is about 0.8% of the flux of the Crab nebula and shows no significant variability over the time reported. In addition, public Fermi/LAT data are analysed to search for high energy emission from the source. The Fermi/LAT HE emission in the 100 MeV to 200 GeV energy range is significant at 8.3 standard deviations in the chosen 25-month dataset. UV and X-ray contemporaneous observations with the Swift satellite in May 2007 are also reported, together with optical observations performed with the atom telescope located at the H.E.S.S. site. Swift observations reveal an absorbed X-ray flux of F(0.3-7) keV = 1.04+0.04-0.05 × 10-11 erg cm-2 s-1 in the 0.3-7 keV range. Finally, all the available data are used to study the multi-wavelength properties of the source. The spectral energy distribution (SED) can be reproduced using a simple one-zone Synchrotron Self Compton (SSC) model with emission from a region with a Doppler factor of 30 and a

Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst

DOE PAGES

Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj; ...

2015-08-17

We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less

Multi-wavelength study of flaring activity in BL Lac object S5 0716+714 during the 2015 outburst

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, Sunil; Zhang, Haocheng; Kushwaha, Pankaj

We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. Furthermore, the rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less

MULTI-WAVELENGTH STUDY OF FLARING ACTIVITY IN BL Lac OBJECT S5 0716+714 DURING THE 2015 OUTBURST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, Sunil; Kushwaha, Pankaj; Singh, K. P.

We present a detailed investigation of the flaring activity observed from a BL Lac object, S5 0716+714 , during its brightest ever optical state in the second half of 2015 January. Observed almost simultaneously in the optical, X-rays, and γ-rays, a significant change in the degree of optical polarization (PD) and a swing in the position angle (PA) of polarization were recorded. A TeV (VHE) detection was also reported by the MAGIC consortium during this flaring episode. Two prominent sub-flares, peaking about five days apart, were seen in almost all of the energy bands. The multi-wavelength light curves, spectral energymore » distribution, and polarization are modeled using the time-dependent code developed by Zhang et al. This model assumes a straight jet threaded by large-scale helical magnetic fields taking into account the light travel time effects, incorporating synchrotron flux and polarization in 3D geometry. The rapid variation in PD and rotation in PA are most likely due to reconnections happening in the emission region in the jet, as suggested by the change in the ratio of toroidal to poloidal components of the magnetic field during the quiescent and flaring states.« less

Integrability of the Ad{{S}_{5}}\\times {{S}^{5}} superstring and its deformations

NASA Astrophysics Data System (ADS)

van Tongeren, Stijn J.

2014-10-01

This article reviews the application of integrability to the spectral problem of strings on Ad{{S}5}× {{S}5} and its deformations. We begin with a pedagogical introduction to integrable field theories culminating in the description of their finite-volume spectra through the thermodynamic Bethe ansatz (TBA). Next, we apply these ideas to the Ad{{S}5}× {{S}5} string and in later sections discuss how to account for particular integrable deformations. Through the AdS/CFT correspondence this gives an exact description of anomalous scaling dimensions of single trace operators in planar N=4 supersymmetry Yang-Mills theory, its ‘orbifolds’, and β and γ-deformed supersymmetric Yang-Mills theory. We also touch upon some subtleties arising in these deformed theories. Furthermore, we consider complex excited states (bound states) in the su(2) sector and give their TBA description. Finally we discuss the TBA for a quantum deformation of the Ad{{S}5}× {{S}5} superstring S-matrix, with close relations to among others Pohlmeyer reduced string theory, and briefly indicate more recent developments in this area.

Hot super-dense compact object with particular EoS

NASA Astrophysics Data System (ADS)

Tito, E. P.; Pavlov, V. I.

2018-03-01

We show the possibility of existence of a self-gravitating spherically-symmetric equilibrium configuration for a neutral matter with neutron-like density, small mass M ≪ M_{⊙}, and small radius R ≪ R_{⊙}. We incorporate the effects of both the special and general theories of relativity. Such object may be formed in a cosmic cataclysm, perhaps an exotic one. Since the base equations of hydrostatic equilibrium are completed by the equation of state (EoS) for the matter of the object, we offer a novel, interpolating experimental data from high-energy physics, EoS which permits the existence of such compact system of finite radius. This EoS model possesses a critical state characterized by density ρc and temperature Tc. For such an object, we derive a radial distribution for the super-dense matter in "liquid" phase using Tolman-Oppenheimer-Volkoff equations for hydrostatic equilibrium. We demonstrate that a stable configuration is indeed possible (only) for temperatures smaller than the critical one. We derive the mass-radius relation (adjusted for relativistic corrections) for such small (M ≪ M_{⊙}) super-dense compact objects. The results are within the constraints established by both heavy-ion collision experiments and theoretical studies of neutron-rich matter.

Reactions of green lizards (Lacerta viridis) to major repellent compounds secreted by Graphosoma lineatum (Heteroptera: Pentatomidae).

PubMed

Gregorovičová, Martina; Černíková, Alena

2015-06-01

The chemical defence of Heteroptera is primarily based on repellent secretions which signal the potential toxicity of the bug to its predators. We tested the aversive reactions of green lizards (Lacerta viridis) towards the major compounds of the defensive secretion of Graphosoma lineatum, specifically: (i) a mixture of three aldehydes: (E)-hex-2-enal, (E)-oct-2-enal, (E)-dec-2-enal; (ii) a mixture of these three aldehydes and tridecane; (iii) oxoaldehyde: (E)-4-oxohex-2-enal; (iv) secretion extracted from metathoracic scent glands of G. lineatum adults and (v) hexane as a non-polar solvent. All chemicals were presented on a palatable food (Tenebrio molitor larvae). The aversive reactions of the green lizards towards the mealworms were evaluated by observing the approach latencies, attack latencies and approach-attack intervals. The green lizards exhibited a strong aversive reaction to the mixture of three aldehydes. Tridecane reduced the aversive reaction to the aldehyde mixture. Oxoaldehyde caused the weakest, but still significant, aversive reaction. The secretion from whole metathoracic scent glands also clearly had an aversive effect on the green lizards. Moreover, when a living specimen of G. lineatum or Pyrrhocoris apterus (another aposematic red-and-black prey) was presented to the green lizards before the trials with the aldehyde mixture, the aversive effect of the mixture was enhanced. In conclusion, the mixture of three aldehydes had the strong aversive effect and could signal the potential toxicity of G. lineatum to the green lizards. Copyright © 2015 Elsevier GmbH. All rights reserved.

How Much Are Harry Potter's Glasses Worth? Children's Monetary Evaluation of Authentic Objects

ERIC Educational Resources Information Center

Gelman, Susan A.; Frazier, Brandy N.; Noles, Nicholaus S.; Manczak, Erika M.; Stilwell, Sarah M.

2015-01-01

Adults attach special value to objects that link to notable people or events--authentic objects. We examined children's monetary evaluation of authentic objects, focusing on four kinds: celebrity possessions (e.g., Harry Potter's glasses), original creations (e.g., the very first teddy bear), personal possessions (e.g., your…

Entanglement entropy of AdS5 × S5 with massive flavors

NASA Astrophysics Data System (ADS)

Hu, Sen; Wu, Guozhen

2018-01-01

We consider backreacted AdS5 × S5 coupled with Nf massive flavors introduced by D7 branes. The backreacted geometry is in the Veneziano limit with fixed Nf/Nc. By dividing one of the directions into a line segment with length l, we get two subspaces. Then we calculate the entanglement entropy between them. With the method of [I. R. Klebanov, D. Kutasov and A. Murugan, Nucl. Phys. B 796, 274 (2008)], we are able to find the cut-off independent part of the entanglement entropy and finally find that this geometry shows no confinement/deconfinement phase transition at zero temperature from the holographic entanglement entropy point of view similar to the case in pure AdS5 × S5.

The AdS{sub 5}xS{sup 5} superstring worldsheet S matrix and crossing symmetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Janik, Romuald A.

2006-04-15

An S matrix satisfying the Yang-Baxter equation with symmetries relevant to the AdS{sub 5}xS{sup 5} superstring recently has been determined up to an unknown scalar factor. Such scalar factors are typically fixed using crossing relations; however, due to the lack of conventional relativistic invariance, in this case its determination remained an open problem. In this paper we propose an algebraic way to implement crossing relations for the AdS{sub 5}xS{sup 5} superstring worldsheet S matrix. We base our construction on a Hopf-algebraic formulation of crossing in terms of the antipode and introduce generalized rapidities living on the universal cover of themore » parameter space which is constructed through an auxillary, coupling-constant dependent, elliptic curve. We determine the crossing transformation and write functional equations for the scalar factor of the S matrix in the generalized rapidity plane.« less

LHEA contributions to the Future of Ultraviolet Astronomy Based on Six Years of IUE Research

NASA Technical Reports Server (NTRS)

Mushotzky, R. F.; Urry, C. M.

1984-01-01

Astronomical models of galactic nuclei emission spectra are reassessed in light of ultraviolet and X-ray spectroscopic observations. Spectral analysis of BL Lacertae objects using data collected by the International Ultraviolet Explorer (IUE) and other astronomical observatories is presented.

Chaperoning 5S RNA assembly.

PubMed

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-07-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

Chaperoning 5S RNA assembly

PubMed Central

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-01-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

PubMed

Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

2014-11-01

During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Extragalactic counterparts to Einstein slew survey sources

NASA Technical Reports Server (NTRS)

Schachter, Jonathan F.; Elvis, Martin; Plummer, David; Remillard, Ron

1992-01-01

The Einstein slew survey consists of 819 bright X-ray sources, of which 636 (or 78 percent) are identified with counterparts in standard catalogs. The importance of bright X-ray surveys is stressed, and the slew survey is compared to the Rosat all sky survey. Statistical techniques for minimizing confusion in arcminute error circles in digitized data are discussed. The 238 slew survey active galactic nuclei, clusters, and BL Lacertae objects identified to date and their implications for logN-logS and source evolution studies are described.

Tree-level S-matrix of Pohlmeyer reduced form of AdS 5 × S 5 superstring theory

NASA Astrophysics Data System (ADS)

Hoare, B.; Tseytlin, A. A.

2010-02-01

With a motivation to find a 2-d Lorentz-invariant solution of the AdS 5 × S 5 superstring we continue the study of the Pohlmeyer-reduced form of this theory. The reduced theory is constructed from currents of the superstring sigma model and is classically equivalent to it. Its action is that of G/ H = Sp(2, 2) × Sp(4)/[SU(2)]4 gauged WZW model deformed by an integrable potential and coupled to fermions. This theory is UV finite and is conjectured to be related to the superstring theory also at the quantum level. Expanded near the trivial vacuum it has the same elementary excitations (8+8 massive bosonic and fermionic 2-d degrees of freedom) as the AdS 5 × S 5 superstring in the S 5 light-cone gauge or near plane-wave expansion. In contrast to the superstring case, the interaction terms in the reduced action are manifestly 2-d Lorentz invariant. Since the theory is integrable, its S-matrix should be effectively determined by the two-particle scattering. Here we explicitly compute the tree-level two-particle S-matrix for the elementary excitations of the reduced theory. We find that this S-matrix has the same index structure and group factorization properties as the superstring S-matrix computed in hep-th/0611169 but has simpler coefficients, depending only on the difference of two rapidities. While the gauge-fixed form of the reduced action has only the bosonic [SU(2)]4 part of the PSU(2|2) × PSU(2|2) symmetry of the light-cone superstring spectrum as its manifest symmetry we conjecture that it should also have a hidden fermionic symmetry that effectively interchanges bosons and fermions and which should guide us towards understanding the relation between the two S-matrices.

It’s Out of My Hands! Grasping Capacity May Not Influence Perceived Object Size

PubMed Central

2017-01-01

Linkenauger, Witt, and Proffitt (2011) found that the perceived size of graspable objects was scaled by perceived grasping capacity. However, it is possible that this effect occurred because object size was estimated on the same trial as grasping capacity. This may have led to a conflation of estimates of perceived action capacity and spatial properties. In 5 experiments, we tested Linkenauger et al.’s claim that right-handed observers overestimate the grasping capacity of their right hand relative to their left hand, and that this, in turn, leads them to underestimate the size of objects to-be-grasped in their right hand relative to their left hand. We replicated the finding that right handers overestimate the size and grasping capacity of their right hand relative to their left hand. However, when estimates of object size and grasping capacity were made in separate tasks, objects grasped in the right hand were not underestimated relative to those grasped in the left hand. Further, when grasping capacity was physically restricted, observers appropriately recalibrated their perception of their maximum grasp but estimates of object size were unaffected. Our results suggest that changes in action capacity may not influence perceived object size if sources of conflation are controlled for. PMID:28191987

Polarimetry of optically selected BL Lacertae candidates from the SDSS

NASA Astrophysics Data System (ADS)

Heidt, J.; Nilsson, K.

2011-05-01

We present and discuss polarimetric observations of 182 targets drawn from an optically selected sample of 240 probable BL Lac candidates out of the SDSS compiled by Collinge et al. (2005, AJ, 129, 2542). In contrast to most other BL Lac candidate samples extracted from the SDSS, its radio- and/or X-ray properties have not been taken into account for its derivation. Thus, because its selection is based on optical properties alone, it may be less prone to selection effects inherent in other samples derived at different frequencies, so it offers a unique opportunity to extract the first unbiased BL Lac luminosity function that is suitably large in size. We found 124 out of 182 targets (68%) to be polarized, 95 of the polarized targets (77%) to be highly polarized (>4%). The low-frequency peaked BL Lac candidates in the sample are on average only slightly more polarized than the high-frequency peaked ones. Compared to earlier studies, we found a high duty cycle in high polarization (˜ 66+2-14% to be >4% polarized) in high-frequency peaked BL Lac candidates. This may come from our polarization analysis, which minimizes the contamination by host galaxy light. No evidence of radio-quiet BL Lac objects in the sample was found. Our observations show that the probable sample of BL Lac candidates of Collinge et al. (2005) indeed contains a large number of bona fide BL Lac objects. High S/N spectroscopy and deep X-ray observations are required to construct the first luminosity function of optically selected BL Lac objects and to test more stringently for any radio-quiet BL Lac objects in the sample. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory in the course of the observing proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Andalucia (CSIC).Based on observations

5SRNAdb: an information resource for 5S ribosomal RNAs.

PubMed

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Geographic variation of life-history traits in the sand lizard, Lacerta agilis: testing Darwin's fecundity-advantage hypothesis.

PubMed

Roitberg, E S; Eplanova, G V; Kotenko, T I; Amat, F; Carretero, M A; Kuranova, V N; Bulakhova, N A; Zinenko, O I; Yakovlev, V A

2015-03-01

The fecundity-advantage hypothesis (FAH) explains larger female size relative to male size as a correlated response to fecundity selection. We explored FAH by investigating geographic variation in female reproductive output and its relation to sexual size dimorphism (SSD) in Lacerta agilis, an oviparous lizard occupying a major part of temperate Eurasia. We analysed how sex-specific body size and SSD are associated with two putative indicators of fecundity selection intensity (clutch size and the slope of the clutch size-female size relationship) and with two climatic variables throughout the species range and across two widespread evolutionary lineages. Variation within the lineages provides no support for FAH. In contrast, the divergence between the lineages is in line with FAH: the lineage with consistently female-biased SSD (L. a. agilis) exhibits higher clutch size and steeper fecundity slope than the lineage with an inconsistent and variable SSD (L. a. exigua). L. a. agilis shows lower offspring size (egg mass, hatchling mass) and higher clutch mass relative to female mass than L. a. exigua, that is both possible ways to enhance offspring number are exerted. As the SSD difference is due to male size (smaller males in L. a. agilis), fecundity selection favouring larger females, together with viability selection for smaller size in both sexes, would explain the female-biased SSD and reproductive characteristics of L. a. agilis. The pattern of intraspecific life-history divergence in L. agilis is strikingly similar to that between oviparous and viviparous populations of a related species Zootoca vivipara. Evolutionary implications of this parallelism are discussed. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

The first Fermi multifrequency campaign on BL Lacertae: Characterizing the low-activity state of the eponymous blazar

DOE PAGES

Abdo, A. A.; Ackermann, M.; Ajello, M.; ...

2011-03-10

Here, we report on observations of BL Lacertae during the first 18 months of Fermi LAT science operations and present results from a 48 day multifrequency coordinated campaign from 2008 August 19 to 2008 October 7. The radio to gamma-ray behavior of BL Lac is unveiled during a low-activity state thanks to the coordinated observations of radio-band (Metsähovi and VLBA), near-IR/optical (Tuorla, Steward, OAGH, and MDM), and X-ray ( RXTE and Swift) observatories. No variability was resolved in gamma rays during the campaign, and the brightness level was 15 times lower than the level of the 1997 EGRET outburst. Moderatemore » and uncorrelated variability has been detected in UV and X-rays. The X-ray spectrum is found to be concave, indicating the transition region between the low- and high-energy components of the spectral energy distribution (SED). VLBA observation detected a synchrotron spectrum self-absorption turnover in the innermost part of the radio jet appearing to be elongated and inhomogeneous, and constrained the average magnetic field there to be less than 3 G. Over the following months, BL Lac appeared variable in gamma rays, showing flares (in 2009 April and 2010 January). There is no evidence for the correlation of gamma rays with the optical flux monitored from the ground in 18 months. The SED may be described by a single-zone or a two-zone synchrotron self-Compton (SSC) model, but a hybrid SSC plus external radiation Compton model seems to be preferred based on the observed variability and the fact that it provides a fit closest to equipartition.« less

The third spectrum of rhenium (Re III): Analysis of the (5d5 + 5d46s)-(5d46p + 5d36s6p) transition array

NASA Astrophysics Data System (ADS)

Azarov, Vladimir I.; Gayasov, Robert R.

2018-05-01

The spectrum of rhenium was observed in the (1017-2074) Å wavelength region. The (5d5 + 5d46s)-(5d46p + 5d36s6p) transition array of two times ionized rhenium, Re III, has been investigated and 1305 spectral lines have been classified in the region. The analysis has led to the determination of the 5d5, 5d46s, 5d46p and 5d36s6p configurations. Seventy levels of the 5d5 and 5d46s configurations in the even system and 161 levels of the 5d46p and 5d36s6p configurations in the odd system have been established. The orthogonal operators technique was used to calculate the level structure and transition probabilities. The energy parameters have been determined by the least squares fit to the observed levels. Calculated transition probability and energy values, as well as LS-compositions obtained from the fitted parameters are presented.

The environment of x ray selected BL Lacs: Host galaxies and galaxy clustering

NASA Technical Reports Server (NTRS)

Wurtz, Ron; Stocke, John T.; Ellingson, Erica; Yee, Howard K. C.

1993-01-01

Using the Canada-France-Hawaii Telescope, we have imaged a complete, flux-limited sample of Einstein Medium Sensitivity Survey BL Lacertae objects in order to study the properties of BL Lac host galaxies and to use quantitative methods to determine the richness of their galaxy cluster environments.

S-CNN: Subcategory-aware convolutional networks for object detection.

PubMed

Chen, Tao; Lu, Shijian; Fan, Jiayuan

2017-09-26

The marriage between the deep convolutional neural network (CNN) and region proposals has made breakthroughs for object detection in recent years. While the discriminative object features are learned via a deep CNN for classification, the large intra-class variation and deformation still limit the performance of the CNN based object detection. We propose a subcategory-aware CNN (S-CNN) to solve the object intra-class variation problem. In the proposed technique, the training samples are first grouped into multiple subcategories automatically through a novel instance sharing maximum margin clustering process. A multi-component Aggregated Channel Feature (ACF) detector is then trained to produce more latent training samples, where each ACF component corresponds to one clustered subcategory. The produced latent samples together with their subcategory labels are further fed into a CNN classifier to filter out false proposals for object detection. An iterative learning algorithm is designed for the joint optimization of image subcategorization, multi-component ACF detector, and subcategory-aware CNN classifier. Experiments on INRIA Person dataset, Pascal VOC 2007 dataset and MS COCO dataset show that the proposed technique clearly outperforms the state-of-the-art methods for generic object detection.

Asynchronous Object Storage with QoS for Scientific and Commercial Big Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brim, Michael J; Dillow, David A; Oral, H Sarp

2013-01-01

This paper presents our design for an asynchronous object storage system intended for use in scientific and commercial big data workloads. Use cases from the target workload do- mains are used to motivate the key abstractions used in the application programming interface (API). The architecture of the Scalable Object Store (SOS), a prototype object stor- age system that supports the API s facilities, is presented. The SOS serves as a vehicle for future research into scalable and resilient big data object storage. We briefly review our research into providing efficient storage servers capable of providing quality of service (QoS) contractsmore » relevant for big data use cases.« less

Properties of optically selected BL Lacertae candidates from the SDSS

NASA Astrophysics Data System (ADS)

Kügler, S. D.; Nilsson, K.; Heidt, J.; Esser, J.; Schultz, T.

2014-09-01

Context. Deep optical surveys open the avenue for finding large numbers of BL Lac objects that are hard to identify because they lack the unique properties classifying them as such. While radio or X-ray surveys typically reveal dozens of sources, recent compilations based on optical criteria alone have increased the number of BL Lac candidates considerably. However, these compilations are subject to biases and may contain a substantial number of contaminating sources. Aims: In this paper we extend our analysis of 182 optically selected BL Lac object candidates from the SDSS with respect to an earlier study. The main goal is to determine the number of bona fide BL Lac objects in this sample. Methods: We examine their variability characteristics, determine their broad-band radio-UV spectral energy distributions (SEDs), and search for the presence of a host galaxy. In addition we present new optical spectra for 27 targets with improved signal-to-noise ratio with respect to the SDSS spectra. Results: At least 59% of our targets have shown variability between SDSS DR2 and our observations by more than 0.1-0.27 mag depending on the telescope used. A host galaxy was detected in 36% of our targets. The host galaxy type and luminosities are consistent with earlier studies of BL Lac host galaxies. Simple fits to broad-band SEDs for 104 targets of our sample derived synchrotron peak frequencies between 13.5 ≤ log 10(νpeak) ≤ 16 with a peak at log 10 ~ 14.5. Our new optical spectra do not reveal any new redshift for any of our objects. Thus the sample contains a large number of bona fide BL Lac objects and seems to contain a substantial fraction of intermediate-frequency peaked BL Lacs. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory under proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the

Catalog of SAS-2 gamma-ray observations (Fichtel, et al. 1990)

NASA Technical Reports Server (NTRS)

Warren, Wayne H., Jr.

1990-01-01

The machine-readable version of the catalog, as it is currently being distributed from the Astronomical Data Center, is described. The SAS-2 gamma ray catalog contains fluxes measured with the high energy gamma ray telescope flown aboard the second NASA Small Astronomy Satellite. The objects measured include various types of galaxies, quasi-stellar, and BL Lacertae objects, and pulsars. The catalog contains separate files for galaxies, pulsars, other objects, notes, and references.

X-Ray and TeV Gamma-Ray Emission from Parallel Electron-Positron or Electron-Proton Beams in BL Lacertae Objects

NASA Astrophysics Data System (ADS)

Krawczynski, H.

2007-04-01

In this paper we discuss models of the X-ray and TeV γ-ray emission from BL Lac objects based on parallel electron-positron or electron-proton beams that form close to the central black hole, due to the strong electric fields generated by the accretion disk and possibly also by the black hole itself. Fitting the energy spectrum of the BL Lac object Mrk 501, we obtain tight constraints on the beam properties. Launching a sufficiently energetic beam requires rather strong magnetic fields close to the black hole (~100-1000 G). However, the model fits imply that the magnetic field in the emission region is only ~0.02 G. Thus, the particles are accelerated close to the black hole and propagate a considerable distance before instabilities trigger the dissipation of energy through synchrotron and self-Compton emission. We discuss various approaches to generate enough power to drive the jet and, at the same time, to accelerate particles to ~20 TeV energies. Although the parallel beam model has its own problems, it explains some of the long-standing problems that plague models based on Fermi-type particle acceleration, such as the presence of a very high minimum Lorentz factor of accelerated particles. We conclude with a brief discussion of the implications of the model for the difference between the processes of jet formation in BL Lac-type objects and those in quasars.

A memory span of one? Object identification in 6.5-month-old infants.

PubMed

Káldy, Zsuzsa; Leslie, Alan M

2005-09-01

Infants' abilities to identify objects based on their perceptual features develop gradually during the first year and possibly beyond. Earlier we reported [Káldy, Z., & Leslie, A. M. (2003). Identification of objects in 9-month-old infants: Integrating 'what' and 'where' information. Developmental Science, 6, 360-373] that infants at 9 months of age are able to use shape information to identify two objects and follow their spatiotemporal trajectories behind occlusion. On the other hand, another recent study suggests that infants at 4-5 months of age cannot identify objects by features and bind them to locations [Mareschal, D., & Johnson, M. H. (2003). The "what" and "where" of object representations in infancy. Cognition, 88, 259-276]. In the current study, we investigated the developmental steps between these two benchmark ages by testing 6.5-month-old infants. Experiment 1 and 2 adapted the paradigm used in our previous studies with 9-month-olds that involves two objects hidden sequentially behind separate occluders. This technique allows us to address object identification and to examine whether only one or both object identities are being tracked. Results of experiment 1 showed that 6.5-month-old infants could identify at least one of two objects based on shape and experiment 2 found that this ability holds for only one, the last object hidden. We propose that at this age, infants' working memory capacity is limited to one occluded object if there is a second intervening hiding. If their attention is distracted by an intervening object during the memory maintenance period, the memory of the first object identity appears to be lost. Results of experiment 3 supported this hypothesis with a simpler one-screen setup. Finally, results of experiment 4 show that temporal decay of the memory trace (without an intervening hiding) by itself cannot explain the observed pattern of results. Taken together, our findings suggest that at six months of age infants can store

Electrolytic conductivity at 0.5 S m-1 and 5 mS m-1

NASA Astrophysics Data System (ADS)

Seitz, S.; Sander, B.; Snedden, A.; DeLeeBeeck, L.; Canaza, G. T.; Asakai, T.; Maksimov, I.; Song, X.; Wang, H.; Kozlowski, W.; Dumanska, J.; Jakusovszky, B.; Szilágyi, Z. N.; Gavrilkin, V.; Stennik, O.; Ovchinnikov, Y.; Gonzaga, F. B.; da Cruz Cunha, K.; Ferraz, S. F.; Hanková, Z.; Máriássy, M.; Vicarova, M.; Vospelova, A.; Ortiz-Aparicio, J. L.; Lara-Manzano, J. V.; Uribe-Godínez, J.; Stoica, D.; Fisicaro, P.; Suvorov, V. I.; Konopelko, L. A.; Smirnov, A. M.; Amaya, R. C.; Quezada, H. T.

2017-01-01

Key Comparison CCQM-K36.2016 was a follow-up comparison for K36 and provided updated support for the corresponding calibration and measurement capability (CMC) entries in the BIPM CMC database. It aimed to demonstrate the capabilities of the participating NMIs to measure electrolytic conductivity of aqueous electrolyte solutions in the conductivity range 0.15 S m-1 to 1.5 S m-1 and in the conductivity range 1.5 mS m-1 to 15 mS m-1. To this end electrolytic conductivity of a potassium chloride solution (nominal conductivity 0.5 S m-1) and of a HCl solution (nominal conductivity 5 mS m-1) had to be measured. 17 NMIs participated in the comparison. The key comparison reference value (KCRV) of the KCl solution was (0.50999 +/-0.00032) S m-1 and the KCRV of the HCl solution was (4.9877 +/-0.012) mS m-1. Both values were estimated from the medians of the results considered eligible for KCRV calculation. They were given with their expanded uncertainties (95% coverage). The majority of the 0.5 S m-1 results were consistent with the KCRV. Two institutes showed a small inconsistency, one outlier was observed. The conductivity of the HCl solution showed a small, but steady linear drift of 0.00006843 mS m-1 per day during the measurement period and was corrected for KCRV calculation. Some institutes reported unstable measurement conditions for this solution. The results of seven participants have been inconsistent with the KCRV. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

The U.S. survey for faint blue objects

NASA Technical Reports Server (NTRS)

Mitchell, K. J.; Howell, S. B.; Usher, P. D.

1987-01-01

A spectrophotometric study of the blue and UV-excess starlike objects in the U.S. survey (Usher, 1981) has been conducted. Observations were obtained with a resolution of about 20 A over the 3500-7000-A wavelength range. Considered within the sample are 42 DA white dwarfs, 4 DB/DO white dwarfs, 13 subdwarf B stars, 12 subdwarf O stars, and 13 horizontal branch stars. The sample is analyzed using numerical convolution photometry.

DISCOVERY OF VERY HIGH ENERGY gamma-RAYS FROM THE BLAZAR S5 0716+714

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderhub, H.; Biland, A.; Antonelli, L. A.

The MAGIC Collaboration reports the detection of the blazar S5 0716+714 (z = 0.31 +- 0.08) in very high energy gamma rays. The observations were performed in 2007 November and in 2008 April, and were triggered by the Kungliga Vetenskapliga Akademi telescope due to the high optical state of the object. An overall significance of the signal accounts to S = 5.8sigma for 13.1 hr of data. Most of the signal (S = 6.9sigma) comes from the 2008 April data sample during a higher optical state of the object suggesting a possible correlation between the Very High Energy gamma-ray andmore » optical emissions. The differential energy spectrum of the 2008 data sample follows a power law with a photon index of GAMMA = 3.45 +- 0.54{sub stat} +- 0.2{sub syst}, and the integral flux above 400 GeV is at the level of (7.5 +- 2.2{sub stat} +- 2.3{sub syst}) x 10{sup -12} cm{sup -2} s{sup -1}, corresponding to a 9% Crab Nebula flux. Modeling of the broadband spectral energy distribution indicates that a structured jet model appears to be more promising in describing the available data than a simple one-zone synchrotron self-Compton model.« less

X-ray Flaring Activity in HBL Source PKS 2155-304

NASA Astrophysics Data System (ADS)

Kapanadze, Bidzina

2013-08-01

We report an increasing X-ray flux through 0.3-10 keV band in the high-energy peaked BL Lacertae source PKS 2155-304 (z=0.117) which has been observed three times between 2013 July 25 and August 3 with the X-ray Telescope (XRT) onboard the Swift satellite. Using the data provided at the website http://www.swift.psu.edu/monitoring/ we have found that the object increased its 0.3-10 keV flux almost 3-times from 0.98+/-0.06 cts/s (July 25, ObsID=00030795114) to 2.85+/-0.08 cts/s corresponding to the observation performed July 31. The last pointing performed on August 3 (ObsID0008028002) shows even higher flux of 3.08+/-05 cts/s. No subhour flux variability at 99.9% confidence are detected from each observation, lasting 0.7 ks - 2.1 ks. On the basis of our recent study of long-term X-ray flux variability in this source (Kapanadze et al. 2013, submitted to the Monthly Notices of Royal Astronomical Society) we suggest that the similar situation was generally an indicator of the! onset of a longer-term flare with weeks-months duration. Therefore, further densely sampled observations with Swift-XRT and other X-ray instruments are highly recommended. Since X-ray flares in BL Lacertae sources are mostly followed by those in other spectral bands, we encourage intensive multiwavelength observations of PKS 2155-304.

Infants' use of category knowledge and object attributes when segregating objects at 8.5 months of age.

PubMed

Needham, Amy; Cantlon, Jessica F; Ormsbee Holley, Susan M

2006-12-01

The current research investigates infants' perception of a novel object from a category that is familiar to young infants: key rings. We ask whether experiences obtained outside the lab would allow young infants to parse the visible portions of a partly occluded key ring display into one single unit, presumably as a result of having categorized it as a key ring. This categorization was marked by infants' perception of the keys and ring as a single unit that should move together, despite their attribute differences. We showed infants a novel key ring display in which the keys and ring moved together as one rigid unit (Move-together event) or the ring moved but the keys remained stationary throughout the event (Move-apart event). Our results showed that 8.5-month-old infants perceived the keys and ring as connected despite their attribute differences, and that their perception of object unity was eliminated as the distinctive attributes of the key ring were removed. When all of the distinctive attributes of the key ring were removed, the 8.5-month-old infants perceived the display as two separate units, which is how younger infants (7-month-old) perceived the key ring display with all its distinctive attributes unaltered. These results suggest that on the basis of extensive experience with an object category, infants come to identify novel members of that category and expect them to possess the attributes typical of that category.

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

Multiple approaches to detect outliers in a genome scan for selection in ocellated lizards (Lacerta lepida) along an environmental gradient.

PubMed

Nunes, Vera L; Beaumont, Mark A; Butlin, Roger K; Paulo, Octávio S

2011-01-01

Identification of loci with adaptive importance is a key step to understand the speciation process in natural populations, because those loci are responsible for phenotypic variation that affects fitness in different environments. We conducted an AFLP genome scan in populations of ocellated lizards (Lacerta lepida) to search for candidate loci influenced by selection along an environmental gradient in the Iberian Peninsula. This gradient is strongly influenced by climatic variables, and two subspecies can be recognized at the opposite extremes: L. lepida iberica in the northwest and L. lepida nevadensis in the southeast. Both subspecies show substantial morphological differences that may be involved in their local adaptation to the climatic extremes. To investigate how the use of a particular outlier detection method can influence the results, a frequentist method, DFDIST, and a Bayesian method, BayeScan, were used to search for outliers influenced by selection. Additionally, the spatial analysis method was used to test for associations of AFLP marker band frequencies with 54 climatic variables by logistic regression. Results obtained with each method highlight differences in their sensitivity. DFDIST and BayeScan detected a similar proportion of outliers (3-4%), but only a few loci were simultaneously detected by both methods. Several loci detected as outliers were also associated with temperature, insolation or precipitation according to spatial analysis method. These results are in accordance with reported data in the literature about morphological and life-history variation of L. lepida subspecies along the environmental gradient. © 2010 Blackwell Publishing Ltd.

Isoelectronic studies of the 5s/sup 2/ /sup 1/S/sub 0/-5s5p/sup 1,3/P/sub J/ intervals in the Cd sequence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Curtis, L.J.

1986-02-01

The 5s/sup 2/ /sup 1/S/sub 0/-5s5p/sup 1,3/P/sub J/ energy intervals in the Cd isoelectronic sequence have been investigated through a semiempirical systematization of recent measurements and through the performance of ab initio multiconfiguration Dirac-Fock calculations. Screening-parameter reductions of the spin-orbit and exchange energies both for the observed data and for the theoretically computed values establish the existence of empirical linearities similar to those exploited earlier for the Be, Mg, and Zn sequences. This permits extrapolative isoelectronic predictions of the relative energies of the 5s5p levels, which can be connected to 5s/sup 2/ using intersinglet intervals obtained from empirically corrected abmore » initio calculations. These linearities have also been examined homologously for the Zn, Cd, and Hg sequences, and common relationships have been found that accurately describe all three of these sequences.« less

Multiwavelength monitoring of the BL Lacertae object PKS 2155-304. 3: Ground-based observations in 1991 November

NASA Technical Reports Server (NTRS)

Courvoisier, T. J.-L.; Blecha, A.; Bouchet, P.; Bratschi, P.; Carini, M. T.; Donahue, M.; Edelson, R.; Feigelson, E. D.; Filippenko, A. V.; Glass, I. S.

1995-01-01

We present ground-based observations of the BL Lac object PKS 2155-304 during 1991 November. These data were obtained as part of a large international campaign of observations spanning the electro-magnetic spectrum from the radio waves to the X-rays. The data presented here include radio and UBVRI fluxes, as well as optical polarimetry. The U to I data show the same behavior in all bands and that only upper limits to any lag can be deduced from the cross-correlation of the light curves. The spectral slope in the U-I domain remained constant on all epochs but 2. There is no correlation between changes in the spectral slope and large variations in the total or polarized flux. The radio flux variations did not follow the same pattern of variability as the optical and infrared fluxes. The polarized flux varied by a larger factor than the total flux. The variations of the polarized flux are poorly correlated with those of the total flux in the optical (and hence UV domain; see the accompanying paper by Edelson et al.) nor with those of the soft X-rays. We conclude that the variability of PKS 2155-304 in the optical and near-infrared spectral domains are easier to understand in the context of variable geometry or bulk Lorentz factor than of variable electron acceleration and cooling rates.

Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

PubMed Central

Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

2012-01-01

Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

NASA Astrophysics Data System (ADS)

Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

2016-06-01

Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

Hidden Surface Removal through Object Space Decomposition.

DTIC Science & Technology

1982-01-01

12 2.1 Methods of Subdividing the Object Space ..................................................... 14 2.2 Accessing...AC.AIIA TO5ASK FORCE MNT OF TECH WRIONT-PATTERSON AFB 0O4 P/O 1a/I 64100(6 SURFACE REMOVAL THROWN4 OBJECT SPACE 0(COMPOSIT109d.(U UiCLASIFIEC AFZITNl...Surface Removal Through Object Space THESlS/ J AJ;I Decomposition 6. PERFORMING ORG. REPORT NUMBER 7. AUTHOR() a. CONTRACT OR GRANT NUMBER(s) Robert

Wearable sensors objectively measure gait parameters in Parkinson’s disease

PubMed Central

Marxreiter, Franz; Gossler, Julia; Kohl, Zacharias; Reinfelder, Samuel; Gassner, Heiko; Aminian, Kamiar; Eskofier, Bjoern M.; Winkler, Jürgen; Klucken, Jochen

2017-01-01

Distinct gait characteristics like short steps and shuffling gait are prototypical signs commonly observed in Parkinson’s disease. Routinely assessed by observation through clinicians, gait is rated as part of categorical clinical scores. There is an increasing need to provide quantitative measurements of gait, e.g. to provide detailed information about disease progression. Recently, we developed a wearable sensor-based gait analysis system as diagnostic tool that objectively assesses gait parameter in Parkinson’s disease without the need of having a specialized gait laboratory. This system consists of inertial sensor units attached laterally to both shoes. The computed target of measures are spatiotemporal gait parameters including stride length and time, stance phase time, heel-strike and toe-off angle, toe clearance, and inter-stride variation from gait sequences. To translate this prototype into medical care, we conducted a cross-sectional study including 190 Parkinson’s disease patients and 101 age-matched controls and measured gait characteristics during a 4x10 meter walk at the subjects’ preferred speed. To determine intraindividual changes in gait, we monitored the gait characteristics of 63 patients longitudinally. Cross-sectional analysis revealed distinct spatiotemporal gait parameter differences reflecting typical Parkinson’s disease gait characteristics including short steps, shuffling gait, and postural instability specific for different disease stages and levels of motor impairment. The longitudinal analysis revealed that gait parameters were sensitive to changes by mirroring the progressive nature of Parkinson’s disease and corresponded to physician ratings. Taken together, we successfully show that wearable sensor-based gait analysis reaches clinical applicability providing a high biomechanical resolution for gait impairment in Parkinson’s disease. These data demonstrate the feasibility and applicability of objective wearable sensor

8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants. 236.4 Section 236.4 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition...

5S ribosomal RNA database Y2K

PubMed Central

Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

5S ribosomal RNA database Y2K.

PubMed

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

Object permanence in lemurs.

PubMed

Deppe, Anja M; Wright, Patricia C; Szelistowski, William A

2009-03-01

Object permanence, the ability to mentally represent objects that have disappeared from view, should be advantageous to animals in their interaction with the natural world. The objective of this study was to examine whether lemurs possess object permanence. Thirteen adult subjects representing four species of diurnal lemur (Eulemur fulvus rufus, Eulemur mongoz, Lemur catta and Hapalemur griseus) were presented with seven standard Piagetian visible and invisible object displacement tests, plus one single visible test where the subject had to wait predetermined times before allowed to search, and two invisible tests where each hiding place was made visually unique. In all visible tests lemurs were able to find an object that had been in clear view before being hidden. However, when lemurs were not allowed to search for up to 25-s, performance declined with increasing time-delay. Subjects did not outperform chance on any invisible displacements regardless of whether hiding places were visually uniform or unique, therefore the upper limit of object permanence observed was Stage 5b. Lemur species in this study eat stationary foods and are not subject to stalking predators, thus Stage 5 object permanence is probably sufficient to solve most problems encountered in the wild.

Semiclassical spectrum for BMN string in Sch 5 × S 5

NASA Astrophysics Data System (ADS)

Ouyang, Hao

2017-12-01

We investigate the algebraic curve for string in Sch 5 × S 5. We compute the semiclassical spectrum for BMN string in Sch 5 × S 5 from the algebraic curve. We compare our results with the anomalous dimensions in sl(2) sector of the null dipole deformation of N=4 superYang-Millstheory.

8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants. 1236.4 Section 1236.4 Aliens and Nationality EXECUTIVE OFFICE FOR IMMIGRATION REVIEW, DEPARTMENT OF... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6...

Phylogeography and demographic history of Lacerta lepida in the Iberian Peninsula: multiple refugia, range expansions and secondary contact zones

PubMed Central

2011-01-01

Background The Iberian Peninsula is recognized as an important refugial area for species survival and diversification during the climatic cycles of the Quaternary. Recent phylogeographic studies have revealed Iberia as a complex of multiple refugia. However, most of these studies have focused either on species with narrow distributions within the region or species groups that, although widely distributed, generally have a genetic structure that relates to pre-Quaternary cladogenetic events. In this study we undertake a detailed phylogeographic analysis of the lizard species, Lacerta lepida, whose distribution encompasses the entire Iberian Peninsula. We attempt to identify refugial areas, recolonization routes, zones of secondary contact and date demographic events within this species. Results Results support the existence of 6 evolutionary lineages (phylogroups) with a strong association between genetic variation and geography, suggesting a history of allopatric divergence in different refugia. Diversification within phylogroups is concordant with the onset of the Pleistocene climatic oscillations. The southern regions of several phylogroups show a high incidence of ancestral alleles in contrast with high incidence of recently derived alleles in northern regions. All phylogroups show signs of recent demographic and spatial expansions. We have further identified several zones of secondary contact, with divergent mitochondrial haplotypes occurring in narrow zones of sympatry. Conclusions The concordant patterns of spatial and demographic expansions detected within phylogroups, together with the high incidence of ancestral haplotypes in southern regions of several phylogroups, suggests a pattern of contraction of populations into southern refugia during adverse climatic conditions from which subsequent northern expansions occurred. This study supports the emergent pattern of multiple refugia within Iberia but adds to it by identifying a pattern of refugia coincident

Phylogeography and demographic history of Lacerta lepida in the Iberian Peninsula: multiple refugia, range expansions and secondary contact zones.

PubMed

Miraldo, Andreia; Hewitt, Godfrey M; Paulo, Octavio S; Emerson, Brent C

2011-06-17

The Iberian Peninsula is recognized as an important refugial area for species survival and diversification during the climatic cycles of the Quaternary. Recent phylogeographic studies have revealed Iberia as a complex of multiple refugia. However, most of these studies have focused either on species with narrow distributions within the region or species groups that, although widely distributed, generally have a genetic structure that relates to pre-Quaternary cladogenetic events. In this study we undertake a detailed phylogeographic analysis of the lizard species, Lacerta lepida, whose distribution encompasses the entire Iberian Peninsula. We attempt to identify refugial areas, recolonization routes, zones of secondary contact and date demographic events within this species. Results support the existence of 6 evolutionary lineages (phylogroups) with a strong association between genetic variation and geography, suggesting a history of allopatric divergence in different refugia. Diversification within phylogroups is concordant with the onset of the Pleistocene climatic oscillations. The southern regions of several phylogroups show a high incidence of ancestral alleles in contrast with high incidence of recently derived alleles in northern regions. All phylogroups show signs of recent demographic and spatial expansions. We have further identified several zones of secondary contact, with divergent mitochondrial haplotypes occurring in narrow zones of sympatry. The concordant patterns of spatial and demographic expansions detected within phylogroups, together with the high incidence of ancestral haplotypes in southern regions of several phylogroups, suggests a pattern of contraction of populations into southern refugia during adverse climatic conditions from which subsequent northern expansions occurred. This study supports the emergent pattern of multiple refugia within Iberia but adds to it by identifying a pattern of refugia coincident with the southern distribution

Fermi LAT detection of increased gamma-ray activity from blazar S5 0716+71

NASA Astrophysics Data System (ADS)

Buson, S.

2014-04-01

The Large Area Telescope (LAT), one of two instruments on-board the Fermi Gamma-ray Space Telescope, has observed an increase in gamma-ray activity from a source positionally coincident with the BL Lac object S5 0716+71 (also known as 2FGL J0721.9+7120, Nolan et al. ...

Empirical multi-wavelength prediction method for very high energy gamma-ray emitting BL Lacertae objects

NASA Astrophysics Data System (ADS)

Fallah Ramazani, V.; Lindfors, E.; Nilsson, K.

2017-12-01

Aim: We have collected the most complete multi-wavelength (6.0-6.0 × 10-18 cm) dataset of very high energy (VHE) γ-ray emitting (TeV) BL Lacs, which are the most numerous extragalactic VHE sources. Using significant correlations between different bands, we aim to identify the best TeV BL Lac candidates that can be discovered by the current and next generation of imaging air Cherenkov telescopes. Methods: We formed five datasets from lower energy data, i.e. radio, mid-infrared, optical, X-rays, and GeV γ-ray, and five VHE γ-ray datasets to perform a correlation study between different bands and to construct the prediction method. The low energy datasets were averaged for individual sources, while the VHE γ-ray data were divided into subsets according to the flux state of the source. We then looked for significant correlations and determined their best-fit parameters. Using the best-fit parameters we predicted the level of VHE γ-ray flux for a sample of 182 BL Lacs, which have not been detected at TeV energies. We identified the most promising TeV BL Lac candidates based on the predicted VHE γ-ray flux for each source. Results: We found 14 significant correlations between radio, mid-infrared, optical, γ-ray, and VHE γ-ray bands. The correlation between optical and VHE γ-ray luminosity is established for the first time. We attribute this to the more complete sample and more accurate handling of host galaxy flux in our work. We found nine BL Lac candidates whose predicted VHE γ-ray flux is high enough for detection in less than 25 h with current imaging air Cherenkov telescopes. Full Tables A.1 and A.2 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/608/A68

Analysis of the spectrum of the (5d6+5d56s) -(5d56p+5d46s6p) transitions of two times ionized osmium (Os III)

NASA Astrophysics Data System (ADS)

Azarov, Vladimir I.; Tchang-Brillet, W.-Ü. Lydia; Gayasov, Robert R.

2018-05-01

The spectrum of osmium was observed in the (225-2100) Å wavelength region. The (5d6 + 5d56s) - (5d56p + 5d46s6p) transition array of two times ionized osmium, Os III, has been investigated and 1039 spectral lines have been classified in the region. The analysis has led to the determination of the 5d6, 5d56s, 5d56p and 5d46s6p configurations. Fifty-eight levels of the 5d6 and 5d56s configurations in the even system and 142 levels of the 5d56p and 5d46s6p configurations in the odd system have been established. The orthogonal operators technique was used to calculate the level structure and transition probabilities. The energy parameters have been determined by the least squares fit to the observed levels. Calculated transition probability and energy values, as well as LS-compositions obtained from the fitted parameters are presented.

A reduction in hippocampal GABAA receptor alpha5 subunits disrupts the memory for location of objects in mice.

PubMed

Prut, L; Prenosil, G; Willadt, S; Vogt, K; Fritschy, J-M; Crestani, F

2010-07-01

The memory for location of objects, which binds information about objects to discrete positions or spatial contexts of occurrence, is a form of episodic memory particularly sensitive to hippocampal damage. Its early decline is symptomatic for elderly dementia. Substances that selectively reduce alpha5-GABA(A) receptor function are currently developed as potential cognition enhancers for Alzheimer's syndrome and other dementia, consistent with genetic studies implicating these receptors that are highly expressed in hippocampus in learning performance. Here we explored the consequences of reduced GABA(A)alpha5-subunit contents, as occurring in alpha5(H105R) knock-in mice, on the memory for location of objects. This required the behavioral characterization of alpha5(H105R) and wild-type animals in various tasks examining learning and memory retrieval strategies for objects, locations, contexts and their combinations. In mutants, decreased amounts of alpha5-subunits and retained long-term potentiation in hippocampus were confirmed. They exhibited hyperactivity with conserved circadian rhythm in familiar actimeters, and normal exploration and emotional reactivity in novel places, allocentric spatial guidance, and motor pattern learning acquisition, inhibition and flexibility in T- and eight-arm mazes. Processing of object, position and context memories and object-guided response learning were spared. Genotype difference in object-in-place memory retrieval and in encoding and response learning strategies for object-location combinations manifested as a bias favoring object-based recognition and guidance strategies over spatial processing of objects in the mutants. These findings identify in alpha5(H105R) mice a behavioral-cognitive phenotype affecting basal locomotion and the memory for location of objects indicative of hippocampal dysfunction resulting from moderately decreased alpha5-subunit contents.

Compare Human-Made Objects with Natural Objects. Grades 3-5.

ERIC Educational Resources Information Center

Rushton, Erik; Ryan, Emily; Swift, Charles

In this activity, students experiment and observe the similarities and differences between human-made objects and nature in small groups. Students compare the function and structure of hollow bones with drinking straws, bird beaks and tool pliers, and bat wings and airplane wings. A classroom discussion can be held to discuss similarities and…

Attending to space within and between objects: Implications from a patient with Balint’s syndrome

PubMed Central

Robertson, Lynn C.; Treisman, Anne

2007-01-01

Neuropsychological conditions such as Balint’s syndrome have shown that perceptual organization of parts into a perceptual unit can be dissociated from the ability to localize objects relative to each other. Neural mechanisms that code the spatial structure within individual objects or words may seem to be intact, while between-object structure is compromised. Here we investigate the nature of within-object spatial processing in a patient with Balint’s syndrome (RM). We suggest that within-object spatial structure can be determined (a) directly by explicit spatial processing of between-part relations, mediated by the same dorsal pathway as between-object spatial relations; or (b) indirectly by the discrimination of object identities, which may involve implicit processing of between-part relations and which is probably mediated by the ventral system. When this route is ruled out, by testing discrimination of differences in part location that do not change the identity of the object, we find no evidence of explicit within-object spatial coding in a patient without functioning parietal lobes. PMID:21049339

Type IIB supergravity solution for the T-dual of the η-deformed AdS 5 × S 5 superstring

NASA Astrophysics Data System (ADS)

Hoare, B.; Tseytlin, A. A.

2015-10-01

We find an exact type IIB supergravity solution that represents a one-parameter deformation of the T-dual of the AdS 5 × S 5 background (with T-duality applied in all 6 abelian bosonic isometric directions). The non-trivial fields are the metric, dilaton and RR 5-form only. The latter has remarkably simple "undeformed" form when written in terms of a "deformation-rotated" vielbein basis. An unusual feature of this solution is that the dilaton contains a linear dependence on the isometric coordinates of the metric precluding a straightforward reversal of T-duality. If we still formally dualize back, we find exactly the metric, B-field and product of dilaton with RR field strengths as recently extracted from the η-deformed AdS 5 × S 5 superstring action in arXiv:1507.04239. We also discuss similar solutions for deformed AdS n × S n backgrounds with n = 2 , 3. In the η → i limit we demonstrate that all these backgrounds can be interpreted as special limits of gauged WZW models and are also related to (a limit of) the Pohlmeyer-reduced models of the AdS n × S n superstrings.

Cassandra retrotransposons carry independently transcribed 5S RNA

PubMed Central

Kalendar, Ruslan; Tanskanen, Jaakko; Chang, Wei; Antonius, Kristiina; Sela, Hanan; Peleg, Ofer; Schulman, Alan H.

2008-01-01

We report a group of TRIMs (terminal-repeat retrotransposons in miniature), which are small nonautonomous retrotransposons. These elements, named Cassandra, universally carry conserved 5S RNA sequences and associated RNA polymerase (pol) III promoters and terminators in their long terminal repeats (LTRs). They were found in all vascular plants investigated. Uniquely for LTR retrotransposons, Cassandra produces noncapped, polyadenylated transcripts from the 5S pol III promoter. Capped, read-through transcripts containing Cassandra sequences can also be detected in RNA and in EST databases. The predicted Cassandra RNA 5S secondary structures resemble those for cellular 5S rRNA, with high information content specifically in the pol III promoter region. Genic integration sites are common for Cassandra, an unusual feature for abundant retrotransposons. The 5S in each LTR produces a tandem 5S arrangement with an inter-5S spacing resembling that of cellular 5S. The distribution of 5S genes is very variable in flowering plants and may be partially explained by Cassandra activity. Cassandra thus appears both to have adapted a ubiquitous cellular gene for ribosomal RNA for use as a promoter and to parasitize an as-yet-unidentified group of retrotransposons for the proteins needed in its lifecycle. PMID:18408163

17 CFR 20.5 - Series S filings.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 17 Commodity and Securities Exchanges 1 2012-04-01 2012-04-01 false Series S filings. 20.5 Section... FOR PHYSICAL COMMODITY SWAPS § 20.5 Series S filings. (a) 102S filing. (1) When a counterparty... 102S filing only once for each counterparty, even if such persons at various times have multiple...

Nasa s near earth object program office

NASA Astrophysics Data System (ADS)

Yeomans, D.; Chamberlin, A.; Chesley, S.; Chodas, P.; Giorgini, J.; Keesey, M.

In 1998, NASA formed the Near-Earth Object Program Office at JPL to provide a focal point for NASA's efforts to discover and monitor the motions of asteroids and comets that can approach the Earth. This office was charged with 1.) facilitating communication between the near-Earth object (NEO) community and the public, 2.) helping coordinate the search efforts for NEOs, 3.) monitoring the progress in finding NEOs at NASA -supported sites, and 4.) monitoring the future motions of all known NEOs and cataloging their orbits. There are far more near-Earth asteroids (NEAs) than near-Earth comets and one of the driving motivations for NASA's NEO Program is the Spaceguard Goal to find 90% of the NEAs larger than one kilometer by 2008. While the total population of NEAs is not clearly established, the consensus opinion seems to be that the total population of NEAs larger than one kilometer is about 1000 (with a range of perhaps 800 - 1200). By April 2002, nearly 60% of the total population of large NEAs had been discovered and while the discovery rate will likely drop off as the easy ones are found, these early discovery efforts are encouraging. The five NASA-supported NEO discovery teams are the Lincoln Laboratory Near-Earth Asteroid Research effort (LINEAR, Grant Stokes, Principal Investigator), the Near-Earth Asteroid Tracking team at JPL (NEAT, Eleanor Helin, P.I.), the Lowell Observatory Near-Earth Object Search (LONEOS, E. Bowell, P.I.), and two discovery teams near Tucson Arizona - the Spacewatch effort (R. McMillan, P.I.) and the Catalina Sky Survey group (S. Larson, P.I.). Mention should also be made of the Japanese Spaceguard discovery site at Bisei Japan (S. Isobe, P.I.). A substantial portion of the critical follow-up observations necessary to secure the orbits of NEOs and provide information on their physical characteristics is provided by a group of very sophisticated amateur astronomers who might better be described as unfunded professionals. After nearly two

Genetic variation in parthenogenetic Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca, L. unisexualis) analyzed by DNA fingerprinting.

PubMed

Tokarskaya, O N; Kan, N G; Petrosyan, V G; Martirosyan, I A; Grechko, V V; Danielyan, F D; Darevsky, I S; Ryskov, A P

2001-07-01

Multilocus DNA fingerprinting has been used to study the variability of some mini- and microsatellite sequences in parthenogenetic species of Caucasian rock lizards of the genus Lacerta (L. dahli, L. armeniaca and L. unisexualis). We demonstrate that these clonally reproducing lizards possess species-specific DNA fingerprints with a low degree of intra- and interpopulation variation. Mean indices of similarity obtained using M13 DNA, (GACA)4 and (TCC)50 as probes were 0.962 and 0.966 in L. dahli and L. armeniaca, respectively. The mean index of similarity obtained using M 13 and GATA probes in L. unisexualis was estimated to be 0.95. However, despite the high degree of band-sharing, variable DNA fragments were revealed in all populations with the microsatellite probes. An particularly high level of variability was observed for (TCC)n microsatellites in populations of L. unisexualis. In fact TCC-derived DNA fingerprints were close to being individual-specific, with a mean index of similarity of 0.824. Fingerprint analysis of parthenogenetic families of L. armeniaca showed that all maternal fragments were inherited together by the progeny, and no differences in fingerprint patterns were observed. On the other hand, while identical DNA fingerprints were obtained from L. unisexualis families with M13 and (GATA)4 probes, use of the (TCC)50 probe revealed remarkable intrafamily variation in this species. It is assumed that the genetic heterogeneity observed in parthenogenetic populations may be explained, at least in part, by the existence of genetically unstable microsatellite loci. Our data serve to illustrate processes of spontaneous mutagenesis and the initial stages of clonal differentiation in natural populations of the lizard species studied.

12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

Multimodal sexual signals in male ocellated lizards Lacerta lepida: vitamin E in scent and green coloration may signal male quality in different sensory channels

NASA Astrophysics Data System (ADS)

Martín, José; López, Pilar

2010-06-01

The mechanisms that confer honesty to multiple sexual signals of vertebrates remain less known. We suggest that vitamin E in the scent (femoral secretions) and carotenoids in coloration of Lacerta lepida lizards might advertise quality because they are relevant in metabolism as major antioxidants and have a dietary origin. Results showed that there may be similar trade-offs between immunity and both chemical and visual signaling, as males with more vitamin E in secretions and those with more greenish, darker, and saturated carotenoid-dependent colorations had a higher immune response. This suggests that only high-quality males can divert from metabolism and allocate enough vitamin E to secretions and enough carotenoids to coloration. Therefore, information provided by visual and chemical signals is congruent. The use of multiple sensory channels may allow signaling a male quality under different circumstances or reinforce the reliability of the signal when both signals are perceived simultaneously. However, we also found that characteristics of carotenoid-dependent coloration mirror the amounts of vitamin E in secretions. This might support that carotenoids, which are not true antioxidants in the organism, would just reflect and “inform” on the actual contents of metabolic antioxidant vitamin E, which is part of the true system that prevent oxidation. We suggest that the metabolic roles of vitamins might be the actual basis of honesty of many sexual displays, and that carotenoid-based signals might be just the visible part of the whole system.

Doublet Pulse Coherent Laser Radar for Tracking of Resident Space Objects

DTIC Science & Technology

2014-09-01

based laser systems can be limited by the effects of tumbling, extremely accurate Doppler measurement is possible using a doublet coherent laser ...Doublet pulse coherent laser radar for tracking of resident space objects Narasimha S. Prasad *1 , Van Rudd 2 , Scott Shald 2 , Stephan...Doublet Pulse Coherent Laser Radar for Tracking of Resident Space Objects 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S

On the asymptotic states and the quantum S matrix of the η-deformed AdS 5 × S 5 superstring

DOE PAGES

Engelund, Oluf Tang; Roiban, Radu

2015-03-31

We investigate the worldsheet S matrix of string theory in η-deformed AdS 5 × S 5. By computing the six-point tree-level S matrix we explicitly show that there is no particle production at this level, as required by the classical integrability of the theory. At one and two loops we show that integrability requires that the classical two-particle states be redefined in a non-local and η-dependent way. This is a significant departure from the undeformed theory which is probably related to the quantum group symmetry of the worldsheet theory. We use generalized unitarity to carry out the loop calculations andmore » identify a set of integrals that allow us to give a two-loop Feynman integral representation of the logarithmic terms of the two-loop S matrix. We finally also discuss aspects of the calculation of the two-loop rational terms.« less

Young children’s ability to use 2-dimensional and 3-dimensional symbols to show placements of body touches and hidden objects

PubMed Central

Lytle, Nicole; London, Kamala; Bruck, Maggie

2015-01-01

In two experiments, we investigated 3- to 5-year-old children’s ability to use dolls and human figure drawings as symbols to map body touches. In Experiment 1 stickers were placed on different locations of children’s bodies, and they were asked to indicate the location of the sticker using three different symbols: a doll, a human figure drawing, and the adult researcher. Performance on the tasks increased with age, but many 5-year-olds did not attain perfect performance. Surprisingly, younger children made more errors on the 2D human figure drawing task compared to the 3D doll and adult tasks. In Experiment 2, we compared children’s ability to use 3D and 2D symbols to indicate body touch as well as to guide their search for a hidden object. We replicated the findings of Experiment 1 for the body touch task: for younger children, 3D symbols were easier to use than 2D symbols. However, the reverse pattern was found for the object locations task with children showing superior performance using 2D drawings over 3D models. Though children showed developmental improvements in using dolls and drawings to show where they were touched, less than two-thirds of the 5-year-olds performed perfectly on the touch tasks. Developmental as well as forensic implications of these results are discussed. PMID:25781003

V. M. BEKHTEREV IN RUSSIAN CHILD SCIENCE, 1900S-1920S: "OBJECTIVE PSYCHOLOGY"/"REFLEXOLOGY" AS A SCIENTIFIC MOVEMENT.

PubMed

Byford, Andy

2016-01-01

In the early 20(th) century the child population became a major focus of scientific, professional and public interest. This led to the crystallization of a dynamic field of child science, encompassing developmental and educational psychology, child psychiatry and special education, school hygiene and mental testing, juvenile criminology and the anthropology of childhood. This article discusses the role played in child science by the eminent Russian neurologist and psychiatrist Vladimir Mikhailovich Bekhterev. The latter's name is associated with a distinctive program for transforming the human sciences in general and psychology in particular that he in the 1900s labelled "objective psychology" and from the 1910s renamed "reflexology." The article examines the equivocal place that Bekhterev's "objective psychology" and "reflexology" occupied in Russian/Soviet child science in the first three decades of the 20(th) century. While Bekhterev's prominence in this field is beyond doubt, analysis shows that "objective psychology" and "reflexology" had much less success in mobilizing support within it than certain other movements in this arena (for example, "experimental pedagogy" in the pre-revolutionary era); it also found it difficult to compete with the variety of rival programs that arose within Soviet "pedology" during the 1920s. However, this article also demonstrates that the study of child development played a pivotal role in Bekhterev's program for the transformation of the human sciences: it was especially important to his efforts to ground in empirical phenomena and in concrete research practices a new ontology of the psychological, which, the article argues, underpinned "objective psychology"/"reflexology" as a transformative scientific movement. © 2016 The Authors. Journal of the History of the Behavioral Sciences Published by Wiley Periodicals, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Nicolas F.; Ibata, Rodrigo A.; Chambers, Kenneth C.

We present Keck II/DEIMOS spectroscopy of the three distant dwarf galaxies of M31 Lacerta I, Cassiopeia III, and Perseus I, recently discovered within the Pan-STARRS1 3π imaging survey. The systemic velocities of the three systems (v {sub r,} {sub helio} = –198.4 ± 1.1 km s{sup –1}, –371.6 ± 0.7 km s{sup –1}, and –326 ± 3 km s{sup –1}, respectively) confirm that they are satellites of M31. In the case of Lacerta I and Cassiopeia III, the high quality of the data obtained for 126 and 212 member stars, respectively, yields reliable constraints on their global velocity dispersions (σ{submore » vr} = 10.3 ± 0.9 km s{sup –1} and 8.4 ± 0.6 km s{sup –1}, respectively), leading to dynamical-mass estimates for both of ∼4 × 10{sup 7} M {sub ☉} within their half-light radius. These translate to V-band mass-to-light ratios of 15{sub −9}{sup +12} and 8{sub −5}{sup +9} in solar units. We also use our spectroscopic data to determine the average metallicity of the three dwarf galaxies ([Fe/H] = –2.0 ± 0.1, –1.7 ± 0.1, and –2.0 ± 0.2, respectively). All these properties are typical of dwarf galaxy satellites of Andromeda with their luminosity and size.« less

Object locating system

DOEpatents

Novak, J.L.; Petterson, B.

1998-06-09

A sensing system locates an object by sensing the object`s effect on electric fields. The object`s effect on the mutual capacitance of electrode pairs varies according to the distance between the object and the electrodes. A single electrode pair can sense the distance from the object to the electrodes. Multiple electrode pairs can more precisely locate the object in one or more dimensions. 12 figs.

Entanglement entropy of AdS5 × S5 with massless flavors at nonzero temperature

NASA Astrophysics Data System (ADS)

Hu, Sen; Wu, Guozhen

2018-03-01

We consider backreacted AdS5 × S5 coupled with Nf massless flavors introduced by D7-branes at nonzero temperature. The backreacted geometry is in the Veneziano limit. The temperature of this system is related to the event horizon at rh. Dividing one of the spatial directions into a line segment with length l, we will calculate the holographic entanglement entropy (HEE) between the two subspaces. We study the behavior near the event horizon, and finally find that there exists confinement/deconfinement phase transition phenomenon near the horizon since the difference between the entanglement entropy of the connected minimal surface and the disconnected one changes sign.

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

Joint Attention and Object Learning in 5- and 7-Month-Old Infants

ERIC Educational Resources Information Center

Cleveland, Allison; Schug, Mariah; Striano, Tricia

2007-01-01

We examined the effects of joint attention for object learning in 5- and 7-month-old infants. Infants interacted with an adult social partner who taught them about a novel toy in two conditions. In the "Joint Attention" condition, the adult spoke about the toy while alternating gaze between the infant and the toy, while in the…

Hydrolysis and coordination behavior of ferrocenyl-phosphonodithiolate: Synthesis and structure of Cu 4[FcP(OCH 3)( μ-S)( μ3-S)] 4 [Fc = Fe( η5-C 5H 4)( η5-C 5H 5)

NASA Astrophysics Data System (ADS)

Liu, Shu-Lei; Wang, Xi-Ying; Duan, Taike; Leung, Wa-Hung; Zhang, Qian-Feng

2010-02-01

Treatment of the dimeric [FcP(S)( μ-S)] 2 [Fc = Fe( η5-C 5H 4)( η5-C 5H 5)] with the organic base Et 3N in methylene chloride solution resulted in the isolation of a multi-component compound [Et 3NH] 2[(FcPO 2S) 2CH 2][FcPS(OH) 2] 2·CH 2Cl 2 ( 1·CH 2Cl 2). The formation of the [(FcPO 2S) 2CH 2] 2- anion was due to the dechlorination of methylene chloride, it consists of two [FcPO 2S] 2- units bridging by a methylene group. Reaction of Na[FcP(OCH 3)S 2] with equal equivalent of [Cu(MeCN) 4][ClO 4] in methanol afforded a sole tetranuclear copper(I) complex Cu 4[FcP(OCH 3)( μ-S)( μ3-S)] 4 ( 2). The neutral complex 2 consists of a crystallographically centrosymmetric tetramer containing four CuS 3 arrays each of which has one μ-sulfur and two μ3-sulfur bridges.

Identification and electrophysiological studies of (4 S,5 S)-5-hydroxy-4-methyl-3-heptanone and 4-methyl-3,5-heptanedione in male lucerne weevils

NASA Astrophysics Data System (ADS)

Unelius, C. R.; Park, K.-C.; McNeill, M.; Wee, S. L.; Bohman, B.; Suckling, D. M.

2013-02-01

An investigation to identify a sex or aggregation pheromone of Sitona discoideus Gyllenhål (Coleoptera: Curculionidae) is presented. Antenna flicking and attraction behaviors evoked by conspecifics of both sexes were recorded in arena bioassays, where attraction of females to males was observed. Air entrainment of both males and females was conducted in separate chambers. Gas chromatographic-mass spectrometric analysis of headspace volatiles revealed that two male-specific compounds, 4-methyl-3,5-heptanedione (major) and (4 S,5 S)-5-hydroxy-4-methyl-3-heptanone (minor), were emitted during the autumnal post-aestivatory flight period. The stereoisomers of the minor component were separated by enantioselective gas chromatography and their absolute configurations assigned by NMR (diastereomers) and the known preference of enantioselective transesterification reactions catalyzed by Candida antarctica lipase B. Electroantennogram and single sensillum recording studies indicate that 4-methyl-3,5-heptanedione as well as all individual stereoisomers of 5-hydroxy-4-methyl-3-heptanone are detected by the antennae of male and female S. discoideus. Further, single sensillum recordings suggest that both sexes of S. discoideus have specialized olfactory receptor neurons (ORNs) for detecting 4-methyl-3,5-heptanedione and different populations of stereoselective ORNs for detecting the stereoisomers of 5-hydroxy-4-methyl-3-heptanone. Some of these stereoselective ORNs appear to be sex-specific in S. discoideus.

Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

NASA Astrophysics Data System (ADS)

Yu, Wen; Fang, Pengfei; Wang, Shaojie

2014-12-01

Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

SHIPMO5: An Updated User’s Manual Incorporating New Wave Spectra and Ship-Referenced Forces

DTIC Science & Technology

1992-04-01

equipment sliding, or of personnel loss-of- balance events, termed motion-induced interruptions. First consider an object on deck and suppose that the object...lateral force estimator in Reference 5. In the present work , this quantity will be called the port sliding estimator function, and denoted by Sport...0.170 , TIME FOR OPERATION " 60.0 a HEADING *$.LATE.LL*$$ **LONGITUDIILL*s TOTAL LFE NIl LFE Nil NI DEG G G 0.0 0.000 0.000 0.001 0.000 0.000 30.0 0.061

Navy’s Advanced Aircraft Armament System Program Concept Objectives

DTIC Science & Technology

1983-10-01

12-1 00 NAVY’S ADVANCED AIRCRAFT ARMAMENT SYSTEM PROGRAM CONCEPT OBJECTIVES T. M . Leese and J. F. Haney Naval Weapons Center Code 31403 China...STORE FLWNT LIFE RECONFIOURATION ♦ UWMST OMHTH ninoairv M — MANN HUCTHM ^♦■ SILECT ALTERNATE • STORE 0PTI0M ■ REOUCIO CK« W0RKL0A0 • . README...mOVEMENTS INÜTEO FUIWUTY MM AM tTATWM COMPLEX AUTOMATIC LACK OF OIT RESTRICTIVE MLNIRV M FLUWAITV IUCSMVI Figure 1. Carrier aircraft

S5 0716+714: GeV variability study

DOE PAGES

Rani, B.; Krichbaum, T. P.; Lott, B.; ...

2013-02-19

The GeV observations by Fermi-LAT give us the opportunity to characterize the high-energy emission (100 MeV–300 GeV) variability properties of the BL Lac object S5 0716+714. In this study, we performed flux and spectral analysis of more than 3 year long (August 2008 to April 2012) Fermi-LAT data of the source. During this period, the source exhibits two different modes of flux variability with characteristic timescales of ~75 and ~140 days, respectively. In addition, we also notice that the flux variations are characterized by a weak spectral hardening. The GeV spectrum of the source shows a clear deviation from amore » simple power law, and is better explained by a broken power law. Similar to other bright Fermi blazars, the break energy does not vary with the source flux during the different activity states. Finally, we discuss several possible scenarios to explain the observed spectral break.« less

S5 0716+714: GeV variability study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rani, B.; Krichbaum, T. P.; Lott, B.

The GeV observations by Fermi-LAT give us the opportunity to characterize the high-energy emission (100 MeV–300 GeV) variability properties of the BL Lac object S5 0716+714. In this study, we performed flux and spectral analysis of more than 3 year long (August 2008 to April 2012) Fermi-LAT data of the source. During this period, the source exhibits two different modes of flux variability with characteristic timescales of ~75 and ~140 days, respectively. In addition, we also notice that the flux variations are characterized by a weak spectral hardening. The GeV spectrum of the source shows a clear deviation from amore » simple power law, and is better explained by a broken power law. Similar to other bright Fermi blazars, the break energy does not vary with the source flux during the different activity states. Finally, we discuss several possible scenarios to explain the observed spectral break.« less

Increased 5S rRNA oxidation in Alzheimer's disease.

PubMed

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

Babinet’s principle for scalar complex objects in the far field

NASA Astrophysics Data System (ADS)

Rodriguez-Zurita, G.; Rickenstorff, C.; Pastrana-Sánchez, R.; Vázquez-Castillo, J. F.; Robledo-Sanchez, C.; Meneses-Fabian, C.; Toto-Arellano, N. I.

2014-10-01

Babinet’s principle is briefly reviewed, especially regarding the zeroth diffraction order of the far field diffraction pattern associated with a given aperture. The pattern is basically described by the squared modulus of the Fourier transform of its amplitude distribution (scalar case). In this paper, complementary objects are defined with respect to complex values and not only with respect to unity in order to include phase objects and phase modulation. It is shown that the difference in complementary patterns can be sometimes a bright spot at the zero order location as is widely known, but also, it can be a gray spot or even a dark one. Conditions of occurrence for each case are given as well as some numerical and experimental examples.

Making safety an integral part of 5S in healthcare.

PubMed

Ikuma, Laura H; Nahmens, Isabelina

2014-01-01

Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

5-HT2a receptor in mPFC influences context-guided reconsolidation of object memory in perirhinal cortex.

PubMed

Morici, Juan Facundo; Miranda, Magdalena; Gallo, Francisco Tomás; Zanoni, Belén; Bekinschtein, Pedro; Weisstaub, Noelia V

2018-05-02

Context-dependent memories may guide adaptive behavior relaying in previous experience while updating stored information through reconsolidation. Retrieval can be triggered by partial and shared cues. When the cue is presented, the most relevant memory should be updated. In a contextual version of the object recognition task, we examined the effect of medial PFC (mPFC) serotonin 2a receptor (5-HT2aR) blockade during retrieval in reconsolidation of competing objects memories. We found that mPFC 5-HT2aR controls retrieval and reconsolidation of object memories in the perirhinal cortex (PRH), but not in the dorsal hippocampus in rats. Also, reconsolidation of objects memories in PRH required a functional interaction between the ventral hippocampus and the mPFC. Our results indicate that in the presence of conflicting information at retrieval, mPFC 5-HT2aR may facilitate top-down context-guided control over PRH to control the behavioral response and object memory reconsolidation. © 2018, Morici et al.

5-HT2a receptor in mPFC influences context-guided reconsolidation of object memory in perirhinal cortex

PubMed Central

Morici, Juan Facundo; Miranda, Magdalena; Gallo, Francisco Tomás; Zanoni, Belén; Bekinschtein, Pedro

2018-01-01

Context-dependent memories may guide adaptive behavior relaying in previous experience while updating stored information through reconsolidation. Retrieval can be triggered by partial and shared cues. When the cue is presented, the most relevant memory should be updated. In a contextual version of the object recognition task, we examined the effect of medial PFC (mPFC) serotonin 2a receptor (5-HT2aR) blockade during retrieval in reconsolidation of competing objects memories. We found that mPFC 5-HT2aR controls retrieval and reconsolidation of object memories in the perirhinal cortex (PRH), but not in the dorsal hippocampus in rats. Also, reconsolidation of objects memories in PRH required a functional interaction between the ventral hippocampus and the mPFC. Our results indicate that in the presence of conflicting information at retrieval, mPFC 5-HT2aR may facilitate top-down context-guided control over PRH to control the behavioral response and object memory reconsolidation. PMID:29717980

Fuzzy Multi-Objective Transportation Planning with Modified S-Curve Membership Function

NASA Astrophysics Data System (ADS)

Peidro, D.; Vasant, P.

2009-08-01

In this paper, the S-Curve membership function methodology is used in a transportation planning decision (TPD) problem. An interactive method for solving multi-objective TPD problems with fuzzy goals, available supply and forecast demand is developed. The proposed method attempts simultaneously to minimize the total production and transportation costs and the total delivery time with reference to budget constraints and available supply, machine capacities at each source, as well as forecast demand and warehouse space constraints at each destination. We compare in an industrial case the performance of S-curve membership functions, representing uncertainty goals and constraints in TPD problems, with linear membership functions.

Role of the S4-S5 linker in CNG channel activation.

PubMed

Kusch, Jana; Zimmer, Thomas; Holschuh, Jascha; Biskup, Christoph; Schulz, Eckhard; Nache, Vasilica; Benndorf, Klaus

2010-10-20

Cyclic nucleotide-gated (CNG) channels mediate sensory signal transduction in retinal and olfactory cells. The channels are activated by the binding of cyclic nucleotides to a cyclic nucleotide-binding domain (CNBD) in the C-terminus that is located at the intracellular side. The molecular events translating the ligand binding to the pore opening are still unknown. We investigated the role of the S4-S5 linker in the activation process by quantifying its interaction with other intracellular regions. To this end, we constructed chimeric channels in which the N-terminus, the S4-S5 linker, the C-linker, and the CNBD of the retinal CNGA1 subunit were systematically replaced by the respective regions of the olfactory CNGA2 subunit. Macroscopic concentration-response relations were analyzed, yielding the apparent affinity to cGMP and the Hill coefficient. The degree of functional coupling of intracellular regions in the activation gating was determined by thermodynamic double-mutant cycle analysis. We observed that all four intracellular regions, including the relatively short S4-S5 linker, are involved in controlling the apparent affinity of the channel to cGMP and, moreover, in determining the degree of cooperativity between the subunits, as derived from the Hill coefficient. The interaction energies reveal an interaction of the S4-S5 linker with both the N-terminus and the C-linker, but no interaction with the CNBD. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The 5S RNA gene minichromosome of Euplotes.

PubMed Central

Roberson, A E; Wolffe, A P; Hauser, L J; Olins, D E

1989-01-01

The macronucleus of the ciliated protozoan Euplotes eurystomus contains about 10(6) copies of a single type of 5S ribosomal RNA gene. This 5S gene DNA is only 930 bp long, is flanked by telomeres, and contains a single coding region of 120 bp which serves as a template for transcription in vivo and in vitro. The 5S gene minichromatin possesses four positioned nucleosomes and hypersensitive cleavage sites in the telomeric regions. Images PMID:2501759

Conversation and Object Manipulation Influence Children's Learning in a Museum

ERIC Educational Resources Information Center

Jant, Erin A.; Haden, Catherine A.; Uttal, David H.; Babcock, Elizabeth

2014-01-01

The effects of parent-child conversation and object manipulation on children's learning, transfer of knowledge, and memory were examined in two museum exhibits and conversations recorded at home. Seventy-eight children (M[subscript age] = 4.9) and their parents were randomly assigned to receive conversation cards featuring elaborative…

High resolution emission Fourier transform infrared spectra of the 4p-5s and 5p-6s bands of ArH.

PubMed

Baskakov, O I; Civis, S; Kawaguchi, K

2005-03-15

In the 2500-8500 cm(-1) region several strong emission bands of (40)ArH were observed by Fourier transform spectroscopy through a dc glow discharge in a mixture of argon and hydrogen. Rotational-electronic transitions of the two previously unstudied 4p-5s and 5p-6s,v = 0-0, bands of (40)ArH were measured and assigned in the 6060 and 3770 cm(-1) regions, respectively. A simultaneous fit of the emission transitions of the 4p-5s and 5p-6s bands and an extended set of transitions of the 6s-4p band observed by Dabrowski, Tokaryk, and Watson [J. Mol. Spectrosc. 189, 95 (1998)] and remeasured in the present work yielded consistent values of the spectroscopic parameters of the electronic states under investigation. In the branch of the 4p-5s band with transitions of type (Q)Q(f(3)e) we observed a narrowing in the linewidths with increasing rotational quantum number N. The rotational dependence of the linewidth is caused by predissociation of the 5s state by the repulsive ground 4s state through homogeneous coupling and changes in overlap integrals of the vibrational wave functions with the rotational level. Analysis was based on the Fermi's golden rule approximation model. In the 4p-5s band region a vibrational sequence ofv(')-v(")=1-1, 2-2, and 3-3 were recorded and a number of transitions belonging to the strongest (Q)Q(f(3)e) form branch of the 1-1 band were analyzed.

Combining TerraSAR-X and SPOT-5 data for object-based landslide detection

NASA Astrophysics Data System (ADS)

Friedl, B.; Hölbling, D.; Füreder, P.

2012-04-01

Landslide detection and classification is an essential requirement in pre- and post-disaster hazard analysis. In earlier studies landslide detection often was achieved through time-consuming and cost-intensive field surveys and visual orthophoto interpretation. Recent studies show that Earth Observation (EO) data offer new opportunities for fast, reliable and accurate landslide detection and classification, which may conduce to an effective landslide monitoring and landslide hazard management. To ensure the fast recognition and classification of landslides at a regional scale, a (semi-)automated object-based landslide detection approach is established for a study site situated in the Huaguoshan catchment, Southern Taiwan. The study site exhibits a high vulnerability to landslides and debris flows, which are predominantly typhoon-induced. Through the integration of optical satellite data (SPOT-5 with 2.5 m GSD), SAR (Synthetic Aperture Radar) data (TerraSAR-X Spotlight with 2.95 m GSD) and digital elevation information (DEM with 5 m GSD) including its derived products (e.g. slope, curvature, flow accumulation) landslides may be examined in a more efficient way as if relying on single data sources only. The combination of optical and SAR data in an object-based image analysis (OBIA) domain for landslide detection and classification has not been investigated so far, even if SAR imagery show valuable properties for landslide detection, which differ from optical data (e.g. high sensitivity to surface roughness and soil moisture). The main purpose of this study is to recognize and analyze existing landslides by applying object-based image analysis making use of eCognition software. OBIA provides a framework for examining features defined by spectral, spatial, textural, contextual as well as hierarchical properties. Objects are derived through image segmentation and serve as input for the classification process, which relies on transparent rulesets, representing knowledge

Transforming clinical imaging and 3D data for virtual reality learning objects: HTML5 and mobile devices implementation.

PubMed

Trelease, Robert B; Nieder, Gary L

2013-01-01

Web deployable anatomical simulations or "virtual reality learning objects" can easily be produced with QuickTime VR software, but their use for online and mobile learning is being limited by the declining support for web browser plug-ins for personal computers and unavailability on popular mobile devices like Apple iPad and Android tablets. This article describes complementary methods for creating comparable, multiplatform VR learning objects in the new HTML5 standard format, circumventing platform-specific limitations imposed by the QuickTime VR multimedia file format. Multiple types or "dimensions" of anatomical information can be embedded in such learning objects, supporting different kinds of online learning applications, including interactive atlases, examination questions, and complex, multi-structure presentations. Such HTML5 VR learning objects are usable on new mobile devices that do not support QuickTime VR, as well as on personal computers. Furthermore, HTML5 VR learning objects can be embedded in "ebook" document files, supporting the development of new types of electronic textbooks on mobile devices that are increasingly popular and self-adopted for mobile learning. © 2012 American Association of Anatomists.

Implementation of 5S Method for Ergonomic Laboratory

NASA Astrophysics Data System (ADS)

Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

2017-06-01

This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

Discovery of soft X-ray flux from 2A 1102+384 = Markarian 421

NASA Technical Reports Server (NTRS)

Hearn, D. R.; Marshall, F. J.; Jernigan, J. G.

1979-01-01

During April 1976 a soft X-ray flux was detected with SAS 3 from the vicinity of 2A 1102+384. The average flux densities were 4.3 x 10 to the -11th and 14 x 10 to the -11th erg/sq cm per sec in the energy bands 0.1-0.28 keV and 1-6 keV, respectively. There is an indication of variability over about 0.5 day in the lowest energy band. An upper limit of 3 x 10 to the 20th H atoms per sq cm is found for the gas column density to the X-ray source. In May 1978, observations with the modulation collimators of SAS 3 yielded an accurate (40 arcsec error radius) position for the X-ray source (2-6 keV) at right ascension 11 h 1 m 39.7 s, declination + 38 deg 28 min 51 sec (equinox 1950). The earlier tentative identification by Ricketts et al. (1976) with the BL Lacertae object B2 1101+38 = Markarian 421 is thus confirmed.

The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

PubMed

Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

2017-10-27

The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

SIMP J013656.5+093347 Is Likely a Planetary-mass Object in the Carina-Near Moving Group

NASA Astrophysics Data System (ADS)

Gagné, Jonathan; Faherty, Jacqueline K.; Burgasser, Adam J.; Artigau, Étienne; Bouchard, Sandie; Albert, Loïc; Lafrenière, David; Doyon, René; Bardalez Gagliuffi, Daniella C.

2017-05-01

We report on the discovery that the nearby (˜6 pc) photometrically variable T2.5 dwarf SIMP J013656.5+093347 is a likely member of the ˜200 Myr old Carina-Near moving group with a probability of >99.9% based on its full kinematics. Our v\\sin I measurement of 50.9 ± 0.8 km s-1 combined with the known rotation period inferred from variability measurements provide a lower limit of 1.01 ± 0.02 {R}{Jup} on the radius of SIMP 0136+0933, an independent verification that it must be younger than ˜950 Myr, according to evolution models. We estimate a field interloper probability of 0.2% based on the density of field T0-T5 dwarfs. At the age of Carina-Near, SIMP 0136+0933 has an estimated mass of 12.7 ± 1.0 {M}{Jup} and is predicted to have burned roughly half of its original deuterium. SIMP 0136+0933 is the closest known young moving group member to the Sun and is one of only a few known young T dwarfs, making it an important benchmark for understanding the atmospheres of young planetary-mass objects.

Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

NASA Astrophysics Data System (ADS)

Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

2017-04-01

Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]- 5-[(methanesulfonyloxy)methyl]-2- pyrrolidinone.

PubMed

Yee, Nathan K; Dong, Yong; Kapadia, Suresh R; Song, Jinhua J

2002-11-29

A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]-5-[(methanesulfonyloxy)methyl]-2-pyrrolidinone (1) is described. The key transformations involve a highly efficient reaction sequence consisting of ethoxycarbonylation, alkylation, hydrolysis, and decarboxylation to produce compound 10. The process described herein is practical, robust, and cost-effective, and it has been successfully implemented in a pilot plant to produce a multikilogram quantity of mesylate 1.

Fuzzy Multi-Objective Vendor Selection Problem with Modified S-CURVE Membership Function

NASA Astrophysics Data System (ADS)

Díaz-Madroñero, Manuel; Peidro, David; Vasant, Pandian

2010-06-01

In this paper, the S-Curve membership function methodology is used in a vendor selection (VS) problem. An interactive method for solving multi-objective VS problems with fuzzy goals is developed. The proposed method attempts simultaneously to minimize the total order costs, the number of rejected items and the number of late delivered items with reference to several constraints such as meeting buyers' demand, vendors' capacity, vendors' quota flexibility, vendors' allocated budget, etc. We compare in an industrial case the performance of S-curve membership functions, representing uncertainty goals and constraints in VS problems, with linear membership functions.

The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management

PubMed Central

Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

2017-01-01

Abstract Background and Aims The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012–2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. Methods During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. Results The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Conclusions Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. PMID:28981622

Optical Spectroscopy of SDSS J004054.65-0915268: Three Possible Scenarios for the Classification. A z ˜ 5 BL Lacertae, a Blue FSRQ, or a Weak Emission Line Quasar

NASA Astrophysics Data System (ADS)

Landoni, M.; Zanutta, A.; Bianco, A.; Tavecchio, F.; Bonnoli, G.; Ghisellini, G.

2016-02-01

The haunt of high-redshift BL Lacerate objects is day by day more compelling to firmly understand their intrinsic nature and evolution. SDSS J004054.65-0915268 is, at the moment, one of the most distant BL Lac candidates, at z ˜ 5. We present a new optical-near-IR spectrum obtained with ALFOSC-NOT with a new, custom designed dispersive grating aimed to detect broad emission lines that could disprove this classification. In the obtained spectra, we do not detect any emission features and we provide an upper limit to the luminosity of the C IV broad emission line. Therefore, the nature of the object is then discussed, building the overall spectral energy distribution (SED) and fitting it with three different models. Our fits, based on SED modeling with different possible scenarios, cannot rule out the possibility that this source is indeed a BL Lac object, though the absence of optical variability and the lack of strong radio flux seem to suggest that the observed optical emission originates from a thermalized accretion disk.

Neuropeptide S enhances memory and mitigates memory impairment induced by MK801, scopolamine or Aβ₁₋₄₂ in mice novel object and object location recognition tasks.

PubMed

Han, Ren-Wen; Zhang, Rui-San; Xu, Hong-Jiao; Chang, Min; Peng, Ya-Li; Wang, Rui

2013-07-01

Neuropeptide S (NPS), the endogenous ligand of NPSR, has been shown to promote arousal and anxiolytic-like effects. According to the predominant distribution of NPSR in brain tissues associated with learning and memory, NPS has been reported to modulate cognitive function in rodents. Here, we investigated the role of NPS in memory formation, and determined whether NPS could mitigate memory impairment induced by selective N-methyl-D-aspartate receptor antagonist MK801, muscarinic cholinergic receptor antagonist scopolamine or Aβ₁₋₄₂ in mice, using novel object and object location recognition tasks. Intracerebroventricular (i.c.v.) injection of 1 nmol NPS 5 min after training not only facilitated object recognition memory formation, but also prolonged memory retention in both tasks. The improvement of object recognition memory induced by NPS could be blocked by the selective NPSR antagonist SHA 68, indicating pharmacological specificity. Then, we found that i.c.v. injection of NPS reversed memory disruption induced by MK801, scopolamine or Aβ₁₋₄₂ in both tasks. In summary, our results indicate that NPS facilitates memory formation and prolongs the retention of memory through activation of the NPSR, and mitigates amnesia induced by blockage of glutamatergic or cholinergic system or by Aβ₁₋₄₂, suggesting that NPS/NPSR system may be a new target for enhancing memory and treating amnesia. Copyright © 2013 Elsevier Ltd. All rights reserved.

Associations of ozone and PM2.5 concentrations with Parkinson’s disease among participants in the Agricultural Health Study

EPA Science Inventory

Background: Evidence from experimental studies suggests that exposure to air pollution may be associated with risk of Parkinson’s disease (PD). Objective: To evaluate associations of ambient ozone and fine particulate matter (PM2.5 – particulate matter with an aerodynamic diam...

76 FR 45646 - Culturally Significant Objects Imported for Exhibition Determinations: “5,000 Years of Chinese...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-29

... DEPARTMENT OF STATE [Public Notice: 7540] Culturally Significant Objects Imported for Exhibition Determinations: ``5,000 Years of Chinese Jade Featuring Selections From the National Museum of Taiwan and the... ``5,000 Years of Chinese Jade Featuring Selections from the National Museum of Taiwan and the Arthur M...

Modeling the Radar Signature of Thin Metallic Objects with the AFDTD Software

DTIC Science & Technology

2014-09-01

CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Jason Cornelius and Traian Dogaru 5d. PROJECT NUMBER ...17. LIMITATION OF ABSTRACT UU 18. NUMBER OF PAGES 28 19a. NAME OF RESPONSIBLE PERSON Traian Dogaru A... number of geometric objects, which are part of the AFDTDGRID library.3 These objects are rectangular plate, rectangular box, polygonal

Selected highlights from the Extreme Ultraviolet Explorer

NASA Technical Reports Server (NTRS)

Bowyer, S.; Malina, R. F.

1995-01-01

We present a few scientific highlights from the Extreme Ultraviolet Explorer (EUVE) all-sky and deep surveys, from the EUVE Righ Angle Program, and from the EUVE Guest Observer Program. The First EUVE Source Catalog includes 410 extreme ultraviolet (EUV) sources detected in the initial processing of the EUVE all-sky data. A program of optical identification indicates that counterparts include cool star coronae, flare stars, hot white dwarfs, central stars of planetary nebulae, B star photospheres and winds, an X-ray binary, extragalactic objects (active galactic nuclei, BL Lacertae), solar system objects (Moon, Mars, Io,), supernova remnants, and two novae.

Extreme X-ray Behaviour of Mrk 421

NASA Astrophysics Data System (ADS)

Kapanadze, Bidzina

2013-03-01

In ATel #4864 (B. Kapanadze, M4k 421 Still Active through X-rays), we reported the flaring activity in the high-energy peaked BL Lacertae source Mrk 421 (z=0.031) detected via the observations performed during March 1-5, 2013, by the X-ray Telescope (XRT) onboard the Swift satellite. The recent observations, performed by this telescope, show increasing X-ray activity of this source. The data, allocated at the webpage http://www.swift.psu.edu/monitoring/ , show that the source was extremely active on hours timescale during the March 17 pointing: the 0.3-10 keV flux dropped from 16.83+0.17 cts/s (Orbit 1) to 12.46+0.24 cts/s (Orbit 5) in about 4.2 hr; it increased then to 24.60+0.14 cts/s for next orbit (in 1.45 hr) and afterwards drooped again to 16.01+0.15 cts/s in the case of next orbit (in 1.7 hr).

Synthesis of ( 2S, 4S)-4-phenylamino-5-oxoproline derivatives.

PubMed

Nizova, I A; Krasnov, V P; Levit, G L; Kodess, M I

2002-01-01

The paper describes the synthesis of ( 2S, 4S)-4-(N-Ts)- and ( 2S, 4S)-4-(N-Boc)-phenylamino-5-oxoprolines (pyroglutamic acid). These derivatives have been shown to be useful for synthesis of their amides and peptides in spite of steric hindrances caused by bulky groups adjacent to the reaction centre. Under the conditions applied no lactam ring opening and no loss of stereochemical integrity of any of the chiral centres were observed, which has been confirmed by NMR techniques.

Object-based benefits without object-based representations.

PubMed

Fougnie, Daryl; Cormiea, Sarah M; Alvarez, George A

2013-08-01

Influential theories of visual working memory have proposed that the basic units of memory are integrated object representations. Key support for this proposal is provided by the same object benefit: It is easier to remember multiple features of a single object than the same set of features distributed across multiple objects. Here, we replicate the object benefit but demonstrate that features are not stored as single, integrated representations. Specifically, participants could remember 10 features better when arranged in 5 objects compared to 10 objects, yet memory for one object feature was largely independent of memory for the other object feature. These results rule out the possibility that integrated representations drive the object benefit and require a revision of the concept of object-based memory representations. We propose that working memory is object-based in regard to the factors that enhance performance but feature based in regard to the level of representational failure. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Eukaryotic 5S rRNA biogenesis

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

NASA Technical Reports Server (NTRS)

Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

1982-01-01

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

Object Toolkit Version 4.3 User’s Manual

DTIC Science & Technology

2016-12-31

unlimited. (OPS-17-12855 dtd 19 Jan 2017) 13. SUPPLEMENTARY NOTES 14. ABSTRACT Object Toolkit is a finite - element model builder specifically designed for...INTRODUCTION 1 What Is Object Toolkit? Object Toolkit is a finite - element model builder specifically designed for creating representations of spacecraft...Nascap-2k and EPIC, the user is not required to purchase or learn expensive finite element generators to create system models. Second, Object Toolkit

[Structural organization of 5S ribosomal DNA of Rosa rugosa].

PubMed

Tynkevych, Iu O; Volkov, R A

2014-01-01

In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

Fixed-focus camera objective for small remote sensing satellites

NASA Astrophysics Data System (ADS)

Topaz, Jeremy M.; Braun, Ofer; Freiman, Dov

1993-09-01

An athermalized objective has been designed for a compact, lightweight push-broom camera which is under development at El-Op Ltd. for use in small remote-sensing satellites. The high performance objective has a fixed focus setting, but maintains focus passively over the full range of temperatures encountered in small satellites. The lens is an F/5.0, 320 mm focal length Tessar type, operating over the range 0.5 - 0.9 micrometers . It has a 16 degree(s) field of view and accommodates various state-of-the-art silicon detector arrays. The design and performance of the objective is described in this paper.

Children’s level of word knowledge predicts their exclusion of familiar objects as referents of novel words

PubMed Central

Grassmann, Susanne; Schulze, Cornelia; Tomasello, Michael

2015-01-01

When children are learning a novel object label, they tend to exclude as possible referents familiar objects for which they already have a name. In the current study, we wanted to know if children would behave in this same way regardless of how well they knew the name of potential referent objects, specifically, whether they could only comprehend it or they could both comprehend and produce it. Sixty-six monolingual German-speaking 2-, 3-, and 4-year-old children participated in two experimental sessions. In one session the familiar objects were chosen such that their labels were in the children’s productive vocabularies, and in the other session the familiar objects were chosen such that their labels were only in the children’s receptive vocabularies. Results indicated that children at all three ages were more likely to exclude a familiar object as the potential referent of the novel word if they could comprehend and produce its name rather than comprehend its name only. Indeed, level of word knowledge as operationalized in this way was a better predictor than was age. These results are discussed in the context of current theories of word learning by exclusion. PMID:26322005

S5H/DMR6 Encodes a Salicylic Acid 5-Hydroxylase That Fine-Tunes Salicylic Acid Homeostasis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanjun; Zhao, Li; Zhao, Jiangzhe

The phytohormone salicylic acid (SA) plays essential roles in biotic and abiotic responses, plant development, and leaf senescence. 2,5-Dihydroxybenzoic acid (2,5-DHBA or gentisic acid) is one of the most commonly occurring aromatic acids in green plants and is assumed to be generated from SA, but the enzymes involved in its production remain obscure. DMR6 (Downy Mildew Resistant 6, At5g24530) has been proven essential in plant immunity of Arabidopsis, but its biochemical properties are not well understood. Here in this paper, we report the discovery and functional characterization of DMR6 as a SA 5-hydroxylase (S5H) that catalyzes the formation of 2,5-DHBAmore » by hydroxylating SA at the C5 position of its phenyl ring in Arabidopsis. S5H/DMR6 specifically converts SA to 2,5-DHBA in vitro and displays higher catalytic efficiency (K cat/K m=4.96×10 4 M -1s -1) than the previously reported SA 3-hydroxylase (S3H, K cat/K m=6.09 × 10 3 M -1s -1) for SA. Interestingly, S5H/DMR6 displays a substrate inhibition property that may enable automatic control of its enzyme activities. The s5h mutant and s5hs3h double mutant over accumulate SA and display phenotypes such as a smaller growth size, early senescence and a loss of susceptibility to Pseudomonas syringae pv. tomato DC3000 (Pst DC3000). S5H/DMR6 is sensitively induced by SA/pathogen treatment and is widely expressed from young seedlings to senescing plants, whereas S3H is more specifically expressed at the mature and senescing stages. Collectively, our results disclose the identity of the enzyme required for 2,5-DHBA formation and reveal a mechanism by which plants fine-tune SA homeostasis by mediating SA 5-hydroxylation.« less

S5H/DMR6 Encodes a Salicylic Acid 5-Hydroxylase That Fine-Tunes Salicylic Acid Homeostasis

DOE PAGES

Zhang, Yanjun; Zhao, Li; Zhao, Jiangzhe; ...

2017-09-12

The phytohormone salicylic acid (SA) plays essential roles in biotic and abiotic responses, plant development, and leaf senescence. 2,5-Dihydroxybenzoic acid (2,5-DHBA or gentisic acid) is one of the most commonly occurring aromatic acids in green plants and is assumed to be generated from SA, but the enzymes involved in its production remain obscure. DMR6 (Downy Mildew Resistant 6, At5g24530) has been proven essential in plant immunity of Arabidopsis, but its biochemical properties are not well understood. Here in this paper, we report the discovery and functional characterization of DMR6 as a SA 5-hydroxylase (S5H) that catalyzes the formation of 2,5-DHBAmore » by hydroxylating SA at the C5 position of its phenyl ring in Arabidopsis. S5H/DMR6 specifically converts SA to 2,5-DHBA in vitro and displays higher catalytic efficiency (K cat/K m=4.96×10 4 M -1s -1) than the previously reported SA 3-hydroxylase (S3H, K cat/K m=6.09 × 10 3 M -1s -1) for SA. Interestingly, S5H/DMR6 displays a substrate inhibition property that may enable automatic control of its enzyme activities. The s5h mutant and s5hs3h double mutant over accumulate SA and display phenotypes such as a smaller growth size, early senescence and a loss of susceptibility to Pseudomonas syringae pv. tomato DC3000 (Pst DC3000). S5H/DMR6 is sensitively induced by SA/pathogen treatment and is widely expressed from young seedlings to senescing plants, whereas S3H is more specifically expressed at the mature and senescing stages. Collectively, our results disclose the identity of the enzyme required for 2,5-DHBA formation and reveal a mechanism by which plants fine-tune SA homeostasis by mediating SA 5-hydroxylation.« less

The 5HT(1A) receptor ligand, S15535, antagonises G-protein activation: a [35S]GTPgammaS and [3H]S15535 autoradiography study.

PubMed

Newman-Tancredi, A; Rivet, J; Chaput, C; Touzard, M; Verrièle, L; Millan, M J

1999-11-19

4-(Benzodioxan-5-yl)1-(indan-2-yl)piperazine (S15535) is a highly selective ligand at 5-HT(1A) receptors. The present study compared its autoradiographic labelling of rat brain sections with its functional actions, visualised by guanylyl-5'-[gamma-thio]-triphosphate ([35S]GTPgammaS) autoradiography, which affords a measure of G-protein activation. [3H]S15535 binding was highest in hippocampus, frontal cortex, entorhinal cortex, lateral septum, interpeduncular nucleus and dorsal raphe, consistent with specific labelling of 5-HT(1A) receptors. In functional studies, S15535 (10 microM) did not markedly stimulate G-protein activation in any brain region, but abolished the activation induced by the selective 5-HT(1A) agonist, (+)-8-hydroxy-dipropyl-aminotetralin ((+)-8-OH-DPAT, 1 microM), in structures enriched in [3H]S15535 labelling. S15535 did not block 5-HT-stimulated activation in caudate nucleus or substantia nigra, regions where (+)-8-OH-DPAT was ineffective and [3H]S15535 binding was absent. Interestingly, S15535 attenuated (+)-8-OH-DPAT and 5-HT-stimulated G-protein activation in dorsal raphe, a region in which S15535 is known to exhibit agonist properties in vivo [Lejeune, F., Millan, M.J., 1998. Induction of burst firing in ventral tegmental area dopaminergic neurons by activation of serotonin (5-HT)(1A) receptors: WAY100,635-reversible actions of the highly selective ligands, flesinoxan and S15535. Synapse 30, 172-180.]. The present data show that (i) [3H]S15535 labels pre- and post-synaptic populations of 5-HT(1A) sites in rat brain sections, (ii) S15535 exhibits antagonist properties at post-synaptic 5-HT(1A) receptors in corticolimbic regions, and (iii) S15535 also attenuates agonist-stimulated G-protein activation at raphe-localised 5-HT(1A) receptors.

Studies of BL Lacertae objects with the Einstein Observatory - The soft X-ray spectra of OJ 287 and PKS 0735+178

NASA Technical Reports Server (NTRS)

Madejski, Greg M.; Schwartz, Daniel A.

1988-01-01

Accurate, soft X-ray spectra of two BL Lac objects, OJ 287 and PKS 0735+178, are presented. The X-ray spectra are well described by a power-law model with a low-energy cutoff consistent with photoelectric absorption within the Galaxy. The best-fit values of the energy spectral index in the 0.2-4.0 keV band are 0.91 and 0.76 respectively. The X-ray flux from OJ 287 is variable by a ratio of three from low to high state; PKS 0735+178 shows no indication of X-ray variability. The X-ray emission in OJ 287 is interpreted to be due to the synchrotron process from a volume common with either a beamed radio component or a stationary optical component. In PKS 0735+178, where the X-ray emission is most likely due to the Compton process operating in one of the VLBI radio components. The synchrotron self-Compton process with modest kinematic Doppler factors predicts the measured X-ray flux from PKS 0735+178 and lower than the measured flux in OJ 287.

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

PubMed

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP)

PubMed Central

Kamina, Anyango D.; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains’ interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP. PMID:28542332

Synthesis of enantiopure trans-2,5-disubstituted trifluoromethylpyrrolidines and (2S,5R)-5-trifluoromethylproline.

PubMed

Lubin, Hodney; Pytkowicz, Julien; Chaume, Grégory; Sizun-Thomé, Gwenaëlle; Brigaud, Thierry

2015-03-06

Enantiopure trans-2,5-disubstituted trifluoromethylpyrrolidines were prepared on a several gram scale starting from a readily available chiral fluorinated oxazolidine (Fox). A pure oxazolopyrrolidine intermediate could be obtained after an efficient separation by selective diastereomer destruction. The addition of various Grignard reagents on this oxazolopyrrolidine provided disubstituted pyrrolidines with moderate to complete trans diastereoselectivity. The highly valuable compound (2S,5R)-5-trifluoromethylproline could be synthesized from the same oxazolopyrrolidine intermediate via a Strecker-type reaction.

Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions

NASA Astrophysics Data System (ADS)

Zhang, Yawei; Li, Gang

2018-01-01

Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

Acoustic Noise Test Report for the U.S. Department of Energy 1.5-Megawatt Wind Turbine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roadman, Jason; Huskey, Arlinda

2015-07-01

A series of tests were conducted to characterize the baseline properties and performance of the U.S. Department of Energy (DOE) 1.5-megawatt wind turbine (DOE 1.5) to enable research model development and quantify the effects of future turbine research modifications. The DOE 1.5 is built on the platform of GE's 1.5-MW SLE commercial wind turbine model. It was installed in a nonstandard configuration at the NWTC with the objective of supporting DOE Wind Program research initiatives such as A2e. Therefore, the test results may not represent the performance capabilities of other GE 1.5-MW SLE turbines. The acoustic noise test documented inmore » this report is one of a series of tests carried out to establish a performance baseline for the DOE 1.5 in the NWTC inflow environment.« less

Structure and properties of Li 2S-P 2S 5-P 2S 3 glass and glass-ceramic electrolytes

NASA Astrophysics Data System (ADS)

Minami, Keiichi; Hayashi, Akitoshi; Ujiie, Satoshi; Tatsumisago, Masahiro

High lithium ion conducting 70Li 2S·(30 - x)P 2S 5· xP 2S 3 (mol%) glasses and glass-ceramics were prepared by the mechanical milling method. Glasses were obtained in the composition range of 0 ≦ x ≦ 10. The substitution of P 2S 3 for P 2S 5 promoted the formation of the P 2S 6 4- units in the glasses. The conductivity of the glass increased with an increase in P 2S 3 contents up to 5 mol% and the glass with 5 mol% of P 2S 3 showed the conductivity of 1 × 10 -4 S cm -1 at room temperature. In the case of glass-ceramics, the conductivity increased with an increase in P 2S 3 contents up to 1 mol%, and the superionic conducting Li 7P 3S 11 crystal was precipitated in the glass-ceramic. The glass-ceramic with 1 mol% of P 2S 3 showed the highest conductivity of 3.9 × 10 -3 S cm -1 at room temperature.

Structural and electronic features of binary Li2S-P2S5 glasses

PubMed Central

Ohara, Koji; Mitsui, Akio; Mori, Masahiro; Onodera, Yohei; Shiotani, Shinya; Koyama, Yukinori; Orikasa, Yuki; Murakami, Miwa; Shimoda, Keiji; Mori, Kazuhiro; Fukunaga, Toshiharu; Arai, Hajime; Uchimoto, Yoshiharu; Ogumi, Zempachi

2016-01-01

The atomic and electronic structures of binary Li2S-P2S5 glasses used as solid electrolytes are modeled by a combination of density functional theory (DFT) and reverse Monte Carlo (RMC) simulation using synchrotron X-ray diffraction, neutron diffraction, and Raman spectroscopy data. The ratio of PSx polyhedral anions based on the Raman spectroscopic results is reflected in the glassy structures of the 67Li2S-33P2S5, 70Li2S-30P2S5, and 75Li2S-25P2S5 glasses, and the plausible structures represent the lithium ion distributions around them. It is found that the edge sharing between PSx and LiSy polyhedra increases at a high Li2S content, and the free volume around PSx polyhedra decreases. It is conjectured that Li+ ions around the face of PSx polyhedra are clearly affected by the polarization of anions. The electronic structure of the DFT/RMC model suggests that the electron transfer between the P ion and the bridging sulfur (BS) ion weakens the positive charge of the P ion in the P2S7 anions. The P2S7 anions of the weak electrostatic repulsion would causes it to more strongly attract Li+ ions than the PS4 and P2S6 anions, and suppress the lithium ionic conduction. Thus, the control of the edge sharing between PSx and LiSy polyhedra without the electron transfer between the P ion and the BS ion is expected to facilitate lithium ionic conduction in the above solid electrolytes. PMID:26892385

Evidence for Bs* Bs* production at the Gamma(5S) resonance.

PubMed

Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dorjkhaidav, O; Li, J; Menaa, N; Mountain, R; Nandakumar, R; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Bornheim, A; Pappas, S P; Weinstein, A J; Briere, R A; Chen, G P; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Crede, V; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gittelman, B; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Shepherd, M R; Stroiney, S; Sun, W M; Urner, D; Wilksen, T; Weaver, K M; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Williams, J; Wiss, J; Asner, D M; Edwards, K W; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Li, S Z; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Arms, K; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Mueller, J A; Savinov, V; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Adams, G S; Cravey, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Stroynowski, R

2005-12-31

We use data collected by the CLEO III detector at the Cornell Electron Storage Ring to measure the inclusive yields of D(s) mesons as B(Y(5S) --> D(s)X) = (44-7 +/- 4.2 +/- 9.9)% and B(Y(4S) --> D(s)X) = (18.1 +/- 0.5 +/- 2.8)%. From these measurements, we make a model dependent estimate of the ratio of B(s)*B(s)* to the total bb quark pair production of (16.0 +/- 2.6 +/- 5.8)% at the Y(5S) energy.

10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

PubMed

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-11-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

Systematic analysis and evolution of 5S ribosomal DNA in metazoans

PubMed Central

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-01-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690

Sex-related preferences for real and doll’s faces versus real and toy objects in young infants and adults

PubMed Central

Escudero, Paola; Robbins, Rachel A.; Johnson, Scott P.

2013-01-01

Findings of previous studies demonstrate sex-related preferences for toys in 6-month-old infants: Boys prefer non-social or mechanical toys such as cars, while girls prefer social toys such as dolls. Here, we explored the innate versus learned nature of this sex-related preferences using multiple pictures of doll and real faces (of men and women) as well as pictures of toy and real objects (cars and stoves). Forty-eight 4- and 5-month-old infants (24 girls) and 48 young adults (24 women) saw six trials of all relevant pairs of faces and objects, with each trial containing a different exemplar of a stimulus type. The infant results showed no sex-related preferences; infants preferred faces of men and women, regardless of whether they were real or doll’s faces. Similarly, adults did not show sex-related preferences for social versus non-social stimuli, but, unlike infants, they preferred faces of the opposite sex over objects. These results challenge claims of an innate basis for sex-related preferences for toy and real stimuli preferences (Connellan et al., 2000) and suggest that sex-related preferences result from maturational and social development, which continues into adulthood. PMID:23933180

VizieR Online Data Catalog: Einstein EMSS Survey (Gioia+ 1990, Stocke+ 1991)

NASA Astrophysics Data System (ADS)

Gioia, I. M.; Maccacaro, T.; Schild, R. E.; Wolter, A.

1995-07-01

The Einstein Extended Medium Sensitivity Survey (EMSS) consists of 835 serendipitous X-ray sources detected at or above 4 times the rms level in 1435 IPC fields with their centers located away from the galactic plane. Their limiting sensitivities range from ~5*10-14 to to ~ 3*10-12 erg.cm-2.s-1 in the 0.3-3.5keV band. A total area of 778 square degrees of the high galactic latitude sky (|b|>20) has been covered. The analysis has been performed using data from the Rev 1 processing system at the CfA. The resulting EMSS catalog is a flux-limited and homogeneous sample of astronomical objects that can be used for statistical studies. Here we present the table listing all the sources taken from the publication referenced below and the optical identifications. At present over 96% of the 835 X-ray sources have been successfully identified in the following proportions: active galactic nuclei (QSO's, quasars and Seyfert), 51.1%; BL Lacertae objects, 4.3%; clusters of galaxies, 12.2%; normal galaxies, 2.1%; cooling flow galaxies, 0.6%; Galactic stars 25.8%; and unidentified, 3.9%. Most of the individual optical counterparts are previously unknown objects and so constitute large statistical samples independent of previously selection methods. The contents of the table is described below. The sky coverage computed for a specific assumed source spectrum is also given under "Additional Information" below. For further details please see the published articles: Gioia et al. 1990, Stocke et al. 1991. (1 data file).

75 FR 57539 - U.S. National Climate Assessment Objectives, Proposed Topics, and Next Steps

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-21

... OFFICE OF SCIENCE & TECHNOLOGY POLICY U.S. National Climate Assessment Objectives, Proposed Topics, and Next Steps Correction In notice document 2010-22229 beginning on page 54403 in the issue of Tuesday, September 7, 2010 make the following correction: On page 54403 under the SUMMARY section, in the...

A Double-Dissociation in Infants' Representations of Object Arrays

ERIC Educational Resources Information Center

Feigenson, L.

2005-01-01

Previous studies show that infants can compute either the total continuous extent (e.g. Clearfield, M.W., & Mix, K.S. (1999). Number versus contour length in infants' discrimination of small visual sets. Psychological Science, 10(5), 408-411; Feigenson, L., & Carey, S. (2003). Tracking individuals via object-files: evidence from infants' manual…

The Discovery of a High-Redshift Quasar without Emission Lines from Sloan Digital Sky Survey Commissioning Data.

PubMed

Fan; Strauss; Gunn; Lupton; Carilli; Rupen; Schmidt; Moustakas; Davis; Annis; Bahcall; Brinkmann; Brunner; Csabai; Doi; Fukugita; Heckman; Hennessy; Hindsley; Ivezic; Knapp; Lamb; Munn; Pauls; Pier; Rockosi; Schneider; Szalay; Tucker; York

1999-12-01

We report observations of a luminous unresolved object at redshift z=4.62, with a featureless optical spectrum redward of the Lyalpha forest region, discovered from Sloan Digital Sky Survey commissioning data. The redshift is determined by the onset of the Lyalpha forest at lambda approximately 6800 Å and a Lyman limit system at lambda=5120 Å. A strong Lyalpha absorption system with weak metal absorption lines at z=4.58 is also identified in the spectrum. The object has a continuum absolute magnitude of -26.6 at 1450 Å in the rest frame (h0=0.5, q0=0.5) and therefore cannot be an ordinary galaxy. It shows no radio emission (the 3 sigma upper limit of its flux at 6 cm is 60 µJy), indicating a radio-to-optical flux ratio at least as small as that of the radio-weakest BL Lacertae objects known. It is also not linearly polarized to a 3 sigma upper limit of 4% in the observed I band. Therefore, it is either the most distant BL Lac object known to date, with very weak radio emission, or a new type of unbeamed quasar, whose broad emission line region is very weak or absent.

Despin of a Highly Spinning Object: Despin of the Army’s Unattended Expendable Jammer.

DTIC Science & Technology

1981-09-01

AD-A07 725 HARRY DIAMOND LABS AOELPHI MD F/6 17/4 DESPIN OF A HIGHLY SPINNING OBJECT: DESPIN OF THE ARMY’S UNATTE-ETC(U) SEP al I POLLIN...OF REPORT & PERIOD COVERED lDespin of a Highl%. Spinning Object: Despin of the Technical Report Armss UattededExpedabe Jamer6. PERFORMING ORG. REPORT...Diamond Laboratories AREA & WORK UNIT NUMBERS 28W8 Powder Mill Road Program Ele: 6.37.55. A Adelphi, MD 20783 11. CONTROLLING OFFICE NAME AND ADDRESS

Metallic 1T-LixMoS2 Cocatalyst Significantly Enhanced the Photocatalytic H2 Evolution over Cd0.5Zn0.5S Nanocrystals under Visible Light Irradiation.

PubMed

Du, Hong; Guo, Hong-Li; Liu, Ya-Nan; Xie, Xiao; Liang, Kuang; Zhou, Xiao; Wang, Xin; Xu, An-Wu

2016-02-17

In the present work, metallic 1T-LixMoS2 is utilized as a novel cocatalyst for Cd0.5Zn0.5S photocatalyst. The obtained LixMoS2/Cd0.5Zn0.5S hybrids show excellent photocatalytic performance for H2 generation from aqueous solution containing Na2S and Na2SO3 under splitting visible light illumination (λ ≥ 420 nm) without precious metal cocatalysts. It turns out that a certain amount of intercalating Li(+) ions ultimately drives the transition of MoS2 crystal from semiconductor triagonal phase (2H phase) to metallic phase (1T phase). The distinct properties of 1T-LixMoS2 promote the efficient separation of photoexcited electrons and holes when used as cocatalyst for Cd0.5Zn0.5S photocatalyst. As compared to 2H-MoS2 nanosheets only having edge active sites, photoinduced electrons not only transfer to the edge sites of 1T-LixMoS2, but also to the plane active sites of 1T-LixMoS2 nanosheets. The content of LixMoS2 in hybrid photocatalysts influences the photocatalytic activity. The optimal 1T-LixMoS2 (1.0 wt %)/Cd0.5Zn0.5S nanojunctions display the best activity for hydrogen production, achieving a hydrogen evolution rate of 769.9 μmol h(-1), with no use of noble metal loading, which is about 3.5 times higher than that of sole Cd0.5Zn0.5S, and 2 times higher than that of 2H-MoS2 (1.0 wt %)/Cd0.5Zn0.5S samples. Our results demonstrate that Li(+)-intercalated MoS2 nanosheets with high conductivity, high densities of active sites, low cost, and environmental friendliness are a prominent H2 evolution cocatalyst that might substitute for noble metal for potential hydrogen energy applications.

Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

PubMed

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2013 CFR

2013-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2010 CFR

2010-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2014 CFR

2014-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2011 CFR

2011-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

40 CFR 180.1065 - 2-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the...

Code of Federal Regulations, 2012 CFR

2012-07-01

...-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. 180.1065...-Amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha)pyrimidin-5-one; exemption from the requirement of a tolerance. The inert ingredient, 2-amino-4,5-dihydro-6-methyl-4-propyl-s-triazolo(1,5-alpha...

The 5-HT2A/1A agonist psilocybin disrupts modal object completion associated with visual hallucinations.

PubMed

Kometer, Michael; Cahn, B Rael; Andel, David; Carter, Olivia L; Vollenweider, Franz X

2011-03-01

Recent findings suggest that the serotonergic system and particularly the 5-HT2A/1A receptors are implicated in visual processing and possibly the pathophysiology of visual disturbances including hallucinations in schizophrenia and Parkinson's disease. To investigate the role of 5-HT2A/1A receptors in visual processing the effect of the hallucinogenic 5-HT2A/1A agonist psilocybin (125 and 250 μg/kg vs. placebo) on the spatiotemporal dynamics of modal object completion was assessed in normal volunteers (n = 17) using visual evoked potential recordings in conjunction with topographic-mapping and source analysis. These effects were then considered in relation to the subjective intensity of psilocybin-induced visual hallucinations quantified by psychometric measurement. Psilocybin dose-dependently decreased the N170 and, in contrast, slightly enhanced the P1 component selectively over occipital electrode sites. The decrease of the N170 was most apparent during the processing of incomplete object figures. Moreover, during the time period of the N170, the overall reduction of the activation in the right extrastriate and posterior parietal areas correlated positively with the intensity of visual hallucinations. These results suggest a central role of the 5-HT2A/1A-receptors in the modulation of visual processing. Specifically, a reduced N170 component was identified as potentially reflecting a key process of 5-HT2A/1A receptor-mediated visual hallucinations and aberrant modal object completion potential. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Streptococcal 5'-Nucleotidase A (S5nA), a Novel Streptococcus pyogenes Virulence Factor That Facilitates Immune Evasion.

PubMed

Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M S; Langley, Ries J; Proft, Thomas

2015-12-25

Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5'-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5'-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg(2+), Ca(2+), or Mn(2+). However, Zn(2+) inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5'-nucleotidase activity and immune evasion properties. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Give Me a Hand: Adult Involvement During Object Exploration Affects Object Individuation in Infancy

PubMed Central

Johnson, Kristin M.; Woods, Rebecca J.

2015-01-01

The development of object individuation, a fundamental ability that supports identification and discrimination of objects across discrete encounters, has been examined extensively by researchers. There are significant advancements in infants’ ability to individuate objects during the first year-and-a-half. Experimental work has established a timeline of object individuation abilities and revealed some mechanisms underlying this ability, however, the influence of adult assistance during object exploration has not yet been explored. The current study investigates the effect of adult involvement during object exploration on infants’ object individuation abilities. In Experiment 1a and 1b, we examined 9.5-month-old infants’ colour-based object individuation following adult-assisted multisensory object exploration. Two components of adult interaction were of particular interest: facilitation of object manipulation (grasping, rotating, and attention-getting behaviours) and social engagement (smiling, pointing, attention-getting verbalizations, and object-directed gaze). Experiment 2a and 2b assessed these components with 4.5-month-olds to examine their impact across development. The results showed that after adult-guided object exploration, both 9.5- and 4.5-month-old infants successfully individuated previously undifferentiated objects. Results of Experiments 1b and 2b provide implications for the mechanisms underlying the scaffolding influence of adult interaction during infant behaviours. PMID:28082834

5 CFR 430.204 - Agency performance appraisal system(s).

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Agency performance appraisal system(s... Other Employees § 430.204 Agency performance appraisal system(s). (a) Each agency as defined at section 4301(1) of title 5, United States Code, shall develop one or more performance appraisal systems for...

OPTICAL SPECTROSCOPY OF SDSS J004054.65-0915268: THREE POSSIBLE SCENARIOS FOR THE CLASSIFICATION. A z ∼ 5 BL LACERTAE, A BLUE FSRQ, OR A WEAK EMISSION LINE QUASAR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Landoni, M.; Zanutta, A.; Bianco, A.

2016-02-15

The haunt of high-redshift BL Lacerate objects is day by day more compelling to firmly understand their intrinsic nature and evolution. SDSS J004054.65-0915268 is, at the moment, one of the most distant BL Lac candidates, at z ∼ 5. We present a new optical-near-IR spectrum obtained with ALFOSC-NOT with a new, custom designed dispersive grating aimed to detect broad emission lines that could disprove this classification. In the obtained spectra, we do not detect any emission features and we provide an upper limit to the luminosity of the C iv broad emission line. Therefore, the nature of the object is then discussed,more » building the overall spectral energy distribution (SED) and fitting it with three different models. Our fits, based on SED modeling with different possible scenarios, cannot rule out the possibility that this source is indeed a BL Lac object, though the absence of optical variability and the lack of strong radio flux seem to suggest that the observed optical emission originates from a thermalized accretion disk.« less

Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser.

PubMed

Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi

2018-06-01

In this work, we fabricate the Mo 0.5 W 0.5 S 2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo 0.5 W 0.5 S 2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm -2 . The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo 0.5 W 0.5 S 2 SAs.

Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser

NASA Astrophysics Data System (ADS)

Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi

2018-06-01

In this work, we fabricate the Mo0.5W0.5S2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo0.5W0.5S2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm‑2. The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo0.5W0.5S2 SAs.

5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. SWITCH TOWER AND JUNCTION OF S.A.R. #1 & S.A.R. #2 TRANSMISSION LINES, MARCH 7, 1916. SCE drawing no. 4932. - Santa Ana River Hydroelectric System, Transmission Lines, Redlands, San Bernardino County, CA

Objective Measurement of Daytime Napping, Cognitive Dysfunction and Subjective Sleepiness in Parkinson’s Disease

PubMed Central

Bolitho, Samuel J.; Naismith, Sharon L.; Salahuddin, Pierre; Terpening, Zoe; Grunstein, Ron R.; Lewis, Simon J. G.

2013-01-01

Introduction Sleep-wake disturbances and concomitant cognitive dysfunction in Parkinson’s disease (PD) contribute significantly to morbidity in patients and their carers. Subjectively reported daytime sleep disturbance is observed in over half of all patients with PD and has been linked to executive cognitive dysfunction. The current study used daytime actigraphy, a novel objective measure of napping and related this to neuropsychological performance in a sample of PD patients and healthy, age and gender-matched controls. Furthermore this study aimed to identify patients with PD who may benefit from pharmacologic and behavioural intervention to improve these symptoms. Methods Eighty-five PD patients and 21 healthy, age-matched controls completed 14 days of wrist actigraphy within two weeks of neuropsychological testing. Objective napping measures were derived from actigraphy using a standardised protocol and subjective daytime sleepiness was recorded by the previously validated Epworth Sleepiness Scale. Results Patients with PD had a 225% increase in the mean nap time per day (minutes) as recorded by actigraphy compared to age matched controls (39.2 ± 35.2 vs. 11.5 ± 11.0 minutes respectively, p < 0.001). Significantly, differences in napping duration between patients, as recorded by actigraphy were not distinguished by their ratings on the subjective measurement of excessive daytime sleepiness. Finally, those patients with excessive daytime napping showed greater cognitive deficits in the domains of attention, semantic verbal fluency and processing speed. Conclusion This study confirms increased levels of napping in PD, a finding that is concordant with subjective reports. However, subjective self-report measures of excessive daytime sleepiness do not robustly identify excessive napping in PD. Fronto-subcortical cognitive dysfunction was observed in those patients who napped excessively. Furthermore, this study suggests that daytime actigraphy, a non

Genomic organization, evolution and functional characterization of soluble toll-like receptor 5 (TLR5S) in miiuy croaker (Miichthys miiuy).

PubMed

Huo, Ruixuan; Zhao, Xueyan; Han, Jingjing; Xu, Tianjun

2018-05-30

Toll-like receptors (TLRs) play the key role in host defense of invasion of pathogens, not only in the innate immunity, but also in adaptive immunity. There are significant varieties and distinct features in fish TLRs, the TLR5 subfamily have two members (TLR5M and TLR5S). However, the exact role of TLR5 was lack of research in fish. In this study, a soluble form of TLR5 (TLR5S) was identified in miiuy croaker. The bioinformatics analysis showed that miiuy croaker TLR5S lacked the transmembrane domain and TIR domain. In other words, mmiTLR5S only has leucine-rich repeats (LRRs) domain, it is one of differences between TLR5M and TLR5S. Comparative genomic analysis showed that TLR5S might have happened an evolution between species. Expression analysis showed that mmiTLR5S was expressed in all tested miiuy croaker tissues and the mmiTLR5S expressions were significantly upregulated at 12 h in liver and kidney after Vibrio harveyi infection. Further functional experiments showed that NF-кB can be actived by mmiTLR5S, TLR5S might be an indispensable role in organism immune response. In short, the study of mmiTLR5S enriches the information of TLR5S and lays the foundation for future research on teleost TLRs system. Copyright © 2018 Elsevier Ltd. All rights reserved.

Asymptotic M5-brane entropy from S-duality

NASA Astrophysics Data System (ADS)

Kim, Seok; Nahmgoong, June

2017-12-01

We study M5-branes compactified on S 1 from the D0-D4 Witten index in the Coulomb phase. We first show that the prepotential of this index is S-dual, up to a simple anomalous part. This is an extension of the well-known S-duality of the 4d N=4 theory to the 6d (2, 0) theory on finite T 2. Using this anomalous S-duality, we find that the asymptotic free energy scales like N 3 when various temperature-like parameters are large. This shows that the number of 5d Kaluza-Klein fields for light D0-brane bound states is proportional to N 3. We also compute some part of the asymptotic free energy from 6d chiral anomalies, which precisely agrees with our D0-D4 calculus.

Children’s sedentary behaviour: descriptive epidemiology and associations with objectively-measured sedentary time

PubMed Central

2013-01-01

Background Little is known regarding the patterning and socio-demographic distribution of multiple sedentary behaviours in children. The aims of this study were to: 1) describe the leisure-time sedentary behaviour of 9–10 year old British children, and 2) establish associations with objectively-measured sedentary time. Methods Cross-sectional analysis in the SPEEDY study (Sport, Physical activity and Eating behaviour: Environmental Determinants in Young people) (N=1513, 44.3% boys). Twelve leisure-time sedentary behaviours were assessed by questionnaire. Objectively-measured leisure-time sedentary time (Actigraph GT1M, <100 counts/minute) was assessed over 7 days. Differences by sex and socioeconomic status (SES) in self-reported sedentary behaviours were tested using Kruskal-Wallis tests. The association between objectively-measured sedentary time and the separate sedentary behaviours (continuous (minutes) and categorised into 'none’ 'low’ or 'high’ participation) was assessed using multi-level linear regression. Results Sex differences were observed for time spent in most sedentary behaviours (all p ≤ 0.02), except computer use. Girls spent more time in combined non-screen sedentary behaviour (median, interquartile range: girls: 770.0 minutes, 390.0-1230.0; boys: 725.0, 365.0 - 1182.5; p = 0.003), whereas boys spent more time in screen-based behaviours (girls: 540.0, 273.0 - 1050.0; boys: 885.0, 502.5 - 1665.0; p < 0.001). Time spent in five non-screen behaviours differed by SES, with higher values in those of higher SES (all p ≤ 0.001). Regression analyses with continuous exposures indicated that reading (β = 0.1, p < 0.001) and watching television (β = 0.04, p < 0.01) were positively associated with objectively-measured sedentary time, whilst playing board games (β = -0.12, p < 0.05) was negatively associated. Analysed in categorical form, sitting and talking (vs. none: 'low’ β = 26.1,ns

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

The Examination of Alignment between National Assessment and English Curriculum Objectives Using Revised Bloom's Taxonomy

ERIC Educational Resources Information Center

Kozikoglu, Ishak

2018-01-01

Bloom's taxonomy for the classification of the objectives in cognitive domain was developed in mid 1950s and this taxonomy was revised by a group with Anderson and Krathwohl by making some changes and revisions. The purpose of this research was to evaluate the objectives of 8th grade English curriculum and TEOG exam questions (national assessment…

Analysis of Microvariable Activity of BL Lacertae

NASA Astrophysics Data System (ADS)

Sadun, Alberto C.; Asadi-Zeydabadi, Masoud; Hindman, Lauren; Moody, J. Ward

2018-06-01

BL Lac is a low-frequency peaked blazar (LBL) which emits synchrotron radiation at near-IR and optical wavelengths. Therefore optical observations are helpful in, among other things, studying the acceleration and cooling timescales of the electrons in the relativistic jets. We have made very high cadence observations of BL Lac over a number of nights with the Remote Observatory for Variable Object Research (ROVOR). Each night shows secular drift as well as a number of microvariable events lasting only a few minutes each. These data were then processed, compiled, and analyzed in order to examine the underlying mechanism that resulted in such activity. A geometric model is introduced that has worked well in the past on other similar sources.Our relativistic jet model consists of a slowly varying beamed source that already appears bright because it lies nearly to our line of sight. From this, individual relativistic components are ejected a few degrees relative to the aforementioned beaming angle. This is what we believe is responsible for the microvariability emission.

Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

PubMed

Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

2017-01-23

Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Crohn’s Disease and Genetic Hitchhiking at IBD5

PubMed Central

Huff, Chad D.; Witherspoon, David J.; Zhang, Yuhua; Gatenbee, Chandler; Denson, Lee A.; Kugathasan, Subra; Hakonarson, Hakon; Whiting, April; Davis, Chadwick T.; Wu, Wilfred; Xing, Jinchuan; Watkins, W. Scott; Bamshad, Michael J.; Bradfield, Jonathan P.; Bulayeva, Kazima; Simonson, Tatum S.; Jorde, Lynn B.; Guthery, Stephen L.

2012-01-01

Inflammatory bowel disease 5 (IBD5) is a 250 kb haplotype on chromosome 5 that is associated with an increased risk of Crohn’s disease in Europeans. The OCTN1 gene is centrally located on IBD5 and encodes a transporter of the antioxidant ergothioneine (ET). The 503F variant of OCTN1 is strongly associated with IBD5 and is a gain-of-function mutation that increases absorption of ET. Although 503F has been implicated as the variant potentially responsible for Crohn’s disease susceptibility at IBD5, there is little evidence beyond statistical association to support its role in disease causation. We hypothesize that 503F is a recent adaptation in Europeans that swept to relatively high frequency and that disease association at IBD5 results not from 503F itself, but from one or more nearby hitchhiking variants, in the genes IRF1 or IL5. To test for evidence of recent positive selection on the 503F allele, we employed the iHS statistic, which was significant in the European CEU HapMap population (P = 0.0007) and European Human Genome Diversity Panel populations (P ≤ 0.01). To evaluate the hypothesis of disease-variant hitchhiking, we performed haplotype association tests on high-density microarray data in a sample of 1,868 Crohn’s disease cases and 5,550 controls. We found that 503F haplotypes with recombination breakpoints between OCTN1 and IRF1 or IL5 were not associated with disease (odds ratio [OR]: 1.05, P = 0.21). In contrast, we observed strong disease association for 503F haplotypes with no recombination between these three genes (OR: 1.24, P = 2.6 × 10−8), as expected if the sweeping haplotype harbored one or more disease-causing mutations in IRF1 or IL5. To further evaluate these disease-gene candidates, we obtained expression data from lower gastrointestinal biopsies of healthy individuals and Crohn’s disease patients. We observed a 72% increase in gene expression of IRF1 among Crohn’s disease patients (P = 0.0006) and no significant difference

Developmental Changes in Children’s Processing of Redundant Modifiers in Definite Object Descriptions

PubMed Central

Koolen, Ruud; Krahmer, Emiel; Swerts, Marc

2016-01-01

This paper investigates developmental changes in children’s processing of redundant information in definite object descriptions. In two experiments, children of two age groups (6 or 7, and 9 or 10 years old) were presented with pictures of sweets. In the first experiment (pairwise comparison), two identical sweets were shown, and one of these was described with a redundant modifier. After the description, the children had to indicate the sweet they preferred most in a forced-choice task. In the second experiment (graded rating), only one sweet was shown, which was described with a redundant color modifier in half of the cases (e.g., “the blue sweet”) and in the other half of the cases simply as “the sweet.” This time, the children were asked to indicate on a 5-point rating scale to what extent they liked the sweets. In both experiments, the results showed that the younger children had a preference for the sweets described with redundant information, while redundant information did not have an effect on the preferences for the older children. These results imply that children are learning to distinguish between situations in which redundant information carries an implicature and situations in which this is not the case. PMID:27994569

Streptococcal 5′-Nucleotidase A (S5nA), a Novel Streptococcus pyogenes Virulence Factor That Facilitates Immune Evasion*

PubMed Central

Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M. S.; Langley, Ries J.; Proft, Thomas

2015-01-01

Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5′-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5′-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg2+, Ca2+, or Mn2+. However, Zn2+ inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5′-nucleotidase activity and immune evasion properties. PMID:26527680

Isothermal sections of the quasi-ternary systems Ag{sub 2}S(Se)–Ga{sub 2}S(Se){sub 3}–In{sub 2}S(Se){sub 3} at 820 K and the physical properties of the ternary phases Ga{sub 5.5}In{sub 4.5}S{sub 15}, Ga{sub 6}In{sub 4}Se{sub 15} and Ga{sub 5.5}In{sub 4.5}S{sub 15}:Er{sup 3+}, Ga{sub 6}In{sub 4}Se{sub 15}:Er{sup 3+}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ivashchenko, I.A., E-mail: Ivashchenko.Inna@eenu.edu.ua; Danyliuk, I.V.; Gulay, L.D.

Isothermal sections of the quasi-ternary systems Ag{sub 2}S(Se)–Ga{sub 2}S(Se){sub 3}–In{sub 2}S(Se){sub 3} at 820 K were compared. Along the 50 mol% Ag{sub 2}S(Se), both systems feature continuous solid solutions with the chalcopyrite structure. Along the 17 mol% Ag{sub 2}S(Se), the interactions at the AgIn{sub 5}S(Se){sub 8}–'AgGa{sub 5}S(Se){sub 8}' sections are different. In the Ag{sub 2}S–Ga{sub 2}S{sub 3}–In{sub 2}S{sub 3} system the existence of the layered phase AgGa{sub x}In{sub 5–x}S{sub 8}, 2.25≤x≤2.85, was confirmed (S.G. P6{sub 3}mc). The Ag{sub 2}Se–Ga{sub 2}Se{sub 3}–In{sub 2}Se{sub 3} system features the formation of solid solution (up to 53 mol% Ga{sub 2}Se{sub 3}) based on AgIn{submore » 5}Se{sub 8} (S.G. P-42m). Crystal structure, atomic coordinates were determined by powder diffraction method for samples from the homogeneity region of AgIn{sub 5}Se{sub 8}. Specific conductivities of the crystals Ga{sub 6}In{sub 4}Se{sub 15} (1.33·10{sup −6} Ω{sup −1} m{sup −1}), Ga{sub 5.94}In{sub 3.96}Er{sub 0.1}Se{sub 15} (3.17·10{sup −6} Ω{sup −1} m{sup −1}), Ga{sub 5.5}In{sub 4.5}S{sub 15} (7.94·10{sup −6} Ω{sup −1} m{sup −1}), Ga{sub 5.46}In{sub 4.47}Er{sub 0.07}S{sub 15} (1·10{sup −9} Ω{sup −1} m{sup −1}) were measured at room temperature. Optical absorption and photoconductivity spectra were recorded in the range 400–760 nm. The introduction of erbium leads to an increase in the absorption coefficient and to the appearance of absorption bands at 530, 660, 810, 980, 1530 nm. - Highlights: • Nature of solid solutions in Ag{sub 2}S(Se)–Ga{sub 2}S(Se){sub 3}–In{sub 2}S(Se){sub 3} (820 K) were discussed. • Crystal structures of ternary and quaternary compounds were discussed. • Specific conductivity, optical properties of four single crystals were measured. • Photoconductivity of the Ga{sub 5.5}In{sub 4.5}S{sub 15} in the range 400–760 nm were recorded.« less

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

S5 Lipase: an organic solvent tolerant enzyme.

PubMed

Rahman, Raja Noor Zaliha Abdul; Baharum, Syarul Nataqain; Salleh, Abu Bakar; Basri, Mahiran

2006-12-01

In this study, an organic solvent tolerant bacterial strain was isolated. This strain was identified as Pseudomonas sp. strain S5, and was shown to degrade BTEX (Benzene, Toluene, Ethyl-Benzene, and Xylene). Strain S5 generates an organic solvent-tolerant lipase in the late logarithmic phase of growth. Maximum lipase production was exhibited when peptone was utilized as the sole nitrogen source. Addition of any of the selected carbon sources to the medium resulted in a significant reduction of enzyme production. Lower lipase generation was noted when an inorganic nitrogen source was used as the sole nitrogen source. This bacterium hydrolyzed all tested triglycerides and the highest levels of production were observed when olive oil was used as a natural triglyceride. Basal medium containing Tween 60 enhanced lipase production to the most significant degree. The absence of magnesium ions (Mg2+) in the basal medium was also shown to stimulate lipase production. Meanwhile, an alkaline earth metal ion, Na+, was found to stimulate the production of S5 lipase.

Distributed Object Oriented Programming

DTIC Science & Technology

1990-02-01

of the object oriented model of computation. Therefore, object oriented programming can provide the programmer with good conceptual tools to divide his...LABOR SALES-COMMISSION). The symbol + refers to the addition function and takes any number of numeric arguments. The third subtype of list forms is the...2) ’(:SEND-DONE) (SEWF (AREF OBJECT-i1-MESSAGES-SENT 2) ’(PROGN (FORMAT T "-s methd completely executed instr-ptr -s-V NAME %INSTR-PTR%) (INCF

AdS5 solutions from M5-branes on Riemann surface and D6-branes sources

DOE PAGES

Bah, Ibrahima

2015-09-24

Here, we describe the gravity duals of four-dimensional N = 1 superconformal field theories obtained by wrapping M5-branes on a punctured Riemann surface. The internal geometry, normal to the AdS 5 factor, generically preserves two U(1)s, with generators (J +, J –), that are fibered over the Riemann surface. The metric is governed by a single potential that satisfies a version of the Monge-Ampère equation. The spectrum of N = 1 punctures is given by the set of supersymmetric sources of the potential that are localized on the Riemann surface and lead to regular metrics near a puncture. We usemore » this system to study a class of punctures where the geometry near the sources corresponds to M-theory description of D6-branes. These carry a natural (p, q) label associated to the circle dual to the killing vector pJ + + qJ – which shrinks near the source. In the generic case the world volume of the D6-branes is AdS 5 × S 2 and they locally preserve N = 2 supersymmetry. When p = –q, the shrinking circle is dual to a flavor U(1). The metric in this case is non-degenerate only when there are co-dimension one sources obtained by smearing M5-branes that wrap the AdS 5 factor and the circle dual the superconformal R-symmetry. The D6-branes are extended along the AdS 5 and on cups that end on the co-dimension one branes. In the special case when the shrinking circle is dual to the R-symmetry, the D6-branes are extended along the AdS 5 and wrap an auxiliary Riemann surface with an arbitrary genus. When the Riemann surface is compact with constant curvature, the system is governed by a Monge-Ampère equation.« less

Monsters in the sky. I mostri del cielo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maffei, P.

1980-01-01

The book treats astronomical objects and phenomena which remain unexplained or unproven by current investigators. Specific objects discussed include comets, satellite clouds surrounding the earth, tektites, the planet Vulcan (within the orbit of Mercury), Planet X (beyond Pluto), the Gum Nebula, planetary nebulae, supernovae, supernova remnants, transient X-ray sources, the possible extinction of the dinosaurs by an X-ray explosion and super-supernovae. Attention is also given to the star Eta Carinae, black holes, BL Lacertae objects, active galaxies, Markarian galaxies, N and compact galaxies, Seyfert galaxies, quasars, redshift anomalies, Stephan's quintet of galaxies, and intergalactic black holes or black dwarfs whichmore » may account for the mass necessary to bind together clusters of galaxies.« less

Association between Accelerometer-Assessed Physical Activity and Objectively Measured Hearing Sensitivity among U.S. Adults with Diabetes

ERIC Educational Resources Information Center

Loprinzi, Paul D.; Gilham, Ben; Cardinal, Bradley J.

2014-01-01

Purpose: The purpose of this study was to examine the association between objectively measured physical activity and hearing sensitivity among a nationally representative sample of U.S. adults with diabetes. Method: Data from the 2003-2006 National Health and Nutrition Examination Survey were used. One hundred eighty-four U.S. adults with diabetes…

Objectively measured physical activity and balance among U.S. adults.

PubMed

Loprinzi, Paul D; Brosky, Joseph A

2014-08-01

The purpose of this study was to examine the association between objectively measured physical activity (PA) and balance in a nationally representative sample of U.S. adults 40 years of age and older. Data from the 2003-2004 National Health and Nutrition Examination Survey were used. Physical activity was measured over a 7-day period using accelerometry, and balance was assessed using the Romberg test. Participants completed a questionnaire regarding their subjective views on difficulty with falling in the past 12 months. For every 60-minute increase in light-intensity PA, participants were 10% (p = 0.04) more likely to have functional balance. Similarly, for every 1-minute increase in log-transformed moderate-to-vigorous physical activity, participants were 23% (p = 0.04) more likely to have functional balance. Regular PA, regardless of intensity, may have health benefits for older adults and is associated with functional balance.

CAVIAR: a 45k neuron, 5M synapse, 12G connects/s AER hardware sensory-processing- learning-actuating system for high-speed visual object recognition and tracking.

PubMed

Serrano-Gotarredona, Rafael; Oster, Matthias; Lichtsteiner, Patrick; Linares-Barranco, Alejandro; Paz-Vicente, Rafael; Gomez-Rodriguez, Francisco; Camunas-Mesa, Luis; Berner, Raphael; Rivas-Perez, Manuel; Delbruck, Tobi; Liu, Shih-Chii; Douglas, Rodney; Hafliger, Philipp; Jimenez-Moreno, Gabriel; Civit Ballcels, Anton; Serrano-Gotarredona, Teresa; Acosta-Jimenez, Antonio J; Linares-Barranco, Bernabé

2009-09-01

This paper describes CAVIAR, a massively parallel hardware implementation of a spike-based sensing-processing-learning-actuating system inspired by the physiology of the nervous system. CAVIAR uses the asychronous address-event representation (AER) communication framework and was developed in the context of a European Union funded project. It has four custom mixed-signal AER chips, five custom digital AER interface components, 45k neurons (spiking cells), up to 5M synapses, performs 12G synaptic operations per second, and achieves millisecond object recognition and tracking latencies.

Dynamic Structure of a Molecular Liquid S0.5Cl0.5: Ab initio Molecular-Dynamics Simulations

NASA Astrophysics Data System (ADS)

Ohmura, Satoshi; Shimakura, Hironori; Kawakita, Yukinobu; Shimojo, Fuyuki; Yao, Makoto

2013-07-01

The static and dynamic structures of a molecular liquid S0.5Cl0.5 consisting of Cl--S--S--Cl (S2Cl2) type molecules are studied by means of ab initio molecular dynamics simulations. Both the calculated static and dynamic structure factors are in good agreement with experimental results. The dynamic structures are discussed based on van-Hove distinct correlation functions, molecular translational mean-square displacements (TMSD) and rotational mean-square displacements (RMSD). In the TMSD and RMSD, there are ballistic and diffusive regimes in the sub-picosecond and picosecond time regions, respectively. These time scales are consistent with the decay time observed experimentally. The interaction between molecules in the liquid is also discussed in comparison with that in another liquid chalcogen--halogen system Se0.5Cl0.5.

Impact of the Japanese 5S management method on patients’ and caretakers’ satisfaction: a quasi-experimental study in Senegal

PubMed Central

Kanamori, Shogo; Castro, Marcia C.; Sow, Seydou; Matsuno, Rui; Cissokho, Alioune; Jimba, Masamine

2016-01-01

Background The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. Objective To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers) who visited the health centers. Design A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities). A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83). Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Results Backward stepwise linear regression (n=1,928) indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention (p=0.014). Additional regression analyses showed significant score increases of 0.44 (p=0.002), 0.14 (p=0.002), 0.06 (p=0.019), and 0.17 (p=0.044) points on four items, which, respectively were healthcare staff members’ communication, explanations about illnesses or cases, and consultation duration, and clients’ overall satisfaction. Conclusions The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective intervention modalities

Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

PubMed

Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

2017-11-14

The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

PubMed Central

Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

1984-01-01

Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

PubMed Central

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Low Cost Multiple Near Earth Object Missions

NASA Astrophysics Data System (ADS)

Smith, D. B.; Klaus, K.; Kaplan, M.

2009-12-01

Commercial spacecraft are available with efficient high power solar arrays and hybrid propulsion systems (Chemical and Solar Electric) that make possible multiple Near Earth Object Missions within Discovery budget limits. Our analysis is based on the Geosynchronous Transfer Orbit Capability (GTOC-3) solution. GTOC-3 assumptions: - Escape from Earth, rendezvous with 3 asteroids, then rendezvous with Earth - Departure velocity below 0.5 km/s - Launch between 2016 and 2025 - Total trip time less than 10 years - Minimum stay time of 60 days at each asteroid - Initial spacecraft mass of 2,000 kg - Thrust of 0.15 N and Isp of 3,000 s - Only Earth GAMs allowed (Rmin = 6,871 km) Preliminary results indicate that for mission objectives we can visit Apophis and any other 2 asteroids on this list or any other 3 asteroids listed. We have considered two spacecraft approaches to accomplish mission objectives: - Case 1: Chemical engine burn to the 1st target, and then solar electric to the 2nd and 3rd targets, or - Case 2: Solar electric propulsion to all 3 targets For both Cases, we assumed an instrument mass of up to 100 kg, power up to 100 W, and s/c bus pointing as good as 12 arc sec.Multi-NEO Mission Candidates

Verification of Spatial Forecasts of Continuous Meteorological Variables Using Categorical and Object-Based Methods

DTIC Science & Technology

2016-08-01

Using Categorical and Object-Based Methods by John W Raby and Huaqing Cai Approved for public release; distribution...by John W Raby and Huaqing Cai Computational and Information Sciences Directorate, ARL Approved for public release...AUTHOR(S) John W Raby and Huaqing Cai 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND

Physical mapping of 18S-25S rDNA and 5S rDNA in Lupinus via fluorescent in situ hybridization.

PubMed

Naganowska, Barbara; Zielińska, Anna

2002-01-01

Double-target fluorescent in situ hybridization (FISH) was used to determine the genomic distribution of ribosomal RNA genes in five Lupinus species: L. cosentinii (2n=32), L. pilosus (2n=42), L. angustifolius (2n=40), L. luteus (2n=52) and L. mutabilis (2n=48). 18S-25S rDNA and 5S rDNA were used as probes. Some interspecific variation was observed in the number and size of the 18S-25S rDNA loci. All the studied species had one chromosome pair carrying 5S rDNA.

Measurements of the exclusive decays of the upsilon(5S) to meson final states and improved B(s)* mass measurement.

PubMed

Aquines, O; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Stroynowski, R; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Brock, I; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Arms, K; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Savinov, V

2006-04-21

Using 420 pb(-1) of data collected on the upsilon(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of upsilon(5S) into B meson final states. We measure the inclusive B cross section to be sigma(upsilon(5S) --> BB(X)) = (0.177 +/- 0.030 +/- 0.016) nb and make the first measurements of the production rates of sigma(upsilon(5S) --> B*B*) = (0.131 +/- 0.025 +/- 0.014) nb and sigma(upsilon(5S) --> BB*) = (0.043 +/- 0.016 +/- 0.006) nb, respectively. We set 90% confidence level limits of sigma(upsilon(5S) -->BB) < 0.038 nb, sigma(upsilon(5S) --> B(*)B(*)pi) < 0.055 nb and sigma(upsilon(5S) --> BBpipi) < 0.024 nb. We also extract the most precise value of the B(s)* mass to date, M(B(s)*) = (5411.7 +/- 1.6 +/- 0.6) MeV/c2.

Determinants of Three-Year Change in Children’s Objectively Measured Sedentary Time

PubMed Central

Foley, Louise; Corder, Kirsten; Ekelund, Ulf; van Sluijs, Esther M. F.

2016-01-01

Background Sedentary behaviours (SB) are highly prevalent in young people and may be adversely associated with physical and mental health. Understanding of the modifiable determinants of SB is necessary to inform the design of behaviour change interventions but much of the existing research is cross-sectional and focussed upon screen-based behaviours. Purpose To examine the social, psychological and environmental determinants of change in children’s objectively measured sedentary time from age 11 to 14 years. Methods Data are from the second (2008) and third (2011) waves of assessment in the Sport, Physical Activity, and Eating Behaviour: Environmental Determinants in Young People (SPEEDY) study, conducted in the county of Norfolk, United Kingdom. Longitudinal data on accelerometer assessed sedentary time were available for 316 (53.5% female, 11.2±0.3 years at baseline) and 264 children after-school and at the weekend respectively. Information on 14 candidate determinants, including school travel mode and electronic media ownership, was self-reported. Change in the proportion of registered time spent sedentary was used as the outcome variable in cross-classified linear regression models, adjusted for age, sex, body mass index and baseline sedentary time. Simple and multiple models were run and interactions with sex explored. Results Daily sedentary time increased by 30–40 minutes after-school and at the weekend from baseline to follow-up. Participants who travelled to school by cycle exhibited smaller increases in after-school sedentary time (beta; 95%CI for change in % time spent sedentary: -3.3;-6.7,-0.07). No significant determinants of change in weekend sedentary time were identified. Conclusions Time spent sedentary increased during the three-year duration of follow-up but few of the variables examined were significantly associated with changes in sedentary time. Children’s mode of school travel may influence changes in their sedentary time over this

Effect of Pressure on the Stability and Electronic Structure of ZnO0.5S0.5 and ZnO0.5Se0.5

NASA Astrophysics Data System (ADS)

Manotum, R.; Klinkla, R.; Phaisangittisakul, N.; Pinsook, U.; Bovornratanaraks, T.

2017-12-01

Structures and high-pressure phase transitions in ZnO0.5S0.5 and ZnO0.5Se0.5 have been investigated using density functional theory calculations. The previously proposed structures of ZnO0.5S0.5 and ZnO0.5Se0.5 which are chalcopyrite ( I\\bar{4}2d ), rocksalt ( Fm3m ), wurtzite ( P63 mc ) and CuAu-I ( P\\bar{4}m2 ) have been fully investigated. Stabilities of these materials have been systematically studied up to 40 GPa using various approaches. We have confirmed the stability of the chalcopyrite structure up to 30 GPa for which the CuAu-I structure has been previously proposed. However, our calculation revealed that CuAu-I is not a stable structure under 32 GPa and 33 GPa for both ZnO0.5S0.5 and ZnO0.5Se0.5, respectively, which could explain the failure in several attempts to fabricate these materials under such conditions. We have also examined the pressure-dependence of the bandgap and electronic structure up to 30 GPa. We can conclude from our PDOS analysis that the applied pressure does not change the atomic state characters of electronic states near the top of valence and the bottom of conduction bands, but mainly modifies the dominant Zn-3d atomic state of the deep Bloch state at -1 eV below Fermi level.

Penrose limits of Abelian and non-Abelian T-duals of AdS 5 × S 5 and their field theory duals

NASA Astrophysics Data System (ADS)

Itsios, Georgios; Nastase, Horatiu; Núñez, Carlos; Sfetsos, Konstantinos; Zacarías, Salomón

2018-01-01

We consider the backgrounds obtained by Abelian and non-Abelian T-duality applied on AdS 5 × S 5. We study geodesics, calculate Penrose limits and find the associated plane-wave geometries. We quantise the weakly coupled type-IIA string theory on these backgrounds. We study the BMN sector, finding operators that wrap the original quiver CFT. For the non-Abelian plane wave, we find a `flow' in the frequencies. We report some progress to understand this, in terms of deconstruction of a higher dimensional field theory. We explore a relation with the plane-wave limit of the Janus solution, which we also provide.

76 FR 12730 - Clean Air Act Operating Permit Program; Objection to State Operating Permit for U.S. Steel...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-08

... ENVIRONMENTAL PROTECTION AGENCY [Regional Docket Nos. V-2009-1, FRL-9276-7] Clean Air Act Operating Permit Program; Objection to State Operating Permit for U.S. Steel-Granite City Works AGENCY... operating permit issued by the Illinois Environmental Protection Agency to the U.S. Steel--Granite City...

Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

PubMed

Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

2016-07-01

Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

BORN CROSS SECTIONS FOR INELASTIC SCATTERING OF ELECTRONS BY HYDROGEN ATOMS. III. 5s, 5p, 5d, 5f, 5g STATES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milford, S.N.; Morrissey, J.J.; Scanlon, J.H.

1960-12-01

Born total cross sections were computed for the strong optically allowed transitions from n = 5 to n' = 6, at incident energies between 0.2 and 1361 ev. Thirty energy values were considered for the 5s to 6p and 5g to 6h cases, and nine for the other transitions. The cross sections obtained were larger than those of comparable transitions for lower n. The Bethe (dipole) approximation was also used, and was found to give good agreement with the Born results down to relatively low energies ( approx equal 3 ev). (auth)

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

40 CFR 122.30 - What are the objectives of the storm water regulations for small MS4s?

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 23 2012-07-01 2012-07-01 false What are the objectives of the storm... objectives of the storm water regulations for small MS4s? (a) Sections 122.30 through 122.37 are written in a... 402(p)(6) of the Clean Water Act, the purpose of this portion of the storm water program is to...

40 CFR 122.30 - What are the objectives of the storm water regulations for small MS4s?

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 23 2013-07-01 2013-07-01 false What are the objectives of the storm... objectives of the storm water regulations for small MS4s? (a) Sections 122.30 through 122.37 are written in a... 402(p)(6) of the Clean Water Act, the purpose of this portion of the storm water program is to...

40 CFR 122.30 - What are the objectives of the storm water regulations for small MS4s?

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 22 2014-07-01 2013-07-01 true What are the objectives of the storm... objectives of the storm water regulations for small MS4s? (a) Sections 122.30 through 122.37 are written in a... 402(p)(6) of the Clean Water Act, the purpose of this portion of the storm water program is to...

Superconductivity in REO0.5F0.5BiS2 with high-entropy-alloy-type blocking layers

NASA Astrophysics Data System (ADS)

Sogabe, Ryota; Goto, Yosuke; Mizuguchi, Yoshikazu

2018-05-01

We synthesized new REO0.5F0.5BiS2 (RE: rare earth) superconductors with high-entropy-alloy-type (HEA-type) REO blocking layers. The lattice constant a systematically changed in the HEA-type samples with the RE concentration and the RE ionic radius. A sharp superconducting transition was observed in the resistivity measurements for all the HEA-type samples, and the transition temperature of the HEA-type samples was higher than that of typical REO0.5F0.5BiS2. The sharp superconducting transition and the enhanced superconducting properties of the HEA-type samples may indicate the effectiveness of the HEA states of the REO blocking layers in the REO0.5F0.5BiS2 system.

Simultaneous Multiwavelength Variability Characterization of the Free-floating Planetary-mass Object PSO J318.5‑22

NASA Astrophysics Data System (ADS)

Biller, Beth A.; Vos, Johanna; Buenzli, Esther; Allers, Katelyn; Bonnefoy, Mickaël; Charnay, Benjamin; Bézard, Bruno; Allard, France; Homeier, Derek; Bonavita, Mariangela; Brandner, Wolfgang; Crossfield, Ian; Dupuy, Trent; Henning, Thomas; Kopytova, Taisiya; Liu, Michael C.; Manjavacas, Elena; Schlieder, Joshua

2018-02-01

We present simultaneous Hubble Space Telescope (HST) WFC3+Spitzer IRAC variability monitoring for the highly variable young (∼20 Myr) planetary-mass object PSO J318.5‑22. Our simultaneous HST + Spitzer observations covered approximately two rotation periods with Spitzer and most of a rotation period with the HST. We derive a period of 8.6 ± 0.1 hr from the Spitzer light curve. Combining this period with the measured v\\sin i for this object, we find an inclination of 56.°2 ± 8.°1. We measure peak-to-trough variability amplitudes of 3.4% ± 0.1% for Spitzer Channel 2 and 4.4%–5.8% (typical 68% confidence errors of ∼0.3%) in the near-IR bands (1.07–1.67 μm) covered by the WFC3 G141 prism—the mid-IR variability amplitude for PSO J318.5‑22 is one of the highest variability amplitudes measured in the mid-IR for any brown dwarf or planetary-mass object. Additionally, we detect phase offsets ranging from 200° to 210° (typical error of ∼4°) between synthesized near-IR light curves and the Spitzer mid-IR light curve, likely indicating depth-dependent longitudinal atmospheric structure in this atmosphere. The detection of similar variability amplitudes in wide spectral bands relative to absorption features suggests that the driver of the variability may be inhomogeneous clouds (perhaps a patchy haze layer over thick clouds), as opposed to hot spots or compositional inhomogeneities at the top-of-atmosphere level.

Conscientious objection to referrals for abortion: pragmatic solution or threat to women’s rights?

PubMed Central

2014-01-01

Background Conscientious objection has spurred impassioned debate in many Western countries. Some Norwegian general practitioners (GPs) refuse to refer for abortion. Little is know about how the GPs carry out their refusals in practice, how they perceive their refusal to fit with their role as professionals, and how refusals impact patients. Empirical data can inform subsequent normative analysis. Methods Qualitative research interviews were conducted with seven GPs, all Christians. Transcripts were analysed using systematic text condensation. Results Informants displayed a marked ambivalence towards their own refusal practices. Five main topics emerged in the interviews: 1) carrying out conscientious objection in practice, 2) justification for conscientious objection, 3) challenges when relating to colleagues, 4) ambivalence and consistency, 5) effects on the doctor-patient relationship. Conclusions Norwegian GP conscientious objectors were given to consider both pros and cons when evaluating their refusal practices. They had settled on a practical compromise, the precise form of which would vary, and which was deemed an acceptable middle way between competing interests. PMID:24571955

25 Tb/s transmission over 5,530 km using 16QAM at 5.2 b/s/Hz spectral efficiency.

PubMed

Cai, J-X; Batshon, H G; Zhang, H; Davidson, C R; Sun, Y; Mazurczyk, M; Foursa, D G; Sinkin, O; Pilipetskii, A; Mohs, G; Bergano, Neal S

2013-01-28

We transmit 250x100G PDM RZ-16QAM channels with 5.2 b/s/Hz spectral efficiency over 5,530 km using single-stage C-band EDFAs equalized to 40 nm. We use single parity check coded modulation and all channels are decoded with no errors after iterative decoding between a MAP decoder and an LDPC based FEC algorithm. We also observe that the optimum power spectral density is nearly independent of SE, signal baud rate or modulation format in a dispersion uncompensated system.

Chemical Signature of Biomass Burning Emitted PM2.5 as Revealed by a C/N/S Multi- Elemental Scanning Thermal Analysis (MESTA) Technique

NASA Astrophysics Data System (ADS)

Hsieh, Y.; Bugna, G.

2006-12-01

Uncertainty of black carbon (BC) research is often plagued by the analytical difficulty associated with separating carbon components in solid samples. A rapid and sensitive multi-elemental scanning thermal analysis (MESTA), originally developed for organic matter analysis in solid samples, was applied to this study. The objective was to identify the chemical signature of biomass burning emitted PM2.5 (aerosols less than 2.5 micron) for tracing purposes. We collected PM2.5 from the burning of various biomass of a pine forest and from the ambient air of an urban campus using a PM sampler. The MESTA provides simultaneous C, N and S thermograms of the PM2.5 samples that can be used for characterization and identification purposes. This study showed that the PM2.5 samples produced from the burning of forest biomass can be characterized by a high temperature (greater than 350 oC) volatile organic component with high C/N ratio and no S content while those produced from the ambient air can be characterized by a low temperature (less than 350 oC) volatile organic component with low C/N ratio and high S content. Burning of the soaked woody debris, however, produced significant amount of the low-temperature volatile organic component similar to that of the ambient air in C/N ratio but different in S content. Most PM2.5 samples have a very low temperature (less than 110 oC) volatile N component that is identified as absorbed ammonia. The absorbed ammonia is most significant in the PM2.5 of the ambient air and the burning of soaked woody debris. All PM2.5 samples have significant amount of BC which volatilized above 500 oC with very high C/N ratio. This study also shows that MESTA can provide an objective means to present the chemical signature of the whole spectrum of OC/BC in the PM2.5 samples.

Learning Distance Functions for Exemplar-Based Object Recognition

DTIC Science & Technology

2007-08-08

requires prior specific permission. Learning Distance Functions for Exemplar-Based Object Recognition by Andrea Lynn Frome B.S. ( Mary Washington...fantastic advisor and advocate when I was at Mary Washington College i and has since become a dear friend. Thank you, Dr. Bass, for continuing to stand...Antonio Torralba. 5 Chapter 1. Introduction 0 5 10 15 20 25 30 35 10 15 20 25 30 35 40 45 50 55 60 65 70 Number of training examples per class M ea n

Effect of 5-S-GAD on UV-B-induced cataracts in rats.

PubMed

Kawada, Hiroyoshi; Kojima, Masami; Kimura, Takahito; Natori, Shunji; Sasaki, Kazuyuki; Sasaki, Hiroshi

2009-09-01

5-S-Glutathionyl-N-beta-alanyl-3,4-dihydroxyphenylalanine (5-S-GAD) is a novel antibacterial substance purified from Sarcophaga peregrina (flesh fly) that has both a radical scavenging activity and antioxidative activity. This is a report of an investigation of the effect of 5-S-GAD (eyedrops) on UVB-induced cataracts in rats. Brown Norway male rats (n = 32; 7 weeks old) were treated with either 5-S-GAD 0.1%, 5-SGAD 1%, astaxanthin (AST) 0.1% suspension eyedrops or the vehicle alone (the solution without 5-S-GAD) three times a day (three doses at 5-min intervals each time). The treatment was scheduled 2 days before UV-B exposure and 2 days after UV-B exposure. Exposure to 100-200 mJ/cm(2) UV-B was performed once a week between drug treatments for 9 consecutive weeks, with a total dose of 1200 mJ/cm(2) UV-B. Ocular penetration of 5-S-GAD was analyzed using high-pressure liquid chromatography (HPLC). Cataract formation was documented by an anterior eye segment analysis system once a week under mydriasis. The light-scattering intensity (LSI) of the anterior superficial cortex region was measured. In the eighth to ninth week after the start of UV-B exposure, the LSI of anterior subcapsular lenses of 5-S-GAD-treated groups, as detected by HPLC, was significantly lower (P < 0.05) than that of the control, whereas no such difference was found in the AST-treated group. 5-S-GAD eyedrop application may delay the progression of UV-B-induced cataract in rats.

Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

PubMed Central

Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

1978-01-01

A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

The conformational free-energy landscape of β-D-mannopyranose: evidence for a (1)S(5) → B(2,5) → (O)S(2) catalytic itinerary in β-mannosidases.

PubMed

Ardèvol, Albert; Biarnés, Xevi; Planas, Antoni; Rovira, Carme

2010-11-17

The mechanism of glycosidic bond cleavage by glycosidases involves substrate ring distortions in the Michaelis complex that favor catalysis. Retaining β-mannosidases bind the substrate in a (1)S(5) conformation, and recent experiments have proposed an unusual substrate conformational pathway ((1)S(5) → B(2,5) → (O)S(2)) for the hydrolysis reaction. By means of Car-Parrinello metadynamics simulations, we have obtained the conformational free-energy surface (FES) of a β-d-mannopyranose molecule associated with the ideal Stoddart conformational diagram. We have found that (1)S(5) is among the most stable conformers and simultaneously is the most preactivated conformation in terms of elongation/shortening of the C1-O1/C1-O5 bonds, C1-O1 orientation, and charge development at the anomeric carbon. Analysis of the computed FES gives support to the proposed (1)S(5) → B(2,5) → (O)S(2) catalytic itinerary, showing that the degree of preactivation of the substrate in glycoside hydrolases (GHs) is related to the properties of an isolated sugar ring. We introduce a simple preactivation index integrating several structural, electronic, and energetic properties that can be used to predict the conformation of the substrate in the Michaelis complex of any GH.

Scale invariance of the η-deformed AdS5 × S5 superstring, T-duality and modified type II equations

NASA Astrophysics Data System (ADS)

Arutyunov, G.; Frolov, S.; Hoare, B.; Roiban, R.; Tseytlin, A. A.

2016-02-01

We consider the ABF background underlying the η-deformed AdS5 ×S5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that has 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R-R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R-R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS3 ×S3 ×T4and AdS2 ×S2 ×T6models.

Scale invariance of the η-deformed AdS 5 × S 5 superstring, T-duality and modified type II equations

DOE PAGES

Arutyunov, G.; Frolov, S.; Hoare, B.; ...

2015-12-23

We consider the ABF background underlying the η-deformed AdS 5 × S 5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that hasmore » 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R–R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R–R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS 3 × S 3 × T 4 and AdS 2 × S 2 × T 6 models.« less

Assessing Learning, Quality and Engagement in Learning Objects: The Learning Object Evaluation Scale for Students (LOES-S)

ERIC Educational Resources Information Center

Kay, Robin H.; Knaack, Liesel

2009-01-01

Learning objects are interactive web-based tools that support the learning of specific concepts by enhancing, amplifying, and/or guiding the cognitive processes of learners. Research on the impact, effectiveness, and usefulness of learning objects is limited, partially because comprehensive, theoretically based, reliable, and valid evaluation…

Frequency measurement of the 5 S{1}/{2}(F = 3)-5 D{5}/{2}(F = 5) two-photon transition in rubidium

NASA Astrophysics Data System (ADS)

Touahri, D.; Acef, O.; Clairon, A.; Zondy, J.-J.; Felder, R.; Hilico, L.; de Beauvoir, B.; Biraben, F.; Nez, F.

1997-02-01

We have measured the frequencies of three diode lasers stabilized on the 5 S{1}/{2}(F = 3)-5 D{5}/{2}(F = 5) two-photon transition in rubidium at λ = 778.1 nm, with an uncertainty of 1 kHz, using BNM-LPTF frequency synthesis chain starting from a {CO 2}/{OsO 4} reference laser at 10.3 μm. We show that this frequency chain is able to reach the 10 -13 resolution level. After a discussion of the systematic effects that may shift the resonance, the transition frequency is found to be ν = 385 285 142 378.280 ± 2 kHz.

Objective Biomarkers of Balance and Gait for Parkinson’s Disease using Body-worn Sensors

PubMed Central

Horak, Fay B; Mancini, Martina

2014-01-01

Balance and gait impairments characterize progression of Parkinson’s disease (PD), predict fall risk, and are important contributors to reduced quality of life. Advances in technology of small, body-worn inertial sensors have made it possible to develop quick, objective measures of balance and gait impairments in the clinic for research trials and clinical practice. Objective balance and gait metrics may eventually provide useful biomarkers for PD. In fact, objective balance and gait measures are already being used as surrogate end-points for demonstrating clinical efficacy of new treatments, in place of counting falls from diaries, using stop-watch measures of gait speed, or clinical balance rating scales. This review summarizes the types of objective measures available from body-worn sensors. We organize the metrics based on the neural control system for mobility affected by PD: postural stability in stance, postural responses, gait initiation, gait (temporal-spatial lower and upper body coordination and dynamic equilibrium), postural transitions, and freezing of gait. However, the explosion of metrics derived by wearable sensors during prescribed balance and gait tasks that are abnormal in people with PD do not yet qualify as behavioral biomarkers because many balance and gait impairments observed in PD are not specific to the disease, nor shown to be related to specific pathophysiologic biomarkers. In the future, the most useful balance and gait biomarkers for PD will be those that are sensitive and specific for early PD and related to the underlying disease process. PMID:24132842

Objective Assessment of General Surgery Residents Followed by Remediation.

PubMed

Gas, Becca L; Buckarma, EeeLN H; Mohan, Monali; Pandian, T K; Farley, David R

Surgical training programs often lack objective assessment strategies. Complicated scheduling characteristics frequently make it difficult for surgical residents to undergo formal assessment; actually having the time and opportunity to remediate poor performance is an even greater problem. We developed a novel methodology of assessment for residents and created an efficient remediation system using a combination of simulation, online learning, and self-assessment options. Postgraduate year (PGY) 2 to 5 general surgery (GS) residents were tested in a 5 station, objective structured clinical examination style event called the Surgical X-Games. Stations were 15 minutes in length and tested both surgical knowledge and technical skills. Stations were scored on a scale of 1 to 5 (1 = Fail, 2 = Mediocre, 3 = Pass, 4 = Good, and 5 = Stellar). Station scores ≤ 2 were considered subpar and required remediation to a score ≥ 4. Five remediation sessions allowed residents the opportunity to practice the stations with staff surgeons. Videos of each skill or test of knowledge with clear instructions on how to perform at a stellar level were offered. Trainees also had the opportunity to checkout take-home task trainers to practice specific skills. Residents requiring remediation were then tested again in-person or sent in self-made videos of their performance. Academic medical center. PGY2, 3, 4, and 5 GS residents at Mayo Clinic in Rochester, MN. A total of, 35 residents participated in the Surgical X-Games in the spring of 2015. Among all, 31 (89%) had scores that were deemed subpar on at least 1 station. Overall, 18 (58%) residents attempted remediation. All 18 (100%) achieved a score ≥ 4 on the respective stations during a makeup attempt. Overall X-Games scores and those of PGY2s, 3s, and 4s were higher after remediation (p < 0.05). No PGY5s attempted remediation. Despite difficulties with training logistics and busy resident schedules, it is feasible to objectively

Synchrotron powder X-ray diffraction and structural analysis of Eu0.5La0.5FBiS2-x Se x

NASA Astrophysics Data System (ADS)

Nagasaka, K.; Jinno, G.; Miura, O.; Miura, A.; Moriyoshi, C.; Kuroiwa, Y.; Mizuguchi, Y.

2017-07-01

Eu0.5La0.5FBiS2-x Se x is a new BiS2-based superconductor system. In Eu0.5La0.5FBiS2-x Se x , electron carriers are doped to the BiS2 layer by the substitution of Eu by La. Bulk superconductivity in this system is induced by increasing the in-plane chemical pressure, which is controlled by the Se concentration (x). In this study, we have analysed the crystal structure of Eu0.5La0.5FBiS2-x Se x using synchrotron powder diffraction and the Rietveld refinement. The precise determination of the structural parameters and thermal factors suggest that the emergence of bulk superconductivity in Eu0.5La0.5FBiS2-x Se x is achieved by the enhanced in-plane chemical pressure and the decrease in in-plane disorder.

Learning Distance Functions for Exemplar-Based Object Recognition

DTIC Science & Technology

2007-01-01

Learning Distance Functions for Exemplar-Based Object Recognition by Andrea Lynn Frome B.S. ( Mary Washington College) 1996 A dissertation submitted...advisor and advocate when I was at Mary Washington College i and has since become a dear friend. Thank you, Dr. Bass, for continuing to stand by my...Torralba. 5 Chapter 1. Introduction 0 5 10 15 20 25 30 35 10 15 20 25 30 35 40 45 50 55 60 65 70 Number of training examples per class M ea n re co

CLB5-dependent activation of late replication origins in S. cerevisiae.

PubMed

Donaldson, A D; Raghuraman, M K; Friedman, K L; Cross, F R; Brewer, B J; Fangman, W L

1998-08-01

Replication origins in chromosomes are activated at specific times during the S phase. We show that the B-type cyclins are required for proper execution of this temporal program. clb5 cells activate early origins but not late origins, explaining the previously described long clb5 S phase. Origin firing appears normal in cIb6 mutants. In clb5 clb6 double mutant cells, the late origin firing defect is suppressed, accounting for the normal duration of the phase despite its delayed onset. Therefore, Clb5p promotes the timely activation of early and late origins, but Clb6p can activate only early origins. In clb5 clb6 mutants, the other B-type cyclins (Clb1-4p) promote an S phase during which both early and late replication origins fire.

Phenomenology with F-theory S U (5 )

NASA Astrophysics Data System (ADS)

Leontaris, George K.; Shafi, Qaisar

2017-09-01

We explore the low-energy phenomenology of an F-theory-based S U (5 ) model which, in addition to the known quarks and leptons, contains Standard Model (SM) singlets and vectorlike color triplets and S U (2 ) doublets. Depending on their masses and couplings, some of these new particles may be observed at the LHC and future colliders. We discuss the restrictions by Cabibbo-Kobayashi-Maskawa matrix constraints on their mixing with the ordinary down quarks of the three chiral families. The model is consistent with gauge coupling unification at the usual supersymmetric GUT scale; dimension-five proton decay is adequately suppressed, while dimension-six decay mediated by the superheavy gauge bosons is enhanced by a factor of 5-7. The third generation charged fermion Yukawa couplings yield the corresponding low-energy masses in reasonable agreement with observations. The hierarchical nature of the masses of lighter generations is accounted for via nonrenormalizable interactions, with the perturbative vacuum expectation values (VEVs) of the SM singlet fields playing an essential role.

Physical locations of 5S and 18S-25S rDNA in Asian and American diploid Hordeum species with the I genome.

PubMed

Taketa, S; Ando, H; Takeda, K; von Bothmer, R

2001-05-01

The physical locations of 5S and 18S-25S rDNA sequences in 15 diploid Hordeum species with the I genome were examined by double-target in situ hybridization with pTa71 (18S-25S rDNA) and pTa794 (5S rDNA) clones as probes. All the three Asian species had a species-specific rDNA pattern. In 12 American species studied, eight different rDNA types were found. The type reported previously in H. chilense (the 'chilense' type) was observed in eight American species. The chilense type had double 5S rDNA sites - two sites on one chromosome arm separated by a short distance - and two pairs of major 18S-25S rDNA sites on two pairs of satellite chromosomes. The other seven types found in American species were similar to the chilense type and could be derived from the chilense type through deletion, reduction or addition of a rDNA site. Intraspecific polymorphisms were observed in three American species. The overall similarity in rDNA patterns among American species indicates the close relationships between North and South American species and their derivation from a single ancestral source. The differences in the distribution patterns of 5S and 18S-25S rDNA between Asian and American species suggest differentiation between the I genomes of Asian and American species. The 5S and 18S-25S rDNA sites are useful chromosome markers for delimiting Asian species, but have limited value as a taxonomic character in American species. On the basis of rDNA patterns, karyotype evolution and phylogeny of the I-genome diploid species are discussed.

Constructing Cd0.5Zn0.5S@ZIF-8 nanocomposites through self-assembly strategy to enhance Cr(VI) photocatalytic reduction.

PubMed

Qiu, Jianhao; Zhang, Xiong-Fei; Zhang, Xingguang; Feng, Yi; Li, Yuxin; Yang, Lvye; Lu, Haiqiang; Yao, Jianfeng

2018-05-05

A novel and highly efficient photocatalyst of Cd 0.5 Zn 0.5 S@ZIF-8 nanocomposite has been developed by a facile self-assembly strategy. This is the first report on the application of Cd x Zn 1-x S and metal-organic framework (MOF) nanocomposite as photocatalysts for the reduction of Cr(VI). The resulting Cd 0.5 Zn 0.5 S@ZIF-8 exhibited higher photocatalytic activity than that of pristine Cd 0.5 Zn 0.5 S and ZIF-8. Particularly, the CZS@Z60 composite with 60 wt% of ZIF-8 exhibited a photocatalytic activity that is about 1.6 times as high as that of Cd 0.5 Zn 0.5 S. The dominant reason for the improved photocatalytic reduction potential is proved to be the newly-formed interfacial SZn bonds that firmly connect Cd 0.5 Zn 0.5 S and ZIF-8 and substantially improve the separation efficiency of photo-excited electrons and holes. The newly-formed chemical bonds are confirmed by XPS analyses, and the prolonged lifetime of photo-excited electrons is evidenced by the electrochemical measurement of photocurrent, which shows that the photocurrent on Cd 0.5 Zn 0.5 S@ZIF-8 is much higher than that of Cd 0.5 Zn 0.5 S and ZIF-8. This study clearly demonstrates that the MOF-based composite nanomaterials hold great promises for applications in the field of environmental remediation and for design of novel photocatalytic materials. Copyright © 2018 Elsevier B.V. All rights reserved.

Agonist and antagonist actions of antipsychotic agents at 5-HT1A receptors: a [35S]GTPgammaS binding study.

PubMed

Newman-Tancredi, A; Gavaudan, S; Conte, C; Chaput, C; Touzard, M; Verrièle, L; Audinot, V; Millan, M J

1998-08-21

Recombinant human (h) 5-HT1A receptor-mediated G-protein activation was characterised in membranes of transfected Chinese hamster ovary (CHO) cells by use of guanosine-5'-O-(3-[35S]thio)-triphosphate ([35S]GTPgammaS binding). The potency and efficacy of 21 5-HT receptor agonists and antagonists was determined. The agonists, 5-CT (carboxamidotryptamine) and flesinoxan displayed high affinity (subnanomolar Ki values) and high efficacy (Emax > 90%, relative to 5-HT = 100%). In contrast, ipsapirone, zalospirone and buspirone displayed partial agonist activity. EC50s for agonist stimulation of [35S]GTPgammaS binding correlated well with Ki values from competition binding (r = +0.99). Among the compounds tested for antagonist activity, methiothepin and (+)butaclamol exhibited 'inverse agonist' behaviour, inhibiting basal [35S]GTPgammaS binding. The actions of 17 antipsychotic agents were investigated. Clozapine and several putatively 'atypical' antipsychotic agents, including ziprasidone, quetiapine and tiospirone, exhibited partial agonist activity and marked affinity at h5-HT1A receptors, similar to their affinity at hD2 dopamine receptors. In contrast, risperidone and sertindole displayed low affinity at h5-HT1A receptors and behaved as 'neutral' antagonists, inhibiting 5-HT-stimulated [35S]GTPgammaS binding. Likewise the 'typical' neuroleptics, haloperidol, pimozide, raclopride and chlorpromazine exhibited relatively low affinity and 'neutral' antagonist activity at h5-HT1A receptors with Ki values which correlated with their respective Kb values. The present data show that (i) [35S]GTPgammaS binding is an effective method to evaluate the efficacy and potency of agonists and antagonists at recombinant human 5-HT1A receptors. (ii) Like clozapine, several putatively 'atypical' antipsychotic drugs display balanced serotonin h5-HT1A/dopamine hD2 receptor affinity and partial agonist activity at h5-HT1A receptors. (iii) Several 'typical' and some putatively 'atypical

Crystallographic and optical properties and band diagrams of CuGaS2 and CuGa5S8 phases in Cu-poor Cu2S-Ga2S3 pseudo-binary system

NASA Astrophysics Data System (ADS)

Maeda, Tsuyoshi; Yu, Ying; Chen, Qing; Ueda, Kenta; Wada, Takahiro

2017-04-01

We synthesized Cu-poor Cu-Ga-S samples such, as CuGaS2 and CuGa5S8 with the composition of (1 - x)Cu2S-(x)Ga2S3 with 0.5 ≤ x ≤ 1.0, by a mechanochemical process and sequential heating. The crystal structure changes from tetragonal chalcopyrite-type CuGaS2 (0.5 ≤ x ≤ 0.55) to tetragonal stannite-type CuGa5S8 (x = 0.8). For samples with 0.60 ≤ x ≤ 0.75, the diffraction peaks were identified to be those of a mixed phase of the chalcopyrite- and stannite-type structures. The band-gap energies of Cu-poor Cu-Ga-S samples increase in a stepwise manner with increasing x. The band-gap energy of CuGa5S8 (x = 0.8) with the tetragonal stannite-type structure is approximately 2.66 eV, which is wider than that of chalcopyrite-type CuGaS2 (2.45 eV). The energy levels of valence band maxima (VBMs) were estimated from the ionization energies measured by photoemission yield spectroscopy (PYS). The energy levels of the VBM and conduction band minimum (CBM) of the Cu-poor Cu-Ga-S samples decrease significantly with increasing x (decreasing Cu/Ga ratio). The energy level of the VBM of CuGaS2 (-5.8 eV) is considerably deeper than those of CuInSe2 (-5.2 eV) and CuInS2 (-5.5 eV). The VBM of stannite-type CuGa5S8 with x = 0.8 (-6.4 eV) is much deeper than that of chalcopyrite-type CuGaS2 (-5.8 eV) and stannite-type CuIn3Se5 (-5.6 eV). In order to understand the band structures of chalcopyrite-type CuGaS2 and stannite-type CuGa5S8, we performed first-principles calculations using the Heyd-Scuseria-Ernzerhof (HSE06), nonlocal screened hybrid density functional method. The theoretical band-gap energy of stannite-type CuGa5S8 (2.2 eV) is wider than that of chalcopyrite-type CuGaS2 (2.0 eV). Both the theoretical and experimental band gaps of stannite-type CuGa5S8 are about 0.2 eV wider than those of chalcopyrite-type CuGaS2.

Sexual Health Curricula in U.S. Medical Schools: Current Educational Objectives

ERIC Educational Resources Information Center

Galletly, Carol; Lechuga, Julia; Layde, Joseph B.; Pinkerton, Steven

2010-01-01

Objective: The authors identify the explicit and implicit objectives that shape decisions about what medical schools teach regarding human sexuality. Methods: The authors reviewed relevant articles in journals, physician licensing examinations, and publications by professional organizations to identify learning objectives for human sexuality in…

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

iPhone 4s and iPhone 5s Imaging of the Eye.

PubMed

Jalil, Maaz; Ferenczy, Sandor R; Shields, Carol L

2017-01-01

To evaluate the technical feasibility of a consumer-grade cellular iPhone camera as an ocular imaging device compared to existing ophthalmic imaging equipment for documentation purposes. A comparison of iPhone 4s and 5s images was made with external facial images (macrophotography) using Nikon cameras, slit-lamp images (microphotography) using Zeiss photo slit-lamp camera, and fundus images (fundus photography) using RetCam II. In an analysis of six consecutive patients with ophthalmic conditions, both iPhones achieved documentation of external findings (macrophotography) using standard camera modality, tap to focus, and built-in flash. Both iPhones achieved documentation of anterior segment findings (microphotography) during slit-lamp examination through oculars. Both iPhones achieved fundus imaging using standard video modality with continuous iPhone illumination through an ophthalmic lens. Comparison to standard ophthalmic cameras, macrophotography and microphotography were excellent. In comparison to RetCam fundus photography, iPhone fundus photography revealed smaller field and was technically more difficult to obtain, but the quality was nearly similar to RetCam. iPhone versions 4s and 5s can provide excellent ophthalmic macrophotography and microphotography and adequate fundus photography. We believe that iPhone imaging could be most useful in settings where expensive, complicated, and cumbersome imaging equipment is unavailable.

Experience with Malleable Objects Influences Shape-based Object Individuation by Infants

PubMed Central

Woods, Rebecca J.; Schuler, Jena

2014-01-01

Infants’ ability to accurately represent and later recognize previously viewed objects, and conversely, to discriminate novel objects from those previously seen improves remarkably over the first two years of life. During this time, infants acquire extensive experience viewing and manipulating objects and these experiences influence their physical reasoning. Here we posited that infants’ observations of object feature stability (rigid versus malleable) can influence use of those features to individuate two successively viewed objects. We showed 8.5-month-olds a series of objects that could or could not change shape then assessed their use of shape as a basis for object individuation. Infants who explored rigid objects later used shape differences to individuate objects; however, infants who explored malleable objects did not. This outcome suggests that the latter infants did not take into account shape differences during the physical reasoning task and provides further evidence that infants’ attention to object features can be readily modified based on recent experiences. PMID:24561541

Shifting Weights: Adapting Object Detectors from Image to Video (Author’s Manuscript)

DTIC Science & Technology

2012-12-08

Skateboard Sewing Machine Sandwich Figure 1: Images of the “Skateboard”, “ Sewing machine ”, and “Sandwich” classes taken from (top row) ImageNet [7...9.85% 9.45% 12.49% 0.21% 6.68% Sewing machine 9.76% 9.71% 10.35% 10.35% 0.12% 3.81% Mean AP 6.63% 6.33% 8.29% 9.36% 0.74% 5.06% Table 2: Average...Animal”, “Tire”, “Vehicle”, “Sandwich”, and “ Sewing machine ”. These objects appear respectively in the events “Attempting a 6 Sandwich Car New

Enzymes Involved in Naproxen Degradation by Planococcus sp. S5.

PubMed

Wojcieszyńska, Danuta; Domaradzka, Dorota; Hupert-Kocurek, Katarzyna; Guzik, Urszula

2016-01-01

Naproxen is a one of the most popular non-steroidal anti-inflammatory drugs (NSAIDs) entering the environment as a result of high consumption. For this reason, there is an emerging need to recognize mechanisms of its degradation and enzymes engaged in this process. Planococcus sp. S5 is a gram positive strain able to degrade naproxen in monosubstrate culture (27%). However, naproxen is not a sufficient growth substrate for this strain. In the presence of benzoate, 4-hydroxybenzoic acid, 3,4-dihydroxybenzoic acid or vanillic acid as growth substrates, the degradation of 21.5%, 71.71%, 14.75% and 8.16% of naproxen was observed respectively. It was shown that the activity of monooxygenase, hydroxyquinol 1,2-dioxygenase, protocatechuate 3,4-dioxygenase and protocatechuate 4,5-dioxyegnase in strain S5 was induced after growth of the strain with naproxen and 4-hydroxybenzoate. Moreover, in the presence of naproxen activity of gentisate 1,2-dioxygenase, enzyme engaged in 4-hydroxybenzoate metabolism, was completely inhibited. The obtained results suggest that monooxygenase and hydroxyquinol 1,2-dioxygenase are the main enzymes in naproxen degradation by Planococcus sp. S5.

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

PubMed

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

Enamel Surface with Pit and Fissure Sealant Containing 45S5 Bioactive Glass.

PubMed

Yang, S-Y; Kwon, J-S; Kim, K-N; Kim, K-M

2016-05-01

Enamel demineralization adjacent to pit and fissure sealants leads to the formation of marginal caries, which can necessitate the replacement of existing sealants. Dental materials with bioactive glass, which releases ions that inhibit dental caries, have been studied. The purpose of this study was to evaluate the enamel surface adjacent to sealants containing 45S5 bioactive glass (BAG) under simulated microleakage between the material and the tooth in a cariogenic environment. Sealants containing 45S5BAG filler were prepared as follows: 0% 45S5BAG + 50.0% glass (BAG0 group), 12.5% 45S5BAG + 37.5% glass (BAG12.5 group), 25.0% 45S5BAG + 25.0% glass (BAG25.0 group), 37.5% 45S5BAG + 12.5% glass (BAG37.5 group), and 50.0% 45S5BAG + 0% glass (BAG50.0 group). A cured sealant disk was placed over a flat bovine enamel disk, separated by a 60-µm gap, and immersed in lactic acid solution (pH 4.0) at 37 °C for 15, 30, and 45 d. After the storage period, each enamel disk was separated from the cured sealant disk, and the enamel surface was examined with optical 3-dimensional surface profilometer, microhardness tester, and scanning electron microscopy. The results showed a significant increase in roughness and a decrease in microhardness of the enamel surface as the proportion of 45S5BAG decreased (P< 0.05). In the scanning electron microscopy images, enamel surfaces with BAG50.0 showed a smooth surface, similar to those in the control group with distilled water, even after prolonged acid storage. Additionally, an etched pattern was observed on the surface of the demineralized enamel with a decreasing proportion of 45S5BAG. Increasing the 45S5BAG filler contents of the sealants had a significant impact in preventing the demineralization of the enamel surface within microgaps between the material and the tooth when exposed to a cariogenic environment. Therefore, despite some marginal leakage, these novel sealants may be effective preventive dental materials for inhibiting

Motor Experience Influences Object Knowledge

PubMed Central

Chrysikou, Evangelia G.; Casasanto, Daniel; Thompson-Schill, Sharon L.

2016-01-01

An object’s perceived readiness-for-action (e.g., its size, the degree of rotation from its canonical position, or the user’s viewpoint) can influence semantic knowledge retrieval. Yet, the organization of object knowledge may also be affected by body-specific sensorimotor experiences. Here, we investigated whether people’s history of performing motor actions with their hands influences the knowledge they store and retrieve about graspable objects. We compared object representations between healthy right- and left-handers (Experiment 1), and between unilateral stroke patients, whose motor experience was changed by impairment of either their right or left hand (Experiment 2). Participants saw pictures of graspable everyday items with the handles oriented toward either the left or right hand, and they generated the type of grasp they would employ (i.e., clench or pinch) when using each object, responding orally. In both experiments, hand dominance and object orientation interacted to predict response times. In Experiment 1, judgments were fastest when objects were oriented toward the right hand in right-handers, but not in left-handers. In Experiment 2, judgments were fastest when objects were oriented toward the left hand in patients who had lost the use of their right hand, even though these patients were right-handed prior to brain injury. Results suggest that at least some aspects of object knowledge are determined by motor experience, and can be changed by new patterns of motor experience. People with different bodily characteristics, who interact with objects in systematically different ways, form correspondingly different neurocognitive representations of the same common objects. PMID:28253009

Pipsqueak Star Unleashes Monster Flare

NASA Image and Video Library

2017-12-08

NASA release date May 9, 2008 An artist depicts the incredibly powerful flare that erupted from the red dwarf star EV Lacertae. Credit: Casey Reed/NASA To read more about this image go to: www.nasa.gov/topics/universe/features/pipsqueak_star.html NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram

The 5S lean method as a tool of industrial management performances

NASA Astrophysics Data System (ADS)

Filip, F. C.; Marascu-Klein, V.

2015-11-01

Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

Feasibility of reducing fines in S-5 mixes.

DOT National Transportation Integrated Search

1975-01-01

The study investigated the feasibility of eliminating aggregate particulates passing the #200 and #100 sieves from a surface mix (S-5) gradation. Feasibility was to be determined on the basis of test mixtures, with particulates deleted, meeting Virgi...

Effective Use of Java Data Objects in Developing Database Applications; Advantages and Disadvantages

DTIC Science & Technology

2004-06-01

DATA OBJECTS IN DEVELOPING DATABASE APPLICATIONS. ADVANTAGES AND DISADVANTAGES Paschalis Zilidis June 2004 Thesis Advisor: Thomas...Objects in Developing Database Applications. Advantages and Disadvantages 6. AUTHOR(S) Paschalis ZILIDIS 5. FUNDING NUMBERS 7. PERFORMING...database for the backend datastore. The major disadvantage of this approach is the well-known “impedance mismatch” in which some form of mapping is

Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

PubMed Central

Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

2013-01-01

We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G . incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G . raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

PubMed

Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

2013-01-01

We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

Correlation of Objective Assessment Data With General Surgery Resident In-Training Evaluation Reports and Operative Volumes.

PubMed

Abdelsattar, Jad M; AlJamal, Yazan N; Ruparel, Raaj K; Rowse, Phillip G; Heller, Stephanie F; Farley, David R

2018-05-14

Faculty evaluations, ABSITE scores, and operative case volumes often tell little about true resident performance. We developed an objective structured clinical examination called the Surgical X-Games (5 rooms, 15 minutes each, 12-15 tests total, different for each postgraduate [PGY] level). We hypothesized that performance in X-Games will prove more useful in identifying areas of strength or weakness among general surgery (GS) residents than faculty evaluations, ABSITE scores, or operative cases volumes. PGY 2 to 5 GS residents (n = 35) were tested in a semiannual X-Games assessment using multiple simulation tasks: laparoscopic skills, bowel anastomosis, CT/CXR analysis, chest tube placement, etc. over 1 academic year. Resident scores were compared to their ABSITE, in-training evaluation reports, and operating room case numbers. Academic medical center. PGY-2, 3, 4, and 5 GS residents at Mayo Clinic in Rochester, MN. Results varied greatly within each class except for staff evaluations: in-training evaluation reports medians for PGY-2s were 5.3 (range: 5.0-6.0), PGY-3s 5.9 (5.5-6.3), PGY-4s 5.6 (5.0-6.0), and PGY-5s were 6.1 (5.6-6.9). Although ABSITE and operating room case volumes fluctated greatly with each PGY class, only X-Games scores (median: PGY-2 = 82, PGY-3 = 61, PGY-4 = 76, and PGY-5 = 60) correlated positively (p < 0.05) with operative case volume and negatively (p < 0.05) with staff evaluations. X-Games assessment generated wide differentiation of resident performance quickly, inexpensively, and objectively. Although "Minnesota-nice" surgical staff may feel all GS trainees are "above average," objective assessment tells us otherwise. Copyright © 2018 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

PubMed Central

Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

2006-01-01

As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

PubMed

Garcia, S; Kovařík, A

2013-07-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

Mineral Information Extraction Based on GAOFEN-5'S Thermal Infrared Data

NASA Astrophysics Data System (ADS)

Liu, L.; Shang, K.

2018-04-01

Gaofen-5 carries six instruments aimed at various land and atmosphere applications, and it's an important unit of China High-resolution Earth Observation System. As Gaofen-5's thermal infrared payload is similar to that of ASTER, which is widely used in mineral exploration, application of Gaofen-5's thermal infrared data is discussed regarding its capability in mineral classification and silica content estimation. First, spectra of silicate, carbonate, sulfate minerals from a spectral library are used to conduct spectral feature analysis on Gaofen-5's thermal infrared emissivities. Spectral indices of band emissivities are proposed, and by setting thresholds of these spectral indices, it can classify three types of minerals mentioned above. This classification method is tested on a simulated Gaofen-5 emissivity image. With samples acquired from the study area, this method is proven to be feasible. Second, with band emissivities of silicate and their silica content from the same spectral library, correlation models have been tried to be built for silica content inversion. However, the highest correlation coefficient is merely 0.592, which is much lower than that of correlation model built on ASTER thermal infrared emissivity. It can be concluded that GF-5's thermal infrared data can be utilized in mineral classification but not in silica content inversion.

9 CFR 102.5 - U.S. Veterinary Biological Product License.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false U.S. Veterinary Biological Product... BIOLOGICAL PRODUCTS § 102.5 U.S. Veterinary Biological Product License. (a) Authorization to produce each biological product shall be specified on a U.S. Veterinary Biological Product License, issued by the...

9 CFR 102.5 - U.S. Veterinary Biological Product License.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false U.S. Veterinary Biological Product... BIOLOGICAL PRODUCTS § 102.5 U.S. Veterinary Biological Product License. (a) Authorization to produce each biological product shall be specified on a U.S. Veterinary Biological Product License, issued by the...

Structures of (5′S)-8,5′-Cyclo-2′-deoxyguanosine Mismatched with dA or dT

PubMed Central

2012-01-01

Diastereomeric 8,5′-cyclopurine 2′-deoxynucleosides, containing a covalent bond between the deoxyribose and the purine base, are induced in DNA by ionizing radiation. They are suspected to play a role in the etiology of neurodegeneration in xeroderma pigmentosum patients. If not repaired, the S-8,5′-cyclo-2′-deoxyguanosine lesion (S-cdG) induces Pol V-dependent mutations at a frequency of 34% in Escherichia coli. Most are S-cdG → A transitions, suggesting mis-incorporation of dTTP opposite the lesion during replication bypass, although low levels of S-cdG → T transversions, arising from mis-incorporation of dATP, are also observed. We report the structures of 5′-d(GTGCXTGTTTGT)-3′·5′-d(ACAAACAYGCAC)-3′, where X denotes S-cdG and Y denotes either dA or dT, corresponding to the situation following mis-insertion of either dTTP or dATP opposite the S-cdG lesion. The S-cdG·dT mismatch pair adopts a wobble base pairing. This provides a plausible rationale for the S-cdG → A transitions. The S-cdG·dA mismatch pair differs in conformation from the dG·dA mismatch pair. For the S-cdG·dA mismatch pair, both S-cdG and dA intercalate, but no hydrogen bonding is observed between S-cdG and dA. This is consistent with the lower levels of S-cdG → T transitions in E. coli. PMID:22309170

Centrality dependence of ψ(2S) suppression in p-Pb collisions at s N N = 5.02 $$ {\\sqrt{s}}_{\\mathrm{NN}}=5.02 $$ TeV

DOE PAGES

Adam, J.; Adamová, D.; Aggarwal, M. M.; ...

2016-06-08

The inclusive production of the ψ(2S) charmonium state was studied as a function of centrality in p-Pb collisions at the nucleon-nucleon center of mass energy √ sNN = 5.02 TeV at the CERN LHC. The measurement was performed with the ALICE detector in the center of mass rapidity ranges -4.46 < y cms < -2.96 and 2.03 < y cms < 3.53, down to zero transverse momentum, by reconstructing the ψ(2S) decay to a muon pair. The ψ(2S) production cross section σ ψ(2S) is presented as a function of the collision centrality, which is estimated through the energy deposited inmore » forward rapidity calorimeters. The relative strength of nuclear effects on the ψ(2S) and on the corresponding 1S charmonium state J/ψ is then studied by means of the double ratio of cross sections [σ ψ(2S) /σ J/ψ] pPb /[σ ψ(2S) /σ J/ψ] pp between p-Pb and pp collisions, and by the values of the nuclear modification factors for the two charmonium states. The results show a large suppression of ψ(2S) production relative to the J/ψ at backward (negative) rapidity, corresponding to the flight direction of the Pb-nucleus, while at forward (positive) rapidity the suppressions of the two states are comparable. Finally, comparisons to results from lower energy experiments and to available theoretical models are presented.« less

Feasibility and efficacy of the Great Leaders Active StudentS (GLASS) program on children's physical activity and object control skill competency: A non-randomised trial.

PubMed

Nathan, Nicole; Sutherland, Rachel; Beauchamp, Mark R; Cohen, Kristen; Hulteen, Ryan M; Babic, Mark; Wolfenden, Luke; Lubans, David R

2017-12-01

This study aimed to assess the feasibility and efficacy of the Great Leaders Active StudentS (GLASS) program, a school-based peer-led physical activity and object control skill intervention. The study employed a quasi-experimental design. The study was conducted in two elementary schools, one intervention and one comparison, in Newcastle, New South Wales (NSW), Australia from April to June 2015 (N=224 students). Peer leaders (n=20) in the intervention school received training to deliver two 30-min object control skill sessions per week to students in Kindergarten, Grades 1 and 2 (5-8 years, n=83) over one school term (10 weeks). The primary outcome was pedometer assessed physical activity during school hours. Secondary outcomes included students' object control skill competency and peers' leadership self-efficacy and teacher ratings of peers' leadership skills. Almost all (19/20) GLASS sessions were delivered by peer leaders who reported high acceptability of the program. The treatment-by-time interaction for students' physical activity during school hours was not significant (p=0.313). The intervention effect on students' overall object control skills was statistically significant (mean difference 5.8 (95% CI 4.1, 7.4; p<0.001)). Teacher-rated peer leadership significantly improved (0.70; 95% CI 0.38-1.01); p<.001)). The GLASS program was found to be both feasible and acceptable. The intervention also resulted in improvements in students' overall object control skills as well as teacher-rated peers' leadership behaviours. Future fully powered trials using peer leaders to deliver fundamental movement skill (FMS) programs are warranted. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

33 CFR 279.9 - Objective rationale.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Section 279.9 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.9 Objective rationale. (a) Statement of objectives... objective(s) and providing the rationale, impact, and basic management measures for their accomplishment...

33 CFR 279.9 - Objective rationale.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Section 279.9 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.9 Objective rationale. (a) Statement of objectives... objective(s) and providing the rationale, impact, and basic management measures for their accomplishment...

33 CFR 279.9 - Objective rationale.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Section 279.9 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.9 Objective rationale. (a) Statement of objectives... objective(s) and providing the rationale, impact, and basic management measures for their accomplishment...

33 CFR 279.9 - Objective rationale.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Section 279.9 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.9 Objective rationale. (a) Statement of objectives... objective(s) and providing the rationale, impact, and basic management measures for their accomplishment...

33 CFR 279.9 - Objective rationale.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Section 279.9 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.9 Objective rationale. (a) Statement of objectives... objective(s) and providing the rationale, impact, and basic management measures for their accomplishment...

The Sixth Spectrum of Iridium (Ir VI): Determination of the 5d4, 5d36s and 5d36p Configurations

NASA Astrophysics Data System (ADS)

Azarov, V. I.; Gayasov, R. R.; Gayasov, R. R.; Joshi, Y. N.; Churilov, S. S.

The spectrum of five times ionized iridium, Ir VI, was investigated in the 420-1520 Å wavelength region. The analysis has led to the determination of the 5d4, 5d36s and 5d36p configurations. Thirty of thirty four theoretically possible 5d4 levels, 27 of 38 possible 5d36s levels and 96 of 110 possible 5d36p levels have been established. The levels are based on 711 classified spectral lines. The level structure of the configurations has been theoretically interpreted using the orthogonal operators technique. The energy parameters have been determined by a least squares fit to the observed levels. Calculated energy values and LS-compositions, obtained from the fitted parameter values are given.

Cytotoxicity of 45S5 bioglass paste used for dentine hypersensitivity treatment.

PubMed

Bakry, Ahmed Samir; Tamura, Yukihiko; Otsuki, Masayuki; Kasugai, Shohei; Ohya, Keiichi; Tagami, Junji

2011-09-01

45S5 bioglass mixed with 50% phosphoric acid has been suggested to treat dentine hypersensitivity and incipient enamel caries. This study is going to evaluate the biocompatibility of using the aforementioned technique with the rat pulpal cells. The relative cytotoxicity of 45S5 bioglass on rat dental pulp cells was compared to the cytotoxicity of a temporary filling material (Caviton; GC, Japan), Type 1 glass ionomer cement (Fuji I; GC, Tokyo, Japan) and commercial desensitising agent (SuperSeal; Phoenix Dental, Fenton, MI, USA) using a transwell insert model. Cell viability was measured by means of a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The number of viable cell counts were compared using one way ANOVA (p<0.05). The morphological alterations of the pulp cells were observed directly by phase contrast microscope. The results of this study indicated that cell viability recorded by the 45S5 bioglass paste group did not differ significantly from those of the Caviton, glass ionomer or superseal, moreover pulpal cells microscopic analysis revealed that 45S5 bioglass elicited minimal toxic effect. 45S5 bioglass paste can serve as a biocompatible material that can potentially be used safely on dentine. Copyright © 2011 Elsevier Ltd. All rights reserved.

Social object play among young Japanese macaques (Macaca fuscata) in Arashiyama, Japan.

PubMed

Shimada, Masaki

2006-10-01

Social object play (SOP), i.e., social play using portable object(s), among young Japanese macaques (Macaca fuscata; 0-4 years old) in the Arashiyama E troop was studied using a modified sequence sampling method from July to October 2000. SOP was a relatively common activity for most of the young macaques and often continued for long periods. Participants used many kinds of object, including edible natural objects and artificial objects, such as plastic bottles, but they never used provisioned food or wild fruit in SOP bouts. An analysis of long bouts (>/=0.5 min) revealed the following interactive SOP features: (1) at any given time, participants used only one object, and only one participant held the object; (2) during SOP play-chasing, the object holder was likely to be chased by others; (3) during long bouts, the object changed hands frequently; and (4) agonistic competition for an object among young macaques was rare. Combinations of sexes, ages, relative ranks, or matrilines of the object holder and non-holder did not affect the tendency that the holder was chased by non-holder(s) during play-chasing. Even when there was a change in object holders, the repetitiveness of this interactive pattern, i.e., that the holder would be chased during SOP bouts, distinguished the SOP structure from that of other types of social play without object(s). General proximate social play mechanisms, such as self-handicapping or role taking, were associated with SOP. Other mechanisms that affected SOP included the following: (1) young macaques treated an object as a target in play competition, and (2) 'being the holder of a target object' was associated with the 'role of the chasee.'

iPhone 4s and iPhone 5s Imaging of the Eye

PubMed Central

Jalil, Maaz; Ferenczy, Sandor R.; Shields, Carol L.

2017-01-01

Background/Aims To evaluate the technical feasibility of a consumer-grade cellular iPhone camera as an ocular imaging device compared to existing ophthalmic imaging equipment for documentation purposes. Methods A comparison of iPhone 4s and 5s images was made with external facial images (macrophotography) using Nikon cameras, slit-lamp images (microphotography) using Zeiss photo slit-lamp camera, and fundus images (fundus photography) using RetCam II. Results In an analysis of six consecutive patients with ophthalmic conditions, both iPhones achieved documentation of external findings (macrophotography) using standard camera modality, tap to focus, and built-in flash. Both iPhones achieved documentation of anterior segment findings (microphotography) during slit-lamp examination through oculars. Both iPhones achieved fundus imaging using standard video modality with continuous iPhone illumination through an ophthalmic lens. Comparison to standard ophthalmic cameras, macrophotography and microphotography were excellent. In comparison to RetCam fundus photography, iPhone fundus photography revealed smaller field and was technically more difficult to obtain, but the quality was nearly similar to RetCam. Conclusions iPhone versions 4s and 5s can provide excellent ophthalmic macrophotography and microphotography and adequate fundus photography. We believe that iPhone imaging could be most useful in settings where expensive, complicated, and cumbersome imaging equipment is unavailable. PMID:28275604

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Cultural transmission through infant signs: Objects and actions in U.S. and Taiwan.

PubMed

Wang, Wen; Vallotton, Claire

2016-08-01

Infant signs are intentionally taught/learned symbolic gestures which can be used to represent objects, actions, requests, and mental state. Through infant signs, parents and infants begin to communicate specific concepts earlier than children's first spoken language. This study examines whether cultural differences in language are reflected in children's and parents' use of infant signs. Parents speaking East Asian languages with their children utilize verbs more often than do English-speaking mothers; and compared to their English-learning peers, Chinese children are more likely to learn verbs as they first acquire spoken words. By comparing parents' and infants' use of infant signs in the U.S. and Taiwan, we investigate cultural differences of noun/object versus verb/action bias before children's first language. Parents reported their own and their children's use of first infant signs retrospectively. Results show that cultural differences in parents' and children's infant sign use were consistent with research on early words, reflecting cultural differences in communication functions (referential versus regulatory) and child-rearing goals (independent versus interdependent). The current study provides evidence that intergenerational transmission of culture through symbols begins prior to oral language. Copyright © 2016 Elsevier Inc. All rights reserved.

Roma-BZCAT: a multifrequency catalogue of blazars

NASA Astrophysics Data System (ADS)

Massaro, E.; Giommi, P.; Leto, C.; Marchegiani, P.; Maselli, A.; Perri, M.; Piranomonte, S.; Sclavi, S.

2009-02-01

We present a new catalogue of blazars based on multifrequency surveys and on an extensive review of the literature. Blazars are classified as BL Lacertae objects, as flat spectrum radio quasars or as blazars of uncertain/transitional type. Each object is identified by a root name, coded as BZB, BZQ and BZU for these three subclasses respectively, and by its coordinates. This catalogue is being built as a tool useful for the identification of the extragalactic sources that will be detected by present and future experiments for X and gamma-ray astronomy, like Swift, AGILE, Fermi-GLAST and Simbol-X. An electronic version is available from the ASI Science Data Center web site at http://www.asdc.asi.it/bzcat.

Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

PubMed

Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

2017-04-15

Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

Quasimolecular emission near the Xe(5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance lines induced by collisions with He atoms

NASA Astrophysics Data System (ADS)

Alekseeva, O. S.; Devdariani, A. Z.; Grigorian, G. M.; Lednev, M. G.; Zagrebin, A. L.

2017-02-01

This study is devoted to the theoretical investigation of the quasimolecular emission of Xe*-He and Kr*-He collision pairs near the Xe (5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance atomic lines. The potential curves of the quasimolecules Xe(5p 56s) + He and Kr(4p 55s) + He have been obtained with the use of the effective Hamiltonian and pseudopotential methods. Based on these potential curves the processes of quasimolecular emission of Xe*+He and Kr*+He mixtures have been considered and the spectral distributions I(ħΔω) of photons emitted have been obtained in the framework of quasistatic approximation.

Unique dielectric features of a ceramic-semiconductor nanocomposite MgNb2O6 + 0.25Zn0.5Cd0.5S

NASA Astrophysics Data System (ADS)

Pukazhselvan, D.; Selvaraj, Nivas Babu; Bdikin, Igor; Saravanan, R. Sakthi Sudar; Jakka, Suresh Kumar; Soares, M. J.; Fagg, Duncan Paul

2017-12-01

The present communication deals with the optical/dielectric characteristics of MgNb2O6 + 0.25Zn0.5Cd0.5S nanocomposite (10-30 nm) mixture. Zn0.5Cd0.5S (size ∼10 nm) was synthesized by microwave assisted solvo-thermal method. Monophase magnesium niobate (MN) nanoparticles (10-20 nm) were synthesized in a single step by mechanochemical treatment of MgO + Nb2O5 under dry N2 atmosphere. The nanocomposite, MgNb2O6 + 0.25Zn0.5Cd0.5S, was prepared by mechanical admixing of MgNb2O6 and Zn0.5Cd0.5S taken in 4:1 molar ratio. The photoluminescence study shows violet, yellow and orange-red emissions by the MgNb2O6 + 0.25Zn0.5Cd0.5S composite. The observed dielectric constant value (ε) for MgNb2O6 + 0.25Zn0.5Cd0.5S is only 4.7, which is ∼5 times smaller than the ε value of MgNb2O6 while a dielectric loss for the composite being closer to zero ensures promising commercial applications.

Continuous-spin mixed-symmetry fields in AdS(5)

NASA Astrophysics Data System (ADS)

Metsaev, R. R.

2018-05-01

Free mixed-symmetry continuous-spin fields propagating in AdS(5) space and flat R(4,1) space are studied. In the framework of a light-cone gauge formulation of relativistic dynamics, we build simple actions for such fields. The realization of relativistic symmetries on the space of light-cone gauge mixed-symmetry continuous-spin fields is also found. Interrelations between constant parameters entering the light-cone gauge actions and eigenvalues of the Casimir operators of space-time symmetry algebras are obtained. Using these interrelations and requiring that the field dynamics in AdS(5) be irreducible and classically unitary, we derive restrictions on the constant parameters and eigenvalues of the second-order Casimir operator of the algebra.

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

PubMed Central

Garcia, S; Kovařík, A

2013-01-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

The Effect of Inversion on 3- to 5-Year-Olds' Recognition of Face and Nonface Visual Objects

ERIC Educational Resources Information Center

Picozzi, Marta; Cassia, Viola Macchi; Turati, Chiara; Vescovo, Elena

2009-01-01

This study compared the effect of stimulus inversion on 3- to 5-year-olds' recognition of faces and two nonface object categories matched with faces for a number of attributes: shoes (Experiment 1) and frontal images of cars (Experiments 2 and 3). The inversion effect was present for faces but not shoes at 3 years of age (Experiment 1). Analogous…

How Many Ultra-Low Delta-v Near Earth Objects Remain Undiscovered? Implications for missions.

NASA Astrophysics Data System (ADS)

Elvis, Martin; Ranjan, Sukrit; Galache, Jose Luis; Murphy, Max

2015-08-01

The past decade has witnessed considerable growth of interest in missions to Near-Earth Objects (NEOs). NEOs are considered prime targets for manned and robotic missions, for both scientific objectives as well as in-situ resource utilization including harvesting of water for propellant and life support and mining of high-value elements for sale on Earth. Appropriate targets are crucial to such missions. Hence, ultra-low delta-v mission targets are strongly favored. Some mission architectures rely on the discovery of more ultra-low delta-v NEOs. In fact the approved and executed NEO missions have all targeted asteroids with ultra-low LEO to asteroid rendezvous delta-v <5.5 km/s.In this paper, we estimate the total NEO population as a function of delta-v, and how many remain to be discovered in various size ranges down to ~100m. We couple the NEOSSat-1 model (Greenstreet et al., 2012) to the NEO size distribution derived from the NEOWISE survey (Mainzer et al., 2011b) to compute an absolute NEO population model. We compare the Minor Planet Center (MPC) catalog of known NEOs to this NEO population model. We compute the delta-v from LEO to asteroid rendezvous orbits using a modified Shoemaker-Helin (S-H) formalism that empirically removes biases found comparing S-H with the results from NHATS. The median delta-v of the known NEOs is 7.3 km/s, the median delta-v predicted by our NEO model is 9.8 km/s, suggesting that undiscovered objects are biased to higher delta-v. The survey of delta-v <10.3 km/s NEOs is essentially complete for objects with diameter D >300 m. However, there are tens of thousands of objects with delta-v <10.3 km/s to be discovered in the D = 50 - 300 m size class (H = 20.4 - 24.3). Our work suggests that there are 100 yet-undiscovered NEOs with delta-v < 5:8 km/s, and 1000 undiscovered NEOs with v < 6.3 km/s. We conclude that, even with complete NEO surveys, the selection of good (i.e. ultra-low delta-v) mission targets is limited given current

5. Photographic copy of photograph. (Source: U.S. Department of Interior. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. Photographic copy of photograph. (Source: U.S. Department of Interior. Office of Indian Affairs. Indian Irrigation Service. Annual Report, Fiscal Year 1925. Vol. I, Narrative and Photographs, Irrigation District #4, California and Southern Arizona, RG 75, Entry 655, Box 28, National Archives, Washington, DC.) Photographer unknown. MAIN (TITLED FLORENCE) CANAL, CHINA WASH FLUME, 5/13/25 - San Carlos Irrigation Project, China Wash Flume, Main (Florence-Case Grande) Canal at Station 137+00, T4S, R10E, S14, Coolidge, Pinal County, AZ

5. Rockwork on the north bank of S. Platte River ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. Rockwork on the north bank of S. Platte River located approximately 5 of a mile downstream from Deansbury Bridge. View looking northwest from a distance of 50 feet. - Denver & Rio Grande Rockwork, East of South Platte, Waterton, Jefferson County, CO

Space Object Query Tool

NASA Technical Reports Server (NTRS)

Phillips, Veronica J.

2017-01-01

STI is for a fact sheet on the Space Object Query Tool being created by the MDC. When planning launches, NASA must first factor in the tens of thousands of objects already in orbit around the Earth. The number of human-made objects, including nonfunctional spacecraft, abandoned launch vehicle stages, mission-related debris and fragmentation debris orbiting Earth has grown steadily since Sputnik 1 was launched in 1957. Currently, the U.S. Department of Defenses Joint Space Operations Center, or JSpOC, tracks over 15,000 distinct objects and provides data for more than 40,000 objects via its Space-Track program, found at space-track.org.

Mechanisms Regulating the Secretion of the Promalignancy Chemokine CCL5 by Breast Tumor Cells: CCL5's 40s Loop and Intracellular Glycosaminoglycans12

PubMed Central

Soria, Gali; Lebel-Haziv, Yaeli; Ehrlich, Marcelo; Meshel, Tsipi; Suez, Adva; Avezov, Edward; Rozenberg, Perri; Ben-Baruch, Adit

2012-01-01

The chemokine CCL5 (RANTES) plays active promalignancy roles in breast malignancy. The secretion of CCL5 by breast tumor cells is an important step in its tumor-promoting activities; therefore, inhibition of CCL5 secretion may have antitumorigenic effects. We demonstrate that, in breast tumor cells, CCL5 secretion necessitated the trafficking of CCL5-containing vesicles on microtubules from the endoplasmic reticulum (ER) to the post-Golgi stage, and CCL5 release was regulated by the rigidity of the actin cytoskeleton. Focusing on the 40s loop of CCL5, we found that the 43TRKN46 sequence of CCL5 was indispensable for its inclusion in motile vesicles, and for its secretion. The TRKN-mutated chemokine reached the Golgi, but trafficked along the ER-to-post-Golgi route differently than the wild-type (WT) chemokine. Based on the studies showing that the 40s loop of CCL5 mediates its binding to glycosaminoglycans (GAG), we analyzed the roles of GAG in regulating CCL5 secretion. TRKN-mutated CCL5 had lower propensity for colocalization with GAG in the Golgi compared to the WT chemokine. Secretion of WT CCL5 was significantly reduced in CHO mutant cells deficient in GAG synthesis, and the WT chemokine acquired an ER-like distribution in these cells, similar to that of TRKN-mutated CCL5 in GAG-expressing cells. The release of WT CCL5 was also reduced after inhibition of GAG presence/synthesis by intracellular expression of heparanase, inhibition of GAG sulfation, and sulfate deprivation. The need for a 43TRKN46 motif and for a GAG-mediated process in CCL5 secretion may enable the future design of modalities that prevent CCL5 release by breast tumor cells. PMID:22355269

Implementation of 5S management method for lean healthcare at a health center in Senegal: a qualitative study of staff perception

PubMed Central

Kanamori, Shogo; Sow, Seydou; Castro, Marcia C.; Matsuno, Rui; Tsuru, Akiko; Jimba, Masamine

2015-01-01

Background 5S is a lean method for workplace organization; it is an abbreviation representing five Japanese words that can be translated as sort, set in order, shine, standardize, and sustain. The 5S management method has been recognized recently as a potential solution for improving the quality of government healthcare services in low- and middle-income countries. Objective To assess how the 5S management method creates changes in the workplace and in the process and outcomes of healthcare services, and how it can be applicable in a resource-poor setting, based on data from a pilot intervention of the 5S program implemented in a health facility in Senegal. Design In this qualitative study, we interviewed 21 health center staff members 1 year after the pilot intervention. We asked them about their views on the changes brought on by the 5S program in their workplace, daily routines, and services provided. We then transcribed interview records and organized the narrative information by emerging themes using thematic analysis in the coding process. Results Study participants indicated that, despite resource constraints and other demotivating factors present at the health center, the 5S program created changes in the work environment, including fewer unwanted items, improved orderliness, and improved labeling and directional indicators of service units. These efforts engendered changes in the quality of services (e.g. making services more efficient, patient-centered, and safe), and in the attitude and behavior of staff and patients. Conclusions The pilot intervention of the 5S management method was perceived to have improved the quality of healthcare services and staff motivation in a resource-poor healthcare facility with a disorderly work environment in Senegal. Quantitative and qualitative research based on a larger-scale intervention would be needed to elaborate and validate these findings and to identify the cost-effectiveness of such intervention in low- and

In vitro reduction of endotoxin concentrations with the 5S fragment of immunoglobulin G.

PubMed Central

Xuan, D; Nicolau, D P; Tessier, P R; Bow, L; Quintiliani, R; Nightingale, C H

1997-01-01

Endotoxin has long been implicated as an inducer for the development and progression of gram-negative sepsis. Accordingly, antiendotoxin therapy has been considered one of the major targets for the treatment of sepsis. To investigate the influence of a human immunoglobulin G (IgG) derivative, the 5S fragment of IgG (5S-IgG; Gamma-Venin, Centeon Pharma GmbH, Frankfurt-Niederrad, Germany), on endotoxin release during bacterial proliferation and under antibiotic bactericidal action, time-kill studies were performed by using Escherichia coli ATCC 25922 starting inocula of 10(3), 10(5), and 10(7) CFU/ml with cefotaxime (120 microg/ml) alone and in combination with 5S-IgG (2,100 microg/ml). Samples were collected for bacterial colony count and endotoxin concentration determinations; the area under the free endotoxin concentration curve (AUFEC) was calculated by using the trapezoidal rule. Colony counts showed that cefotaxime had a rapid bactericidal effect because it achieved greater than a 4-log decrease in the numbers of E. coli CFU per milliliter over the first 2 h; the addition of 5S-IgG did not appear to alter the kinetics of killing. Comparison of the AUFEC revealed that the addition of 5S-IgG resulted in a mean reduction of 50, 66, and 27% in the free endotoxin concentration at starting inocula of 10(3), 10(5), and 10(7) CFU/ml, respectively. Moreover, experiments were conducted with a starting inoculum of 10(5) CFU/ml and various amounts of 5S-IgG (2 to 20 mg/ml) to further investigate the dose-effect relation of 5S-IgG on endotoxin release. Decreased AUFECs were observed with increasing concentrations of 5S-IgG, suggesting the dose-dependent antiendotoxin activity of 5S-IgG. Further study is required to investigate the mechanism(s) responsible for this observation, the biological significance of this antiendotoxin activity, and the potential utility of 5S-IgG as an adjuvant therapy in the treatment of gram-negative sepsis. PMID:9210676

A different method for calculation of the deflection angle of light passing close to a massive object by Fermat’s principle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akkus, Harun, E-mail: physicisthakkus@gmail.com

2013-12-15

We introduce a method for calculating the amount of deflection angle of light passing close to a massive object. It is based on Fermat’s principle. The varying refractive index of medium around the massive object is obtained from the Buckingham pi-theorem. Highlights: •A different and simpler method for the calculation of deflection angle of light. •Not a curved space, only 2-D Euclidean space. •Getting a varying refractive index from the Buckingham pi-theorem. •Obtaining the some results of general relativity from Fermat’s principle.